WorldWideScience

Sample records for carbohydrate response element

  1. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Directory of Open Access Journals (Sweden)

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  2. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    Czech Academy of Sciences Publication Activity Database

    Sillam-Dusses, D.; Hanus, Robert; Poulsen, M.; Roy, V.; Favier, M.; Vasseur-Cognet, M.

    2016-01-01

    Roč. 6, č. 5 (2016), č. článku 160080. ISSN 2046-2441 R&D Projects: GA ČR(CZ) GA14-12774S Institutional support: RVO:61388963 Keywords : reproduction * phenotypic plasticity * carbohydrate-responsive element-binding protein * transcription factor * social insects * lipogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.481, year: 2016 http://rsob.royalsocietypublishing.org/content/6/5/160080

  3. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Science.gov (United States)

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR.

    Science.gov (United States)

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku

    2016-05-13

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Thyroid Hormone Receptor β (TRβ) and Liver X Receptor (LXR) Regulate Carbohydrate-response Element-binding Protein (ChREBP) Expression in a Tissue-selective Manner*

    Science.gov (United States)

    Gauthier, Karine; Billon, Cyrielle; Bissler, Marie; Beylot, Michel; Lobaccaro, Jean-Marc; Vanacker, Jean-Marc; Samarut, Jacques

    2010-01-01

    Thyroid hormone (TR) and liver X (LXR) receptors are transcription factors involved in lipogenesis. Both receptors recognize the same consensus DNA-response element in vitro. It was previously shown that their signaling pathways interact in the control of cholesterol elimination in the liver. In the present study, carbohydrate-response element-binding protein (ChREBP), a major transcription factor controlling the activation of glucose-induced lipogenesis in liver, is characterized as a direct target of thyroid hormones (TH) in liver and white adipose tissue (WAT), the two main lipogenic tissues in mice. Using genetic and molecular approaches, ChREBP is shown to be specifically regulated by TRβ but not by TRα in vivo, even in WAT where both TR isoforms are expressed. However, this isotype specificity is not found in vitro. This TRβ specific regulation correlates with the loss of TH-induced lipogenesis in TRβ−/− mice. Fasting/refeeding experiments show that TRβ is not required for the activation of ChREBP expression particularly marked in WAT following refeeding. However, TH can stimulate ChREBP expression in WAT even under fasting conditions, suggesting completely independent pathways. Because ChREBP has been described as an LXR target, the interaction of LXR and TRβ in ChREBP regulation was assayed both in vitro and in vivo. Each receptor recognizes a different response element on the ChREBP promoter, located only 8 bp apart. There is a cross-talk between LXR and TRβ signaling on the ChREBP promoter in liver but not in WAT where LXR does not regulate ChREBP expression. The molecular basis for this cross-talk has been determined in in vitro systems. PMID:20615868

  6. Amino Acid Change in the Carbohydrate Response Element Binding Protein is associated with lower triglycerides and myocardial infarction incidence depending on level of adherence to the Mediterranean diet in the PREDIMED trial

    Science.gov (United States)

    A variant (rs3812316, C771G, and Gln241His) in the MLXIPL (Max-like protein X interacting protein-like) gene encoding the carbohydrate response element binding protein has been associated with lower triglycerides. However, its association with cardiovascular diseases and gene-diet interactions modul...

  7. Deletion of hepatic carbohydrate response element binding protein (ChREBP impairs glucose homeostasis and hepatic insulin sensitivity in mice

    Directory of Open Access Journals (Sweden)

    Tara Jois

    2017-11-01

    Conclusions: Overall, hepatic ChREBP is protective in regards to hepatic insulin sensitivity and whole body glucose homeostasis. Hepatic ChREBP action can influence other peripheral tissues and is likely essential in coordinating the body's response to different feeding states.

  8. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity

    DEFF Research Database (Denmark)

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C

    2015-01-01

    in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin...... of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc...... transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose...

  9. Activation of the transcription factor carbohydrate-responsive element-binding protein by glucose leads to increased pancreatic beta cell differentiation in rats.

    Science.gov (United States)

    Soggia, A; Flosseau, K; Ravassard, P; Szinnai, G; Scharfmann, R; Guillemain, G

    2012-10-01

    Pancreatic cell development is a tightly controlled process. Although information is available regarding the mesodermal signals that control pancreatic development, little is known about the role of environmental factors such as nutrients, including glucose, on pancreatic development. We previously showed that glucose and its metabolism through the hexosamine biosynthesis pathway (HBP) promote pancreatic endocrine cell differentiation. Here, we analysed the role of the transcription factor carbohydrate-responsive element-binding protein (ChREBP) in this process. This transcription factor is activated by glucose, and has been recently described as a target of the HBP. We used an in vitro bioassay in which pancreatic endocrine and exocrine cells develop from rat embryonic pancreas in a way that mimics in vivo pancreatic development. Using this model, gain-of-function and loss-of-function experiments were undertaken. ChREBP was produced in the endocrine lineage during pancreatic development, its abundance increasing with differentiation. When rat embryonic pancreases were cultured in the presence of glucose or xylitol, the production of ChREBP targets was induced. Concomitantly, beta cell differentiation was enhanced. On the other hand, when embryonic pancreases were cultured with inhibitors decreasing ChREBP activity or an adenovirus producing a dominant-negative ChREBP, beta cell differentiation was reduced, indicating that ChREBP activity was necessary for proper beta cell differentiation. Interestingly, adenovirus producing a dominant-negative ChREBP also reduced the positive effect of N-acetylglucosamine, a substrate of the HBP acting on beta cell differentiation. Our work supports the idea that glucose, through the transcription factor ChREBP, controls beta cell differentiation from pancreatic progenitors.

  10. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    DEFF Research Database (Denmark)

    Sillam-Dussès, David; Hanus, Robert; Thomas-Poulsen, Michael

    2016-01-01

    in eight different termite species. ChREBP is expressed in several tissues, including ovaries and fat bodies, and increases in expression in totipotent workers during their differentiation into neotenic mature queens. We further show that ChREBP is regulated by a carbohydrate diet in termite queens...

  11. Varying response of the concentration and content of soybean seed mineral elements, carbohydrates, organic acids, amino acids, protein, and oil to phosphorus starvation and CO2 enrichment

    Science.gov (United States)

    A detailed investigation of the concentration (g-1 seed weight) and content (g plant-1) of seed mineral elements and metabolic profile under phosphorus (P) starvation at ambient (aCO2) and elevated carbon dioxide (eCO2) in soybean is limited. Soybean plants were grown in a controlled environment at ...

  12. Carbohydrates

    Science.gov (United States)

    Carbohydrates are one of the main types of nutrients. They are the most important source of energy for your body. Your digestive system changes carbohydrates into glucose (blood sugar). Your body uses this ...

  13. Long-term salt stress responsive growth, carbohydrate metabolism ...

    African Journals Online (AJOL)

    We investigated the long-term responses of tobacco tissues to salt stress, with a particular interest for growth parameters, proline (Pro) accumulation, and carbohydrate metabolism. Exposure of 17-day-old tobacco plants to 0.2 M NaCl was followed by a higher decrease in dry matter in roots than shoots with a decrease of ...

  14. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    Energy Technology Data Exchange (ETDEWEB)

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas, E-mail: tke@uams.edu [Winthrop P. Rockefeller Cancer Institute and Department of Pathology, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States)

    2011-11-11

    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses.

  15. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    International Nuclear Information System (INIS)

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas

    2011-01-01

    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses

  16. Influence on bone metabolism of dietary trace elements, protein, fat, carbohydrates, and vitamins.

    Science.gov (United States)

    Sarazin, M; Alexandre, C; Thomas, T

    2000-01-01

    Osteoporosis is a multifactorial disease driven primarily by the genetic factors that control bone metabolism. Among environmental factors, diet may play a key role, affording a target for low-cost intervention. Calcium and vitamin D are well known to affect bone metabolism. Other nutrients may influence bone mass changes; for instance, a number of trace elements and vitamins other than vitamin D are essential to many of the steps of bone metabolism. A wide variety of foods provide these nutrients, and in industrialized countries deficiencies are more often due to idiosyncratic eating habits than to cultural influences. Both culture and vogue influence the amount of carbohydrate, fat, and protein in the typical diet. In children, the current trend is to reduce protein and to increase carbohydrate and fat. Data from epidemiological and animal studies suggest that this may adversely affect bone mass and the fracture risk.

  17. Comparing the responses of rumen ciliate protozoa and bacteria to excess carbohydrate.

    Science.gov (United States)

    Teixeira, César R V; Lana, Rogério de Paula; Tao, Junyi; Hackmann, Timothy J

    2017-06-01

    When given excess carbohydrate, certain microbial species respond by storing energy (synthesizing reserve carbohydrate), but other species respond by dissipating the energy as heat (spilling energy). To determine the importance of these responses in the rumen microbial community, this study quantified the responses of mixed ciliate protozoa vs bacteria to glucose. We hypothesized that ciliates would direct more glucose to synthesis of reserve carbohydrate (and less to energy spilling) than would bacteria. Ciliates and bacteria were isolated from rumen fluid using filtration and centrifugation, resuspended in nitrogen-free buffer to limit growth, and dosed with 5 mM glucose. Compared with bacteria, ciliates consumed glucose >3-fold faster and synthesized reserve carbohydrate 4-fold faster. They incorporated 53% of glucose carbon into reserve carbohydrate-nearly double the value (27%) for bacteria. Energy spilling was not detected for ciliates, as all heat production (104%) was accounted by synthesis of reserve carbohydrate and endogenous metabolism. For bacteria, reserve carbohydrate and endogenous metabolism accounted for only 68% of heat production, and spilling was detected within 11 min of dosing glucose. These results suggest that ciliates alter the course of ruminal carbohydrate metabolism by outcompeting bacteria for excess carbohydrate, maximizing reserve carbohydrate synthesis, and minimizing energy spilling. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Entirely Carbohydrate-Based Vaccines: An Emerging Field for Specific and Selective Immune Responses

    Directory of Open Access Journals (Sweden)

    Sharmeen Nishat

    2016-05-01

    Full Text Available Carbohydrates are regarded as promising targets for vaccine development against infectious disease because cell surface glycans on many infectious agents are attributed to playing an important role in pathogenesis. In addition, oncogenic transformation of normal cells, in many cases, is associated with aberrant glycosylation of the cell surface glycan generating tumor associated carbohydrate antigens (TACAs. Technological advances in glycobiology have added a new dimension to immunotherapy when considering carbohydrates as key targets in developing safe and effective vaccines to combat cancer, bacterial infections, viral infections, etc. Many consider effective vaccines induce T-cell dependent immunity with satisfactory levels of immunological memory that preclude recurrence. Unfortunately, carbohydrates alone are poorly immunogenic as they do not bind strongly to the MHCII complex and thus fail to elicit T-cell immunity. To increase immunogenicity, carbohydrates have been conjugated to carrier proteins, which sometimes can impede carbohydrate specific immunity as peptide-based immune responses can negate antibodies directed at the targeted carbohydrate antigens. To overcome many challenges in using carbohydrate-based vaccine design and development approaches targeting cancer and other diseases, zwitterionic polysaccharides (ZPSs, isolated from the capsule of commensal anaerobic bacteria, will be discussed as promising carriers of carbohydrate antigens to achieve desired immunological responses.

  19. Dietary ratio of protein to carbohydrate induces plastic responses in the gastrointestinal tract of mice

    DEFF Research Database (Denmark)

    Sørensen, Allan; Mayntz, David; Simpson, Stephen James

    2010-01-01

    of the protein-rich food. In contrast, intestines, caeca and colons were heavier when diets contained more carbohydrates and less protein. This response may function to increase the digestive rate of carbohydrates when the dietary content of this macronutrient increases, but it may also indicate a compensatory...

  20. Maximizing Immune Response to Carbohydrate Antigens on Breast Tumors

    Science.gov (United States)

    2005-08-01

    immunological mimicry of peptide ten- to apopiosis. J. CeILl Phvisiol 200: 223--234- niotopes of Lewis carbohydrate antigens. Mol. lmrrtunol. 35. 865- 879. 32...Serial, 5 pm sections were mounted on glass (4-6 weeks old, female) were obtained fiom Taconic Farms slides. Every fifth section was stained with H&E and

  1. Glucose-6-phosphate mediates activation of the carbohydrate responsive binding protein (ChREBP)

    International Nuclear Information System (INIS)

    Li, Ming V.; Chen, Weiqin; Harmancey, Romain N.; Nuotio-Antar, Alli M.; Imamura, Minako; Saha, Pradip; Taegtmeyer, Heinrich; Chan, Lawrence

    2010-01-01

    Carbohydrate response element binding protein (ChREBP) is a Mondo family transcription factor that activates a number of glycolytic and lipogenic genes in response to glucose stimulation. We have previously reported that high glucose can activate the transcriptional activity of ChREBP independent of the protein phosphatase 2A (PP2A)-mediated increase in nuclear entry and DNA binding. Here, we found that formation of glucose-6-phosphate (G-6-P) is essential for glucose activation of ChREBP. The glucose response of GAL4-ChREBP is attenuated by D-mannoheptulose, a potent hexokinase inhibitor, as well as over-expression of glucose-6-phosphatase (G6Pase); kinetics of activation of GAL4-ChREBP can be modified by exogenously expressed GCK. Further metabolism of G-6-P through the two major glucose metabolic pathways, glycolysis and pentose-phosphate pathway, is not required for activation of ChREBP; over-expression of glucose-6-phosphate dehydrogenase (G6PD) diminishes, whereas RNAi knockdown of the enzyme enhances, the glucose response of GAL4-ChREBP, respectively. Moreover, the glucose analogue 2-deoxyglucose (2-DG), which is phosphorylated by hexokinase, but not further metabolized, effectively upregulates the transcription activity of ChREBP. In addition, over-expression of phosphofructokinase (PFK) 1 and 2, synergistically diminishes the glucose response of GAL4-ChREBP. These multiple lines of evidence support the conclusion that G-6-P mediates the activation of ChREBP.

  2. Equine colostral carbohydrates reduce lipopolysaccharide-induced inflammatory responses in equine peripheral blood mononuclear cells.

    Science.gov (United States)

    Vendrig, J C; Coffeng, L E; Fink-Gremmels, J

    2012-12-01

    Increasing evidence suggests that reactions to lipopolysaccharide (LPS), particularly in the gut, can be partly or completely mitigated by colostrum- and milk-derived oligosaccharides. Confirmation of this hypothesis could lead to the development of new therapeutic concepts. To demonstrate the influence of equine colostral carbohydrates on the inflammatory response in an in vitro model with equine peripheral blood mononuclear cells (PBMCs). Carbohydrates were extracted from mare colostrum, and then evaluated for their influence on LPS-induced inflammatory responses in PBMCs isolated from the same mares, mRNA expression of tumour necrosis factor-alpha, interleukin-6 and interleukin-10 was measured as well as the protein levels of tumour necrosis factor-alpha (TNF-alpha) and interleukin-10 (IL-10). Equine colostral carbohydrates significantly reduced LPS-induced TNF-alpha protein at both times measured and significantly reduced LPS-induced TNF-alpha, IL-6 and IL-10 mRNA expression by PBMCs. Moreover, cell viability significantly increased in the presence of high concentrations of colostral carbohydrates. Carbohydrates derived from equine colostrum reduce LPS-induced inflammatory responses of equine PBMCs. Colostrum and milk-derived carbohydrates are promising candidates for new concepts in preventive and regenerative medicine.

  3. Behavioural responses of the snail Lymnaea acuminata to carbohydrates in snail-attractant pellets

    Science.gov (United States)

    Tiwari, Farindra; Singh, D. K.

    Snail control is one of the most important tools in the campaign to reduce the incidence of fascioliasis. In order to attain this objective, the method of bait formulation in order to contain an attractant and a molluscicide is an expedient approach to lure the target snail population to the molluscicide. This study identifies certain carbohydrates, namely sucrose, maltose, glucose, fructose and starch, for preparing such baits. These were tested on Lymnaea acuminata, an intermediate host of the digenean trematodes Fasciola hepatica and Fasciola gigantica. The behavioural responses of snails to these carbohydrates were examined. Significant variations in behavioural responses were observed in the snail even when the five carbohydrates were used in low concentrations in snail-attractant pellets. Starch emerged as the strongest attractant for Lymnaea acuminata, followed by maltose.

  4. Does prior acute exercise affect postexercise substrate oxidation in response to a high carbohydrate meal?

    Directory of Open Access Journals (Sweden)

    Hickey Matthew S

    2008-01-01

    Full Text Available Abstract Background Consumption of a mixed meal increases postprandial carbohydrate utilization and decreases fat oxidation. On the other hand, acute endurance exercise increases fat oxidation and decreases carbohydrate utilization during the post-exercise recovery period. It is possible that the resulting post-exercise increase in circulating nonesterified fatty acids could attenuate the ability of ingested carbohydrate to inhibit lipid oxidation. The purpose of this study was to determine whether prior exercise attenuates the usual meal-induced decline in lipid oxidation. Methods Six healthy, physically active young subjects (x age = 26.3 years, 4 males, 2 females completed three treatments in random order after a ~10 h fast: (a Exercise/Carbohydrate (Ex/CHO – subjects completed a bout of exercise at 70% VO2peak (targeted net energy cost of 400 kcals, followed by consumption of a carbohydrate-rich meal; (b Exercise/Placebo (Ex/Placebo – subjects completed an identical bout of exercise followed by consumption of a placebo; and (c No Exercise/Carbohydrate (NoEx/CHO – subjects sat quietly rather than exercising and then consumed the carbohydrate-rich meal. Blood samples were obtained before and during the postprandial period to determine plasma glucose, insulin, and non-esterified fatty acids (NEFA. Respiratory gas exchange measures were used to estimate rates of fat and carbohydrate oxidation. Results Plasma NEFA were approximately two-fold higher immediately following the two exercise conditions compared to the no-exercise condition, while meal consumption significantly increased insulin and glucose in both Ex/CHO and NoEx/CHO. NEFA concentrations fell rapidly during the 2-h postprandial period, but remained higher compared to the NoEx/CHO treatment. Carbohydrate oxidation increased rapidly and fat oxidation decreased in response to the meal, with no differences in the rates of carbohydrate and fat oxidation during recovery between the Ex

  5. Liquid scintillation vial for radiometric assay of lymphocyte carbohydrate metabolism in response to mitogens

    International Nuclear Information System (INIS)

    Tran, N.; Wagner, H.N. Jr.

    1978-01-01

    We have demonstrated that mitogens--i.e., PHA and Con.A--stimulate lymphocyte carbohydrate metabolism using a liquid-scintillation vial with conventional liquid-scintillation detectors. The results showed that this enclosed system can be useful for development of rapid in vitro tests of lymphocytes immune responsiveness, as well as for radiometric detection of bacterial growth in various gaseous atmospheres

  6. Carbohydrate fatty acid monosulphate esters are safe and effective adjuvants for humoral responses

    NARCIS (Netherlands)

    Hilgers, L.A.T.; Platenburg, P.; Bajramovic, J.; Veth, J.; Sauerwein, R.; Roeffen, W.; Pohl, M.; Amerongen, G. van; Stittelaar, K.J.; Bosch, J.F. van den

    2017-01-01

    Carbohydrate fatty acid sulphate esters (CFASEs) formulated in a squalane-in-water emulsion are effective adjuvants for humoral responses to a wide range of antigens in various animal species but rise in body temperature and local reactions albeit mild or minimal hampers application in humans. In

  7. Postprandial lipid responses to standard carbohydrates used to determine glycaemic index values.

    Science.gov (United States)

    Vega-López, Sonia; Ausman, Lynne M; Matthan, Nirupa R; Lichtenstein, Alice H

    2013-11-01

    Prior studies assessing the metabolic effects of different types of carbohydrates have focused on their glycaemic response. However, the response of postprandial cardiometabolic risk indicators has not been considered in these studies. The present study assessed postprandial lipid responses to two forms of carbohydrates used as reference foods for glycaemic index determinations, white bread (50 g available carbohydrate) and glucose (50 g), under controlled conditions and with intra-individual replicate determinations. A total of twenty adults (20–70 years) underwent two cycles of challenges with each pair of reference foods (four challenges/person), administered in a random order on separate days under standard conditions. Serum lipids (total cholesterol, LDL-cholesterol, HDL-cholesterol, TAG and NEFA), glucose and insulin were monitored for 5 h post-ingestion. Oral glucose resulted in greater glycaemic and insulinaemic responses than white bread for the first 90 min and a greater subsequent decline after 120 min (P =0·0001). The initial decline in serum NEFA concentrations was greater after the oral glucose than after the white bread challenge, as was the rebound after 150 min (P = 0·001). Nevertheless, the type of carbohydrate had no significant effect on postprandial total cholesterol, LDL-cholesterol and HDL-cholesterol concentrations. Following an initial modest rise in TAG concentrations in response to both challenges, the values dropped below the fasting values for oral glucose but not for the white bread challenge. These data suggest that the type of carbohydrate used to determine the glycaemic index, bread or glucose, has little or modest effects on postprandial plasma cholesterol concentrations. Differences in TAG and NEFA concentrations over the 5 h time period were modest, and their clinical relevance is unclear.

  8. Carbohydrate restriction improves the features of Metabolic Syndrome. Metabolic Syndrome may be defined by the response to carbohydrate restriction.

    Science.gov (United States)

    Volek, Jeff S; Feinman, Richard D

    2005-11-16

    Metabolic Syndrome (MetS) represents a constellation of markers that indicates a predisposition to diabetes, cardiovascular disease and other pathologic states. The definition and treatment are a matter of current debate and there is not general agreement on a precise definition or, to some extent, whether the designation provides more information than the individual components. We consider here five indicators that are central to most definitions and we provide evidence from the literature that these are precisely the symptoms that respond to reduction in dietary carbohydrate (CHO). Carbohydrate restriction is one of several strategies for reducing body mass but even in the absence of weight loss or in comparison with low fat alternatives, CHO restriction is effective at ameliorating high fasting glucose and insulin, high plasma triglycerides (TAG), low HDL and high blood pressure. In addition, low fat, high CHO diets have long been known to raise TAG, lower HDL and, in the absence of weight loss, may worsen glycemic control. Thus, whereas there are numerous strategies for weight loss, a patient with high BMI and high TAG is likely to benefit most from a regimen that reduces CHO intake. Reviewing the literature, benefits of CHO restriction are seen in normal or overweight individuals, in normal patients who meet the criteria for MetS or in patients with frank diabetes. Moreover, in low fat studies that ameliorate LDL and total cholesterol, controls may do better on the symptoms of MetS. On this basis, we feel that MetS is a meaningful, useful phenomenon and may, in fact, be operationally defined as the set of markers that responds to CHO restriction. Insofar as this is an accurate characterization it is likely the result of the effect of dietary CHO on insulin metabolism. Glucose is the major insulin secretagogue and insulin resistance has been tied to the hyperinsulinemic state or the effect of such a state on lipid metabolism. The conclusion is probably not

  9. Carbohydrate restriction improves the features of Metabolic Syndrome. Metabolic Syndrome may be defined by the response to carbohydrate restriction

    Directory of Open Access Journals (Sweden)

    Feinman Richard D

    2005-11-01

    Full Text Available Abstract Metabolic Syndrome (MetS represents a constellation of markers that indicates a predisposition to diabetes, cardiovascular disease and other pathologic states. The definition and treatment are a matter of current debate and there is not general agreement on a precise definition or, to some extent, whether the designation provides more information than the individual components. We consider here five indicators that are central to most definitions and we provide evidence from the literature that these are precisely the symptoms that respond to reduction in dietary carbohydrate (CHO. Carbohydrate restriction is one of several strategies for reducing body mass but even in the absence of weight loss or in comparison with low fat alternatives, CHO restriction is effective at ameliorating high fasting glucose and insulin, high plasma triglycerides (TAG, low HDL and high blood pressure. In addition, low fat, high CHO diets have long been known to raise TAG, lower HDL and, in the absence of weight loss, may worsen glycemic control. Thus, whereas there are numerous strategies for weight loss, a patient with high BMI and high TAG is likely to benefit most from a regimen that reduces CHO intake. Reviewing the literature, benefits of CHO restriction are seen in normal or overweight individuals, in normal patients who meet the criteria for MetS or in patients with frank diabetes. Moreover, in low fat studies that ameliorate LDL and total cholesterol, controls may do better on the symptoms of MetS. On this basis, we feel that MetS is a meaningful, useful phenomenon and may, in fact, be operationally defined as the set of markers that responds to CHO restriction. Insofar as this is an accurate characterization it is likely the result of the effect of dietary CHO on insulin metabolism. Glucose is the major insulin secretagogue and insulin resistance has been tied to the hyperinsulinemic state or the effect of such a state on lipid metabolism. The

  10. Response of C57Bl/6 mice to a carbohydrate-free diet

    Directory of Open Access Journals (Sweden)

    Borghjid Saihan

    2012-07-01

    Full Text Available Abstract High fat feeding in rodents generally leads to obesity and insulin resistance whereas in humans this is only seen if dietary carbohydrate is also high, the result of the anabolic effect of poor regulation of glucose and insulin. A previous study of C57Bl/6 mice (Kennedy AR, et al.: Am J Physiol Endocrinol Metab (2007 262 E1724-1739 appeared to show the kind of beneficial effects of calorie restriction that is seen in humans but that diet was unusually low in protein (5%. In the current study, we tested a zero-carbohydrate diet that had a higher protein content (20%. Mice on the zero-carbohydrate diet, despite similar caloric intake, consistently gained more weight than animals consuming standard chow, attaining a dramatic difference by week 16 (46.1 ± 1.38 g vs. 30.4 ± 1.00 g for the chow group. Consistent with the obese phenotype, experimental mice had fatty livers and hearts as well as large fat deposits in the abdomino-pelvic cavity, and showed impaired glucose clearance after intraperitoneal injection. In sum, the response of mice to a carbohydrate-free diet was greater weight gain and metabolic disruptions in distinction to the response in humans where low carbohydrate diets cause greater weight loss than isocaloric controls. The results suggest that rodent models of obesity may be most valuable in the understanding of how metabolic mechanisms can work in ways different from the effect in humans.

  11. Antibiotics from bacillus subtilis AECL90 - effect of trace elements and carbohydrates on antibiotic production

    International Nuclear Information System (INIS)

    Malik, M.A.; Shaukat, G.A.; Ahmed, M.S.

    1990-01-01

    Three types of antibiotics S, X and F characteristically bioactive against staphylococcic, xanthomonas and fungi are elaborated by Bacillus Subtilis AECL 69 when grown in molasses peptone malt extract sucrose. No antibiotic production was observed when molasses was omitted from the growth medium. A mineral salt mixture was devised that could replace molasses and restore the production of antibiotics. Influence of various carbohydrates on the production of antibiotics was also studied. Mannose and mannitol had inhibitory effect on the antibiotic production. (author)

  12. Genomic Microdiversity of Bifidobacterium pseudocatenulatum Underlying Differential Strain-Level Responses to Dietary Carbohydrate Intervention

    Directory of Open Access Journals (Sweden)

    Guojun Wu

    2017-02-01

    Full Text Available The genomic basis of the response to dietary intervention of human gut beneficial bacteria remains elusive, which hinders precise manipulation of the microbiota for human health. After receiving a dietary intervention enriched with nondigestible carbohydrates for 105 days, a genetically obese child with Prader-Willi syndrome lost 18.4% of his body weight and showed significant improvement in his bioclinical parameters. We obtained five isolates (C1, C15, C55, C62, and C95 of one of the most abundantly promoted beneficial species, Bifidobacterium pseudocatenulatum, from a postintervention fecal sample. Intriguingly, these five B. pseudocatenulatum strains showed differential responses during the dietary intervention. Two strains were largely unaffected, while the other three were promoted to different extents by the changes in dietary carbohydrate resources. The differential responses of these strains were consistent with their functional clustering based on the COGs (Clusters of Orthologous Groups, including those involved with the ABC-type sugar transport systems, suggesting that the strain-specific genomic variations may have contributed to the niche adaption. Particularly, B. pseudocatenulatum C15, which had the most diverse types and highest gene copy numbers of carbohydrate-active enzymes targeting plant polysaccharides, had the highest abundance after the dietary intervention. These studies show the importance of understanding genomic diversity of specific members of the gut microbiota if precise nutrition approaches are to be realized.

  13. Postprandial Responses to Lipid and Carbohydrate Ingestion in Repeated Subcutaneous Adipose Tissue Biopsies in Healthy Adults

    Directory of Open Access Journals (Sweden)

    Aimee L. Dordevic

    2015-07-01

    Full Text Available Adipose tissue is a primary site of meta-inflammation. Diet composition influences adipose tissue metabolism and a single meal can drive an inflammatory response in postprandial period. This study aimed to examine the effect lipid and carbohydrate ingestion compared with a non-caloric placebo on adipose tissue response. Thirty-three healthy adults (age 24.5 ± 3.3 year (mean ± standard deviation (SD; body mass index (BMI 24.1 ± 3.2 kg/m2, were randomised into one of three parallel beverage groups; placebo (water, carbohydrate (maltodextrin or lipid (dairy-cream. Subcutaneous, abdominal adipose tissue biopsies and serum samples were collected prior to (0 h, as well as 2 h and 4 h after consumption of the beverage. Adipose tissue gene expression levels of monocyte chemoattractant protein-1 (MCP-1, interleukin 6 (IL-6 and tumor necrosis factor-α (TNF-α increased in all three groups, without an increase in circulating TNF-α. Serum leptin (0.6-fold, p = 0.03 and adipose tissue leptin gene expression levels (0.6-fold, p = 0.001 decreased in the hours following the placebo beverage, but not the nutrient beverages. Despite increased inflammatory cytokine gene expression in adipose tissue with all beverages, suggesting a confounding effect of the repeated biopsy method, differences in metabolic responses of adipose tissue and circulating adipokines to ingestion of lipid and carbohydrate beverages were observed.

  14. Nuclear responses in INTOR plasma stabilization elements

    International Nuclear Information System (INIS)

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  15. The finite element response matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  16. Glycemic Response of a Carbohydrate-Protein Bar with Ewe-Goat Whey

    Directory of Open Access Journals (Sweden)

    Eirini Manthou

    2014-06-01

    Full Text Available In this study we examined the glycaemic index (GI and glycaemic load (GL of a functional food product, which contains ewe-goat whey protein and carbohydrates in a 1:1 ratio. Nine healthy volunteers, (age, 23.3 ± 3.9 years; body mass index, 24.2 ± 4.1 kg·m2; body fat %, 18.6 ± 10.0 randomly consumed either a reference food or amount of the test food both with equal carbohydrate content in two visits. In each visit, seven blood samples were collected; the first sample after an overnight fast and the remaining six at 15, 30, 45, 60, 90 and 120 min after the beginning of food consumption. Plasma glucose concentration was measured and the GI was determined by calculation of the incremental area under the curve. The GL was calculated using the equation: test food GI/100 g available carbohydrates per test food serving. The GI of the test food was found to be 5.18 ± 3.27, while the GL of one test food serving was 1.09 ± 0.68. These results indicate that the tested product can be classified as a low GI (<55 and low GL (<10 food. Given the health benefits of low glycaemic response foods and whey protein consumption, the tested food could potentially promote health beyond basic nutrition.

  17. Integrating Responsive Building Elements in Buildings

    DEFF Research Database (Denmark)

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  18. The Influence of Oral Carbohydrate Solution Intake on Stress Response before Total Hip Replacement Surgery during Epidural and General Anaesthesia.

    Science.gov (United States)

    Çeliksular, M Cem; Saraçoğlu, Ayten; Yentür, Ercüment

    2016-06-01

    The effects of oral carbohydrate solutions, ingested 2 h prior to operation, on stress response were studied in patients undergoing general or epidural anaesthesia. The study was performed on 80 ASA I-II adult patients undergoing elective total hip replacement, which were randomized to four groups (n=20). Group G patients undergoing general anaesthesia fasted for 8 h preoperatively; Group GN patients undergoing general anaesthesia drank oral carbohydrate solutions preoperatively; Group E patients undergoing epidural anaesthesia fasted for 8 h and Group EN patients undergoing epidural anaesthesia drank oral carbohydrate solutions preoperatively. Groups GN and EN drank 800 mL of 12.5% oral carbohydrate solution at 24:00 preoperatively and 400 mL 2 h before the operation. Blood samples were taken for measurements of glucose, insulin, cortisol and IL-6 levels. The effect of preoperative oral carbohydrate ingestion on blood glucose levels was not significant. Insulin levels 24 h prior to surgery were similar; however, insulin levels measured just before surgery were 2-3 times higher in groups GN and EN than in groups G and E. Insulin levels at the 24(th) postoperative hour in epidural groups were increased compared to those at basal levels, although general anaesthesia groups showed a decrease. From these measurements, only the change in Group EN was statistically significant (poral carbohydrate nutrition did not reveal a significant effect on surgical stress response.

  19. The finite element response Matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  20. Equivalent glycemic load (EGL: a method for quantifying the glycemic responses elicited by low carbohydrate foods

    Directory of Open Access Journals (Sweden)

    Spolar Matt

    2006-08-01

    Full Text Available Abstract Background Glycemic load (GL is used to quantify the glycemic impact of high-carbohydrate (CHO foods, but cannot be used for low-CHO foods. Therefore, we evaluated the accuracy of equivalent-glycemic-load (EGL, a measure of the glycemic impact of low-CHO foods defined as the amount of CHO from white-bread (WB with the same glycemic impact as one serving of food. Methods Several randomized, cross-over trials were performed by a contract research organization using overnight-fasted healthy subjects drawn from a pool of 63 recruited from the general population by newspaper advertisement. Incremental blood-glucose response area-under-the-curve (AUC elicited by 0, 5, 10, 20, 35 and 50 g CHO portions of WB (WB-CHO and 3, 5, 10 and 20 g glucose were measured. EGL values of the different doses of glucose and WB and 4 low-CHO foods were determined as: EGL = (F-B/M, where F is AUC after food and B is y-intercept and M slope of the regression of AUC on grams WB-CHO. The dose-response curves of WB and glucose were used to derive an equation to estimate GL from EGL, and the resulting values compared to GL calculated from the glucose dose-response curve. The accuracy of EGL was assessed by comparing the GL (estimated from EGL values of the 4 doses of oral-glucose with the amounts actually consumed. Results Over 0–50 g WB-CHO (n = 10, the dose-response curve was non-linear, but over the range 0–20 g the curve was indistinguishable from linear, with AUC after 0, 5, 10 and 20 g WB-CHO, 10 ± 1, 28 ± 2, 58 ± 5 and 100 ± 6 mmol × min/L, differing significantly from each other (n = 48. The difference between GL values estimated from EGL and those calculated from the dose-response curve was 0 g (95% confidence-interval, ± 0.5 g. The difference between the GL values of the 4 doses of glucose estimated from EGL, and the amounts of glucose actually consumed was 0.2 g (95% confidence-interval, ± 1 g. Conclusion EGL, a measure of the glycemic impact of

  1. Drought response strategies define the relative contributions of hydraulic dysfunction and carbohydrate depletion during tree mortality.

    Science.gov (United States)

    Mitchell, Patrick J; O'Grady, Anthony P; Tissue, David T; White, Donald A; Ottenschlaeger, Maria L; Pinkard, Elizabeth A

    2013-02-01

    Plant survival during drought requires adequate hydration in living tissues and carbohydrate reserves for maintenance and recovery. We hypothesized that tree growth and hydraulic strategy determines the intensity and duration of the 'physiological drought', thereby affecting the relative contributions of loss of hydraulic function and carbohydrate depletion during mortality. We compared patterns in growth rate, water relations, gas exchange and carbohydrate dynamics in three tree species subjected to prolonged drought. Two Eucalyptus species (E. globulus, E. smithii) exhibited high growth rates and water-use resulting in rapid declines in water status and hydraulic conductance. In contrast, conservative growth and water relations in Pinus radiata resulted in longer periods of negative carbon balance and significant depletion of stored carbohydrates in all organs. The ongoing demand for carbohydrates from sustained respiration highlighted the role that duration of drought plays in facilitating carbohydrate consumption. Two drought strategies were revealed, differentiated by plant regulation of water status: plants maximized gas exchange, but were exposed to low water potentials and rapid hydraulic dysfunction; and tight regulation of gas exchange at the cost of carbohydrate depletion. These findings provide evidence for a relationship between hydraulic regulation of water status and carbohydrate depletion during terminal drought. © 2012 CSIRO. New Phytologist © 2012 New Phytologist Trust.

  2. Effect of training in the fasted state on metabolic responses during exercise with carbohydrate intake

    DEFF Research Database (Denmark)

    De Bock, K; Derave, W; Eijnde, B O

    2008-01-01

    program (6 wk, 3 day/wk, 1-2 h, 75% of peak Vo(2)) in moderately active males. They trained in the fasted (F; n = 10) or carbohydrate-fed state (CHO; n = 10) while receiving a standardized diet [65 percent of total energy intake (En) from carbohydrates, 20%En fat, 15%En protein]. Before and after...... the training period, substrate use during a 2-h exercise bout was determined. During these experimental sessions, all subjects were in a fed condition and received extra carbohydrates (1 g.kg body wt(-1) .h(-1)). Peak Vo(2) (+7%), succinate dehydrogenase activity, GLUT4, and hexokinase II content were...... adaptations in peak Vo(2) whether carried out in the fasted or carbohydrate-fed state. Although there was a decrease in exercise-induced glycogen breakdown and an increase in proteins involved in fat handling after fasting training, fat oxidation during exercise with carbohydrate intake was not changed....

  3. Time course of the response of carbohydrate metabolism to unloading of the soleus

    Science.gov (United States)

    Henriksen, Erik J.; Tischler, Marc E.

    1988-01-01

    The time course of the response of carbohydrate metabolism to unloading was studied in the soleus muscle of rats subjected to tail-cast suspension. In the fresh soleus, 12 hours of unloading led to higher concentrations of glycogen and lower activity ratios of both glycogen synthase and glycogen phosphorylase. These changes were still evident on day three. Thereafter, the increased glycogen concentration apparently diminished the activity ratio of glycogen synthase, leading to a subsequent fall in the total glycogen content after day one. After 24 hours of unloading, when no significant atrophy was detectable, there was no differential response to insulin for in vitro glucose metabolism. On day three, the soleus atrophied significantly and displayed a greater sensitivity to insulin for most of these parameters compared to the weight-bearing control muscle. However, insulin sensitivity for glycogen synthesis was unchanged. These results showed that the increased sensitivity to insulin of the unloaded soleus is associated with the degree of muscle atrophy, likely due to an increased insulin binding capacity relative to muscle mass. This study also showed that insulin regulation of glucose uptake and of glycogen synthesis is affected differentially in the unloaded soleus muscle.

  4. Counting carbohydrates

    Science.gov (United States)

    Carb counting; Carbohydrate-controlled diet; Diabetic diet; Diabetes-counting carbohydrates ... Many foods contain carbohydrates (carbs), including: Fruit and fruit juice Cereal, bread, pasta, and rice Milk and milk products, soy milk Beans, legumes, ...

  5. Effect of weight loss on the postprandial response to high-fat and high-carbohydrate meals in obese women.

    Science.gov (United States)

    Dallongeville, J; Gruson, E; Dallinga-Thie, G; Pigeyre, M; Gomila, S; Romon, M

    2007-06-01

    To assess the effect of weight loss on the plasma lipid and remnant-like lipoprotein cholesterol (RLPc) response to a high-fat or a high-carbohydrate meal in a population of obese women. Nutritional intervention study. Sixteen obese women (mean body mass index (BMI): 37.6+/-5 kg/m(2)). Subjects were asked to follow an energy-restricted diet (800 kcal/day) for 7 weeks, followed by a 1-week maintenance diet. Before and after weight loss, each participant was given (in random order) two iso-energetic meals containing either 80% fat and 20% protein (the high-fat meal) or 80% carbohydrate and 20% protein (the high-carbohydrate meal). Blood samples were collected over the following 10-h period. A two-way analysis of variance with repeated measures was used to assess the effect of the meal and postprandial time on biological variables and postprandial responses (notably RLPc levels). Weight loss was associated with a significant decrease in fasting triglyceride (P=0.0102), cholesterol (Pfat meal was less intense after weight reduction than before (interaction Pcarbohydrate meal was biphasic (i.e. with two peaks, 1 and 6 h after carbohydrate intake). After adjustment on baseline values, weight reduction was associated with a trend towards a reduction in the magnitude of the second triglyceride peak (interaction Ploss, again after adjustment on baseline levels. Our data suggest that weight loss preferentially affects postprandial triglyceride metabolism.

  6. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  7. Carbohydrate fatty acid monosulphate esters are safe and effective adjuvants for humoral responses.

    Science.gov (United States)

    Hilgers, Luuk A Th; Platenburg, Peter Paul L I; Bajramovic, Jeffrey; Veth, Jennifer; Sauerwein, Robert; Roeffen, Will; Pohl, Marie; van Amerongen, Geert; Stittelaar, Koert J; van den Bosch, Johannes F

    2017-05-31

    Carbohydrate fatty acid sulphate esters (CFASEs) formulated in a squalane-in-water emulsion are effective adjuvants for humoral responses to a wide range of antigens in various animal species but rise in body temperature and local reactions albeit mild or minimal hampers application in humans. In rabbits, body temperature increased 1°C one day after intramuscular (IM) injection, which returned to normal during the next day. The effect increased with increasing dose of CFASE but not with the number of injections (up to 5). Antigen enhanced the rise in body temperature after booster immunization (P100-fold after the second immunization. In ferrets immunized with 7.5μg of inactivated influenza virus A/H7N9, CMS adjuvant gave 100-fold increase in HAI antibody titres after the first and 25-fold after the second immunisation, which were 10-20-fold higher than with the MF59-like AddaVax adjuvant. In both models, a single immunisation with CMS adjuvant revealed similar or higher titres than two immunisations with either benchmark, without detectable systemic and local adverse effects. Despite striking chemical similarities with monophospholipid A (MPL), CMS adjuvant did not activate human TLR4 expressed on HEK cells. We concluded that the synthetic CMS adjuvant is a promising candidate for poor immunogens and single-shot vaccines and that rise in body temperature, local reactions or activation of TLR4 is not a pre-requisite for high adjuvanticity. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  8. A high carbohydrate, but not fat or protein meal attenuates postprandial ghrelin, PYY and GLP-1 responses in Chinese men

    OpenAIRE

    Parvaresh Rizi, Ehsan; Loh, Tze Ping; Baig, Sonia; Chhay, Vanna; Huang, Shiqi; Caleb Quek, Jonathan; Tai, E. Shyong; Toh, Sue-Anne; Khoo, Chin Meng

    2018-01-01

    It is known that the macronutrient content of a meal has different impacts on the postprandial satiety and appetite hormonal responses. Whether obesity interacts with such nutrient-dependent responses is not well characterized. We examined the postprandial appetite and satiety hormonal responses after a high-protein (HP), high-carbohydrate (HC), or high-fat (HF) mixed meal. This was a randomized cross-over study of 9 lean insulin-sensitive (mean±SEM HOMA-IR 0.83±0.10) and 9 obese insulin-resi...

  9. A high carbohydrate, but not fat or protein meal attenuates postprandial ghrelin, PYY and GLP-1 responses in Chinese men.

    Directory of Open Access Journals (Sweden)

    Ehsan Parvaresh Rizi

    Full Text Available It is known that the macronutrient content of a meal has different impacts on the postprandial satiety and appetite hormonal responses. Whether obesity interacts with such nutrient-dependent responses is not well characterized. We examined the postprandial appetite and satiety hormonal responses after a high-protein (HP, high-carbohydrate (HC, or high-fat (HF mixed meal. This was a randomized cross-over study of 9 lean insulin-sensitive (mean±SEM HOMA-IR 0.83±0.10 and 9 obese insulin-resistant (HOMA-IR 4.34±0.41 young (age 21-40 years, normoglycaemic Chinese men. We measured fasting and postprandial plasma concentration of glucose, insulin, active glucagon-like peptide-1 (GLP-1, total peptide-YY (PYY, and acyl-ghrelin in response to HP, HF, or HC meals. Overall postprandial plasma insulin response was more robust in the lean compared to obese subjects. The postprandial GLP-1 response after HF or HP meal was higher than HC meal in both lean and obese subjects. In obese subjects, HF meal induced higher response in postprandial PYY compared to HC meal. HP and HF meals also suppressed ghrelin greater compared to HC meal in the obese than lean subjects. In conclusion, a high-protein or high-fat meal induces a more favorable postprandial satiety and appetite hormonal response than a high-carbohydrate meal in obese insulin-resistant subjects.

  10. A high carbohydrate, but not fat or protein meal attenuates postprandial ghrelin, PYY and GLP-1 responses in Chinese men

    Science.gov (United States)

    Parvaresh Rizi, Ehsan; Loh, Tze Ping; Baig, Sonia; Chhay, Vanna; Huang, Shiqi; Caleb Quek, Jonathan; Tai, E. Shyong; Toh, Sue-Anne

    2018-01-01

    It is known that the macronutrient content of a meal has different impacts on the postprandial satiety and appetite hormonal responses. Whether obesity interacts with such nutrient-dependent responses is not well characterized. We examined the postprandial appetite and satiety hormonal responses after a high-protein (HP), high-carbohydrate (HC), or high-fat (HF) mixed meal. This was a randomized cross-over study of 9 lean insulin-sensitive (mean±SEM HOMA-IR 0.83±0.10) and 9 obese insulin-resistant (HOMA-IR 4.34±0.41) young (age 21–40 years), normoglycaemic Chinese men. We measured fasting and postprandial plasma concentration of glucose, insulin, active glucagon-like peptide-1 (GLP-1), total peptide-YY (PYY), and acyl-ghrelin in response to HP, HF, or HC meals. Overall postprandial plasma insulin response was more robust in the lean compared to obese subjects. The postprandial GLP-1 response after HF or HP meal was higher than HC meal in both lean and obese subjects. In obese subjects, HF meal induced higher response in postprandial PYY compared to HC meal. HP and HF meals also suppressed ghrelin greater compared to HC meal in the obese than lean subjects. In conclusion, a high-protein or high-fat meal induces a more favorable postprandial satiety and appetite hormonal response than a high-carbohydrate meal in obese insulin-resistant subjects. PMID:29385178

  11. Preliminary results of sugar maple carbohydrate and growth response under vacuum and gravity sap extraction

    Science.gov (United States)

    Mark L. Isselhardt; Timothy D. Perkins; Abby K. van den Berg; Paul G. Schaberg

    2016-01-01

    Recent technological advancements have increased the amount of sugar-enriched sap that can be extracted from sugar maple (Acer saccharum). This pilot study quantified overall sugar removal and the impacts of vacuum (60 cm Hg) and gravity sap extraction on residual nonstructural carbohydrate (NSC) concentrations and on stem and twig growth. Vacuum...

  12. Enhanced carbohydrate production by Southern Ocean phytoplankton in response to in situ iron fertilization

    NARCIS (Netherlands)

    van Oijen, T; Veldhuis, MJW; Gorbunov, MY; Nishioka, J; van Leeuwe, MA; de Baara, HJW; de Baar, H.J.W.

    2005-01-01

    Storage carbohydrates (e.g., water-extractable beta-1,3-D-glucan in diatoms) are of key importance for phytoplankton growth in a variable light climate, because they facilitate continued growth of the cells in darkness by providing energy and carbon skeletons for protein synthesis. Here, we tested

  13. Ghrelin response to carbohydrate-enriched breakfast is related to insulin

    NARCIS (Netherlands)

    Blom, W.A.M.; Stafleu, A.; Graaf, de C.; Kok, F.J.; Schaafsma, G.; Hendriks, H.F.J.

    2005-01-01

    Ghrelin plays an important role in the regulation of food intake. Little is known about how ghrelin concentrations are modified by dietary factors. Objective: We examined the effects of both amount and type of carbohydrate on ghrelin concentrations and all correlations among the variables ghrelin,

  14. Differences in postprandial hemodynamic response on a high protein versus a high carbohydrate diet

    NARCIS (Netherlands)

    Dopheide, J.; Geleijnse, J.M.; Bakker, S.J.L.; Brink, E.J.; Baak, van M.A.

    2011-01-01

    Objective: Several intervention trials have shown that diet composition affects blood pressure (BP). In this study we focused on postprandial hemodynamic changes on a high carbohydrate versus a high protein diet. Design and Method: In this randomized double-blind parallel group study, 53 adult

  15. Feeding responses by female Pieris brassicae butterflies to carbohydrates and amino acids

    NARCIS (Netherlands)

    Romeis, J.; Wäckers, F.L.

    2000-01-01

    Most Lepidoptera feed during the adult stage on carbohydrate-rich food sources, primarily floral nectar. However, little is known about the factors leading to the acceptance of a possible food source. It is reported that butterflies select for nectar rich in sucrose and amino acids. This suggests

  16. Feeding responses by female Pieris brassicae butterflies to carbohydrates and amino acids

    NARCIS (Netherlands)

    Romeis, J.; Wäckers, F.L.

    2000-01-01

    Most Lepidoptera feed during the adult stage on carbohydrate- rich food sources, primarily floral nectar. However, little is known about the factors leading to the acceptance of a possible food source. It is reported that butterflies select for nectar rich in sucrose and amino acids. This suggests

  17. Slow-release carbohydrates: growing evidence on metabolic responses and public health interest

    NARCIS (Netherlands)

    Vinoy, S.; Laville, M.; Feskens, E.J.M.

    2016-01-01

    To draw attention to the necessity of considering differences in the digestibility of carbohydrates, and more specifically of starch, a symposium was held at the 12th European Nutrition Conference (FENS), which took place in Berlin from October 20 to 23, 2015. The purpose of this session was to

  18. The degree of saturation of fatty acids in dietary fats does not affect the metabolic response to ingested carbohydrate.

    Science.gov (United States)

    Radulescu, Angela; Hassan, Youssef; Gannon, Mary C; Nuttall, Frank Q

    2009-06-01

    We are interested in the metabolic response to ingested macronutrients, and the interaction between macronutrients in meals. Previously, we and others reported that the postprandial rise in serum glucose following ingestion of 50 g carbohydrate, consumed as potato, was markedly attenuated when butter was ingested with the carbohydrate, whereas the serum insulin response was little affected by the combination. To determine whether a similar response would be observed with three other dietary fats considerably different in fatty acid composition. Nine healthy subjects received lard, twelve received olive oil and eleven received safflower oil as a test meal. The subjects ingested meals of 25 g fat (lard, olive oil or safflower oil), 50 g CHO (potato), 25 g fat with 50 g CHO or water only. Glucose, C peptide, insulin, triacylglycerols and nonesterified fatty acids were determined. Ingestion of lard, olive oil or safflower oil with potato did not affect the quantitative glucose and insulin responses to potato alone. However, the responses were delayed, diminished and prolonged. All three fats when ingested alone modestly increased the insulin concentration when compared to ingestion of water alone. When either lard, olive oil or safflower oil was ingested with the potato, there was an accelerated rise in triacylglycerols. This was most dramatic with safflower oil. Our data indicate that the glucose and insulin response to butter is unique when compared with the three other fat sources varying in their fatty acid composition.

  19. Carbohydrate microarrays

    DEFF Research Database (Denmark)

    Park, Sungjin; Gildersleeve, Jeffrey C; Blixt, Klas Ola

    2012-01-01

    In the last decade, carbohydrate microarrays have been core technologies for analyzing carbohydrate-mediated recognition events in a high-throughput fashion. A number of methods have been exploited for immobilizing glycans on the solid surface in a microarray format. This microarray...... of substrate specificities of glycosyltransferases. This review covers the construction of carbohydrate microarrays, detection methods of carbohydrate microarrays and their applications in biological and biomedical research....

  20. Carbohydrate Analysis

    Science.gov (United States)

    Bemiller, James N.

    Carbohydrates are important in foods as a major source of energy, to impart crucial textural properties, and as dietary fiber which influences physiological processes. Digestible carbohydrates, which are converted into monosaccharides, which are absorbed, provide metabolic energy. Worldwide, carbohydrates account for more than 70% of the caloric value of the human diet. It is recommended that all persons should limit calories from fat (the other significant source) to not more than 30% and that most of the carbohydrate calories should come from starch. Nondigestible polysaccharides (all those other than starch) comprise the major portion of dietary fiber (Sect. 10.5). Carbohydrates also contribute other attributes, including bulk, body, viscosity, stability to emulsions and foams, water-holding capacity, freeze-thaw stability, browning, flavors, aromas, and a range of desirable textures (from crispness to smooth, soft gels). They also provide satiety. Basic carbohydrate structures, chemistry, and terminology can be found in references (1, 2).

  1. The effects of handling and anesthetic agents on the stress response and carbohydrate metabolism in northern elephant seals.

    Directory of Open Access Journals (Sweden)

    Cory D Champagne

    Full Text Available Free-ranging animals often cope with fluctuating environmental conditions such as weather, food availability, predation risk, the requirements of breeding, and the influence of anthropogenic factors. Consequently, researchers are increasingly measuring stress markers, especially glucocorticoids, to understand stress, disturbance, and population health. Studying free-ranging animals, however, comes with numerous difficulties posed by environmental conditions and the particular characteristics of study species. Performing measurements under either physical restraint or chemical sedation may affect the physiological variable under investigation and lead to values that may not reflect the standard functional state of the animal. This study measured the stress response resulting from different handling conditions in northern elephant seals and any ensuing influences on carbohydrate metabolism. Endogenous glucose production (EGP was measured using [6-(3H]glucose and plasma cortisol concentration was measured from blood samples drawn during three-hour measurement intervals. These measurements were conducted in weanlings and yearlings with and without the use of chemical sedatives--under chemical sedation, physical restraint, or unrestrained. We compared these findings with measurements in adult seals sedated in the field. The method of handling had a significant influence on the stress response and carbohydrate metabolism. Physically restrained weanlings and yearlings transported to the lab had increased concentrations of circulating cortisol (F(11, 46 = 25.2, p<0.01 and epinephrine (F(3, 12 = 5.8, p = 0.01. Physical restraint led to increased EGP (t = 3.1, p = 0.04 and elevated plasma glucose levels (t = 8.2, p<0.01. Animals chemically sedated in the field typically did not exhibit a cortisol stress response. The combination of anesthetic agents (Telazol, ketamine, and diazepam used in this study appeared to alleviate a

  2. Carbohydrate Loading.

    Science.gov (United States)

    Csernus, Marilyn

    Carbohydrate loading is a frequently used technique to improve performance by altering an athlete's diet. The objective is to increase glycogen stored in muscles for use in prolonged strenuous exercise. For two to three days, the athlete consumes a diet that is low in carbohydrates and high in fat and protein while continuing to exercise and…

  3. Seaweed supplements normalise metabolic, cardiovascular and liver responses in high-carbohydrate, high-fat fed rats.

    Science.gov (United States)

    Kumar, Senthil Arun; Magnusson, Marie; Ward, Leigh C; Paul, Nicholas A; Brown, Lindsay

    2015-02-02

    Increased seaweed consumption may be linked to the lower incidence of metabolic syndrome in eastern Asia. This study investigated the responses to two tropical green seaweeds, Ulva ohnoi (UO) and Derbesia tenuissima (DT), in a rat model of human metabolic syndrome. Male Wistar rats (330-340 g) were fed either a corn starch-rich diet or a high-carbohydrate, high-fat diet with 25% fructose in drinking water, for 16 weeks. High-carbohydrate, high-fat diet-fed rats showed the signs of metabolic syndrome leading to abdominal obesity, cardiovascular remodelling and non-alcoholic fatty liver disease. Food was supplemented with 5% dried UO or DT for the final 8 weeks only. UO lowered total final body fat mass by 24%, systolic blood pressure by 29 mmHg, and improved glucose utilisation and insulin sensitivity. In contrast, DT did not change total body fat mass but decreased plasma triglycerides by 38% and total cholesterol by 17%. UO contained 18.1% soluble fibre as part of 40.9% total fibre, and increased magnesium, while DT contained 23.4% total fibre, essentially as insoluble fibre. UO was more effective in reducing metabolic syndrome than DT, possibly due to the increased intake of soluble fibre and magnesium.

  4. Seaweed Supplements Normalise Metabolic, Cardiovascular and Liver Responses in High-Carbohydrate, High-Fat Fed Rats

    Directory of Open Access Journals (Sweden)

    Senthil Arun Kumar

    2015-02-01

    Full Text Available Increased seaweed consumption may be linked to the lower incidence of metabolic syndrome in eastern Asia. This study investigated the responses to two tropical green seaweeds, Ulva ohnoi (UO and Derbesia tenuissima (DT, in a rat model of human metabolic syndrome. Male Wistar rats (330–340 g were fed either a corn starch-rich diet or a high-carbohydrate, high-fat diet with 25% fructose in drinking water, for 16 weeks. High-carbohydrate, high-fat diet-fed rats showed the signs of metabolic syndrome leading to abdominal obesity, cardiovascular remodelling and non-alcoholic fatty liver disease. Food was supplemented with 5% dried UO or DT for the final 8 weeks only. UO lowered total final body fat mass by 24%, systolic blood pressure by 29 mmHg, and improved glucose utilisation and insulin sensitivity. In contrast, DT did not change total body fat mass but decreased plasma triglycerides by 38% and total cholesterol by 17%. UO contained 18.1% soluble fibre as part of 40.9% total fibre, and increased magnesium, while DT contained 23.4% total fibre, essentially as insoluble fibre. UO was more effective in reducing metabolic syndrome than DT, possibly due to the increased intake of soluble fibre and magnesium.

  5. Seaweed Supplements Normalise Metabolic, Cardiovascular and Liver Responses in High-Carbohydrate, High-Fat Fed Rats

    Science.gov (United States)

    Kumar, Senthil Arun; Magnusson, Marie; Ward, Leigh C.; Paul, Nicholas A.; Brown, Lindsay

    2015-01-01

    Increased seaweed consumption may be linked to the lower incidence of metabolic syndrome in eastern Asia. This study investigated the responses to two tropical green seaweeds, Ulva ohnoi (UO) and Derbesia tenuissima (DT), in a rat model of human metabolic syndrome. Male Wistar rats (330–340 g) were fed either a corn starch-rich diet or a high-carbohydrate, high-fat diet with 25% fructose in drinking water, for 16 weeks. High-carbohydrate, high-fat diet-fed rats showed the signs of metabolic syndrome leading to abdominal obesity, cardiovascular remodelling and non-alcoholic fatty liver disease. Food was supplemented with 5% dried UO or DT for the final 8 weeks only. UO lowered total final body fat mass by 24%, systolic blood pressure by 29 mmHg, and improved glucose utilisation and insulin sensitivity. In contrast, DT did not change total body fat mass but decreased plasma triglycerides by 38% and total cholesterol by 17%. UO contained 18.1% soluble fibre as part of 40.9% total fibre, and increased magnesium, while DT contained 23.4% total fibre, essentially as insoluble fibre. UO was more effective in reducing metabolic syndrome than DT, possibly due to the increased intake of soluble fibre and magnesium. PMID:25648511

  6. The effects of the proportions of dietary macronutrients on the digestibility, post-prandial endocrine responses and large intestinal fermentation of carbohydrate in working dogs.

    Science.gov (United States)

    Hill, S R; Rutherfurd-Markwick, K J; Ravindran, G; Ugarte, C E; Thomas, D G

    2009-12-01

    To compare the effects of feeding diets varying in the proportions of macronutrients on the digestibility, post-prandial endocrine responses and large intestinal fermentation of carbohydrate in working dogs. The apparent digestibility of two test diets, one comprising low-carbohydrate, high-protein dry biscuits (Diet 1), and one comprising high-carbohydrate, low-protein dry biscuits (Diet 2), fed to 12 adult Harrier Hounds (n=5 female), was determined using the indigestible-marker and total-collection methods. Serial breath samples were collected from each dog before and after feeding, and analysed for concentrations of hydrogen. Concentrations of glucose and insulin in plasma were established from serial blood samples obtained after feeding. The apparent dry matter, protein, fat and energy digestibility of Diet 1 were higher, but the carbohydrate digestibility was lower (pdogs occurred earlier for Diet 1 than Diet 2 (pdogs fed Diet 2 than Diet 1 (pdogs fed Diet 2 compared with those fed Diet 1 (pdogs, including higher apparent nutrient digestibility, slower release of glucose into the bloodstream, and reduced large intestinal fermentation of carbohydrate. A low-carbohydrate, high-protein diet may be beneficial for specific groups of dogs, including working dogs subjected to prolonged bouts of exercise requiring a sustained energy source, or those with diabetes mellitus requiring better glycaemic control.

  7. Third Exposure to a Reduced Carbohydrate Meal Lowers Evening Postprandial Insulin and GIP Responses and HOMA-IR Estimate of Insulin Resistance.

    Science.gov (United States)

    Lin, Po-Ju; Borer, Katarina T

    2016-01-01

    Postprandial hyperinsulinemia, hyperglycemia, and insulin resistance increase the risk of type 2 diabetes (T2D) and cardiovascular disease mortality. Postprandial hyperinsulinemia and hyperglycemia also occur in metabolically healthy subjects consuming high-carbohydrate diets particularly after evening meals and when carbohydrate loads follow acute exercise. We hypothesized the involvement of dietary carbohydrate load, especially when timed after exercise, and mediation by the glucose-dependent insulinotropic peptide (GIP) in this phenomenon, as this incretin promotes insulin secretion after carbohydrate intake in insulin-sensitive, but not in insulin-resistant states. Four groups of eight metabolically healthy weight-matched postmenopausal women were provided with three isocaloric meals (a pre-trial meal and two meals during the trial day) containing either 30% or 60% carbohydrate, with and without two-hours of moderate-intensity exercise before the last two meals. Plasma glucose, insulin, glucagon, GIP, glucagon-like peptide 1 (GLP-1), free fatty acids (FFAs), and D-3-hydroxybutyrate concentrations were measured during 4-h postprandial periods and 3-h exercise periods, and their areas under the curve (AUCs) were analyzed by mixed-model ANOVA, and insulin resistance during fasting and meal tolerance tests within each diet was estimated using homeostasis-model assessment (HOMA-IR). The third low-carbohydrate meal, but not the high-carbohydrate meal, reduced: (1) evening insulin AUC by 39% without exercise and by 31% after exercise; (2) GIP AUC by 48% without exercise and by 45% after exercise, and (3) evening insulin resistance by 37% without exercise and by 24% after exercise. Pre-meal exercise did not alter insulin-, GIP- and HOMA-IR- lowering effects of low-carbohydrate diet, but exacerbated evening hyperglycemia. Evening postprandial insulin and GIP responses and insulin resistance declined by over 30% after three meals that limited daily carbohydrate intake to

  8. Effects of consumption of sucromalt, a slowly digestible carbohydrate, on mental and physical energy questionnaire responses.

    Science.gov (United States)

    Dammann, Kristen W; Bell, Margie; Kanter, Mitch; Berger, Alvin

    2013-03-01

    To evaluate whether consumption of the low-glycemic index (GI) carbohydrate sucromalt improves healthy adults' perceptions of mental and physical energy and fatigue compared to dextrose (glucose), a high GI control. In this double-blind, randomized, cross-over study, subjects (n = 44 healthy adults) consumed a standardized dinner, and following an overnight fast, ingested 75 g of either sucromalt or glucose in solution at 7:30 AM the next day. Subjects completed validated questionnaires that assessed mental and physical energy, and fatigue, hunger, and sleepiness at baseline and hourly until 12:30 PM for a total of five post-consumption time points. Within-subject differences adjusted for baseline for individual questions and composite scores (Mental Energy State, Mental Fatigue State, Physical Energy State, and Physical Fatigue State) were analyzed using repeated measures analysis of variance. Mental Energy State, Physical Energy State, and Physical Fatigue State results favored sucromalt compared to glucose, with significant differences emerging particularly after 4-5 hours (P Mental Fatigue State was also observed with sucromalt compared to glucose (P mental and physical energy and rise in mental and physical fatigue that can occur 4-5 hours after ingestion of a high GI beverage. Trials examining effects of sucromalt on cognitive and physical performance are of future interest.

  9. Carbohydrate malabsorption

    DEFF Research Database (Denmark)

    Rumessen, J J; Nordgaard-Andersen, I; Gudmand-Høyer, E

    1994-01-01

    Previous studies in small series of healthy adults have suggested that parallel measurement of hydrogen and methane resulting from gut fermentation may improve the precision of quantitative estimates of carbohydrate malabsorption. Systematic, controlled studies of the role of simultaneous hydrogen...

  10. Streptococcus uberis: In vitro biofilm production in response to carbohydrates and skim milk.

    Science.gov (United States)

    Dieser, Silvana A; Fessia, Aluminé S; Ferrari, Miriam P; Raspanti, Claudia G; Odierno, Liliana M

    Streptococcus uberis has become one of the most important environmental pathogens associated with clinical and subclinical bovine mastitis. Biofilm confers to bacteria more resistance to physical and chemical agents as well as to different mechanisms of the innate immune system. The aim of this work was to evaluate the ability of in vitro biofilm production in 32 S. uberis isolates from bovine mastitis and identified by biochemical tests and subsequently confirmed by the amplification of the pauA gene. The isolates were cultivated in TMP broth and TMP broth with the addition of 0.5% glucose, 1% sucrose, 1% lactose or 0.5% skim milk in microtiter plates stained with crystal violet. We demonstrated that S. uberis isolated from bovine mastitis are able to produce biofilms in TMP broth and, also that biofilm formation by S. uberis can be significantly enhanced by the addition of 0.5% glucose or 1% sucrose to TMP broth. This may suggest that the carbohydrates in milk or within the ruminant gut might affect the growth mode of S. uberis. In addition, our results showed that in vitro biofilm production under different conditions of supplementation displays variation among the isolates and that each isolate shows a particular profile of biofilm production. This phenotypic heterogeneity in biofilm production exhibited by S. uberis could at least partly explain why this bacterium has the ability to adapt to different niches facilitating survival to diverse and stressful conditions. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  11. Filtered molasses concentrate from sugar cane: natural functional ingredient effective in lowering the glycaemic index and insulin response of high carbohydrate foods.

    Science.gov (United States)

    Wright, Alison G; Ellis, Timothy P; Ilag, Leodevico L

    2014-12-01

    An aqueous filtered molasses concentrate (FMC) sourced from sugar cane was used as a functional ingredient in a range of carbohydrate-containing foods to reduce glycaemic response. When compared to untreated controls, postprandial glucose responses in the test products were reduced 5-20%, assessed by accredited glycaemic index (GI) testing. The reduction in glucose response in the test foods was dose-dependent and directly proportional to the ratio of FMC added to the amount of available carbohydrate in the test products. The insulin response to the foods was also reduced with FMC addition as compared to untreated controls. Inclusion of FMC in test foods did not replace any formulation ingredients; it was incorporated as an additional ingredient to existing formulations. Filtered molasses concentrate, made by a proprietary and patented process, contains many naturally occurring compounds. Some of the identified compounds are known to influence carbohydrate metabolism, and include phenolic compounds, minerals and organic acids. FMC, sourced from a by-product of sugar cane processing, shows potential as a natural functional ingredient capable of modifying carbohydrate metabolism and contributing to GI reduction of processed foods and beverages.

  12. Characteristic and analysis of structural elements of corporate social responsibility

    Directory of Open Access Journals (Sweden)

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  13. Elements of a national emergency response system for nuclear accidents

    International Nuclear Information System (INIS)

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  14. Effects of BCAA, arginine and carbohydrate combined drink on post-exercise biochemical response and psychological condition.

    Science.gov (United States)

    Hsu, Mei-Chich; Chien, Kuei-Yu; Hsu, Cheng-Chen; Chung, Chia-Jung; Chan, Kuei-Hui; Su, Borcherng

    2011-04-30

    This study investigated the effects of BCAA, arginine and carbohydrate combined beverage (BCAA Drink) on biochemical responses and psychological conditions during recovery after a single bout of exhaustive exercise. Fourteen healthy males were assigned to drink either BCAA Drink (BA trial) or placebo (PL trial) on two sessions separated by 2 weeks. Blood samples of each subject were collected before exercise, 0, 10, 20, 40, 60, 120 min and 24 h after exercise. No significant differences in the levels of lactate, ammonia, creatine kinase and glycerol between the two groups were observed at any of the time points. However, the levels of glucose and insulin were significantly higher in the BA trial as compared to those in the PL trial at the 40 and 60 min recovery points. Furthermore, the testosterone-to-cortisol ratio at the 120 min recovery point was significantly higher in the BA trial as compared to that in the PL trial. The results indicate the occurrence of anabolic response during the recovery period. The benefit of BCAA Drink was also performed by Profile of Mood States to assess the psychological condition. Fatigue score increased immediately at exhaustion in both groups, but the decrease in the fatigue score at 120 min recovery point was significant only in BA trial. These data indicate that a single bout of exhaustive exercise enhanced the feeling of fatigue. The detrimental consequence was reduced by an ingestion of BCAA Drink.

  15. Specificity determinants for the abscisic acid response element ?

    OpenAIRE

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  16. Pre-exercise carbohydrate and fluid ingestion: influence of glycemic response on 10-km treadmill running performance in the heat.

    Science.gov (United States)

    Mitchell, J B; Braun, W A; Pizza, F X; Forrest, M

    2000-03-01

    The purpose of this study was to determine the influence of ingesting solutions containing mixtures of carbohydrate (CHO) types on pre-exercise glycemic response, exercise-induced hypoglycemia, metabolic responses, and 10-km treadmill running performance in a warm environment. Ten trained runners completed 6, self-paced 10-km treadmill runs one hour after ingesting 900 ml of one of the following test solutions: a water placebo (WP), an 8 g 100 ml-1 high fructose corn syrup solution (HFG; 72 g CHO), a 6 g 100 ml-1 glucose solution (GLU; 54 g CHO), a 6 g.100 ml-1 sucrose/glucose mixture (SUG; 54 g CHO), or banana with water to equal 900 ml (BAN; approx. 54 g CHO). The sixth condition was 675 ml of an 8 g.100 ml-1 HFCS solution (LFG; 54 g CHO). Blood samples were taken prior to ingestion and every 15 min during rest and at 15 and 30 min, and at the end of the 10-km run. Blood was analyzed for glucose (BG) insulin (IN), glycerol, lactate, and percent change in plasma volume. Urine volume during the 1 hour of rest and change in body mass during exercise were also determined. A significant (p glucose was related to the PEGR; however, the decline in BG did not affect 10-km running performance. In addition, there were no differences in the metabolic responses during exercise between the different CHO types, nor did the type of CHO influence running performance. Finally, the presence of CHO and/or electrolytes in the hydration solutions produced a better fluid retention during the 60-min pre-exercise rest period compared to water. The results confirmed that if a competitive athlete consumed a breakfast prior to ingesting a CHO-electrolyte beverage, a practice that is common, the glycemic responses may be different.

  17. ABFs, a family of ABA-responsive element binding factors.

    Science.gov (United States)

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  18. Impact of Carbohydrate-Electrolyte Beverage Ingestion on Heart Rate Response While Climbing Mountain Fuji at ~3000 m

    Directory of Open Access Journals (Sweden)

    Masahiro Horiuchi

    2017-01-01

    Full Text Available We sought to investigate whether carbohydrate-electrolyte beverage ingestion reduced heart rate (HR in twenty-three healthy young adults while climbing Mount Fuji at a given exercise intensity. Twenty-three healthy adults were randomly divided into two groups: the tap water (11 males [M] and 1 female [F] and the carbohydrate-electrolyte group (10 M and 1 F. HR and activity energy expenditure (AEE were recorded every min. The HRs for the first 30 minutes of climbing were not significantly different between the groups [121 ± 2 beats per min (bpm in the tap water and 116 ± 3 bpm in the carbohydrate-electrolyte]; however, HR significantly increased with climbing in the tap water group (129 ± 2 bpm but showed no significant increase in the carbohydrate-electrolyte group (121 ± 3 bpm. In addition, body weight changes throughout two days ascending and descending on Mount Fuji were inversely related to changes in resting HR. Further, individual variation of body weight changes was suppressed by carbohydrate-electrolyte drink. Collectively, carbohydrate-electrolyte beverage intake may attenuate an increase in HR at a given AEE while mountaineering at ~3000 m compared with tap water intake.

  19. Evaluation of glucose and insulin response to haylage diets with different content of nonstructural carbohydrates in 2 breeds of horses.

    Science.gov (United States)

    Lindåse, S; Müller, C; Nostell, K; Bröjer, J

    2018-04-09

    Information about the effect of nonstructural carbohydrates (NSCs) in forage on the postprandial glucose and insulin response in horses is scarce. This is of interest as postprandial hyperinsulinemia in horses is a risk factor for laminitis. In addition, insulin sensitivity (IS) differs between breeds. The aim was to evaluate the postprandial glucose and insulin response to haylage diets with different NSC content in horses of 2 different breeds and to evaluate the relationship between the postprandial insulin response and measures of IS derived from a frequently sampled intravenous glucose tolerance test (FSIGTT). Standardbreds (n = 9) and Icelandic horses (n = 9) with a mean body condition score of 5.5 ± 0.6 (scale 1-9) were studied. Horses were clinically healthy at the start of the study and had no history of endocrinopathic laminitis. The experiment was conducted as a replicate 3 × 3 Latin square, in which horses were fed haylage diets with low (4.2%), medium (13.6%), and high (18.2%) NSC content of dry matter. Blood sampling was performed before feeding and every 30 min until 300 min after feeding. An FSIGTT was also performed in all horses. The early (first 60 min) and the total (300 min) postprandial glucose and insulin response (area under the curve [AUC]) was higher after a meal of both medium and high NSC haylage in comparison with low NSC haylage when both breeds were combined (P ≤ 0.02). There was a main effect of breed for the early (P ≤ 0.004) but not for the total (P > 0.12) postprandial glucose and insulin response. The IS index was comparable between breeds (P = 0.75). The natural logarithm of the peak concentration, the AUC for the first 60 min and the total AUC for insulin, after a meal of medium and high NSC haylage, were moderately negatively correlated (P haylage with low NSC content (P > 0.054). This study demonstrates that the postprandial insulin response is affected by both the NSC content of haylage and the horse's IS. However

  20. Learning about Carbohydrates

    Science.gov (United States)

    ... Videos for Educators Search English Español Learning About Carbohydrates KidsHealth / For Kids / Learning About Carbohydrates Print en ... source of energy for the body. What Are Carbohydrates? There are two major types of carbohydrates (or ...

  1. A 3-day high-fat/low-carbohydrate diet does not alter exercise-induced growth hormone response in healthy males.

    Science.gov (United States)

    Sasaki, Hiroto; Ishibashi, Aya; Tsuchiya, Yoshihumi; Shimura, Nobuhiro; Kurihara, Toshiyuki; Ebi, Kumiko; Goto, Kazushige

    2015-12-01

    The purpose of the present study was to examine the effects of 3 days isoenergetic high-fat/low-carbohydrate diet (HF-LC) relative to low-fat/high-carbohydrate diet (LF-HC) on the exercise-induced growth hormone (GH) response in healthy male subjects. Ten healthy young males participated in this study. Each subject consumed the HF-LC (18±1% protein, 61±2% fat, 21±1% carbohydrate, 2720 kcal per day) for 3 consecutive days after consuming the LF-HC (18±1% protein, 20±1% fat, 62±1% carbohydrate, 2755 kcal per day) for 3 consecutive days. After each dietary intervention period, the hormonal and metabolic responses to an acute exercise (30 min of continuous pedaling at 60% of V˙O2max) were compared. The intramyocellular lipid (IMCL) contents in the vastus lateralis, soleus, and tibialis anterior were evaluated by proton magnetic resonance spectroscopy. Serum GH concentrations increased significantly during the exercise after both the HF-LC and LF-HC periods (Pexercise-induced GH response was not significantly different between the two periods. Fat utilization and lipolytic responses during the exercise were enhanced significantly after the HF-LC period compared with the LF-HC period. IMCL content did not differ significantly in any portion of muscle after the dietary interventions. We could not show that short-term HF-LC consumption changed significantly exercise-induced GH response or IMCL content in healthy young males. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Slow-release carbohydrates: growing evidence on metabolic responses and public health interest. Summary of the symposium held at the 12th European Nutrition Conference (FENS 2015

    Directory of Open Access Journals (Sweden)

    Sophie Vinoy

    2016-07-01

    Full Text Available To draw attention to the necessity of considering differences in the digestibility of carbohydrates, and more specifically of starch, a symposium was held at the 12th European Nutrition Conference (FENS, which took place in Berlin from October 20 to 23, 2015. The purpose of this session was to present the consolidated knowledge and recent advances regarding the relationship between slow-release carbohydrates, metabolic responses, and public health issues. Three main topics were presented: 1 the definition of, sources of, and recognised interest in the glycaemic response to slowly digestible starch (SDS; 2 clinical evidence regarding the physiological effects of slow-release carbohydrates from cereal foods; and 3 interest in reducing the postprandial glycaemic response to help prevent metabolic diseases. Foods with the highest SDS content induce the lowest glycaemic responses, as the starch is protected from gelatinisation during processing. In humans, high-SDS food consumption induces slower glucose release, lower postprandial insulinaemia, and stimulation of gut hormones. Moreover, postprandial hyperglycaemia is an independent risk factor for type two diabetes mellitus (T2DM and cardiovascular disease (CVD. Therefore, given the plausible aetiologic mechanisms, we argue that postprandial glucose levels are relevant for health and disease and represent a meaningful target for intervention, for example, through dietary factors. This symposium was organised by Mondelez International R&D.

  3. Slow-release carbohydrates: growing evidence on metabolic responses and public health interest. Summary of the symposium held at the 12th European Nutrition Conference (FENS 2015).

    Science.gov (United States)

    Vinoy, Sophie; Laville, Martine; Feskens, Edith J M

    2016-01-01

    To draw attention to the necessity of considering differences in the digestibility of carbohydrates, and more specifically of starch, a symposium was held at the 12th European Nutrition Conference (FENS), which took place in Berlin from October 20 to 23, 2015. The purpose of this session was to present the consolidated knowledge and recent advances regarding the relationship between slow-release carbohydrates, metabolic responses, and public health issues. Three main topics were presented: 1) the definition of, sources of, and recognised interest in the glycaemic response to slowly digestible starch (SDS); 2) clinical evidence regarding the physiological effects of slow-release carbohydrates from cereal foods; and 3) interest in reducing the postprandial glycaemic response to help prevent metabolic diseases. Foods with the highest SDS content induce the lowest glycaemic responses, as the starch is protected from gelatinisation during processing. In humans, high-SDS food consumption induces slower glucose release, lower postprandial insulinaemia, and stimulation of gut hormones. Moreover, postprandial hyperglycaemia is an independent risk factor for type two diabetes mellitus (T2DM) and cardiovascular disease (CVD). Therefore, given the plausible aetiologic mechanisms, we argue that postprandial glucose levels are relevant for health and disease and represent a meaningful target for intervention, for example, through dietary factors. This symposium was organised by Mondelez International R&D.

  4. Spectral response of multi-element silicon detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  5. Finite element simulation of impact response of wire mesh screens

    Directory of Open Access Journals (Sweden)

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  6. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Directory of Open Access Journals (Sweden)

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  7. Responses of leaf nitrogen and mobile carbohydrates in different Quercus species/provenances to moderate climate changes.

    Science.gov (United States)

    Li, M-H; Cherubini, P; Dobbertin, M; Arend, M; Xiao, W-F; Rigling, A

    2013-01-01

    Global warming and shortage of water have been evidenced in the recent past and are predicted for the future. Climate change will inevitably have considerable impact on plant physiology, growth, productivity and forest ecosystem functions. The present study determined the effects of simulated daytime air warming (+1 to 1.5 °C during the growing season), drought (-40% and -57% of mean precipitation of 728 mm during the 2007 and 2008 growing season, respectively) and their combination, on leaf nitrogen (N) and non-structural carbohydrates (NSC) of two Quercus species (Q. robur and Q. petraea) and provenances (two provenances for each species) grown in two soil types in Switzerland across two treatment years, to test the hypothesis that leaf N and NSC in the more water-sensitive species (Q. robur) and provenances (originating from water-rich locations) will more strongly respond to global warming and water deficit, compared to those in the more drought-tolerant species (Q. petraea) or provenances. No species- and provenance-specific responses in leaf N and NSC to the climate treatment were found, indicating that the results failed to support our hypothesis. The between-species variation of leaf N and NSC concentrations mainly reflected differences in biology of the two species, and the between-provenance variation of N and NSC concentrations apparently mirrored the climate of their origins. Hence, we conclude that (i) the two Quercus species studied are somewhat insensitive, due to their distribution covering a wide geographical and climate range, to moderate climate change within Switzerland, and (ii) a moderate global warming of B1 scenario (IPCC 2007) will not, or at least less, negatively affect the N and carbon physiology in Q. robur and Q. petraea. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.

  8. Clinical response in Mexican patients with irritable bowel syndrome treated with a low diet low in fermentable carbohydrates (FODMAP).

    Science.gov (United States)

    Pérez y López, N; Torres-López, E; Zamarripa-Dorsey, F

    2015-01-01

    The low FODMAP diet eliminates carbohydrates and fermentable alcohols because they are not absorbed by the intestine, but are fermented by the microbiota, causing bloating and flatulence. To evaluate the clinical response to the low FODMAP diet in patients with the different clinical subtypes of irritable bowel syndrome (IBS). Patients attended to at the Gastroenterology Department in 2014 that were diagnosed with IBS based on the Rome III criteria were included in the study. They were managed with a low FODMAP diet for 21 days and their response to the symptoms of abdominal pain, bloating, flatulence, and stool form pre and post-diet were evaluated through the visual analogue scale, Bristol scale, and patient overall satisfaction. The results were analyzed by means, 95% CI, and the Student's t test. Of the 31 patients included in the study, 87% were women and the mean age was 46.48 years. Distribution was: IBS-C 64.5%, IBS-D 22.6%, and IBS-M 12.9%. The score for pain was 6.0 (95% CI 5.04-6.96) and the post-diet score was 2.77 (95% CI 1.60-3.95) (P<.001). The score for bloating was 7.10 (95% CI 6.13-8.06) and the post-diet score was 4.19 (95% CI 2.95-5.44) (P<.001). The score for flatulence was 5.94 (95% CI 4.79-7.08) and the post-diet score was 3.06 (IC95% 1.99-4.14) (P<.001). The pre-diet Bristol Scale result was 3.68 (95% CI 3.14-4.22) and the post-diet result was 4.10 (95% CI 3.66-4.54) (P=.1). The satisfaction percentage was 70.9%. In this first study on a Mexican population with IBS, there was significant improvement of the main symptoms, including pain, bloating, and flatulence after treatment with a low FODMAP diet. Copyright © 2015 Asociación Mexicana de Gastroenterología. Published by Masson Doyma México S.A. All rights reserved.

  9. Role of pathogen-derived cell wall carbohydrates and prostaglandin E2 in immune response and suppression of fish immunity by the oomycete Saprolegnia parasitica.

    Science.gov (United States)

    Belmonte, Rodrigo; Wang, Tiehui; Duncan, Gary J; Skaar, Ida; Mélida, Hugo; Bulone, Vincent; van West, Pieter; Secombes, Christopher J

    2014-11-01

    Saprolegnia parasitica is a freshwater oomycete that is capable of infecting several species of fin fish. Saprolegniosis, the disease caused by this microbe, has a substantial impact on Atlantic salmon aquaculture. No sustainable treatment against saprolegniosis is available, and little is known regarding the host response. In this study, we examined the immune response of Atlantic salmon to S. parasitica infection and to its cell wall carbohydrates. Saprolegnia triggers a strong inflammatory response in its host (i.e., induction of interleukin-1β1 [IL-1β1], IL-6, and tumor necrosis factor alpha), while severely suppressing the expression of genes associated with adaptive immunity in fish, through downregulation of T-helper cell cytokines, antigen presentation machinery, and immunoglobulins. Oomycete cell wall carbohydrates were recognized by fish leukocytes, triggering upregulation of genes involved in the inflammatory response, similar to what is observed during infection. Our data suggest that S. parasitica is capable of producing prostaglandin [corrected] E2 (PGE2) in vitro, a metabolite not previously shown to be produced by oomycetes, and two proteins with homology to vertebrate enzymes known to play a role in prostaglandin biosynthesis have been identified in the oomycete genome. Exogenous PGE2 was shown to increase the inflammatory response in fish leukocytes incubated with cell wall carbohydrates while suppressing genes involved in cellular immunity (gamma interferon [IFN-γ] and the IFN-γ-inducible protein [γ-IP]). Inhibition of S. parasitica zoospore germination and mycelial growth by two cyclooxygenase inhibitors (aspirin and indomethacin) also suggests that prostaglandins may be involved in oomycete development. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  10. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Science.gov (United States)

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  11. Specificity determinants for the abscisic acid response element.

    Science.gov (United States)

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  12. Acclimatory responses of the Daphnia pulex proteome to environmental changes. I. Chronic exposure to hypoxia affects the oxygen transport system and carbohydrate metabolism

    Directory of Open Access Journals (Sweden)

    Madlung Johannes

    2009-04-01

    Full Text Available Abstract Background Freshwater planktonic crustaceans of the genus Daphnia show a remarkable plasticity to cope with environmental changes in oxygen concentration and temperature. One of the key proteins of adaptive gene control in Daphnia pulex under hypoxia is hemoglobin (Hb, which increases in hemolymph concentration by an order of magnitude and shows an enhanced oxygen affinity due to changes in subunit composition. To explore the full spectrum of adaptive protein expression in response to low-oxygen conditions, two-dimensional gel electrophoresis and mass spectrometry were used to analyze the proteome composition of animals acclimated to normoxia (oxygen partial pressure [Po2]: 20 kPa and hypoxia (Po2: 3 kPa, respectively. Results The comparative proteome analysis showed an up-regulation of more than 50 protein spots under hypoxia. Identification of a major share of these spots revealed acclimatory changes for Hb, glycolytic enzymes (enolase, and enzymes involved in the degradation of storage and structural carbohydrates (e.g. cellubiohydrolase. Proteolytic enzymes remained constitutively expressed on a high level. Conclusion Acclimatory adjustments of the D. pulex proteome to hypoxia included a strong induction of Hb and carbohydrate-degrading enzymes. The scenario of adaptive protein expression under environmental hypoxia can be interpreted as a process to improve oxygen transport and carbohydrate provision for the maintenance of ATP production, even during short episodes of tissue hypoxia requiring support from anaerobic metabolism.

  13. Measuring the short-term substrate utilization response to high-carbohydrate and high-fat meals in the whole-body indirect calorimeter.

    Science.gov (United States)

    Gribok, Andrei; Leger, Jayme L; Stevens, Michelle; Hoyt, Reed; Buller, Mark; Rumpler, William

    2016-06-01

    The paper demonstrates that minute-to-minute metabolic response to meals with different macronutrient content can be measured and discerned in the whole-body indirect calorimeter. The ability to discriminate between high-carbohydrate and high-fat meals is achieved by applying a modified regularization technique with additional constraints imposed on oxygen consumption rate. These additional constraints reduce the differences in accuracy between the oxygen and carbon dioxide analyzers. The modified technique was applied to 63 calorimeter sessions that were each 24 h long. The data were collected from 16 healthy volunteers (eight males, eight females, aged 22-35 years). Each volunteer performed four 24-h long calorimeter sessions. At each session, they received one of four treatment combinations involving exercise (high or low intensity) and diet (a high-fat or high-carbohydrate shake for lunch). One volunteer did not complete all four assignments, which brought the total number of sessions to 63 instead of 64. During the 24-h stay in the calorimeter, subjects wore a continuous glucose monitoring system, which was used as a benchmark for subject's postprandial glycemic response. The minute-by-minute respiratory exchange ratio (RER) data showed excellent agreement with concurrent subcutaneous glucose concentrations in postprandial state. The averaged minute-to-minute RER response to the high-carbohydrate shake was significantly different from the response to high-fat shake. Also, postprandial RER slopes were significantly different for two dietary treatments. The results show that whole-body respiration calorimeters can be utilized as tools to study short-term kinetics of substrate oxidation in humans. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  14. The yeast genome may harbor hypoxia response elements (HRE).

    Science.gov (United States)

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  15. Influence of a low-carbohydrate diet on thermoregulatory responses to exercise in women during follicular and luteal phase of the menstrual cycle

    Directory of Open Access Journals (Sweden)

    I Pokora

    2003-12-01

    Full Text Available The aim of this study was to examine the effects of a low-carbohydrate diet on thermoregulatory responses to exercise in women during follicular (F and luteal (L phase of the menstrual cycle. Ten subjects performed a graded bicycle exercise in a thermoneutral environment (23oC, 52-60% relative humidity. Women were tested after consuming, for 3 days, a control diet (C: 60% carbohydrates, 20% fat, 20% protein and after that a low-carbohydrate diet (LCHO: 50% fat, 35% protein and 5% carbohydrates, in each phase of the menstrual cycle. Tympanic temperature (Tty, mean skin temperature (Tsk, electrical skin resistance (ESR, oxygen uptake (VO2, heart rate (HR as well as blood β-hydroxybutyrate acid (β-HB, glucose (Glu and lactate (LA concentrations were measured. On the basis of ESR, dynamics of sweating was estimated. No differences in Tty and Tsk were found between the C and LCHO during exercise tests. However, Tty was significantly higher during L than F phase. Delay time for sweating was shorter after LCHO (F: 10.8 vs 9.4 min, P<0.05, L: 9.9 vs 9.3 N.S., but temperature threshold for this reaction was unchanged (L: 37.22 vs 37.37 and F: 36.91 vs 36.94 oC. Sweating sensitivity was greater after LCHO during both F and L. Resting blood Glu and LA concentrations were similar in women after C and LCHO diet. Before exercise β-HB level was F: 0.45, L: 0.35 mM after LCHO and F: 0.08, L: 0.09 mM after C diet (P<0.05, respectively. At rest and during exercise HR was significantly higher after LCHO diet in women during F phase. In submaximal exercise loads VO2 after LCHO diet were significantly higher than after C diet in all women. It was concluded that the low-carbohydrate diet ingested by young women in both phases of the menstrual cycle have no effect on body temperature, however, it affects heat dissipation mechanism during exercise.

  16. Use of molecular modeling and site-directed mutagenesis to define the structural basis for the immune response to carbohydrate xenoantigens

    Directory of Open Access Journals (Sweden)

    Yew Margaret

    2007-03-01

    Full Text Available Abstract Background Natural antibodies directed at carbohydrates reject porcine xenografts. They are initially expressed in germline configuration and are encoded by a small number of structurally-related germline progenitors. The transplantation of genetically-modified pig organs prevents hyperacute rejection, but delayed graft rejection still occurs, partly due to humoral responses. IgVH genes encoding induced xenoantibodies are predominantly, not exclusively, derived from germline progenitors in the VH3 family. We have previously identified the immunoglobulin heavy chain genes encoding VH3 xenoantibodies in patients and primates. In this manuscript, we complete the structural analysis of induced xenoantibodies by identifying the IgVH genes encoding the small proportion of VH4 xenoantibodies and the germline progenitors encoding xenoantibody light chains. This information has been used to define the xenoantibody/carbohydrate binding site using computer-simulated modeling. Results The VH4-59 gene encodes antibodies in the VH4 family that are induced in human patients mounting active xenoantibody responses. The light chain of xenoantibodies is encoded by DPK5 and HSIGKV134. The structural information obtained by sequencing analysis was used to create computer-simulated models. Key contact sites for xenoantibody/carbohydrate interaction for VH3 family xenoantibodies include amino acids in sites 31, 33, 50, 57, 58 and the CDR3 region of the IgVH gene. Site-directed mutagenesis indicates that mutations in predicted contact sites alter binding to carbohydrate xenoantigens. Computer-simulated modeling suggests that the CDR3 region directly influences binding. Conclusion Xenoantibodies induced during early and delayed xenograft responses are predominantly encoded by genes in the VH3 family, with a small proportion encoded by VH4 germline progenitors. This restricted group can be identified by the unique canonical structure of the light chain, heavy

  17. Carbohydrates of human immunodeficiency virus

    DEFF Research Database (Denmark)

    Hansen, J E

    1992-01-01

    Elucidation of the mechanism by which viral infection induces the appearance of carbohydrate neoantigens is highly important. Results from such studies could be expected to be significant for a general understanding of the regulation of glycosylation, and perhaps especially important for the unde......Elucidation of the mechanism by which viral infection induces the appearance of carbohydrate neoantigens is highly important. Results from such studies could be expected to be significant for a general understanding of the regulation of glycosylation, and perhaps especially important...... therapy with glycosylation enzyme inhibitors will, however, require the development of more specific and less toxic compounds. If carbohydrate antigens can elicit a neutralizing immune response in vivo, the possibility exists that carbohydrate neoantigens can be utilized in the construction of a vaccine...

  18. Lichen Parmelia sulcata time response model to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  19. Effect of dietary carbohydrate on non-specific immune response, hepatic antioxidative abilities and disease resistance of juvenile golden pompano (Trachinotus ovatus).

    Science.gov (United States)

    Zhou, Chuanpeng; Ge, Xianping; Lin, Heizhao; Niu, Jin

    2014-12-01

    The present study was conducted to investigate the effects of dietary carbohydrate (CHO) levels on non-specific immune responses, hepatic antioxidative status and disease resistance of juvenile golden pompano. Fish were fed six isonitrogenous and isoenergetic diets containing various CHO levels for 8 weeks. After the feeding trial, fish were challenged by Vibrio harveyi and survival rate was recorded for the next 12 days. Plasma total protein and albumin content, respiratory burst activity, alkaline phosphatase, slightly increased with dietary starch level from 0% to 16.8%, but significantly decreased at dietary starch levels of 16.8%-28%. Plasma lysozyme, complement 3 and complement 4 levels increased with increasing dietary carbohydrate up to 11.2% and then declined (P 0.05) with those of the other treatments. After challenge, fish fed 11.2% and 16.8% dietary CHO showed higher survival rate than that of fish in 0% CHO group (P 0.05). The results of this study suggest that ingestion of 11.2-16.8% dietary CHO can enhance the non-specific immune responses, increase the hepatic antioxidant abilities, and improve resistance to V. harveyi infection of juvenile golden pompano. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Science.gov (United States)

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  1. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Science.gov (United States)

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  2. Nonstructural carbohydrate-balance response to long-term elevated CO2 exposure in European beech and Norway spruce mixed cultures: biochemical and ultrastructural responses

    Czech Academy of Sciences Publication Activity Database

    Mašková, P.; Radochová, Barbora; Lhotáková, Z.; Michálek, Jan; Lipavská, H.

    2017-01-01

    Roč. 47, č. 11 (2017), s. 1498-1494 ISSN 0045-5067 R&D Projects: GA ČR(CZ) GAP501/10/0340 Institutional support: RVO:67985823 Keywords : chloroplast ultrastructure * CO2 enrichment * forest trees * soluble carbohydrates * starch Subject RIV: GK - Forestry OBOR OECD: Forestry Impact factor: 1.827, year: 2016

  3. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  4. Testing food-related inhibitory control to high- and low-calorie food stimuli: Electrophysiological responses to high-calorie food stimuli predict calorie and carbohydrate intake.

    Science.gov (United States)

    Carbine, Kaylie A; Christensen, Edward; LeCheminant, James D; Bailey, Bruce W; Tucker, Larry A; Larson, Michael J

    2017-07-01

    Maintaining a healthy diet has important implications for physical and mental health. One factor that may influence diet and food consumption is inhibitory control-the ability to withhold a dominant response in order to correctly respond to environmental demands. We examined how N2 amplitude, an ERP that reflects inhibitory control processes, differed toward high- and low-calorie food stimuli and related to food intake. A total of 159 participants (81 female; M age = 23.5 years; SD = 7.6) completed two food-based go/no-go tasks (one with high-calorie and one with low-calorie food pictures as no-go stimuli) while N2 amplitude was recorded. Participants recorded food intake using the Automated Self-Administered 24-hour Dietary Recall system. Inhibiting responses toward high-calorie stimuli elicited a larger (i.e., more negative) no-go N2 amplitude; inhibiting responses toward low-calorie stimuli elicited a smaller no-go N2 amplitude. Participants were more accurate during the high-calorie than low-calorie task, but took longer to respond on go trials toward high-calorie rather than low-calorie stimuli. When controlling for age, gender, and BMI, larger high-calorie N2 difference amplitude predicted lower caloric intake (β = 0.17); low-calorie N2 difference amplitude was not related to caloric intake (β = -0.03). Exploratory analyses revealed larger high-calorie N2 difference amplitude predicted carbohydrate intake (β = 0.22), but not protein (β = 0.08) or fat (β = 0.11) intake. Results suggest that withholding responses from high-calorie foods requires increased recruitment of inhibitory control processes, which may be necessary to regulate food consumption, particularly for foods high in calories and carbohydrates. © 2017 Society for Psychophysiological Research.

  5. Absence of Carbohydrate Response Element Binding Protein in Adipocytes Causes Systemic Insulin Resistance and Impairs Glucose Transport

    Directory of Open Access Journals (Sweden)

    Archana Vijayakumar

    2017-10-01

    Full Text Available Lower adipose-ChREBP and de novo lipogenesis (DNL are associated with insulin resistance in humans. Here, we generated adipose-specific ChREBP knockout (AdChREBP KO mice with negligible sucrose-induced DNL in adipose tissue (AT. Chow-fed AdChREBP KO mice are insulin resistant with impaired insulin action in the liver, muscle, and AT and increased AT inflammation. HFD-fed AdChREBP KO mice are also more insulin resistant than controls. Surprisingly, adipocytes lacking ChREBP display a cell-autonomous reduction in insulin-stimulated glucose transport that is mediated by impaired Glut4 translocation and exocytosis, not lower Glut4 levels. AdChREBP KO mice have lower levels of palmitic acid esters of hydroxy stearic acids (PAHSAs in serum, and AT. 9-PAHSA supplementation completely rescues their insulin resistance and AT inflammation. 9-PAHSA also normalizes impaired glucose transport and Glut4 exocytosis in ChREBP KO adipocytes. Thus, loss of adipose-ChREBP is sufficient to cause insulin resistance, potentially by regulating AT glucose transport and flux through specific lipogenic pathways.

  6. ANALYSIS OF STRUCTURAL ELEMENT OF FAMILY 6 CARBOHYDRATE BINDING MODULE (CTCBM6B OF ALPHA-L-ARABINOFURANOSIDASE FROM CLOSTRIDIUM THERMOCELLUM

    Directory of Open Access Journals (Sweden)

    Shadab Ahmed

    2013-06-01

    Full Text Available The amino acid sequence of a family 6 carbohydrate binding module (CtCBM6B from Clostridium thermocellum alpha-L-arabinofuranosidase showed close evolutionary relationship with some other member of family 6 carbohydrate binding modules. The CD spectrum analysis confirmed the secondary structure prediction of CtCBM6B as both showed beta-sheets (44-48% and random coils (52-54% and no alpha-helix. The hydrogen bonding plot of CtCBM6B showed many segments of parallel and anti-parallel beta-strands which was similar to the secondary structure prediction by PSIPRED VIEW. The three dimensional structure of CtCBM6B generated by MODELLER revealed a typical beta-sandwich architecture at its core, characteristic of beta-jelly roll CBM superfamily. The Ramachandran plot analysis by PROCHECK showed that out of 134 residues, 92.9% were in most favoured region, 6.2% in additionally allowed region and only 0.9% in generously allowed region which indicated a stable conformation of 3D model of CtCBM6B. The docking analysis of CtCBM6B for finding putative ligand binding sites showed that it has high binding affinity for arabinobiose, beta-L-arabinofuranose and beta-D-xylopyranose indicated by lower ligand binding energy (-14.28 kcal mol–1, -12.5 kcal mol–1 and -11.3 kcal mol–1, respectively. CtCBM6B also showed appreciable binding affinity with alpha-D-xylopyranose (–10.8 kcal mol–1, beta-L-arabinopyranose (–10.2 kcal mol-1, alpha-L-arabinopyranose (–10.0 kcal mol–1 and alpha-L-arabinofuranose (–8.75 kcal mol–1. The results indicated that CtCBM6B has high potential for binding arabinan, xylans and substituted xylans.

  7. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    International Nuclear Information System (INIS)

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  8. Responses of nutrients and mobile carbohydrates in Quercus variabilis seedlings to environmental variations using in situ and ex situ experiments.

    Directory of Open Access Journals (Sweden)

    Jing-Pin Lei

    Full Text Available Forest tree species distributed across a wide range of geographical areas are subjected to differential climatic and edaphic conditions and long-term selection, leading to genotypes with morphological and physiological adaptation to the local environment. To test the ability of species to cope with changing environmental conditions, we studied the ecophysiological features of Quercus variabilis using seedlings grown in geographically widely isolated populations (Exp. I, in situ and in a common garden (Exp. II, ex situ using seedlings originating from those populations. We found that Q. variabilis plants grown in different locations along a south-north gradient had different levels of nutrients (N, P, K and carbon-physiological performance (photosynthesis, non-structural carbohydrates, such as soluble sugars and starch, and that these physiological differences were not correlated with local soil properties. These geographic variations of plant physiology disappeared when plants from different locations were grown in the same environment. Our results indicate that the physiological performance of Q. variabilis plants is mainly determined by the climatic variations across latitude rather than by their soils or by genetic differentiation. The adaptive ability of Q. variabilis found in the present study suggests that this species has the potential to cope, at least to some extent, with changing environmental conditions.

  9. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    NARCIS (Netherlands)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  10. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  11. Carbohydrate-Loading Diet

    Science.gov (United States)

    ... Grape juice (12 ounces) 55 225 Lunch Milk, chocolate, reduced fat (12 ounces) 45 285 4 slices ... usual during carbohydrate loading to get the same benefits as a man does. Despite carbohydrate loading, you ...

  12. Carbohydrate Metabolism Disorders

    Science.gov (United States)

    ... metabolic disorder, something goes wrong with this process. Carbohydrate metabolism disorders are a group of metabolic disorders. Normally your enzymes break carbohydrates down into glucose (a type of sugar). If ...

  13. Proteomic analysis of Arabidopsis thaliana leaves in response to acute boron deficiency and toxicity reveals effects on photosynthesis, carbohydrate metabolism, and protein synthesis.

    Science.gov (United States)

    Chen, Mei; Mishra, Sasmita; Heckathorn, Scott A; Frantz, Jonathan M; Krause, Charles

    2014-02-15

    Boron (B) stress (deficiency and toxicity) is common in plants, but as the functions of this essential micronutrient are incompletely understood, so too are the effects of B stress. To investigate mechanisms underlying B stress, we examined protein profiles in leaves of Arabidopsis thaliana plants grown under normal B (30 μM), compared to plants transferred for 60 and 84 h (i.e., before and after initial visible symptoms) in deficient (0 μM) or toxic (3 mM) levels of B. B-responsive polypeptides were sequenced by mass spectrometry, following 2D gel electrophoresis, and 1D gels and immunoblotting were used to confirm the B-responsiveness of some of these proteins. Fourteen B-responsive proteins were identified, including: 9 chloroplast proteins, 6 proteins of photosynthetic/carbohydrate metabolism (rubisco activase, OEC23, photosystem I reaction center subunit II-1, ATPase δ-subunit, glycolate oxidase, fructose bisphosphate aldolase), 6 stress proteins, and 3 proteins involved in protein synthesis (note that the 14 proteins may fall into multiple categories). Most (8) of the B-responsive proteins decreased under both B deficiency and toxicity; only 3 increased with B stress. Boron stress decreased, or had no effect on, 3 of 4 oxidative stress proteins examined, and did not affect total protein. Hence, our results indicate relatively early specific effects of B stress on chloroplasts and protein synthesis. Copyright © 2013 Elsevier GmbH. All rights reserved.

  14. Design Process for Integrated Concepts with Responsive Building Elements

    DEFF Research Database (Denmark)

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  15. Issues in Nutrition: Carbohydrates.

    Science.gov (United States)

    Thompson, Margaret E; Noel, Mary Barth

    2017-01-01

    Carbohydrates include sugars, starches, and dietary fibers. Resistant starches resemble fiber in their behavior in the intestinal tract, and may have positive effects on blood glucose levels and the gut microbiome. Fibers are classified as soluble and insoluble, but most fiber-containing foods contain a mixture of soluble and insoluble fiber. Soluble fiber has been shown to lower low-density lipoprotein cholesterol levels. Many artificial sweeteners and other sugar substitutes are available. Most natural sources of sweeteners also are energy sources. Many artificial sweeteners contain no kilocalories in the amounts typically used. Sugar alcohols may have a laxative effect when consumed in large amounts. Glycemic index and glycemic load are measurements that help quantify serum glucose response after ingestion of particular foods. These measurements may be affected by the combination of foods consumed in a given meal, and the glycemic index may vary among individuals eating the same meal. Eating foods with a low glycemic index may help prevent development of type 2 diabetes. There is no definitive evidence to recommend low-carbohydrate diets over low-fat diets for long-term weight loss; they are equally effective. Written permission from the American Academy of Family Physicians is required for reproduction of this material in whole or in part in any form or medium.

  16. Concentrations of progesterone and insulin in serum of nonlactating dairy cows in response to carbohydrate source and processing.

    Science.gov (United States)

    Moriel, P; Scatena, T S; Sá Filho, O G; Cooke, R F; Vasconcelos, J L M

    2008-12-01

    Two experiments were conducted to investigate the effects of carbohydrate source and processing on serum progesterone (P4) and insulin concentrations of nonlactating dairy cows. In experiment 1, 12 ovariectomized grazing Gir x Holstein cows were stratified by body weight and body condition score, and randomly assigned to receive a supplement containing either finely ground corn or citrus pulp in a Latin square crossover design. Diets were fed individually, twice daily at a rate of 10.9 kg of dry matter per cow. Cows received a controlled intravaginal P4-releasing insert before the beginning of the study, and inserts were replaced every 7 d. During the first experimental period, cows were adapted to treatments from d 0 to 13 and blood was collected on d 14, whereas during the second experimental period cows were adapted to treatments from d 0 to 6 and blood samples were collected on d 7. In both periods, blood samples were collected immediately before and at 1, 2, 3, 4, 5, and 6 h after the first supplement feeding of the collection day. In experiment 2, the cows utilized in experiment 1 were randomly assigned to receive a supplement based on finely ground corn, coarsely ground corn, or high-moisture corn in a Latin square crossover design. Cows were fed and received the controlled intravaginal P4-releasing insert as in experiment 1. Within each of the 3 experimental periods, cows were adapted to diets from d 0 to 6, and blood samples were collected on d 7 as in experiment 1. Time effects were detected in experiments 1 and 2 because insulin concentrations increased by 1 h (4.6 +/- 0.90 vs. 7.4 +/- 0.91 microIU/mL for 0 and 1 h, respectively) and P4 concentrations decreased by 3 h (1.8 +/- 0.12 vs. 1.2 +/- 0.11 ng/mL for 0 and 3 h, respectively) after supplements were offered. In experiment 2, insulin concentrations were greater in cows fed high-moisture corn compared with those fed coarsely or finely ground corn (8.8 +/- 1.05, 5.7 +/- 1.05, and 6.1 +/- 1.05 micro

  17. Exponential increase in postprandial blood-glucose exposure with increasing carbohydrate loads using a linear carbohydrate-to-insulin ratio.

    Science.gov (United States)

    Marran, K J; Davey, B; Lang, A; Segal, D G

    2013-04-10

    Postprandial glucose excursions contribute significantly to average blood glucose, glycaemic variability and cardiovascular risk. Carbohydrate counting is a method of insulin dosing that balances carbohydrate load to insulin dose using a fixed ratio. Many patients and current insulin pumps calculate insulin delivery for meals based on a linear carbohydrate-to-insulin relationship. It is our hypothesis that a non-linear relationship exists between the amounts of carbohydrate consumed and the insulin required to cover it. To document blood glucose exposure in response to increasing carbohydrate loads on fixed carbohydrate-to-insulin ratios. Five type 1 diabetic subjects receiving insulin pump therapy with good control were recruited. Morning basal rates and carbohydrate- to-insulin ratios were optimised. A Medtronic glucose sensor was used for 5 days to collect data for area-under-the-curve (AUC) analysis, during which standardised meals of increasing carbohydrate loads were consumed. Increasing carbohydrate loads using a fixed carbohydrate-to-insulin ratio resulted in increasing glucose AUC. The relationship was found to be exponential rather than linear. Late postprandial hypoglycaemia followed carbohydrate loads of >60 g and this was often followed by rebound hyperglycaemia that lasted >6 hours. A non-linear relationship exists between carbohydrates consumed and the insulin required to cover them. This has implications for control of postprandial blood sugars, especially when consuming large carbohydrate loads. Further studies are required to look at the optimal ratios, duration and type of insulin boluses required to cover increasing carbohydrate loads.

  18. The sweet side of global change-dynamic responses of non-structural carbohydrates to drought, elevated CO2 and nitrogen fertilization in tree species.

    Science.gov (United States)

    Li, Weibin; Hartmann, Henrik; Adams, Henry D; Zhang, Hongxia; Jin, Changjie; Zhao, Chuanyan; Guan, Dexin; Wang, Anzhi; Yuan, Fenghui; Wu, Jiabing

    2018-06-11

    Non-structural carbohydrates (NSC) play a central role in plant functioning as energy carriers and building blocks for primary and secondary metabolism. Many studies have investigated how environmental and anthropogenic changes, like increasingly frequent and severe drought episodes, elevated CO2 and atmospheric nitrogen (N) deposition, influence NSC concentrations in individual trees. However, this wealth of data has not been analyzed yet to identify general trends using a common statistical framework. A thorough understanding of tree responses to global change is required for making realistic predictions of vegetation dynamics. Here we compiled data from 57 experimental studies on 71 tree species and conducted a meta-analysis to evaluate general responses of stored soluble sugars, starch and total NSC (soluble sugars + starch) concentrations in different tree organs (foliage, above-ground wood and roots) to drought, elevated CO2 and N deposition. We found that drought significantly decreased total NSC in roots (-17.3%), but not in foliage and above-ground woody tissues (bole, branch, stem and/or twig). Elevated CO2 significantly increased total NSC in foliage (+26.2%) and roots (+12.8%), but not in above-ground wood. By contrast, total NSC significantly decreased in roots (-17.9%), increased in above-ground wood (+6.1%), but was unaffected in foliage from N fertilization. In addition, the response of NSC to three global change drivers was strongly affected by tree taxonomic type, leaf habit, tree age and treatment intensity. Our results pave the way for a better understanding of general tree function responses to drought, elevated CO2 and N fertilization. The existing data also reveal that more long-term studies on mature trees that allow testing interactions between these factors are urgently needed to provide a basis for forecasting tree responses to environmental change at the global scale.

  19. Design of responsive materials using topologically interlocked elements

    International Nuclear Information System (INIS)

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  20. Effects of preoperative feeding with a whey protein plus carbohydrate drink on the acute phase response and insulin resistance. A randomized trial

    Directory of Open Access Journals (Sweden)

    Dock-Nascimento Diana B

    2011-06-01

    Full Text Available Abstract Background Prolonged preoperative fasting increases insulin resistance and current evidence recommends carbohydrate (CHO drinks 2 hours before surgery. Our hypothesis is that the addition of whey protein to a CHO-based drink not only reduces the inflammatory response but also diminish insulin resistance. Methods Seventeen patients scheduled to cholecystectomy or inguinal herniorraphy were randomized and given 474 ml and 237 ml of water (CO group or a drink containing CHO and milk whey protein (CHO-P group respectively, 6 and 3 hours before operation. Blood samples were collected before surgery and 24 hours afterwards for biochemical assays. The endpoints of the study were the insulin resistance (IR, the prognostic inflammatory and nutritional index (PINI and the C-reactive protein (CRP/albumin ratio. A 5% level for significance was established. Results There were no anesthetic or postoperative complications. The post-operative IR was lower in the CHO-P group when compared with the CO group (2.75 ± 0.72 vs 5.74 ± 1.16; p = 0.03. There was no difference between the two groups in relation to the PINI. The CHO-P group showed a decrease in the both CRP elevation and CRP/albumin ratio (p Conclusions Shortening the pre-operative fasting using CHO and whey protein is safe and reduces insulin resistance and postoperative acute phase response in elective moderate operations. Trial registration ClinicalTrail.gov NCT01354249

  1. The effect of different protein hydrolysate/carbohydrate mixtures on postprandial glucagon and insulin responses in healthy subjects.

    Science.gov (United States)

    Claessens, M; Calame, W; Siemensma, A D; van Baak, M A; Saris, W H M

    2009-01-01

    To study the effect of four protein hydrolysates from vegetable (pea, gluten, rice and soy) and two protein hydrolysates from animal origin (whey and egg) on glucagon and insulin responses. Eight healthy normal-weight male subjects participated in this study. The study employed a repeated-measures design with Latin square randomization and single-blind trials. Protein hydrolysates used in this study (pea, rice, soy, gluten, whey and egg protein hydrolysate) consisted of 0.2 g hydrolysate per kg body weight (bw) and 0.2 g maltodextrin per kg bw and were compared to maltodextrin alone. Postprandial plasma glucose, glucagon, insulin and amino acids were determined over 2 h. All protein hydrolysates induced an enhanced insulin secretion compared to maltodextrin alone and a correspondingly low plasma glucose response. A significant difference was observed in area under the curve (AUC) for plasma glucagon between protein hydrolysates and the maltodextrin control drink (Pprotein hydrolysate induced the lowest glucagon response. High amino-acid-induced glucagon response does not necessarily go together with low insulin response. Protein hydrolysate source affects AUC for glucagon more profoundly than for insulin, although the protein load used in this study seemed to be at lower level for significant physiological effects.

  2. Leaf non-structural carbohydrate allocation and C:N:P stoichiometry in response to light acclimation in seedlings of two subtropical shade-tolerant tree species.

    Science.gov (United States)

    Xie, Hongtao; Yu, Mukui; Cheng, Xiangrong

    2018-03-01

    Light availability greatly affects plant growth and development. In shaded environments, plants must respond to reduced light intensity to ensure a regular rate of photosynthesis to maintain the dynamic balance of nutrients, such as leaf non-structural carbohydrates (NSCs), carbon (C), nitrogen (N) and phosphorus (P). To improve our understanding of the nutrient utilization strategies of understory shade-tolerant plants, we compared the variations in leaf NSCs, C, N and P in response to heterogeneous controlled light conditions between two subtropical evergreen broadleaf shade-tolerant species, Elaeocarpus sylvestris (E. sylvestris) and Illicium henryi (I. henryi). Light intensity treatments were applied at five levels (100%, 52%, 33%, 15% and 6% full sunlight) for 30 weeks to identify the effects of reduced light intensity on leaf NSC allocation patterns and leaf C:N:P stoichiometry characteristics. We found that leaf soluble sugar, starch and NSC concentrations in E. sylvestris showed decreasing trends with reduced light intensity, whereas I. henryi presented slightly increasing trends from 100% to 15% full sunlight and then significant decreases at extremely low light intensity (6% full sunlight). The soluble sugar/starch ratio of E. sylvestris decreased with decreasing light intensity, whereas that of I. henryi remained stable. Moreover, both species exhibited increasing trends in leaf N and P concentrations but limited leaf N:P and C:P ratio fluctuations with decreasing light intensity, revealing their adaptive strategies for poor light environments and their growth strategies under ideal light environments. There were highly significant correlations between leaf NSC variables and C:N:P stoichiometric variables in both species, revealing a trade-off in photosynthesis production between leaf NSC and carbon allocation. Thus, shade-tolerant plants readjusted their allocation of leaf NSCs, C, N and P in response to light acclimation. Redundancy analysis showed

  3. pH responsive label-assisted click chemistry triggered sensitivity amplification for ultrasensitive electrochemical detection of carbohydrate antigen 24-2.

    Science.gov (United States)

    Zheng, Yun; Zhao, Lihua; Ma, Zhanfang

    2018-05-15

    Sensitivity amplification strategy by implementing click chemistry in the construction of biosensing interface can efficiently improve the performance of immunosensor. Herein, we developed a sandwich-type amperometric immunosensor for ultrasensitive detection of carbohydrate antigen 24-2 (CA 242) based on pH responsive label-assisted click chemistry triggered sensitivity amplification strategy. The sensitivity of amperometric immunosensor relies on the current response differences (ΔI) caused by per unit concentration target analyte. The pH responsive Cu 2+ -loaded polydopamine (CuPDA) particles conjugated with detection antibodies were employed as labels, which can release Cu(II) ions by regulating pH. In the presence of ascorbic acid (reductant), Cu(II) ions were reduced to Cu(I) ions. Azide-functionalized double-stranded DNA (dsDNA) as signal enhancer was immobilized on the substrate through Cu + -catalyzed azide/alkyne cycloaddition reaction. With the help of the click reaction, the ΔI caused by target was elevated prominently, resulting in sensitivity amplification of the immunosensor. Under optimal condition, the proposed immunosensor exhibited excellent performance with linear range from 0.0001 to 100 U mL -1 and ultralow detection limit of 20.74 μU mL -1 . This work successfully combines click chemistry with pH-responsive labels in sandwich-type amperometric immunosensor, providing a promising sensitivity amplification strategy to construct immunosensing platform for analysis of other tumor marker. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Carbohydrates in Supramolecular Chemistry.

    Science.gov (United States)

    Delbianco, Martina; Bharate, Priya; Varela-Aramburu, Silvia; Seeberger, Peter H

    2016-02-24

    Carbohydrates are involved in a variety of biological processes. The ability of sugars to form a large number of hydrogen bonds has made them important components for supramolecular chemistry. We discuss recent advances in the use of carbohydrates in supramolecular chemistry and reveal that carbohydrates are useful building blocks for the stabilization of complex architectures. Systems are presented according to the scaffold that supports the glyco-conjugate: organic macrocycles, dendrimers, nanomaterials, and polymers are considered. Glyco-conjugates can form host-guest complexes, and can self-assemble by using carbohydrate-carbohydrate interactions and other weak interactions such as π-π interactions. Finally, complex supramolecular architectures based on carbohydrate-protein interactions are discussed.

  5. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    DEFF Research Database (Denmark)

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  6. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Science.gov (United States)

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Effects of a low- or a high-carbohydrate diet on performance, energy system contribution, and metabolic responses during supramaximal exercise.

    Science.gov (United States)

    Lima-Silva, Adriano E; Pires, Flavio O; Bertuzzi, Romulo; Silva-Cavalcante, Marcos D; Oliveira, Rodrigo S F; Kiss, Maria Augusta; Bishop, David

    2013-09-01

    The purpose of the present study was to examine the effects of a high- or low-carbohydrate (CHO) diet on performance, aerobic and anaerobic contribution, and metabolic responses during supramaximal exercise. Six physically-active men first performed a cycling exercise bout at 115% maximal oxygen uptake to exhaustion after following their normal diet for 48 h (∼50% of CHO, control test). Seventy-two hours after, participants performed a muscle glycogen depletion exercise protocol, followed by either a high- or low-CHO diet (∼70 and 25% of CHO, respectively) for 48 h, in a random, counterbalanced order. After the assigned diet period (48 h), the supramaximal cycling exercise bout (115% maximal oxygen consumption) to exhaustion was repeated. The low-CHO diet reduced time to exhaustion when compared with both the control and the high-CHO diet (-19 and -32%, respectively, p diet was accompanied by a lower total aerobic energy contribution (-39%) compared with the high-CHO diet (p 0.05). The low-CHO diet was associated with a lower blood lactate concentration (p 0.05). In conclusion, a low-CHO diet reduces both performance and total aerobic energy provision during supramaximal exercise. As peak K(+) concentration was similar, but time to exhaustion shorter, the low-CHO diet was associated with an earlier attainment of peak plasma K(+) concentration.

  8. A putative low-carbohydrate ketogenic diet elicits mild nutritional ketosis but does not impair the acute or chronic hypertrophic responses to resistance exercise in rodents.

    Science.gov (United States)

    Roberts, Michael D; Holland, A Maleah; Kephart, Wesley C; Mobley, C Brooks; Mumford, Petey W; Lowery, Ryan P; Fox, Carlton D; McCloskey, Anna E; Shake, Joshua J; Mesquita, Paulo; Patel, Romil K; Martin, Jeffrey S; Young, Kaelin C; Kavazis, Andreas N; Wilson, Jacob M

    2016-05-15

    We examined whether acute and/or chronic skeletal muscle anabolism is impaired with a low-carbohydrate diet formulated to elicit ketosis (LCKD) vs. a mixed macronutrient Western diet (WD). Male Sprague-Dawley rats (9-10 wk of age, 300-325 g) were provided isoenergetic amounts of a LCKD or a WD for 6 wk. In AIM 1, basal serum and gastrocnemius assessments were performed. In AIM 2, rats were resistance exercised for one bout and were euthanized 90-270 min following exercise for gastrocnemius analyses. In AIM 3, rats voluntarily exercised daily with resistance-loaded running wheels, and hind limb muscles were analyzed for hypertrophy markers at the end of the 6-wk protocol. In AIM 1, basal levels of gastrocnemius phosphorylated (p)-rps6, p-4EBP1, and p-AMPKα were similar between diets, although serum insulin (P ketosis, as the LCKD-fed rats in AIM 2 exhibited ∼1.5-fold greater serum β-hydroxybutyrate levels relative to WD-fed rats (diet effect P = 0.003). This study demonstrates that the tested LCKD in rodents, while only eliciting mild nutritional ketosis, does not impair the acute or chronic skeletal muscle hypertrophic responses to resistance exercise. Copyright © 2016 the American Physiological Society.

  9. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  10. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Directory of Open Access Journals (Sweden)

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  11. Carbohydrate-rich breakfast attenuates glycaemic, insulinaemic and ghrelin response to ad libitum lunch relative to morning fasting in lean adults.

    Science.gov (United States)

    Chowdhury, Enhad A; Richardson, Judith D; Tsintzas, Kostas; Thompson, Dylan; Betts, James A

    2015-07-14

    Breakfast omission is associated with obesity and CVD/diabetes, but the acute effects of extended morning fasting upon subsequent energy intake and metabolic/hormonal responses have received less attention. In a randomised cross-over design, thirty-five lean men (n 14) and women (n 21) extended their overnight fast or ingested a typical carbohydrate-rich breakfast in quantities relative to RMR (i.e. 1963 (sd 238) kJ), before an ad libitum lunch 3 h later. Blood samples were obtained hourly throughout the day until 3 h post-lunch, with subjective appetite measures assessed. Lunch intake was greater following extended fasting (640 (sd 1042) kJ, P1590) kJ, P< 0.001). Systemic concentrations of peptide tyrosine-tyrosine and leptin were greater during the afternoon following breakfast (both P< 0.05) but neither acylated/total ghrelin concentrations were suppressed by the ad libitum lunch in the breakfast trial, remaining greater than the morning fasting trial throughout the afternoon (all P< 0.05). Insulin concentrations were greater during the afternoon in the morning fasting trial (all P< 0.01). There were no differences between trials in subjective appetite during the afternoon. In conclusion, morning fasting caused incomplete energy compensation at an ad libitum lunch. Breakfast increased some anorectic hormones during the afternoon but paradoxically abolished ghrelin suppression by the second meal. Extending morning fasting until lunch altered subsequent metabolic and hormonal responses but without greater appetite during the afternoon. The present study clarifies the impact of acute breakfast omission and adds novel insights into second-meal metabolism.

  12. Carbohydrates and Diabetes (For Parents)

    Science.gov (United States)

    ... Staying Safe Videos for Educators Search English Español Carbohydrates and Diabetes KidsHealth / For Parents / Carbohydrates and Diabetes ... many kids with diabetes take to stay healthy. Carbohydrates and Blood Sugar The two main forms of ...

  13. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Science.gov (United States)

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  14. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    DEFF Research Database (Denmark)

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  15. CARBOHYDRATE-CONTAINING COMPOUNDS WHICH BIND TO CARBOHYDRATE BINDING RECEPTORS

    DEFF Research Database (Denmark)

    1995-01-01

    Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases.......Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases....

  16. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Science.gov (United States)

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  17. Carbohydrates and Depression.

    Science.gov (United States)

    Wurtman, Richard J.; Wurtman, Judith J.

    1989-01-01

    Describes the symptoms, such as appetite change and mood fluctuation, basic mechanisms, and some treatments of Seasonal Affective Disorder (SAD), Carbohydrate-Craving Obesity (CCO) and Premenstrual Syndrome (PMS). Provides several tables and diagrams, and three reading references. (YP)

  18. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    OpenAIRE

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  19. Application of ADINA fluid element for transient response analysis of fluid-structure system

    International Nuclear Information System (INIS)

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  20. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Directory of Open Access Journals (Sweden)

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  1. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Science.gov (United States)

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  2. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Science.gov (United States)

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  3. Carbohydrate Nutrition and Team Sport Performance.

    Science.gov (United States)

    Williams, Clyde; Rollo, Ian

    2015-11-01

    The common pattern of play in 'team sports' is 'stop and go', i.e. where players perform repeated bouts of brief high-intensity exercise punctuated by lower intensity activity. Sprints are generally 2-4 s long and recovery between sprints is of variable length. Energy production during brief sprints is derived from the degradation of intra-muscular phosphocreatine and glycogen (anaerobic metabolism). Prolonged periods of multiple sprints drain muscle glycogen stores, leading to a decrease in power output and a reduction in general work rate during training and competition. The impact of dietary carbohydrate interventions on team sport performance have been typically assessed using intermittent variable-speed shuttle running over a distance of 20 m. This method has evolved to include specific work to rest ratios and skills specific to team sports such as soccer, rugby and basketball. Increasing liver and muscle carbohydrate stores before sports helps delay the onset of fatigue during prolonged intermittent variable-speed running. Carbohydrate intake during exercise, typically ingested as carbohydrate-electrolyte solutions, is also associated with improved performance. The mechanisms responsible are likely to be the availability of carbohydrate as a substrate for central and peripheral functions. Variable-speed running in hot environments is limited by the degree of hyperthermia before muscle glycogen availability becomes a significant contributor to the onset of fatigue. Finally, ingesting carbohydrate immediately after training and competition will rapidly recover liver and muscle glycogen stores.

  4. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Science.gov (United States)

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  5. Plasma glycosylphosphatidylinositol-specific phospholipase D predicts the change in insulin sensitivity in response to a low-fat but not a low-carbohydrate diet in obese women.

    Science.gov (United States)

    Gray, Dona L; O'Brien, Kevin D; D'Alessio, David A; Brehm, Bonnie J; Deeg, Mark A

    2008-04-01

    Although circulating glycosylphosphatidylinositol-specific phospholipase D (GPI-PLD), a minor high-density lipoprotein-associated protein, is elevated in patients with insulin resistance or high triglycerides, no information is available on the effect of weight loss or changes in insulin sensitivity on circulating GPI-PLD levels. The objective of the study was to determine the effect of weight loss and changes in insulin sensitivity on plasma GPI-PLD levels. Forty-two nondiabetic obese women were included in the study, which involved a 3-month dietary intervention randomizing patients to a low-fat or a low-carbohydrate diet. The study's main outcome measures were plasma GPI-PLD levels and insulin sensitivity as estimated by the homeostasis model assessment. The very low carbohydrate diet group lost more weight after 3 months (-7.6 +/- 3.2 vs -4.2 +/- 3.5 kg, P low-fat diet, whereas baseline insulin sensitivity correlated with the change in insulin sensitivity in response to the low-carbohydrate diet. Plasma GPI-PLD may serve as a clinical tool to determine the effect of a low-fat diet on insulin sensitivity.

  6. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  7. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    Energy Technology Data Exchange (ETDEWEB)

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  8. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Science.gov (United States)

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  9. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Science.gov (United States)

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  10. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Science.gov (United States)

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  11. Who is the carbohydrate?

    Directory of Open Access Journals (Sweden)

    Paulo Enrique Cuevas Mestanza

    2017-10-01

    Full Text Available Biochemistry is a complex science that studies biomolecules and their interactions in metabolic pathways in living beings. Due to the large amount of contents against the short period to apply them, only expositive classes are not enough to arouse the interest of students and solve questions. In this perspective, is very important to develop new educational tools to improve the understanding of these contents. “Who is the carbohydrate?” It is a didactic game created to review the structural and functional relationship of carbohydrates. Based on the classic “Guess who?” The objective of the player or group is to first find out the opponent's carbohydrate name.

  12. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  13. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    International Nuclear Information System (INIS)

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  14. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Science.gov (United States)

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  15. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  16. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    International Nuclear Information System (INIS)

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  17. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    International Nuclear Information System (INIS)

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  18. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    International Nuclear Information System (INIS)

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  19. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    OpenAIRE

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  20. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Science.gov (United States)

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    International Nuclear Information System (INIS)

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  2. Carbohydrate intake and obesity

    NARCIS (Netherlands)

    van Dam, R M; Seidell, J C

    2007-01-01

    The prevalence of obesity has increased rapidly worldwide and the importance of considering the role of diet in the prevention and treatment of obesity is widely acknowledged. This paper reviews data on the effects of dietary carbohydrates on body fatness. Does the composition of the diet as related

  3. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    International Nuclear Information System (INIS)

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  4. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Science.gov (United States)

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  5. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Directory of Open Access Journals (Sweden)

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  6. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Directory of Open Access Journals (Sweden)

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  7. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Science.gov (United States)

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  8. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    Directory of Open Access Journals (Sweden)

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  9. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Directory of Open Access Journals (Sweden)

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  10. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  11. Carbohydrates as Fat Replacers.

    Science.gov (United States)

    Peng, Xingyun; Yao, Yuan

    2017-02-28

    The overconsumption of dietary fat contributes to various chronic diseases, which encourages attempts to develop and consume low-fat foods. Simple fat reduction causes quality losses that impede the acceptance of foods. Fat replacers are utilized to minimize the quality deterioration after fat reduction or removal to achieve low-calorie, low-fat claims. In this review, the forms of fats and their functions in contributing to food textural and sensory qualities are discussed in various food systems. The connections between fat reduction and quality loss are described in order to clarify the rationales of fat replacement. Carbohydrate fat replacers usually have low calorie density and provide gelling, thickening, stabilizing, and other texture-modifying properties. In this review, carbohydrates, including starches, maltodextrins, polydextrose, gums, and fibers, are discussed with regard to their interactions with other components in foods as well as their performances as fat replacers in various systems.

  12. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Science.gov (United States)

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  13. Molecular Characterization of the RNA-Binding Protein Quaking-a in Megalobrama amblycephala: Response to High-Carbohydrate Feeding and Glucose/Insulin/Glucagon Treatment

    Directory of Open Access Journals (Sweden)

    Hua-Juan Shi

    2018-04-01

    Full Text Available The RNA-binding protein quaking-a (Qkia was cloned from the liver of blunt snout bream Megalobrama amblycephala through the rapid amplification of cDNA ends method, with its potential role in glucose metabolism investigated. The full-length cDNA of qkia covered 1,718 bp, with an open reading frame of 1,572 bp, which encodes 383 AA. Sequence alignment and phylogenetic analysis revealed a high degree of conservation (97–99% among most fish and other higher vertebrates. The mRNA of qkia was detected in all examined organs/tissues. Then, the plasma glucose levels and tissue qkia expressions were determined in fish intraperitoneally injected with glucose [1.67 g per kg body weight (BW], insulin (0.052 mg/kg BW, and glucagon (0.075 mg/kg BW respectively, as well as in fish fed two dietary carbohydrate levels (31 and 41% for 12 weeks. Glucose administration induced a remarkable increase of plasma glucose with the highest value being recorded at 1 h. Thereafter, it reduced to the basal value. After glucose administration, qkia expressions significantly decreased with the lowest value being recorded at 1 h in liver and muscle and 8 h in brain, respectively. Then they gradually returned to the basal value. The insulin injection induced a significant decrease of plasma glucose with the lowest value being recorded at 1 h, whereas the opposite was true after glucagon load (the highest value was gained at 4 h. Subsequently, glucose levels gradually returned to the basal value. After insulin administration, the qkia expressions significantly decreased with the lowest value being attained at 2 h in brain and muscle and 1 h in liver, respectively. However, glucagon significantly stimulated the expressions of qkia in tissues with the highest value being gained at 6 h. Moreover, high dietary carbohydrate levels remarkably increased plasma glucose levels, but down-regulated the transcriptions of qkia in tissues. These results indicated that the gene of blunt

  14. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    International Nuclear Information System (INIS)

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  15. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  16. Integration of growth factor signals at the c-fos serum response element.

    Science.gov (United States)

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  17. Transcriptomic responses of the liver and adipose tissues to altered carbohydrate-fat ratio in diet: an isoenergetic study in young rats.

    Science.gov (United States)

    Tanaka, Mitsuru; Yasuoka, Akihito; Shimizu, Manae; Saito, Yoshikazu; Kumakura, Kei; Asakura, Tomiko; Nagai, Toshitada

    2017-01-01

    To elucidate the effects of altered dietary carbohydrate and fat balance on liver and adipose tissue transcriptomes, 3-week-old rats were fed three kinds of diets: low-, moderate-, and high-fat diets (L, M, and H) containing a different ratio of carbohydrate-fat (C-F) (65:15, 60:20, and 35:45 in energy percent, respectively). The rats consumed the diets for 9 weeks and were subjected to biochemical and DNA microarray analyses. The rats in the H-group exhibited lower serum triacylglycerol (TG) levels but higher liver TG and cholesterol content than rats in the L-group. The analysis of differentially expressed genes (DEGs) between each group (L vs M, M vs H, and L vs H) in the liver revealed about 35% of L vs H DEGs that were regulated in the same way as M vs H DEGs, and most of the others were L- vs H-specific. Gene ontology analysis of these L vs H DEGs indicated that those related to fatty acid synthesis and circadian rhythm were enriched. Interestingly, about 30% of L vs M DEGs were regulated in a reverse way compared with L vs H and M vs H DEGs. These reversed liver DEGs included M-up/H-down genes ( Sds for gluconeogenesis from amino acids) and M-down/H-up genes ( Gpd2 for gluconeogenesis from glycerol, Agpat9 for TG synthesis, and Acot1 for beta-oxidation). We also analyzed L vs H DEGs in white (WAT) and brown (BAT) adipose tissues and found that both oxidation and synthesis of fatty acids were inhibited in these tissues. These results indicate that the alteration of dietary C-F balance differentially affects the transcriptomes of metabolizing and energy-storing tissues.

  18. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  19. Simple and robust determination of the activity signature of key carbohydrate metabolism enzymes for physiological phenotyping in model and crop plants

    DEFF Research Database (Denmark)

    Jammer, Alexandra; Gasperl, Anna; Luschin-Ebengreuth, Nora

    2015-01-01

    The analysis of physiological parameters is important to understand the link between plant phenotypes and their genetic bases, and therefore is needed as an important element in the analysis of model and crop plants. The activities of enzymes involved in primary carbohydrate metabolism have been...... shown to be strongly associated with growth performance, crop yield, and quality, as well as stress responses. A simple, fast, and cost-effective method to determine activities for 13 key enzymes involved in carbohydrate metabolism has been established, mainly based on coupled spectrophotometric kinetic...

  20. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    DEFF Research Database (Denmark)

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  1. Improvement of dynamic response in an impact absorber by frictional elements

    International Nuclear Information System (INIS)

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  2. Calculation of foundation response to spatially varying ground motion by finite element method

    International Nuclear Information System (INIS)

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  3. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    International Nuclear Information System (INIS)

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  4. A displacement assay for the sensing of carbohydrate using zinc oxide biotracers

    International Nuclear Information System (INIS)

    Yang Chi; Xu Chunxiang; Wang Xuemei; Xiao Zhongdang; Gu Baoxiang

    2012-01-01

    Due to the high isoelectric point of the ZnO quantum dots (QDs), ZnO QDs were employed as biolabels for carbohydrates to construct a biosensor for determination of the carcinoembryonic antigen (CEA), which act as the carbohydrate. The assay was based on the competition between a quantum dots labeled CEA and analyte CEA using concanavalin A (Con A) as the recognition element. The extent of completion was monitored by the square wave stripping voltammetry. The displacement assay results showed that there are two changes model of the current response to the analyte CEA concentration (0–30 ng/mL and 30–80 ng/mL). The most likely reason for this was also discussed in the paper.

  5. Sublethal effects of manganese on the carbohydrate metabolism of ...

    African Journals Online (AJOL)

    Carbohydrate metabolism provides (1) energy,. (2) precursors for synthetic reactions ... as a response to the adrenal corticotrophic hormone (ACTH) from the ... During the exposure experiments, control groups were also set-up. The control fish ...

  6. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Science.gov (United States)

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  7. Finite element modelling of Plantar Fascia response during running on different surface types

    Science.gov (United States)

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  8. Effects of Carbohydrate Consumption Case Study: carbohydrates in Bread

    Directory of Open Access Journals (Sweden)

    Neacsu N.A.

    2014-12-01

    Full Text Available Carbohydrates perform numerous roles in living organisms; they are an important source of energy. The body uses carbohydrates to make glucose which is the fuel that gives it energy and helps keep everything going. However, excess carbohydrate consumption has negative health effects. Bread is a basic product in our nutrition and it also is a product with a high content of carbohydrates. So, it is important to find out more information on bread and on the recommended bread type best for consumption.

  9. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Science.gov (United States)

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  10. Contributions of individual domains to function of the HIV-1 Rev response element.

    Science.gov (United States)

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  11. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Directory of Open Access Journals (Sweden)

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  12. Replacement of glycaemic carbohydrates by inulin-type fructans from chicory (oligofructose, inulin) reduces the postprandial blood glucose and insulin response to foods: report of two double-blind, randomized, controlled trials.

    Science.gov (United States)

    Lightowler, Helen; Thondre, Sangeetha; Holz, Anja; Theis, Stephan

    2018-04-01

    Inulin-type fructans are recognized as prebiotic dietary fibres and classified as non-digestible carbohydrates that do not contribute to glycaemia. The aim of the present studies was to investigate the glycaemic response (GR) and insulinaemic response (IR) to foods in which sucrose was partially replaced by inulin or oligofructose from chicory. In a double-blind, randomized, controlled cross-over design, 40-42 healthy adults consumed a yogurt drink containing oligofructose or fruit jelly containing inulin and the respective full-sugar variants. Capillary blood glucose and insulin were measured in fasted participants and at 15, 30, 45, 60, 90, and 120 min after starting to drink/eat. For each test food, the incremental area under the curve (iAUC) for glucose and insulin was calculated and the GR and IR determined. Consumption of a yogurt drink with oligofructose which was 20% reduced in sugars significantly lowered the glycaemic response compared to the full-sugar reference (iAUC 120min 31.9 and 37.3 mmol/L/min, respectively; p inulin and containing 30% less sugars than the full-sugar variant likewise resulted in a significantly reduced blood glucose response (iAUC 120min 53.7 and 63.7 mmol/L/min, respectively; p inulin-type fructans (p inulin or oligofructose from chicory may be an effective strategy to reduce the postprandial blood glucose response to foods.

  13. Comparison of two consecutive fat-rich and carbohydrate-rich meals on postprandial myeloperoxidase response in women with and without type 2 diabetes mellitus.

    Science.gov (United States)

    Schindhelm, Roger K; Alssema, Marjan; Diamant, Michaela; Teerlink, Tom; Dekker, Jacqueline M; Kok, Astrid; Kostense, Piet J; Nijpels, Giel; Heine, Robert J; Scheffer, Peter G

    2008-02-01

    Patients with type 2 diabetes mellitus (DM2) have an increased risk of cardiovascular disease (CVD). Myeloperoxidase (MPO), expressed in leukocytes and released upon activation, is associated with CVD and endothelial dysfunction. Postprandial leukocyte recruitment and activation with subsequent MPO release may contribute to atherosclerosis and CVD. We hypothesized that MPO may increase in the postprandial state because of postprandial leukocyte recruitment and/or activation, especially in subjects with DM2. One hundred postmenopausal women, aged 50 to 65 years (66 with normal glucose metabolism [NGM] and 34 with DM2), received 2 consecutive fat-rich meals and 2 consecutive carbohydrate-rich meals on separate occasions. Blood samples were taken before (t = 0) and at 2, 4, and 8 hours after breakfast; lunch was given at t = 4. Plasma MPO concentration was measured by sandwich enzyme-linked immunosorbent assay. The number of leukocytes in fasting blood samples was higher in DM2 compared with NGM (6.1 +/- 1.4 and 5.4 +/- 1.2 x 10(9)/L, respectively; P DM2 (51.4 +/- 12.9 and 54.5 +/- 18.4 mug/L, respectively; P = .39). Baseline MPO was positively associated with leukocytes (r = 0.20, P DM2, respectively (both P DM2 (fat-rich meals only). Our findings provide no support to our initial hypothesis that meal-induced release of MPO might be a mechanism that contributes to CVD risk.

  14. The transient response for different types of erodable surface thermocouples using finite element analysis

    Directory of Open Access Journals (Sweden)

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  15. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Science.gov (United States)

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  16. Degradation by radiation of the response of a thermocouple of a fuel element

    International Nuclear Information System (INIS)

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  17. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Directory of Open Access Journals (Sweden)

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  18. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    International Nuclear Information System (INIS)

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  20. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Directory of Open Access Journals (Sweden)

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  1. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Science.gov (United States)

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  2. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Science.gov (United States)

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  3. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    International Nuclear Information System (INIS)

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  4. Impact of Dietary Carbohydrate and Protein Levels on Carbohydrate Metabolism

    Science.gov (United States)

    Lasker, Denise Ann

    2009-01-01

    The goal of this dissertation was to investigate the impact of changing dietary carbohydrate (CARB) intakes within recommended dietary guidelines on metabolic outcomes specifically associated with glycemic regulations and carbohydrate metabolism. This research utilized both human and animal studies to examine changes in metabolism across a wide…

  5. Effects of carbohydrate and branched-chain amino acid beverage ingestion during acute upper body resistance exercise on performance and postexercise hormone response.

    Science.gov (United States)

    Smith, JohnEric W; Krings, Ben M; Shepherd, Brandon D; Waldman, Hunter S; Basham, Steven A; McAllister, Matthew J

    2018-05-01

    The purpose of this investigation was to examine the individual and combined effects of ingesting carbohydrates (CHO) and branched-chain amino acids (BCAA) during high-volume upper body resistance exercise (RE) on markers of catabolism and performance. Thirteen resistance-trained males completed 4 experimental trials with supplementation, ingesting beverages containing CHO, BCAA, CHO+BCAA, or placebo (PLA) in a randomized, double-blind design. The beverages were ingested in 118-mL servings 6 times during an ∼60-min RE session consisting of bench press, bent-over row, incline press, and close-grip row. Each RE was performed with 5 sets of repetitions at 65% 1-repetition maximum until volitional fatigue. Blood samples were collected at baseline, immediately postexercise, and 60 min postexercise to assess glucose and insulin. Cortisol was assessed immediately and at 60 min postexercise. No significant performance benefits were observed for any RE. CHO+BCAA (152.4 ± 71.4 ng/mL) resulted in the lowest cortisol levels, which was lower than BCAA and PLA (193.7 ± 88.5, 182.8 ± 67.5 ng/mL, p BCAA and PLA (3.7 ± 2.0, 3.5 ± 1.8 mU/L, p BCAA (4.3 ± 2.5 mU/L, p = 0.339). There was no treatment effect for glucose, but glucose significantly increased from baseline to immediately postexercise and significantly decreased at 60 min postexercise. Ingesting beverages containing CHO with or without BCAA during upper body resistance exercise may promote a more favorable postexercise less catabolic environment.

  6. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    Science.gov (United States)

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  7. Optical absorption of irradiated carbohydrates

    International Nuclear Information System (INIS)

    Supe, A.A.; Tiliks, Yu.E.

    1994-01-01

    The optical absorption spectra of γ-irradiated carbohydrates (glucose, lactose, sucrose, maltose, and starch) and their aqueous solutions were studied. The comparison of the data obtained with the determination of the concentrations of molecular and radical products of radiolysis allows the absorption bands with maxima at 250 and 310 nm to be assigned to the radicals trapped in the irradiated carbohydrates

  8. Catalytic Conversion of Carbohydrates

    DEFF Research Database (Denmark)

    Osmundsen, Christian Mårup

    a renewable route to aromatics. The conversion of biomass by high temperature processes is a desirable prospect due to the high volumetric production rates which can be achieved, and the ability of these types of processes to convert a wide range of substrates. Current processes however typically have rather...... with the production of commodity chemicals from the most abundantly available renewable source of carbon, carbohydrates. The production of alkyl lactates by the Lewis acid catalyzed conversion of hexoses is an interesting alternative to current fermentation based processes. A range of stannosilicates were...... to be an efficient initial conversion step in the utilization of biomass for chemicals production. The shift from an oil based chemical industry to one based on renewable resources is bound to happen sooner or later, however the environmental problems associated with the burning of fossil resources means...

  9. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Science.gov (United States)

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  10. Myostatin and carbohydrate disturbances.

    Science.gov (United States)

    Assyov, Yavor S; Velikova, Tsvetelina V; Kamenov, Zdravko A

    2017-05-01

    Purpose/aim of the study: Myostatin is a myokine that has been shown to inhibit muscle growth and to have potentially deleterious effects on metabolism. The aim of the current study was to compare its circulating serum levels in subjects from the whole spectrum of carbohydrate disturbances leading to diabetes. A total of 159 age-, sex-, and BMI-matched subjects participated in the study - 50 had normal glucose tolerance (NGT), 60 had prediabetes (PreDM), and 49 had type 2 diabetes mellitus (T2D). Oral glucose tolerance testing was used to determine glucose tolerance. Serum myostatin was quantified by means of ELISA. Circulating serum myostatin levels were highest in patients with T2D, lower in subjects with prediabetes, and lowest in subjects with normoglycemia (all p Myostatin was shown to be positively associated with fasting plasma glucose, HOMA-IR, hepatic enzymes, uric acid, and FINDRISC questionnaire scores in both sexes. ROC analyses determined circulating myostatin levels to be of value for differentiating subjects with T2D (AUC = 0.72, p = 0.002 in men; AUC = 0.70, p = 0.004 in women) in the study population. After adjustment for potential confounders, in a multiple binary logistic regression model, serum myostatin added further information to traditional risk estimates in distinguishing subjects with T2D. Serum myostatin levels are higher with deterioration of carbohydrate tolerance. Furthermore, circulating myostatin is positively associated with traditional biochemical estimates of poor metabolic health. These data add to evidence of the involvement of this myokine in the pathogenesis of T2D.

  11. Synthesis of carbohydrate-based surfactants

    Energy Technology Data Exchange (ETDEWEB)

    Pemberton, Jeanne E.; Polt, Robin L.; Maier, Raina M.

    2016-11-22

    The present invention provides carbohydrate-based surfactants and methods for producing the same. Methods for producing carbohydrate-based surfactants include using a glycosylation promoter to link a carbohydrate or its derivative to a hydrophobic compound.

  12. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Science.gov (United States)

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  13. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Directory of Open Access Journals (Sweden)

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  14. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    International Nuclear Information System (INIS)

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  15. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Science.gov (United States)

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  16. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    International Nuclear Information System (INIS)

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  17. Carbohydrates/nucleosides/RNA-DNA-ligand interactions

    International Nuclear Information System (INIS)

    Kaptein, R.; McConnell, B.; Serianni, A.S.; Silks, L.A. III.

    1994-01-01

    Carbohydrate and nucleotide structural determination using modern spectroscopic techniques is dependent on our ability to label oligonucleotides and oligosaccharides with stable isotopes. Uniform Carbon 13 and Nitrogen 15 labeling of oligonucleotides is important to present-day efforts, which are focused on determining the structure of relatively small oligosaccharides and oligonucleotides, which form the elements of larger structures. Because of the relatively recent interest in three-dimensional structure, the development of techniques used to label them has lagged behind parallel techniques used to label peptides and proteins. Therefore, this group's discussion focused primarily on problems faced today in obtaining oligonucleotides labeled uniformly with carbon 13 and nitrogen 15

  18. Carbohydrates/nucleosides/RNA-DNA-ligand interactions

    Energy Technology Data Exchange (ETDEWEB)

    Kaptein, R.; McConnell, B.; Serianni, A.S.; Silks, L.A. III

    1994-12-01

    Carbohydrate and nucleotide structural determination using modern spectroscopic techniques is dependent on our ability to label oligonucleotides and oligosaccharides with stable isotopes. Uniform Carbon 13 and Nitrogen 15 labeling of oligonucleotides is important to present-day efforts, which are focused on determining the structure of relatively small oligosaccharides and oligonucleotides, which form the elements of larger structures. Because of the relatively recent interest in three-dimensional structure, the development of techniques used to label them has lagged behind parallel techniques used to label peptides and proteins. Therefore, this group`s discussion focused primarily on problems faced today in obtaining oligonucleotides labeled uniformly with carbon 13 and nitrogen 15.

  19. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  20. Assessing Bacterial Interactions Using Carbohydrate-Based Microarrays

    Directory of Open Access Journals (Sweden)

    Andrea Flannery

    2015-12-01

    Full Text Available Carbohydrates play a crucial role in host-microorganism interactions and many host glycoconjugates are receptors or co-receptors for microbial binding. Host glycosylation varies with species and location in the body, and this contributes to species specificity and tropism of commensal and pathogenic bacteria. Additionally, bacterial glycosylation is often the first bacterial molecular species encountered and responded to by the host system. Accordingly, characterising and identifying the exact structures involved in these critical interactions is an important priority in deciphering microbial pathogenesis. Carbohydrate-based microarray platforms have been an underused tool for screening bacterial interactions with specific carbohydrate structures, but they are growing in popularity in recent years. In this review, we discuss carbohydrate-based microarrays that have been profiled with whole bacteria, recombinantly expressed adhesins or serum antibodies. Three main types of carbohydrate-based microarray platform are considered; (i conventional carbohydrate or glycan microarrays; (ii whole mucin microarrays; and (iii microarrays constructed from bacterial polysaccharides or their components. Determining the nature of the interactions between bacteria and host can help clarify the molecular mechanisms of carbohydrate-mediated interactions in microbial pathogenesis, infectious disease and host immune response and may lead to new strategies to boost therapeutic treatments.

  1. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  2. Transcription factor HIF1A: downstream targets, associated pathways, polymorphic hypoxia response element (HRE) sites, and initiative for standardization of reporting in scientific literature.

    Science.gov (United States)

    Slemc, Lucija; Kunej, Tanja

    2016-11-01

    Hypoxia-inducible factor-1α (HIF-1α) has crucial role in adapting cells to hypoxia through expression regulation of many genes. Identification of HIF-1α target genes (HIF-1α-TGs) is important for understanding the adapting mechanism. The aim of the present study was to collect known HIF-1α-TGs and identify their associated pathways. Targets and associated genomics data were retrieved using PubMed, WoS ( http://apps.webofknowledge.com/ ), HGNC ( http://www.genenames.org/ ), NCBI ( http://www.ncbi.nlm.nih.gov/ ), Ensemblv.84 ( http://www.ensembl.org/index.html ), DAVID Bioinformatics Resources ( https://david.ncifcrf.gov /), and Disease Ontology database ( http://disease-ontology.org/ ). From 51 papers, we collected 98 HIF-1α TGs found to be associated with 20 pathways, including metabolism of carbohydrates and pathways in cancer. Reanalysis of genomic coordinates of published HREs (hypoxia response elements) revealed six polymorphisms within HRE sites (HRE-SNPs): ABCG2, ACE, CA9, and CP. Due to large heterogeneity of results presentation in scientific literature, we also propose a first step towards reporting standardization of HIF-1α-target interactions consisting of ten relevant data types. Suggested minimal checklist for reporting will enable faster development of a complete catalog of HIF-1α-TGs, data sharing, bioinformatics analyses, and setting novel more targeted hypotheses. The proposed format for data standardization is not yet complete but presents a baseline for further optimization of the protocol with additional details, for example, regarding the experimental validation.

  3. Carbohydrates and the human gut microbiota.

    Science.gov (United States)

    Chassard, Christophe; Lacroix, Christophe

    2013-07-01

    Due to its scale and its important role in maintaining health, the gut microbiota can be considered as a 'new organ' inside the human body. Many complex carbohydrates are degraded and fermented by the human gut microbiota in the large intestine to both yield basic energy salvage and impact gut health through produced metabolites. This review will focus on the gut microbes and microbial mechanisms responsible for polysaccharides degradation and fermentation in the large intestine. Gut microbes and bacterial metabolites impact the host at many levels, including modulation of inflammation, and glucose and lipid metabolisms. A complex relationship occurs in the intestine between the human gut microbiota, diet and the host. Research on carbohydrates and gut microbiota composition and functionality is fast developing and will open opportunities for prevention and treatment of obesity, diabetes and other related metabolic disorders through manipulation of the gut ecosystem.

  4. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  5. The French national inventory of radioactive waste. Elements of openness and responsibility

    International Nuclear Information System (INIS)

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  6. The key elements for genetic response in Finnish dairy cattle breeding

    Directory of Open Access Journals (Sweden)

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  7. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Science.gov (United States)

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Science.gov (United States)

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  9. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Directory of Open Access Journals (Sweden)

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  10. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Energy Technology Data Exchange (ETDEWEB)

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  11. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Science.gov (United States)

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  12. Methodological challenges in carbohydrate analyses

    Directory of Open Access Journals (Sweden)

    Mary Beth Hall

    2007-07-01

    Full Text Available Carbohydrates can provide up to 80% of the dry matter in animal diets, yet their specific evaluation for research and diet formulation is only now becoming a focus in the animal sciences. Partitioning of dietary carbohydrates for nutritional purposes should reflect differences in digestion and fermentation characteristics and effects on animal performance. Key challenges to designating nutritionally important carbohydrate fractions include classifying the carbohydrates in terms of nutritional characteristics, and selecting analytical methods that describe the desired fraction. The relative lack of information on digestion characteristics of various carbohydrates and their interactions with other fractions in diets means that fractions will not soon be perfectly established. Developing a system of carbohydrate analysis that could be used across animal species could enhance the utility of analyses and amount of data we can obtain on dietary effects of carbohydrates. Based on quantities present in diets and apparent effects on animal performance, some nutritionally important classes of carbohydrates that may be valuable to measure include sugars, starch, fructans, insoluble fiber, and soluble fiber. Essential to selection of methods for these fractions is agreement on precisely what carbohydrates should be included in each. Each of these fractions has analyses that could potentially be used to measure them, but most of the available methods have weaknesses that must be evaluated to see if they are fatal and the assay is unusable, or if the assay still may be made workable. Factors we must consider as we seek to analyze carbohydrates to describe diets: Does the assay accurately measure the desired fraction? Is the assay for research, regulatory, or field use (affects considerations of acceptable costs and throughput? What are acceptable accuracy and variability of measures? Is the assay robust (enhances accuracy of values? For some carbohydrates, we

  13. Molar extinction coefficients of some carbohydrates in aqueous ...

    Indian Academy of Sciences (India)

    of plants and animals, both as structural elements and in the maintenance of functional ... In this paper we report the molar extinction coefficient ε, of carbohydrates ... as the area, which has to be hit by the photons in order to cause interaction.

  14. The inositol-1,2-cyclic phosphate moiety of the cross-reacting determinant, carbohydrate chains, and proteinaceous components are all responsible for the cross-reactivity of trypanosome variant surface glycoproteins.

    Science.gov (United States)

    Escalona, José L; Uzcanga, Graciela L; Carrasquel, Liomary M; Bubis, José

    2018-01-24

    Salivarian trypanosomes evade the host immune system by continually swapping their protective variant surface glycoprotein (VSG) coat. Given that VSGs from various trypanosome stocks exhibited cross-reactivity (Camargo et al., Vet. Parasitol. 207, 17-33, 2015), we analyzed here which components are the antigenic determinants for this cross-reaction. Soluble forms of VSGs were purified from four Venezuelan animal trypanosome isolates: TeAp-N/D1, TeAp-ElFrio01, TeAp-Mantecal01, and TeGu-Terecay323. By using the VSG soluble form from TeAp-N/D1, we found that neither the inositol-1,2-cyclic phosphate moiety of the cross-reacting determinant nor the carbohydrate chains were exclusively responsible for its cross-reactivity. Then, all four purified glycoproteins were digested with papain and the resulting peptides were separated by high-performance liquid chromatography. Dot blot evaluation of the fractions using sera from trypanosome-infected animals yielded peptides that possessed cross-reaction activity, demonstrating for the first time that proteinaceous epitopes are also responsible for the cross-reactivity of trypanosome VSGs.

  15. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  16. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Science.gov (United States)

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  17. Consumption of Low-Calorie Sweetened Beverages Compared to Water Is Associated with Reduced Intake of Carbohydrates and Sugar, with No Adverse Relationships to Glycemic Responses: Results from the 2001–2012 National Health and Nutrition Examination Surveys

    Directory of Open Access Journals (Sweden)

    Marge Leahy

    2017-08-01

    Full Text Available Although the 2015 Dietary Guidelines Advisory Committee concluded that there was moderate evidence that substituting sugar-containing sweeteners with low-calorie sweeteners (LCS reduces calorie intake and weight, dietary recommendations encourage substituting only water for sugar-sweetened beverages during weight management. This cross-sectional study evaluated the relation of water and no- and low-calorie sweetened beverage (LCSB intake with nutrient intakes and prediabetes criteria using data from the National Health and Nutrition Examination Survey (NHANES 2001–2012 in 25,817 adults that were free of diabetes. Although linear trends were observed with both beverages, higher LCSB intake was associated with significantly lower consumption of carbohydrates (−9.1 g/day vs. −1.4 g/day, total sugars (−10.9 g/day vs. −2.2 g/day, and added sugars (−2.0 tsp eq vs. −0.8 tsp eq than those associated with higher water intake. Higher intake of both beverages was significantly associated with lower insulin levels (p < 0.01; however, higher intake of LCSB was also associated with lower hemoglobin A1c (HbA1c and lower homeostatic model assessment of insulin resistance (HOMA-IR (p < 0.01. We observed lower odds ratios for elevated HbA1c (adjusted odds ratio [OR] 0.79, 95% CI 0.64–0.98, HOMA-IR (0.68, 0.53–0.87, and insulin levels (0.63, 0.49–0.80 in LCSB among the higher (2+ servings intake group compared to the lowest (<1 serving intake group. Contrary to conventional wisdom, LCSB consumption was associated with equal, if not better, dietary intake and glycemic response than water consumption. Although observational in nature, these results contribute to the growing body of evidence from human studies suggesting that in addition to water, LCSBs can also be sensible choices for reducing sugars and carbohydrate intake, with no adverse associations to measures of glycemic response.

  18. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Directory of Open Access Journals (Sweden)

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  19. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    DEFF Research Database (Denmark)

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  20. Human glycemic response curves after intake of carbohydrate foods are accurately predicted by combining in vitro gastrointestinal digestion with in silico kinetic modeling

    Directory of Open Access Journals (Sweden)

    Susann Bellmann

    2018-02-01

    Conclusion: Based on the demonstrated accuracy and predictive quality, this in vitro–in silico technology can be used for the testing of food products on their glycemic response under standardized conditions and may stimulate the production of (slow carbs for the prevention of metabolic diseases.

  1. Facultative thermogenesis induced by carbohydrate

    DEFF Research Database (Denmark)

    Astrup, A; Bülow, J; Christensen, N J

    1986-01-01

    In addition to the obligatory thermogenesis due to processing and storage, carbohydrate ingestion is accompanied by a facultative thermogenesis mediated by catecholamines via beta-adrenoceptors. The anatomical origin of facultative thermogenesis has hitherto not been determined. The possible...

  2. Transition metals in carbohydrate chemistry

    DEFF Research Database (Denmark)

    Madsen, Robert

    1997-01-01

    This review describes the application of transition metal mediated reactions in carbohydrate synthesis. The different metal mediated transformations are divided into reaction types and illustrated by various examples on monosaccharide derivatives. Carbon-carbon bond forming reactions are further ...

  3. Racemic carbohydrates - fact or fiction?

    DEFF Research Database (Denmark)

    Senning, Alexander Erich Eugen

    2007-01-01

    Chemical Abstracts Service has developed unsound practices in the naming and handling of simple carbohydrates such as aldopentoses 1, aldohexoses 2, and ketohexoses 3. Typically, the common name glucose is sometimes, inappropriately, interpreted as meaning DL-glucose DL-2d. Thus, a considerable...... number of CA names and registry numbers have been created for non-existing racemic carbohydrates and linked to irrelevant references which, moreover, in many cases cannot be retrieved by the SciFinder Scholar program....

  4. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    NARCIS (Netherlands)

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  5. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    DEFF Research Database (Denmark)

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  6. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Science.gov (United States)

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  7. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Science.gov (United States)

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  8. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    International Nuclear Information System (INIS)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  9. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  10. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Science.gov (United States)

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  11. Complexes of natural carbohydrates with metal cations

    International Nuclear Information System (INIS)

    Alekseev, Yurii E; Garnovskii, Alexander D; Zhdanov, Yu A

    1998-01-01

    Data on the interaction of natural carbohydrates (mono-, oligo-, and poly-saccharides, amino sugars, and natural organic acids of carbohydrate origin) with metal cations are surveyed and described systematically. The structural diversity of carbohydrate metal complexes, caused by some specific features of carbohydrates as ligands, is demonstrated. The influence of complex formation on the chemical properties of carbohydrates is discussed. It is shown that the formation of metal complexes plays an important role in the configurational and conformational analysis of carbohydrates. The practical significance of the coordination interaction in the series of carbohydrate ligands is demonstrated. The bibliography includes 571 references.

  12. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    NARCIS (Netherlands)

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  13. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  14. Type-4 Resistant Starch in Substitution for Available Carbohydrate Reduces Postprandial Glycemic Response and Hunger in Acute, Randomized, Double-Blind, Controlled Study

    Directory of Open Access Journals (Sweden)

    Maria L. Stewart

    2018-01-01

    Full Text Available Resistant starch (RS is a type of dietary fiber that has been acknowledged for multiple physiological benefits. Resistant starch type 4 (RS4 is a subcategory of RS that has been more intensively studied as new types of RS4 emerge in the food supply. The primary aim of this randomized, double-blind, controlled study was to characterize the postprandial glucose response in healthy adults after consuming a high fiber scone containing a novel RS4 or a low fiber control scone without RS4. Secondary aims included assessment of postprandial insulin response, postprandial satiety, and gastrointestinal tolerance. The fiber scone significantly reduced postprandial glucose and insulin incremental areas under the curves (43–45% reduction, 35–40% reduction, respectively and postprandial glucose and insulin maximum concentrations (8–10% and 22% reduction, respectively. The fiber scone significantly reduced hunger and desire to eat during the 180 min following consumption and yielded no gastrointestinal side effects compared with the control scone. The results from this study demonstrate that a ready-to-eat baked-good, such as a scone, can be formulated with RS4 replacing refined wheat flour to yield statistically significant and clinically meaningful reductions in blood glucose and insulin excursions. This is the first study to report increased satiety after short-term RS4 intake, which warrants further investigation in long-term feeding studies.

  15. Carcass glycogen repletion on carbohydrate re-feeding after starvation.

    OpenAIRE

    Cox, D J; Palmer, T N

    1987-01-01

    In mice, the response of carcass glycogen to glucose re-feeding after starvation is biphasic. The initial repletive phase is followed by partial (greater than 50%) glycogen mobilization. This turnover of carcass glycogen in response to carbohydrate re-feeding may play an important role in the provision of C3 precursors for hepatic glycogen synthesis.

  16. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Science.gov (United States)

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  17. An approach to unfold the response of a multi-element system using an artificial neural network

    International Nuclear Information System (INIS)

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  18. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  19. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Science.gov (United States)

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  20. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Science.gov (United States)

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  1. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Science.gov (United States)

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  2. APPROACHING CARBOHYDRATES AND ITS METABOLISM: AN EXPERIENCE FOR EDUCATIONAL GAMES

    Directory of Open Access Journals (Sweden)

    Sandro Henrique Dias Ribeiro

    2016-11-01

    Full Text Available INTRODUCTION: The study of carbohydrates, its metabolism and many other fields of biochemistry are often understood by students as a junction of chemical structures and reactions of difficult compression. However, Biochemistry should no longer be seen as an abstruse field, but a way to know the human body and its components, including molecular, structural and functional aspects. Therefore, some alternatives are being evaluated in order to assist and improve the dissemination of knowledge among them highlights are the educational games. OBJECTIVES: The aim of this work is the production of two educational games able to include the contents of carbohydrates and its metabolism in higher education. MATERIALS AND METHODS: The educational games produced were made from available materials and low cost. The games were tested in courses of Biological Sciences and Biotechnology of the Federal University of Uberlândia and the response of the students towards the activities was analyzed. The application, had the presence of trained students to instruct on the activity and correcting. DISCUSSION AND RESULTS: "What is the Carbohydrate?" and "Mastering the metabolism" are two educational games covering the content of structure and function carbohydrates and basal metabolism, respectively. "What is the Carbohydrate?" consists in unravel amid several options the carbohydrate in the hands of the others players. For this, several questions with two possible answers, “yes” or “not”, are accepted each round, and if the player find difficulty in formulating questions, there are cards tips. “Mastering the metabolism” consists in a combination of cards that simulate pieces of a domino that must be mounted following the metabolic pathway of carbohydrates, and as the game progresses, the main points of regulation of the pathway will be accompanied by surprise questions. The games showed great acceptance by students. CONCLUSION: “What is the Carbohydrate

  3. Radiolysis of carbohydrates and of carbohydrate-containing foodstuffs

    International Nuclear Information System (INIS)

    Diehl, J.F.; Adam, S.; Delincee, H.; Jakubick, V.

    1978-01-01

    Toxicological evaluation of irradiated foodstuffs requires knowledge of radiation-induced chemical changes. A review of the literature reveals much information on the radiation chemistry of pure substances, e.g., dilute solutions of individual carbohydrates. Much less is known about the interactions of food constituents during irradiation. In an effort to remedy this situation, radiation effects on various compounds have been studied in systems of increasing complexity. In one approach, gas chromatography was used to investigate the radiolysis of tehalose in pure solution and in the presence of amino acids or proteins. In another approach, radiation-induced aggregation of proteins and of [ 14 C]tryptophan with proteins was studied in the absence and presence of carbohydrates (trehalose, starch), emulsified sunfower oil, and a mixture of carbohydrates and emulsified sunflower oil

  4. Carbohydrates Through Animation: Preliminary Step

    Directory of Open Access Journals (Sweden)

    J.K. Sugai

    2004-05-01

    Full Text Available Methods of education are changing, so the educational tools must change too. The developmentof the systems of information and communication gave the opportunity to bring new technology tothe learning process. Modern education needs interactive programs that may be available to theacademic community, in order to ease the learning process and sharing of the knowledge. Then,an educational software on Carbohydrates is being developed using concept maps and FLASH-MXanimations program, and approached through six modules. The introduction of Carbohydrates wasmade by the module Carbohydrates on Nature, which shows the animations gures of a teacher andstudents, visiting a farm, identifying the carbohydrates found in vegetables, animals, and microor-ganisms, integrated by links containing short texts to help understanding the structure and functionof carbohydrates. This module was presented, as pilot experiment, to teachers and students, whichdemonstrated satisfaction, and high receptivity, by using animation and interactivitys program asstrategy to biochemistrys education. The present work is part of the project Biochemistry throughanimation, which is having continuity.

  5. Aminooxylated Carbohydrates: Synthesis and Applications.

    Science.gov (United States)

    Pifferi, Carlo; Daskhan, Gour Chand; Fiore, Michele; Shiao, Tze Chieh; Roy, René; Renaudet, Olivier

    2017-08-09

    Among other classes of biomolecules, carbohydrates and glycoconjugates are widely involved in numerous biological functions. In addition to addressing the related synthetic challenges, glycochemists have invested intense efforts in providing access to structures that can be used to study, activate, or inhibit these biological processes. Over the past few decades, aminooxylated carbohydrates have been found to be key building blocks for achieving these goals. This review provides the first in-depth overview covering several aspects related to the syntheses and applications of aminooxylated carbohydrates. After a brief introduction to oxime bonds and their relative stabilities compared to related C═N functions, synthetic aspects of oxime ligation and methodologies for introducing the aminooxy functionality onto both glycofuranosyls and glycopyranosyls are described. The subsequent section focuses on biological applications involving aminooxylated carbohydrates as components for the construcion of diverse architectures. Mimetics of natural structures represent useful tools for better understanding the features that drive carbohydrate-receptor interaction, their biological output and they also represent interesting structures with improved stability and tunable properties. In the next section, multivalent structures such as glycoclusters and glycodendrimers obtained through oxime ligation are described in terms of synthetic design and their biological applications such as immunomodulators. The second-to-last section discusses miscellaneous applications of oxime-based glycoconjugates, such as enantioselective catalysis and glycosylated oligonucleotides, and conclusions and perspectives are provided in the last section.

  6. Intestinal absorption of copper: influence of carbohydrates.

    Science.gov (United States)

    Wapnir, R A; Balkman, C

    1992-02-01

    Macronutrients can modulate the intestinal absorption of trace elements by binding the metal or altering mucosal function. We investigated whether certain simple and complex carbohydrates modify copper (Cu) absorption, using an in vivo perfusion technique in the rat. Corn syrup solids, which contain a mixture of glucose polymers of diverse length, added at either 20 or 50 mosm/kg enhanced Cu absorption from a 31.5 microM (2 mg/liter) Cu solution (128 +/- 11 and 130 +/- 11 pmol/min x cm, respectively, vs 101 +/- 4 pmol/min x cm, P less than 0.05, in the absence of carbohydrate). This was concomitant with a stimulation of net water absorption (1.05 +/- 0.08 and 0.84 +/- 0.08 microliter/min x cm, respectively, vs 0.63 +/- 0.02 microliter/min x cm with no carbohydrate, P less than 0.05). Glucose, fructose, lactose, or sucrose had no influence on Cu absorption, although they altered water exchanges, an effect attributable to a reduction of the outflow component of fluid recirculation. Low concentrations of lactose resulted in a greater accumulation of Cu in the intestinal mucosa (8.75 +/- 0.71 micrograms/g vs 5.77 +/- 0.68 micrograms/g for controls, P less than 0.05). Hence, solutes that moderately stimulate mucosa-to-serosa fluid influx in a progressive manner, such as glucose polymers, may contribute to functionally increase Cu absorption. Conversely, conditions which tend to reduce water inflow or increase water outflow across the small intestinal mucosa, as may occur with high lactose diets or in cases of chronic diarrhea, may have negative effects.

  7. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Energy Technology Data Exchange (ETDEWEB)

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  8. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  9. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    International Nuclear Information System (INIS)

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  10. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    International Nuclear Information System (INIS)

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  11. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Directory of Open Access Journals (Sweden)

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  12. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Science.gov (United States)

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  13. EFSA NDA Panel (EFSA Panel on Dietetic Products, Nutrition and Allergies), 2014. Scientific Opinion on the substantiation of a health claim related to non-digestible carbohydrates and reduction of post-prandial glycaemic responses pursuant to Article 13(5) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    Following an application from Beneo-Orafti SA, Sensus BV and Cosucra-Groupe Warcoing SA, submitted for authorisation of a health claim pursuant to Article 13(5) of Regulation (EC) No 1924/2006 via the Competent Authority of Belgium, the EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA...... not contribute to post-prandial glycaemia. This opinion applies to non-digestible carbohydrates (e.g. non-starch polysaccharides, resistant oligosaccharides and resistant starch) which should replace sugars in foods or beverages in order to obtain the claimed effect. The Panel considers that the food constituent......-prandial glycaemic responses might be a beneficial physiological effect. In weighing the evidence, the Panel took into account that consumption of non-digestible carbohydrates results in reduced post-prandial blood glucose (and insulinaemic) responses compared with the consumption of sugars on a weight...

  14. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Science.gov (United States)

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  15. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Science.gov (United States)

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  16. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    OpenAIRE

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  17. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Czech Academy of Sciences Publication Activity Database

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  18. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Czech Academy of Sciences Publication Activity Database

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  19. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    International Nuclear Information System (INIS)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  20. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    International Nuclear Information System (INIS)

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  1. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Science.gov (United States)

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  2. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Science.gov (United States)

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. NIR calibration of soluble stem carbohydrates for predicting drought tolerance in spring wheat

    Science.gov (United States)

    Soluble stem carbohydrates are a component of drought response in wheat (Triticum aestivum L.) and other grasses. Near-infrared spectroscopy (NIR) can rapidly assay for soluble carbohydrates indirectly, but this requires a statistical model for calibration. The objectives of this study were: (i) to ...

  4. Gastric emptying, glucose metabolism and gut hormones: Evaluation of a common preoperative carbohydrate beverage

    NARCIS (Netherlands)

    Vermeulen, M.A.R.; Richir, M.C.; Garretsen, M.K.; van Schie, A.; Ghatei, M.A.; Holst, J.J.; Heijboer, A.C.; Uitdehaag, B.M.J.; Diamant, M.; Eekhoff, E.M.W.; van Leeuwen, P.A.M.; Ligthart-Melis, G.C.

    2011-01-01

    Objective: To study the gastric-emptying rate and gut hormonal response of two carbohydrate-rich beverages. A specifically designed carbohydrate-rich beverage is currently used to support the surgical patient metabolically. Fruit-based beverages may also promote recovery, due to natural antioxidant

  5. Gastric emptying, glucose metabolism and gut hormones: evaluation of a common preoperative carbohydrate beverage

    NARCIS (Netherlands)

    Vermeulen, Mechteld A. R.; Richir, Milan C.; Garretsen, Martijn K.; van Schie, Annelies; Ghatei, Mohammed A.; Holst, Jens J.; Heijboer, Annemieke C.; Uitdehaag, Bernard M. J.; Diamant, Michaela; Eekhoff, E. Marelise W.; van Leeuwen, Paul A. M.; Ligthart-Melis, Gerdien C.

    2011-01-01

    To study the gastric-emptying rate and gut hormonal response of two carbohydrate-rich beverages. A specifically designed carbohydrate-rich beverage is currently used to support the surgical patient metabolically. Fruit-based beverages may also promote recovery, due to natural antioxidant and

  6. Effects of Carbohydrate Source on Genetic Competence in Streptococcus mutans.

    Science.gov (United States)

    Moye, Zachary D; Son, Minjun; Rosa-Alberty, Ariana E; Zeng, Lin; Ahn, Sang-Joon; Hagen, Stephen J; Burne, Robert A

    2016-08-01

    The capacity to internalize and catabolize carbohydrates is essential for dental caries pathogens to persist and cause disease. The expression of many virulence-related attributes by Streptococcus mutans, an organism strongly associated with human dental caries, is influenced by the peptide signaling pathways that control genetic competence. Here, we demonstrate a relationship between the efficiency of competence signaling and carbohydrate source. A significant increase in the activity of the promoters for comX, comS, and comYA after exposure to competence-stimulating peptide (CSP) was observed in cells growing on fructose, maltose, sucrose, or trehalose as the primary carbohydrate source, compared to cells growing on glucose. However, only cells grown in the presence of trehalose or sucrose displayed a significant increase in transformation frequency. Notably, even low concentrations of these carbohydrates in the presence of excess glucose could enhance the expression of comX, encoding a sigma factor needed for competence, and the effects on competence were dependent on the cognate sugar:phosphotransferase permease for each carbohydrate. Using green fluorescent protein (GFP) reporter fusions, we observed that growth in fructose or trehalose resulted in a greater proportion of the population activating expression of comX and comS, encoding the precursor of comX-inducing peptide (XIP), after addition of CSP, than growth in glucose. Thus, the source of carbohydrate significantly impacts the stochastic behaviors that regulate subpopulation responses to CSP, which can induce competence in S. mutans The signaling pathways that regulate development of genetic competence in Streptococcus mutans are intimately intertwined with the pathogenic potential of the organism, impacting biofilm formation, stress tolerance, and expression of known virulence determinants. Induction of the gene for the master regulator of competence, ComX, by competence-stimulating peptide (CSP

  7. Effects of Carbohydrate Source on Genetic Competence in Streptococcus mutans

    Science.gov (United States)

    Moye, Zachary D.; Son, Minjun; Rosa-Alberty, Ariana E.; Zeng, Lin; Ahn, Sang-Joon

    2016-01-01

    ABSTRACT The capacity to internalize and catabolize carbohydrates is essential for dental caries pathogens to persist and cause disease. The expression of many virulence-related attributes by Streptococcus mutans, an organism strongly associated with human dental caries, is influenced by the peptide signaling pathways that control genetic competence. Here, we demonstrate a relationship between the efficiency of competence signaling and carbohydrate source. A significant increase in the activity of the promoters for comX, comS, and comYA after exposure to competence-stimulating peptide (CSP) was observed in cells growing on fructose, maltose, sucrose, or trehalose as the primary carbohydrate source, compared to cells growing on glucose. However, only cells grown in the presence of trehalose or sucrose displayed a significant increase in transformation frequency. Notably, even low concentrations of these carbohydrates in the presence of excess glucose could enhance the expression of comX, encoding a sigma factor needed for competence, and the effects on competence were dependent on the cognate sugar:phosphotransferase permease for each carbohydrate. Using green fluorescent protein (GFP) reporter fusions, we observed that growth in fructose or trehalose resulted in a greater proportion of the population activating expression of comX and comS, encoding the precursor of comX-inducing peptide (XIP), after addition of CSP, than growth in glucose. Thus, the source of carbohydrate significantly impacts the stochastic behaviors that regulate subpopulation responses to CSP, which can induce competence in S. mutans. IMPORTANCE The signaling pathways that regulate development of genetic competence in Streptococcus mutans are intimately intertwined with the pathogenic potential of the organism, impacting biofilm formation, stress tolerance, and expression of known virulence determinants. Induction of the gene for the master regulator of competence, ComX, by competence

  8. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Directory of Open Access Journals (Sweden)

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  9. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Science.gov (United States)

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  10. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Science.gov (United States)

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  11. Carbohydrates of human immunodeficiency virus

    DEFF Research Database (Denmark)

    Hansen, J E

    1992-01-01

    Elucidation of the mechanism by which viral infection induces the appearance of carbohydrate neoantigens is highly important. Results from such studies could be expected to be significant for a general understanding of the regulation of glycosylation, and perhaps especially important for the unde...

  12. Carbohydrates, Sugar, and Your Child

    Science.gov (United States)

    ... carbs are: simple carbohydrates (or simple sugars): including fructose, glucose, and lactose, which also are found in nutritious ... sugar, check the ingredients list for sugar, corn syrup, or other sweeteners, such as dextrose, fructose, honey, or molasses, to name just a few. ...

  13. Modeling and assessment of the response of super-light elements to fire

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  14. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    DEFF Research Database (Denmark)

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  15. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    OpenAIRE

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  16. Qualitative Carbohydrate Analysis using Alkaline Potassium ...

    Indian Academy of Sciences (India)

    IAS Admin

    CLASSROOM. 285. RESONANCE | March 2016. Qualitative Carbohydrate Analysis using Alkaline. Potassium Ferricyanide. Keywords. Alkaline potassium ferricyanide, qualitative ... Carbohydrates form a distinct class of organic compounds often .... Laboratory Techniques: A contemporary Approach, W B Saunders Com-.

  17. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Science.gov (United States)

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  18. Non-structural carbohydrates in woody plants compared among laboratories

    NARCIS (Netherlands)

    Quentin, Audrey G.; Pinkard, Elizabeth A.; Ryan, Michael G.; Tissue, David T.; Baggett, Scott L.; Adams, Henry D.; Maillard, Pascale; Marchand, Jacqueline; Landhäusser, Simon M.; Lacointe, André; Gibon, Yves; Anderegg, William R.L.; Asao, Shinichi; Atkin, Owen K.; Bonhomme, Marc; Claye, Caroline; Chow, Pak S.; Clément-Vidal, Anne; Davies, Noel W.; Dickman, Turin L.; Dumbur, Rita; Ellsworth, David S.; Falk, Kristen; Galiano, Lucía; Grünzweig, José M.; Hartmann, Henrik; Hoch, Günter; Hood, Sharon; Jones, Joanna E.; Koike, Takayoshi; Kuhlmann, Iris; Lloret, Francisco; Maestro, Melchor; Mansfield, Shawn D.; Martínez-Vilalta, Jordi; Maucourt, Mickael; McDowell, Nathan G.; Moing, Annick; Muller, Bertrand; Nebauer, Sergio G.; Niinemets, Ülo; Palacio, Sara; Piper, Frida; Raveh, Eran; Richter, Andreas; Rolland, Gaëlle; Rosas, Teresa; Joanis, Brigitte Saint; Sala, Anna; Smith, Renee A.; Sterck, Frank; Stinziano, Joseph R.; Tobias, Mari; Unda, Faride; Watanabe, Makoto; Way, Danielle A.; Weerasinghe, Lasantha K.; Wild, Birgit; Wiley, Erin; Woodruff, David R.

    2015-01-01

    Non-structural carbohydrates (NSC) in plant tissue are frequently quantified to make inferences about plant responses to environmental conditions. Laboratories publishing estimates of NSC of woody plants use many different methods to evaluate NSC. We asked whether NSC estimates in the recent

  19. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Science.gov (United States)

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  20. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Directory of Open Access Journals (Sweden)

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  1. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Science.gov (United States)

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Carbohydrate Microarray on Glass: a Tool for Carbohydrate-Lectin Interactions

    NARCIS (Netherlands)

    Tetala, K.K.R.; Giesbers, M.; Visser, G.M.; Sudhölter, E.J.R.; Beek, van T.A.

    2007-01-01

    A simple method to immobilize carbohydrates on a glass surface to obtain a carbohydrate microarray is described. The array was used to study carbohydrate-lectin interactions. The glass surface was modified with aldehyde terminated linker groups of various chain lengths. Coupling of carbohydrates

  3. Action of ionizing radiation on the carbohydrate metabolism enzymes

    International Nuclear Information System (INIS)

    Cherkasova, L.S.; Mironova, T.M.

    1976-01-01

    It follows from data reported in literature and those obtained in our laboratory that ionizing radiation does not drastically change the activity of enzymes of the carbohydrate metabolism in tissues of an animal organism. The data are reported on the effect of a whole-body single, fractionated or continuous irradiation of the enzymes of carbohydrate metabolism and the accompanying interrelated co-operative redistributions within the processes of aerobic and anaerobic glycolysis, and the pentose route of their conversion. The dependence of the postirradiation changes in the activity of enzymes on the neuroendocrine system response to irradiation has been demonstrated

  4. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Science.gov (United States)

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  5. Impact of Carbohydrate Restriction on Healthy Adolescent Development.

    Science.gov (United States)

    Richmond, Hannah M; Duriancik, David M

    2017-09-01

    Carbohydrate-restricted diets are known for their impact on weight loss; however, research is still required to determine if low-carbohydrate diets are safe for adolescents. Carbohydrates directly stimulate an insulin response, and studies have recently shown that insulin and binding to respective insulin receptors (IRs) are critical in Kisspeptin (Kiss1) neuronal development. These neurons directly stimulate gonadotropin-releasing hormone, which activates the pituitary-gonadal axis during puberty. This information suggests that carbohydrate restriction may delay pubertal development in adolescents due to the impact on insulin and Kiss1 transcription. Studies have observed disturbed insulin metabolism in Type I Diabetics leading to delayed puberty, along with overfeeding stimulating early pubertal onset. Additionally, recent clinical trials bred female mice with IR deletions on Kiss1 neurons and observed delayed vaginal opening and estrus. Current animal research suggests low carbohydrate intake may delay pubertal onset, however additional research is required to determine outcome in human subjects. Copyright© of YS Medical Media ltd.

  6. Very low-carbohydrate versus isocaloric high-carbohydrate diet in dietary obese rats.

    Science.gov (United States)

    Axen, Kathleen V; Axen, Kenneth

    2006-08-01

    The effects of a very low-carbohydrate (VLC), high-fat (HF) dietary regimen on metabolic syndrome were compared with those of an isocaloric high-carbohydrate (HC), low-fat (LF) regimen in dietary obese rats. Male Sprague-Dawley rats, made obese by 8 weeks ad libitum consumption of an HF diet, developed features of the metabolic syndrome vs. lean control (C) rats, including greater visceral, subcutaneous, and hepatic fat masses, elevated plasma cholesterol levels, impaired glucose tolerance, and fasting and post-load insulin resistance. Half of the obese rats (VLC) were then fed a popular VLC-HF diet (Weeks 9 and 10 at 5% and Weeks 11 to 14 at 15% carbohydrate), and one-half (HC) were pair-fed an HC-LF diet (Weeks 9 to 14 at 60% carbohydrate). Energy intakes of pair-fed VLC and HC rats were less than C rats throughout Weeks 9 to 14. Compared with HC rats, VLC rats exhibited impaired insulin and glycemic responses to an intraperitoneal glucose load at Week 10 and lower plasma triacylglycerol levels but retarded loss of hepatic, retroperitoneal, and total body fat at Week 14. VLC, HC, and C rats no longer differed in body weight, plasma cholesterol, glucose tolerance, or fasting insulin resistance at Week 14. Progressive decreases in fasting insulin resistance in obese groups paralleled concomitant reductions in hepatic, retroperitoneal, and total body fat. When energy intake was matched, the VLC-HF diet provided no advantage in weight loss or in improving those components of the metabolic syndrome induced by dietary obesity and may delay loss of hepatic and visceral fat as compared with an HC-LF diet.

  7. Carbohydrate metabolism during long-term growth hormone (GH) treatment and after discontinuation of GH treatment in girls with Turner syndrome participating in a randomized dose-response study. Dutch Advisory Group on Growth Hormone

    NARCIS (Netherlands)

    T.C.J. Sas (Theo); S.M.P.F. de Muinck Keizer-Schrama (Sabine); Th. Stijnen (Theo); H-J. Aanstoot (Henk-Jan); S.L.S. Drop (Stenvert)

    2000-01-01

    textabstractTo assess possible side-effects of GH treatment with supraphysiological doses on carbohydrate (CH) metabolism in girls with Turner syndrome (TS) during long term GH treatment and after discontinuation of GH treatment, the results of oral glucose tolerance

  8. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Science.gov (United States)

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  9. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  10. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    DEFF Research Database (Denmark)

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  11. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Directory of Open Access Journals (Sweden)

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  12. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Science.gov (United States)

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  13. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Science.gov (United States)

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  14. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  15. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Science.gov (United States)

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  16. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Energy Technology Data Exchange (ETDEWEB)

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  17. CARBOHYDRATE INTAKE CONSIDERATIONS FOR YOUNG ATHLETES

    Directory of Open Access Journals (Sweden)

    Veronica Montfort-Steiger

    2007-09-01

    Full Text Available Good nutritional practices are important for exercise performance and health during all ages. Athletes and especially growing children engaged in heavy training have higher energy and nutrient requirements compared to their non-active counterparts. Scientific understanding of sports nutrition for the young athlete is lacking behind the growing number of young athletes engaged in sports. Most of the sports nutrition recommendations given to athletic children and adolescents are based on adult findings due to the deficiency in age specific information in young athletes. Therefore, this review reflects on child specific sports nutrition, particularly on carbohydrate intake and metabolism that distinguishes the child athlete from the adult athlete. Children are characterised to be in an insulin resistance stage during certain periods of maturation, have different glycolytic/metabolic responses during exercise, have a tendency for higher fat oxidation during exercise and show different heat dissipation mechanisms compared to adults. These features point out that young athletes may need different nutritional advice on carbohydrate for exercise to those from adult athletes. Sport drinks for example may need to be adapted to children specific needs. However, more research in this area is warranted to clarify sports nutrition needs of the young athlete to provide better and healthy nutritional guidance to young athletes

  18. Impact of Dietary Polyphenols on Carbohydrate Metabolism

    Directory of Open Access Journals (Sweden)

    Kati Hanhineva

    2010-03-01

    Full Text Available Polyphenols, including flavonoids, phenolic acids, proanthocyanidins and resveratrol, are a large and heterogeneous group of phytochemicals in plant-based foods, such as tea, coffee, wine, cocoa, cereal grains, soy, fruits and berries. Growing evidence indicates that various dietary polyphenols may influence carbohydrate metabolism at many levels. In animal models and a limited number of human studies carried out so far, polyphenols and foods or beverages rich in polyphenols have attenuated postprandial glycemic responses and fasting hyperglycemia, and improved acute insulin secretion and insulin sensitivity. The possible mechanisms include inhibition of carbohydrate digestion and glucose absorption in the intestine, stimulation of insulin secretion from the pancreatic b-cells, modulation of glucose release from the liver, activation of insulin receptors and glucose uptake in the insulin-sensitive tissues, and modulation of intracellular signalling pathways and gene expression. The positive effects of polyphenols on glucose homeostasis observed in a large number of in vitro and animal models are supported by epidemiological evidence on polyphenol-rich diets. To confirm the implications of polyphenol consumption for prevention of insulin resistance, metabolic syndrome and eventually type 2 diabetes, human trials with well-defined diets, controlled study designs and clinically relevant end-points together with holistic approaches e.g., systems biology profiling technologies are needed.

  19. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    Directory of Open Access Journals (Sweden)

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  20. Carbohydrate Microarrays in Plant Science

    DEFF Research Database (Denmark)

    Fangel, Jonatan Ulrik; Pedersen, H.L.; Vidal-Melgosa, S.

    2012-01-01

    Almost all plant cells are surrounded by glycan-rich cell walls, which form much of the plant body and collectively are the largest source of biomass on earth. Plants use polysaccharides for support, defense, signaling, cell adhesion, and as energy storage, and many plant glycans are also important...... industrially and nutritionally. Understanding the biological roles of plant glycans and the effective exploitation of their useful properties requires a detailed understanding of their structures, occurrence, and molecular interactions. Microarray technology has revolutionized the massively high...... for plant research and can be used to map glycan populations across large numbers of samples to screen antibodies, carbohydrate binding proteins, and carbohydrate binding modules and to investigate enzyme activities....

  1. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Directory of Open Access Journals (Sweden)

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  2. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Science.gov (United States)

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  3. Assisting the development of innovative responsive façade elements using building performance simulation

    NARCIS (Netherlands)

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  4. The effect of tibia element on the tibia response due to impact loading

    CSIR Research Space (South Africa)

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  5. Dietary carbohydrates and triacylglycerol metabolism.

    Science.gov (United States)

    Roche, H M

    1999-02-01

    There is a growing body of scientific evidence which demonstrates that plasma triacylglycerol (TAG) concentration, especially in the postprandial state, is an important risk factor in relation to the development of CHD. Postprandial hypertriacylglycerolaemia is associated with a number of adverse metabolic risk factors, including the preponderance of small dense LDL, low HDL-cholesterol concentrations and elevated factor VII activity. Traditionally, a low-fat high-carbohydrate diet was used to prevent CHD because it effectively reduces plasma cholesterol concentrations, but this dietary regimen increases plasma TAG concentrations and reduces HDL-cholesterol concentrations. There is substantial epidemiological evidence which demonstrates that high plasma TAG and low plasma HDL concentrations are associated with an increased risk of CHD. Thus, there is reason for concern that the adverse effects of low-fat high-carbohydrate diets on TAG and HDL may counteract or negate the beneficial effect of reducing LDL-cholesterol concentrations. Although there have been no prospective studies to investigate whether reduced fat intake has an adverse effect on CHD, there is strong epidemiological evidence that reducing total fat intake is not protective against CHD. On the other hand, high-fat diets predispose to obesity, and central obesity adversely affects TAG metabolism. There is substantial evidence that in free-living situations low-fat high-carbohydrate diets lead to weight loss, which in turn will correct insulin resistance and plasma TAG metabolism. Clearly there is a need for prospective studies to resolve the issue as to whether low-fat high-carbohydrate diets play an adverse or beneficial role in relation to the development of CHD.

  6. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Science.gov (United States)

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  7. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    International Nuclear Information System (INIS)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  8. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Directory of Open Access Journals (Sweden)

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  9. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Directory of Open Access Journals (Sweden)

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  10. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Science.gov (United States)

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  11. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Directory of Open Access Journals (Sweden)

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  12. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Directory of Open Access Journals (Sweden)

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  13. A systematic study of chemogenomics of carbohydrates.

    Science.gov (United States)

    Gu, Jiangyong; Luo, Fang; Chen, Lirong; Yuan, Gu; Xu, Xiaojie

    2014-03-04

    Chemogenomics focuses on the interactions between biologically active molecules and protein targets for drug discovery. Carbohydrates are the most abundant compounds in natural products. Compared with other drugs, the carbohydrate drugs show weaker side effects. Searching for multi-target carbohydrate drugs can be regarded as a solution to improve therapeutic efficacy and safety. In this work, we collected 60 344 carbohydrates from the Universal Natural Products Database (UNPD) and explored the chemical space of carbohydrates by principal component analysis. We found that there is a large quantity of potential lead compounds among carbohydrates. Then we explored the potential of carbohydrates in drug discovery by using a network-based multi-target computational approach. All carbohydrates were docked to 2389 target proteins. The most potential carbohydrates for drug discovery and their indications were predicted based on a docking score-weighted prediction model. We also explored the interactions between carbohydrates and target proteins to find the pathological networks, potential drug candidates and new indications.

  14. Cats and Carbohydrates: The Carnivore Fantasy?

    Directory of Open Access Journals (Sweden)

    Adronie Verbrugghe

    2017-11-01

    Full Text Available The domestic cat’s wild ancestors are obligate carnivores that consume prey containing only minimal amounts of carbohydrates. Evolutionary events adapted the cat’s metabolism and physiology to this diet strictly composed of animal tissues and led to unique digestive and metabolic peculiarities of carbohydrate metabolism. The domestic cat still closely resembles its wild ancestor. Although the carnivore connection of domestic cats is well recognised, little is known about the precise nutrient profile to which the digestive physiology and metabolism of the cat have adapted throughout evolution. Moreover, studies show that domestic cats balance macronutrient intake by selecting low-carbohydrate foods. The fact that cats evolved consuming low-carbohydrate prey has led to speculations that high-carbohydrate diets could be detrimental for a cat’s health. More specifically, it has been suggested that excess carbohydrates could lead to feline obesity and diabetes mellitus. Additionally, the chances for remission of diabetes mellitus are higher in cats that consume a low-carbohydrate diet. This literature review will summarise current carbohydrate knowledge pertaining to digestion, absorption and metabolism of carbohydrates, food selection and macronutrient balancing in healthy, obese and diabetic cats, as well as the role of carbohydrates in prevention and treatment of obesity and diabetes mellitus.

  15. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Science.gov (United States)

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  16. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Science.gov (United States)

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  17. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  18. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Science.gov (United States)

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  19. Carbohydrates

    Science.gov (United States)

    ... such as kidney beans, black beans, pinto beans, black-eyed peas, split peas, and garbanzo beans Starchy vegetables, such as potatoes, corn, green peas, and parsnips Whole grains, such as brown rice, oats, barley, and quinoa Refined grains, such as ...

  20. Carbohydrates

    Science.gov (United States)

    ... of the great nutrients. That's why your best bet is whole grain. Enriched products means some of ... Molasses Syrup and malt syrup If you are thinking about using a sugar substitute, you may wonder ...

  1. Characterization of the carbohydrate components of Taenia solium oncosphere proteins and their role in the antigenicity.

    Science.gov (United States)

    Arana, Yanina; Verastegui, Manuela; Tuero, Iskra; Grandjean, Louis; Garcia, Hector H; Gilman, Robert H

    2013-10-01

    This study examines the carbohydrate composition of Taenia solium whole oncosphere antigens (WOAs), in order to improve the understanding of the antigenicity of the T. solium. Better knowledge of oncosphere antigens is crucial to accurately diagnose previous exposure to T. solium eggs and thus predict the development of neurocysticercosis. A set of seven lectins conjugates with wide carbohydrate specificity were used on parasite fixations and somatic extracts. Lectin fluorescence revealed that D-mannose, D-glucose, D-galactose and N-acetyl-D-galactosamine residues were the most abundant constituents of carbohydrate chains on the surface of T. solium oncosphere. Lectin blotting showed that posttranslational modification with N-glycosylation was abundant while little evidence of O-linked carbohydrates was observed. Chemical oxidation and enzymatic deglycosylation in situ were performed to investigate the immunoreactivity of the carbohydrate moieties. Linearizing or removing the carbohydrate moieties from the protein backbones did not diminish the immunoreactivity of these antigens, suggesting that a substantial part of the host immune response against T. solium oncosphere is directed against the peptide epitopes on the parasite antigens. Finally, using carbohydrate probes, we demonstrated for the first time that the presence of several lectins on the surface of the oncosphere was specific to carbohydrates found in intestinal mucus, suggesting a possible role in initial attachment of the parasite to host cells.

  2. Low-carbohydrate diet induces metabolic depression: a possible mechanism to conserve glycogen.

    Science.gov (United States)

    Winwood-Smith, Hugh S; Franklin, Craig E; White, Craig R

    2017-10-01

    Long-term studies have found that low-carbohydrate diets are more effective for weight loss than calorie-restricted diets in the short term but equally or only marginally more effective in the long term. Low-carbohydrate diets have been linked to reduced glycogen stores and increased feelings of fatigue. We propose that reduced physical activity in response to lowered glycogen explains the diminishing weight loss advantage of low-carbohydrate compared with low-calorie diets over longer time periods. We explored this possibility by feeding adult Drosophila melanogaster a standard or a low-carbohydrate diet for 9 days and measured changes in metabolic rate, glycogen stores, activity, and body mass. We hypothesized that a low-carbohydrate diet would cause a reduction in glycogen stores, which recover over time, a reduction in physical activity, and an increase in resting metabolic rate. The low-carbohydrate diet reduced glycogen stores, which recovered over time. Activity was unaffected by diet, but metabolic rate was reduced, in the low-carbohydrate group. We conclude that metabolic depression could explain the decreased effectiveness of low-carbohydrate diets over time and recommend further investigation of long-term metabolic effects of dietary interventions and a greater focus on physiological plasticity within the study of human nutrition. Copyright © 2017 the American Physiological Society.

  3. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  4. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    International Nuclear Information System (INIS)

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  5. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  6. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    International Nuclear Information System (INIS)

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  7. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  8. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    International Nuclear Information System (INIS)

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  9. The effects of carbohydrate variation in isocaloric diets on glycogenolysis and gluconeogenesis in healthy men

    NARCIS (Netherlands)

    Bisschop, P. H.; Pereira Arias, A. M.; Ackermans, M. T.; Endert, E.; Pijl, H.; Kuipers, F.; Meijer, A. J.; Sauerwein, H. P.; Romijn, J. A.

    2000-01-01

    To evaluate the effect of dietary carbohydrate content on postabsorptive glucose metabolism, we quantified gluconeogenesis and glycogenolysis after 11 days of high carbohydrate (85% carbohydrate), control (44% carbohydrate), and very low carbohydrate (2% carbohydrate) diets in six healthy men. Diets

  10. The effects of carbohydrate variation in isocaloric diets on glycogenolysis and gluconeogenesis in healthy men

    NARCIS (Netherlands)

    Bisschop, PH; Arias, AMP; Ackermans, MT; Endert, E; Pijl, H; Kuipers, F; Meijer, AJ; Sauerwein, HP; Romijn, JA

    To evaluate the effect of dietary carbohydrate content on postabsorptive glucose metabolism, we quantified gluconeogenesis and glycogenolysis after 11 days of high carbohydrate (85% carbohydrate), control (44% carbohydrate), and very low carbohydrate (2% carbohydrate) diets in six healthy men. Diets

  11. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Science.gov (United States)

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  12. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Energy Technology Data Exchange (ETDEWEB)

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  13. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Directory of Open Access Journals (Sweden)

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  14. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Science.gov (United States)

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  15. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Science.gov (United States)

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  16. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Science.gov (United States)

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  17. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    DEFF Research Database (Denmark)

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  18. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    International Nuclear Information System (INIS)

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  19. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Science.gov (United States)

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  20. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Science.gov (United States)

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  1. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  2. Carbohydrate availability of arroz caldo with lambda-carrageenan.

    Science.gov (United States)

    Dumelod, B D; Ramirez, R P; Tiangson, C L; Barrios, E B; Panlasigui, L N

    1999-07-01

    Total available carbohydrate (sugars and starches) and total dietary fiber (soluble and insoluble) make up the total carbohydrate content of a food. Soluble fiber decreases the availability of glucose by delaying its absorption in the proximal small intestine, thus reducing the postprandial glucose levels (Jenkins et al., 1978; Schneeman, 1987a). Carrageenan, a seaweed extract, is a good source of soluble fiber (Montaño et al., 1985). This study aimed to determine the effect of carrageenan incorporation into arroz caldo on carbohydrate availability by monitoring the postprandial blood glucose levels of normal subjects. Control and experimental arroz caldo samples were prepared and subjected to proximate analysis and feeding studies. The total dietary fiber (TDF) content of the experimental (2.03%) was about thrice that of the control (0.68%). Using randomized crossover design, preweighed 55 g available carbohydrate serving portions of control and experimental arroz caldo samples, with 3.45 and 14.84 g TDF, respectively, were fed to ten fasting normal subjects then their postprandial blood glucose levels were determined at 15, 30, 45, 60 and 90 min intervals. Results of the short-term in vivo study showed that the mean postprandial glycaemic responses of subjects after consuming the experimental sample were significantly lower than the levels after consuming the control at 15, 45, and 90 min (P arroz caldo than control (147.29 +/- 53.34). The hypoglycaemic effect of carrageenan may prove useful in the prevention and management of metabolic conditions such as diabetes.

  3. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  4. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Directory of Open Access Journals (Sweden)

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  5. Vaccines based on the cell surface carbohydrates of pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Jones Christopher

    2005-01-01

    Full Text Available Glycoconjugate vaccines, in which a cell surface carbohydrate from a micro-organism is covalently attached to an appropriate carrier protein are proving to be the most effective means to generate protective immune responses to prevent a wide range of diseases. The technology appears to be generic and applicable to a wide range of pathogens, as long as antibodies against surface carbohydrates help protect against infection. Three such vaccines, against Haemophilus influenzae type b, Neisseria meningitidis Group C and seven serotypes of Streptococcus pneumoniae, have already been licensed and many others are in development. This article discusses the rationale for the development and use of glycoconjugate vaccines, the mechanisms by which they elicit T cell-dependent immune responses and the implications of this for vaccine development, the role of physicochemical methods in the characterisation and quality control of these vaccines, and the novel products which are under development.

  6. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  7. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Science.gov (United States)

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  8. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Directory of Open Access Journals (Sweden)

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  9. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Directory of Open Access Journals (Sweden)

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  10. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    International Nuclear Information System (INIS)

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  11. Wood adhesives containing proteins and carbohydrates

    Science.gov (United States)

    In recent years there has been resurgent interest in using biopolymers as sustainable and environmentally friendly ingredients in wood adhesive formulations. Among them, proteins and carbohydrates are the most commonly used. In this chapter, an overview is given of protein-based and carbohydrate-...

  12. Conversion of carbohydrates to levulinic acid esters

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to the field of converting carbohydrates into levulinic acid, a platform chemical for many chemical end products. More specifically the invention relates to a method for converting carbohydrates such as mono-, di- or polysaccharides, obtained from for example biomass...

  13. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  14. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    International Nuclear Information System (INIS)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results

  15. Carbohydrate epitopes on Haemonchus contortus antigens

    NARCIS (Netherlands)

    Schallig, H. D.; van Leeuwen, M. A.

    1996-01-01

    Extracts of infective larvae and adults of the trichostrongylid Haemonchus contortus were studied for the presence of carbohydrate moieties. Several different lectin-binding sites were demonstrated in both stages using a panel of nine lectins. The carbohydrate specificity of the lectins used

  16. Determining a carbohydrate profile for Hansenula polymorpha

    Science.gov (United States)

    Petersen, G. R.

    1985-01-01

    The determination of the levels of carbohydrates in the yeast Hansenula polymorpha required the development of new analytical procedures. Existing fractionation and analytical methods were adapted to deal with the problems involved with the lysis of whole cells. Using these new procedures, the complete carbohydrate profiles of H. polymorpha and selected mutant strains were determined and shown to correlate favourably with previously published results.

  17. Total dissolved carbohydrate in Mahi river estuary

    Digital Repository Service at National Institute of Oceanography (India)

    Bhosle, N.B.; Rokade, M.A.; Zingde, M.D.

    Total dissolved carbohydrate varied from 4.37-15 mg l-1 and 3.71-15.95 mg l-1 in the surface and bottom samples respectively. Highest concentration of carbohydrate was observed at station 1 which decreased downward upto Station 6 which showed...

  18. Characterization of carbohydrate fractions and fermentation quality ...

    African Journals Online (AJOL)

    This experiment was carried out to evaluate the effects of adding fast-sile (FS), previous fermented juice (PFJ), sucrose (S) or fast-sile + sucrose (FS + S) on the fermentation characteristics and carbohydrates fractions of alfalfa silages by the Cornell net carbohydrates and proteins systems (CNCPS). Silages quality were well ...

  19. Carbohydrate clearance receptors in transfusion medicine

    DEFF Research Database (Denmark)

    Sørensen, Anne Louise Tølbøll; Clausen, Henrik; Wandall, Hans H

    2012-01-01

    Complex carbohydrates play important functions for circulation of proteins and cells. They provide protective shields and refraction from non-specific interactions with negative charges from sialic acids to enhance circulatory half-life. For recombinant protein therapeutics carbohydrates are espe...

  20. A functional carbohydrate chip platform for analysis of carbohydrate-protein interaction

    International Nuclear Information System (INIS)

    Seo, Jeong Hyun; Kim, Chang Sup; Hwang, Byeong Hee; Cha, Hyung Joon

    2010-01-01

    A carbohydrate chip based on glass or other transparent surfaces has been suggested as a potential tool for high-throughput analysis of carbohydrate-protein interactions. Here we proposed a facile, efficient, and cost-effective method whereby diverse carbohydrate types are modified in a single step and directly immobilized onto a glass surface, with retention of functional orientation. We modified various types of carbohydrates by reductive amination, in which reducing sugar groups were coupled with 4-(2-aminoethyl)aniline, which has di-amine groups at both ends. The modified carbohydrates were covalently attached to an amino-reactive NHS-activated glass surface by formation of stable amide bonds. This proposed method was applied for efficient construction of a carbohydrate microarray to analyze carbohydrate-protein interactions. The carbohydrate chip prepared using our method can be successfully used in diverse biomimetic studies of carbohydrates, including carbohydrate-biomolecule interactions, and carbohydrate sensor chip or microarray development for diagnosis and screening.

  1. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  2. Technological aspects of functional food-related carbohydrates.

    NARCIS (Netherlands)

    Voragen, A.G.J.

    1998-01-01

    Carbohydrates in food occur as natural constituents or are added as ingredients or additives. The most important endogenous carbohydrates in food are starch, depolymerized starch, sucrose, lactose, glucose, fructose and sorbitol (digestible) and carbohydrates such as raffinose, stachyose, resistant

  3. Phenol-Sulfuric Acid Method for Total Carbohydrates

    Science.gov (United States)

    Nielsen, S. Suzanne

    The phenol-sulfuric acid method is a simple and rapid colorimetric method to determine total carbohydrates in a sample. The method detects virtually all classes of carbohydrates, including mono-, di-, oligo-, and polysaccharides. Although the method detects almost all carbohydrates, the absorptivity of the different carbohydrates varies. Thus, unless a sample is known to contain only one carbohydrate, the results must be expressed arbitrarily in terms of one carbohydrate.

  4. A Specific ChREBP and PPARα Cross-Talk Is Required for the Glucose-Mediated FGF21 Response

    Directory of Open Access Journals (Sweden)

    Alison Iroz

    2017-10-01

    Full Text Available While the physiological benefits of the fibroblast growth factor 21 (FGF21 hepatokine are documented in response to fasting, little information is available on Fgf21 regulation in a glucose-overload context. We report that peroxisome-proliferator-activated receptor α (PPARα, a nuclear receptor of the fasting response, is required with the carbohydrate-sensitive transcription factor carbohydrate-responsive element-binding protein (ChREBP to balance FGF21 glucose response. Microarray analysis indicated that only a few hepatic genes respond to fasting and glucose similarly to Fgf21. Glucose-challenged Chrebp−/− mice exhibit a marked reduction in FGF21 production, a decrease that was rescued by re-expression of an active ChREBP isoform in the liver of Chrebp−/− mice. Unexpectedly, carbohydrate challenge of hepatic Pparα knockout mice also demonstrated a PPARα-dependent glucose response for Fgf21 that was associated with an increased sucrose preference. This blunted response was due to decreased Fgf21 promoter accessibility and diminished ChREBP binding onto Fgf21 carbohydrate-responsive element (ChoRE in hepatocytes lacking PPARα. Our study reports that PPARα is required for the ChREBP-induced glucose response of FGF21.

  5. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Directory of Open Access Journals (Sweden)

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  6. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  7. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  8. A two-dimensional, finite-element methods for calculating TF coil response to out-of-plane Lorentz forces

    International Nuclear Information System (INIS)

    Witt, R.J.

    1989-01-01

    Toroidal field (TF) coils in fusion systems are routinely operated at very high magnetic fields. While obtaining the response of the coil to in-plane loads is relatively straightforward, the same is not true for the out-of-plane loads. Previous treatments of the out-of-plane problem have involved large, three-dimensional finite element idealizations. A new treatment of the out-of-plane problem is presented here; the model is two-dimensional in nature, and consumes far less CPU-time than three-dimensional methods. The approach assumes there exists a region of torsional deformation in the inboard leg and a bending region in the outboard leg. It also assumes the outboard part of the coil is attached to a torque frame/cylinder, which experiences primarily torsional deformation. Three-dimensional transition regions exist between the inboard and outboard legs and between the outboard leg and the torque frame. By considering several idealized problems of cylindrical shells subjected to moment distributions, it is shown that the size of these three-dimensional regions is quite small, and that the interaction between the torsional and bending regions can be treated in an equivalent two-dimensional fashion. Equivalent stiffnesses are derived to model penetration into and twist along the cylinders. These stiffnesses are then used in a special substructuring analysis to couple the three regions together. Results from the new method are compared to results from a 3D continuum model. (orig.)

  9. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    International Nuclear Information System (INIS)

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  10. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Directory of Open Access Journals (Sweden)

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  11. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  12. Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

    Science.gov (United States)

    Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

    2009-02-01

    Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

  13. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Science.gov (United States)

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  14. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Science.gov (United States)

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Groundwater response under an electronuclear plant to a river flood wave analyzed by a nonlinear finite element model

    International Nuclear Information System (INIS)

    Gambolati, G.; Toffolo, F.; Uliana, F.

    1984-01-01

    A nonlinear finite element model based on the Dupuit-Boussinesq equation of flow in an unconfined aquifer has been developed and applied to simulate the water table fluctuation under the electronuclear plant of the test site of Trino Vercellese (northwestern Italy) in response to the flood event that occurred in the Po River from March 30 to April 4, 1981. The nonlinearity has been overcome by the aid of an efficient iterative linearization technique wherein the model equations are solved by symbolic factorization, numerical factorization, and backward-forward substitution after an optimal preliminary reordering. The model was run for uniform values of aquifer permeability and specific yield within the typical range evidenced for the Trino sands by the early data in our possession. The results show that the maximum water level elevation below the reactor is almost 3 m lower than the corresponding river flood peak even in the most unfavorable conditions, i.e., with the hydraulic conductivity in the upper range, and is rather insensitive to the specific yield values within the plausible interval. The model allowed for an easy evaluation of the effectiveness of the impermeable protection walls and of a possible secondary aquifer recharge from a minor channel. The modeling approach for the analysis of the water table behavior appears to be a very promising tool to help in the structural design of future electronuclear plants

  16. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Science.gov (United States)

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  17. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Science.gov (United States)

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  18. Utilization of carbohydrates by radiation processing

    International Nuclear Information System (INIS)

    Kume, T.; Nagasawa, N.; Yoshii, F.

    2002-01-01

    Upgrading and utilization of carbohydrates such as chitosan, sodium alginate, carrageenan, cellulose, pectin have been investigated for recycling these bio-resources and reducing the environmental pollution. These carbohydrates were easily degraded by irradiation and various kinds of biological activities such as anti-microbial activity, promotion of plant growth, suppression of heavy metal stress, phytoalexins induction, etc. were induced. On the other hand, some carbohydrate derivatives, carboxymethylcellulose and carboxymethylstarch, could be crosslinked under certain radiation condition and produce the biodegradable hydrogel for medical and agricultural use

  19. The Use of Sparse Direct Solver in Vector Finite Element Modeling for Calculating Two Dimensional (2-D) Magnetotelluric Responses in Transverse Electric (TE) Mode

    Science.gov (United States)

    Yihaa Roodhiyah, Lisa’; Tjong, Tiffany; Nurhasan; Sutarno, D.

    2018-04-01

    The late research, linear matrices of vector finite element in two dimensional(2-D) magnetotelluric (MT) responses modeling was solved by non-sparse direct solver in TE mode. Nevertheless, there is some weakness which have to be improved especially accuracy in the low frequency (10-3 Hz-10-5 Hz) which is not achieved yet and high cost computation in dense mesh. In this work, the solver which is used is sparse direct solver instead of non-sparse direct solverto overcome the weaknesses of solving linear matrices of vector finite element metod using non-sparse direct solver. Sparse direct solver will be advantageous in solving linear matrices of vector finite element method because of the matrix properties which is symmetrical and sparse. The validation of sparse direct solver in solving linear matrices of vector finite element has been done for a homogen half-space model and vertical contact model by analytical solution. Thevalidation result of sparse direct solver in solving linear matrices of vector finite element shows that sparse direct solver is more stable than non-sparse direct solver in computing linear problem of vector finite element method especially in low frequency. In the end, the accuracy of 2D MT responses modelling in low frequency (10-3 Hz-10-5 Hz) has been reached out under the efficient allocation memory of array and less computational time consuming.

  20. The relationship between carbohydrate content and gamma irradiation during rooting of chrysanthemum cuttings

    International Nuclear Information System (INIS)

    Noh, Seol Ah; Kim, Jin Kyu

    2003-01-01

    The effect of gamma radiation on carbohydrate metabolism was studied in chrysanthemum cuttings. Total water-soluble carbohydrate, glucose, fructose, sucrose, and starch contents were measured in leaves and stems. Differences in the accumulation of carbohydrate associated with inhibition or stimulation in response to gamma irradiation. Sucrose levels increased significantly in leaves and stems until the 15th day, reaching maximum values on that day. Glucose contents declined rapidly until the 10th day and increased later, reaching maximum values on the 15th day. Fructose levels gradually increased, reaching maximum values at the 10th day, and then decreased again. Differences in the components of soluble carbohydrates were evident between rooting durations and doses. Soluble sugars were in the highest contents in the 20 Gy irradiated group. However, irradiation dose higher than 20 Gy resulted in an inhibitory effect

  1. Carbohydrates as T-cell antigens with implications in health and disease.

    Science.gov (United States)

    Sun, Lina; Middleton, Dustin R; Wantuch, Paeton L; Ozdilek, Ahmet; Avci, Fikri Y

    2016-10-01

    Glycosylation is arguably the most ubiquitous post-translational modification on proteins in microbial and mammalian cells. During the past few years, there has been intensive research demonstrating that carbohydrates, either in pure forms or in conjunction with proteins or lipids, evoke and modulate adaptive immune responses. We now know that carbohydrates can be directly recognized by T cells or participate in T-cell stimulation as components of T-cell epitopes. T-cell recognition of carbohydrate antigens takes place via their presentation by major histocompatibility complex pathways on antigen-presenting cells. In this review, we summarize studies on carbohydrates as T-cell antigens modulating adaptive immune responses. Through discussion of glycan-containing antigens, such as glycoproteins, glycolipids, zwitterionic polysaccharides and carbohydrate-based glycoconjugate vaccines, we will illustrate the key molecular and cellular interactions between carbohydrate antigens and T cells and the implications of these interactions in health and disease. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Carbohydrate regulation of photosynthesis and respiration from branch girdling in four species of wet tropical rain forest trees.

    Science.gov (United States)

    Asao, Shinichi; Ryan, Michael G

    2015-06-01

    How trees sense source-sink carbon balance remains unclear. One potential mechanism is a feedback from non-structural carbohydrates regulating photosynthesis and removing excess as waste respiration when the balance of photosynthesis against growth and metabolic activity changes. We tested this carbohydrate regulation of photosynthesis and respiration using branch girdling in four tree species in a wet tropical rainforest in Costa Rica. Because girdling severs phloem to stop carbohydrate export while leaving xylem intact to allow photosynthesis, we expected carbohydrates to accumulate in leaves to simulate a carbon imbalance. We varied girdling intensity by removing phloem in increments of one-quarter of the circumference (zero, one--quarter, half, three-quarters, full) and surrounded a target branch with fully girdled ones to create a gradient in leaf carbohydrate content. Light saturated photosynthesis rate was measured in situ, and foliar respiration rate and leaf carbohydrate content were measured after destructive harvest at the end of the treatment. Girdling intensity created no consistent or strong responses in leaf carbohydrates. Glucose and fructose slightly increased in all species by 3.4% per one-quarter girdle, total carbon content and leaf mass per area increased only in one species by 5.4 and 5.5% per one-quarter girdle, and starch did not change. Only full girdling lowered photosynthesis in three of four species by 59-69%, but the decrease in photosynthesis was unrelated to the increase in glucose and fructose content. Girdling did not affect respiration. The results suggest that leaf carbohydrate content remains relatively constant under carbon imbalance, and any changes are unlikely to regulate photosynthesis or respiration. Because girdling also stops the export of hormones and reactive oxygen species, girdling may induce physiological changes unrelated to carbohydrate accumulation and may not be an effective method to study carbohydrate feedback

  3. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Science.gov (United States)

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  4. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity.

    NARCIS (Netherlands)

    Boerboom, A.M.A.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  5. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity

    NARCIS (Netherlands)

    Boerboom, A.M.J.F.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.M.M.J.G.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  6. Carbohydrate plasma expanders for passive tumor targeting

    DEFF Research Database (Denmark)

    Hoffmann, Stefan; Caysa, Henrike; Kuntsche, Judith

    2013-01-01

    The objective of this study was to investigate the suitability of carbohydrate plasma volume expanders as a novel polymer platform for tumor targeting. Many synthetic polymers have already been synthesized for targeted tumor therapy, but potential advantages of these carbohydrates include inexpen...... was characterized in human colon carcinoma xenograft bearing nude mice. A tumor specific accumulation of HES 450 was observed, which proves it’s potential as carrier for passive tumor targeting....

  7. Digestion and metabolism of carbohydrates in fish

    OpenAIRE

    Abro, Rani

    2014-01-01

    This thesis deals with the digestion and metabolism of carbohydrates in Arctic charr, Eurasian perch and tilapia. Two sources of carbohydrates, native starch (wheat) and chitin (zygomycete biomass), were evaluated. Gut tissue of Arctic charr displayed significant chitinase activity, of both endo- and exo-chitinase forms. Moreover, the distribution pattern along the gastrointestinal tract of Arctic charr differed between endo-chitinase and exo-chitinase. The endo-chitinase activity in sto...

  8. Enhanced efficacy of radiation-induced gene therapy in mice bearing lung adenocarcinoma xenografts using hypoxia responsive elements

    International Nuclear Information System (INIS)

    Wang Wei-dong; Chen Zheng-tang; Li De-zhi; Duan Yu-zhong; Cao Zheng-huai; Li Rong

    2005-01-01

    The aim of the present study was to investigate whether the hypoxia responsive element (HRE) could be used to enhance suicide gene (HSV-tk) expression and tumoricidal activity in radiation-controlled gene therapy of human lung adenocarcinoma xenografts. A chimeric promoter, HRE-Egr, was generated by directly linking a 0.3-kb fragment of HRE to a 0.6-kb human Egr-1 promoter. Retroviral vectors containing luciferase or the HSV-tk gene driven by Egr-1 or HRE-Egr were constructed. A human adenocarcinoma cell line (A549) was stably transfected with the above vectors using the lipofectamine method. The sensitivity of transfected cells to prodrug ganciclovir (GCV) and cell survival rates were analyzed after exposure to a dose of 2 Gy radiation and hypoxia (1%). In vivo, tumor xenografts in BALB/c mice were transfected with the constructed retroviruses and irradiated to a total dose of 6 Gy, followed by GCV treatment (20 mg/kg for 14 days). When the HSV-tk gene controlled by the HRE-Egr promoter was introduced into A549 cells by a retroviral vector, the exposure to 1% O 2 and 2 Gy radiation induced significant enhancement of GCV cytotoxicity to the cells. Moreover, in nude mice bearing solid tumor xenografts, only the tumors infected with the hybrid promoter-containing virus gradually disappeared after GCV administration and radiation. These results indicate that HRE can enhance transgene expression and tumoricidal activity in HSV-tk gene therapy controlled by ionizing radiation in hypoxic human lung adenocarcinoma. (author)

  9. Polybutylcyanoacrylate nanoparticles for delivering hormone response element-conjugated neurotrophin-3 to the brain of intracerebral hemorrhagic rats.

    Science.gov (United States)

    Chung, Chiu-Yen; Yang, Jen-Tsung; Kuo, Yung-Chih

    2013-12-01

    Hypertensive intracerebral hemorrhage (ICH) is a rapidly evolutional pathology, inducing necrotic cell death followed by apoptosis, and alters gene expression levels in surrounding tissue of an injured brain. For ICH therapy by controlled gene release, the development of intravenously administrable delivery vectors to promote the penetration across the blood-brain barrier (BBB) is a critical challenge. To enhance transfer efficiency of genetic materials under hypoxic conditions, polybutylcyanoacrylate (PBCA) nanoparticles (NPs) were used to mediate the intracellular transport of plasmid neurotrophin-3 (NT-3) containing hormone response element (HRE) with a cytomegalovirus (cmv) promoter and to differentiate induced pluripotent stem cells (iPSCs). The differentiation ability of iPSCs to neurons was justified by various immunological stains for protein fluorescence. The effect of PBCA NP/cmvNT-3-HRE complexes on treating ICH rats was studied by immunostaining, western blotting and Nissl staining. We found that the treatments with PBCA NP/cmvNT-3-HRE complexes increased the capability of differentiating iPSCs to express NT-3, TrkC and MAP-2. Moreover, PBCA NPs could protect cmvNT-3-HRE against degradation with EcoRI/PstI and DNase I in vitro and raise the delivery across the BBB in vivo. The administration of PBCA NP/cmvNT-3-HRE complexes increased the expression of NT-3, inhibited the expression of apoptosis-inducing factor, cleaved caspase-3 and DNA fragmentation, and reduced the cell death rate after ICH in vivo. PBCA NPs are demonstrated as an appropriate delivery system for carrying cmvNT-3-HRE to the brain for ICH therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Science.gov (United States)

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  11. The carbohydrate sequence markup language (CabosML): an XML description of carbohydrate structures.

    Science.gov (United States)

    Kikuchi, Norihiro; Kameyama, Akihiko; Nakaya, Shuuichi; Ito, Hiromi; Sato, Takashi; Shikanai, Toshihide; Takahashi, Yoriko; Narimatsu, Hisashi

    2005-04-15

    Bioinformatics resources for glycomics are very poor as compared with those for genomics and proteomics. The complexity of carbohydrate sequences makes it difficult to define a common language to represent them, and the development of bioinformatics tools for glycomics has not progressed. In this study, we developed a carbohydrate sequence markup language (CabosML), an XML description of carbohydrate structures. The language definition (XML Schema) and an experimental database of carbohydrate structures using an XML database management system are available at http://www.phoenix.hydra.mki.co.jp/CabosDemo.html kikuchi@hydra.mki.co.jp.

  12. Gastric emptying, glucose metabolism and gut hormones: evaluation of a common preoperative carbohydrate beverage.

    Science.gov (United States)

    Vermeulen, Mechteld A R; Richir, Milan C; Garretsen, Martijn K; van Schie, Annelies; Ghatei, Mohammed A; Holst, Jens J; Heijboer, Annemieke C; Uitdehaag, Bernard M J; Diamant, Michaela; Eekhoff, E Marelise W; van Leeuwen, Paul A M; Ligthart-Melis, Gerdien C

    2011-09-01

    To study the gastric-emptying rate and gut hormonal response of two carbohydrate-rich beverages. A specifically designed carbohydrate-rich beverage is currently used to support the surgical patient metabolically. Fruit-based beverages may also promote recovery, due to natural antioxidant and carbohydrate content. However, gastric emptying of fluids is influenced by its nutrient composition; hence, safety of preoperative carbohydrate loading should be confirmed. Because gut hormones link carbohydrate metabolism and gastric emptying, hormonal responses were studied. In eight volunteers, gastric emptying rates of both 400 mL of a ready-to-use beverage (A: Nutricia preOp; 50.4 g carbohydrates-mainly polysaccharides; 260 mOsm/kg) and 400 mL over-the-counter fruit-based lemonade (B: Roosvicee Original; 48 g carbohydrates--mainly fruit-associated saccharides; 805 mOsm/kg) were determined scintigraphically (using hepatate Tc-99(m)) according to a crossover design. Plasma glucose, insulin, C-peptide, glucagon-like peptide (GLP-1), peptide YY, total glucagon, and ghrelin were studied. Gastric emptying showed no differences in residual volumes. Earlier onset in emptying for beverage A versus B was observed (trend), with significantly higher glucose, insulin, C-peptide, and glucagon responses at 15-90 min. GLP-1 was inversely related to residual volume. Fruit-based lemonade is a safe alternative for preoperative purposes. It induces a more limited glucose, insulin, and C-peptide response. Later onset in gastric emptying (B versus A: trend), lower glucagon release, and differences in beverage content and osmolarity may have contributed to those differences. Efficient emptying was reflected by early GLP-1 levels. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Cause of impaired carbohydrate metabolism in hyperthyroidism

    International Nuclear Information System (INIS)

    Foeldes, J.; Megyesi, K.; Koranyi, L.

    1984-01-01

    Hyperthyroidism (HT) affects glucose metabolism in various ways. The role of insulin, glucagon and growth-hormone (GH) was determined. After glucose loading the insulin response is weaker in HT than in euthyroid subjects. Enhanced degradation of insulin has been reported. It is suggested that in HT the serum insulin concentration declines at a slightly accelerated rate. In HT the deranged carbohydrate metabolism might be a consequence of altered tissue sensitivity to insulin. To elucidate this problem insulin receptors on erythrocytes obtained from hyperthyroid women were investigated. The maximal specific binding of 125 I-insulin to RBC of hyperthyroid patients was decreased and the analysis refers to a decreased receptor concentration in RBC. The nature of glucagon secretion and its influence on glucose metabolism in HT was investigated. The basal plasma glucagon is elevated in hyperthyroid patients. The suppression of glucagon secretion induced by an oral glucose loading was of significantly lesser degree in hyperthyroid patients than in controls. Applying the erythrocyte receptor assay a decreased specific binding of 125 I-glucagon to RBC of hyperthyroid patients has been found and data indicate a significantly less glucagon receptor concentration in thyrotoxicosis. Physiological elevations of serum GH levels led to a significant impairment of glucose metabolism. Beside the GH-RH and somatostatin, the dopaminergic neurotransmitter system participates in the regulation of GH secretion too. It has been demonstrated that after administration of the dopamine agonist l-dopa the GH response was weaker in HT than in controls. This indicates that in thyrotoxicosis the GH secretion can not be stimulated in such a degree as in euthyroidism. (author)

  14. Cause of impaired carbohydrate metabolism in hyperthyroidism

    Energy Technology Data Exchange (ETDEWEB)

    Foeldes, J.; Megyesi, K.; Koranyi, L. (Semmelweis Orvostudomanyi Egyetem, Budapest (Hungary))

    1984-01-01

    Hyperthyroidism (HT) affects glucose metabolism in various ways. The role of insulin, glucagon and growth-hormone (GH) was determined. After glucose loading the insulin response is weaker in HT than in euthyroid subjects. Enhanced degradation of insulin has been reported. It is suggested that in HT the serum insulin concentration declines at a slightly accelerated rate. In HT the deranged carbohydrate metabolism might be a consequence of altered tissue sensitivity to insulin. To elucidate this problem insulin receptors on erythrocytes obtained from hyperthyroid women were investigated. The maximal specific binding of /sup 125/I-insulin to RBC of hyperthyroid patients was decreased and the analysis refers to a decreased receptor concentration in RBC. The nature of glucagon secretion and its influence on glucose metabolism in HT was investigated. The basal plasma glucagon is elevated in hyperthyroid patients. The suppression of glucagon secretion induced by an oral glucose loading was of significantly lesser degree in hyperthyroid patients than in controls. Applying the erythrocyte receptor assay a decreased specific binding of /sup 125/I-glucagon to RBC of hyperthyroid patients has been found and data indicate a significantly less glucagon receptor concentration in thyrotoxicosis. Physiological elevations of serum GH levels led to a significant impairment of glucose metabolism. Beside the GH-RH and somatostatin, the dopaminergic neurotransmitter system participates in the regulation of GH secretion too. It has been demonstrated that after administration of the dopamine agonist l-dopa the GH response was weaker in HT than in controls. This indicates that in thyrotoxicosis the GH secretion can not be stimulated in such a degree as in euthyroidism.

  15. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    Science.gov (United States)

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  16. Metabolic aspects of low carbohydrate diets and exercise

    Directory of Open Access Journals (Sweden)

    Peters Sandra

    2004-01-01

    Full Text Available Abstract Following a low carbohydrate diet, there is a shift towards more fat and less carbohydrate oxidation to provide energy to skeletal muscle, both at rest and during exercise. This review summarizes recent work on human skeletal muscle carbohydrate and fat metabolic adaptations to a low carbohydrate diet, focusing mainly on pyruvate dehydrogenase and pyruvate dehydrogenase kinase, and how these changes relate to the capacity for carbohydrate oxidation during exercise.

  17. Spatiotemporal variation characteristics and related affecting factors of dissolved carbohydrates in the East China Sea

    Science.gov (United States)

    He, Zhen; Wang, Qi; Yang, Gui-Peng; Gao, Xian-Chi; Wu, Guan-Wei

    2015-10-01

    Carbohydrates are the largest identified fraction of dissolved organic carbon and play an important role in biogeochemical cycling in the ocean. Seawater samples were collected from the East China Sea (ECS) during June and October 2012 to study the spatiotemporal distributions of total dissolved carbohydrates (TCHOs) constituents, including dissolved monosaccharides (MCHOs) and polysaccharides (PCHOs). The concentrations of TCHOs, MCHOs and PCHOs showed significant differences between summer and autumn 2012, and exhibited an evident diurnal variation, with high values occurring in the daytime. Phytoplankton biomass was identified as the primary factor responsible for seasonal and diurnal variations of dissolved carbohydrates in the ECS. The TCHOs, MCHOs and PCHOs distributions in the study area displayed similar distribution patterns, with high concentrations appearing in the coastal water. The influences of chlorophyll-a, salinity and nutrients on the distributions of these carbohydrates were examined. A carbohydrate enrichment in the near-bottom water was found at some stations, implying that there might be an important source of carbohydrate in the deep water or bottom sediment.

  18. Ultraviolet-B effects on transcript levels for photosynthetic genes are not mediated through carbohydrate metabolism

    International Nuclear Information System (INIS)

    Mackerness, S.A.H.; Surplus, S.L.; Jordan, B.R.; Thomas, B.

    1997-01-01

    The relationship between UV-B-induced changes in gene expression and carbohydrate levels in pea seedlings has been investigated. The effect of supplementary UV-B radiation on the transcript abundance for two photosynthetic genes, photosynthesis, respiration and the levels of carbohydrates was determined in fully expanded leaves of 17-d-old pea seedlings under high (HL: 350 μmol m −2 s −1 ) and low (LL: 150 μmol m −2 s 1 ) light. Supplementary UV-B caused down regulation of the photosynthetic genes in green leaves under LL and to a lesser extent under HL. In contrast to previous studies, UV-B radiation resulted in a decrease in glucose levels rather than an increase under LL. Sucrose and starch levels were not affected until longer exposure. Effects of UV-B on carbohydrate levels were, however, minimal under HL. The effects on transcript levels were most marked under LL and therefore could not be attributed to elevated carbohydrate levels. Comparison of UV-B effects on carbohydrates in source (leaf) and sink (green buds) organs indicated that changes in carbohydrates in response to UV-B are probably indirect and arise from effects of UV-B on photosynthesis in source organs. (author)

  19. Carbohydrates for Soccer: A Focus on Skilled Actions and Half-Time Practices

    Directory of Open Access Journals (Sweden)

    Samuel P. Hills

    2017-12-01

    Full Text Available Carbohydrate consumption is synonymous with soccer performance due to the established effects on endogenous energy store preservation, and physical capacity maintenance. For performance-enhancement purposes, exogenous energy consumption (in the form of drinks, bars, gels and snacks is recommended on match-day; specifically, before and during match-play. Akin to the demands of soccer, limited opportunities exist to consume carbohydrates outside of scheduled breaks in competition, such as at half-time. The link between cognitive function and blood glucose availability suggests that carbohydrates may influence decision-making and technical proficiency (e.g., soccer skills. However, relatively few reviews have focused on technical, as opposed to physical, performance while also addressing the practicalities associated with carbohydrate consumption when limited in-play feeding opportunities exist. Transient physiological responses associated with reductions in activity prevalent in scheduled intra-match breaks (e.g., half-time likely have important consequences for practitioners aiming to optimize match-day performance. Accordingly, this review evaluated novel developments in soccer literature regarding (1 the ergogenic properties of carbohydrates for skill performance; and (2 novel considerations concerning exogenous energy provision during half-time. Recommendations are made to modify half-time practices in an aim to enhance subsequent performance. Viable future research opportunities exist regarding a deeper insight into carbohydrate provision on match-day.

  20. Identification of an ICP27-responsive element in the coding region of a herpes simplex virus type 1 late gene.

    Science.gov (United States)

    Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A

    2010-03-01

    During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.

  1. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    DEFF Research Database (Denmark)

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical...

  2. The effects of whey protein with or without carbohydrates on resistance training adaptations.

    Science.gov (United States)

    Hulmi, Juha J; Laakso, Mia; Mero, Antti A; Häkkinen, Keijo; Ahtiainen, Juha P; Peltonen, Heikki

    2015-01-01

    Nutrition intake in the context of a resistance training (RT) bout may affect body composition and muscle strength. However, the individual and combined effects of whey protein and carbohydrates on long-term resistance training adaptations are poorly understood. A four-week preparatory RT period was conducted in previously untrained males to standardize the training background of the subjects. Thereafter, the subjects were randomized into three groups: 30 g of whey proteins (n = 22), isocaloric carbohydrates (maltodextrin, n = 21), or protein + carbohydrates (n = 25). Within these groups, the subjects were further randomized into two whole-body 12-week RT regimens aiming either for muscle hypertrophy and maximal strength or muscle strength, hypertrophy and power. The post-exercise drink was always ingested immediately after the exercise bout, 2-3 times per week depending on the training period. Body composition (by DXA), quadriceps femoris muscle cross-sectional area (by panoramic ultrasound), maximal strength (by dynamic and isometric leg press) and serum lipids as basic markers of cardiovascular health, were analysed before and after the intervention. Twelve-week RT led to increased fat-free mass, muscle size and strength independent of post-exercise nutrient intake (P carbohydrate group independent of the type of RT (P carbohydrate group (P carbohydrates or combination of proteins and carbohydrates did not have a major effect on muscle size or strength when ingested two to three times a week. However, whey proteins may increase abdominal fat loss and relative fat-free mass adaptations in response to resistance training when compared to fast-acting carbohydrates.

  3. The Effects of Breakfast Consumption and Composition on Metabolic Wellness with a Focus on Carbohydrate Metabolism.

    Science.gov (United States)

    Maki, Kevin C; Phillips-Eakley, Alyssa K; Smith, Kristen N

    2016-05-01

    Findings from epidemiologic studies indicate that there are associations between breakfast consumption and a lower risk of type 2 diabetes mellitus (T2DM) and metabolic syndrome, prompting interest in the influence of breakfast on carbohydrate metabolism and indicators of T2DM risk. The objective of this review was to summarize the available evidence from randomized controlled trials assessing the impact of breakfast on variables related to carbohydrate metabolism and metabolic wellness. Consuming compared with skipping breakfast appeared to improve glucose and insulin responses throughout the day. Breakfast composition may also be important. Dietary patterns high in rapidly available carbohydrate were associated with elevated T2DM risk. Therefore, partial replacement of rapidly available carbohydrate with other dietary components, such as whole grains and cereal fibers, proteins, and unsaturated fatty acids (UFAs), at breakfast may be a useful strategy for producing favorable metabolic outcomes. Consumption of fermentable and viscous dietary fibers at breakfast lowers glycemia and insulinemia. Fermentable fibers likely act through enhancing insulin sensitivity later in the day, and viscous fibers have an acute effect to slow the rate of carbohydrate absorption. Partially substituting protein for rapidly available carbohydrate enhances satiety and diet-induced thermogenesis, and also favorably affects lipoprotein lipids and blood pressure. Partially substituting UFA for carbohydrate has been associated with improved insulin sensitivity, lipoprotein lipids, and blood pressure. Overall, the available evidence suggests that consuming breakfast foods high in whole grains and cereal fiber, while limiting rapidly available carbohydrate, is a promising strategy for metabolic health promotion. © 2016 American Society for Nutrition.

  4. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Science.gov (United States)

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  5. Single tag for total carbohydrate analysis.

    Science.gov (United States)

    Anumula, Kalyan Rao

    2014-07-15

    Anthranilic acid (2-aminobenzoic acid, 2-AA) has the remarkable property of reacting rapidly with every type of reducing carbohydrate. Reactivity of 2-AA with carbohydrates in aqueous solutions surpasses all other tags reported to date. This unique capability is attributed to the strategically located -COOH which accelerates Schiff base formation. Monosaccharides, oligosaccharides (N-, O-, and lipid linked and glycans in secretory fluids), glycosaminoglycans, and polysaccharides can be easily labeled with 2-AA. With 2-AA, labeling is simple in aqueous solutions containing proteins, peptides, buffer salts, and other ingredients (e.g., PNGase F, glycosidase, and transferase reaction mixtures). In contrast, other tags require relatively pure glycans for labeling in anhydrous dimethyl sulfoxide-acetic acid medium. Acidic conditions are known to cause desialylation, thus requiring a great deal of attention to sample preparation. Simpler labeling is achieved with 2-AA within 30-60 min in mild acetate-borate buffered solution. 2-AA provides the highest sensitivity and resolution in chromatographic methods for carbohydrate analysis in a simple manner. Additionally, 2-AA is uniquely qualified for quantitative analysis by mass spectrometry in the negative mode. Analyses of 2-AA-labeled carbohydrates by electrophoresis and other techniques have been reported. Examples cited here demonstrate that 2-AA is the universal tag for total carbohydrate analysis. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Nuclear toxicology file: cell response to the steady or radioactive chemical elements exposure; Dossier toxicologie nucleaire: reponse cellulaire a l'exposition aux elements chimiques stables ou radioactifs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, B.S.; Saintigny, Y. [Centre National de la Recherche Scientifique (CNRS), Sciences du Vivant, UMR 217, 92 - Fontenay aux Roses (France); CEA Fontenay aux Roses, IRCM, UMR 217, 92 (France); Adam, Ch. [Institut de Radioprotection et de Surete Nucleaire (IRSN:DEI/SECRE), Lab. de Radioecologie et d' Ecotoxicologie, 13 - Saint-Paul-lez-Durance (France)

    2008-09-15

    The cellular response to an exposure in a toxic element is made at different levels. The first level is the agent detoxication by its elimination or its neutralization. The second level is the repair of the damages caused by this agent (for example the DNA repair). The third level is the control of the cellular death programmed to eliminate the irreparably damaged cells.Finally, the hurt cell can inform the nearby cells by producing molecular effectors inducing an abscopal or bystander effect. (N.C.)

  7. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Yan-Zhuo Yang

    Full Text Available The plant hormone abscisic acid (ABA plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  8. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Science.gov (United States)

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  9. Boronic acids for fluorescence imaging of carbohydrates.

    Science.gov (United States)

    Sun, Xiaolong; Zhai, Wenlei; Fossey, John S; James, Tony D

    2016-02-28

    "Fluorescence imaging" is a particularly exciting and rapidly developing area of research; the annual number of publications in the area has increased ten-fold over the last decade. The rapid increase of interest in fluorescence imaging will necessitate the development of an increasing number of molecular receptors and binding agents in order to meet the demand in this rapidly expanding area. Carbohydrate biomarkers are particularly important targets for fluorescence imaging given their pivotal role in numerous important biological events, including the development and progression of many diseases. Therefore, the development of new fluorescent receptors and binding agents for carbohydrates is and will be increasing in demand. This review highlights the development of fluorescence imaging agents based on boronic acids a particularly promising class of receptors given their strong and selective binding with carbohydrates in aqueous media.

  10. Carbohydrates in pig nutrition - Recent advances

    DEFF Research Database (Denmark)

    Knudsen, Knud Erik Bach; Lærke, Helle Nygaard; Ingerslev, Anne Krog

    2016-01-01

    The dietary carbohydrates are a diverse group of substances with a range of chemical, physical, and physiological properties. The primary chemical classification of carbohydrates is by molecular size (degree of polymerization [DP]), the type of linkage (α or β), and composition of individual...... to their potential for digestion by endogenous enzymes. Carbohydrates are the principal substrates for energy metabolism but also exert a number of other effects throughout the gastrointestinal tract. The starch structure as well as type and levels of DF influence, to a varying degree, the rate of starch digestion...... in the small intestine. Some types of soluble NSP are found to interact with intestinal mucus and produce a layer that significantly delays the transport of lipid digestion products. Potentially, the same may be the case for proteinous compounds. The delay in the transport of the nutrients to the gut...

  11. Effects of low-carbohydrate diet therapy in overweight subject with autoimmune thyroiditis: possible synergism with ChREBP

    Directory of Open Access Journals (Sweden)

    Esposito T

    2016-09-01

    . With regard to the body parameters measured in patients who followed this diet, reduction in body weight (-5%, P<0.000 and body mass index (-4%, P<0.000 were observed. Since 83% of patients with high levels of autoantibodies are breath test positive to lactase with a lactase deficit higher than 50%, this fact led us to hypothesize a correlation with carbohydrate-responsive element-binding protein and therefore a possible role of carbohydrate metabolism in the development and maintenance of autoimmune thyroiditis associated with body weight increase and slower basic metabolism. Keywords: thyroiditis, thyroid hormones, thyroid autoantibodies, low-carbohydrate diet, protein diet

  12. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    OpenAIRE

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-01-01

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define ...

  13. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Directory of Open Access Journals (Sweden)

    Dozmorov Igor

    2007-05-01

    Full Text Available Abstract Background Tachykinins (TK, such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs. Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2. In the absence of

  14. Signatures of rare-earth elements in banded corals of Kalpeni atoll-Lakshadweep archipelago in response to monsoonal variations

    Digital Repository Service at National Institute of Oceanography (India)

    Naqvi, S.A.S.; Nath, B.N.; Balaram, V.

    Concentrations of rare-earth elements (REE) have been determined in seasonal bands of Porites species collected from the Lakshadweep lagoon. Total REE (REE) are very low (less than 3 ppm) in these corals. Seasonal variations in REE appear to have...

  15. Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

    Science.gov (United States)

    Wang, F; Samudio, I; Safe, S

    2001-01-01

    The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

  16. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Science.gov (United States)

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  17. Minimally refined biomass fuel. [carbohydrate-water-alcohol mixture

    Energy Technology Data Exchange (ETDEWEB)

    Pearson, R.K.; Hirschfeld, T.B.

    1981-03-26

    A minimally refined fluid composition, suitable as a fuel mixture and derived from biomass material, is comprised of one or more water-soluble carbohydrates such as sucrose, one or more alcohols having less than four carbons, and water. The carbohydrate provides the fuel source; water-solubilizes the carbohydrate; and the alcohol aids in the combustion of the carbohydrate and reduces the viscosity of the carbohydrate/water solution. Because less energy is required to obtain the carbohydrate from the raw biomass than alcohol, an overall energy savings is realized compared to fuels employing alcohol as the primary fuel.

  18. Hepatocyte heterogeneity in the metabolism of carbohydrates.

    Science.gov (United States)

    Jungermann, K; Thurman, R G

    1992-01-01

    Periportal and perivenous hepatocytes possess different amounts and activities of the rate-generating enzymes of carbohydrate and oxidative energy metabolism and thus different metabolic capacities. This is the basis of the model of metabolic zonation, according to which periportal cells catalyze predominantly the oxidative catabolism of fatty and amino acids as well as glucose release and glycogen formation via gluconeogenesis, and perivenous cells carry out preferentially glucose uptake for glycogen synthesis and glycolysis coupled to liponeogenesis. The input of humoral and nervous signals into the periportal and perivenous zones is different; gradients of oxygen, substrates and products, hormones and mediators and nerve densities exist which are important not only for the short-term regulation of carbohydrate metabolism but also for the long-term regulation of zonal gene expression. The specialization of periportal and perivenous hepatocytes in carbohydrate metabolism has been well characterized. In vivo evidence is provided by the complex metabolic situation termed the 'glucose paradox' and by zonal flux differences calculated on the basis of the distribution of enzymes and metabolites. In vitro evidence is given by the different flux rates determined with classical invasive techniques, e.g. in periportal-like and perivenous-like hepatocytes in cell culture, in periportal- and perivenous-enriched hepatocyte populations and in perfused livers during orthograde and retrograde flow, as well as with noninvasive techniques using miniature oxygen electrodes, e.g. in livers perfused in either direction. Differences of opinion in the interpretation of studies with invasive and noninvasive techniques by the authors are discussed. The declining gradient in oxygen concentrations, the decreasing glucagon/insulin ratio and the different innervation could be important factors in the zonal expression of the genes of carbohydrate-metabolizing enzymes. While it is clear that

  19. Carbohydrates digestion and metabolism in the spiny lobster (Panulirus argus): biochemical indication for limited carbohydrate utilization.

    Science.gov (United States)

    Rodríguez-Viera, Leandro; Perera, Erick; Montero-Alejo, Vivian; Perdomo-Morales, Rolando; García-Galano, Tsai; Martínez-Rodríguez, Gonzalo; Mancera, Juan M

    2017-01-01

    As other spiny lobsters, Panulirus argus is supposed to use preferentially proteins and lipids in energy metabolism, while carbohydrates are well digested but poorly utilized. The aim of this study was to evaluate the effect of dietary carbohydrate level on digestion and metabolism in the spiny lobster P. argus . We used complementary methodologies such as post-feeding flux of nutrients and metabolites, as well as measurements of α-amylase expression and activity in the digestive tract. Lobsters readily digested and absorbed carbohydrates with a time-course that is dependent on their content in diet. Lobster showed higher levels of free glucose and stored glycogen in different tissues as the inclusion of wheat flour increased. Modifications in intermediary metabolism revealed a decrease in amino acids catabolism coupled with a higher use of free glucose as carbohydrates rise up to 20%. However, this effect seems to be limited by the metabolic capacity of lobsters to use more than 20% of carbohydrates in diets. Lobsters were not able to tightly regulate α-amylase expression according to dietary carbohydrate level but exhibited a marked difference in secretion of this enzyme into the gut. Results are discussed to highlight the limitations to increasing carbohydrate utilization by lobsters. Further growout trials are needed to link the presented metabolic profiles with phenotypic outcomes.

  20. Carbohydrates digestion and metabolism in the spiny lobster (Panulirus argus: biochemical indication for limited carbohydrate utilization

    Directory of Open Access Journals (Sweden)

    Leandro Rodríguez-Viera

    2017-11-01

    Full Text Available As other spiny lobsters, Panulirus argus is supposed to use preferentially proteins and lipids in energy metabolism, while carbohydrates are well digested but poorly utilized. The aim of this study was to evaluate the effect of dietary carbohydrate level on digestion and metabolism in the spiny lobster P. argus. We used complementary methodologies such as post-feeding flux of nutrients and metabolites, as well as measurements of α-amylase expression and activity in the digestive tract. Lobsters readily digested and absorbed carbohydrates with a time-course that is dependent on their content in diet. Lobster showed higher levels of free glucose and stored glycogen in different tissues as the inclusion of wheat flour increased. Modifications in intermediary metabolism revealed a decrease in amino acids catabolism coupled with a higher use of free glucose as carbohydrates rise up to 20%. However, this effect seems to be limited by the metabolic capacity of lobsters to use more than 20% of carbohydrates in diets. Lobsters were not able to tightly regulate α-amylase expression according to dietary carbohydrate level but exhibited a marked difference in secretion of this enzyme into the gut. Results are discussed to highlight the limitations to increasing carbohydrate utilization by lobsters. Further growout trials are needed to link the presented metabolic profiles with phenotypic outcomes.

  1. A Universal Protocol for Photochemical Covalent Immobilization of Intact Carbohydrates for the Preparation of Carbohydrate Microarrays

    Science.gov (United States)

    Wang, Huibin; Zhang, Yiming; Yuan, Xun; Chen, Yi; Yan, Mingdi

    2010-01-01

    A universal photochemical method has been established for the immobilization of intact carbohydrates and their analogues, and for the fabrication of carbohydrate microarrays. The method features the use of perfluorophenyl azide (PFPA)-modified substrates and the photochemical reaction of surface azido groups with printed carbohydrates. Various aldoses, ketoses, non-reducing sugars such as alditols and their derivatives can be directly arrayed on the PFPA-modified chips. The lectin-recognition ability of arrayed mannose, glucose and their oligo- and polysaccharides were confirmed using surface plasmon resonance imaging and laser-induced fluorescence imaging. PMID:21138274

  2. Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene

    DEFF Research Database (Denmark)

    Galsgaard, E D; Gouilleux, F; Groner, B

    1996-01-01

    promoter activity 2-fold, and this stimulation was abolished by introduction of a block mutation in a gamma-interferon-activated sequence (GAS)-like element (GLE) with the sequence 5'-TTCTGGGAA-3' located in the rat insulin 1 enhancer at position -330 to -322. This element, termed Ins-GLE, was able...... transfected with STAT5 and GH receptor cDNAs, it was found that expression of STAT5 was necessary for GH induction of these two DNA-binding complexes. These results suggest that GH stimulates insulin 1 promoter activity by inducing the binding of STAT5 to Ins-GLE.......GH and PRL stimulate both proliferation and insulin production in pancreatic beta-cells as well as in the rat insulinoma cell line RIN-5AH, We report here that human GH increases insulin mRNA levels in RIN-5AH cells via both somatogenic and lactogenic receptors. GH stimulated the rat insulin 1...

  3. Pre pregnancy dietary carbohydrate quantity and quality, and risk of developing gestational diabetes: the Australian Longitudinal Study on Women's Health : The Australian longitudinal study on women's health

    NARCIS (Netherlands)

    Looman, M.; Schoenaker, D.A.J.M.; Soedamah-Muthu, S.S.; Geelen, A.; Feskens, E.J.M.; Mishra, G.D.

    2018-01-01

    Carbohydrate quantity and quality affect postprandial glucose response, glucose metabolism and risk of type 2 diabetes. The aim of this study was to examine the association of pre-pregnancy dietary carbohydrate quantity and quality with the risk of developing gestational diabetes mellitus (GDM). We

  4. Pre-pregnancy dietary carbohydrate quantity and quality, and risk of developing gestational diabetes: the Australian Longitudinal Study on Women's Health

    NARCIS (Netherlands)

    Looman, M.; Schoenaker, D.A.J.M.; Soedamah-Muthu, S.S.; Geelen, M.M.E.E.; Feskens, E.J.M.; Mishra, G.D.

    2018-01-01

    Carbohydrate quantity and quality affect postprandial glucose response, glucose metabolism and risk of type 2 diabetes. The aim of this study was to examine the association of pre-pregnancy dietary carbohydrate quantity and quality with the risk of developing gestational diabetes mellitus (GDM). We

  5. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    Science.gov (United States)

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  6. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Directory of Open Access Journals (Sweden)

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  7. HIGH PERCENTAGE OF RARE EARTH ELEMENT CONNECTION WITH THE ACCUMULATION SEDIMENT AS RESPONSE LONGSHORE CURRENTS IN THE BELITUNG WATERS

    Directory of Open Access Journals (Sweden)

    Delyuzar Ilahude

    2017-07-01

    Full Text Available The study area is geographically located in the West coast of Belitung island at coordinates 105o48'00" - 106o06' 00" E and 06o46'00" - 06o50' 00" S. The beach and coastal area is influenced by wave energy from the West and North directions The purpose of this study is to analyze the relationship between the zone of sediment accumulation of empirical approaches on oceanography parameter containing rare earth elements. The approach used is to predict the shore wave energy using wave prediction curve deep waters to obtain the energy flux of the wave at each point of reference. Sediments containing rare earth elements tend to lead to the south as a result of the movement of longshore currents. Regional coastal area of the western part of the island of Belitung, especially in the southern part of the estuary of the river Tanjung Pandan is estimated to be a zone of sediment accumulation. The movement of sediment caused by wave energy from the north led to sedimentation evolved significantly in the south which is thought to contain rare earths minerals derived from land. This sedimentation process takes place on a seasonal basis, which allegedly took place in the west. The movement of sediment to the south of the mouth of the Cerucuk River it is predicted that rare earth elements were supplied from these rivers tend to settle in the southern part of the estuary Cerucuk throughout the year.

  8. Extended spectrum β-lactamases, carbapenemases and mobile genetic elements responsible for antibiotics resistance in Gram-negative bacteria.

    Science.gov (United States)

    El Salabi, Allaaeddin; Walsh, Timothey R; Chouchani, Chedly

    2013-05-01

    Infectious diseases due to Gram-negative bacteria are a leading cause of morbidity and mortality worldwide. Antimicrobial agents represent one major therapeutic tools implicated to treat these infections. The misuse of antimicrobial agents has resulted in the emergence of resistant strains of Gram-negatives in particular Enterobacteriaceae and non-fermenters; they have an effect not only on a human but on the public health when bacteria use the resistance mechanisms to spread in the hospital environment and to the community outside the hospitals by means of mobile genetic elements. Gram-negative bacteria have become increasingly resistant to antimicrobial agents. They have developed several mechanisms by which they can withstand to antimicrobials, these mechanisms include the production of Extended-spectrum β-lactamases (ESBLs) and carbapenemases, furthermore, Gram-negative bacteria are now capable of spreading such resistance between members of the family Enterobacteriaceae and non-fermenters using mobile genetic elements as vehicles for such resistance mechanisms rendering antibiotics useless. Therefore, addressing the issue of mechanisms of antimicrobial resistance is considered one of most urgent priorities. This review will help to illustrate different resistance mechanisms; ESBLs, carbapenemases encoded by genes carried by mobile genetic elements, which are used by Gram-negative bacteria to escape antimicrobial effect.

  9. Use of a questionnaire design as an element of nuclear energy generating enterprises social responsibility public audit

    International Nuclear Information System (INIS)

    Gushchina, M.O.; Pryalyin, M.A.; Torganova, O.B.

    2006-01-01

    In the article we describe some issues concerning corporate social responsibility to a society from the point of view its influence on image of an enterprise. We present results of a social investigation regarding to evaluation of social responsibility of the 'South-Ukraine Nuclear Power Plant'

  10. Carbohydrates and gibberellins relationship in potato tuberization

    Czech Academy of Sciences Publication Activity Database

    Ševčíková, H.; Mašková, P.; Tarkowská, Danuše; Mašek, T.; Lipavská, H.

    2017-01-01

    Roč. 214, JUL (2017), s. 53-63 ISSN 0176-1617 R&D Projects: GA ČR GA14-34792S Institutional support: RVO:61389030 Keywords : Carbohydrate distribution * Gibberellin * Photoautotrophic cultivation * Potato * Tuberization Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Plant sciences, botany Impact factor: 3.121, year: 2016

  11. Accumulation pattern of total nonstructural carbohydrate in ...

    African Journals Online (AJOL)

    Umukoro

    1977-09-09

    Sep 9, 1977 ... 1Instituto Nacional de Tecnología Agropecuaria (INTA), EEA Famaillá, Argentina. 2Department of Plant Sciences, University of California Davis, CA, USA. Accepted 17 October, 2012. The pattern of total nonstructural carbohydrate (TNC) accumulation in strawberry (Fragaria ananassa. Duch.) nursery ...

  12. Crystallization of carbohydrate oxidase from Microdochium nivale

    Czech Academy of Sciences Publication Activity Database

    Dušková, Jarmila; Dohnálek, Jan; Skálová, Tereza; Ostergaard, L. H.; Fuglsang, C. C.; Kolenko, Petr; Štěpánková, Andrea; Hašek, Jindřich

    2009-01-01

    Roč. 65, č. 6 (2009), s. 638-640 ISSN 1744-3091 R&D Projects: GA AV ČR IAA500500701; GA ČR GA305/07/1073 Institutional research plan: CEZ:AV0Z40500505 Keywords : carbohydrate oxidase * crystallization * data processing Subject RIV: CD - Macromolecular Chemistry Impact factor: 0.551, year: 2009

  13. Nutrient and carbohydrate partitioning in sorghum stover

    International Nuclear Information System (INIS)

    Powell, J.M.; Hons, F.M.; McBee, G.G.

    1991-01-01

    Sorghum [Sorghum bicolor (L.) Moench] stover has been demonstrated to be a potential biomass energy source. Complete aboveground crop removal, however, can result in soil degradation. Differential dry matter, nutrient, and carbohydrate partitioning by sorghum cultivars may allow management strategies that return certain parts to the field while removing other portions for alternative uses, such as energy production. A field study was conducted to determine N,P,K, nonstructural carbohydrate, cellulose hemicellulose, and lignin distributions in stover of three diverse sorghum cultivars of differing harvest indices. Determinations were based on total vegetative biomass; total blades; total stalks; and upper middle, and lower blades and stalks. Concentrations of N and P were higher in blades than stalks and generally declines from upper to lower stover parts. Large carbohydrate and lignin concentration differences were observed on the basis of cultivar and stover part. Greater nutrient partitioning to the upper third of the intermediate and forage-type sorghum stovers was observed as compared to the conventional grain cultivar. Stover carbohydrates for all cultivars were mainly contained in the lower two-thirds of the stalk fraction. A system was proposed for returning upper stover portion to soil, while removing remaining portions for alternative uses

  14. Saturated fat, carbohydrates and cardiovascular disease

    NARCIS (Netherlands)

    Kuipers, R. S.; de Graaf, D. J.; Luxwolda, M. F.; Muskiet, M. H. A.; Dijck-Brouwer, D. A. J.; Muskiet, F. A. J.

    The dietary intake of saturated fatty acids (SAFA) is associated with a modest increase in serum total cholesterol, but not with cardiovascular disease (CVD). Replacing dietary SAFA with carbohydrates (CHO), notably those with a high glycaemic index, is associated with an increase in CVD risk in

  15. Profiling of carbohydrate polymers in biotechnology using ...

    African Journals Online (AJOL)

    The analysis of carbohydrate polymers is very demanding and challenging because of the similar physical and chemical properties they possess. Enzymatic hydrolysis is employed to cleave the polymers. The use of enzymes in analytical chemistry requires an analytical system that has on-line capability, is fast, ...

  16. Radiation chemistry of carbohydrates, ch. 5

    International Nuclear Information System (INIS)

    Dauphin, J.F.; Saint-Lebe, L.R.

    1977-01-01

    The physical and chemical changes undergone by carbohydrates at irradiation are reviewed. The discussion includes the irradiation of pure sugars (low molecular weight sugars and derivatives in the solid state or in solution; polysaccharides) as well as the irradiation of simple mixtures containing a given sugar, emphasizing the irradiation of foodstuffs containing one or more sugars

  17. Carbohydrates in Colobanthus quitensis and Deschampsia antarctica

    Directory of Open Access Journals (Sweden)

    Agnieszka I. Piotrowicz-Cieślak

    2011-01-01

    Full Text Available Eight to nineteen ethanol-soluble carbohydrate components were identified in vegetative tissues of Colobanthus quitensis and Deschampsia antarctica. The analysed carbohydrates included: monosaccharides, cyclitols, galactosyl cyclitols, raffinose family oligosaccharides, lichnose family oligosaccharides, kestose family oligosaccharides. The analysed vegetative tissues accumulated from 447 to 139 mg/g d.m. soluble carbohydrates in Colobanthus quitensis, Deschampsia antarctica respectively. The raffinose family oligosaccharides constituted 53.3% in Colobanthus quitensis of the identified soluble carbohydrate component pool. Vegetative tissues accumulated starch in Colobanthus quitensis 20.6 mg/g d.m. and 261.6 mg/g d.m. in Deschampsia antarctica. Anatomical and ultrastructural observations of vegetative part of Colobanthus quitensis and Deschmpsia antarctica revealed the presence of various ergastic materials in intercellular spaces, cell walls and protoplasts. Various parts of these plants contain insoluble, PAS positive polysaccharides in intercellular spaces and in cell walls. Chloroplasts of analysed tissues contained starch. Less starch was visible in young, growing parts of shoots of Colobanthus quitensis and Deschmpsia antarctica, more starch appears in mature, differentiated parts.

  18. Dissolved carbohydrate in the central Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Dhople, V.M.; Bhosle, N.B.

    with chlorophyll a (P 0.001) and phaeopigments (P 0.001) suggesting its release from the former and zooplankton grazing in the latter. Inverse correlations with dissolved oxygen, phosphate and nitrate indicated the possibility of the release of carbohydrate from...

  19. Accumulation pattern of total nonstructural carbohydrate in ...

    African Journals Online (AJOL)

    The pattern of total nonstructural carbohydrate (TNC) accumulation in strawberry (Fragaria ananassa Duch.) nursery runner plants, cv. eCamarosaf, was determined for three growing seasons. Plant growth and fruit production patterns were also evaluated. The experiments were carried out on plants propagated in high ...

  20. STICS: surface-tethered iterative carbohydrate synthesis.

    Science.gov (United States)

    Pornsuriyasak, Papapida; Ranade, Sneha C; Li, Aixiao; Parlato, M Cristina; Sims, Charles R; Shulga, Olga V; Stine, Keith J; Demchenko, Alexei V

    2009-04-14

    A new surface-tethered iterative carbohydrate synthesis (STICS) technology is presented in which a surface functionalized 'stick' made of chemically stable high surface area porous gold allows one to perform cost efficient and simple synthesis of oligosaccharide chains; at the end of the synthesis, the oligosaccharide can be cleaved off and the stick reused for subsequent syntheses.

  1. DETERMINATION OF CARBOHYDRATE AND β-CAROTENE ...

    African Journals Online (AJOL)

    DR. AMINU

    A sample of each vegetable was washed and ground to a fine pulp using pestle and mortar. The operation was done under dim light to reduce the rate of carotene oxidation contained in them. One gramme (1g) and 10g of macerated sample were weighed using Metler PT balance for carbohydrate and β-carotene analysis ...

  2. Particulate carbohydrates in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Bhosle, N.B.; Nandakumar, K.; Venkat, K.

    Particulate matter collected from 77 water samples over a 3000 m water column was analyzed for particulate carbohydrates (PCHO). PCHO in the surface waters ranged from 43 to 143 mu g.l-1, and below 250 m it was 16.PCHO showed large variations at all...

  3. Food-derived carbohydrates--structural complexity and functional diversity.

    Science.gov (United States)

    Tharanathan, Rudrapatnam N

    2002-01-01

    Carbohydrates are biomolecules abundantly available in nature. They are found in bewildering types ranging from simple sugars through oligo- and polysaccharides to glycoconjugates and saccharide complexes, each exhibiting characteristic bio-physiological and/or nutritional functions both in in vivo and in vitro systems. For example, their presence or inclusion in food dictates the texture (body) and gives desirable customer appeal (satisfaction), or their inclusion in the diet offers beneficial effects of great therapeutic value. Thus, carbohydrates are integrally involved in a multitude of biological functions such as regulation of the immune system, cellular signaling (communication), cell malignancy, antiinfection responses, host-pathogen interactions, etc. If starch is considered the major energy storage carbohydrate, the gums/mucilages and other non-starch carbohydrates are of structural significance. The most investigated properties of starch are its gelatinization and melting behavior, especially during food processing. This has led to the development of the food polymer science approach, which has enabled a new interpretive and experimental frame work for the study of the plasticizing influence of simple molecules such as water, sugars, etc. on food systems that are kinetically constrained. Starch, although considered fully digestible, has been challenged, and starch is found to be partly indigestible in the GI tract of humans. This fraction of starch-resisting digestion in vivo is known as resistant starch (RS). The latter, due to its excellent fermentative capacity in the gut, especially yielding butyric acid is considered a new tool for the creation of fiber-rich foods, which are of nutraceutical importance. By a careful control of the processing conditions the content of RS, a man-made fiber, can be increased to as high as 30%. Arabinoxylans are the major endospermic cell wall polysaccharides of cereals. In wheat they are found complexed with ferulic

  4. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    Science.gov (United States)

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  5. Cell surface carbohydrates as prognostic markers in human carcinomas

    DEFF Research Database (Denmark)

    Dabelsteen, Erik

    1996-01-01

    Tumour development is usually associated with changes in cell surface carbohydrates. These are often divided into changes related to terminal carbohydrate structures, which include incomplete synthesis and modification of normally existing carbohydrates, and changes in the carbohydrate core...... structure. The latter includes chain elongation of both glycolipids and proteins, increased branching of carbohydrates in N-linked glycoproteins, and blocked synthesis of carbohydrates in O-linked mucin-like glycoproteins. In mature organisms, expression of distinct carbohydrates is restricted to specific...... cell types; within a given tissue, variation in expression may be related to cell maturation. Tumour-associated carbohydrate structures often reflect a certain stage of cellular development; most of these moieties are structures normally found in other adult or embryonic tissues. There is no unique...

  6. Carbohydrate secretion by phototrophic communities in tidal sediments

    NARCIS (Netherlands)

    de Winder, B.; Staats, N.; Stal, L.J.; Paterson, D.M.

    1999-01-01

    Two different benthic phototrophic communities on tidal flats were investigated for their carbohydrate content and distribution. Carbohydrates were analysed as two operationally defined fractions, related to the difficulty of extraction from the sediment matrix. Water-soluble (colloidal) and EDTA-

  7. High throughput screening of starch structures using carbohydrate microarrays

    DEFF Research Database (Denmark)

    Tanackovic, Vanja; Rydahl, Maja Gro; Pedersen, Henriette Lodberg

    2016-01-01

    In this study we introduce the starch-recognising carbohydrate binding module family 20 (CBM20) from Aspergillus niger for screening biological variations in starch molecular structure using high throughput carbohydrate microarray technology. Defined linear, branched and phosphorylated...

  8. Mixed drink increased carbohydrate oxidation but not performance ...

    African Journals Online (AJOL)

    Kathryn van Boom

    ... carbohydrate intake is hypothesised to provide additional substrate for oxidation[3] ... performance is attained when a multiple carbohydrate drink is ingested. ..... and often intense exercise, such as can be seen in events such as the Tour de ...

  9. Effect of Carbohydrate Supplementation on Investment into Offspring Number, Size, and Condition in a Social Insect.

    Directory of Open Access Journals (Sweden)

    Bill D Wills

    Full Text Available Resource availability can determine an organism's investment strategies for growth and reproduction. When nutrients are limited, there are potential tradeoffs between investing into offspring number versus individual offspring size. In social insects, colony investment in offspring size and number may shift in response to colony needs and the availability of food resources. We experimentally manipulated the diet of a polymorphic ant species (Solenopsis invicta to test how access to the carbohydrate and amino acid components of nectar resources affect colony investment in worker number, body size, size distributions, and individual percent fat mass. We reared field-collected colonies on one of four macronutrient treatment supplements: water, amino acids, carbohydrates, and amino acid and carbohydrates. Having access to carbohydrates nearly doubled colony biomass after 60 days. This increase in biomass resulted from an increase in worker number and mean worker size. Access to carbohydrates also altered worker body size distributions. Finally, we found a negative relationship between worker number and size, suggesting a tradeoff in colony investment strategies. This tradeoff was more pronounced for colonies without access to carbohydrate resources. The monopolization of plant-based resources has been implicated in the ecological success of ants. Our results shed light on a possible mechanism for this success, and also have implications for the success of introduced species. In addition to increases in colony size, our results suggest that having access to plant-based carbohydrates can also result in larger workers that may have better individual fighting ability, and that can withstand greater temperature fluctuations and periods of food deprivation.

  10. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    Science.gov (United States)

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  11. Comparison of a carbohydrate-free diet vs. fasting on plasma glucose, insulin and glucagon in type 2 diabetes.

    Science.gov (United States)

    Nuttall, Frank Q; Almokayyad, Rami M; Gannon, Mary C

    2015-02-01

    Hyperglycemia improves when patients with type 2 diabetes are placed on a weight-loss diet. Improvement typically occurs soon after diet implementation. This rapid response could result from low fuel supply (calories), lower carbohydrate content of the weight-loss diet, and/or weight loss per se. To differentiate these effects, glucose, insulin, C-peptide and glucagon were determined during the last 24 h of a 3-day period without food (severe calorie restriction) and a calorie-sufficient, carbohydrate-free diet. Seven subjects with untreated type 2 diabetes were studied. A randomized-crossover design with a 4-week washout period between arms was used. Results from both the calorie-sufficient, carbohydrate-free diet and the 3-day fast were compared with the initial standard diet consisting of 55% carbohydrate, 15% protein and 30% fat. The overnight fasting glucose concentration decreased from 196 (standard diet) to 160 (carbohydrate-free diet) to 127 mg/dl (fasting). The 24 h glucose and insulin area responses decreased by 35% and 48% on day 3 of the carbohydrate-free diet, and by 49% and 69% after fasting. Overnight basal insulin and glucagon remained unchanged. Short-term fasting dramatically lowered overnight fasting and 24 h integrated glucose concentrations. Carbohydrate restriction per se could account for 71% of the reduction. Insulin could not entirely explain the glucose responses. In the absence of carbohydrate, the net insulin response was 28% of the standard diet. Glucagon did not contribute to the metabolic adaptations observed. Published by Elsevier Inc.

  12. Radiographic element

    International Nuclear Information System (INIS)

    Abbott, T.I.; Jones, C.G.

    1984-01-01

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  13. Chemoselective Reactions for the Synthesis of Glycoconjugates from Unprotected Carbohydrates

    DEFF Research Database (Denmark)

    Villadsen, Klaus; Martos Maldonado, Manuel Cristo; Jensen, Knud Jørgen

    2017-01-01

    Glycobiology is the comprehensive biological investigation of carbohydrates. The study of the role and function of complex carbohydrates often requires the attachment of carbohydrates to surfaces, their tagging with fluorophores, or their conversion into natural or non-natural glycoconjugates......, such as glycopeptides or glycolipids. Glycobiology and its “omics”, glycomics, require easy and robust chemical methods for the construction of these glycoconjugates. This review gives an overview of the rapidly expanding field of chemical reactions that selectively convert unprotected carbohydrates...

  14. Renewable Hydrogen Carrier - Carbohydrate: Constructing the Carbon-Neutral Carbohydrate Economy

    Science.gov (United States)

    2011-01-31

    combinations have been investigated for the production of hydrogen from biomass carbohydrate. Chemical catalysis approaches include pyrolysis [19...temperature. High fructose corn syrup, low-cost sucrose replacement, is made by stabilized glucose isomerase, which can work at ~60 °C for even about two...gasoline, vegetable oil vs. biodiesel, corn kernels vs. ethanol [31,109]. Given a price of $0.18/kg carbohydrate (i.e., $10.6/GJ) [2,44], the hydrogen

  15. The effect of carbohydrate and fat variation in euenergetic diets on postabsorptive free fatty acid release

    NARCIS (Netherlands)

    Bisschop, PH; Ackermans, MT; Endert, E; Ruiter, AFC; Meijer, AJ; Kuipers, F; Sauerwein, HP; Romijn, JA

    Diet composition and energy content modulate free fatty acid (FFA) release. The aim of this study was to evaluate the dose-response effects of euenergetic variations in dietary carbohydrate and fat content on postabsorptive FFA release. The rate of appearance (R-a) of palmitate was measured by

  16. Effects of ratios of non-fibre carbohydrates to rumen degradable ...

    African Journals Online (AJOL)

    To evaluate the effect of different ratios of non-fibre carbohydrates (NFC) to rumen degradable protein (RDP) on lactation responses, digestion and dry matter intake (DMI), nine multiparous mid-lactation Holstein cows, averaging 171 +-17 days in milk and 24.1+-3.3 kg of milk/d were assigned to a 3 x 3 Latin square design.

  17. Prediction and analysis of human thoracic impact responses and injuries in cadaver impacts using a full human body finite element model.

    Science.gov (United States)

    Ruan, Jesse; El-Jawahri, Raed; Chai, Li; Barbat, Saeed; Prasad, Priya

    2003-10-01

    Human thoracic dynamic responses and injuries associated with frontal impact, side impact, and belt loading were investigated and predicted using a complete human body finite element model for an average adult male. The human body model was developed to study the impact biomechanics of a vehicular occupant. Its geometry was based on the Visible Human Project (National Library of Medicine) and the topographies from human body anatomical texts. The data was then scaled to an average adult male according to available biomechanical data from the literature. The model includes details of the head, neck, ribcage, abdomen, thoracic and lumbar spine, internal organs of the chest and abdomen, pelvis, and the upper and lower extremities. The present study is focused on the dynamic response and injuries of the thorax. The model was validated at various impact speeds by comparing predicted responses with available experimental cadaver data in frontal and side pendulum impacts, as well as belt loading. Model responses were compared with similar individual cadaver tests instead of using cadaver corridors because the large differences between the upper and lower bounds of the corridors may confound the model validation. The validated model was then used to study thorax dynamic responses and injuries in various simulated impact conditions. Parameters that could induce injuries such as force, deflection, and stress were computed from model simulations and were compared with previously proposed thoracic injury criteria to assess injury potential for the thorax. It has been shown that the model exhibited speed sensitive impact characteristics, and the compressibility of the internal organs significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated FE human body model could be useful for injury assessment in various cadaveric impacts reported in the literature. Internal organ injuries, which are

  18. The effect of stereochemistry on carbohydrate hydration in aqueous solutions

    NARCIS (Netherlands)

    Galema, Saskia Alexandra

    1992-01-01

    Although-carbohydrates are widely used, not much is known about the stereochemical aspects of hydration of carbohydrates. For D-aldohexoses, for example, there are eight different stereoisomers. Just how the hydroxy topology of a carbohydrate molecule influences the hydration behaviour in water is

  19. The Seismic Response of High-Speed Railway Bridges Subjected to Near-Fault Forward Directivity Ground Motions Using a Vehicle-Track-Bridge Element

    Directory of Open Access Journals (Sweden)

    Chen Ling-kun

    2014-01-01

    Full Text Available Based on the Next Generation Attenuation (NGA project ground motion library, the finite element model of the high-speed railway vehicle-bridge system is established. The model was specifically developed for such system that is subjected to near-fault ground motions. In addition, it accounted for the influence of the rail irregularities. The vehicle-track-bridge (VTB element is presented to simulate the interaction between train and bridge, in which a train can be modeled as a series of sprung masses concentrated at the axle positions. For the short period railway bridge, the results from the case study demonstrate that directivity pulse effect tends to increase the seismic responses of the bridge compared with far-fault ground motions or nonpulse-like motions and the directivity pulse effect and high values of the vertical acceleration component can notably influence the hysteretic behaviour of piers.

  20. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    Science.gov (United States)

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-10-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

  1. Phakopsora euvitis Causes Unusual Damage to Leaves and Modifies Carbohydrate Metabolism in Grapevine

    Directory of Open Access Journals (Sweden)

    Antonio F. Nogueira Júnior

    2017-09-01

    Full Text Available Asian grapevine rust (Phakopsora euvitis is a serious disease, which causes severe leaf necrosis and early plant defoliation. These symptoms are unusual for a strict biotrophic pathogen. This work was performed to quantify the effects of P. euvitis on photosynthesis, carbohydrates, and biomass accumulation of grapevine. The reduction in photosynthetic efficiency of the green leaf tissue surrounding the lesions was quantified using the virtual lesion concept (β parameter. Gas exchange and responses of CO2 assimilation to increasing intercellular CO2 concentration were analyzed. Histopathological analyses and quantification of starch were also performed on diseased leaves. Biomass and carbohydrate accumulation were quantified in different organs of diseased and healthy plants. Rust reduced the photosynthetic rate, and β was estimated at 5.78, indicating a large virtual lesion. Mesophyll conductance, maximum rubisco carboxylation rate, and regeneration of ribulose-1,5-bisphosphate dependent on electron transport rate were reduced, causing diffusive and biochemical limitations to photosynthesis. Hypertrophy, chloroplast degeneration of mesophyll cells, and starch accumulation in cells close to lesions were observed. Root carbohydrate concentration was reduced, even at low rust severity. Asian grapevine rust dramatically reduced photosynthesis and altered the dynamics of production and accumulation of carbohydrates, unlike strict biotrophic pathogens. The reduction in carbohydrate reserves in roots would support polyetic damage on grapevine, caused by a polycyclic disease.

  2. Standard elements; Elements standards

    Energy Technology Data Exchange (ETDEWEB)

    Blanc, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Following his own experience the author recalls the various advantages, especially in the laboratory, of having pre-fabricated vacuum-line components at his disposal. (author) [French] A la suite de sa propre experience, l'auteur veut rappeler les divers avantages que presente, tout particulierement en laboratoire, le fait d'avoir a sa disposition des elements pre-fabriques de canalisations a vide. (auteur)

  3. MBTH: A novel approach to rapid, spectrophotometric quantitation of total algal carbohydrates.

    Science.gov (United States)

    Van Wychen, Stefanie; Long, William; Black, Stuart K; Laurens, Lieve M L

    2017-02-01

    A high-throughput and robust application of the 3-methyl-2-benzothiazolinone hydrazone (MBTH) method was developed for carbohydrate determination in microalgae. The traditional phenol-sulfuric acid method to quantify carbohydrates is strongly affected by algal biochemical components and exhibits a highly variable response to microalgal monosaccharides. We present a novel use of the MBTH method to accurately quantify carbohydrates in hydrolyzate after acid hydrolysis of algal biomass, without a need for neutralization. The MBTH method demonstrated consistent and sensitive quantitation of algae-specific monosaccharides down to 5 μg mL -1 without interference from other algae acidic hydrolyzate components. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors.

    Science.gov (United States)

    Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho

    2005-12-01

    The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.

  5. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Energy Technology Data Exchange (ETDEWEB)

    Chan, T; Griffith, P; Nakka, B W; Khair, K R

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs.

  6. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    International Nuclear Information System (INIS)

    Chan, T.; Griffith, P.; Nakka, B.W.; Khair, K.R.

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs

  7. Phosphorylated cAMP response element-binding protein as a molecular marker of memory processing in rat hippocampus: effect of novelty

    OpenAIRE

    Viola, Haydée Ana María; Furman, Melina; Izquierdo, Luciana Adriana; Alonso, Mariana; Barros, Daniela Martí; Souza, Márcia Maria de; Izquierdo, Ivan Antônio; Medina, Jorge Horacio

    2000-01-01

    From mollusks to mammals the activation of cAMP response element-binding protein (CREB) appears to be an important step in the formation of long-term memory (LTM). Here we show that a 5 min exposure to a novel environment (open field) 1 hr after acquisition of a one-trial inhibitory avoidance training hinders both the formation of LTM for the avoidance task and the increase in the phosphorylation state of hippocampal Ser 133 CREB [phosphorylated CREB (pCREB)] associated with the avoidance tra...

  8. Disorders of carbohydrate metabolism in clinical practice

    Directory of Open Access Journals (Sweden)

    V.I. Pankiv

    2017-02-01

    Full Text Available Considering the prevalence of diabetes mellitus (DM, the possibility of early and rapid progress of complications, a large number of undiagnosed cases and disappointing forecasts of the World Health Organization on the prospects of DM spreading in the world, timely and accurate diagnosis of carbohydrate metabolism disorders is important. The criteria for the diagnosis of carbohydrate metabolism and DM are shown in the article. The article includes a new consensus on the staging of type 1 DM and a discussion of a proposed unifying diabetes classification scheme that focuses on β-cell dysfunction and disease stage as indicated by glucose status. Modern recommendations 2017 of the American Diabetes Association are shown in relation to the criteria of diagnostics of impaired fasting glucose, impaired glucose tolerance and diabetes mellitus. The value of insulin resistance and functional state of pancreatic β-cells is underlined in determination of type 2 DM duration. A plan of type 2 DM management is brought.

  9. Solubility of carbohydrates in heavy water.

    Science.gov (United States)

    Cardoso, Marcus V C; Carvalho, Larissa V C; Sabadini, Edvaldo

    2012-05-15

    The solubility of several mono-(glucose and xylose), di-(sucrose and maltose), tri-(raffinose) and cyclic (α-cyclodextrin) saccharides in H(2)O and in D(2)O were measured over a range of temperatures. The solution enthalpies for the different carbohydrates in the two solvents were determined using the vant' Hoff equation and the values in D(2)O are presented here for the first time. Our findings indicate that the replacement of H(2)O by D(2)O remarkably decreases the solubilities of the less soluble carbohydrates, such as maltose, raffinose and α-cyclodextrin. On the other hand, the more soluble saccharides, glucose, xylose, and sucrose, are practically insensitive to the H/D replacement in water. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Role of carbohydrate metabolism in grass tetany

    Energy Technology Data Exchange (ETDEWEB)

    Miller, J.K.; Madsen, F.C.; Lentz, D.E.; Hansard, S.L.

    1977-01-01

    Clinical hypomagnesemia is confined primarily to beef cattle in the United States but also occurs in dairy cattle in other countries, probably due to different management practices. During periods when grass tetany is likely, early vegetative temperate zone grasses are usually low in total readily available carbohydrates and magnesium but high in potassium and nitrogen. The tetany syndrome may include hypoglycemia and ketosis, suggesting an imbalance in intermediary energy metabolism. Many enzyme systems critical to cellular metabolism, including those which hydrolyze and transfer phosphate groups, are activated by Mg. Thus, by inference, Mg is required for normal glucose utilization, fat, protein, nucleic acid and coenzyme synthesis, muscle contraction, methyl group transfer, and sulfate, acetate, and formate activation. Numerous clinical and experimental studies suggest an intimate relationship between metabolism of Mg and that of carbohydrate, glucagon, and insulin. The objective is to review this literature and suggest ways in which these relationships might contribute to a chain of events leading to grass tetany.

  11. Carbocyclic Carbohydrate Mimics as Potential Glycosidase Inhibitors

    DEFF Research Database (Denmark)

    Fanefjord, Mette; Lundt, Inge

    It has been proven that aminocyclopentanols having the aminogroup adjacent to a carbon sidechain could be potential anomer-selective glycosidase inhibitors [1]. A successful pathway for synthesising mimics to L-carbohydrates 2, by introducing nitrogen to the C6 position in compound 1, has been...... developed in our group. A similar strategy has been used for synthesising mimics of D-carbohydrates. The α,β-unsaturated lactone 3 was cyclised to compound 4 which was further transformed into 5. The nitrogen functionality in compound 7 is introduced by an Overman rearrangement of 6 and the hydroxyl...... functionalities was introduced by either epoxidation or dihydroxylation of 7. Finally, reduction of the lactone ring led to the sugar mimics 8. The synthesis of several isomers of 8 will be presented. [1] a) Kleban, M. ; Hilgers, P. ; Greul, J.N. ; Kugler, R.D. ; Li, J. ; Picasso, S. ; Vogel, P. ; Jäger, V. Chem...

  12. MsmK, an ATPase, Contributes to Utilization of Multiple Carbohydrates and Host Colonization of Streptococcus suis.

    Science.gov (United States)

    Tan, Mei-Fang; Gao, Ting; Liu, Wan-Quan; Zhang, Chun-Yan; Yang, Xi; Zhu, Jia-Wen; Teng, Mu-Ye; Li, Lu; Zhou, Rui

    2015-01-01

    Acquisition and metabolism of carbohydrates are essential for host colonization and pathogenesis of bacterial pathogens. Different bacteria can uptake different lines of carbohydrates via ABC transporters, in which ATPase subunits energize the transport though ATP hydrolysis. Some ABC transporters possess their own ATPases, while some share a common ATPase. Here we identified MsmK, an ATPase from Streptococcus suis, an emerging zoonotic bacterium causing dead infections in pigs and humans. Genetic and biochemistry studies revealed that the MsmK was responsible for the utilization of raffinose, melibiose, maltotetraose, glycogen and maltotriose. In infected mice, the msmK-deletion mutant showed significant defects of survival and colonization when compared with its parental and complementary strains. Taken together, MsmK is an ATPase that contributes to multiple carbohydrates utilization and host colonization of S. suis. This study gives new insight into our understanding of the carbohydrates utilization and its relationship to the pathogenesis of this zoonotic pathogen.

  13. Analysis and validation of carbohydrate three-dimensional structures

    International Nuclear Information System (INIS)

    Lütteke, Thomas

    2009-01-01

    The article summarizes the information that is gained from and the errors that are found in carbohydrate structures in the Protein Data Bank. Validation tools that can locate these errors are described. Knowledge of the three-dimensional structures of the carbohydrate molecules is indispensable for a full understanding of the molecular processes in which carbohydrates are involved, such as protein glycosylation or protein–carbohydrate interactions. The Protein Data Bank (PDB) is a valuable resource for three-dimensional structural information on glycoproteins and protein–carbohydrate complexes. Unfortunately, many carbohydrate moieties in the PDB contain inconsistencies or errors. This article gives an overview of the information that can be obtained from individual PDB entries and from statistical analyses of sets of three-dimensional structures, of typical problems that arise during the analysis of carbohydrate three-dimensional structures and of the validation tools that are currently available to scientists to evaluate the quality of these structures

  14. A rapid stereoselective synthesis of fluorinated carbohydrates

    International Nuclear Information System (INIS)

    Adam, M.J.; Neeser, J-R.; Hall, L.D.; Pate, B.D.

    1983-01-01

    Acetyl hypofluorite has been added to six unsaturated carbohydrates which contain the vinyl ether moiety. All reactions were rapid (less than 5 min.) at -78 degrees C and gave, with one exception, high yields of isomerically pure products. The hypofluorite was shown to add exclusively in a cis mode and with a strong preference for a particular 'face' of the double bond. As well as the syntheses, NMR data and preferred conformations for the fluorinated products are also discussed

  15. Hearing Loss, Dizziness, and Carbohydrate Metabolism

    OpenAIRE

    Albernaz, Pedro L. Mangabeira

    2015-01-01

    Abstract Introduction Metabolic activity of the inner ear is very intense, and makes it sensitive to changes in the body homeostasis. This study involves a group of patients with inner ear disorders related to carbohydrate metabolism disturbances, including hearing loss, tinnitus, dizziness, and episodes of vertigo. Objectives To describe the symptoms of metabolic inner ear disorders and the examinations required to establish diagnoses. These symptoms are often the first to allow for an e...

  16. The cis decoy against the estrogen response element suppresses breast cancer cells via target disrupting c-fos not mitogen-activated protein kinase activity.

    Science.gov (United States)

    Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L

    2003-05-01

    Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.

  17. An ABA-responsive element in the AtSUC1 promoter is involved in the regulation of AtSUC1 expression.

    Science.gov (United States)

    Hoth, Stefan; Niedermeier, Matthias; Feuerstein, Andrea; Hornig, Julia; Sauer, Norbert

    2010-09-01

    Abscisic acid (ABA) and sugars regulate many aspects of plant growth and development, and we are only just beginning to understand the complex interactions between ABA and sugar signaling networks. Here, we show that ABA-dependent transcription factors bind to the promoter of the Arabidopsis thaliana AtSUC1 (At1g71880) sucrose transporter gene in vitro. We present the characterization of a cis-regulatory element by truncation of the AtSUC1 promoter and by electrophoretic mobility shift assays that is identical to a previously characterized ABA-responsive element (ABRE). In yeast 1-hybrid analyses we identified ABI5 (AtbZIP39; At2g36270) and AREB3 (AtbZIP66; At3g56850) as potential interactors. Analyses of plants expressing the beta-glucuronidase reporter gene under the control of ABI5 or AREB3 promoter sequences demonstrated that both transcription factor genes are co-expressed with AtSUC1 in pollen and seedlings, the primary sites of AtSUC1 action. Mutational analyses of the identified cis-regulatory element verified its importance for AtSUC1 expression in young seedlings. In abi5-4 seedlings, we observed an increase of sucrose-dependent anthocyanin accumulation and AtSUC1 mRNA levels. This suggests that ABI5 prevents an overshoot of sucrose-induced AtSUC1 expression and confirmed a novel cross-link between sugar and ABA signaling.

  18. Response of a multi-element dosimeter to calibrated beta sources with E/sub max/ from 0.23 to 3.5 MeV

    International Nuclear Information System (INIS)

    Endres, G.W.R.; Scherpelz, R.I.; Roberson, P.L.

    1982-06-01

    The responses of several different dosimeter absorber systems were studied to determine their usefulness in beta radiation fields. Exposures to several different beta emitters were conducted at the PNL Calibrations Laboratory. The sources used are: 147 Pm, 85 Kr, U(nat), 90 Sr- 90 Y, and 106 Ru- 106 Rh. The maximum energy of these beta emitters varies from 0.23 to 3.5 MeV. The beta sources are calibrated for absorbed dose to tissue at a depth of 0.007 cm. Measurements of response for 4, 5, and 7 element versions of the dosimeter were made. All data reported were obtained from sets of three TLDs exposed under each absorber and for each of the radiation sources

  19. Impact of carbohydrates on weight regain.

    Science.gov (United States)

    Bosy-Westphal, Anja; Müller, Manfred J

    2015-07-01

    Research on obesity treatment has shifted its focus from weight loss to weight-loss maintenance strategies. The conventional approach of a low-fat diet is challenged by insights from glycemic effects of carbohydrates on body weight regulation. Metabolic and endocrine adaptations to weight loss that contribute to weight regain involve reduced energy expenditure, increased insulin sensitivity, and enhanced orexigenic signals. This review summarizes the impact of carbohydrates on energetic efficiency, partitioning of weight regain as fat and lean mass, and appetite control. Both the amount and frequency of postprandial glycemia add to body weight regulation after weight loss and strengthen the concept of glycemic index and glycemic load. In addition, dietary fiber and slowly or poorly absorbable functional sugars modify gastrointestinal peptides involved in appetite and metabolic regulation and exert prebiotic effects. Current evidence suggests that a low-glycemic load diet with a preference for low-glycemic index foods and integration of slowly digestible, poorly absorbable carbohydrates may improve weight-loss maintenance. Future studies should investigate the health benefits of low glycemic functional sweeteners (e.g., isomaltulose and tagatose).

  20. Hearing Loss, Dizziness, and Carbohydrate Metabolism.

    Science.gov (United States)

    Albernaz, Pedro L Mangabeira

    2016-07-01

    Metabolic activity of the inner ear is very intense, and makes it sensitive to changes in the body homeostasis. This study involves a group of patients with inner ear disorders related to carbohydrate metabolism disturbances, including hearing loss, tinnitus, dizziness, and episodes of vertigo. To describe the symptoms of metabolic inner ear disorders and the examinations required to establish diagnoses. These symptoms are often the first to allow for an early diagnosis of metabolic disorders and diabetes. Retrospective study of 376 patients with inner ear symptoms suggestive of disturbances of carbohydrate metabolism. The authors present patientś clinical symptoms and clinical evaluations, with emphasis on the glucose and insulin essays. Authors based their conclusions on otolaryngological findings, diagnostic procedures and treatment principles. They found that auditory and vestibular symptoms usually occur prior to other manifestations of metabolic changes, leading to an early diagnosis of hyperinsulinemia, intestinal sugar malabsorption or diabetes. Previously undiagnosed diabetes mellitus type II was found in 39 patients. The identification of carbohydrate metabolism disturbances is important not only to minimize the patients' clinical symptoms, but also to help maintain their general health.