WorldWideScience

Sample records for caprine arthritis-encephalitis lentivirus

  1. Frequency of the serological reactivity against the caprine arthritis encephalitis lentivirus gp135 in children who consume goat milk.

    Science.gov (United States)

    Tesoro-Cruz, Emiliano; Feria-Romero, Iris Angelica; Orozco-Suárez, Sandra; Hernández-González, Rafael; Silva-García, Raúl; Valladares-Salgado, Adan; Bekker-Méndez, Vilma Carolina; Blanco-Favela, Francisco; Aguilar-Setién, Alvaro

    2009-04-01

    Caprine arthritis encephalitis virus (CAEV) is a retrovirus belonging to the lentivirus genus that also includes the human immunodeficiency virus (HIV). CAEV may be transmitted to humans by goat milk consumption. It has been suggested that CAEV may also be involved in the immunological protection process against HIV, but this has not been demonstrated. Here we identified serological reactivity against CAEV gp135 in children who consumed goat milk. Thirty sera samples from children (males between 6 and 16 years of age) who regularly consumed goat milk and a negative control of 30 serum samples from children (males between 6 and 12 years) with no previous contact with goats or goat dairy products were used. All sera were tested by Western blot against CAEV antigens. There were 18/30 serum samples from goat milk consumers that were reactive to CAEV gp135, and one reacted against gp50 simultaneously; none of the 30 serum samples from nonconsumers of goat dairy products reacted to viral proteins. These results showed that the positive response to gp135 may be the result of a repetitive stimulation without viral replication or the result of CAEV replication in humans. CAEV gp135 is codified by the env gene located on the viral particle surface as well as gp50. Moreover, there are similarities between CAEV gp135 and HIV-1 gp120, so there is a possibility that CAEV replicates in humans and may participate in immunological cross-phenomena, but this should be further studied.

  2. A Polytropic Caprine Arthritis Encephalitis Virus Promoter Isolated from Multiple Tissues from a Sheep with Multisystemic Lentivirus-Associated Inflammatory Disease

    Directory of Open Access Journals (Sweden)

    Brian Murphy

    2013-08-01

    Full Text Available Caprine arthritis encephalitis virus (CAEV is a lentivirus that infects both goats and sheep and is closely related to maedi-visna virus that infects sheep; collectively, these viruses are known as small ruminant lentiviruses (SRLV. Infection of goats and sheep with SRLV typically results in discrete inflammatory diseases which include arthritis, mastitis, pneumonia or encephalomyelitis. SRLV-infected animals concurrently demonstrating lentivirus-associated lesions in tissues of lung, mammary gland, joint synovium and the central nervous system are either very rare or have not been reported. Here we describe a novel CAEV promoter isolated from a sheep with multisystemic lentivirus-associated inflammatory disease including interstitial pneumonia, mastitis, polyarthritis and leukomyelitis. A single, novel SRLV promoter was cloned and sequenced from five different anatomical locations (brain stem, spinal cord, lung, mammary gland and carpal joint synovium, all of which demonstrated lesions characteristic of lentivirus associated inflammation. This SRLV promoter isolate was found to be closely related to CAEV promoters isolated from goats in northern California and other parts of the world. The promoter was denoted CAEV-ovine-MS (multisystemic disease; the stability of the transcription factor binding sites within the U3 promoter sequence are discussed.

  3. Affinity (tropism) of caprine arthritis encephalitis virus for brain cells

    African Journals Online (AJOL)

    STORAGESEVER

    2008-11-19

    Nov 19, 2008 ... Full Length Research Paper. Affinity (tropism) of caprine arthritis encephalitis virus for brain cells. Adebayo, I. A.1*, Awoniyi, T. A. M. 1 and Olaleye, O. D.2. 1Department of Animal Production and Health, Animal Parasitology and Microbiology Research Unit, Federal University of Technology, P M B 704, ...

  4. Use of two commercial caprine arthritis-encephalitis immunoenzymatic assays for screening of arthritic goats.

    Science.gov (United States)

    Czopowicz, Michał; Szaluś-Jordanow, Olga; Moroz, Agata; Mickiewicz, Marcin; Witkowski, Lucjan; Markowska-Daniel, Iwona; Bagnicka, Emilia; Kaba, Jarosław

    2018-01-01

    Roughly one-fourth of goats infected with small ruminant lentivirus (SRLV) develop caprine arthritis-encephalitis (CAE). We compared the profile of antibody response to surface glycoprotein (SU), and combined transmembrane glycoprotein and capsid protein (TM/CA) in SRLV-infected arthritic and asymptomatic goats, and determined the ability of 2 commercial ELISAs to distinguish between arthritic and asymptomatic goats. We used sera from 312 SRLV-seropositive dairy goats in a whole-virus ELISA; 222 were collected from arthritic goats and 90 from apparently healthy goats. Sera were screened with a competitive inhibition ELISA based on SU antigen (SU-ELISA) and an indirect ELISA based on TM and CA antigens (TM/CA-ELISA). Receiver operating characteristic (ROC) curves were prepared for both ELISAs, and areas under the ROC curves (AUC) were compared. The proportion of goats with antibody response stronger to SU antigen than to TM/CA antigen was significantly higher among arthritic than asymptomatic goats (58.1% vs. 28.9%; p < 0.001). Antibody response to SU antigen was a good predictor of the arthritic form of CAE: AUC for SU-ELISA was 89.7% (95% CI: 85.2%, 94.2%), compared to 59.3% (95% CI: 51.9%, 66.8%) for TM/CA-ELISA ( p < 0.001). With the cutoff set at percentage of inhibition of 56%, SU-ELISA had sensitivity of 86.9% (95% CI: 81.9%, 90.7%) and specificity of 84.4% (95% CI: 75.6%, 90.5%) in discriminating between arthritic and asymptomatic goats.

  5. Occurrence and pathology of caprine arthritis - encephalitis in young ...

    African Journals Online (AJOL)

    APPARITION ET PATHOLOGIE DE L'ARTHRITE ET DE L'ENCEPHALITE CAPRINES CHEZ LES JEUNES CHEVRES AU KENYA Résumé Six chevreaux SEA (race “petite chèvre ... Those brought in extremis were recumbent, bleating like in extreme pain and attempted to chew. On postmortem examination, all the kids had ...

  6. Pestivirus is a common contaminant in maedi-visna and caprine arthritis-encephalitis virus stocks.

    Science.gov (United States)

    Heckert, R A; Power, C A; Briscoe, M R

    1992-01-01

    Eight different laboratory stocks of maedi-visna or caprine arthritis-encephalitis virus were examined for the presence of pestiviruses by a fixed-cell immunoperoxidase assay with polyclonal and monoclonal antibodies. All of the viral stocks examined were found to contain noncytopathic pestivirus contaminants. The panel of monoclonal antibodies could not type the isolates as being more related to bovine virus diarrhea virus or border disease virus. However, the results did indicate that all isolates were not the same, except for two from the same laboratory where the source of pestivirus contamination may have been common. PMID:1335836

  7. Specific G2 arrest of caprine cells infected with a caprine arthritis encephalitis virus expressing vpr and vpx genes from simian immunodeficiency virus

    International Nuclear Information System (INIS)

    Bouzar, Amel Baya; Guiguen, Francois; Morin, Thierry; Villet, Stephanie; Fornazero, Claudie; Garnier, Celine; Gallay, Kathy; Gounel, Francoise; Favier, Colette; Durand, Jitka; Balleydier, Sabine; Mornex, Jean Francois; Narayan, Opendra; Chebloune, Yahia

    2003-01-01

    Primate lentivirus (HIV and SIV) vpr accessory genes encode 12- to 14-kDa proteins which induce cell cycle arrest at the G2 phase of infected cells, preventing them from going through mitosis. Members of the HIV-2/SIVmac/SIVsmm group also encode a second closely related accessory protein called Vpx. Vpx and HIV Vpr are critical for virus replication in nondividing cells due to their participation in nuclear import of the preintegration complex. Caprine arthritis encephalitis virus (CAEV) and maedi visna virus are the natural lentiviruses of domestic goat and sheep, respectively, and their genomes do not carry vpr and vpx genes. In this study, we generated chimeric CAEV-based genomes carrying vpr and vpx genes from SIVmac239 and tested their ability to induce G2 cell cycle arrest in infected caprine cells. CAEV-pBSCAvpxvpr is the chimeric genome that was shown to be infectious and replication competent. Our data demonstrated that CAEV-pBSCAvpxvpr-infected goat synovial membrane cell monolayer developed more cytopathic effects and a high proportion of cells remained in the G2 phase of cell cycle. This G2 arrest was observed both at the early and at the late stages of infection, while minimal effect was observed with the parental CAEV-pBSCA. These results, described for the first time in mammalian cells other than those of primates, indicate that Vpr-induced G2 cell cycle arrest is not restricted to only primate cells. Thus, conservation of Vpx/Vpr protein functions in caprine cells suggests a possible role for these proteins in the virus life cycle and its ability to adapt to new hosts. The data presented here thus raise a pertinent question about the biological significance of the conservation of Vpr and Vpx functions in caprine cells despite the high phylogenic distance between primates and small ruminants

  8. Variability and Immunogenicity of Caprine Arthritis-Encephalitis Virus Surface Glycoprotein

    Science.gov (United States)

    Valas, S.; Benoit, C.; Baudry, C.; Perrin, G.; Mamoun, R. Z.

    2000-01-01

    The complete surface glycoprotein (SU) nucleotide sequences of three French isolates of caprine arthritis-encephalitis virus (CAEV) were determined and compared with those of previously described isolates: three American isolates and one French isolate. Phylogenetic analyses revealed the existence of four distinct and roughly equidistant evolutionary CAEV subtypes. Four conserved and five variable domains were identified in the SU. The fine specificities of antibodies produced against these domains during natural infection were examined using a pepscan analysis. Nine immunogenic segments were delineated throughout the conserved and variable domains of SU, two of them corresponding to conserved immunodominant epitopes. Antigenic determinants which may be involved in the immunopathogenic process induced by CAEV were identified. These results also provide sensitive and specific antigen peptides for the serological detection and differentiation of CAEV and visna/maedi virus infections. PMID:10846103

  9. Investigation of caprine arthritis-encephalitis virus in Sudan using competitive enzyme-linked immunosorbent assay

    Directory of Open Access Journals (Sweden)

    Rajaa H. Halfawi

    2013-06-01

    Full Text Available Aim: This seroprevalence study was carried out to detect anti Caprine Arthritis-Encephalitis Virus (CAEV antibodies in goat sera in five States in the Sudan during 2009 and 2010. Materials and Methods: In this study, four hundred and thirty two sera samples collected from five States in the Sudan were screened for anti-CAE virus antibodies using a commercial competitive ELISA (cELISA kit. Results: Out of 432 samples, 25 (5.8% tested positive using ELISA. The highest prevalence was recorded in El-gazira State (19%, whereas in Kassala State the prevalence was 10.7%, Khartoum State (0.92% and no positive antibodies were found in Northern and River Nile. Conclusion: The information obtained in this study showed that the disease spread to other states in the Sudan beside Khartoum state. Therefore, further epizootiological investigation on CAEV and Maedi Visna Virus at the country level is important to monitor its spread and determine its economic impact in the Sudan, while better control on imported animals for genetic improvement must be instituted. [Vet World 2013; 6(8.000: 558-562

  10. Characterization of a new 5' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein

    Directory of Open Access Journals (Sweden)

    Perrin Cécile

    2008-02-01

    Full Text Available Abstract Background Lentiviral genomes encode multiple structural and regulatory proteins. Expression of the full complement of viral proteins is accomplished in part by alternative splicing of the genomic RNA. Caprine arthritis encephalitis virus (CAEV and maedi-visna virus (MVV are two highly related small-ruminant lentiviruses (SRLVs that infect goats and sheep. Their genome seems to be less complex than those of primate lentiviruses since SRLVs encode only three auxiliary proteins, namely, Tat, Rev, and Vif, in addition to the products of gag, pol, and env genes common to all retroviruses. Here, we investigated the central part of the SRLV genome to identify new splice elements and their relevance in viral mRNA and protein expression. Results We demonstrated the existence of a new 5' splice (SD site located within the central part of CAEV genome, 17 nucleotides downstream from the SD site used for the rev mRNA synthesis, and perfectly conserved among SRLV strains. This new SD site was found to be functional in both transfected and infected cells, leading to the production of a transcript containing an open reading frame generated by the splice junction with the 3' splice site used for the rev mRNA synthesis. This open reading frame encodes two major protein isoforms of 18- and 17-kDa, named Rtm, in which the N-terminal domain shared by the Env precursor and Rev proteins is fused to the entire cytoplasmic tail of the transmembrane glycoprotein. Immunoprecipitations using monospecific antibodies provided evidence for the expression of the Rtm isoforms in infected cells. The Rtm protein interacts specifically with the cytoplasmic domain of the transmembrane glycoprotein in vitro, and its expression impairs the fusion activity of the Env protein. Conclusion The characterization of a novel CAEV protein, named Rtm, which is produced by an additional multiply-spliced mRNA, indicated that the splicing pattern of CAEV genome is more complex than

  11. A long term study of goats naturally infected with caprine arthritis-encephalitis virus.

    Science.gov (United States)

    Hanson, J; Hydbring, E; Olsson, K

    1996-01-01

    The caprine arthritis-encephalitis virus (CAEV) is a big problem in dairy goat industry. Little is known about its characteristics in naturally infected goat herds. The aims of this study were: 1) to study how antibody expression, measured by agar gel immunodiffusion test (AGIDT), varied over time in naturally infected, seropositive goats, 2) to observe clinical signs in seropositive adult goats and 3) to follow seroconversion and gamma globulin concentration in goat kids artificially reared on cow milk replacement product only, compared to kids reared on untreated goat milk. The antibody expression pattern to the viral proteins gp135 and p28 varied in the individual goat and intermittent negative reactions were seen in 19 adult animals followed for 30-91 weeks. Four seropositive goats developed clinical symptoms with difficulties to move. However, no correlation between clinical signs and antibody expression pattern was seen. During the first 27 weeks of age no kid in the milk replacement reared group (N = 4) seroconverted, but 5 of the 7 kids fed goat milk occasionally showed a positive antibody reaction. The gamma globulin concentration was significantly higher in the goat milk fed group until the kids had become more than 19 weeks old. The results show that a great variation of the antibody pattern in individual goats occurs, and therefore the AGIDT is only reliable as a herd screening test. Frequent sampling is necessary to get reliable information about spreading of the CAEV in a naturally infected goat herd. Removing kids from their dams immediately after birth combined with segregation and artificial rearing protected them from CAEV infection. However their gamma globulin concentration was initially low.

  12. Caprine nictitating membrane cell culture for production of small ruminants lentivirus antigen

    Directory of Open Access Journals (Sweden)

    Dalva Alana Aragão de Azevedo

    2015-12-01

    Full Text Available ABSTRACT. Azevedo D.A.A., Araújo J.F., Sousa A.L.M. de, Dias R.P., Souza T.S. de, Andrioli A. & Pinheiro R.R. [Caprine nictitating membrane cell culture for production of small ruminants lentivirus antigen.] Produção de antí- geno de lentivírus de pequenos ruminantes através da cultura celular de membrana nictitante caprina. Revista Brasileira de Medicina Veterinária, 37(4:316-320, 2015. Empresa Brasileira de Pesquisa Agropecuária (Embrapa Caprinos e Ovinos, Fazenda Três Lagoas, Estrada Sobral/Jordão Km 4, Sobral, CE 62010-970, Brasil. E-mail: dalvaazevedo@outlook.com Small Ruminants lentivirus (SRLV belong to the Retroviridae family and is the etiologic agent of caprine arthritis encephalitis in goats and maedi-visna in sheep. Cells of the monocytic-phagocytic lineage are the main viral targets and infected hosts cannot develop a curative immune response. We evaluated whether nictitating membrane (NM cells can be cultivated in vitro and also whether it is a feasible system for SRLV antigen production for immunodiagnosis purposes. MN cells were collected from a SRLV negative animal and cultivated in minimal essential media supplemented with bovine fetal serum. Subcultures were inoculated with caprine arthritis encephalitis virus (CAEV Cork strain, the supernatant was collected, clarified by centrifugation (3.400 g for 20 minutes, concentrated using the AMICON® system. Samples were subjected to agar gel immunodiffusion (AGID tests. MN cells presented satisfactory performance, were amenable to several subcultivation.

  13. Blood and milk polymorphonuclear leukocyte and monocyte/macrophage functions in naturally caprine arthritis encephalitis virus infection in dairy goats.

    Science.gov (United States)

    Santos, Bruna Parapinski; Souza, Fernando Nogueira; Blagitz, Maiara Garcia; Batista, Camila Freitas; Bertagnon, Heloísa Godoi; Diniz, Soraia Araújo; Silva, Marcos Xavier; Haddad, João Paulo Amaral; Della Libera, Alice Maria Melville Paiva

    2017-06-01

    The exact influence of caprine arthritis encephalitis virus (CAEV) infection on blood and milk polymorphonuclear leukocytes (PMNLs) and monocyte/macrophages of goats remains unclear. Thus, the present study sought to explore the blood and milk PMNL and monocyte/macrophage functions in naturally CAEV-infected goats. The present study used 18 healthy Saanen goats that were segregated according to sera test outcomes into serologically CAEV negative (n=8; 14 halves) and positive (n=10; 14 halves) groups. All milk samples from mammary halves with milk bacteriologically positive outcomes, somatic cell count ≥2×10 6 cellsmL -1 , and abnormal secretions in the strip cup test were excluded. We evaluated the percentage of blood and milk PMNLs and monocyte/macrophages, the viability of PMNLs and monocyte/macrophages, the levels of intracellular reactive oxygen species (ROS) and the nonopsonized phagocytosis of Staphylococcus aureus and Escherichia coli by flow cytometry. In the present study, a higher percentage of milk macrophages (CD14 + ) and milk polymorphonuclear leukocytes undergoing late apoptosis or necrosis (Annexin-V + /Propidium iodide + ) was observed in CAEV-infected goats; we did not find any further alterations in blood and milk PMNL and monocyte/macrophage functions. Thus, regarding our results, the goats naturally infected with CAEV did not reveal pronounced dysfunctions in blood and milk polymorphonuclear leukocytes and monocytes/macrophages. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Infecção experimental em cabritos pelo vírus da artrite encefalite Caprine arthritis encephalitis virus experimental infection in new-born kids

    Directory of Open Access Journals (Sweden)

    M.I.M.C. Guedes

    2001-02-01

    Full Text Available Vinte e quatro caprinos de uma semana de idade, soronegativos pela imunodifusão em gel de agar para artrite encefalite caprina (AEC, foram utilizados para estudo de infecção experimental pelo vírus da AEC. Dezesseis animais foram inoculados com lentivirus caprino, amostra Cork, oito pela via intravenosa e oito por instilação nasal. Oito animais serviram como controle, inoculados pelas vias intranasal ou intravenosa com 1ml de meio de cultura de células não infectadas. Os animais foram sacrificados aos 2, 6, 12 e 20 dias pós-inoculação (PI, e colhidas amostras do sistema nervoso central, articulações, tonsilas, linfonodos, pulmões, rins, timo, baço e intestinos delgado e grosso para histopatologia e imunoistoquímica. Um animal inoculado com o vírus da AEC pela via intranasal e sacrificado aos 20 dias PI apresentou imunomarcação positiva em um macrófago alveolar. Concluiu-se que a via aerógena é uma provável rota de infecção pelo vírus da AEC.The caprine arthritis encephalitis virus (CAEV experimental infection was studied in 24 one-week-old seronegative kids. Sixteen kids were inoculated with CAEV-Cork, with 10(6 TCID50/ml concentration, being eight inoculated intravenously, and eight intranasally. Eight animals were used as controls, being four inoculated intravenously, and four intranasally with non-infected cell culture medium. Since the day of the inoculation, clinical evaluation was performed daily, until the day of the sacrifice. Blood samples were taken for serological tests. The animals were killed in pairs at 2, 6, 12 and 20 days post-inoculation (PI and tissues samples of central nervous system, joints, tonsils, lymphonodes, lungs, kidneys, thymus, spleen, small and large intestine were collected for histopathological and immunohistochemical studies. One animal CAEV inoculated intranasally and killed at 20 days PI showed immunohistochemical positive reaction in an alveolar macrophage. It was concluded that

  15. Serological diagnostic of maedi-visna (MVV in sheep and caprine arthritis encephalitis virus (CAEV in goats in Macedonia

    Directory of Open Access Journals (Sweden)

    Mitrov Dine

    2009-11-01

    Full Text Available Maedi-Visna in sheep and CAEV in goats are diseases caused by lentiviruses with very similar antigenic characteristics. This diseases are very important for the animal husbandry because of the economical losses they cause (reduced milk yield, lower body weight, deaths, therapy expenses. The results in this article, represents the first serological confirmation for the existence of this diseases in Macedonia. Investigations showed high percent of seroprevalence in the examined herds. The seroprevalence ranges from 60.3% for Maedi-Visna to 55.8% for CAEV. Despite the presence of clinical signs of the disease, the mortality is low, witch is related to the presence of the causal agent in the field i.e. the endemic character of this diseases.

  16. The validation of housekeeping genes as a reference in quantitative Real Time PCR analysis: application in the milk somatic cells and frozen whole blood of goats infected with caprine arthritis encephalitis virus.

    Science.gov (United States)

    Jarczak, Justyna; Kaba, Jarosław; Bagnicka, Emilia

    2014-10-10

    The validation of housekeeping genes (HKGs) for normalization of RNA expression in Real-Time PCR is crucial to obtain the most reliable results. There is limited information on reference genes used in the study of gene expression in milk somatic cells and the frozen whole blood of goats. Thus, the aim of this study was to propose the most stable housekeeping genes that can be used as a reference in Real-Time PCR analysis of milk somatic cells and whole blood of goats infected with caprine arthritis encephalitis virus (CAEV). Animals were divided into two groups: non-infected (N=13) and infected with CAEV (N=13). Biological material (milk somatic cells and whole blood) was collected 4 times during the lactation period (7, 30, 100 and 240days post-partum). The expression levels of candidate reference genes were analyzed using geNorm and NormFinder software. The stability of candidates for reference gene expression was analyzed for CAEV-free (control) and CAEV-infected groups, and also for both groups together (combined group). The stability of expression of β-actin (ACTB), glyceraldehyde-3P-dehydrogenase (GAPDH), cyclophilin A (PPIA), RNA18S1, ubiquilin (UBQLN1) and ribosomal protein large subunit P0 (RPLP0) was determined in milk somatic cells, while ACTB, PPIA, RPLP0, succinate dehydrogenase complex subunit A (SDHA), zeta polypeptide (YWHAZ), battenin (CLN3), eukaryotic translation initiation factor 3K (EIF3K) and TATA box-binding protein (TBP) were measured in frozen whole blood of goats. PPIA and RPLP0 were considered as the most suitable internal controls as they were stably expressed in milk somatic cells regardless of disease status, according to NormFinder software. Furthermore, geNorm results indicated the expression of PPIA/RPLP0 genes as the best combination under these experimental conditions. The results of frozen whole blood analysis using NormFinder software revealed that the most stable reference gene in control, CAEV-infected and combined groups is

  17. Isolation and identification of a South African lentivirus from jaagsiekte lungs

    International Nuclear Information System (INIS)

    Payne, A.; York, D.F.; De Villiers, E-M.; Verwoerd, D.W.; Querat, G.; Barban, V.; Sauze, N.; Vigne, R.

    1986-01-01

    In the course of attempts to grow the jaagsiekte retrovirus in cell culture, a typical lentivirus was isolated for the first time in South Africa from adenomatous lungs. Morphologically the virus could not be distinguished from other lentiviruses, but serologically it was shown to be more closely related to visna virus than to caprine arthritis-encephalitis virus. However, a preliminary restriction enzyme analysis of the linear proviral DNA of this new lentivirus (SA-DMVV) revealed that it is significantly district from visna virus and CAEV and therefore may represent a third type of lentivirus. Antibodies to the virus were demonstrated in a number of sheep in various parts of the country, but a direct link to a disease condition was not found. Attempts to produce lung lesions by intratracheal injection of the virus have been unsuccessful to date but a transient arthritis was produced by intra-articular inoculation. Viral replication seems to be enhanced in jaagsiekte lungs

  18. Retroviral Infections in Sheep and Goats: Small Ruminant Lentiviruses and Host Interaction

    Directory of Open Access Journals (Sweden)

    Begoña M. Jugo

    2013-08-01

    Full Text Available Small ruminant lentiviruses (SRLV are members of the Retrovirus family comprising the closely related Visna/Maedi Virus (VMV and the Caprine Arthritis-Encephalitis Virus (CAEV, which infect sheep and goats. Both infect cells of the monocyte/macrophage lineage and cause lifelong infections. Infection by VMV and CAEV can lead to Visna/Maedi (VM and Caprine Arthritis-Encephalitis (CAE respectively, slow progressive inflammatory diseases primarily affecting the lungs, nervous system, joints and mammary glands. VM and CAE are distributed worldwide and develop over a period of months or years, always leading to the death of the host, with the consequent economic and welfare implications. Currently, the control of VM and CAE relies on the control of transmission and culling of infected animals. However, there is evidence that host genetics play an important role in determining Susceptibility/Resistance to SRLV infection and disease progression, but little work has been performed in small ruminants. More research is necessary to understand the host-SRLV interaction.

  19. Comparative Analysis of Tat-Dependent and Tat-Deficient Natural Lentiviruses

    Directory of Open Access Journals (Sweden)

    Deepanwita Bose

    2015-09-01

    Full Text Available The emergence of human immunodeficiency virus (HIV causing acquired immunodeficiency syndrome (AIDS in infected humans has resulted in a global pandemic that has killed millions. HIV-1 and HIV-2 belong to the lentivirus genus of the Retroviridae family. This genus also includes viruses that infect other vertebrate animals, among them caprine arthritis-encephalitis virus (CAEV and Maedi-Visna virus (MVV, the prototypes of a heterogeneous group of viruses known as small ruminant lentiviruses (SRLVs, affecting both goat and sheep worldwide. Despite their long host-SRLV natural history, SRLVs were never found to be responsible for immunodeficiency in contrast to primate lentiviruses. SRLVs only replicate productively in monocytes/macrophages in infected animals but not in CD4+ T cells. The focus of this review is to examine and compare the biological and pathological properties of SRLVs as prototypic Tat-independent lentiviruses with HIV-1 as prototypic Tat-dependent lentiviruses. Results from this analysis will help to improve the understanding of why and how these two prototypic lentiviruses evolved in opposite directions in term of virulence and pathogenicity. Results may also help develop new strategies based on the attenuation of SRLVs to control the highly pathogenic HIV-1 in humans.

  20. Emergence of caprine arthritis-encephalitis in Tanzania: Challenges ...

    African Journals Online (AJOL)

    CAEV) in dairy goats and their offspring imported from Norway was carried out in flocks located in Morogoro and Manyara regions of Tanzania. A total of 352 blood samples were collected and sent to a laboratory in Norway, where they were ...

  1. Affinity (tropism) of caprine arthritis encephalitis virus for brain cells ...

    African Journals Online (AJOL)

    The specific brain cell types infected by the (CAE) virus were determined using reverse-transcription polymerase chain reaction (RTPCR) and transmission electron microscopy (TEM techniques). TEM showed that in 85 – 90% cases, microglia were the cells specifically infected by the virus. Amplification of the genomic ...

  2. Fagocitose intensificada de Corynebacterium pseudotuberculosis por células da série monócito-macrófago de caprinos naturalmente infectados pelo vírus da artrite encefalite Enhanced phagocytosis of Corynebacterium pseudotuberculosis by monocyte-macrophage cells from goats naturally infected with caprine arthritis encephalitis vírus

    Directory of Open Access Journals (Sweden)

    Bárbara G.S. Sanches

    2012-12-01

    Full Text Available A Artrite Encefalite Caprina (AEC e a Linfadenite Caseosa (LC possuem alta incidência e transmissibilidade em pequenos ruminantes. Como ambas possuem tropismo por monócitos-macrófagos e afetam mecanismos da resposta inata do hospedeiro, acredita-se que a AEC predispõe o animal a infecções por Corynebacteruim pseudotuberculosis, agente etiológico da LC. Para confirmar esta hipótese, avaliou-se a fagocitose de células da série monócito-macrófago de cabras naturalmente infectadas pelo vírus da AEC (VAEC. Para tanto, foram utilizadas 30 cabras da raça Saanen, alocadas em dois grupos distintos, com 15 animais cada, conforme a sororreatividade de anticorpos séricos antivírus da AEC. Células mononucleares de sangue periférico foram isoladas por gradiente de densidade e plaqueadas para isolamento de células da série monócito-macrófago. Posteriormente, o ensaio de fagocitose de C. pseudotuberculosis foi realizado, após incubação por duas horas a 37ºC a 5% de CO2, e a visualização da fagocitose foi identificada por microscopia óptica. O presente estudo não encontrou diferença na porcentagem de monócito-macrófagos que realizaram fagocitose entre os diferentes grupos (P = 0,41. Todavia, a análise quantitativa de bactérias fagocitadas, demonstrou maior capacidade fagocítica pelos macrófagos-monócitos do grupo sororreagente ao vírus da AEC. Correlação entre monócitos fagocitando e macrófagos que fagocitaram mais de 12 bactérias foi observado neste grupo (r = 0,488; P = 0,006, não sendo o mesmo encontrado no grupo de animais sorroreagentes negativos. Os dados demonstram aumento na intensidade da fagocitose de macrófagos de animais infectados com o vírus da AEC.Caprine arthritis encephalitis (CAE and caseous lymphadenitis (CL have high incidence and transmissibility in small ruminants. Since both virus have tropism for macrophages and monocytes and affect the innate immune response, it is believed that CAE can

  3. Expanding Possibilities for Intervention against Small Ruminant Lentiviruses through Genetic Marker-Assisted Selective Breeding

    Directory of Open Access Journals (Sweden)

    Donald P. Knowles

    2013-06-01

    Full Text Available Small ruminant lentiviruses include members that infect sheep (ovine lentivirus [OvLV]; also known as ovine progressive pneumonia virus/maedi-visna virus and goats (caprine arthritis encephalitis virus [CAEV]. Breed differences in seroprevalence and proviral concentration of OvLV had suggested a strong genetic component in susceptibility to infection by OvLV in sheep. A genetic marker test for susceptibility to OvLV has been developed recently based on the TMEM154 gene with validation data from over 2,800 sheep representing nine cohorts. While no single genotype has been shown to have complete resistance to OvLV, consistent association in thousands of sheep from multiple breeds and management conditions highlight a new strategy for intervention by selective breeding. This genetic marker-assisted selection (MAS has the potential to be a useful addition to existing viral control measures. Further, the discovery of multiple additional genomic regions associated with susceptibility to or control of OvLV suggests that additional genetic marker tests may be developed to extend the reach of MAS in the future. This review will cover the strengths and limitations of existing data from host genetics as an intervention and outline additional questions for future genetic research in sheep, goats, small ruminant lentiviruses, and their host-pathogen interactions.

  4. Expanding Possibilities for Intervention against Small Ruminant Lentiviruses through Genetic Marker-Assisted Selective Breeding

    Science.gov (United States)

    White, Stephen N.; Knowles, Donald P.

    2013-01-01

    Small ruminant lentiviruses include members that infect sheep (ovine lentivirus [OvLV]; also known as ovine progressive pneumonia virus/maedi-visna virus) and goats (caprine arthritis encephalitis virus [CAEV]). Breed differences in seroprevalence and proviral concentration of OvLV had suggested a strong genetic component in susceptibility to infection by OvLV in sheep. A genetic marker test for susceptibility to OvLV has been developed recently based on the TMEM154 gene with validation data from over 2,800 sheep representing nine cohorts. While no single genotype has been shown to have complete resistance to OvLV, consistent association in thousands of sheep from multiple breeds and management conditions highlight a new strategy for intervention by selective breeding. This genetic marker-assisted selection (MAS) has the potential to be a useful addition to existing viral control measures. Further, the discovery of multiple additional genomic regions associated with susceptibility to or control of OvLV suggests that additional genetic marker tests may be developed to extend the reach of MAS in the future. This review will cover the strengths and limitations of existing data from host genetics as an intervention and outline additional questions for future genetic research in sheep, goats, small ruminant lentiviruses, and their host-pathogen interactions. PMID:23771240

  5. Impaired Expression of Cytokines as a Result of Viral Infections with an Emphasis on Small Ruminant Lentivirus Infection in Goats

    Directory of Open Access Journals (Sweden)

    Justyna Jarczak

    2016-07-01

    Full Text Available Knowing about the genes involved in immunity, and being able to identify the factors influencing their expressions, helps in gaining awareness of the immune processes. The qPCR method is a useful gene expression analysis tool, but studies on immune system genes are still limited, especially on the caprine immune system. Caprine arthritis encephalitis, a disease caused by small ruminant lentivirus (SRLV, causes economic losses in goat breeding, and there is no therapy against SRLV. The results of studies on vaccines against other viruses are promising. Moreover, the Marker-Assisted Selection strategy against SRLV is possible, as has been shown in sheep breeding. However, there are still many gaps in our knowledge on the caprine immune response to infection. All types of cytokines play pivotal roles in immunity, and SRLV infection influences the expression of many cytokines in different types of cells. This information encouraged the authors to examine the results of studies conducted on SRLV and other viral infections, with an emphasis on the expression of cytokine genes. This review attempts to summarize the results of studies on the expression of cytokines in the context of the SRLV infection.

  6. Small ruminant lentiviruses (SRLVs) break the species barrier to acquire new host range.

    Science.gov (United States)

    Minardi da Cruz, Juliano Cezar; Singh, Dinesh Kumar; Lamara, Ali; Chebloune, Yahia

    2013-07-23

    Zoonotic events of simian immunodeficiency virus (SIV) from non-human primates to humans have generated the acquired immunodeficiency syndrome (AIDS), one of the most devastating infectious disease of the last century with more than 30 million people dead and about 40.3 million people currently infected worldwide. Human immunodeficiency virus (HIV-1 and HIV-2), the two major viruses that cause AIDS in humans are retroviruses of the lentivirus genus. The genus includes arthritis-encephalitis virus (CAEV) and Maedi-Visna virus (MVV), and a heterogeneous group of viruses known as small ruminant lentiviruses (SRLVs), affecting goat and sheep. Lentivirus genome integrates into the host DNA, causing persistent infection associated with a remarkable diversity during viral replication. Direct evidence of mixed infections with these two closely related SRLVs was found in both sheep and goats. The evidence of a genetic continuum with caprine and ovine field isolates demonstrates the absence of an efficient species barrier preventing cross-species transmission. In dual-infected animals, persistent infections with both CAEV and MVV have been described, and viral chimeras have been detected. This not only complicates animal trade between countries but favors the risk that highly pathogenic variants may emerge as has already been observed in the past in Iceland and, more recently, in outbreaks with virulent strains in Spain. SRLVs affecting wildlife have already been identified, demonstrating the existence of emergent viruses adapted to new hosts. Viruses adapted to wildlife ruminants may acquire novel biopathological properties which may endanger not only the new host species but also domestic ruminants and humans. SRLVs infecting sheep and goats follow a genomic evolution similar to that observed in HIV or in other lentiviruses. Lentivirus genetic diversity and host factors leading to the establishment of naturally occurring virulent versus avirulent infections, in addition to

  7. Small Ruminant Lentiviruses (SRLVs Break the Species Barrier to Acquire New Host Range

    Directory of Open Access Journals (Sweden)

    Juliano Cezar Minardi da Cruz

    2013-07-01

    Full Text Available Zoonotic events of simian immunodeficiency virus (SIV from non-human primates to humans have generated the acquired immunodeficiency syndrome (AIDS, one of the most devastating infectious disease of the last century with more than 30 million people dead and about 40.3 million people currently infected worldwide. Human immunodeficiency virus (HIV-1 and HIV-2, the two major viruses that cause AIDS in humans are retroviruses of the lentivirus genus. The genus includes arthritis-encephalitis virus (CAEV and Maedi-Visna virus (MVV, and a heterogeneous group of viruses known as small ruminant lentiviruses (SRLVs, affecting goat and sheep. Lentivirus genome integrates into the host DNA, causing persistent infection associated with a remarkable diversity during viral replication. Direct evidence of mixed infections with these two closely related SRLVs was found in both sheep and goats. The evidence of a genetic continuum with caprine and ovine field isolates demonstrates the absence of an efficient species barrier preventing cross-species transmission. In dual-infected animals, persistent infections with both CAEV and MVV have been described, and viral chimeras have been detected. This not only complicates animal trade between countries but favors the risk that highly pathogenic variants may emerge as has already been observed in the past in Iceland and, more recently, in outbreaks with virulent strains in Spain. SRLVs affecting wildlife have already been identified, demonstrating the existence of emergent viruses adapted to new hosts. Viruses adapted to wildlife ruminants may acquire novel biopathological properties which may endanger not only the new host species but also domestic ruminants and humans. SRLVs infecting sheep and goats follow a genomic evolution similar to that observed in HIV or in other lentiviruses. Lentivirus genetic diversity and host factors leading to the establishment of naturally occurring virulent versus avirulent infections

  8. Molecular characterization and phylogenetic analysis of small ruminant lentiviruses isolated from Canadian sheep and goats

    Directory of Open Access Journals (Sweden)

    Bertoni Giuseppe

    2011-06-01

    Full Text Available Abstract Background Small Ruminant Lentiviruses (SRLV are widespread in Canadian sheep and goats and represent an important health issue in these animals. There is however no data about the genetic diversity of Caprine Arthritis Encephalitis Virus (CAEV or Maedi Visna Virus (MVV in this country. Findings We performed a molecular and phylogenetic analysis of sheep and goat lentiviruses from a small geographic area in Canada using long sequences from the gag region of 30 infected sheep and 36 infected goats originating from 14 different flocks. Pairwise DNA distance and phylogenetic analyses revealed that all SRLV sequences obtained from sheep clustered tightly with prototypical Maedi visna sequences from America. Similarly, all SRLV strains obtained from goats clustered tightly with prototypical US CAEV-Cork strain. Conclusions The data reported in this study suggests that Canadian and US SRLV strains share common origins. In addition, the molecular data failed to bring to light any evidence of past cross species transmission between sheep and goats, which is consistent with the type of farming practiced in this part of the country where single species flocks predominate and where opportunities of cross species transmissions are proportionately low.

  9. Caracterização molecular parcial do gene gag de amostras do vírus da artrite-encefalite caprina (CAEV isoladas de animais naturalmente infectados no Rio Grande do Sul, Brasil Molecular characterization of part of the gag gene of caprine arthritis-encephalitis virus isolated from naturally infected goats from Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Denise M. Marchesin

    1998-07-01

    Full Text Available Realizou-se a análise de parte do gene gag, que codifica para as proteínas do capsídeo viral, de 5 amostras de CAEV isolados de animais naturalmente infectados do Rio Grande do Sul, Brasil. As amostras foram analisadas por PCR e clivagem com enzimas de restrição (DdeI, HaeIII e NdeI. Fragmentos de aproximadamente 600 pb foram amplificados na PCR e submetidos à digestão enzimática. Os perfis obtidos foram comparados com as seqüências gag de 6 lentivírus de pequenos ruminantes.Os resultados obtidos permitiram separar as amostras em 3 grupos distintos. Os fragmentos observados foram diferentes dos descritos previamente.The gag gene of 5 CAEV samples, isolated from naturally infected goats from Rio Grande do Sul, Brazil, were analised by PCR and restriction endonuclease (DdeI, HaeIII e NdeI digestion. Fragments of about 600 bp were amplified by PCR and submitted to enzymatic digestion. The patterns observed were compared with the corresponding gag sequences from 6 small ruminant lentiviruses. The results obtained allowed the separation of 3 distinct groups. The restriction fragment profiles observed were different from those previously described.

  10. Soroprevalência da infecção pelo vírus da artrite-encefalite caprina (caev no rebanho de caprinos leiteiros da região da Grande Fortaleza, Ceará, Brasil Seroprevalence of the caprine arthritis-encephalitis vírus infection in dairy goats in the region of "Grande Fortaleza", Ceará, Brazil

    Directory of Open Access Journals (Sweden)

    Ana Célia Mendes Melo

    1997-03-01

    Full Text Available Foi realizada uma pesquisa sorológica, com base no teste de imunodifusão em ágar gel (AGID com antígeno (p28 do vírus Maedi/Visna, para estimar a soroprevalência da infecção pelo vírus da Artrite-Encefalite Caprina (CAEV na população de caprinos leiteiros da região da Grande Fortaleza, Ceará. O estudo abrangeu um total de oito criatórios. dos quais cinco praticam o manejo intensivo e três o manejo semi-intensivo. A população estudada é composta, por animais puros de raças exóticas como a Saanen, Parda Alpina, Anglonubiana e Toggenburg, por animais Meio Sangue e alguns sem raça definida (SRD. Foi realizado exame clinico e coleta de amostra de soro em 248 caprinos, bem como a aplicação de questinonário epidemiológico. A análise dos dados revelou uma soroprevalência de 40,73% (101/248. As amostras soropositivas foram todas provenientes das propriedades com manejo intensivo (5/8. A distribuição da soroprevalência em cada um destes criatórios foi 61% (54/89, 74,28% (26/35, 61,11% (11/18, 11,36% (5/44 e 75% (6/8. Diferença significativa (P0,05 quanto aos falares idade e sexo dos animais estudados.A serologic survey was performed using a agar gel immunodiffusion test (AGID with the Maedi/Visna virus antigen (p28 to estimate the seroprevalence of the caprine arthritisencephalitis virus infection (CAEV in a dairy goat population in the region of "Grande Fortaleza", in the state of Ceará, Brazil. In this study a total of eight flocks were examined, five included intensive and three semi-intensive managements. The population studied consisted of three groups: pure-bred animais of exotic races such as Saanen, Alpine Parda, Anglonubian and Toggenburg: crossbreeds and animais of undefined breed. Serum samples were colleted from 248 goats, clinicai analysis were performed, andan epidemiologic survey was applied. Analysis of the results showed a seroprevalence of 40.73% (101/248. All seropositive samples carne from the flocks

  11. Caprine arthritis encephalitis: productive and reproductive aspects evaluation in infected and no infected goats

    Directory of Open Access Journals (Sweden)

    Elizabeth Bohland

    2005-04-01

    Full Text Available O objetivo foi avaliar os aspectos produtivos e reprodutivos, de caprinos leiteiros, reagentes e não reagentes à prova de imunodifusão em ágar gel (IDAG, utilizando os antígenos gp135 e p28 do vírus da Artrite Encefalite Caprina (CAE. Os animais pertenciam a uma propriedade localizada no interior de São Paulo e foram acompanhados por um período de 24 meses, tendo sido realizados 3 testes sorológicos, com intervalos de 12 meses. A freqüência de ocorrência da CAE, nos três momentos foi respectivamente, 60,1%, 74,1%, e 70,5% (média de 68,3% - 566/829. O percentual de animais reagentes aumentou significativamente com a idade. A duração média da lactação (dias foi menor para reagentes e significativa nas faixas etárias 24 a 36 meses e 36 a 48 meses. A produção leiteira (kg./dia foi menor para reagentes e significativa nas faixas etárias: 12 a 24 meses maior ou igual a 48 meses. A produção total por lactação foi 21,5% menor para as cabras soropositivas. A CAE não influenciou os aspectos reprodutivos neste estudo no que se refere à idade ao primeiro parto, ao intervalo interpartos. No entanto, a média de idade ao parto entre os animais reagentes foi maior e estatisticamente significante e o peso das crias nascidas de mães reagentes com idade maior ou igual a 48 meses foi menor do que os animais nascidos de cabras não reagentes.

  12. Detection Of Caprine Arthritis Encephalitis Virus Gag-Gene By Rt ...

    African Journals Online (AJOL)

    Predominantly, cells of the monocyte-macrophage lineage were specifically infected by the virus as proviral DNA was detected in infected cultures by amplification of a 414 base-pair (bp) fragment of the viral gag-gene by Reverse Transcription- Polymerase Chain Reaction (RT-PCR) technique. The present study revealed ...

  13. ANTI-Lentivirus, Brucella abortus AND B. ovis ANTIBODIES IN SMALL RUMINANTS RAISED IN PERNAMBUCO AND BAHIA

    Directory of Open Access Journals (Sweden)

    RODOLFO DE MORAES PEIXOTO

    2016-01-01

    Full Text Available Goat and sheep production in the semi-arid northeast of Brazil has shown great economic potential. However, health problems can compromise the productivity of these animals. Given the scarcity of studies about the occurrence of these diseases, the aim of the present study was to analyze the serological diagnosis of anti-Brucella and anti-lentivirus antibodies among small ruminants in municipalities located in the Brazilian states of Bahia and Pernambuco. The samples were collected from local slaughterhouses and dairy farms. In total, 997 serum samples from animals in slaughterhouses and dairy herds were collected. In order to diagnose the caprine arthritis encephalitis virus (CAEV, the samples underwent agarose gel immunodiffusion (AGID testing. The buffered acidified antigen test (goats and agarose gel immunodiffusion test (sheep were used to detect anti-Brucella abortus and B. ovis antibodies following the methodology recommended by the Institute of Technology of Paraná (TECPAR. With anti-CAEV antibodies, seropositivity rates of 4.1% and 2.2% were recorded for animals from the slaughterhouses and dairy farms, respectively. None of the animals (goats or sheep were positive for anti-B. abortus antibodies. With B. ovis, a seropositivity rate of 6.5% (n = 13 was recorded among the 199 sheep serum samples. Results of the present study confirmed the presence of the CAE virus in the meat and dairy herds studied, although the prevalence was low. Natural infection by B. abortus did not occur in the goat and sheep herds assessed. Seropositivity for B. ovis was confirmed, although prevalence was low. Direct tests are required to diagnose ovine brucellosis.

  14. Small ruminant lentiviruses: Strain variation, viral tropism, and host genetics influence pathogenesis

    Science.gov (United States)

    Small Ruminant Lentiviruses (SRLV), which include the Maedi-Visna virus, also known as ovine progressive pneumonia virus (OPPV), and caprine arthritis and encephalitis virus (CAEV), are of global economic importance to sheep and goat producers, respectively. These viruses belong to the genus Lentivi...

  15. Detection and control of lentiviral infections in sheep and goats

    NARCIS (Netherlands)

    Brinkhof, J.M.A.

    2009-01-01

    Infections caused by the small ruminant lentiviruses (SRLV) of sheep (maedi visna virus) and goats (caprine arthritis encephalitis virus) are a serious economical threat to small ruminant farming particularly in the more intensive settings like dairy farms. Revenue is ultimately negatively

  16. Interspecific transmission of small ruminant lentiviruses from goats to sheep

    Directory of Open Access Journals (Sweden)

    Thiago S. de Souza

    2015-09-01

    Full Text Available This study was conducted in order to evaluate the transmission of caprine lentivirus to sheep using different experimental groups. The first one (colostrum group was formed by nine lambs receiving colostrum from goats positive for small ruminant lentiviruses (SRLV. The second group (milk group was established by nine lambs that received milk of these goats. Third was a control group, consisting of lambs that suckled colostrum and milk of negative mothers. Another experimental group (contact group was formed by eight adult sheep, confined with two naturally infected goats. The groups were monitored by immunoblotting (IB, enzyme-linked immunosorbent assay (ELISA, agar gel immunodiffusion (AGID and nested polymerase chain reaction (nPCR. All lambs that suckled colostrum and milk of infected goats and six sheep of the contact group had positive results in the nPCR, although seroconversion was detected only in three of the exposed animals, with no clinical lentiviruses manifestation, in 720 days of observation. There was a close relationship between viral sequences obtained from infected animals and the prototype CAEV-Cork. Thus, it was concluded that SRLV can be transmitted from goats to sheep, however, the degree of adaptation of the virus strain to the host species probably interferes with the infection persistence and seroconversion rate.

  17. Seroprevalence of contagious caprine pleuropneumonia in Borana ...

    African Journals Online (AJOL)

    Nigatu, B., 2003. Epidemiology and Serosurveillance of Contagious Caprine. Pleuropneumonia in Dire Dawa Administrative Region. Vet. Rec., 131, 585-600. OIE, 2004. Contagious Caprine Pleuropneumonia. Manual of Standards for Diagnostic. Tests and Vaccine for Terrestrial Animals. Office International Des Epizooties.

  18. Seroconversion and seroreactivity patterns of dairy goats naturally exposed to caprine arthritis-encephalitis virus in Brazil Soroconversão e sororeatividade de cabras leiteiras naturalmente expostas ao virus da artrite-encefalite caprina no Brasil

    Directory of Open Access Journals (Sweden)

    Roberto Soares Castro

    2002-08-01

    Full Text Available A labelled avidin-biotin ELISA (lab-ELISA using repeated serum samples of goats showed a progressive seroconversion with higher seroconversion rate at the period going from the beginning of the breeding up to the last half of lactation (35.0%, compared to that recorded at the beginning of breeding (17.8%(pForam realizados exames sorológicos em cabras leiteiras, utilizando-se ELISA marcado com avidina-biotina (LAB-ELISA. Esses exames mostraram soroconversão progressiva, com uma taxa maior entre os animais a partir do início da reprodução até a última metade da lactação (35% comparada à observada nos animais até o início da reprodução (17,8%(p<0,05. Além disso, o padrão de sororeatividade das amostras colhidas a cada 30-40 dias, durante 12 meses, avaliado pelo LAB-ELISA, foi caracterizado por alta variabilidade individual. Não foi observada sororeversão, e títulos mais altos foram obtidos mais no grupo constituído por animais que entraram em lactação (n=6, média de títulos=913,4 do que no grupo constituído por animais que cruzaram, mas não conceberam (n=4, média de títulos=261,2(p<0,01.

  19. Immunization against Small Ruminant Lentiviruses

    Directory of Open Access Journals (Sweden)

    Beatriz Amorena

    2013-08-01

    Full Text Available Multisystemic disease caused by Small Ruminant Lentiviruses (SRLV in sheep and goats leads to production losses, to the detriment of animal health and welfare. This, together with the lack of treatments, has triggered interest in exploring different strategies of immunization to control the widely spread SRLV infection and, also, to provide a useful model for HIV vaccines. These strategies involve inactivated whole virus, subunit vaccines, DNA encoding viral proteins in the presence or absence of plasmids encoding immunological adjuvants and naturally or artificially attenuated viruses. In this review, we revisit, comprehensively, the immunization strategies against SRLV and analyze this double edged tool individually, as it may contribute to either controlling or enhancing virus replication and/or disease.

  20. Immunogenetics of Small Ruminant Lentiviral Infections

    Directory of Open Access Journals (Sweden)

    Nancy Stonos

    2014-08-01

    Full Text Available The small ruminant lentiviruses (SRLV include the caprine arthritis encephalitis virus (CAEV and the Maedi-Visna virus (MVV. Both of these viruses limit production and can be a major source of economic loss to producers. Little is known about how the immune system recognizes and responds to SRLVs, but due to similarities with the human immunodeficiency virus (HIV, HIV research can shed light on the possible immune mechanisms that control or lead to disease progression. This review will focus on the host immune response to HIV-1 and SRLV, and will discuss the possibility of breeding for enhanced SRLV disease resistance.

  1. Rev Variation during Persistent Lentivirus Infection

    Directory of Open Access Journals (Sweden)

    Karin S. Dorman

    2011-01-01

    Full Text Available The ability of lentiviruses to continually evolve and escape immune control is the central impediment in developing an effective vaccine for HIV-1 and other lentiviruses. Equine infectious anemia virus (EIAV is considered a useful model for immune control of lentivirus infection. Virus-specific cytotoxic T lymphocytes (CTL and broadly neutralizing antibody effectively control EIAV replication during inapparent stages of disease, but after years of low-level replication, the virus is still able to produce evasion genotypes that lead to late re-emergence of disease. There is a high rate of genetic variation in the EIAV surface envelope glycoprotein (SU and in the region of the transmembrane protein (TM overlapped by the major exon of Rev. This review examines genetic and phenotypic variation in Rev during EIAV disease and a possible role for Rev in immune evasion and virus persistence.

  2. A primitive endogenous lentivirus in a colugo: insights into the early evolution of lentiviruses.

    Science.gov (United States)

    Han, Guan-Zhu; Worobey, Michael

    2015-01-01

    Lentiviruses infect a wide range of mammal species. Much remains unknown about their deep history and host distribution. Here, we report the discovery of an endogenous lentivirus within the genome of the Sunda flying lemur (Galeopterus variegatus) (which we designate "Galeopterus variegatus endogenous lentivirus" [GvaELV]). We estimate the GvaELV genome invasion to have occurred more than 14 Ma, supporting an ancient origin of the lentivirus clade and an ancient lentiviral infection in colugo. Phylogenetic analyses show that GvaELV is a sister group of all previously known lentiviruses. The GvaELV genome appears to possess some primitive genomic features of a lentivirus, encoding not only a trans-activator of transcription (tat) gene but also two additional putative accessory genes that share no discernible similarity with other lentiviral accessory genes. The discovery of GvaELV provides novel insights into the prehistory and host distribution of lentivirus. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Immune evasion strategies of the primate lentiviruses.

    Science.gov (United States)

    Evans, D T; Desrosiers, R C

    2001-10-01

    Individuals infected with human immunodeficiency virus (HIV) and macaques infected with simian immunodeficiency virus (SIV) make vigorous virus-specific antibody and cellular immune responses. Despite these responses, virus replication continues at all stages of infection and ultimately leads to immunological collapse, onset of opportunistic infections and death of infected hosts. Thus, the strategies by which HIV and SIV evade antiviral immune surveillance are fundamental to understanding lentiviral pathogenesis and crucial for our ability to develop effective strategies. It has become increasingly clear that the primate lentiviruses have evolved multiple and complementary mechanisms to circumvent host immune responses. Here we review these mechanisms of immune evasion considering contributions from both human and non-human primate systems.

  4. Caprine Monocytes Release Extracellular Traps against Neospora caninum In Vitro

    Directory of Open Access Journals (Sweden)

    Zhengtao Yang

    2018-01-01

    Full Text Available Neospora caninum is an obligate intracellular apicomplexan parasite that causes reproductive loss and severe economic losses in dairy and goat industry. In the present study, we aim to investigate the effects of N. caninum tachyzoites on the release of extracellular traps (ETs in caprine monocytes and furthermore elucidated parts of its molecular mechanisms. N. caninum tachyzoite-induced monocytes-derived ETs formation was detected by scanning electron microscopy. H3 and myeloperoxidase (MPO within monocyte-ETs structures were examined using laser scanning confocal microscopy analyses. The results showed that N. caninum tachyzoites were not only able to trigger ETs formation in caprine monocytes, but also that monocyte-released ETs were capable of entrapping viable tachyzoites. Histones and MPO were found to be decorating the DNA within the monocytes derived-ETs structures thus proving the classical components of ETs. Furthermore, inhibitors of NADPH oxidase-, MPO-, ERK 1/2-, or p38 MAPK-signaling pathway significantly decreased N. caninum tachyzoite-triggered caprine monocyte-derived ETosis. This is the first report of ETs release extruded from caprine monocytes after N. caninum exposure and thus showing that this early innate immune effector mechanism might be relevant during the acute phase of caprine neosporosis.

  5. Parallel germline infiltration of a lentivirus in two Malagasy lemurs.

    Directory of Open Access Journals (Sweden)

    Clément Gilbert

    2009-03-01

    Full Text Available Retroviruses normally infect the somatic cells of their host and are transmitted horizontally, i.e., in an exogenous way. Occasionally, however, some retroviruses can also infect and integrate into the genome of germ cells, which may allow for their vertical inheritance and fixation in a given species; a process known as endogenization. Lentiviruses, a group of mammalian retroviruses that includes HIV, are known to infect primates, ruminants, horses, and cats. Unlike many other retroviruses, these viruses have not been demonstrably successful at germline infiltration. Here, we report on the discovery of endogenous lentiviral insertions in seven species of Malagasy lemurs from two different genera -- Cheirogaleus and Microcebus. Combining molecular clock analyses and cross-species screening of orthologous insertions, we show that the presence of this endogenous lentivirus in six species of Microcebus is the result of one endogenization event that occurred about 4.2 million years ago. In addition, we demonstrate that this lentivirus independently infiltrated the germline of Cheirogaleus and that the two endogenization events occurred quasi-simultaneously. Using multiple proviral copies, we derive and characterize an apparently full length and intact consensus for this lentivirus. These results provide evidence that lentiviruses have repeatedly infiltrated the germline of prosimian species and that primates have been exposed to lentiviruses for a much longer time than what can be inferred based on sequence comparison of circulating lentiviruses. The study sets the stage for an unprecedented opportunity to reconstruct an ancestral primate lentivirus and thereby advance our knowledge of host-virus interactions.

  6. Prevalence Of Caprine Strongyle Infection And The Diagnostic ...

    African Journals Online (AJOL)

    The prevalence of caprine strongyle infections and the diagnostic efficacy of some culture media in supporting the recovery of strongyle larvae were evaluated using 840 faecal sampes collected from goats during slaughter at Maiduguri Metropolitan abattoir. Faecal examination conducted by the modfied McMaster ...

  7. A seroprevalence study of ovine and caprine brucellosis in three ...

    African Journals Online (AJOL)

    A random survey to study the seroprevalence of ovine and caprine brucellosis was carried out between July 2008 and January 2009 in three main districts of arid and semiarid rearing regions of Somaliland. A total of 1938 sheep, and 1344 goats' blood sera were randomly collected from 42 herd/flock of accessible ...

  8. Isolation and characterization of Pasteurella multocida from caprine ...

    African Journals Online (AJOL)

    By conventional microbiological methods, investigation was carried out in Nsukka and Enugu areasof Enugu State, Nigeria to determne the percentage frequency of occurrence of Pasteurella multocida from caprine pneumonic lungs in Nsukka and Enugu areas of Enugu State, Nigeria. In this study that spanned 12 years, ...

  9. Association of SLC11A1 gene polymorphism with caprine ...

    Indian Academy of Sciences (India)

    Navya

    2017-01-16

    Jan 16, 2017 ... 1984). Infections with MAP in caprine herds result in significant economic loss, through slow progressive wasting and the subsequent death of the infected ... Institutional Animal Ethics Committee of Kerala Veterinary and Animal Sciences University. Blood, serum and faecal samples were collected from one ...

  10. Binding properties of beetal recombinant caprine growth hormone to ...

    African Journals Online (AJOL)

    SAM

    2014-07-23

    Jul 23, 2014 ... The aim of the study was to illustrate the radio-receptor assay of beetal recombinant caprine growth hormone (rcGH) ... interaction with microsomal membrane that shall be beneficial to study hormone receptor interactions of other Bovidae .... adding 1 ml of ice cold assay buffer, followed by 1 ml of 25% (w/v).

  11. Binding properties of beetal recombinant caprine growth hormone to ...

    African Journals Online (AJOL)

    The aim of the study was to illustrate the radio-receptor assay of beetal recombinant caprine growth hormone (rcGH). Tracer (125I-rcGH) was prepared by iodinating beetal rcGH with iodine-125 and its biological activity was analyzed by rabbit anti-rcGH antibodies. Liver microsomal membranes of the Bovidae species ...

  12. Cross-Sectional Study on Contagious Caprine Pleuro Pneumonia in ...

    African Journals Online (AJOL)

    Contagious caprine pleuro-pneumonia (CCPP) is an important, devastating disease of goats and sheep, caused by Mycoplasma capricolum subspecies capripneumoniae ( Mccp). In Uganda the disease occurs mainly in the Karamoja region and the surrounding districts. It is a devastating disease of goats, caused by ...

  13. Haplotype combination of the caprine PC1 gene sequence variants ...

    Indian Academy of Sciences (India)

    Mutations in PC1 gene are related to obesity-related traits which may influence the performance of animals, and therefore it has been the focus of this study. In this study, polymorphisms of the caprine PC1 gene were detected in. 407 individuals from three breeds by PCR-SSCP and DNA sequencing methods. The results ...

  14. Sero-prevalence and associated risk factors of contagious Caprine ...

    African Journals Online (AJOL)

    Sero-prevalence and associated risk factors of contagious Caprine pleuropneumonia in goats in selected districts of bale zone pastoral area, south eastern Ethiopia. ... Multivariable logistic regression statistical analysis revealed that age category, flock size, newly introduced goats and accessibility to veterinary service ...

  15. Age Related Variations in The Architecture of Caprine Haemal Nodes

    African Journals Online (AJOL)

    Age related variations in the architecture of caprine haemal nodes were studied in West African dwarf goats aged between 1-24 months. Variations were observed in the thickness of the capsule, the content and organization of the cortical and medullary parenchyma as well as the stroma. In young goats age between 1-4 ...

  16. Determination of risk factors and level of awareness of caprine ...

    African Journals Online (AJOL)

    In Oju, goats are the major livestock kept and there is a well established goat market held every five days. This study was aimed at determining the risk factors associated with caprine brucellosis and assessing level of awareness amongst goat owners in Oju Local Government Area (LGA) of Benue State using a structured ...

  17. Oligopeptide-based enzyme immunoassay for ovine lentivirus antibody detection.

    OpenAIRE

    Kwang, J; Torres, J V

    1994-01-01

    Ovine progressive pneumonia virus (OPPV) is a lentivirus which causes a progressive disease in sheep. Immunodominant epitopes have been identified in the envelope gp40 glycoprotein. Synthetic peptides representing these regions are able to detect the presence of OPPV antibodies in 96% of infected sheep.

  18. Endogenous lentivirus in Malayan colugo (Galeopterus variegatus), a close relative of primates.

    Science.gov (United States)

    Hron, Tomáš; Fábryová, Helena; Pačes, Jan; Elleder, Daniel

    2014-10-04

    A significant fraction of mammalian genomes is composed of endogenous retroviral (ERV) sequences that are formed by germline infiltration of various retroviruses. In contrast to other retroviral genera, lentiviruses only rarely form ERV copies. We performed a computational search aimed at identification of novel endogenous lentiviruses in vertebrate genomes. Using the in silico strategy, we have screened 104 publicly available vertebrate genomes for the presence of endogenous lentivirus sequences. In addition to the previously described cases, the search revealed the presence of endogenous lentivirus in the genome of Malayan colugo (Galeopterus variegatus). At least three complete copies of this virus, denoted ELVgv, were detected in the colugo genome, and approximately one hundred solo LTR sequences. The assembled consensus sequence of ELVgv had typical lentivirus genome organization including three predicted accessory genes. Phylogenetic analysis placed this virus as a distinct subgroup within the lentivirus genus. The time of insertion into the dermopteran lineage was estimated to be more than thirteen million years ago. We report the discovery of the first endogenous lentivirus in the mammalian order Dermoptera, which is a taxon close to the Primates. Lentiviruses have infiltrated the mammalian germline several times across millions of years. The colugo virus described here represents possibly the oldest documented endogenization event and its discovery can lead to new insights into lentivirus evolution. This is also the first report of an endogenous lentivirus in an Asian mammal, indicating a long-term presence of this retrovirus family in Asian continent.

  19. Challenges of up-scaling lentivirus production and processing.

    Science.gov (United States)

    McCarron, Alexandra; Donnelley, Martin; McIntyre, Chantelle; Parsons, David

    2016-12-20

    Lentiviruses are becoming an increasingly popular choice of gene transfer vehicle for use in the treatment of a variety of genetic and acquired human diseases. As research progresses from basic studies into pre-clinical and clinical phases, there is a growing demand for large volumes of high purity, concentrated vector, and accordingly, the means to produce such quantities. Unlike other viral vectors, lentiviruses are difficult to produce using stable cell lines, therefore transient transfection of adherent cell lines is conventionally used, and this method has proven challenging to up-scale. Furthermore, with the required increases in the volume of vector needed for larger animal and human use, comes the need for more efficient and sophisticated supernatant purification and concentration techniques. This review presents the challenges of up-scaling lentivirus production and processing approaches, novel systems for overcoming these issues, and the quality assessments recommended for producing a clinical grade lentiviral gene therapy product. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Anti-tetherin activities in Vpu-expressing primate lentiviruses

    Directory of Open Access Journals (Sweden)

    Haworth Kevin G

    2010-02-01

    Full Text Available Abstract Background The anti-viral activity of the cellular restriction factor, BST-2/tetherin, was first observed as an ability to block the release of Vpu-minus HIV-1 from the surface of infected cells. However, tetherin restriction is also counteracted by primate lentiviruses that do not express a Vpu protein, where anti-tetherin functions are provided by either the Env protein (HIV-2, SIVtan or the Nef protein (SIVsm/mac and SIVagm. Within the primate lentiviruses, Vpu is also present in the genomes of SIVcpz and certain SIVsyk viruses. We asked whether, in these viruses, anti-tetherin activity was always a property of Vpu, or if it had selectively evolved in HIV-1 to perform this function. Results We found that despite the close relatedness of HIV-1 and SIVcpz, the chimpanzee viruses use Nef instead of Vpu to counteract tetherin. Furthermore, SIVcpz Nef proteins had activity against chimpanzee but not human tetherin. This specificity mapped to a short sequence that is present in the cytoplasmic tail of primate but not human tetherins, and this also accounts for the specificity of SIVsm/mac Nef for primate but not human tetherins. In contrast, Vpu proteins from four diverse members of the SIVsyk lineage all displayed an anti-tetherin activity that was active against macaque tetherin. Interestingly, Vpu from a SIVgsn isolate was also found to have activity against human tetherin. Conclusions Primate lentiviruses show a high degree of flexibility in their use of anti-tetherin factors, indicating a strong selective pressure to counteract tetherin restriction. The identification of an activity against human tetherin in SIVgsn Vpu suggests that the presence of Vpu in the ancestral SIVmus/mon/gsn virus believed to have contributed the 3' half of the HIV-1 genome may have played a role in the evolution of viruses that could counteract human tetherin and infect humans.

  1. Reduced lentivirus susceptibility in sheep with TMEM154 mutations.

    Science.gov (United States)

    Heaton, Michael P; Clawson, Michael L; Chitko-Mckown, Carol G; Leymaster, Kreg A; Smith, Timothy P L; Harhay, Gregory P; White, Stephen N; Herrmann-Hoesing, Lynn M; Mousel, Michelle R; Lewis, Gregory S; Kalbfleisch, Theodore S; Keen, James E; Laegreid, William W

    2012-01-01

    Visna/Maedi, or ovine progressive pneumonia (OPP) as it is known in the United States, is an incurable slow-acting disease of sheep caused by persistent lentivirus infection. This disease affects multiple tissues, including those of the respiratory and central nervous systems. Our aim was to identify ovine genetic risk factors for lentivirus infection. Sixty-nine matched pairs of infected cases and uninfected controls were identified among 736 naturally exposed sheep older than five years of age. These pairs were used in a genome-wide association study with 50,614 markers. A single SNP was identified in the ovine transmembrane protein (TMEM154) that exceeded genome-wide significance (unadjusted p-value 3×10(-9)). Sanger sequencing of the ovine TMEM154 coding region identified six missense and two frameshift deletion mutations in the predicted signal peptide and extracellular domain. Two TMEM154 haplotypes encoding glutamate (E) at position 35 were associated with infection while a third haplotype with lysine (K) at position 35 was not. Haplotypes encoding full-length E35 isoforms were analyzed together as genetic risk factors in a multi-breed, matched case-control design, with 61 pairs of 4-year-old ewes. The odds of infection for ewes with one copy of a full-length TMEM154 E35 allele were 28 times greater than the odds for those without (p-valuesheep from Nebraska, Idaho, and Iowa, the relative risk of infection was 2.85 times greater for sheep with a full-length TMEM154 E35 allele (p-valuesheep were homozygous for TMEM154 deletion mutations and remained uninfected despite a lifetime of significant exposure. Together, these findings indicate that TMEM154 may play a central role in ovine lentivirus infection and removing sheep with the most susceptible genotypes may help eradicate OPP and protect flocks from reinfection.

  2. The origin of lentivirus research: Maedi-visna virus.

    Science.gov (United States)

    Thormar, Halldor

    2013-01-01

    Maedi and visna are contagious sheep diseases which were introduced into Iceland in 1933 by imported sheep of Karakul breed. Maedi, a slowly progressing pneumonia, and the central nervous system disease visna were shown to be transmissible in sheep and most likely caused by a virus. In 1957, visna virus was isolated in tissue culture from sheep brain and maedi virus was isolated the following year from sheep lungs. Both viruses showed similar cytopathic effect in tissue culture. Electron microscope studies of ultrathin sections from visna virus infected cells demonstrated spherical particles, 70-100 nm in diameter, which were formed by budding from the cell membrane. Later studies showed identical particles in maedi virus infected cultures. These, and several other comparative studies, strongly indicated that maedi and visna were caused by strains of the same virus, later named maedi-visna virus (MVV). Comparative studies in tissue culture suggested that MVV was related to RNA tumor viruses of animals, the oncornaviruses. This was later supported by the finding that MVV is an RNA virus. A few months after reverse transcriptase was demonstrated in oncornaviruses, the enzyme was also found in MVV virions. Thus, MVV was classified as a retrovirus together with the oncornaviruses. However, MVV is not oncogenic in vivo or in vitro and was in 1975 placed in a subgroup of retroviruses named lentiviruses, which cause cytopathic effect in vitro and slowly progressing inflammatory disease in animals, but are nononcogenic. In the early 1980s, the causative agent of AIDS was found to be a non-oncogenic retrovirus and was classified as a lentivirus. Thus, HIV became the first human lentivirus.

  3. Dynamics of the enzymatic antioxidants during experimental caprine coccidiosis.

    Science.gov (United States)

    Rakhshandehroo, E; Razavi, S M; Nazifi, S; Farzaneh, M; Mobarraei, N

    2013-04-01

    Caprine coccidiosis, caused by coccidian parasites from genus Eimeria, is considered as one of the most common and significant diseases in goats worldwide. The aim of this experiment was to investigate the responses of the enzymatic antioxidant systems during experimental coccidiosis. For this purpose, 20 newborn kids were selected. Ten were infected with sporulated oocysts of the most pathogenic species of Eimeria, and the remainder served as the control. Blood samples were taken at 0 (before inoculation), 3, 7, 14, 21, 28, and 35 days post-infection (dpi), and antioxidant-oxidant-related parameters were measured. Our data showed that the activities of the main erythrocyte antioxidant enzymes revealed significant declines at 7 dpi. These decreases were more evident at 14 to 21 dpi and then gradually enhanced to the normal values until 35 dpi; however, total antioxidant capacity revealed a remarkable decrease at 7 dpi and remained on the same level toward the end of the study. By contrast, serum levels of malondialdehyde (a biomarker of lipid peroxidation) and total homocysteine significantly increased at 21 and 14, 21, and 28 dpi, respectively. These observations suggest that caprine coccidiosis can impair the major antioxidant systems leading to remarkable oxidative damages during the infection. Furthermore, oxidative injuries could have a considerable linkage to the pathogenesis of Eimeria parasites.

  4. Preparation of fresh cheese from caprine milk as a model for the reduction of allergenicity.

    Science.gov (United States)

    Tomotake, Hiroyuki; Katagiri, Mitsuaki; Fujita, Masaru; Yamato, Masayuki

    2009-06-01

    Fresh cheese was prepared from caprine milk by isoelectric precipitation as a model experiment for reducing the allergenicity of milk. After acidic precipitation of casein, the beta-lactoglobulin content in curd was determined by ELISA using monoclonal antibody (MAb-beta209). The beta-lactoglobulin content was very high in the fresh cheese obtained from heat-treated (85 degrees C) bovine or caprine milk, while that obtained from untreated milk contained none of this protein. Taking it into account that caprine milk has only a small amount of alpha(s1)-casein, one of the major bovine milk allergens, the caprine fresh cheese sterilized after processing by precipitation may be useful as a protein source of low allergenicity.

  5. Reduced lentivirus susceptibility in sheep with TMEM154 mutations.

    Directory of Open Access Journals (Sweden)

    Michael P Heaton

    2012-01-01

    Full Text Available Visna/Maedi, or ovine progressive pneumonia (OPP as it is known in the United States, is an incurable slow-acting disease of sheep caused by persistent lentivirus infection. This disease affects multiple tissues, including those of the respiratory and central nervous systems. Our aim was to identify ovine genetic risk factors for lentivirus infection. Sixty-nine matched pairs of infected cases and uninfected controls were identified among 736 naturally exposed sheep older than five years of age. These pairs were used in a genome-wide association study with 50,614 markers. A single SNP was identified in the ovine transmembrane protein (TMEM154 that exceeded genome-wide significance (unadjusted p-value 3×10(-9. Sanger sequencing of the ovine TMEM154 coding region identified six missense and two frameshift deletion mutations in the predicted signal peptide and extracellular domain. Two TMEM154 haplotypes encoding glutamate (E at position 35 were associated with infection while a third haplotype with lysine (K at position 35 was not. Haplotypes encoding full-length E35 isoforms were analyzed together as genetic risk factors in a multi-breed, matched case-control design, with 61 pairs of 4-year-old ewes. The odds of infection for ewes with one copy of a full-length TMEM154 E35 allele were 28 times greater than the odds for those without (p-value<0.0001, 95% CI 5-1,100. In a combined analysis of nine cohorts with 2,705 sheep from Nebraska, Idaho, and Iowa, the relative risk of infection was 2.85 times greater for sheep with a full-length TMEM154 E35 allele (p-value<0.0001, 95% CI 2.36-3.43. Although rare, some sheep were homozygous for TMEM154 deletion mutations and remained uninfected despite a lifetime of significant exposure. Together, these findings indicate that TMEM154 may play a central role in ovine lentivirus infection and removing sheep with the most susceptible genotypes may help eradicate OPP and protect flocks from reinfection.

  6. Mannose receptor may be involved in small ruminant lentivirus pathogenesis

    Directory of Open Access Journals (Sweden)

    Crespo Helena

    2012-05-01

    Full Text Available Abstract Thirty-one sheep naturally infected with small ruminant lentiviruses (SRLV of known genotype (A or B, and clinically affected with neurological disease, pneumonia or arthritis were used to analyse mannose receptor (MR expression (transcript levels and proviral load in virus target tissues (lung, mammary gland, CNS and carpal joints. Control sheep were SRLV-seropositive asymptomatic (n = 3, seronegative (n = 3 or with chronic listeriosis, pseudotuberculosis or parasitic cysts (n = 1 in each case. MR expression and proviral load increased with the severity of lesions in most analyzed organs of the SRLV infected sheep and was detected in the affected tissue involved in the corresponding clinical disease (CNS, lung and carpal joint in neurological disease, pneumonia and arthritis animal groups, respectively. The increased MR expression appeared to be SRLV specific and may have a role in lentiviral pathogenesis.

  7. Pathological and Molecular Based Study of Naturally Occurring Lentivirus Infection

    Directory of Open Access Journals (Sweden)

    Fazal Mahmood*, Ahrar Khan, Muhammad Zargham Khan, Riaz Hussain1, Shafia Tehseen Gul and Abu Baker Siddique2

    2012-10-01

    Full Text Available The present study describes the multicentric lymphosarcoma associated with lymphoid interstitial pneumonia in indigenous breeds of sheep and goats in Pakistan. Serum samples from sheep (n=93 and goats (n=129 were screened for ovine lentivirus using agar gel immunodiffusion test. Overall, 7.52 and 3.87% seroprevalence was recorded in sheep and goat, respectively. During necropsy of sheep (n=3 and goats (n=4, gross lesions including dark color liver with multifocal whitish areas, unilaterally lungs consolidation with granular appearance of cut surface were observed. Mediastinal lymph nodes were swollen and arranged in chain like fashion. Histopathologically, liver parenchyma exhibited extensive proliferation of neoplastic cells of lymphocytic series. Metastatic cells in the form of follicular pattern in the lungs, spleen and mediastinal lymph nodes were also observed. Brain tissue exhibited degenerative changes in the neuron and perivascular cuffing. The PCR product size approximately 300 bp from lung tissue confirmed viral infection.

  8. Effect of aging on the rheology of full fat and low fat Cheddar-like caprine cheese

    Science.gov (United States)

    The rheological properties of aging full fat (FF) and low fat (LF) caprine milk cheeses were characterized to determine the changes in the cheese matrix during storage. Six batches of high moisture, Cheddar-like cheese were manufactured from whole or skim caprine milk and were aged at 4 deg C for u...

  9. Visualization of transfer of a fluorescently-labeled membrane raft protein to T cells using lentivirus

    OpenAIRE

    Byrum, Jennifer; Rodgers, William

    2005-01-01

    Lentivirus vector systems have been developed for the safe delivery of foreign genes to target tissues. However, the use of these systems for delivering specific proteins to target cells has been largely unexplored. To test this concept, the lentivirus expression plasmid pLenti was utilized to overexpress in producer cells a YFP-fusion protein that is specifically targeted to glycolipid-enriched membrane rafts, which is the site of virus assembly. Our data show that virus generated in produce...

  10. Cloned kids derived from caprine mammary gland epithelial cells.

    Science.gov (United States)

    Yuan, Y-G; Cheng, Y; Guo, L; Ding, G-L; Bai, Y-J; Miao, M-X; An, L-Y; Zhao, J-H; Cao, Y-J

    2009-09-01

    The use of nucleus transfer techniques to generate transgenic dairy goats capable of producing recombinant therapeutic proteins in milk could have a major impact on the pharmaceutical industry. However, transfection or gene targeting of nucleus transfer donor cells requires a long in vitro culture period and the selection of marker genes. In the current study, we evaluated the potential for using caprine mammary gland epithelial cells (CMGECs), isolated from udders of lactating F1 hybrid goats (Capra hircus) and cryopreserved at Passages 24 to 26, for nucleus transfer into enucleated in vivo-matured oocytes. Pronuclear-stage reconstructed embryos were transferred into the oviducts of 31 recipient goats. Twenty-three (74%), 21 (72%), and 14 (48%) recipients were confirmed pregnant by ultrasonography on Days 30, 60, and 90, respectively. Four recipients aborted between 35 and 137 d of gestation. Five recipients carried the pregnancies to term and delivered one goat kid each, one of which subsequently died due to respiratory difficulties. The remaining four goat kids were healthy and well. Single-strand conformation polymorphism analysis confirmed that all kids were clones of the donor cells. In conclusion, the CMGECs remained totipotent for nucleus transfer.

  11. Abortion in woman caused by caprine Chlamydophila abortus (Chlamydia psittaci serovar 1).

    Science.gov (United States)

    Pospischil, A; Thoma, R; Hilbe, M; Grest, P; Gebbers, J-O

    2002-02-09

    On a farm housing cattle and goats an abortion storm occurred affecting 50% of the goats during the lambing season 2000/2001. In one of three investigated caprine abortions Chlamydophila abortus could be identified as aetiology. During this time a pregnant woman (pregnancy week 19/20) had contact with aborting goats. She developed a severe generalized infection and aborted. The placenta contained Chlamydophila abortus shown by immunohistochemistry and PCR. The aim of the present case report is to alert medical doctors about the potential zoonotic risk of ovine/caprine abortions.

  12. Duration of passive immunity to small ruminant lentiviruses in lambs

    Directory of Open Access Journals (Sweden)

    Thiago Sampaio de Souza

    2014-02-01

    Full Text Available In order to evaluate the passive immunity against small ruminant lentiviruses (SRLV in lambs, this study was conducted from two experimental groups. The first one (G1 was established by nine lambs subjected to artificial feeding of colostrum of goats positive for SRLV. The second one (G2 was the control group, consisting of ten lambs subjected to suckling of colostrum from their negative mothers. Blood samples were obtained before the first feeding, after 24 hours of birth and at 7, 15, 30, 50, 70, 90 and 120 days of age. The concentrations of total serum protein (TSP, albumin (ALB, globulin (GLOB and immunoglobulin G (IgG were determined and antibodies to SRLV were surveyed from the techniques of agar gel immunodiffusion (AGID, enzyme linked immunosorbent assay (Elisa and immunoblotting (IB. In both groups, the lowest averages of TSP, GLOB and IgG were observed at birth and the highest averages were observed at 24 hours of life, due to absorption of colostral immunoglobulins. For G1, transfer of immunity could also be detected by immunodiagnostic tests. At birth, the animals were seronegative. After 24 hours, all animals were positive in three serological tests. Negative results began to be observed after 15 days of age by the AGID test. As for Elisa testing, all animals remained reagent until 50 days old. Only IB was able to detect anti-SRLV at 70 days. Regarding G2, all animals tested negative in AGID and IB, from birth until 120 days of age. However, false-positive results were observed until day 15 in Elisa, due to nonspecific reactions. These data are consistent with the sensitivity and specificity of serological tests and show that starting at 90 days of age, colostral antibodies to SRLV are no longer detected in the serum of lambs.

  13. Prevalence of ovine and caprine oestrosis in Ambo, Ethiopia.

    Science.gov (United States)

    Gebremedhin, Endrias Zewdu

    2011-01-01

    A study was carried out to estimate the prevalence, larval burden and risk factors of ovine and caprine oestrosis from December 2007 to May 2008 on 554 heads of randomly selected sheep and goat slaughtered at Ambo town, Western Shoa, Ethiopia. The results show an overall prevalence of 59.9% with infection rate of 69.8% and 47.3% in sheep and goats respectively. No statistically significant difference in the prevalence was noted with regard to the assumed risk factors like sex, nose color, face color, horned versus polled, origin, and months (p > 0.05). Sheep were nearly twice more likely to be infected as compared to goats (p = 0.0001, odds ratio (OR) = 1.975). Age of the animals was found to be protective (OR = 0.579; 95% confidence interval = 0.393, 0.853; p = 0.006). As compared to very fat animals, poor (p = 0.040, OR = 4.834), medium (p = 0.049, OR = 4.198), and fat (p = 0.022, OR = 5.795) body condition animals are more likely to be infected by Oestrus ovis larvae. Nasal and sinus cavity pathology is positively correlated with the total larval count (r = 0.56, p oestrosis is a common problem in the study area and more prevalent in sheep than goats, in adult than young, and in animals with poor body condition.

  14. Chlamydia pecorum: fetal and placental lesions in sporadic caprine abortion.

    Science.gov (United States)

    Giannitti, Federico; Anderson, Mark; Miller, Myrna; Rowe, Joan; Sverlow, Karen; Vasquez, Marce; Cantón, Germán

    2016-03-01

    Chlamydial abortion in small ruminants is usually associated with Chlamydia abortus infection. Although Chlamydia pecorum has been detected in aborted ruminants and epidemiological data suggests that C. pecorum is abortigenic in these species, published descriptions of lesions in fetuses are lacking. This work describes fetoplacental lesions in a caprine abortion with C. pecorum infection, and further supports the abortigenic role of C. pecorum in ruminants. A 16-month-old Boer goat aborted twin fetuses at ~130 days of gestation. Both fetuses (A and B) and the placenta of fetus A were submitted for postmortem examination and diagnostic workup. At autopsy, the fetuses had moderate anasarca, intermuscular edema in the hindquarters (A), and brachygnathia and palatoschisis (B). In the placenta, the cotyledons were covered by yellow fibrinosuppurative exudate that extended into the adjacent intercotyledonary areas. Histologically, there was severe suppurative and necrotizing placentitis with vasculitis (arteriolitis) and thrombosis, multifocal lymphohistiocytic and neutrophilic hepatitis (A), and fibrinosuppurative enteritis in both fetuses. Chlamydia antigen was detected in the placenta by the direct fluorescent antibody test and in fetal intestines by immunohistochemistry. Nested polymerase chain reaction of DNA extracted from formalin-fixed, paraffin-embedded sections of placenta and intestine amplified 400 bp of the Chlamydia 16S rRNA gene that was sequenced and found to be 99% identical to C. pecorum by BLAST analysis. Other known abortigenic infectious agents were ruled out by specific testing. It is concluded that C. pecorum infection is associated with fetoplacental lesions and sporadic abortion in goats. © 2015 The Author(s).

  15. Proteomic study on the stability of proteins in bovine, camel, and caprine milk sera after processing

    NARCIS (Netherlands)

    Zhang, Lina; Boeren, Sjef; Smits, Marcel; Hooijdonk, van Toon; Vervoort, Jacques; Hettinga, Kasper

    2016-01-01

    Milk proteins have been shown to be very sensitive to processing. This study aims to investigate the changes of the bovine, camel, and caprine milk proteins after freezing, pasteurization (62 °C, 30 min), and spray drying by proteomic techniques, filter-aided sample preparation (FASP) and

  16. Screening of fluoroquinolone residues in caprine milk using a 5-kg luminescence photometer

    Science.gov (United States)

    A terbium-sensitized luminescence (TSL) method was developed to screen presence of residues of four fluoroquinolones (FQ) registered in caprine milk in the European Union: enrofloxacin, ciprofloxacin, flumequine, and danofloxacin. After extraction in McIlvaine buffer and SPE cleanup, TSL was measure...

  17. Molecular analyses on Neospora caninum-triggered NETosis in the caprine system.

    Science.gov (United States)

    Villagra-Blanco, R; Silva, L M R; Gärtner, U; Wagner, H; Failing, K; Wehrend, A; Taubert, A; Hermosilla, C

    2017-07-01

    Neospora caninum is an obligate intracellular protozoan parasite causing serious reproductive disorders in large and small ruminants worldwide. Polymorphonuclear neutrophils (PMN) react against multiple invading pathogens through different mechanisms including the release of neutrophil extracellular traps (NETs). Here, in vitro interactions of caprine PMN and N. caninum tachyzoites were studied. Scanning electron microscopic- and immunofluorescence-analyses demonstrated that caprine PMN undergo NETosis upon contact with tachyzoites of N. caninum, extruding filaments that entrap parasites. Detailed co-localization studies of N. caninum tachyzoite-induced NETs revealed the presence of PMN-derived DNA being decorated with histones (H1, H2A/H2B, H3,H4) and neutrophil elastase (NE) corroborating the molecular characteristics of classical mammalian NETs. As a new result for parasite-induced NETosis, we identified pentraxin and cathepsin B in N. caninum-triggered NETs. Nonetheless, functional inhibition assays revealed that during caprine NET formation triggered by N. caninum different molecular signaling pathways are induced, when compared to other apicomplexan parasites or host species. As such, N. caninum-induced NETosis appears to be influenced by MPO but independent of NADPH oxidase, SOCE, ERK1/2 and p38 MAPK activities. Furthermore, the inhibition of PMN autophagy via blockage of the PI3K-mediated signaling pathway failed to influence tachyzoite-induced NETosis. Since N. caninum-tachyzoites induced caprine NETosis, this effector mechanism should be considered as an early host immune response during acute caprine neosporosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. A Functional Henipavirus Envelope Glycoprotein Pseudotyped Lentivirus Assay System

    Directory of Open Access Journals (Sweden)

    Broder Christopher C

    2010-11-01

    Full Text Available Abstract Background Hendra virus (HeV and Nipah virus (NiV are newly emerged zoonotic paramyxoviruses discovered during outbreaks in Queensland, Australia in 1994 and peninsular Malaysia in 1998/9 respectively and classified within the new Henipavirus genus. Both viruses can infect a broad range of mammalian species causing severe and often-lethal disease in humans and animals, and repeated outbreaks continue to occur. Extensive laboratory studies on the host cell infection stage of HeV and NiV and the roles of their envelope glycoproteins have been hampered by their highly pathogenic nature and restriction to biosafety level-4 (BSL-4 containment. To circumvent this problem, we have developed a henipavirus envelope glycoprotein pseudotyped lentivirus assay system using either a luciferase gene or green fluorescent protein (GFP gene encoding human immunodeficiency virus type-1 (HIV-1 genome in conjunction with the HeV and NiV fusion (F and attachment (G glycoproteins. Results Functional retrovirus particles pseudotyped with henipavirus F and G glycoproteins displayed proper target cell tropism and entry and infection was dependent on the presence of the HeV and NiV receptors ephrinB2 or B3 on target cells. The functional specificity of the assay was confirmed by the lack of reporter-gene signals when particles bearing either only the F or only G glycoprotein were prepared and assayed. Virus entry could be specifically blocked when infection was carried out in the presence of a fusion inhibiting C-terminal heptad (HR-2 peptide, a well-characterized, cross-reactive, neutralizing human mAb specific for the henipavirus G glycoprotein, and soluble ephrinB2 and B3 receptors. In addition, the utility of the assay was also demonstrated by an examination of the influence of the cytoplasmic tail of F in its fusion activity and incorporation into pseudotyped virus particles by generating and testing a panel of truncation mutants of NiV and HeV F

  19. Inhibition of lentivirus replication by aqueous extracts of Prunella vulgaris

    Directory of Open Access Journals (Sweden)

    Hauck Cathy

    2009-01-01

    of the fractions. Conclusion Our findings indicate that multiple Prunella constituents have profound anti-viral activity against EIAV, providing additional evidence of the broad anti-viral abilities of these extracts. The ability of the aqueous extracts to prevent entry of viral particles into permissive cells suggests that these extracts may function as promising microbicides against lentiviruses.

  20. A lion lentivirus related to feline immunodeficiency virus: epidemiologic and phylogenetic aspects.

    Science.gov (United States)

    Brown, E W; Yuhki, N; Packer, C; O'Brien, S J

    1994-09-01

    Feline immunodeficiency virus (FIV) is a novel lentivirus that is genetically homologous and functionally analogous to the human AIDS viruses, human immunodeficiency virus types 1 and 2. FIV causes immunosuppression in domestic cats by destroying the CD4 T-lymphocyte subsets in infected hosts. A serological survey of over 400 free-ranging African and Asian lions (Panthera leo) for antibodies to FIV revealed endemic lentivirus prevalence with an incidence of seropositivity as high as 90%. A lion lentivirus (FIV-Ple) was isolated by infection of lion lymphocytes in vitro. Seroconversion was documented in two Serengeti lions, and discordance of mother-cub serological status argues against maternal transmission (in favor of horizontal spread) as a major route of infection among lions. A phylogenetic analysis of cloned FIV-Ple pol gene sequences from 27 lions from four African populations (from the Serengeti reserve, Ngorongoro Crater, Lake Manyara, and Kruger Park) revealed remarkably high intra- and interindividual genetic diversity at the sequence level. Three FIV-Ple phylogenetic clusters or clades were resolved with phenetic, parsimony, and likelihood analytical procedures. The three clades, which occurred not only together in the same population but throughout Africa, were as divergent from each other as were homologous pol sequences of lentivirus isolated from distinct feline species, i.e., puma and domestic cat. The FIV-Ple clades, however, were more closely related to each other than to other feline lentiviruses (monophyletic for lion species), suggesting that the ancestors of FIV-Ple evolved in allopatric (geographically isolated) lion populations that converged recently. To date, there is no clear evidence of FIV-Ple-associated pathology, raising the possibility of a historic genetic accommodation of the lion lentivirus and its host leading to a coevolved host-parasite symbiosis (or commensalism) in the population similar to that hypothesized for endemic

  1. Incidence of Listeria species in bovine, ovine, caprine, camel and water buffalo milk using cultural method and the PCR assay

    OpenAIRE

    Rahimi, Ebrahim; Momtaz, Hassan; Behzadnia, Asma; Baghbadorani, Zeinab Torki

    2014-01-01

    Objective: To determine the prevalence rate of Listeria species in bovine, ovine, caprine, camel and water buffalo milk in Iran. Methods: From September 2010 to December 2011 a total of 260 bulk milk samples including 85 bovine, 37 camel, 34 water buffalo, 56 ovine and 48 caprine bulk milk samples were collected from commercial dairy herds, in Fars and Khuzestan provinces, Iran and were evaluated for the presence of Listeria species using cultural method and the PCR assay. R...

  2. Caprine Butchery and Bone Modification Templates: A step towards standardisation

    Directory of Open Access Journals (Sweden)

    Peter Popkin

    2005-03-01

    Full Text Available Widely accepted zooarchaeological procedure for recording butchery marks and other types of bone modification involves two processes: Drawing the bone showing the exact location and orientation of the modification and recording all of the information about the bone and its modification into an electronic database. No recording templates have ever been published, however, resulting in individual zooarchaeologists repeating the effort of developing their own templates or drawings for each bone in an assemblage showing a modification. Both of these tasks are time consuming and lead to inconsistencies in recording and quantification methods. To help alleviate this problem a series of caprine (sheep and goat bone templates have been created. These templates show every bone in a goat skeleton, apart from the skull, from six views at life-size when printed on A4 paper. They have intentionally been produced with a minimum of detail (without shading or stippling etc. so that the recorded butchery marks and bone modifications will be clearly visible. Because the skeletal morphology of sheep and goats is so similar these templates may be used interchangeably for either species. They may also be used for many other artiodactyl species such as cattle and deer as no scale has been indicated. The study of butchery marks and bone modification has the potential to provide zooarchaeologists with information about taphonomy, site formation processes, burial/ritual practices, human behaviour, ancient technologies and possibly ethnicity amongst other things, but only if the recording of these bone modifications is undertaken in a standardised fashion across the field. While much effort has been directed towards standardising the recognition and classification of various bone modifications, the recording of these modifications regularly occurs in various ways. Using standardised recording templates will save valuable time and help to alleviate problems of data

  3. Endogenous lentivirus in Malayan colugo (Galeopterus variegatus), a close relative of primates

    Czech Academy of Sciences Publication Activity Database

    Hron, Tomáš; Fábryová, Helena; Pačes, Jan; Elleder, Daniel

    2014-01-01

    Roč. 11, č. 84 (2014) ISSN 1742-4690 R&D Projects: GA MŠk(CZ) LK11215 Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:68378050 Keywords : Endogenous lentiviruses * Dermoptera * Paleovirology Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.185, year: 2014

  4. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  5. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Yomi

    2011-02-14

    Feb 14, 2011 ... Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to ... The lentivirus system encoding FasL induced by deoxycycline promotes apoptosis of Th1 cells. Key words: FasL ..... In the immune system, especially in lymphocytes, apoptosis functions to ...

  6. Author Details

    African Journals Online (AJOL)

    Awoniyi, TAM. Vol 6, No 15 (2007) - Articles Mycological investigation of compounded poultry feeds used in poultry farms in southwest Nigeria Abstract PDF · Vol 7, No 22 (2008) - Articles Affinity (tropism) of caprine arthritis encephalitis virus for brain cells. Abstract PDF. ISSN: 1684-5315. AJOL African Journals Online.

  7. Tropical Veterinarian - Vol 21, No 4 (2003)

    African Journals Online (AJOL)

    Differences in the Tropism and Nitric Oxide Production by Goat Brain Cells Infected with Caprine Arthritis Encephalitis Virus · EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. IA Adebayo, O Adeyemo, 200-206. http://dx.doi.org/10.4314/tv.v21i4.4543 ...

  8. Comparison of the principal proteins in bovine, caprine, buffalo, equine and camel milk.

    Science.gov (United States)

    Hinz, Katharina; O'Connor, Paula M; Huppertz, Thom; Ross, R Paul; Kelly, Alan L

    2012-05-01

    Proteomic analysis of bovine, caprine, buffalo, equine and camel milk highlighted significant interspecies differences. Camel milk was found to be devoid of β-lactoglobulin, whereas β-lactoglobulin was the major whey protein in bovine, buffalo, caprine, and equine milk. Five different isoforms of κ-casein were found in camel milk, analogous to the micro-heterogeneity observed for bovine κ-casein. Several spots observed in 2D-electrophoretograms of milk of all species could tentatively be identified as polypeptides arising from the enzymatic hydrolysis of caseins. The understanding gained from the proteomic comparison of these milks may be of relevance both in terms of identifying sources of hypoallergenic alternatives to bovine milk and detection of adulteration of milk samples and products.

  9. Effects of addition of somatic cells to caprine milk on cheese quality

    DEFF Research Database (Denmark)

    Sánchez-Macías, D.; Morales-delaNuez, Antonio; Torres, A.

    2013-01-01

    Milk quality criteria and limits for somatic cell count (SCC) established in many countries make it difficult to maintain SCC of bulk tank goat milk below the threshold, due to non-infection factors linked to goat physiology. The aim of this study was to objectively verify the effects of SCC...... on fresh caprine milk cheese. Somatic cells were recovered from pooled healthy goat milk, and added to low SCC raw or pasteurised goat milk. Miniature cheeses were made and evaluated after 1 and 7 d. Somatic cells had a major effect on lipolysis, increasing free fatty acids regardless of whether milk...... was raw or pasteurised. The effect of somatic cells on proteolysis was specific for caseins and the effects were different if cheeses are made from raw or pasteurised milk. It is concluded that somatic cells themselves in caprine milk can directly affect some cheese parameters....

  10. Alginate hydrogel matrix stiffness influences the in vitro development of caprine preantral follicles.

    Science.gov (United States)

    Brito, I R; Silva, C M G; Duarte, A B G; Lima, I M T; Rodrigues, G Q; Rossetto, R; Sales, A D; Lobo, C H; Bernuci, M P; Rosa-E-Silva, A C J S; Campello, C C; Xu, M; Figueiredo, J R

    2014-07-01

    This study examined caprine follicular development in different concentrations of alginate matrix to determine the optimal conditions for culture. Caprine preantral follicles were cultured in a two-dimensional system (control) or a three-dimensional encapsulated system in 0.25%, 0.5%, or 1% alginate (ALG 0.25, ALG 0.5, and ALG 1, respectively). A higher percentage of morphologically normal follicles developed in ALG 0.5 and ALG 1 than in ALG 0.25 or the control (P rate of antrum formation, however, was higher in ALG 0.25 than in ALG 0.5 and ALG 1 conditions (P growth rates and meiotic resumption than those cultured in ALG 0.5, ALG 1, or the control (P rate of meiotic resumption. © 2014 Wiley Periodicals, Inc.

  11. Comparison of three suture techniques in closure of caprine skin incision: cosmetic and cost considerations

    OpenAIRE

    Adamu Abdul Abubakar; John Bayo Adeyanju; Raphael O. Chukudi Kene; Mohammad Legbo Sonfada; Abubakar Sadiq Yakubu; Umaru Adamu

    2012-01-01

    The cosmetic and economic evaluations of three suture techniques were evaluated in closure of caprine skin incision. Fifteen apparently healthy male and female intact goats, free of any dermatological lesions were used for the investigation. They were randomly grouped into three; A (Subcuticular); B (Ford interlocking) and C (Simple interrupted). Cosmetic appearance of the surgical site was assessed on day 7, 14 and 21 post surgery using standard procedure as described by Sakka et al, 1995...

  12. Caprine herpesvirus 1 (CpHV-1) vaginal infection of goats: clinical efficacy of fig latex.

    Science.gov (United States)

    Camero, Michele; Marinaro, Mariarosaria; Losurdo, Michele; Larocca, Vittorio; Bodnar, Livia; Patruno, Giovanni; Buonavoglia, Canio; Tempesta, Maria

    2016-01-01

    The latex of Ficus carica Linn. (Moraceae) has been shown to interfere with the replication of caprine herpesvirus (CpHV)-1 in vitro. The present study was undertaken to determine the efficacy of vaginal administration of fig latex in goats experimentally infected with CpHV-1. The fig latex reduced the clinical signs of the herpetic disease although it slightly influenced the titres of CpHV-1 shed. Thus, the fig latex maintained a partial efficacy in vivo.

  13. Sensitivity and specificity of a nested polymerase chain reaction for detection of lentivirus infection in lions (Panthera leo).

    Science.gov (United States)

    Adams, Hayley; van Vuuren, Moritz; Kania, Stephen; Bosman, Anna-Mari; Keet, Dewald; New, John; Kennedy, Melissa

    2010-12-01

    Feline immunodeficiency virus (FIV) is a lentivirus in the Retroviridae family that causes lifelong infection in domestic cats. The lentivirus of African lions (Panthera leo), referred to as FIVple, is endemic in certain lion populations in eastern and southern Africa. Lentivirus infection leads to immunologic dysfunction and immunosuppressive disease in domestic cats; however, little is known about the pathogenic effects of infection in lions, nor about the epidemiologic impact on free-ranging and captive populations. Whole blood and serum samples were collected opportunistically from free-ranging lions in Kruger National Park, Republic of South Africa (RSA). Whole blood and serum samples were also collected from captive wild lions in the RSA. A nested polymerase chain reaction (PCR) assay for detection of FIV was performed on all whole blood samples. In addition, serum samples were tested for cross-reactive antibodies to domestic feline lentivirus antigens and puma lentivirus synthetic envelope peptide antigen. The PCR assay successfully amplified the lion lentivirus from African lions. The relative sensitivity and relative specificity were 79% and 100%, respectively, and the positive and negative predictive values were 100% and 67%, respectively. This research represents the first study to compare genetic material with antibody-based methods of lentivirus detection on lions in RSA. Using PCR as an additional diagnostic test for FIV in lions will increase screening sensitivity and will allow viral characterization among circulating isolates and monitoring of changes in the viral epidemiology within geographic regions and populations over time.

  14. Gene transfer to human trabecular meshwork cells in vitro and ex vivo using HIV-based lentivirus

    Directory of Open Access Journals (Sweden)

    Yan Xiang

    2014-12-01

    Full Text Available AIM:To investigate whether the enhanced green fluorescent protein (EGFP reporter gene could be transferred into human trabecular meshwork (HTM cells by a HIV-based lentivirus both in vitro and ex vivo.METHODS:The HIV-based lentivirus that contains an EF1-α promoter driving EGFP expression cassette was constructed following the standard molecular cloning methods. The cultured HTM cells were transduced at a range of multiplicity of infection (MOI with HIV-based lentivirus. EGFP positive cell populations were detected by flow cytometry. Human anterior eye segments were cultured with perfusion culture system and transfected by HIV-based lentivirus with a 1×108 transducing unit (TU virus in perfusion liquid. The intraocular pressure was recorded every 8h for 21d. The expression of EGFP in the anterior segment of the human eye was detected by fluorescence microscopy. Furthermore, the distribution of EGFP expression was confirmed by anti-EGFP immunohistochemical staining.RESULTS:The HIV-based lentivirus which contains an EF1-α promoter driving EGFP expression cassette was constructed successfully. After HTM cells were transduced with HIV-based lentivirus containing EGFP in vitro, the ratio of EGFP positive cells to the total cell number reached 92.3%, with the MOI of 15. After the lentivirus containing EGFP were used to transduce human anterior eye segments, the EGFP could be directly detected by fluorescence microscopy in vivo. Immunohistochemistry staining revealed that 88.19% EGFP-positive trabecular meshwork (TM cells were observed in the human anterior segment. Nevertheless, the intraocular pressure in the lentivirus-transduced group kept constant when compared with control group (P>0.05.CONCLUSION:EGFP gene could be efficiently transferred into HTM cells both in vitro and ex vivo by using HIV-based lentivirus.

  15. Infection of differentiated airway epithelial cells from caprine lungs by viruses of the bovine respiratory disease complex.

    Science.gov (United States)

    Kirchhoff, Jana; Uhlenbruck, Sabine; Keil, Günther M; Schwegmann-Wessels, Christel; Ganter, Martin; Herrler, Georg

    2014-05-14

    Bovine respiratory syncytial virus (BRSV), bovine parainfluenza virus type 3 (BPIV3) and bovine herpesvirus type 1 (BHV-1) are important pathogens associated with the bovine respiratory disease complex (BRDC). Non-bovine ruminants such as goats may also be infected and serve as a virus reservoir to be considered in the development of control strategies. To evaluate the susceptibility of caprine airway epithelial cells to infection by viruses of BRDC, we established a culture system for differentiated caprine epithelial cells. For this purpose, we generated precision-cut lung slices (PCLS), in which cells are retained in their original structural configuration and remain viable for more than a week. The three bovine viruses were found to preferentially infect different cell types. Ciliated epithelial cells were the major target cells of BPIV3, whereas BHV-1 preferred basal cells. Cells infected by BRSV were detected in submucosal cell layers. This spectrum of susceptible cells is the same as that reported recently for infected bovine PCLS. While infection of caprine cells by BRSV and BPIV3 was as efficient as that reported for bovine cells, infection of caprine cells by BHV-1 required a tenfold higher dose of infectious virus as compared to infection of bovine airway cells. These results support the notion that non-bovine ruminants may serve as a reservoir for viruses of BRDC and introduce a culture system to analyze virus infection of differentiated airway epithelial cells from the caprine lung. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. The experimental study of genetic engineering human neural stem cells mediated by lentivirus to express multigene.

    Science.gov (United States)

    Cai, Pei-qiang; Tang, Xun; Lin, Yue-qiu; Martin, Oudega; Sun, Guang-yun; Xu, Lin; Yang, Yun-kang; Zhou, Tian-hua

    2006-02-01

    To explore the feasibility to construct genetic engineering human neural stem cells (hNSCs) mediated by lentivirus to express multigene in order to provide a graft source for further studies of spinal cord injury (SCI). Human neural stem cells from the brain cortex of human abortus were isolated and cultured, then gene was modified by lentivirus to express both green fluorescence protein (GFP) and rat neurotrophin-3 (NT-3); the transgenic expression was detected by the methods of fluorescence microscope, dorsal root ganglion of fetal rats and slot blot. Genetic engineering hNSCs were successfully constructed. All of the genetic engineering hNSCs which expressed bright green fluorescence were observed under the fluorescence microscope. The conditioned medium of transgenic hNSCs could induce neurite flourishing outgrowth from dorsal root ganglion (DRG). The genetic engineering hNSCs expressed high level NT-3 which could be detected by using slot blot. Genetic engineering hNSCs mediated by lentivirus can be constructed to express multigene successfully.

  17. The Role of the Antiviral APOBEC3 Gene Family in Protecting Chimpanzees against Lentiviruses from Monkeys.

    Directory of Open Access Journals (Sweden)

    Lucie Etienne

    2015-09-01

    Full Text Available Cross-species transmissions of viruses from animals to humans are at the origin of major human pathogenic viruses. While the role of ecological and epidemiological factors in the emergence of new pathogens is well documented, the importance of host factors is often unknown. Chimpanzees are the closest relatives of humans and the animal reservoir at the origin of the human AIDS pandemic. However, despite being regularly exposed to monkey lentiviruses through hunting, chimpanzees are naturally infected by only a single simian immunodeficiency virus, SIVcpz. Here, we asked why chimpanzees appear to be protected against the successful emergence of other SIVs. In particular, we investigated the role of the chimpanzee APOBEC3 genes in providing a barrier to infection by most monkey lentiviruses. We found that most SIV Vifs, including Vif from SIVwrc infecting western-red colobus, the chimpanzee's main monkey prey in West Africa, could not antagonize chimpanzee APOBEC3G. Moreover, chimpanzee APOBEC3D, as well as APOBEC3F and APOBEC3H, provided additional protection against SIV Vif antagonism. Consequently, lentiviral replication in primary chimpanzee CD4(+ T cells was dependent on the presence of a lentiviral vif gene that could antagonize chimpanzee APOBEC3s. Finally, by identifying and functionally characterizing several APOBEC3 gene polymorphisms in both common chimpanzees and bonobos, we found that these ape populations encode APOBEC3 proteins that are uniformly resistant to antagonism by monkey lentiviruses.

  18. Expression of exogenetic enhanced green fluorescent protein in rat endocranium through lentivirus infection.

    Science.gov (United States)

    Zhang, Qi; Li, Qiang; Li, Li; Zhang, Zhaolong; Wu, Yina; Xu, Yi

    2015-01-01

    The study aims to investigate whether exogenetic green fluorescent protein is able to express in the endocranium of rats, and to establish a method for further study in exogenetic gene knock-in or gene overexpression. Forty female Sprague Dawley (SD) rats were randomly divided into 4 groups with 10 in each: low and high dose groups, treated with 10% and 100% EGFP-lentivirus, respectively; negative control group, treated with virus enhancer; sham group, treated with normal saline. Seven days later, half rats' brain tissues were perfusion fixed and fresh brain tissues were obtained from the rest after euthanasia in each group. Immunohistochemical analysis, Western blotting and RT-PCR were respectively performed to detect the site where EGFP expressed and its levels. Immunohistochemical analysis demonstrated that EGFP was successfully expressed in brain tissue of those rats infected with EGFP-lentivirus. Both Western blotting and RT-PCR showed that EGFP was expressed after treatment with EGFP-lentivirus, and the expression level increased with the dosage of the vector. Exogenetic EGFP gene can express in brain tissue of the rat, which laid a solid foundation for future studies in exogenetic gene knock in or gene overexpression.

  19. Proteome profile and biological activity of caprine, bovine and human milk fat globules.

    Science.gov (United States)

    Spertino, Stefano; Cipriani, Valentina; De Angelis, Chiara; Giuffrida, Maria Gabriella; Marsano, Francesco; Cavaletto, Maria

    2012-04-01

    Upon combining bidimensional electrophoresis with monodimensional separation, a more comprehensive analysis of the milk fat globule membrane has been obtained. The proteomic profile of caprine milk fat globules revealed the presence of butyrophilin, lactadherin and perilipin as the major proteins, they were also associated to bovine and human milk fat globule membranes. Xanthine dehydrogenase/oxidase has been detected only in monodimensional gels. Biological activity of milk fat globules has been evaluated in Caco2-cells, as a representative model of the intestinal barrier. The increase of cell viability was indicative of a potential nutraceutical role for the whole milk fat globule, suggesting a possible employment in milk formula preparation.

  20. Gag Protein Epitopes Recognized by CD4+ T-Helper Lymphocytes from Equine Infectious Anemia Virus-Infected Carrier Horses

    Science.gov (United States)

    Lonning, S. M.; Zhang, W.; McGuire, T. C.

    1999-01-01

    Antigen-specific T-helper (Th) lymphocytes are critical for the development of antiviral humoral responses and the expansion of cytotoxic T lymphocytes (CTL). Identification of relevant Th lymphocyte epitopes remains an important step in the development of an efficacious subunit peptide vaccine against equine infectious anemia virus (EIAV), a naturally occurring lentivirus of horses. This study describes Th lymphocyte reactivity in EIAV carrier horses to two proteins, p26 and p15, encoded by the relatively conserved EIAV gag gene. Using partially overlapping peptides, multideterminant and possibly promiscuous epitopes were identified within p26. One peptide was identified which reacted with peripheral blood mononuclear cells (PBMC) from all five EIAV-infected horses, and three other peptides were identified which reacted with PBMC from four of five EIAV-infected horses. Four additional peptides containing both CTL and Th lymphocyte epitopes were also identified. Multiple epitopes were recognized in a region corresponding to the major homology region of the human immunodeficiency virus, a region with significant sequence similarity to other lentiviruses including simian immunodeficiency virus, puma lentivirus, feline immunodeficiency virus, Jembrana disease virus, visna virus, and caprine arthritis encephalitis virus. PBMC reactivity to p15 peptides from EIAV carrier horses also occurred. Multiple p15 peptides were shown to be reactive, but not all infected horses had Th lymphocytes recognizing p15 epitopes. The identification of peptides reactive with PBMC from outbred horses, some of which encoded both CTL and Th lymphocyte epitopes, should contribute to the design of synthetic peptide or recombinant vector vaccines for EIAV. PMID:10196322

  1. Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer

    International Nuclear Information System (INIS)

    Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu

    2014-01-01

    Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA

  2. Pathology and polymerase chain reaction detection of ovine progressive pneumonia (maedi) cases in slaughtered sheep in India.

    Science.gov (United States)

    Singh, Rahul; Kumar, Pawan; Singh, Rajendra; Dhama, Kuldeep; Kumari, Swati; Yadav, Jay Prakash; Kashyap, Gayatri; Singh, Karam Pal; Singh, Vidya; Sahoo, Monalisa

    2017-11-01

    The small ruminant lentiviruses are known to cause maedi-visna (MV) and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR). In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at -20°C for PCR confirmation. Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. This study suggests the low occurrence of MV virus (MVV) infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV.

  3. Pathology and polymerase chain reaction detection of ovine progressive pneumonia (maedi cases in slaughtered sheep in India

    Directory of Open Access Journals (Sweden)

    Rahul Singh

    2017-11-01

    Full Text Available Aim: The small ruminant lentiviruses are known to cause maedi-visna (MV and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR. In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. Materials and Methods: A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at -20°C for PCR confirmation. Results: Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. Conclusion: This study suggests the low occurrence of MV virus (MVV infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV.

  4. Butter making from caprine creams: effect of washing treatment on phospholipids and milk fat globule membrane proteins distribution.

    Science.gov (United States)

    Lamothe, Sophie; Robitaille, Gilles; St-Gelais, Daniel; Britten, Michel

    2008-11-01

    A washing treatment was applied to caprine cream before churning in order to improve phospholipids and MFGM protein purification from buttermilk and butter serum. Cream obtained from a first separation was diluted with water and separated a second time using pilot plant equipment. Regular and washed creams were churned to produce buttermilk and butter, from which butter serum was extracted. The washing treatment allowed a significant decrease of the casein content. As a result, the phospholipids-to-protein ratios in washed buttermilk and butter serum were markedly increased by 2.1 and 1.7-folds respectively, which represents an advantage for the production of phospholipids concentrates. However, when compared with bovine cream, lower phospholipids-to-protein ratios were observed when the washing treatment was applied to caprine cream. A higher concentration of MFGM protein and a lower retention of phospholipids during washing treatment are responsible for the lower phospholipids-to-protein ratios in buttermilk and butter serum obtained from caprine cream. The phospholipids distribution in the butter making process was similar to the one obtained from bovine regular and washed cream. Phospholipids were preferentially concentrated in the butter serum rather than the buttermilk fraction. This simple approach permitted the production of caprine and bovine butter sera extracts containing up to 180 and 240 g phospholipids/kg sera, respectively, on a dry basis.

  5. The Fetal Cleft palate: V. Elucidation of the Mechanism of Palatal Clefting in the Congenital Caprine Model

    Science.gov (United States)

    Maternal ingestion of Nicotiana glauca from gestation days 32 through 41 results in a high incidence of cleft palate in Spanish goats. This caprine cleft palate model was used to evaluate the temporal sequence of palatal shelf fusion throughout the period of cleft induction with the poisonous plant...

  6. Detection of Helicobacter pylori in bovine, buffalo, camel, ovine, and caprine milk in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Kheirabadi, Elahe Kazemi

    2012-05-01

    Helicobacter pylori infection in humans is one of the most common infections worldwide. However, the origin and transmission of this bacterium has not been clearly explained. One of the suggested theories is transmission via raw milk from animals to human beings. This study was conducted to determine the prevalence rate of H. pylori in bulk milk samples from dairy bovine, buffalo, camel, ovine, and caprine herds in Iran. In the present study, 447 bulk milk samples from 230 dairy bovine, buffalo, camel, ovine, and caprine herds were collected in four provinces and tested for H. pylori by cultural method and polymerase chain reaction (PCR) for the detection of the ureC (glmM) gene. The animals whose milk samples collected for this study were clinically healthy. Using the cultural method, three of 447 milk samples (0.67%), including two sheep (2.2%) and one buffalo (1.6%) milk samples, were found to be contaminated with H. pylori. H. pylori ureC gene was detected in 56 (12.5%) of milk samples, including 19 cow (14.1%), 11 sheep (12.2%), nine goat (8.7%), two camel (3.6%), and 15 buffalo (23.4%) milk samples. Using PCR method, there were significant differences (pmilk samples collected from different species. The present study is the first report of the isolation of H. pylori from raw sheep and buffalo milk in Iran and the first demonstration of H. pylori DNA in camel and buffalo milk.

  7. Comparison of Staphylococcus aureus genotypes recovered from cases of bovine, ovine, and caprine mastitis.

    Science.gov (United States)

    Mørk, T; Tollersrud, T; Kvitle, B; Jørgensen, H J; Waage, S

    2005-08-01

    Staphylococcus aureus is an important pathogen in domestic ruminants. The main objective of this study was to determine the similarity of epidemiologically unrelated S. aureus isolates from bovine, ovine, and caprine mastitis. By pulsed-field gel electrophoresis, 160 different pulsotypes (PTs) were identified among 905 isolates recovered from 588 herds in 12 counties in Norway. Based on estimates of similarity, using an 80% cluster cutoff, the isolates were assigned to 47 clusters. One cluster included 62% of all the isolates and more than 45% of the isolates from each host species. Twenty-three PTs included isolates from more than one host species; these 23 PTs represented 72% of all the isolates. The six most prevalent PTs included isolates from all host species and contained 45% of the bovine isolates, 54% of the ovine isolates, and 37% of the caprine isolates. Antimicrobial susceptibility testing of 373 of the isolates revealed resistance to penicillin in 2.9% and to streptomycin in 2.4%; only 1.9% were resistant to 1 of the other 11 antimicrobials tested. The results of this study suggest that a small number of closely related genotypes are responsible for a great proportion of S. aureus mastitis cases in cows, ewes, and goats in Norway and that these genotypes exhibit little or no host preference among these species. Selection due to antimicrobial resistance appears not to have contributed to the predominance of these genotypes.

  8. Evaluation of oxidative stress in caprine bronchoalveolar lavage fluid of pneumonic and normal lungs

    Directory of Open Access Journals (Sweden)

    T.A. Jarikre

    2017-12-01

    Full Text Available Research in the area of oxidative stress in pneumonic pathology still requires attention in small ruminants especially with the use of bronchoalveolar lavage (BAL which may be a more sensitive indicator of respiratory diseases than blood. This investigation evaluates the role of oxidative stress in the pathogenesis of caprine pneumonia using BAL fluid (BALf from healthy and pneumonic goats. A BALf from 192 goats (whose pneumonic histopathology had been characterized using standard techniques was biochemically assayed for anti-oxidants and pro-oxidants. Malondialdehyde (MDA, hydrogen peroxide generation (H2O2, myeloperoxidase (MPO and reduced glutathione (GSH contents were measured to assess free radical activity in the BALf. Superoxide dismutase (SOD, Glutathione transferase (GST and Glutathione peroxidase (GPx activity were also determined colourimetrically. There were significant increases in the BALf supernatant of MDA, H2O2 and MPO with decreases in GSH level and SOD activity in the pneumonic goats (P < 0.05. There was also significant correlation of BALf oxidative assay to the type and severity of pneumonia. The levels of MDA, H2O2, and MPO increased significantly (P < 0.05 in bronchopneumonia and bronchointerstitial pneumonia than other pneumonic conditions and normal lungs. The management of caprine pneumonia should often incorporate antioxidant supplementation to correct the imbalance in pro-oxidant and anti-oxidant levels. Keywords: Anti-oxidants, Pro-oxidants, Pneumonia, Myeloperoxidase, Malondialdehyde, Glutathione transferase

  9. Study of caprine bones after moist and dry heat processes by X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Barbosa, Caroline M., E-mail: carolmattosb@yahoo.com.br [Instituto de Arqueologia Brasileira (IAB), Belford Roxo, RJ (Brazil); Azeredo, Soraia R.; Lopes, Ricardo T., E-mail: soraia@lin.ufrj.br [Coordenacao dos Programas de Pos-Graduacao em Engenharia (COPPE/LIN/UFRJ), Rio de Janeiro, RJ (Brazil). Laboratorio de Instrumentacao Nuclear; Souza, Sheila M.F.M de, E-mail: sferraz@ensp.fiocruz.br [Fundacao Oswaldo Cruz (ENSP/FIOCRUZ), Rio de Janeiro, RJ (Brazil). Escola Nacional de Saude Publica Sergio Arouca

    2013-07-01

    Bone tissue is a biological material composed of hydroxyapatite (HAp) and collagen matrix. The bone X-ray diffraction (XRD) pattern presents characteristics of the hydroxyapatite crystallography planes. This paper presents the characterization by X-ray diffraction of caprine bone powder pattern and the comparison of this pattern with moist or dry heat cooked bone patterns. The parameters chosen to characterize the X-ray diffraction peaks were: angular position (2θ), full width at half maximumt (FWHM), and relative intensity (I{sub rel}). The X-ray diffraction patterns were obtained with a Shimadzu XRD-6000 diffractometer. The caprine bone XRD pattern revealed a significant correlation of several crystallographic parameters (lattice data) with hydroxyapatite. The profiles of the three bone types analyzed presented differences. The study showed as small angular displacement (decrease of the 2θ angle) of some peaks was observed after moist and dry heat cooking processes. The characterization of bone tissue aimed to contribute to future analysis in the field of archeology. (author)

  10. Molecular characterization of exon 3 of caprine myostatin gene in Marwari goat

    Directory of Open Access Journals (Sweden)

    Jai Prakash Khichar

    2016-06-01

    Full Text Available Aim: To estimate genetic variability in exon 3 of caprine myostatin gene in Marwari goats. Materials and Methods: A total of 120 blood samples from unrelated Marwari goats were randomly collected from different villages of Bikaner (Rajasthan, India. Genomic DNA was extracted from whole blood using blood DNA isolation kit (Himedia Ltd. as per manufacturer’s protocol. The quality of extracted genomic DNA was checked on 0.8% agarose gel. Specifically designed a primer set for caprine myostatin (MSTN gene (Genebank accession no. DQ167575 was used to amplify the exon 3 region of MSTN gene in Marwari goat. The genetic variability in exon 3 of MSTN gene in Marwari goat was assessed on 8% polyacrylamide gel electrophoresis to detect single strand conformation polymorphism (SSCP pattern. Results: The exon 3 of MSTN gene in Marwari goat showed two types of conformation patterns on 8% polyacrylamide gel. One of the patterns showed only two bands and was considered as genotype AA, whereas another pattern having an extra band was designated as genotype AB. The frequencies of AA and AB genotype for exon 3 region of MSTN gene were calculated as 0.90 and 0.10, respectively. Conclusion: Low level of polymorphism was observed at exon 3 region of MSTN gene in Marwari goat through SSCP analysis. This information could be utilized in future breeding plan to exploit the unique characteristics of Marwari goat of Rajasthan.

  11. Study of caprine bones after moist and dry heat processes by X-ray diffraction

    International Nuclear Information System (INIS)

    Barbosa, Caroline M.; Azeredo, Soraia R.; Lopes, Ricardo T.; Souza, Sheila M.F.M de

    2013-01-01

    Bone tissue is a biological material composed of hydroxyapatite (HAp) and collagen matrix. The bone X-ray diffraction (XRD) pattern presents characteristics of the hydroxyapatite crystallography planes. This paper presents the characterization by X-ray diffraction of caprine bone powder pattern and the comparison of this pattern with moist or dry heat cooked bone patterns. The parameters chosen to characterize the X-ray diffraction peaks were: angular position (2θ), full width at half maximumt (FWHM), and relative intensity (I rel ). The X-ray diffraction patterns were obtained with a Shimadzu XRD-6000 diffractometer. The caprine bone XRD pattern revealed a significant correlation of several crystallographic parameters (lattice data) with hydroxyapatite. The profiles of the three bone types analyzed presented differences. The study showed as small angular displacement (decrease of the 2θ angle) of some peaks was observed after moist and dry heat cooking processes. The characterization of bone tissue aimed to contribute to future analysis in the field of archeology. (author)

  12. Highly efficient generation of transgenic sheep by lentivirus accompanying the alteration of methylation status.

    Directory of Open Access Journals (Sweden)

    Chenxi Liu

    Full Text Available BACKGROUND: Low efficiency of gene transfer and silence of transgene expression are the critical factors hampering the development of transgenic livestock. Recently, transfer of recombinant lentivirus has been demonstrated to be an efficient transgene delivery method in various animals. However, the lentiviral transgenesis and the methylation status of transgene in sheep have not been well addressed. METHODOLOGY/PRINCIPLE FINDINGS: EGFP transgenic sheep were generated by injecting recombinant lentivirus into zygotes. Of the 13 lambs born, 8 carried the EGFP transgene, and its chromosomal integration was identified in all tested tissues. Western blotting showed that GFP was expressed in all transgenic founders and their various tissues. Analysis of CpG methylation status of CMV promoter by bisulfate sequencing unraveled remarkable variation of methylation levels in transgenic sheep. The average methylation levels ranged from 37.6% to 79.1% in the transgenic individuals and 34.7% to 83% in the tested tissues. Correlative analysis of methylation status with GFP expression revealed that the GFP expression level was inversely correlated with methylation density. The similar phenomenon was also observed in tested tissues. Transgene integration determined by Southern blotting presented multiple integrants ranging from 2 to 6 copies in the genome of transgenic sheep. CONCLUSIONS/SIGNIFICANCE: Injection of lentiviral transgene into zygotes could be a promising efficient gene delivery system to generate transgenic sheep and achieved widespread transgene expression. The promoter of integrants transferred by lentiviral vector was subjected to dramatic alteration of methylation status and the transgene expression level was inversely correlative with promoter methylation density. Our work illustrated for the first time that generation of transgenic sheep by injecting recombinant lentivirus into zygote could be an efficient tool to improve sheep performance by

  13. Viral load and clinical disease enhancement associated with a lentivirus cytotoxic T lymphocyte vaccine regimen

    Science.gov (United States)

    Mealey, Robert H.; Leib, Steven R.; Littke, Matt H.; Wagner, Bettina; Horohov, David W.; McGuire, Travis C.

    2009-01-01

    Effective DNA-based vaccines against lentiviruses will likely induce CTL against conserved viral proteins. Equine infectious anemia virus (EIAV) infects horses worldwide, and serves as a useful model for lentiviral immune control. Although attenuated live EIAV vaccines have induced protective immune responses, DNA-based vaccines have not. In particular, DNA-based vaccines have had limited success in inducing CTL responses against intracellular pathogens in the horse. We hypothesized that priming with a codon-optimized plasmid encoding EIAV Gag p15/p26 with co-administration of a plasmid encoding an equine IL-2/IgG fusion protein as a molecular adjuvant, followed by boosting with a vaccinia vector expressing Gag p15/p26, would induce protective Gag-specific CTL responses. Although the regimen induced Gag-specific CTL in four of seven vaccinated horses, CTL were not detected until after the vaccinia boost, and protective effects were not observed in EIAV challenged vaccinates. Unexpectedly, vaccinates had significantly higher viral loads and more severe clinical disease, associated with the presence of vaccine-induced CTL. It was concluded that 1.) further optimization of the timing and route of DNA immunization was needed for efficient CTL priming in vivo, 2.) co-administration of the IL-2/IgG plasmid did not enhance CTL priming by the Gag p15/p26 plasmid, 3.) vaccinia vectors are useful for lentivirus-specific CTL induction in the horse, 4.) Gag-specific CTL alone are either insufficient or a more robust Gag-specific CTL response is needed to limit EIAV viremia and clinical disease, and 5.) CTL-inducing vaccines lacking envelope immunogens can result in lentiviral disease enhancement. Although the mechanisms for enhancement associated with this vaccine regimen remain to be elucidated, these results have important implications for development of lentivirus T cell vaccines. PMID:19368787

  14. Evolution of puma lentivirus in bobcats (Lynx rufus) and mountain lions (Puma concolor) in North America.

    Science.gov (United States)

    Lee, Justin S; Bevins, Sarah N; Serieys, Laurel E K; Vickers, Winston; Logan, Ken A; Aldredge, Mat; Boydston, Erin E; Lyren, Lisa M; McBride, Roy; Roelke-Parker, Melody; Pecon-Slattery, Jill; Troyer, Jennifer L; Riley, Seth P; Boyce, Walter M; Crooks, Kevin R; VandeWoude, Sue

    2014-07-01

    Mountain lions (Puma concolor) throughout North and South America are infected with puma lentivirus clade B (PLVB). A second, highly divergent lentiviral clade, PLVA, infects mountain lions in southern California and Florida. Bobcats (Lynx rufus) in these two geographic regions are also infected with PLVA, and to date, this is the only strain of lentivirus identified in bobcats. We sequenced full-length PLV genomes in order to characterize the molecular evolution of PLV in bobcats and mountain lions. Low sequence homology (88% average pairwise identity) and frequent recombination (1 recombination breakpoint per 3 isolates analyzed) were observed in both clades. Viral proteins have markedly different patterns of evolution; sequence homology and negative selection were highest in Gag and Pol and lowest in Vif and Env. A total of 1.7% of sites across the PLV genome evolve under positive selection, indicating that host-imposed selection pressure is an important force shaping PLV evolution. PLVA strains are highly spatially structured, reflecting the population dynamics of their primary host, the bobcat. In contrast, the phylogeography of PLVB reflects the highly mobile mountain lion, with diverse PLVB isolates cocirculating in some areas and genetically related viruses being present in populations separated by thousands of kilometers. We conclude that PLVA and PLVB are two different viral species with distinct feline hosts and evolutionary histories. Importance: An understanding of viral evolution in natural host populations is a fundamental goal of virology, molecular biology, and disease ecology. Here we provide a detailed analysis of puma lentivirus (PLV) evolution in two natural carnivore hosts, the bobcat and mountain lion. Our results illustrate that PLV evolution is a dynamic process that results from high rates of viral mutation/recombination and host-imposed selection pressure. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  15. Host Restriction of Lentiviruses and Viral Countermeasures: APOBEC3 and Vif

    Directory of Open Access Journals (Sweden)

    Valgerdur Andrésdóttir

    2013-07-01

    Full Text Available It is becoming increasingly clear that organisms have developed a variety of mechanisms to fight against viral infection. The viruses have developed means of counteracting these defences in various ways. The APOBEC3 proteins are a mammalian-specific family of nucleic acid cytidine deaminases that block retroviral infection. These inhibitors are counteracted by the Vif proteins encoded by most lentiviruses. In this paper, we will review the interaction of the lentiviral Vif proteins with the APOBEC3 proteins, with an emphasis on sheep APOBEC3 and maedi-visna virus (MVV Vif.

  16. Vaccination delays maedi-visna lentivirus infection in a naturally-infected sheep flock

    Directory of Open Access Journals (Sweden)

    Gudnadóttir Margrét

    2013-01-01

    Full Text Available Abstract Background The Maedi-Visna (MV lentivirus causes two slowly progressive eventually fatal diseases of sheep, Maedi, a progressive interstitial pneumonia, and Visna, a progressive demyelinating disease of the central nervous system. Other lentiviruses also cause fatal slow infections in their natural hosts, e.g. the HIV virus in humans. Results of experimental vaccination against any lentivirus where vaccinees are challenged by natural routes, may therefore be of general interest. From 1991–1998 experiments with formalin-inactivated whole Maedi-Visna virus vaccine were carried out in the Department of Microbiology at the University of Iceland. Western Blot tests showed good immune response to all major proteins of the virus. When aluminium hydroxide was added to the vaccine all vaccinees developed neutralizing antibodies to the vaccine strain at titers 1/8 – 1/256. After housing 5 twin pairs, one twin in each pair vaccinated, the other unvaccinated, with infected sheep for 4 years, all the unvaccinated twins became infected, but only 2 of their vaccinated siblings as confirmed by virus cultivation experiments on tissues from their lungs spleens lymph nodes and choroid plexuses. Results One twin in each of 40 female twin pairs, born into a Maedi-Visna-infected sheep flock and kept under natural farming conditions in Cyprus, was vaccinated at birth, 3 weeks and 3 months, with formalin-inactivated whole Maedi-Visna lentivirus vaccine adjuvanted with aluminium hydroxide. 17 mothers of the twins were seronegative, 13 seroconverting and 10 had old infection. Of 17 vaccinees born to seronegative mothers 9 were uninfected at 28 months, but only 2 of their unvaccinated siblings. Of 13 unvaccinated twins born to seroconverting mothers, 12 caught infection during their first 10 weeks, but only 4 of their vaccinated siblings. Vaccination had no effects on 10 vaccinees born to mothers with long-standing Maedi-Visna infections and broad andibody

  17. Deletion variant near ZNF389 is associated with control of ovine lentivirus in multiple sheep flocks

    Science.gov (United States)

    White, S N; Mousel, M R; Reynolds, J O; Herrmann-Hoesing, L M; Knowles, D P

    2014-01-01

    Ovine lentivirus (OvLV) is a macrophage-tropic lentivirus found in many countries that causes interstitial pneumonia, mastitis, arthritis and cachexia in sheep. There is no preventive vaccine and no cure, but breed differences suggest marker-assisted selective breeding might improve odds of infection and control of OvLV post-infection. Although variants in TMEM154 have consistent association with odds of infection, no variant in any gene has been associated with host control of OvLV post-infection in multiple animal sets. Proviral concentration is a live-animal diagnostic measure of OvLV control post-infection related to severity of OvLV-induced lesions. A recent genome-wide association study identified a region including four zinc finger genes associated with proviral concentration in one Rambouillet flock. To refine this region, we tested additional variants and identified a small insertion/deletion variant near ZNF389 that showed consistent association with proviral concentration in three animal sets (P sheep from multiple locations and management conditions. Strikingly, one flock had exceptionally high prevalence (>87%, including yearlings) and mean proviral concentration (>950 copies/μg), possibly due to needle sharing. The best estimate of proviral concentration by genotype, obtained from all 1310 OvLV-positive animals tested, showed insertion homozygotes had less than half the proviral concentration of other genotypes (P sheep flocks. PMID:24303974

  18. Lentivirus-mediated shRNA interference targeting SLUG inhibits lung cancer growth and metastasis.

    Science.gov (United States)

    Wang, Yao-Peng; Wang, Ming-Zhao; Luo, Yi-Ren; Shen, Yi; Wei, Zhao-Xia

    2012-01-01

    Lung cancer is a deadly cancer, whose kills more people worldwide than any other malignancy. SLUG (SNAI2, Snail2) is involved in the epithelial mesenchymal transition in physiological and in pathological contexts and is implicated in the development and progression of lung cancer. We constructed a lentivirus vector with SLUG shRNA (LV-shSLUG). LV-shSLUG and a control lentivirus were infected into the non-small cell lung cancer cell A549 and real-time PCR, Western blot and IHC were applied to assess expression of the SLUG gene. Cell proliferation and migration were detected using MTT and clony formation methods. Real-time PCR, Western Blot and IHC results confirmed down-regulation of SLUG expression by its shRNA by about 80%~90% at both the mRNA and protein levels. Knockdown of SLUG significantly suppressed lung cancer cell proliferation. Furthermore, knockdown of SLUG significantly inhibited lung cancer cell invasion and metastasis. Finally, knockdown of SLUG induced the down-regulation of Bcl-2 and up-regulation of E-cadherin. These results indicate that SLUG is a newly identified gene associated with lung cancer growth and metastasis. SLUG may serve as a new therapeutic target for the treatment of lung cancer in the future.

  19. Generation and analysis of lentivirus expressing a 2A peptide-linked bicistronic fluorescent construct.

    Science.gov (United States)

    Huss, David; Lansford, Rusty

    2014-12-01

    This weeklong protocol for making and testing lentivirus has been used in the Advanced Topics in Molecular Neuroscience (ATMN) lecture and laboratory course at Cold Spring Harbor Laboratory (CSHL) for nearly a decade. Lentiviruses are derived from HIV-1 and are ideal vehicles for the delivery of multiple genes of interest into target cells. In this protocol, 2A peptide-linked sequences are used to create a bicistronic lentiviral construct containing a ubiquitous promoter (chick β actin with a cytomegalovirus [CMV] early enhancer) driving dual expression of two fluorescent proteins (FP): H2B-Cerulean (a nuclear-localized blue FP) and Dendra2 (a photoactivatable green FP that converts to red after exposure to UV light). Polymerase chain reaction (PCR) amplification of the bicistronic insert is followed by subcloning into a lentiviral vector and transfection into a packaging cell line. The resulting viral supernatants can be used to prepare concentrated stocks and infect cells for imaging via epifluorescent and confocal microscopy. © 2014 Cold Spring Harbor Laboratory Press.

  20. Evolution of puma lentivirus in bobcats (Lynx rufus) and mountain lions (Puma concolor) in North America

    Science.gov (United States)

    Lee, Justin S.; Bevins, Sarah N.; Serieys, Laurel E.K.; Vickers, Winston; Logan, Ken A.; Aldredge, Mat; Boydston, Erin E.; Lyren, Lisa M.; McBride, Roy; Roelke-Parker, Melody; Pecon-Slattery, Jill; Troyer, Jennifer L.; Riley, Seth P.; Boyce, Walter M.; Crooks, Kevin R.; VandeWoude, Sue

    2014-01-01

    Mountain lions (Puma concolor) throughout North and South America are infected with puma lentivirus clade B (PLVB). A second, highly divergent lentiviral clade, PLVA, infects mountain lions in southern California and Florida. Bobcats (Lynx rufus) in these two geographic regions are also infected with PLVA, and to date, this is the only strain of lentivirus identified in bobcats. We sequenced full-length PLV genomes in order to characterize the molecular evolution of PLV in bobcats and mountain lions. Low sequence homology (88% average pairwise identity) and frequent recombination (1 recombination breakpoint per 3 isolates analyzed) were observed in both clades. Viral proteins have markedly different patterns of evolution; sequence homology and negative selection were highest in Gag and Pol and lowest in Vif and Env. A total of 1.7% of sites across the PLV genome evolve under positive selection, indicating that host-imposed selection pressure is an important force shaping PLV evolution. PLVA strains are highly spatially structured, reflecting the population dynamics of their primary host, the bobcat. In contrast, the phylogeography of PLVB reflects the highly mobile mountain lion, with diverse PLVB isolates cocirculating in some areas and genetically related viruses being present in populations separated by thousands of kilometers. We conclude that PLVA and PLVB are two different viral species with distinct feline hosts and evolutionary histories.

  1. Estudios estructurales de la proteína mayoritaria de la cápsida de lentivirus

    OpenAIRE

    Yélamos López, María Belén

    1998-01-01

    Los Lentivirus son un grupo de virus, subfamilia de los Retrovirus. Incluyen virus de gran importancia tanto veterinaria, como el virus de la anemia infecciosa equina (EIAV) o el virus de la inmunodeficiencia felina (FIV), como clínica como el virus de la inmunodeficiencia humana (HIV). Nuestro sistema de estudio es la proteína mayoritaria de la cápsida de lentivirus. Las proteínas de las cápsidas lentivirales tienen una gran homología de secuencia. Este alto grado de similitud, junto con la ...

  2. Activities of indigenous proteolytic enzymes in caprine milk of different somatic cell counts.

    Science.gov (United States)

    Albenzio, M; Santillo, A; Kelly, A L; Caroprese, M; Marino, R; Sevi, A

    2015-11-01

    Individual caprine milk with different somatic cell counts (SCC) were studied with the aim of investigating the percentage distribution of leukocyte cell types and the activities of indigenous proteolytic enzymes; proteolysis of casein was also studied in relation to cell type following recovery from milk. The experiment was conducted on 5 intensively managed dairy flocks of Garganica goats; on the basis of SCC, the experimental groups were denoted low (L-SCC; 1,501,000 cells/mL) SCC. Leukocyte distribution differed between groups; polymorphonuclear neutrophilic leukocytes were higher in M-SCC and H-SCC milk samples, the percentage macrophages was the highest in H-SCC, and levels of nonviable cells significantly decreased with increasing SCC. Activities of all the main proteolytic enzymes were affected by SCC; plasmin activity was the highest in H-SCC milk and the lowest in L-SCC, and elastase and cathepsin D activities were the highest in M-SCC. Somatic cell count influenced casein hydrolysis patterns, with less intact α- and β-casein in H-SCC milk. Higher levels of low electrophoretic mobility peptides were detected in sodium caseinate incubated with leukocytes isolated from L-SCC milk, independent of cell type, whereas among cells recovered from M-SCC milk, macrophages yielded the highest levels of low electrophoretic mobility peptides from sodium caseinate. The level of high electrophoretic mobility peptides was higher in sodium caseinate incubated with polymorphonuclear neutrophilic leukocytes and macrophages isolated from M-SCC, whereas the same fraction of peptides was always the highest, independent of leukocyte type, for cells recovered from H-SCC milk. In caprine milk, a level of 700,000 cells/mL represented the threshold for changes in leukocyte distribution, which is presumably related to the immune status of the mammary gland. Differences in the profile of indigenous lysosomal proteolytic enzymes in caprine milk may influence the integrity of casein

  3. Dynamic Patterns of Systemic Innate Immunity and Inflammatory Associated Factors in Experimental Caprine Coccidiosis.

    Science.gov (United States)

    Tadayon, Shabnam; Razavi, Seyed Mostafa; Nazifi, Saeed

    2016-12-01

    The present study was designed to assess the dynamic patterns of pro-inflammatory cytokines, including IFN-γ, TNF-α, IL-4, IL-6, acute phase protein (α1-acid-glycoprotein, AGP), and an inflammation associated factor (adenosine deaminase; ADA) following experimental caprine coccidiosis. Ten kids aging from 2 to 4 months were infected orally with 5×10 4 sporulated oocysts and 10 animals served as controls. Blood samples were collected in both groups before infection and at days 3, 7, 14, 21, 28, and 35 post-infection (PI), and the levels of above-mentioned factors were measured. IFN-γ, TNF-α, IL-4, IL-6, AGP, and ADA activities were significantly higher in infected animals from day 7 PI ( P coccidiosis.

  4. Molecular dating of caprines using ancient DNA sequences of Myotragus balearicus, an extinct endemic Balearic mammal

    Directory of Open Access Journals (Sweden)

    Alcover Josep Antoni

    2005-12-01

    Full Text Available Abstract Background Myotragus balearicus was an endemic bovid from the Balearic Islands (Western Mediterranean that became extinct around 6,000-4,000 years ago. The Myotragus evolutionary lineage became isolated in the islands most probably at the end of the Messinian crisis, when the desiccation of the Mediterranean ended, in a geological date established at 5.35 Mya. Thus, the sequences of Myotragus could be very valuable for calibrating the mammalian mitochondrial DNA clock and, in particular, the tree of the Caprinae subfamily, to which Myotragus belongs. Results We have retrieved the complete mitochondrial cytochrome b gene (1,143 base pairs, plus fragments of the mitochondrial 12S gene and the nuclear 28S rDNA multi-copy gene from a well preserved Myotragus subfossil bone. The best resolved phylogenetic trees, obtained with the cytochrome b gene, placed Myotragus in a position basal to the Ovis group. Using the calibration provided by the isolation of Balearic Islands, we calculated that the initial radiation of caprines can be dated at 6.2 ± 0.4 Mya. In addition, alpine and southern chamois, considered until recently the same species, split around 1.6 ± 0.3 Mya, indicating that the two chamois species have been separated much longer than previously thought. Conclusion Since there are almost no extant endemic mammals in Mediterranean islands, the sequence of the extinct Balearic endemic Myotragus has been crucial for allowing us to use the Messinian crisis calibration point for dating the caprines phylogenetic tree.

  5. Purification and characterization of a sperm motility inhibiting factor from caprine epididymal plasma.

    Directory of Open Access Journals (Sweden)

    Sujoy Das

    Full Text Available Several studies have been reported on the occurrence of sperm motility inhibiting factors in the male reproductive fluids of different mammalian species, but these proteins have not been adequately purified and characterized. A novel sperm motility inhibiting factor (MIF-II has been purified from caprine epididymal plasma (EP by Hydroxylapatite gel adsorption chromatography, DEAE-Cellulose ion-exchange chromatography and chromatofocusing. The MIF-II has been purified to apparent homogeneity and the molecular weight estimated by Sephacryl S-300 gel filtration is 160 kDa. MIF-II is a dimeric protein, made up of two subunits each having a molecular mass of 80 kDa as shown by SDS-PAGE. The isoelectric point of MIF-II is 5.1 as determined by chromatofocusing and isoelectric focusing. It is a heat labile protein and maximal active at the pH 6.9 to 7.5. The sperm motility inhibiting protein factor at 2 microg/ml (12.5 nM level showed maximal motility-inhibiting activity. The observation that the epididymal plasma factor lowered the intracellular cAMP level of spermatozoa in a concentration-dependent manner suggests that it may block the motility of caprine cauda spermatozoa by interfering the cAMP dependent motility function. The results revealed that the purified protein factor has the potential of sperm motility inhibition and may serve as a vaginal contraceptive. The antibody raised against the MIF-II has the potential for enhancement of forward motility of cauda-spermatozoa. This antibody may thus be useful for solving some of the problems of male infertility due to low sperm motility.

  6. Caprine brucellosis: A historically neglected disease with significant impact on public health.

    Science.gov (United States)

    Rossetti, Carlos A; Arenas-Gamboa, Angela M; Maurizio, Estefanía

    2017-08-01

    Caprine brucellosis is a chronic infectious disease caused by the gram-negative cocci-bacillus Brucella melitensis. Middle- to late-term abortion, stillbirths, and the delivery of weak offspring are the characteristic clinical signs of the disease that is associated with an extensive negative impact in a flock's productivity. B. melitensis is also the most virulent Brucella species for humans, responsible for a severely debilitating and disabling illness that results in high morbidity with intermittent fever, chills, sweats, weakness, myalgia, abortion, osteoarticular complications, endocarditis, depression, anorexia, and low mortality. Historical observations indicate that goats have been the hosts of B. melitensis for centuries; but around 1905, the Greek physician Themistokles Zammit was able to build the epidemiological link between "Malta fever" and the consumption of goat milk. While the disease has been successfully managed in most industrialized countries, it remains a significant burden on goat and human health in the Mediterranean region, the Middle East, Central and Southeast Asia (including India and China), sub-Saharan Africa, and certain areas in Latin America, where approximately 3.5 billion people live at risk. In this review, we describe a historical evolution of the disease, highlight the current worldwide distribution, and estimate (by simple formula) the approximate costs of brucellosis outbreaks to meat- and milk-producing farms and the economic losses associated with the disease in humans. Successful control leading to eradication of caprine brucellosis in the developing world will require a coordinated Global One Health approach involving active involvement of human and animal health efforts to enhance public health and improve livestock productivity.

  7. Caprine brucellosis: A historically neglected disease with significant impact on public health.

    Directory of Open Access Journals (Sweden)

    Carlos A Rossetti

    2017-08-01

    Full Text Available Caprine brucellosis is a chronic infectious disease caused by the gram-negative cocci-bacillus Brucella melitensis. Middle- to late-term abortion, stillbirths, and the delivery of weak offspring are the characteristic clinical signs of the disease that is associated with an extensive negative impact in a flock's productivity. B. melitensis is also the most virulent Brucella species for humans, responsible for a severely debilitating and disabling illness that results in high morbidity with intermittent fever, chills, sweats, weakness, myalgia, abortion, osteoarticular complications, endocarditis, depression, anorexia, and low mortality. Historical observations indicate that goats have been the hosts of B. melitensis for centuries; but around 1905, the Greek physician Themistokles Zammit was able to build the epidemiological link between "Malta fever" and the consumption of goat milk. While the disease has been successfully managed in most industrialized countries, it remains a significant burden on goat and human health in the Mediterranean region, the Middle East, Central and Southeast Asia (including India and China, sub-Saharan Africa, and certain areas in Latin America, where approximately 3.5 billion people live at risk. In this review, we describe a historical evolution of the disease, highlight the current worldwide distribution, and estimate (by simple formula the approximate costs of brucellosis outbreaks to meat- and milk-producing farms and the economic losses associated with the disease in humans. Successful control leading to eradication of caprine brucellosis in the developing world will require a coordinated Global One Health approach involving active involvement of human and animal health efforts to enhance public health and improve livestock productivity.

  8. Changing patterns of acute phase proteins and inflammatory mediators in experimental caprine coccidiosis.

    Science.gov (United States)

    Hashemnia, Mohammad; Khodakaram-Tafti, Azizollah; Razavi, Seyed Mostafa; Nazifi, Saeed

    2011-09-01

    This experiment was conducted to assess the changing patterns and relative values of acute phase proteins and inflammatory cytokines in experimental caprine coccidiosis. Eighteen newborn kids were allocated to 3 equal groups. Two groups, A and B, were inoculated with a single dose of 1×10(3) and1×10(5) sporulated oocysts of Eimeria arloingi, respectively. The third group, C, received distilled water as the control. Blood samples were collected from the jugular vein of each kid in both groups before inoculation and at days 7, 14, 21, 28, 35, and 42 post-inoculation (PI), and the levels of haptoglobin (Hp), serum amyloid A (SAA), TNF-α, and IFN-γ were measured. For histopathological examinations, 2 kids were selected from each group, euthanized, and necropsied on day 42 PI. Mean Hp concentrations in groups A and B (0.34 and 0.68 g/L) at day 7 PI were 3.2 and 6.3 times higher than the levels before inoculation. The mean SAA concentrations in groups A and B (25.6 and 83.5 µg/ml) at day 7 PI were 4.2 and 13.7 times higher than the levels before inoculation. The magnitude and duration of the Hp and SAA responses correlated well with the inoculation doses and the severity of the clinical signs and diarrhea in kids. These results were consistent with the histopathological features, which showed advanced widespread lesions in group B. In both groups, significant correlations were observed for TNF-α and IFN-γ with SAA and Hp, respectively. In conclusion, Hp and SAA can be useful non-specific diagnostic indicators in caprine coccidiosis.

  9. Caprine brucellosis: A historically neglected disease with significant impact on public health

    Science.gov (United States)

    Arenas-Gamboa, Angela M.; Maurizio, Estefanía

    2017-01-01

    Caprine brucellosis is a chronic infectious disease caused by the gram-negative cocci-bacillus Brucella melitensis. Middle- to late-term abortion, stillbirths, and the delivery of weak offspring are the characteristic clinical signs of the disease that is associated with an extensive negative impact in a flock’s productivity. B. melitensis is also the most virulent Brucella species for humans, responsible for a severely debilitating and disabling illness that results in high morbidity with intermittent fever, chills, sweats, weakness, myalgia, abortion, osteoarticular complications, endocarditis, depression, anorexia, and low mortality. Historical observations indicate that goats have been the hosts of B. melitensis for centuries; but around 1905, the Greek physician Themistokles Zammit was able to build the epidemiological link between “Malta fever” and the consumption of goat milk. While the disease has been successfully managed in most industrialized countries, it remains a significant burden on goat and human health in the Mediterranean region, the Middle East, Central and Southeast Asia (including India and China), sub-Saharan Africa, and certain areas in Latin America, where approximately 3.5 billion people live at risk. In this review, we describe a historical evolution of the disease, highlight the current worldwide distribution, and estimate (by simple formula) the approximate costs of brucellosis outbreaks to meat- and milk-producing farms and the economic losses associated with the disease in humans. Successful control leading to eradication of caprine brucellosis in the developing world will require a coordinated Global One Health approach involving active involvement of human and animal health efforts to enhance public health and improve livestock productivity. PMID:28817647

  10. Effects of reducing fat content on the proteolytic and rheological properties of Cheddar-like caprine milk cheese

    Science.gov (United States)

    High-moisture Cheddar-like cheeses made from caprine milk containing 3.6, 2.0, 1.0, and 0.1-0.5% fat were manufactured and their proteolytic and rheological properties compared after 1, 3, and 6 mo of aging at 4 deg C. The full-fat (FF), reduced fat (RF), low-fat (LF), and non-fat (NF) cheeses conta...

  11. Incidence of Listeria species in bovine, ovine, caprine, camel and water buffalo milk using cultural method and the PCR assay

    Directory of Open Access Journals (Sweden)

    Ebrahim Rahimi

    2014-02-01

    Full Text Available Objective: To determine the prevalence rate of Listeria species in bovine, ovine, caprine, camel and water buffalo milk in Iran. Methods: From September 2010 to December 2011 a total of 260 bulk milk samples including 85 bovine, 37 camel, 34 water buffalo, 56 ovine and 48 caprine bulk milk samples were collected from commercial dairy herds, in Fars and Khuzestan provinces, Iran and were evaluated for the presence of Listeria species using cultural method and the PCR assay. Results: Using cultural method, 19 samples (7.3% were positive for Listeria spp. The highest prevalence of Listeria was found in raw water buffalo milk (11.8%, followed by raw bovine milk (10.6%, raw ovine milk (7.1%, and raw caprine milk (4.2% samples. All 37 camel milk samples from 20 camel breeding farms were negative for Listeria spp. The overall prevalence of Listeria was 7.3%, in which Listeria innocua was the most recovered species (4.2%; the remaining isolates were Listeria monocytogenes (1.9%, Listeria ivanovii (0.08% and Listeria seeligari (0.04%. The PCR assay could identify 8 Listeria-contaminated milk samples that were negative using the cultural method. Conclusions: The results presented in this study indicate the potential risk of infection with Listeria in people consuming raw and unpasteurized milk.

  12. Transgenic expression of green fluorescent protein in caprine embryos produced through electroporation-aided sperm-mediated gene transfer.

    Science.gov (United States)

    Kumar Pramod, R; Kumar, Rakesh; Mitra, Abhijit

    2016-01-15

    Current methods of transgenic animal production are afflicted by low efficiency and high cost. Recently, the electroporation aided sperm-mediated gene transfer (SMGT) emerges as a promising alternative with variable success rate. Among the domestic animal species, the electroporation-aided SMGT is less investigated in goats, except a few reports in which attempts have been made using the auto-uptake method of SMGT. In this study, we report an optimized electroporation condition for SMGT of caprine sperm cells. Results of this study demonstrated that electroporation of caprine sperm cells at 300 V for 200 mS in TALP medium allowed the maximum uptake of foreign DNA with minimum adverse effects on the vital semen parameters viz., progressive motility, viability, and membrane and acrosome integrity. Further, DNA binding assay revealed DNA uptake by 81.3% sperm cells when 1.0 μg of DNA was used under optimum electroporation conditions as compared to 16.5% on simple incubation. The qPCR analysis showed four-fold more (Pexpression of the foreign gene. In conclusion, our results confirm that using optimized electroporation conditions, the caprine sperm cells can uptake foreign DNA effectively with minimum negative effect on the semen parameters and could produce transgenic embryos. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. The epidemiology of lion lentivirus infection among a population of free-ranging lions (Panthera leo) in the Kruger National Park, South Africa.

    Science.gov (United States)

    Adams, H; van Vuuren, M; Bosman, A-M; Keet, D; New, J; Kennedy, M

    2009-09-01

    Feline immunodeficiency virus is a lentivirus of domestic cats that causes significant lifelong infection. Infection with this or similar lentiviruses has been detected in several nondomestic feline species, including African lions (Panthera leo). Although lion lentivirus (FIVple) infection is endemic in certain lion populations in eastern and southern Africa, little is known about its pathogenic effects or its epidemiological impact in free-ranging lions. This report describes the epidemiological investigation of lentivirus positivity of free-ranging lions in the Kruger National Park, South Africa. A nested polymerase chain reaction assay for virus detection was performed on all whole blood samples collected. In addition, serum samples were tested for cross-reactive antibodies to domestic feline lentivirus antigens and to puma lentivirus synthetic envelope peptide antigen. The results were analysed in conjunction with epidemiological data to provide a descriptive epidemiological study on lion lentivirus infection in a free-ranging population of lions. The overall prevalence of lentivirus infection was 69%, with a prevalence of 41% in the north of the park, and 80% in the south. Adult males had the highest prevalence when combining the factors of sex and age: 94%. The lowest prevalences were found among juveniles, with male juveniles at 29%. Adults were 5.58 times more likely to test positive for FIVple than juveniles, with adult males being 35 times more likely to be test positive for FIVple compared with juvenile males. This research represents the 1st epidemiological study of the lion lentivirus among free-ranging lions in the Kruger National Park.

  14. The epidemiology of lion lentivirus infection among a population of free-ranging lions (Panthera leo in the Kruger National Park, South Africa

    Directory of Open Access Journals (Sweden)

    H. Adams

    2009-05-01

    Full Text Available Feline immunodeficiency virus is a lentivirus of domestic cats that causes significant lifelong infection. Infection with this or similar lentiviruses has been detected in several non-domestic feline species, including African lions (Panthera leo. Although lion lentivirus (FIVple infection is endemic in certain lion populations in eastern and southern Africa, little is known about its pathogenic effects or its epidemiological impact in free-ranging lions. This report describes the epidemiological investigation of lentivirus positivity of free-ranging lions in the Kruger National Park, South Africa. A nested polymerase chain reaction assay for virus detection was performed on all whole blood samples collected. In addition, serum samples were tested for cross-reactive antibodies to domestic feline lentivirus antigens and to puma lentivirus synthetic envelope peptide antigen. The results were analysed in conjunction with epidemiological data to provide a descriptive epidemiological study on lion lentivirus infection in a free-ranging population of lions. The overall prevalence of lentivirus infection was 69 %, with a prevalence of 41 % in the north of the park, and 80 %in the south. Adult males had the highest prevalence when combining the factors of sex and age: 94 %. The lowest prevalences were found among juveniles, with male juveniles at 29 %. Adults were 5.58 times more likely to test positive for FIVple than juveniles, with adult males being 35 times more likely to be test positive for FIVple compared with juvenile males. This research represents the 1st epidemiological study of the lion lentivirus among free-ranging lions in the Kruger National Park.

  15. Dynamical changes of basic chemical indicators and significant lipophilic vitamins in caprine colostrum

    Directory of Open Access Journals (Sweden)

    Lucia Hodulová

    2014-01-01

    Full Text Available Colostrum is currently used as a food supplement. It has been sought after by an increasing number of consumers for its unique composition. Its use is supported by EU legislation that defines colostrum as an animal product for human consumption. Therefore, information on its chemical properties and the content of lipophilic vitamins are important when evaluating colostrum quality and safety. The aim of this study was to assess the dynamic changes of basic chemical properties (protein, fat, lactose, and dry matter and the content of selected lipophilic vitamins (vitamin A and vitamin E in white short-haired goat’s colostrum. Attention was paid to the first milk from the first hour to the sixth day after parturition as the initial milk composition changes rapidly during this period. Protein, fat, and lactose concentrations were measured by near infrared spectroscopy, vitamins were analysed simultaneously by ultra-high performance liquid chromatography with detection in the ultraviolet part of the spectrum. The most significant changes in chemical indicators occurred during the first three days (P ≤ 0.01 post partum. The highest decrease was observed in protein concentrations. It was × 2 lower than in the first hour post partum. The concentration of vitamin A rapidly decreased during 36 h. In the following hours, gradual changes were observed (P > 0.05. The analysed components in caprine colostrum were similar to mature milk after 132 h post partum.

  16. Enhancement of the antiviral activity against caprine herpesvirus type 1 of Acyclovir in association with Mizoribine.

    Science.gov (United States)

    Camero, Michele; Buonavoglia, Domenico; Lucente, Maria Stella; Losurdo, Michele; Crescenzo, Giuseppe; Trerotoli, Paolo; Casalino, Elisabetta; Martella, Vito; Elia, Gabriella; Tempesta, Maria

    2017-04-01

    Caprine herpesvirus 1 (CpHV-1) infection in goats is responsible for genital lesions resembling the lesions induced by herpesvirus 2 in humans (HHV-2). The immunosuppressive drug Mizoribine (MIZ) is able to increase the antiviral activity of Acyclovir (ACV) against herpesvirus infections, raising interesting perspectives on new combined therapeutic strategies. In this study the anti-CpHV-1 activity in vitro of ACV alone or in combination with MIZ was evaluated. ACV (100μg/ml) displayed an antiviral effect on CpHV-1 replication. This inhibitory effect was higher when ACV (100μg/ml) was used in association with MIZ (20μg/ml). Other combinations of ACV and MIZ in various concentrations were not as effective as ACV 100μg/ml/MIZ 20μg/ml. These findings suggest that the association of ACV and MIZ is potentially useful for treatment of genital infection by herpesviruses. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. In vitro antiviral activity of Ficus carica latex against caprine herpesvirus-1.

    Science.gov (United States)

    Camero, Michele; Marinaro, Mariarosaria; Lovero, Angela; Elia, Gabriella; Losurdo, Michele; Buonavoglia, Canio; Tempesta, Maria

    2014-01-01

    The latex of Ficus carica Linn. (Moraceae) has been shown to possess antiviral properties against some human viruses. To determine the ability of F. carica latex (F-latex) to interfere with the infection of caprine herpesvirus-1 (CpHV-1) in vitro, F-latex was resuspended in culture media containing 1% ethanol and was tested for potential antiviral effects against CpHV-1. Titration of CpHV-1 in the presence or in the absence of F-latex was performed on monolayers of Madin Darby Bovine Kidney (MDBK) cells. Simultaneous addition of F-latex and CpHV-1 to monolayers of MDBK cells resulted in a significant reduction of CpHV-1 titres 3 days post-infection and this effect was comparable to that induced by acyclovir. The study suggests that the F-latex is able to interfere with the replication of CpHV-1 in vitro on MDBK cells and future studies will determine the mechanisms responsible for the observed antiviral activity.

  18. The effect of vitamins during maturation of caprine oocytes on subsequent developmental potential in vitro.

    Science.gov (United States)

    Bormann, Charles L; Ongeri, E Moige; Krisher, Rebecca L

    2003-03-01

    Only a small proportion of goat oocytes selected for in vitro oocyte maturation (IVM) can successfully complete cytoplasmic maturation and support embryonic development. To produce goat blastocysts more efficiently in vitro, it is necessary to identify factors required during oocyte maturation. The objective of this study was to determine the role of vitamins during maturation of caprine oocytes in semi-defined medium on subsequent developmental capacity in vitro. Cumulus oocyte complexes (COCs) collected from a local abattoir were matured in synthetic oviductal fluid (SOF) medium supplemented with BSA, LH, FSH, and EGF in the presence or absence of MEM vitamins for 24 h. The COCs were co-incubated with frozen-thawed sperm in Bracket and Oliphant fertilization medium for 18-22 h. Embryos were cultured in G1.2 medium for 72 h followed by culture in G2.2 medium for an additional 72 h. Addition of vitamins significantly increased (Pdevelopment (16.4+/-1.2% versus 12.3+/-1.1%), and tended to increase (Pembryos (61.4+/-3.0% versus 52.7+/-2.6%). Addition of MEM vitamins to SOF maturation medium significantly increased (Pvitamin-treated group (150.5+/-8.4 versus 123.4+/-8.8). These results suggest that addition of vitamins during oocyte maturation is beneficial for subsequent blastocyst development and viability.

  19. The effect of helminth infection on the microbial composition and structure of the caprine abomasal microbiome

    Science.gov (United States)

    Li, Robert W.; Li, Weizhong; Sun, Jiajie; Yu, Peng; Baldwin, Ransom L.; Urban, Joseph F.

    2016-02-01

    Haemonchus contortus is arguably the most injurious helminth parasite for small ruminants. We characterized the impact of H. contortus infection on the caprine abomasal microbiome. Fourteen parasite naive goats were inoculated with 5,000 H. contortus infective larvae and followed for 50 days. Six age-matched naïve goats served as uninfected controls. Reduced bodyweight gain and a significant increase in the abosamal pH was observed in infected goats compared to uninfected controls. Infection also increased the bacterial load while reducing the abundance of the Archaea in the abomasum but did not appear to affect microbial diversity. Nevertheless, the infection altered the abundance of approximately 19% of the 432 species-level operational taxonomic units (OTU) detected per sample. A total of 30 taxa displayed a significantly different abundance between control and infected goats. Furthermore, the infection resulted in a distinct difference in the microbiome structure. As many as 8 KEGG pathways were predicted to be significantly affected by infection. In addition, H. contortus-induced changes in butyrate producing bacteria could regulate mucosal inflammation and tissue repair. Our results provided insight into physiological consequences of helminth infection in small ruminants and could facilitate the development of novel control strategies to improve animal and human health.

  20. [Epidemiology of caprine brucellosis in the Central Zone of the State of Veracruz].

    Science.gov (United States)

    Román-Ramírez, Daniela Lucía; Martínez-Herrera, David Itzcoatl; Villagómez-Cortés, José Alfredo; Peniche-Cardeña, Álvaro Enrique de Jesús; Morales-Álvarez, José Francisco; Flores-Castro, Ricardo

    2017-01-01

    Brucellosis is a disease of high morbidity that affects several animal species, is transmitted to humans and, therefore, is a zoonosis. It is caused by bacteria of the genus Brucella. In this study we aim to determine seroprevalence, risk factors, and spatial distribution of caprine brucellosis in 14 municipalities in the central region of the state of Veracruz. This cross-stratified multistage study was conducted between 2009 and 2012. It included 572 animals of 81 production units selected by consensus according to the value tables of ​​Cannon and Roe. The diagnosis was by Card Testing and Radial Immunodiffusion. The seroprevalence was determined with the VassarStats® risk factor program and odds. The overall seroprevalence was 0.52% (95% CI: 0.13-1.65) and production units 2.47% (95% CI: 0.43-9.46). They were identified as risk factor for infection, production units in feedlot system and Card Testing seroconversion to vaccine against brucellosis; and as a protective factor, vaccination. Seroprevalence and distribution of goat brucellosis is low, the intensive system is a risk, and according with the Health Ministry in order that human cases are scarce.

  1. [The influence of lentivirus-miRNA-184 on epithelial-mesenchcymal transition of human lens epithelial cells in vitro].

    Science.gov (United States)

    Xu, Qing; Li, Zhen; Zhang, Hui

    2015-04-01

    To analyze the influence of miRNA-184 on epithelial-mesenchymal transition (EMT) of human lens epithelial cells (HLEC) induced by TGF-beta2 in vitro. Experimental study. Recombinant plasmid of pL/IRES/GFP-miR-184 was constructed and used to produce the lentivirus. The lentivirus was used to transduce the HLEC which was in the process of EMT induced by transforming growth factor-β2 (TGF-β2). The real-time fluorescence quantitative PCR (QRT-PCR) was used to analyze E-cadherin (CDH1), α-smooth muscle actin (α-SMA), vimentin (VIM) expression at RNA levels during interval of 0 h, 6 h and 24 h after transduction, in comparison with that of control group. Statistical analysis method was single factor variance analysis. The expression level of epithelial marker gene CDH1 in the miRNA-184 transduced group maintains relatively stable during 24h interval, while it goes down in the control group. The expression level of mesenchymal cell marker gene VIM, α-SMA in the miRNA-184 transduced group maintain relatively stable, while it goes up in the control group. The results of statistical analysis showed a statistically significant difference between miRNA-184 transduced group and control group (P184 lentivirus-mediated HLEC can inhibit the occurrence of EMT.

  2. CXCR4 Is Required by a Nonprimate Lentivirus: Heterologous Expression of Feline Immunodeficiency Virus in Human, Rodent, and Feline Cells

    Science.gov (United States)

    Poeschla, Eric M.; Looney, David J.

    1998-01-01

    A heterologous feline immunodeficiency virus (FIV) expression system permitted high-level expression of FIV proteins and efficient production of infectious FIV in human cells. These results identify the FIV U3 element as the sole restriction to the productive phase of replication in nonfeline cells. Heterologous FIV expression in a variety of human cell lines resulted in profuse syncytial lysis that was FIV env specific, CD4 independent, and restricted to cells that express CXCR4, the coreceptor for T-cell-line-adapted strains of human immunodeficiency virus. Stable expression of human CXCR4 in CXCR4-negative human and rodent cell lines resulted in extensive FIV Env-mediated, CXCR4-dependent cell fusion and infection. In feline cells, stable overexpression of human CXCR4 resulted in increased FIV infectivity and marked syncytium formation during FIV replication or after infection with FIV Env-expressing vectors. The use of CXCR4 is a fundamental feature of lentivirus biology independent of CD4 and a shared cellular link to infection and cytopathicity for distantly related lentiviruses that cause AIDS. Their conserved use implicates chemokine receptors as primordial lentivirus receptors. PMID:9658135

  3. A lentivirus-free inducible CRISPR-Cas9 system for efficient targeting of human genes.

    Science.gov (United States)

    Bisht, Kamlesh; Grill, Sherilyn; Graniel, Jacqueline; Nandakumar, Jayakrishnan

    2017-08-01

    CRISPR-Cas9 is a cutting-edge tool for modifying genomes. The efficacy with which Cas9 recognizes its target has revolutionized the engineering of knockouts. However this efficacy complicates the knocking out of important genes in cultured cells. Unedited cells holding a survival advantage within an edited population can confound the knockout phenotype. Here we develop a HeLa-based system that overcomes this limitation, incorporating several attractive features. First, we use Flp-recombinase to generate clones stably integrated for Cas9 and guide RNAs, eliminating the possibility of unedited cells. Second, Cas9 can be induced uniformly in the clonal cultures using doxycycline to measure the knockout phenotype. Third, two genes can be simultaneously knocked out using this approach. Finally, by not involving lentiviruses, our method is appealing to a broad research audience. Using this methodology we generated an inducible AGO2-knockout cell line showing normal RNA interference in the absence of doxycycline. Upon induction of Cas9, the AGO2 locus was cleaved, the AGO2 protein was depleted, and RNA interference was compromised. In addition to generating inducible knockouts, our technology can be adapted to improve other applications of Cas9, including transcriptional/epigenetic modulation and visualization of cellular DNA loci. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Detection of Replication Competent Lentivirus Using a qPCR Assay for VSV-G

    Directory of Open Access Journals (Sweden)

    Lindsey M. Skrdlant

    2018-03-01

    Full Text Available Lentiviral vectors are a common tool used to introduce new and corrected genes into cell therapy products for treatment of human diseases. Although lentiviral vectors are ideal for delivery and stable integration of genes of interest into the host cell genome, they potentially pose risks to human health, such as integration-mediated transformation and generation of a replication competent lentivirus (RCL capable of infecting non-target cells. In consideration of the latter risk, all cell-based products modified by lentiviral vectors and intended for patient use must be tested for RCL prior to treatment of the patient. Current Food and Drug Administration (FDA guidelines recommend use of cell-based assays to this end, which can take up to 6 weeks for results. However, qPCR-based assays are a quick alternative for rapid assessment of RCL in products intended for fresh infusion. We describe here the development and qualification of a qPCR assay based on detection of envelope gene sequences (vesicular stomatitis virus G glycoprotein [VSV-G] for RCL in accordance with Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE guidelines. Our results demonstrate the sensitivity, linearity, specificity, and reproducibility of detection of VSV-G sequences, with a low false-positive rate. These procedures are currently being used in our phase 1 clinical investigations.

  5. [Construction and clinical application of lentivirus-AQP4 expressing vector].

    Science.gov (United States)

    Liao, Zhang-yuan; Ye, Jing; Guan, Yun-qian; Zhang, Yu; You, Xiao-fan; An, Jing; Zhang, Ying; Wang, Shu-yan; Li, Cun-jiang

    2010-01-19

    To construct the human aquaporin-4 (AQP4) expressing vector and detect anti-AQP4 antibody in serum of patients with neuromyelitis optica (NMO). RNA was extracted from human glioblastoma and AQP4 cDNA obtained through RT-PCR.The fragment was cloned into the lentiviral expressing vector (iDUET101) and transformed into competent strain Hb101 for later amplification; plasmids were extracted from the amplified positive-bacteria-colony, sequenced and transfected into HEK-293T cells. Expression of AQP4 was identified by RT-PCR, Western blot and immunofluorescence assay. And anti-AQP4 antibody in human serum was tested. The sequence of target fragment matched with that of human AQP4 fragment sequences (NM_001650) completely. The constructed AQP4 fragment transfected in HEK-293T cell was tested by immunofluorescent examination and it exhibited obvious fluorescence located in cell membrane. Western blot test was positive. And the fragment was about 34 KD. Cellular immunofluorescence examination showed 11 examples of 12 NMO patient serums (91.7%) were positive, 4 in 34 multiple sclerosis (11.8%) positive and negative in all 50 serum samples of healthy controls. The HEK-293T cell transfected with lentivirus-AQP4 vector can express stably. And the expressed fragment may be applied in clinical examination.

  6. Development of a replication-competent lentivirus assay for dendritic cell-targeting lentiviral vectors

    Directory of Open Access Journals (Sweden)

    Daniel C Farley

    Full Text Available It is a current regulatory requirement to demonstrate absence of detectable replication-competent lentivirus (RCL in lentiviral vector products prior to use in clinical trials. Immune Design previously described an HIV-1-based integration-deficient lentiviral vector for use in cancer immunotherapy (VP02. VP02 is enveloped with E1001, a modified Sindbis virus glycoprotein which targets dendritic cell-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN expressed on dendritic cells in vivo. Vector enveloped with E1001 does not transduce T-cell lines used in standard HIV-1-based RCL assays, making current RCL testing formats unsuitable for testing VP02. We therefore developed a novel assay to test for RCL in clinical lots of VP02. This assay, which utilizes a murine leukemia positive control virus and a 293F cell line expressing the E1001 receptor DC-SIGN, meets a series of evaluation criteria defined in collaboration with US regulatory authorities and demonstrates the ability of the assay format to amplify and detect a hypothetical RCL derived from VP02 vector components. This assay was qualified and used to test six independent GMP production lots of VP02, in which no RCL was detected. We propose that the evaluation criteria used to rationally design this novel method should be considered when developing an RCL assay for any lentiviral vector.

  7. Mechanism of reduction in titers from lentivirus vectors carrying large inserts in the 3'LTR.

    Science.gov (United States)

    Urbinati, Fabrizia; Arumugam, Paritha; Higashimoto, Tomoyasu; Perumbeti, Anil; Mitts, Kyle; Xia, Ping; Malik, Punam

    2009-09-01

    Self-inactivating (SIN) lentiviruses flanked by the 1.2-kb chicken hypersensitive site-4 (cHS4) insulator element provide consistent, improved expression of transgenes, but have significantly lower titers. The mechanism by which this occurs is unknown. Lengthening the lentiviral (LV) vector transgene cassette by an additional 1.2 kb by an internal cassette caused no further reduction in titers. However, when cHS4 sequences or inert DNA spacers of increasing size were placed in the 3'-long terminal repeat (LTR), infectious titers decreased proportional to the length of the insert. The stage of vector life cycle affected by vectors carrying the large cHS4 3'LTR insert was compared to a control vector: there was no increase in read-through transcription with insertion of the 1.2-kb cHS4 in the 3'LTR. Equal amount of full-length viral mRNA was produced in packaging cells and viral assembly/packaging was unaffected, resulting in comparable amounts of intact vector particles produced by either vectors. However, LV vectors carrying cHS4 in the 3'LTR were inefficiently processed following target-cell entry, with reduced reverse transcription and integration efficiency, and hence lower transduction titers. Therefore, vectors with large insertions in the 3'LTR are transcribed and packaged efficiently, but the LTR insert hinders viral-RNA (vRNA) processing and transduction of target cells. These studies have important implications in design of integrating vectors.

  8. Apoptotic block in colon cancer cells may be rectified by lentivirus mediated overexpression of caspase-9.

    Science.gov (United States)

    Xu, D; Wang, C; Shen, X; Yu, Y; Rui, Y; Zhang, D; Zhou, Z

    2013-12-01

    At present, the inhibition of apoptosis during pathogenesis of colorectal cancer is widely recognized while the role of caspase-9 in this process remains controversial. We aimed to investigate the differential expression of caspase-9 and evaluate the therapeutic potential of expression intervention in this study. We first examined the different expression of caspase-9 in normal colon mucosa, adenoma and cancer, investigating the relationship between its expression and clinico-pathological characteristics. Secondly, overexpression of caspase-9 was established in colon cancer cell lines by lentivirus infection to study the changes in growth, proliferation and apoptosis. Compared with normal colon mucosa, the expression of caspase-9 was higher in adenoma while lower in cancer both at mRNA and protein level (P expression is more common in poorly differentiated cancers (P expression of caspase-9, poorer colony formation and slower cell proliferation. In terms of apoptosis related indicators, caspase-9 overexpression leads to higher apoptosis rate and GO/G1 arrest, while up-regulating the expression of caspase-3 (P expression from colon mucosa, adenoma to cancer suggested it may be involved in the carcinogenesis of colon cancer. The overexpression of caspase-9 exhibits an inhibitory role in cancer growth and proliferation while promoting apoptosis. However, a non-apoptotic role of caspase-9 facilitating differentiation was also implied.

  9. Influence of small ruminant lentivirus infection on cheese yield in goats.

    Science.gov (United States)

    Nowicka, Dorota; Czopowicz, Michał; Bagnicka, Emilia; Rzewuska, Magdalena; Strzałkowska, Nina; Kaba, Jarosław

    2015-02-01

    Three-year cohort study was carried out to investigate the influence of small ruminant lentivirus (SRLV) infection on cheese yield in goats. For this purpose records of milk yield, milk composition and cheese yield were collected in a dairy goat herd. Cheese yield was recorded as the amount of fresh cheese obtained from 1 kg milk. All goats were serologically tested for SRLV infection twice a year. The analysis included 247 records in total (71 for seropositive and 176 from seronegative individuals) and was carried out with the use of the four-level hierarchical linear model (α = 0·05). SRLV infection proved to be a statistically significant independent factor reducing cheese yield (P = 0·013)--when other covariates were held constant cheese yield was reduced by 4·6 g per each 1 kg milk in an infected goat compared with an uninfected goat. Other statistically significant covariates positively associated with cheese yield were protein contents, fat contents and the 3rd stage of lactation (P < 0·001 for all).

  10. Positive selection of HIV host factors and the evolution of lentivirus genes

    Directory of Open Access Journals (Sweden)

    Lengauer Thomas

    2010-06-01

    Full Text Available Abstract Background Positive selection of host proteins that interact with pathogens can indicate factors relevant for infection and potentially be a measure of pathogen driven evolution. Results Our analysis of 1439 primate genes and 175 lentivirus genomes points to specific host factors of high genetic variability that could account for differences in susceptibility to disease and indicate specific mechanisms of host defense and pathogen adaptation. We find that the largest amount of genetic change occurs in genes coding for cellular membrane proteins of the host as well as in the viral envelope genes suggesting cell entry and immune evasion as the primary evolutionary interface between host and pathogen. We additionally detect the innate immune response as a gene functional group harboring large differences among primates that could potentially account for the different levels of immune activation in the HIV/SIV primate infection. We find a significant correlation between the evolutionary rates of interacting host and viral proteins pointing to processes of the host-pathogen biology that are relatively conserved among species and to those undergoing accelerated genetic evolution. Conclusions These results indicate specific host factors and their functional groups experiencing pathogen driven evolutionary selection pressures. Individual host factors pointed to by our analysis might merit further study as potential targets of antiretroviral therapies.

  11. A nonchromatographic process for purification of secretory immunoglobulins from caprine whey.

    Science.gov (United States)

    Matlschweiger, Alexander; Himmler, Gottfried; Linhart, Clemens; Harasek, Michael; Hahn, Rainer

    2017-05-01

    Secretory immunoglobulins are an important antibody class being primarily responsible for immunoprotection of mucosal surfaces. A simple, non-chromatographic purification process for secretory immunoglobulins from caprine whey was developed. In the first process step whey was concentrated 30-40-fold on a 500 kDa membrane, thereby increasing the purity from 3% to 15%. The second step consisted of a fractionated PEG precipitation, in which high molecular weight impurities were removed first and in the second stage the secretory immunoglobulins were precipitated, leaving a majority of the low molecular weight proteins in solution. The re-dissolved secretory immunoglobulin fraction had a purity of 43% which could then be increased to 72% by diafiltration at a volume exchange factor of 10. Further increase of purity was only possible at the expense of very high buffer consumption. If diafiltration was performed directly after ultrafiltration, followed by precipitation, the yield was higher but purity was only 54%. Overall, filtration performance was characterized by high concentration polarization, therefore process conditions were set to low trans-membrane pressure and moderate protein concentration. As such purity and to a lesser extent throughput were the major objectives rather than yield, since whey, as a by-product of the dairy industry, is a cheap raw material of almost unlimited supply. Ultra-/diafiltration performance was described well by correlations using dimensionless numbers. Compared with a theoretical model (Graetz/Leveque solution) the flux was slightly overestimated. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:642-653, 2017. © 2017 American Institute of Chemical Engineers.

  12. In vitro growth and development of isolated secondary follicles from vitrified caprine ovarian cortex.

    Science.gov (United States)

    Leal, Érica S S; Vieira, Luis A; Sá, Naíza A R; Silva, Gerlane M; Lunardi, Franciele O; Ferreira, Anna C A; Campello, Cláudio C; Alves, Benner G; Cibin, Francielli W S; Smitz, Johan; Figueiredo, José R; Rodrigues, Ana P R

    2018-01-01

    The aim of this study was to evaluate the viability, antrum formation and in vitro development of isolated secondary follicles from vitrified caprine ovarian cortex in a medium previously established for fresh isolated secondary follicles, in the absence (α-minimum essential medium (α-MEM+) alone) or presence of FSH and vascular endothelial growth factor (VEGF; α-MEM++FSH+VEGF). Ovarian fragments were distributed among five treatments (T1 to T5): fresh follicles were fixed immediately (T1), follicles from fresh tissue were cultured in vitro in α-MEM+ (T2) or α-MEM++FSH+VEGF (T3) and follicles from vitrified tissue were cultured in vitro in α-MEM+ (T4) or α-MEM++FSH+VEGF (T5). After 6 days of culture, treated follicles (T2, T3, T4 and T5) were evaluated for morphology, viability and follicular development (growth, antrum formation and proliferation of granulosa cells by Ki67 and argyrophilic nucleolar organiser region (AgNOR) staining). The levels of reactive oxygen species (ROS) in the culture media were also assessed. Overall, morphology of vitrified follicles was altered (P0.05). The average overall and daily follicular growth was highest (P<0.05) in T3. Granulosa cells in all treatments (T1, T2, T3, T4 and T5) stained positive for Ki67. However, fresh follicles from T3 had significantly higher AgNOR staining (P<0.05) compared with follicles of T1, T2, T4 and T5. In conclusion, secondary follicles can be isolated from vitrified and warmed ovarian cortex and survive and form an antrum when growing in an in vitro culture for 6 days.

  13. Virulence factors genes of Staphylococcus spp. isolated from caprine subclinical mastitis.

    Science.gov (United States)

    Salaberry, Sandra Renata Sampaio; Saidenberg, André Becker Simões; Zuniga, Eveline; Melville, Priscilla Anne; Santos, Franklin Gerônimo Bispo; Guimarães, Ednaldo Carvalho; Gregori, Fábio; Benites, Nilson Roberti

    2015-08-01

    The aim of this study was to investigate genes involved in adhesion expression, biofilm formation, and enterotoxin production in isolates of Staphylococcus spp. from goats with subclinical mastitis and associate these results with the staphylococcal species. One hundred and twenty-four isolates were identified and polymerase chain reaction (PCR) was performed to detect the following genes: cna, ebpS, eno, fib, fnbA, fnbB, bap, sea, seb, sec, sed and see. The most commonly Staphylococcus species included S. epidermidis, S. lugdunensis, S. chromogenes, S. capitis ss capitis and S. intermedius. With the exception of fnbB, the genes were detected in different frequencies of occurrence in 86.3% of the Staphylococcus spp. isolates. Eno (73.2%) and bap (94.8%) were more frequently detected in coagulase-negative staphylococci (CNS); ebpS (76%), fib (90.9%) and fnbA (87%) were the most frequent genes in coagulase-positive staphylococci (CPS). Regarding enterotoxins, genes sed (28.2%) and see (24.2%) had a higher frequency of occurrence; sec gene was more frequently detected in CPS (58.8%). There was no association between the presence of the genes and the Staphylococcus species. Different virulence factors genes can be detected in caprine subclinical mastitis caused by CNS and CPS. The knowledge of the occurrence of these virulence factors is important for the development of effective control and prevention measures of subclinical mastitis caused by CNS and CPS in goats. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Static axial overloading primes lumbar caprine intervertebral discs for posterior herniation

    Science.gov (United States)

    Paul, Cornelis P. L.; de Graaf, Magda; Bisschop, Arno; Holewijn, Roderick M.; van de Ven, Peter M.; van Royen, Barend J.; Mullender, Margriet G.; Smit, Theodoor H.; Helder, Marco N.

    2017-01-01

    Introduction Lumbar hernias occur mostly in the posterolateral region of IVDs and mechanical loading is an important risk factor. Studies show that dynamic and static overloading affect the nucleus and annulus of the IVD differently. We hypothesize there is also variance in the effect of overloading on the IVD’s anterior, lateral and posterior annulus, which could explain the predilection of herniations in the posterolateral region. We assessed the regional mechanical and cellular responses of lumbar caprine discs to dynamic and static overloading. Material and methods IVDs (n = 125) were cultured in a bioreactor and subjected to simulated-physiological loading (SPL), high dynamic (HD), or high static (HS) overloading. The effect of loading was determined in five disc regions: nucleus, inner-annulus and anterior, lateral and posterior outer-annulus. IVD height loss and external pressure transfer during loading were measured, cell viability was mapped and quantified, and matrix integrity was assessed. Results During culture, overloaded IVDs lost a significant amount of height, yet the distribution of axial pressure remained unchanged. HD loading caused cell death and disruption of matrix in all IVD regions, whereas HS loading particularly affected cell viability and matrix integrity in the posterior region of the outer annulus. Conclusion Axial overloading is detrimental to the lumbar IVD. Static overloading affects the posterior annulus more strongly, while the nucleus is relatively spared. Hence, static overloading predisposes the disc for posterior herniation. These findings could have implications for working conditions, in particular of sedentary occupations, and the design of interventions aimed at prevention and treatment of early intervertebral disc degeneration. PMID:28384266

  15. Static axial overloading primes lumbar caprine intervertebral discs for posterior herniation.

    Directory of Open Access Journals (Sweden)

    Cornelis P L Paul

    Full Text Available Lumbar hernias occur mostly in the posterolateral region of IVDs and mechanical loading is an important risk factor. Studies show that dynamic and static overloading affect the nucleus and annulus of the IVD differently. We hypothesize there is also variance in the effect of overloading on the IVD's anterior, lateral and posterior annulus, which could explain the predilection of herniations in the posterolateral region. We assessed the regional mechanical and cellular responses of lumbar caprine discs to dynamic and static overloading.IVDs (n = 125 were cultured in a bioreactor and subjected to simulated-physiological loading (SPL, high dynamic (HD, or high static (HS overloading. The effect of loading was determined in five disc regions: nucleus, inner-annulus and anterior, lateral and posterior outer-annulus. IVD height loss and external pressure transfer during loading were measured, cell viability was mapped and quantified, and matrix integrity was assessed.During culture, overloaded IVDs lost a significant amount of height, yet the distribution of axial pressure remained unchanged. HD loading caused cell death and disruption of matrix in all IVD regions, whereas HS loading particularly affected cell viability and matrix integrity in the posterior region of the outer annulus.Axial overloading is detrimental to the lumbar IVD. Static overloading affects the posterior annulus more strongly, while the nucleus is relatively spared. Hence, static overloading predisposes the disc for posterior herniation. These findings could have implications for working conditions, in particular of sedentary occupations, and the design of interventions aimed at prevention and treatment of early intervertebral disc degeneration.

  16. Development and characterization of a caprine aerosol infection model of melioidosis.

    Directory of Open Access Journals (Sweden)

    Carl Soffler

    Full Text Available Infection with Burkholderia pseudomallei causes the disease melioidosis, which often presents as a serious suppurative infection that is typically fatal without intensive treatment and is a significant emerging infectious disease in Southeast Asia. Despite intensive research there is still much that remains unknown about melioidosis pathogenesis. New animal models of melioidosis are needed to examine novel aspects of pathogenesis as well as for the evaluation of novel therapeutics. The objective of the work presented here was to develop a subacute to chronic caprine model of melioidosis and to characterize the progression of disease with respect to clinical presentation, hematology, clinical microbiology, thoracic radiography, and gross and microscopic pathology. Disease was produced in all animals following an intratracheal aerosol of 10(4 CFU delivered, with variable clinical manifestations indicative of subacute and chronic disease. Bronchointerstitial pneumonia was apparent microscopically by day 2 and radiographically and grossly apparent by day 7 post infection (PI. Early lesions of bronchopneumonia soon progressed to more severe bronchointerstitial pneumonia with pyogranuloma formation. Extrapulmonary dissemination appeared to be a function of pyogranuloma invasion of pulmonary vasculature, which peaked around day 7 PI. Histopathology indicated that leukocytoclastic vasculitis was the central step in dissemination of B. pseudomallei from the lungs as well as in the establishment of new lesions. While higher doses of organism in goats can produce acute fatal disease, the dose investigated and resulting disease had many similarities to human melioidosis and may warrant further development to provide a model for the study of both natural and bioterrorism associated disease.

  17. Effects of volatile fatty acids on propionate metabolism and gluconeogenesis in caprine hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Aiello, R.J.; Armentano, L.E.

    1987-12-01

    Isolated caprine hepatocytes were incubated with fatty acids of various chain lengths. Short-chain fatty acids effects on rates of gluconeogenesis and oxidation from (2-/sup 14/C) propionate were determined. Additions of glucose (2.5 mM) had no effect on hepatic (2-/sup 14/C)-propionate metabolism in the presence and absence of amino acids. A complete mixture of amino acids increased label incorporation from (2-/sup 14/C) propionate into (/sup 14/C) glucose by 22%. Butyrate inhibited (2-/sup 14/C) propionate metabolism and increased the apparent Michaelis constant for (2-/sup 14/C) propionate incorporation into (/sup 14/C) glucose from 2.4 +/- 1.5 to 5.6 +/- .9 mM. Butyrate's effects on propionate were similar in the presence and absence of L-carnitine (1 mM). Isobutyrate, 2-methylbutyrate, and valerate (1.25 mM) had no effect on (/sup 14/C) glucose production but decreased /sup 14/CO/sub 2/ production to 57, 61, and 54% of the control (2-/sup 14/C) propionate (1.25 mM). This inhibition on /sup 14/CO/sub 2/ was not competitive. Isovalerate had no effect on either (2-/sup 14/C) propionate incorporation into glucose of CO/sub 2/. An increase in ratio of (/sup 14/C) glucose to /sup 14/CO/sub 2/ from (2-/sup 14/C)-propionate demonstrated that short-chain fatty acids other than butyrate do not inhibit gluconeogenesis from propionate. In addition, fatty acids that generate a net synthesis of intracellular oxaloacetate may partition propionate carbons toward gluconeogenic rather than oxidative pathways in goat hepatocytes.

  18. Protective efficacy of centralized and polyvalent envelope immunogens in an attenuated equine lentivirus vaccine.

    Directory of Open Access Journals (Sweden)

    Jodi K Craigo

    2015-01-01

    -functional, replication-competent lentivirus, which when experimentally evaluated, demonstrated broader immunogenicity that does not equate to higher protective efficacy.

  19. Characterization of Ovine A3Z1 Restriction Properties against Small Ruminant Lentiviruses (SRLVs

    Directory of Open Access Journals (Sweden)

    Lorena de Pablo-Maiso

    2017-11-01

    Full Text Available Intrinsic factors of the innate immune system include the apolipoprotein B editing enzyme catalytic polypeptide-like 3 (APOBEC3 protein family. APOBEC3 inhibits replication of different virus families by cytosine deamination of viral DNA and a not fully characterized cytosine deamination-independent mechanism. Sheep are susceptible to small ruminant lentivirus (SRLVs infection and contain three APOBEC3 genes encoding four proteins (A3Z1, Z2, Z3 and Z2-Z3 with yet not deeply described antiviral properties. Using sheep blood monocytes and in vitro-derived macrophages, we found that A3Z1 expression is associated with lower viral replication in this cellular type. A3Z1 transcripts may also contain spliced variants (A3Z1Tr lacking the cytidine deaminase motif. A3Z1 exogenous expression in fully permissive fibroblast-like cells restricted SRLVs infection while A3Z1Tr allowed infection. A3Z1Tr was induced after SRLVs infection or stimulation of blood-derived macrophages with interferon gamma (IFN-γ. Interaction between truncated isoform and native A3Z1 protein was detected as well as incorporation of both proteins into virions. A3Z1 and A3Z1Tr interacted with SRLVs Vif, but this interaction was not associated with degradative properties. Similar A3Z1 truncated isoforms were also present in human and monkey cells suggesting a conserved alternative splicing regulation in primates. A3Z1-mediated retroviral restriction could be constrained by different means, including gene expression and specific alternative splicing regulation, leading to truncated protein isoforms lacking a cytidine-deaminase motif.

  20. Genetic Testing for TMEM154 Mutations Associated with Lentivirus Susceptibility in Sheep

    Science.gov (United States)

    Petrik, Dustin T.; Simpson, Barry; Kijas, James W.; Clawson, Michael L.; Chitko-McKown, Carol G.; Harhay, Gregory P.; Leymaster, Kreg A.

    2013-01-01

    In sheep, small ruminant lentiviruses cause an incurable, progressive, lymphoproliferative disease that affects millions of animals worldwide. Known as ovine progressive pneumonia virus (OPPV) in the U.S., and Visna/Maedi virus (VMV) elsewhere, these viruses reduce an animal’s health, productivity, and lifespan. Genetic variation in the ovine transmembrane protein 154 gene (TMEM154) has been previously associated with OPPV infection in U.S. sheep. Sheep with the ancestral TMEM154 haplotype encoding glutamate (E) at position 35, and either form of an N70I variant, were highly-susceptible compared to sheep homozygous for the K35 missense mutation. Our current overall aim was to characterize TMEM154 in sheep from around the world to develop an efficient genetic test for reduced susceptibility. The average frequency of TMEM154 E35 among 74 breeds was 0.51 and indicated that highly-susceptible alleles were present in most breeds around the world. Analysis of whole genome sequences from an international panel of 75 sheep revealed more than 1,300 previously unreported polymorphisms in a 62 kb region containing TMEM154 and confirmed that the most susceptible haplotypes were distributed worldwide. Novel missense mutations were discovered in the signal peptide (A13V) and the extracellular domains (E31Q, I74F, and I102T) of TMEM154. A matrix-assisted laser desorption/ionization–time-of flight mass spectrometry (MALDI-TOF MS) assay was developed to detect these and six previously reported missense and two deletion mutations in TMEM154. In blinded trials, the call rate for the eight most common coding polymorphisms was 99.4% for 499 sheep tested and 96.0% of the animals were assigned paired TMEM154 haplotypes (i.e., diplotypes). The widespread distribution of highly-susceptible TMEM154 alleles suggests that genetic testing and selection may improve the health and productivity of infected flocks. PMID:23408992

  1. Genetic testing for TMEM154 mutations associated with lentivirus susceptibility in sheep.

    Directory of Open Access Journals (Sweden)

    Michael P Heaton

    Full Text Available In sheep, small ruminant lentiviruses cause an incurable, progressive, lymphoproliferative disease that affects millions of animals worldwide. Known as ovine progressive pneumonia virus (OPPV in the U.S., and Visna/Maedi virus (VMV elsewhere, these viruses reduce an animal's health, productivity, and lifespan. Genetic variation in the ovine transmembrane protein 154 gene (TMEM154 has been previously associated with OPPV infection in U.S. sheep. Sheep with the ancestral TMEM154 haplotype encoding glutamate (E at position 35, and either form of an N70I variant, were highly-susceptible compared to sheep homozygous for the K35 missense mutation. Our current overall aim was to characterize TMEM154 in sheep from around the world to develop an efficient genetic test for reduced susceptibility. The average frequency of TMEM154 E35 among 74 breeds was 0.51 and indicated that highly-susceptible alleles were present in most breeds around the world. Analysis of whole genome sequences from an international panel of 75 sheep revealed more than 1,300 previously unreported polymorphisms in a 62 kb region containing TMEM154 and confirmed that the most susceptible haplotypes were distributed worldwide. Novel missense mutations were discovered in the signal peptide (A13V and the extracellular domains (E31Q, I74F, and I102T of TMEM154. A matrix-assisted laser desorption/ionization-time-of flight mass spectrometry (MALDI-TOF MS assay was developed to detect these and six previously reported missense and two deletion mutations in TMEM154. In blinded trials, the call rate for the eight most common coding polymorphisms was 99.4% for 499 sheep tested and 96.0% of the animals were assigned paired TMEM154 haplotypes (i.e., diplotypes. The widespread distribution of highly-susceptible TMEM154 alleles suggests that genetic testing and selection may improve the health and productivity of infected flocks.

  2. Targeting SPARC by lentivirus-mediated RNA interference inhibits cervical cancer cell growth and metastasis

    Directory of Open Access Journals (Sweden)

    Chen Jie

    2012-10-01

    Full Text Available Abstract Background Secreted protein acidic and rich in cysteine (SPARC, a calcium-binding matricellular glycoprotein, is implicated in the progressions of some cancers. However, no information has been available to date regarding the function of SPARC in cervical cancer cell growth and metastasis. Methods In this study, we isolated and established high invasive subclones and low invasive subclones from human cervical cancer cell lines HeLa and SiHa by the limited dilution method. Real-time q-RT-PCR, Western Blot and ICC were performed to investigate SPARC mRNA and protein expressions in high invasive subclones and low invasive subclones. Then lentivirus vector with SPARC shRNA was constructed and infected the highly invasive subclones. Real-time q-RT-PCR, Western Blot and ICC were also performed to investigate the changes of SPARC expression after viral infection. In functional assays, effects of SPARC knockdown on the biological behaviors of cervical cancer cells were investigated. The mechanisms of SPARC in cervical cancer proliferation, apoptosis and invasion were also researched. Results SPARC was over-expressed in the highly invasive subclones compared with the low invasive subclones. Knockdown of SPARC significantly suppressed cervical cancer cell proliferation, and induced cell cycle arrest at the G1/G0 phase through the p53/p21 pathway, also caused cell apoptosis accompanied by the decreased ratio of Bcl-2/Bax, and inhibited cell invasion and metastasis accompanied by down-regulated MMP2 and MMP9 expressions and up-regulated E-cadherin expression. Conclusion SPARC is related to the invasive phenotype of cervical cancer cells. Knockdown of SPARC significantly suppresses cervical cancer cell proliferation, induces cell apoptosis and inhibits cell invasion and metastasis. SPARC as a promoter improves cervical cancer cell growth and metastasis.

  3. Generation of transgenic mesenchymal stem cells expressing green fluorescent protein as reporter gene using no viral vector in caprine.

    Science.gov (United States)

    Kumar, Manish; Yasotha, T; Singh, R K; Singh, Renu; Kumar, Kuldeep; Ranjan, R; Meshram, Chetan D; Das, B C; Bag, Sadhan

    2013-07-01

    Mesenchymal stromal cells (MSC) are multipotent cells that can be derived from many different organs and tissues. While there are many ways to label and track cells each with strengths and weakness, the green fluorescent protein (GFP) is a reporter gene commonly employed. In the present study, caprine MSC were collected from bone marrow and cells were characterised with MSC specific markers. Passage 10 (P10) MSC cells were transfected using plasmid vector containing GFP as reporter gene with different concentrations of DNA and lipofectamine. Six different concentrations of DNA and lipofectamine as 1 microg DNA: 2 microL lipofectamine, 1 microg DNA: 2.5 microL lipofectamine, 1.2 microg DNA: 2.2 microL lipofectamine, 1.2 microg DNA: 2.5 microL lipofectamine, 1.5 microg DNA: 2.5 microL lipofectamine, 1.5 microg DNA: 3 microL lipofectamine were used. After 24 h and 48 h of transfection, caprine MSC were observed under florescent microscope. Highest transfection rate indicating green flourecscent MSC were found when the cells were transfected with 1.2 microg DNA: 2.2 microL lipofectamine and 1.5 microg DNA: 2.5 microL lipofectamine than other combinations. These cells have been propagated beyond 4th passage maintaining GFP expression. The results indicated that stable GFP positive MSC cells can be generated using the above protocol. These cells are being used for transplantation studies.

  4. A possible case of caprine-associated malignant catarrhal fever in a domestic water buffalo (Bubalus bubalis in Switzerland

    Directory of Open Access Journals (Sweden)

    Dettwiler Martina

    2011-12-01

    Full Text Available Abstract Background Malignant catarrhal fever (MCF is a fatal herpesvirus infection, affecting various wild and domestic ruminants all over the world. Water buffaloes were reported to be particularly susceptible for the ovine herpesvirus-2 (OvHV-2 causing the sheep-associated form of MCF (SA-MCF. This report describes the first case of possibly caprine-associated malignant catarrhal fever symptoms in a domestic water buffalo in Switzerland. Case presentation The buffalo cow presented with persistent fever, dyspnoea, nasal bleeding and haematuria. Despite symptomatic therapy, the buffalo died and was submitted to post mortem examination. Major findings were an abomasal ulceration, a mild haemorrhagic cystitis and multifocal haemorrhages on the epicardium and on serosal and mucosal surfaces. Eyes and oral cavity were not affected. Histopathology revealed a mild to moderate lymphohistiocytic vasculitis limited to the brain and the urinary bladder. Although these findings are typical for MCF, OvHV-2 DNA was not detected in peripheral blood lymphocytes or in paraffin-embedded brain, using an OvHV-2 specific real time PCR. With the aid of a panherpesvirus PCR, a caprine herpesvirus-2 (CpHV-2 sequence could be amplified from both samples. Conclusions To our knowledge, this is the first report of malignant catarrhal fever in the subfamily Bovinae, where the presence of CpHV-2 could be demonstrated. The etiological context has yet to be evaluated.

  5. Peste des Petits Ruminants Virus Enters Caprine Endometrial Epithelial Cells via the Caveolae-Mediated Endocytosis Pathway

    Directory of Open Access Journals (Sweden)

    Bo Yang

    2018-02-01

    Full Text Available Peste des petits ruminants virus (PPRV causes an acute and highly contagious disease of sheep and goats and has spread with alarming speed around the world. The pathology of Peste des petits ruminants is linked to retrogressive changes and necrotic lesions in lymphoid tissues and epithelial cells. However, the process of PPRV entry into host epithelial cells remains largely unknown. Here, we performed a comprehensive study of the entry mechanism of PPRV into caprine endometrial epithelial cells (EECs. We clearly demonstrated that PPRV internalization was inhibited by chloroquine and ammonium chloride, which elevate the pH of various organelles. However, PPRV entry was not affected by chlorpromazine and knockdown of the clathrin heavy chain in EECs. In addition, we found that the internalization of PPRV was dependent on dynamin and membrane cholesterol and was suppressed by silencing of caveolin-1. Macropinocytosis did not play a role, but phosphatidylinositol 3-kinase (PI3K was required for PPRV internalization. Cell type and receptor-dependent differences indicated that PPRV entry into caprine fetal fibroblast cells (FFCs occurred via a different route. Taken together, our findings demonstrate that PPRV enters EECs through a cholesterol-dependent caveolae-mediated uptake mechanism that is pH-dependent and requires dynamin and PI3K but is independent of clathrin. This potentially provides insight into the entry mechanisms of other morbilliviruses.

  6. An EIAV field isolate reveals much higher levels of subtype variability than currently reported for the equine lentivirus family

    Directory of Open Access Journals (Sweden)

    Zhang Baoshan

    2009-10-01

    Full Text Available Abstract Background Equine infectious anemia virus (EIAV, a lentivirus that infects horses, has been utilized as an animal model for the study of HIV. Furthermore, the disease associated with the equine lentivirus poses a significant challenge to veterinary medicine around the world. As with all lentiviruses, EIAV has been shown to have a high propensity for genomic sequence and antigenic variation, especially in its envelope (Env proteins. Recent studies have demonstrated Env variation to be a major determinant of vaccine efficacy, emphasizing the importance of defining natural variation among field isolates of EIAV. To date, however, published EIAV sequences have been reported only for cell-adapted strains of virus, predominantly derived from a single primary virus isolate, EIAVWyoming (EIAVWY. Results We present here the first characterization of the Env protein of a natural primary isolate from Pennsylvania (EIAVPA since the widely utilized and referenced EIAVWY strain. The data demonstrated that the level of EIAVPA Env amino acid sequence variation, approximately 40% as compared to EIAVWY, is much greater than current perceptions or published reports of natural EIAV variation between field isolates. This variation did not appear to give rise to changes in the predicted secondary structure of the proteins. While the EIAVPA Env was serologically cross reactive with the Env proteins of the cell-adapted reference strain, EIAVPV (derivative of EIAVWY, the two variant Envs were shown to lack any cross neutralization by immune serum from horses infected with the respective virus strains. Conclusion Taking into account the significance of serum neutralization to universal vaccine efficacy, these findings are crucial considerations towards successful EIAV vaccine development and the potential inclusion of field isolate Envs in vaccine candidates.

  7. Mechanism of Reduction in Titers From Lentivirus Vectors Carrying Large Inserts in the 3′LTR

    OpenAIRE

    Urbinati, Fabrizia; Arumugam, Paritha; Higashimoto, Tomoyasu; Perumbeti, Anil; Mitts, Kyle; Xia, Ping; Malik, Punam

    2009-01-01

    Self-inactivating (SIN) lentiviruses flanked by the 1.2-kb chicken hypersensitive site-4 (cHS4) insulator element provide consistent, improved expression of transgenes, but have significantly lower titers. The mechanism by which this occurs is unknown. Lengthening the lentiviral (LV) vector transgene cassette by an additional 1.2 kb by an internal cassette caused no further reduction in titers. However, when cHS4 sequences or inert DNA spacers of increasing size were placed in the 3′-long ter...

  8. Early events in immune evasion by the lentivirus maedi-visna occurring within infected lymphoid tissue.

    Science.gov (United States)

    Bird, P; Blacklaws, B; Reyburn, H T; Allen, D; Hopkins, J; Sargan, D; McConnell, I

    1993-09-01

    Infections caused by lentiviruses, including human immunodeficiency virus, are characterized by slowly progressive disease in the presence of a virus-specific immune response. The earliest events in the virus-host interaction are likely to be important in determining disease establishment and progression, and the kinetics of these early events following lentiviral infection are described here. Lymphatic cannulation in the sheep has been used to monitor both the virus and the immune response in efferent lymph after infection of the node with maedi-visna virus (MVV). Viral replication and dissemination could be detected and consisted of a wave of MVV-infected cells leaving the node around 9 to 18 days postinfection. No cell-free virus was recovered despite the fact that soluble MVV p25 was detected in lymph plasma. The maximum frequency of MVV-infected cells was only 11 in 10(6) but over the first 20 days of infection amounted to greater than 10(4) virus-infected cells leaving the node. There was a profound increase in the output of activated lymphoblast from the lymph nodes of infected sheep, characterized by an increased percentage of CD8+ lymphoblasts. All of the CD8+ lymphoblasts at the peak of the response expressed both major histocompatibility complex class II DR and DQ molecules but not interleukin-2 receptor (CD25). The in vitro proliferative response of efferent lymph cells existing the node after challenge with MVV to both recombinant human interleukin-2 and the mitogen concanavalin A was decreased between days 8 and 16 postinfection, and a specific proliferative response to MVV was not detected until after day 15. Despite the high level of CD8+ lymphoblasts in efferent lymph, direct MVV-specific cytotoxic activity was demonstrated in only one of the five MVV-challenged sheep. MVV-specific antibody responses, including neutralization and MVV p25 immune complexes in efferent lymph, were detectable during the major period of virus dissemination. The

  9. Enterotoxemia em caprinos no Rio Grande do Sul Caprine enterotoxaemia in Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Edson M. Colodel

    2003-12-01

    Full Text Available São descritos surtos de enterotoxemia em caprinos em cinco propriedades no Estado do Rio Grande do Sul. Os animais afetados eram, normalmente, encontrados mortos ou apresentavam evolução aguda de 2 a 3 horas com acentuada depressão, cólicas abdominais e diarréia profusa com fibrina. Em duas propriedades relataram-se casos com a evolução de até 12 horas. Em treze animais necropsiados observaram-se aumento de líquidos nas cavidades abdominal, torácica e pericárdica, congestão e hiperemia da serosa e mucosa do intestino, conteúdo do cólon líquido com fibrina além de hemorragias de serosa e fibrina. Em um animal constatou-se microangiopatia cerebral caracterizada por acúmulo de material homogêneo e eosinofílico no espaço perivascular. No conteúdo intestinal, colônias com bastonetes morfológica e bioquimicamente sugestivos de Clostridium perfringens foram caracterizadas no estudo bacteriológico. A soroneutralização em camundongos com conteúdo intestinal dos animais afetados, revelou a presença da toxina épsilon. Estes achados evidenciam a enterotoxemia como doença de importância para criação de caprinos no Rio Grande do Sul.Five outbreaks of caprine enterotoxaemia in Rio Grande do Sul, Brazil, were studied. The animals were found dead or had a clinical course that usually lasted 2-3 hours. From two farms a clinical manifestation period of 12 hours was reported. Clinical signs were characterized by depression, marked abdominal discomfort, profuse watery diarrhea with fibrin clots, and death. Thirteen necropsies were performed and hydropericardium, hydrothorax and hydroperitoneum were commonly found. The mucosa and serosa of the colon were congested, and its contents was watery with multiple fibrin clots. Serosal hemorrhages and fibrin clots in the gallbladder were also seen. Fibrinous colitis and thyphilitis were the most frequent histological changes. Cerebral microangiopathy was observed in one case, which was

  10. Multiple coding and the evolutionary properties of RNA secondary structure.

    Science.gov (United States)

    Huynen, M A; Konings, D A; Hogeweg, P

    1993-11-21

    This article evaluates evolutionary properties of the transition from RNA primary sequence to RNA secondary structure. It focuses on the restrictions that the conservation of a protein code in an RNA sequence puts on its potential to evolve towards a specific secondary structure. Restricting the mutations to those that do not affect the coding for a protein restricts both the accessibility and the connectivity of the sequence space. The accessibility is restricted because only certain point mutations are allowed. The connectivity is restricted because no insertions and deletions are allowed. Simulating an evolutionary search process for a specific secondary structure shows that (i) the reduction of allowable point mutations allows for adaptation to some large-scale topology, but strongly reduces the possibility of small-scale adaptations, (ii) the abolition of insertions and deletions has very little effect on the results of the search process. During the evolutionary search process for a secondary structure with a specific topology and a high frequency of base-pairing the quasispecies moves into a subspace in which the similarity between secondary structures of neighboring sequences is relatively high. Increased similarity between second structures of neighboring sequences is also found in the Rev responsive element (RRE) in the lentiviruses Caprine arthritis-encephalitis virus and Visna virus. In these viruses a biased nucleotide frequency in the RRE region suggests that selection for the RRE RNA secondary structure affects the amino acid sequence of the env gene. Our results show a variation in the ruggedness of fitness landscapes which are based on a high degree of epistatic interactions. Fitness landscapes play an essential role, not only in biotic evolution, but also in all kinds of optimization processes (Hill Climbing, Simulated Annealing, Genetic Algorithms, etc). Variation in their ruggedness should therefore be taken into account in the analysis of these

  11. Cloning and expression of SOLD1 in ovine and caprine placenta, and their expected roles during the development of placentomes

    Directory of Open Access Journals (Sweden)

    Kizaki Keiichiro

    2010-01-01

    Full Text Available Abstract Background The Ly-6 (Ly-6/uPAR superfamily members share the Ly-6 domain defined by distinct disulfide bonding patterns between 8 or 10 cysteine residues. They comprise membrane- and secretory-type proteins. We recently reported the gene and protein characterization of the bovine secreted protein of Ly-6 domain 1 (SOLD1. Bovine SOLD1 is expressed in trophoblast mononucleate cells (TMCs and is localized in the cotyledonary mesenchyme. Here, we compared the expression and functionality of SOLD1 among the ruminants. We examined mRNA expression by chorionic fibroblasts as a measure of one of the SOLD1 functions. Results Ovine and caprine SOLD1 mRNAs have 303 bp open reading frames and encode for deduced SOLD1 proteins with 100 amino acids, including a 22-aa-long signal peptide at the N-terminal. Both of the SOLD1 amino acid sequences have high similarities with the bovine sequence. Both SOLD1 mRNAs were also expressed in TMCs of cotyledons and intercotyledonary membranes. The mature SOLD1 proteins were localized in the mesenchymal villi of cotyledons after secretion. Bovine, ovine and caprine SOLD1 affected gene expression in mesenchymal fibroblasts in vitro; nucleoredoxin expression was upregulated and BCL2-like 13 was downregulated. Thus, we suggest that SOLD1 acts as a modulator of cell proliferation and apoptosis. Conclusion Expressing cells and protein localization of SOLD1 coincided among the three ruminants. SOLD1 participated in regulating nucleoredoxin and BCL2-like 13 expression in chorionic fibroblasts. SOLD1 is produced specifically in the cotyledons and intercotyledonary membranes in ruminants and appears to be involved in the construction of the ruminant placenta.

  12. A new African fossil caprin and a combined molecular and morphological Bayesian phylogenetic analysis of caprini (Mammalia: Bovidae).

    Science.gov (United States)

    Bibi, F; Vrba, E; Fack, F

    2012-09-01

    Given that most species that have ever existed on Earth are extinct, no evolutionary history can ever be complete without the inclusion of fossil taxa. Bovids (antelopes and relatives) are one of the most diverse clades of large mammals alive today, with over a hundred living species and hundreds of documented fossil species. With the advent of molecular phylogenetics, major advances have been made in the phylogeny of this clade; however, there has been little attempt to integrate the fossil record into the developing phylogenetic picture. We here describe a new large fossil caprin species from ca. 1.9-Ma deposits from the Middle Awash, Ethiopia. To place the new species phylogenetically, we perform a Bayesian analysis of a combined molecular (cytochrome b) and morphological (osteological) character supermatrix. We include all living species of Caprini, the new fossil species, a fossil takin from the Pliocene of Ethiopia (Budorcas churcheri), and the insular subfossil Myotragus balearicus. The combined analysis demonstrates successful incorporation of both living and fossil species within a single phylogeny based on both molecular and morphological evidence. Analysis of the combined supermatrix produces superior resolution than with either the molecular or morphological data sets considered alone. Parsimony and Bayesian analyses of the data set are also compared and shown to produce similar results. The combined phylogenetic analysis indicates that the new fossil species is nested within Capra, making it one of the earliest representatives of this clade, with implications for molecular clock calibration. Geographical optimization indicates no less than four independent dispersals into Africa by caprins since the Pliocene. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.

  13. The characterization of the physicochemical and sensory properties of full-fat, reduced-fat and low-fat bovine, caprine, and ovine Greek yogurt (Labneh).

    Science.gov (United States)

    Atamian, Samson; Olabi, Ammar; Kebbe Baghdadi, Omar; Toufeili, Imad

    2014-03-01

    Concentrated/Greek yogurt or Labneh is a semisolid food produced from yogurt by eliminating part of its water and water-soluble compounds. Today's world is geared toward the production of lower fat foods without compromising the texture and flavor of these products. The objective of this study was to characterize the physicochemical and sensory properties of bovine, caprine, and ovine Labneh with different fat levels. Bovine, caprine, and ovine milks were used to produce two batches of full-fat (∼10%), reduced-fat (∼5%), and low-fat (color, shininess, bitter flavor, denseness, melting rate, and spreadability, whereas fat level affected only color, denseness, and melting rate. Type of milk had a significant effect on overall acceptability and acceptability of flavor and texture.

  14. Manufacture of Third-Generation Lentivirus for Preclinical Use, with Process Development Considerations for Translation to Good Manufacturing Practice.

    Science.gov (United States)

    Gándara, Carolina; Affleck, Valerie; Stoll, Elizabeth Ann

    2018-02-01

    Lentiviral vectors are used in laboratories around the world for in vivo and ex vivo delivery of gene therapies, and increasingly clinical investigation as well as preclinical applications. The third-generation lentiviral vector system has many advantages, including high packaging capacity, stable gene expression in both dividing and post-mitotic cells, and low immunogenicity in the recipient organism. Yet, the manufacture of these vectors is challenging, especially at high titers required for direct use in vivo, and further challenges are presented by the process of translating preclinical gene therapies toward manufacture of products for clinical investigation. The goals of this paper are to report the protocol for manufacturing high-titer third-generation lentivirus for preclinical testing and to provide detailed information on considerations for translating preclinical viral vector manufacture toward scaled-up platforms and processes in order to make gene therapies under Good Manufacturing Practice that are suitable for clinical trials.

  15. Renal Alterations in Feline Immunodeficiency Virus (FIV-Infected Cats: A Natural Model of Lentivirus-Induced Renal Disease Changes

    Directory of Open Access Journals (Sweden)

    Mauro Pistello

    2012-08-01

    Full Text Available Human immunodeficiency virus (HIV is associated with several renal syndromes including acute and chronic renal failures, but the underlying pathogenic mechanisms are unclear. HIV and feline immunodeficiency virus (FIV share numerous biological and pathological features, including renal alterations. We investigated and compared the morphological changes of renal tissue of 51 experimentally and 21 naturally infected cats. Compared to the latter, the experimentally infected cats exhibited some mesangial widening and glomerulonephritis, milder proteinuria, and lower tubular and interstitial alterations. The numbers of giant protein tubular casts and tubular microcysts were also lower. In contrast, diffuse interstitial infiltrates and glomerular and interstitial amyloidosis were detected only in naturally infected cats. Similar alterations are found in HIV infected patients, thus supporting the idea of a causative role of FIV infection in renal disease, and underlining the relevance of the FIV and its natural host as an animal model for investigating lentivirus-associated nephropathy.

  16. Renal alterations in feline immunodeficiency virus (FIV)-infected cats: a natural model of lentivirus-induced renal disease changes.

    Science.gov (United States)

    Poli, Alessandro; Tozon, Natasa; Guidi, Grazia; Pistello, Mauro

    2012-09-01

    Human immunodeficiency virus (HIV) is associated with several renal syndromes including acute and chronic renal failures, but the underlying pathogenic mechanisms are unclear. HIV and feline immunodeficiency virus (FIV) share numerous biological and pathological features, including renal alterations. We investigated and compared the morphological changes of renal tissue of 51 experimentally and 21 naturally infected cats. Compared to the latter, the experimentally infected cats exhibited some mesangial widening and glomerulonephritis, milder proteinuria, and lower tubular and interstitial alterations. The numbers of giant protein tubular casts and tubular microcysts were also lower. In contrast, diffuse interstitial infiltrates and glomerular and interstitial amyloidosis were detected only in naturally infected cats. Similar alterations are found in HIV infected patients, thus supporting the idea of a causative role of FIV infection in renal disease, and underlining the relevance of the FIV and its natural host as an animal model for investigating lentivirus-associated nephropathy.

  17. Identification of the Caprine Keratin-Associated Protein 20-2 (KAP20-2 Gene and Its Effect on Cashmere Traits

    Directory of Open Access Journals (Sweden)

    Jiqing Wang

    2017-11-01

    Full Text Available The gene encoding the high glycine/tyrosine keratin-associated protein 20-2 (KAP20-2 gene has been described in humans, but has not been identified in any livestock species. A search for similar sequences in the caprine genome using the human KAP20-2 gene (KRTAP20-2 revealed a homologous sequence on chromosome 1. Three different banding patterns representing distinct sequences (A–C in Longdong cashmere goats were identified using polymerase chain reaction-single stranded conformational polymorphism (PCR-SSCP analysis. These sequences shared high sequence similarity with the human and mouse KRTAP20-2 sequences, suggesting that A–C are caprine variants of the human and mouse genes. Four single nucleotide polymorphisms (SNPs were identified, and three of them were non-synonymous. KRTAP20-2 was found to be expressed in secondary hair follicles, but not in heart, liver, lung, kidney, spleen, or longissimus dorsi muscle. The presence of A was associated with increased cashmere fibre weight, while the presence of B was associated with a decrease in cashmere fibre weight and curly fibre length. Goats with genotype AA had a higher cashmere fibre weight and a higher curly fibre length than those with genotypes AB or BB. These results indicate that caprine KRTAP20-2 variation may have value as a genetic marker for improving cashmere fibre weight.

  18. Identification of the Caprine Keratin-Associated Protein 20-2 (KAP20-2) Gene and Its Effect on Cashmere Traits.

    Science.gov (United States)

    Wang, Jiqing; Che, Longjie; Hickford, Jon G H; Zhou, Huitong; Hao, Zhiyun; Luo, Yuzhu; Hu, Jiang; Liu, Xiu; Li, Shaobin

    2017-11-17

    The gene encoding the high glycine/tyrosine keratin-associated protein 20-2 (KAP20-2) gene has been described in humans, but has not been identified in any livestock species. A search for similar sequences in the caprine genome using the human KAP20-2 gene ( KRTAP20-2 ) revealed a homologous sequence on chromosome 1. Three different banding patterns representing distinct sequences ( A - C ) in Longdong cashmere goats were identified using polymerase chain reaction-single stranded conformational polymorphism (PCR-SSCP) analysis. These sequences shared high sequence similarity with the human and mouse KRTAP20-2 sequences, suggesting that A - C are caprine variants of the human and mouse genes. Four single nucleotide polymorphisms (SNPs) were identified, and three of them were non-synonymous. KRTAP20-2 was found to be expressed in secondary hair follicles, but not in heart, liver, lung, kidney, spleen, or longissimus dorsi muscle. The presence of A was associated with increased cashmere fibre weight, while the presence of B was associated with a decrease in cashmere fibre weight and curly fibre length. Goats with genotype AA had a higher cashmere fibre weight and a higher curly fibre length than those with genotypes AB or BB . These results indicate that caprine KRTAP20-2 variation may have value as a genetic marker for improving cashmere fibre weight.

  19. Caprine PrP variants harboring Asp-146, His-154 and Gln-211 alleles display reduced convertibility upon interaction with pathogenic murine prion protein in scrapie infected cells.

    Science.gov (United States)

    Kanata, Eirini; Arsenakis, Minas; Sklaviadis, Theodoros

    2016-09-02

    Scrapie, the prion disease of sheep and goats, is a devastating malady of small ruminants. Due to its infectious nature, epidemic outbreaks may occur in flocks/herds consisting of highly susceptible animals. Field studies identified scrapie-protective caprine PrP variants, harboring specific single amino acid changes (Met-142, Arg-143, Asp-146, Ser-146, His-154, Gln-211 and Lys-222). Their effects are under further evaluation, and aim to determine the most protective allele. We assessed some of these variants (Asp-146, His-154, Gln-211 and Lys-222), after their exogenous expression as murine-caprine chimeras in a scrapie- infected murine cell line. We report that exogenously expressed PrPs undergo conformational conversion upon interaction with the endogenous pathological murine prion protein (PrP SC ), which results in the detection of goat-specific and partially PK-resistant moieties. These moieties display a PK-resistance pattern distinct from the one detected in natural goat scrapie cases. Within this cellular model, distinct conformational conversion potentials were assigned to the tested variants. Molecules carrying the Asp-146, His-154 and Gln-211 alleles showed significantly lower conversion levels compared to wild type, confirming their protective effects against scrapie. Although we utilized a heterologous conversion system, this is to our knowledge, the first study of caprine PrP variants in a cellular context of scrapie, that confirms the protective effects of some of the studied alleles.

  20. Evolutionary and Functional Analysis of Old World Primate TRIM5 Reveals the Ancient Emergence of Primate Lentiviruses and Convergent Evolution Targeting a Conserved Capsid Interface.

    Directory of Open Access Journals (Sweden)

    Kevin R McCarthy

    2015-08-01

    Full Text Available The widespread distribution of lentiviruses among African primates, and the lack of severe pathogenesis in many of these natural reservoirs, are taken as evidence for long-term co-evolution between the simian immunodeficiency viruses (SIVs and their primate hosts. Evidence for positive selection acting on antiviral restriction factors is consistent with virus-host interactions spanning millions of years of primate evolution. However, many restriction mechanisms are not virus-specific, and selection cannot be unambiguously attributed to any one type of virus. We hypothesized that the restriction factor TRIM5, because of its unique specificity for retrovirus capsids, should accumulate adaptive changes in a virus-specific fashion, and therefore, that phylogenetic reconstruction of TRIM5 evolution in African primates should reveal selection by lentiviruses closely related to modern SIVs. We analyzed complete TRIM5 coding sequences of 22 Old World primates and identified a tightly-spaced cluster of branch-specific adaptions appearing in the Cercopithecinae lineage after divergence from the Colobinae around 16 million years ago. Functional assays of both extant TRIM5 orthologs and reconstructed ancestral TRIM5 proteins revealed that this cluster of adaptations in TRIM5 specifically resulted in the ability to restrict Cercopithecine lentiviruses, but had no effect (positive or negative on restriction of other retroviruses, including lentiviruses of non-Cercopithecine primates. The correlation between lineage-specific adaptations and ability to restrict viruses endemic to the same hosts supports the hypothesis that lentiviruses closely related to modern SIVs were present in Africa and infecting the ancestors of Cercopithecine primates as far back as 16 million years ago, and provides insight into the evolution of TRIM5 specificity.

  1. Development of an equine-tropic replication-competent lentivirus assay for equine infectious anemia virus-based lentiviral vectors.

    Science.gov (United States)

    Farley, Daniel C; Bannister, Richard; Leroux-Carlucci, Marie A; Evans, Nerys E; Miskin, James E; Mitrophanous, Kyriacos A

    2012-10-01

    The release of lentiviral vectors for clinical use requires the testing of vector material, production cells, and, if applicable, ex vivo-transduced cells for the presence of replication-competent lentivirus (RCL). Vectors derived from the nonprimate lentivirus equine infectious anemia virus (EIAV) have been directly administered to patients in several clinical trials, with no toxicity observed to date. Because EIAV does not replicate in human cells, and because putative RCLs derived from vector components within human vector production cells would most likely be human cell-tropic, we previously developed an RCL assay using amphotropic murine leukemia virus (MLV) as a surrogate positive control and human cells as RCL amplification/indicator cells. Here we report an additional RCL assay that tests for the presence of theoretical "equine-tropic" RCLs. This approach provides further assurance of safety by detecting putative RCLs with an equine cell-specific tropism that might not be efficiently amplified by the human cell-based RCL assay. We tested the ability of accessory gene-deficient EIAV mutant viruses to replicate in a highly permissive equine cell line to direct our choice of a suitable EIAV-derived positive control. In addition, we report for the first time the mathematical rationale for use of the Poisson distribution to calculate minimal infectious dose of positive control virus and for use in monitoring assay positive/spike control failures in accumulating data sets. No RCLs have been detected in Good Manufacturing Practice (GMP)-compliant RCL assays to date, further demonstrating that RCL formation is highly unlikely in contemporary minimal lentiviral vector systems.

  2. Mutations in Ovis aries TMEM154 are associated with lower small ruminant lentivirus proviral concentration in one sheep flock.

    Science.gov (United States)

    Alshanbari, F A; Mousel, M R; Reynolds, J O; Herrmann-Hoesing, L M; Highland, M A; Lewis, G S; White, S N

    2014-08-01

    Small ruminant lentivirus (SRLV), also called ovine progressive pneumonia virus or maedi-visna, is present in 24% of US sheep. Like human immunodeficiency virus, SRLV is a macrophage-tropic lentivirus that causes lifelong infection. The production impacts from SRLV are due to a range of disease symptoms, including pneumonia, arthritis, mastitis, body condition wasting and encephalitis. There is no cure and no effective vaccine for preventing SRLV infection. However, breed differences in prevalence and proviral concentration indicate a genetic basis for susceptibility to SRLV. Animals with high blood proviral concentration show increased tissue lesion severity, so proviral concentration represents a live animal test for control post-infection in terms of proviral replication and disease severity. Recently, it was found that sheep with two copies of TMEM154 haplotype 1 (encoding lysine at position 35) had lower odds of SRLV infection. In this study, we examined the relationship between SRLV control post-infection and variants in two genes, TMEM154 and CCR5, in four flocks containing 1403 SRLV-positive sheep. We found two copies of TMEM154 haplotype 1 were associated with lower SRLV proviral concentration in one flock (P < 0.02). This identified the same favorable diplotype for SRLV control post-infection as for odds of infection. However, frequencies of haplotypes 2 and 3 were too low in the other three flocks to test. The CCR5 promoter deletion did not have consistent association with SRLV proviral concentration. Future work in flocks with more balanced allele frequencies is needed to confirm or refute TMEM154 association with control of SRLV post-infection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA. Animal Genetics published by John Wiley & Sons Ltd on behalf of Stichting International Foundation for Animal Genetics.

  3. Neuroprotective effects of lentivirus-mediated cystathionine-beta-synthase overexpression against 6-OHDA-induced parkinson's disease rats.

    Science.gov (United States)

    Yin, Wei-Lan; Yin, Wei-Guo; Huang, Bai-Sheng; Wu, Li-Xiang

    2017-09-14

    Parkinson's disease (PD) is age-related neurodegenerative disorder by a progressive loss of dopaminergic(DA) neurons in the substantia nigra (SN) and striatum, which is at least partly associated with α-synuclein protein accumulation in these neurons. Hydrogen sulfide (H 2 S) plays an important role in the nervous system. Studies have shown that H 2 S has a protective effect on PD. However, as a kind of gas molecules, H 2 S is lively, volatile, and not conducive to scientific research and clinical application. Cystathionine-beta-synthase(CBS) is the main enzymes of synthesis of H 2 S in the brain. In order to examine the neuroprotective effects of CBS on PD, we detected the effects of CBS overexpression on 6-Hydroxydopamine (6-OHDA)-lesioned PD rats using lentivirus-mediated gene transfection techniques. In the injured SN of 6-OHDA-induced PD rats, the CBS expression and the endogenous H 2 S level markedly decreased, while administration of lentivirus-mediated CBS overexpression increased the CBS expression and the endogenous H 2 S production.CBS overexpression dramatically reversed apomorphine-induced rotation of the 6-OHDA model rats, decreased the number of TUNEL-positive neurons and the loss of the nigral DA neurons,specifically inhibited 6-OHDA-induced oxidase stress injury, and down-regulated the expression of α-synuclein(α-SYN) in the injured SN. NaHS (an H 2 S donor) had similar effects to CBS overexpression, while Amino-oxyacetate(AOAA, a CBS inhibitor) had opposite effects on PD rats. In summary, we demonstrated that CBS overexpression was able to provide neuroprotective on PD rats and improving the expression of CBS may be a potential therapeutic method for PD. Copyright © 2017. Published by Elsevier B.V.

  4. Lentivirus-Mediated Knockdown of Astrocyte Elevated Gene-1 Inhibits Growth and Induces Apoptosis through MAPK Pathways in Human Retinoblastoma Cells.

    Directory of Open Access Journals (Sweden)

    Ying Chang

    Full Text Available To explore expression and function of astrocyte elevated gene-1 (AEG-1 in human retinoblastoma (RB.The expression of AEG-1 in histological sections of human RBs and in RB cell lines was examined using immunohistochemical staining and RT-PCR and Western blotting respectively. We knocked down AEG-1 gene levels by AEG-1-siRNA lentivirus transfection of human RB cell lines SO-RB50 and Y79, and using an MTT assay, we assessed the role of AEG-1 on RB cell proliferation. The biological significance of lentivirus transfection induced AEG-1 down-regulation was examined by assessing the apoptosis rate in the transfected RB cells by Annexin V-APC staining and flow cytometry. We additionally measured the expression of Bcl-2, Bax, cleaved-caspase-3 and caspase-3, and the phosphorylation and non-phosphorylation alternation of MAPKs.AEG-1 expression was detected to be strongly positive in the histological slides of 35 out of 54 (65% patients with RB. AEG-1 expression increased significantly (P<0.05 with tumor stage. In the RB cell lines SO-RB50, Y79 and WERI-RB1 as compared with retinal pigment epithelium cells, expression of AEG-1 mRNA and AEG-1 protein was significantly higher. In AEG-1-siRNA lentivirus transfected cell cultures as compared with negative control lentivirus transfected cell cultures, levels of AEG-1 mRNA and of AEG-1 protein (P<0.05 and cell growth rates (P<0.01 were significantly lower, and apoptosis rate (P<0.001, Bax/Bcl-2 ratio and cleaved-caspase-3 protein level were significantly increased. The P-ERK/ERK ratio was significantly decreased in the AEG-1-siRNA lentivirus transfected cell lines.Expression of AEG-1 was associated with RB, in histological slides of patients and in cell culture experiments. Lentivirus transfection induced knockdown of AEG-1 had a tumor suppressive effect, potentially by tumor cell apoptosis induction through inhibition of ERK.

  5. Lentivirus-ABCG1 instillation reduces lipid accumulation and improves lung compliance in GM-CSF knock-out mice

    Energy Technology Data Exchange (ETDEWEB)

    Malur, Anagha; Huizar, Isham [Program in Lung Cell Biology and Translational Research, Division of Pulmonary, Critical Care and Sleep Medicine, East Carolina University, Greenville, NC (United States); Wells, Greg [Department of Microbiology and Immunology, East Carolina University, Greenville, NC (United States); Barna, Barbara P. [Program in Lung Cell Biology and Translational Research, Division of Pulmonary, Critical Care and Sleep Medicine, East Carolina University, Greenville, NC (United States); Malur, Achut G. [Department of Microbiology and Immunology, East Carolina University, Greenville, NC (United States); Thomassen, Mary Jane, E-mail: thomassenm@ecu.edu [Program in Lung Cell Biology and Translational Research, Division of Pulmonary, Critical Care and Sleep Medicine, East Carolina University, Greenville, NC (United States); Department of Microbiology and Immunology, East Carolina University, Greenville, NC (United States)

    2011-11-18

    Highlights: Black-Right-Pointing-Pointer Lentivirus-ABCG1 reduces lipid accumulation in lungs of GM-CSF knock-out mice. Black-Right-Pointing-Pointer Up-regulation of ABCG1 improves lung function. Black-Right-Pointing-Pointer Upregulation of ABCG1 improves surfactant metabolism. -- Abstract: We have shown decreased expression of the nuclear transcription factor, peroxisome proliferator-activated receptor-gamma (PPAR{gamma}) and the PPAR{gamma}-regulated ATP-binding cassette transporter G1 (ABCG1) in alveolar macrophages from patients with pulmonary alveolar proteinosis (PAP). PAP patients also exhibit neutralizing antibodies to granulocyte-macrophage colony stimulating factor (GM-CSF), an upregulator of PPAR{gamma}. In association with functional GM-CSF deficiency, PAP lung is characterized by surfactant-filled alveolar spaces and lipid-filled alveolar macrophages. Similar pathology characterizes GM-CSF knock-out (KO) mice. We reported previously that intratracheal instillation of a lentivirus (lenti)-PPAR{gamma} plasmid into GM-CSF KO animals elevated ABCG1 and reduced alveolar macrophage lipid accumulation. Here, we hypothesized that instillation of lenti-ABCG1 might be sufficient to decrease lipid accumulation and improve pulmonary function in GM-CSF KO mice. Animals received intratracheal instillation of lenti-ABCG1 or control lenti-enhanced Green Fluorescent Protein (eGFP) plasmids and alveolar macrophages were harvested 10 days later. Alveolar macrophage transduction efficiency was 79% as shown by lenti-eGFP fluorescence. Quantitative PCR analyses indicated a threefold (p = 0.0005) increase in ABCG1 expression with no change of PPAR{gamma} or ABCA1 in alveolar macrophages of lenti-ABCG1 treated mice. ABCG1 was unchanged in control lenti-eGFP and PBS-instilled groups. Oil Red O staining detected reduced intracellular neutral lipid in alveolar macrophages from lenti-ABCG1 treated mice. Extracellular cholesterol and phospholipids were also decreased as shown by

  6. Identification of c.483C>T polymorphism in the caprine tyrosinase-related protein 1 (TYRP1 gene

    Directory of Open Access Journals (Sweden)

    Marcel Amills

    2012-01-01

    Full Text Available Tyrosinase-related protein 1 (TYRP1 has been shown to play a fundamental role in pigmentation both in human and mouse. In this work, we aimed to characterize the variability of the caprine TYRP1 gene and investigate its segregation in a wide array of goat breeds. By partially sequencing the coding region of the TYRP1 gene in 18 individuals from eight different breeds, we were able to identify a synonymous nucleotide substitution at exon 3 (c.483C>T. An extensive survey of Iberian and Balearic (N=175, Italian (N=99, Swiss (N=54, Asian (N=14, Canarian (N=92 and North African (N=117 goats with different coat colours was carried out. We found that the C-allele has a different distribution in European vs African breeds, being almost fixed in the latter. Moreover, the C-allele showed an increased frequency in white coated breeds (Girgentana, Grigia Molisana, Blanca de Rasquera and Saanen when compared with those displaying a dark pigmentation (Cilentana Nera, Azpi Gorri and Murciano- Granadina. This could be due to genetic drift, migration and other factors associated with the demographic history of breeds under analysis or to a genetic hitchhiking event (c.483C>T frequencies would be shaped by a neighbouring causal mutation differentially selected in white and black goats. More refined studies will be needed to distinguish between these two alternative explanations.

  7. Vírus da artrite encefalite caprina: isolamento e caracterização de parte do gene gag

    Directory of Open Access Journals (Sweden)

    P.P. Lima

    2004-04-01

    Full Text Available Amostras de sangue de 12 animais soropositivos pelo teste de imunodifusão em gel de agarose e que não apresentavam sinais clínicos sugestivos de infecção pelo vírus da artrite-encefalite caprina (CAEV foram coletadas para isolamento viral. Mácrofagos derivados de monócitos foram co-cultivados com células de membrana sinovial caprina (MSC, resultando em cinco amostras que apresentaram efeito citopático característico do tipo persistente, semelhante ao observado para o CAEV. Uma técnica de reação em cadeia de polimerase (PCR foi padronizada para amplificar parte do gene gag do genoma pró-viral, codificante para a proteína do capsídeo viral (p25. As cinco amostras foram amplificadas pela PCR e três delas, BR-UFMG/PL1, BR-UFMG/PL2 e BR-UFMG/PL3, foram seqüenciadas diretamente dos seus produtos de PCR. O alinhamento múltiplo das seqüências obtidas com outras de lentivírus de pequenos ruminantes (LVPR, obtidas no GenBank, e o dendrograma revelaram que as novas amostras de CAEV são únicas e distintas das demais amostras de LVPR, possuindo maior identidade de nucleotídeos e aminoácidos entre si e com as amostras de CAEV do que com a do vírus maedi-visna.Blood samples from 12 seropositive animals by agar gel immunodifusion test (AGID showing no evident clinical signs of disease were taken to attempt caprine arthritis-encephalitis virus (CAEV isolation. Monocyte-derived macrophages were co-cultured with goat synovial membrane cells (GSM resulting in five virus isolations, which presented cytophatic effects of the persistent type, resembling those observed for CAEV. A polymerase chain reaction (PCR assay was designed to amplify a portion of the gag proviral gene coding for the major core protein (p25. All of the five isolates were amplified by this PCR and three of them named BR-UFMG/PL1, BR-UFMG/PL2 and BR-UFMG/PL3, were sequenced directly from their PCR products. Multiple sequence analysis and a dendrogram including other

  8. Influence of true within-herd prevalence of small ruminant lentivirus infection in goats on agreement between serological immunoenzymatic tests.

    Science.gov (United States)

    Czopowicz, Michał; Szaluś-Jordanow, Olga; Mickiewicz, Marcin; Moroz, Agata; Witkowski, Lucjan; Markowska-Daniel, Iwona; Bagnicka, Emilia; Kaba, Jarosław

    2017-09-01

    The study was conducted to evaluate influence of the true within-herd prevalence of small ruminant lentivirus (SRLV) infection on agreement beyond chance between three different types of commercial serological ELISAs. Blood samples were collected from 865 goats from 12 dairy goat herds. Serum samples were tested using three commercial ELISA kits: whole-virus indirect ELISA (wELISA), indirect ELISA based on recombined TM and CA antigens (TM/CA-ELISA), and competitive-inhibition ELISA based on SU antigen (SU-ELISA). Herds were classed into three prevalence strata of high (>50%), moderate (10-50%) and low (50% (Gwet's AC 1 between 91.9% and 98.8%) or <10% (Gwet's AC 1 between 94.7% and 98.4%). Concluding, the three different commercial ELISAs for SRLV infection in goats available on the market yield highly consistent results. However, their agreement is affected by the true within-herd prevalence in a tested population, and the worse (although still high) agreement should be expected, when the percentage of infected goats is moderate. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Production and use of lentivirus to selectively transduce primary oligodendrocyte precursor cells for in vitro myelination assays.

    Science.gov (United States)

    Peckham, Haley M; Ferner, Anita H; Giuffrida, Lauren; Murray, Simon S; Xiao, Junhua

    2015-01-12

    Myelination is a complex process that involves both neurons and the myelin forming glial cells, oligodendrocytes in the central nervous system (CNS) and Schwann cells in the peripheral nervous system (PNS). We use an in vitro myelination assay, an established model for studying CNS myelination in vitro. To do this, oligodendrocyte precursor cells (OPCs) are added to the purified primary rodent dorsal root ganglion (DRG) neurons to form myelinating co-cultures. In order to specifically interrogate the roles that particular proteins expressed by oligodendrocytes exert upon myelination we have developed protocols that selectively transduce OPCs using the lentivirus overexpressing wild type, constitutively active or dominant negative proteins before being seeded onto the DRG neurons. This allows us to specifically interrogate the roles of these oligodendroglial proteins in regulating myelination. The protocols can also be applied in the study of other cell types, thus providing an approach that allows selective manipulation of proteins expressed by a desired cell type, such as oligodendrocytes for the targeted study of signaling and compensation mechanisms. In conclusion, combining the in vitro myelination assay with lentiviral infected OPCs provides a strategic tool for the analysis of molecular mechanisms involved in myelination.

  10. Epidemiological survey in single-species flocks from Poland reveals expanded genetic and antigenic diversity of small ruminant lentiviruses

    Science.gov (United States)

    Valas, Stephen; Kuźmak, Jacek

    2018-01-01

    Small ruminant lentivirus (SRLV) infections are widespread in Poland and circulation of subtypes A1, A12, A13, B1 and B2 was detected. The present work aimed at extending previous study based on the analysis of a larger number of animals from single-species flocks. Animals were selected for genetic analysis based on serological reactivity towards a range of recombinant antigens derived from Gag and Env viral proteins. Phylogenetic analysis revealed the existence of subtypes B2 and A12 in both goats and sheep and subtypes A1 and B1 in goats only. In addition, two novel subtypes, A16 and A17, were found in goats. Co-infections with strains belonging to different subtypes within A and B groups were detected in 1 sheep and 4 goats originating from four flocks. Although the reactivity of serum samples towards the recombinant antigens confirmed immunological relatedness between Gag epitopes of different subtypes and the cross-reactive nature of Gag antibodies, eleven serum samples failed to react with antigens representing all subtypes detected up-to-date in Poland, highlighting the limitations of the serological diagnosis. These data showed the complex nature of SRLV subtypes circulating in sheep and goats in Poland and the need for improving SRLV-related diagnostic capacity. PMID:29505612

  11. Targeting S100P Inhibits Colon Cancer Growth and Metastasis by Lentivirus-Mediated RNA Interference and Proteomic Analysis

    Science.gov (United States)

    Jiang, Lei; Lai, Yiu-Kay; Zhang, Jinfang; Wang, Hua; Lin, Marie CM; He, Ming-liang; Kung, Hsiang-fu

    2011-01-01

    S100P was recently found to be overexpressed in a variety of cancers and is considered a potential target for cancer therapy, but the functional role or mechanism of action of S100P in colon cancer is not fully understood. In the present study, we knocked down the gene expression of S100P in colon cancer cells using lentivirus-mediated RNA interference. This step resulted in significant inhibition of cancer cell growth, migration and invasion in vitro and tumor growth and liver metastasis in vivo. Moreover, S100P downstream target proteins were identified by proteomic analysis in colon cancer DLD-1 cells with deletion of S100P. Knockdown of S100P led to downregulation of thioredoxin 1 and β-tubulin and upregulation of Rho guanosine diphosphate (GDP) dissociation inhibitor α (RhoGDIA), all potential therapeutic targets in cancer. Taken together, these findings suggest that S100P plays an important role in colon tumorigenesis and metastasis, and the comprehensive and comparative analyses of proteins associated with S100P could contribute to understanding the downstream signal cascade of S100P, leading to tumorigenesis and metastasis. PMID:21327297

  12. Prevalence of Coxiella burnetii in bulk milk samples from dairy bovine, ovine, caprine, and camel herds in Iran as determined by polymerase chain reaction.

    Science.gov (United States)

    Rahimi, Ebrahim; Ameri, Mehrdad; Karim, Guity; Doosti, Abbas

    2011-02-01

    Q fever is a widespread zoonosis caused by the obligate intracellular micro-organism Coxiella burnetii. The objective of this study was to determine the prevalence rate of C. burnetii in bulk milk samples from dairy bovine, ovine, caprine, and camel herds in Isfahan province, Iran. In the present study, 567 bulk milk samples from 186 dairy bovine, ovine, caprine, and camel herds were tested for C. burnetii using a nested polymerase chain reaction assay. The animals whose milk samples collected for this study were clinically healthy. In total, 8 of 247 (3.2%) bovine milk samples were positive; the positive samples originated from 6 of 90 (6.7%) dairy herds. Eight of 140 (5.7%) ovine bulk milk samples from 42 sheep breeding farms and 5 of 110 (4.5%) caprine bulk milk samples from 32 goat breeding farms were positive for C. burnetii. One of 70 (1.4%) camel bulk milk samples from 22 camel breeding farms was also positive for C. burnetii. Although no extensive prevalence study was undertaken, the results of this study indicate that clinically healthy dairy animals are important sources of C. burnetii infection in Iran. To the authors' knowledge, this study is the first report of direct identification of C. burnetii using polymerase chain reaction in bulk milk samples from dairy ovine herds in Iran and the first report of direct identification of C. burnetii in bulk milk samples from dairy camel herds. Further intensive prevalence studies on Coxiella infection and on possible risks of dairy products will be needed to elucidate the epidemiology of Q fever in Iran.

  13. Detection of Toxoplasma gondii in raw caprine, ovine, buffalo, bovine, and camel milk using cell cultivation, cat bioassay, capture ELISA, and PCR methods in Iran.

    Science.gov (United States)

    Dehkordi, Farhad Safarpoor; Borujeni, Mohammad Reza Haghighi; Rahimi, Ebrahim; Abdizadeh, Rahman

    2013-02-01

    This study was conducted to determine the presence of Toxoplasma gondii in animal milk samples in Iran. From a total of 395 dairy herds in three provinces of Iran, 66 bovine, 58 ovine, 54 caprine, 33 buffalo, and 30 camel herds were studied, and from these parts of Iran, 200 bovine, 185 ovine, 180 caprine, 164 buffalo, and 160 camel milk samples were collected from various seasons. Samples were tested for Toxoplasma gondii by cell line culture, enzyme-linked immunosorbent assay (ELISA), and polymerase chain reaction (PCR) technique. Only the results of cell line cultivation were confirmed by bioassay in cat. Results indicated that all herds were infected with Toxoplasma gondii. The culture method showed that 51 out of 889 milk samples (5.73%) were positive for Toxoplasma gondii, and all 51 positive culture results were positive with bioassay in cat. The Fars province had the highest prevalence of Toxoplasma gondii (6.84%). The ELISA test showed that 41 milk samples (4.61%) were positive for the presence of Toxoplasma gondii, while the PCR showed that 46 milk samples were positive for Toxoplasma gondii. The results showed higher sensitivity of PCR and higher specificity of ELISA. Caprine had the highest (10%) and camel had the lowest (3.12%) prevalence rate of parasite. The summer season had the highest (76.47%) but winter (3.92) had the lowest incidence of Toxoplasma gondii. This study is the first prevalence report of direct detection of Toxoplasma gondii in animal milk samples in Iran.

  14. Repair of bone defect in caprine tibia using a laminated scaffold with bone marrow stromal cells loaded poly (L-lactic acid)/β-tricalcium phosphate.

    Science.gov (United States)

    Huang, Jianyan; Zhang, Lingmin; Chu, Bin; Peng, Xiaohui; Tang, Shunqing

    2011-01-01

    Repair of bone defects of a critical size encounters many problems, and many efforts aim to build a porous scaffold loading bone marrow stromal cells (BMSCs) or bone morphogenetic protein (BMP2) to quickly repair bone defects. In this paper, a laminated scaffold was designed and tested for the repair of bone defects in a caprine tibia. Beta-tricalcium phosphate (β-TCP) and poly (L-lactic acid) (PLLA) were fabricated to a sandwich structured composite that was then rolled up to form a cylindrical shaped, porous scaffold. The porosity and bending strength of the PLLA/β-TCP laminated scaffold were around 70% and 1.7 MPa, respectively. Results from in vitro experiments showed that the pH value of the scaffold in water fluctuated between 4.9 and 7.0 during its degradation. When exposed to the simulated body fluid, the scaffold lost its strength after 11 weeks of degradation. After implantation in Chinese caprines' diaphyseal defects with loaded allogeneic BMSCs, the scaffold sped up the bone repair without collapse of the scaffold and the unwanted inflammatory response, and then rapidly degraded and finally disappeared at 12 weeks. Gross examinations and pullout tests showed that the experimental caprines walked normally and the implanted leg could be heavily loaded. X-ray examinations and histological analyses showed new bone tissues formed with similar structures to normal ones. It is suggested that the novel PLLA/β-TCP laminated scaffold with BMSCs loading can regenerate new bones quickly. © 2010, Copyright the Authors. Artificial Organs © 2010, International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

  15. Clinical protection against caprine herpesvirus 1 genital infection by intranasal administration of a live attenuated glycoprotein E negative bovine herpesvirus 1 vaccine

    OpenAIRE

    Thiry, Julien; Tempesta, Maria; Camero, Michele; Tarsitano, Elvira; Muylkens, Benoît; Meurens, François; Thiry, Etienne; Buonavoglia, Canio

    2007-01-01

    Abstract Background Caprine herpesvirus 1 (CpHV-1) is responsible of systemic diseases in kids and genital diseases leading to abortions in goats. CpHV-1 is widespread and especially in Mediterranean countries as Greece, Italy and Spain. CpHV-1 is antigenically and genetically closely related to bovine herpesvirus 1 (BoHV-1). Taking into account the biological properties shared by these two viruses, we decided in the current study to assess the protection of a live attenuated glycoprotein E (...

  16. Targeted knockout of TNF-α by injection of lentivirus-mediated siRNA into the subacromial bursa for the treatment of subacromial bursitis in rats.

    Science.gov (United States)

    Wang, Yi; Li, Quan; Wei, Xianzhao; Xu, Jie; Chen, Qi; Song, Shuang; Lu, Zhe; Wang, Zimin

    2015-09-01

    Subacromial bursitis (SAB) is the major source of pain in rotator cuff disease. Although multiple investigations have provided support for the role of inflammatory cytokines in SAB, few have focussed on the use these cytokines in the treatment of SAB. The aim of the present study was to observe the therapeutic efficacy of lentivirus‑mediated RNA interference (RNAi) on carrageenan‑induced SAB by injecting lentivirus‑tumor necrosis factor (TNF)‑α‑RNAi expressing TNF‑α small interfering (si)RNA. Using screened siRNA segments, an siRNA was designed. A lentivirus vector expressing siRNA was established and packed as lentivirus particles. A lentivirus that expressed the negative sequence was used as a lentivirus‑negative control (NC). The carrageenan‑induced SAB model was established in 32 male Sprague‑Dawley rats. The modeled rats were randomly assigned to four groups: Lentivirus‑RNAi treatment group, lentivirus‑NC group, SAB group and phosphate‑buffered saline (PBS) blank control group. The lentivirus was injected (1x10(7) transducing units) into the subacromial bursa of the rats in the lentivirus‑RNAi group and lentivirus‑NC group, whereas 100 µl PBS was injected at the same site in the SAB group and the PBS blank control group. At 5 weeks following injection, the animals were sacrificed and venous blood was obtained. The effect of TNF‑α interference and the expression of inflammatory cytokines were determined by reverse transcription‑quantitative polymerase chain reaction, western blotting, hematoxylin and eosin staining, Van Gieson's staining and immunofluorescence. The expression of TNF‑α was decreased in the lentivirus‑TNF‑α‑RNAi group compared with that in the SAB group. Morphological observations revealed that the number of inflammatory cells were reduced and damage to tendon fibers was attenuated in this group, suggesting that the downregulation of the protein expression levels of TNF‑α‑associated nuclear

  17. A comparison of clinical laboratory data for assigning a consensus value for manganese in a caprine blood reference material.

    Science.gov (United States)

    Praamsma, Meredith L; Jones, Deanna R; Jarrett, Jeffrey M; Dumas, Pierre; Cirtiu, Ciprian Mihai; Parsons, Patrick J

    2012-10-01

    Biomonitoring for manganese (Mn) exposure is important due to its potential to cause adverse health effects. In this study, we investigate how different sample preparation methods (simple dilution, digestion, volumetric, gravimetric), calibration protocols (aqueous, blood-based, standard additions), and instrumental techniques affect Mn method bias and analytical imprecision. The techniques used included graphite furnace atomic absorption spectrometry (GFAAS), dynamic reaction cell inductively coupled plasma mass spectrometry (DRC-ICP-MS), and sector field (SF-) ICP-MS. We analyzed NIST SRM 1643e Trace Elements in Water and SRM 1598a Inorganic Constituents in Animal Serum (both certified for Mn), and SRM 955c Toxic Metals in Caprine Blood - Level 1 (not certified for Mn). Various matrix effects in ICP-MS produced inaccurate results for SRM 1643e and discrepant results for SRM 955c. In the absence of a certified value for Mn in SRM 955c, we assigned a "consensus" value by combining data from the New York State Department of Health (NYS), the Centers for Disease Control and Prevention (CDC) and the Centre de toxicologie du Québec (CTQ). With this interlaboratory approach, we established an "all-lab" consensus value of 16.3 ± 0.8 μg L -1 based on data from DRC-ICP-MS with simple dilution sample preparation and blood-based calibration. We also assigned an "all-method" consensus value of 16.3 ± 0.9 μg L -1 based on GFAAS and SF-ICP-MS data from the NYS lab and the DRC-ICP-MS all-lab consensus value. Although the expanded uncertainty ( U ) calculated for the consensus values may not fully account for all sources of uncertainty, it does show the relative variation that might be expected from one study to the next for the determination of Mn in blood.

  18. Elucidation of the involvement of p14, a sperm protein during maturation, capacitation and acrosome reaction of caprine spermatozoa.

    Directory of Open Access Journals (Sweden)

    Pinki Nandi

    Full Text Available Mammalian sperm capacitation is an essential prerequisite to fertilization. Although progress is being made in understanding the physiology and biochemistry of capacitation, little has been yet explored about the potential role(s of individual sperm cell protein during this process. Therefore elucidation of the role of different sperm proteins in the process of capacitation might be of great importance to understand the process of fertilization. The present work describes the partial characterization of a 14-kDa protein (p14 detected in goat spermatozoa using an antibody directed against the purified protein. Confocal microscopic analysis reveals that the protein is present in both the intracellular and extracellular regions of the acrosomal and postacrosomal portion of caudal sperm head. Though subcellular localization shows that p14 is mainly cytosolic, however it is also seen to be present in peripheral plasma membrane and soluble part of acrosome. Immuno-localization experiment shows change in the distribution pattern of this protein upon induction of capacitation in sperm cells. Increased immunolabeling in the anterior head region of live spermatozoa is also observed when these cells are incubated under capacitating conditions, whereas most sperm cells challenged with the calcium ionophore A23187 to acrosome react, lose their labeling almost completely. Intracellular distribution of p14 also changes significantly during acrosome reaction. Interestingly, on the other hand the antibody raised against this 14-kDa sperm protein enhances the forward motility of caprine sperm cells. Rose-Bengal staining method shows that this anti-p14 antibody also decreases the number of acrosome reacted cells if incubated with capacitated sperm cells before induction of acrosome reaction. All these results taken together clearly indicate that p14 is intimately involved and plays a critical role in the acrosomal membrane fusion event.

  19. First Description of Infection of Caprine Herpesvirus 1 (CpHV-1 in Goats in Mainland France

    Directory of Open Access Journals (Sweden)

    Florence Suavet

    2016-02-01

    Full Text Available The purpose of this study was to investigate the epidemiological situation of the caprine herpesvirus 1 (CpHV-1 infection in nine districts in mainland France, mostly in the south, near Italy or Spain, where high seroprevalence has been observed. Two more central areas were also included in the study. The serosurvey was carried out in 9564 goats (275 herds using bovine herpesvirus 1 (BoHV-1 glycoprotein B and E ELISAs. To confirm the presence of specific CpHV-1 antibodies, some of the samples were tested in neutralization assay. Results demonstrate, for the first time, CpHV-1 infection in goat herds on the French mainland. The analysis found cases of alphaherpesviruses infection in each district studied, with different levels of seroprevalence observed within each district (ranging from 0.2% to 31.56% at an individual level and from 9% to 46.2% for herd seroprevalence. Moreover, in the Alpes-Maritimes district, the seroprevalence seemed to be higher in older goats (79.45% of animals 6 years old or more than in younger animals (40.99% of one-year-olds. This result suggests frequent virus re-excretion and circulation in herds. Results analysis also shows that the seroprevalence was higher when the herd size increased. In addition, the first French CpHV-1 strain was isolated from nasal swabs taken on an infected goat. The data reported herein demonstrate that CpHV-1 circulates in mainland France, which should henceforth be taken into consideration in cases of unexplained abortion in goats.

  20. First Description of Infection of Caprine Herpesvirus 1 (CpHV-1) in Goats in Mainland France

    Science.gov (United States)

    Suavet, Florence; Champion, Jean-Luc; Bartolini, Luc; Bernou, Maryline; Alzieu, Jean-Pierre; Brugidou, Roland; Darnatigues, Séverine; Reynaud, Gaël; Perrin, Cécile; Adam, Gilbert; Thiéry, Richard; Duquesne, Véronique

    2016-01-01

    The purpose of this study was to investigate the epidemiological situation of the caprine herpesvirus 1 (CpHV-1) infection in nine districts in mainland France, mostly in the south, near Italy or Spain, where high seroprevalence has been observed. Two more central areas were also included in the study. The serosurvey was carried out in 9564 goats (275 herds) using bovine herpesvirus 1 (BoHV-1) glycoprotein B and E ELISAs. To confirm the presence of specific CpHV-1 antibodies, some of the samples were tested in neutralization assay. Results demonstrate, for the first time, CpHV-1 infection in goat herds on the French mainland. The analysis found cases of alphaherpesviruses infection in each district studied, with different levels of seroprevalence observed within each district (ranging from 0.2% to 31.56% at an individual level and from 9% to 46.2% for herd seroprevalence). Moreover, in the Alpes-Maritimes district, the seroprevalence seemed to be higher in older goats (79.45% of animals 6 years old or more) than in younger animals (40.99% of one-year-olds). This result suggests frequent virus re-excretion and circulation in herds. Results analysis also shows that the seroprevalence was higher when the herd size increased. In addition, the first French CpHV-1 strain was isolated from nasal swabs taken on an infected goat. The data reported herein demonstrate that CpHV-1 circulates in mainland France, which should henceforth be taken into consideration in cases of unexplained abortion in goats. PMID:26861403

  1. Anti-Müllerian hormone reduces growth rate without altering follicular survival in isolated caprine preantral follicles cultured in vitro.

    Science.gov (United States)

    Rocha, R M P; Lima, L F; Brito, I R; Silva, G M; Correia, H H V; Ribeiro de Sá, N A; Ferreira, A C A; Sales, A D; Lobo, C H; Campello, C C; Smitz, J; Wheeler, M B; Figueiredo, J R

    2017-06-01

    The aim of the present study was to evaluate the effect of anti-Müllerian hormone (AMH), with and without FSH, on the in vitro development of isolated caprine preantral follicles, as well as follicular steroid production and mRNA levels of AMH, hormone receptors (AMH and FSH), CYP19A1 (cytochrome P450, family 19, subfamily A, polypeptide 1), CYP17 (cytochrome P450, family 17, subfamily A, polypeptide 1), HSD3B (3-beta-hydroxysteroid dehydrogenase) and Myc (myelocytomatosis oncogene). Isolated secondary follicles were cultured in minimum essential medium alpha (α-MEM+) alone or supplemented with 50ng mL -1 AMH and/or 100ng mL -1 FSH added sequentially on different days of culture. Follicles were cultured for a total of 18 days, with different media during the first (Days 0-9) and second (Days 10-18) halves of the culture period, resulting in six treatment groups, as follows: α-MEM+/α-MEM+, FSH/FSH, AMH/AMH, AMH+FSH/AMH+FSH, AMH/FSH, and FSH/AMH. Follicle development was evaluated on the basis of follicular growth, oocyte maturation and steroid secretion. There was a decrease in follicular growth rate in the AMH, AMH+FSH and AMH/FSH treatment groups compared with α-MEM+ and FSH treatment groups (Prates of meiotic resumption and steroid secretion (P>0.05). Moreover, follicles cultured in the presence of FSH had lower levels of AMH receptor type II (AMHRII) mRNA compared with non-cultured control (freshly isolated follicles), and the AMH and AMH/FSH treatment groups. In conclusion, AMH reduces the follicular growth rate of isolated goat preantral follicles in vitro without affecting follicular survival.

  2. Effect of a Semi-Purified Oligosaccharide-Enriched Fraction from Caprine Milk on Barrier Integrity and Mucin Production of Co-Culture Models of the Small and Large Intestinal Epithelium

    Directory of Open Access Journals (Sweden)

    Alicia M. Barnett

    2016-05-01

    Full Text Available Caprine milk contains the highest amount of oligosaccharides among domestic animals, which are structurally similar to human milk oligosaccharides (HMOs. This suggests caprine milk oligosaccharides may offer similar protective and developmental effects to that of HMOs. However, to date, studies using oligosaccharides from caprine milk have been limited. Thus, this study aimed to examine the impact of a caprine milk oligosaccharide-enriched fraction (CMOF on barrier function of epithelial cell co-cultures of absorptive enterocytes (Caco-2 cells and mucus-secreting goblet cells (HT29-MTX cells, that more closely simulate the cell proportions found in the small (90:10 and large intestine (75:25. Treatment of epithelial co-cultures with 0.4, 1.0, 2.0 and 4.0 mg/mL of CMOF was shown to have no effect on metabolic activity but did enhance cell epithelial barrier integrity as measured by trans-epithelial electrical resistance (TEER, in a dose-dependent manner. The CMOF at the maximum concentration tested (4.0 mg/mL enhanced TEER, mucin gene expression and mucin protein abundance of epithelial co-cultures, all of which are essential components of intestinal barrier function.

  3. Diagnostic performance of ID screen MVV-CAEV Indirect Screening ELISA in identifying small ruminant lentiviruses-infected goats.

    Science.gov (United States)

    Nowicka, D; Czopowicz, M; Mickiewicz, M; Szaluś-Jordanow, O; Witkowski, L; Bagnicka, E; Kaba, J

    2014-01-01

    Diagnostic performance of ID Screen MVV-CAEV Indirect Screening ELISA in identifying goats infected with small ruminant lentiviruses (SRLV) was evaluated. In total 299 serum samples from the collection of the Laboratory of Veterinary Epidemiology and Economics--109 truly positive and 190 truly negative--were used. To be enrolled in the study a serum sample had to come from at least 2 year-old goat which had reacted identically in two serological surveys preceding sample collection and was kept in a herd of stable serological status confirmed at least twice during preceding 5 years. Moreover, in seropositive herds at least 20% of goats had to be serologically positive at the moment when the serum sample was collected for the study. The test proved to have high accuracy. Area under curve was 98.8% (95% CI: 97.5%, 100%). Diagnostic performance of the test was almost identical (Youlden's index of 90%, sensitivity > 90% and specificity > 95%) within a fairly wide range of cut-off values--between 20% and 60%. At manufacturer's cut-off of 50% sensitivity and specificity were 91.7% (95% CI: 85.0%, 95.6%) and 98.9% (95% CI: 96.2%, 99.7%), respectively. For this cut-off positive likelihood ratio was 87 (95% CI: 22, 346) and negative likelihood ratio was 0.08 (95% CI: 0.04, 0.16). In conclusion, the results of this study indicate that ID Screen MVV-CAEV Indirect Screening ELISA is a highly accurate diagnostic test for SRLV infection.

  4. Evolution of Specific Antibodies and Proviral DNA in Milk of Small Ruminants Infected by Small Ruminant Lentivirus

    Directory of Open Access Journals (Sweden)

    Ana Domenech

    2013-10-01

    Full Text Available The diagnosis of Small Ruminant Lentivirus (SRLV is based on clinical signs, pathological lesions and laboratory testing. No standard reference test for the diagnosis of maedi visna has been validated up to the present, and it is puzzling that tests which detect antibodies against the virus and tests which detect the proviral genome may render opposite results. The aim of this study was to evaluate the presence in milk throughout a lactation period of specific antibodies by ELISA and of SRLV proviral DNA by a PCR of the highly conserved pol region. A six-month study was conducted with the milk of 28 ewes and 31 goats intensively reared. The percentage of animals with antibodies against SRLV increased throughout the study period. Seroprevalence in sheep was 28% at the beginning of the study and by the end it had increased up to 52.4%. In goats, initial seroprevalence of 5.6% increased to 16%. The percentage of PCR positive ewes was stable throughout the study period. Of the positive sheep, 21.4% were PCR-positive before antibodies could be detected and most of them became PCR-negative shortly after the first detection of antibodies. This might suggest that antibodies have a neutralizing effect. In addition, an equal percentage of sheep were always PCR-negative but either became ELISA-positive or was always ELISA-positive, which might support this hypothesis. On the other hand, the PCR results in goats did not follow any pattern and oscillated between 35.3% and 55.6% depending on the month. Most goats positive by PCR failed to develop antibodies in the 6 months tested. We may conclude that the infection and the antibody response to it follow a different trend in sheep and goats.

  5. Bone marrow stem cells expressing keratinocyte growth factor via an inducible lentivirus protects against bleomycin-induced pulmonary fibrosis.

    Directory of Open Access Journals (Sweden)

    Susana Aguilar

    2009-11-01

    Full Text Available Many common diseases of the gas exchange surface of the lung have no specific treatment but cause serious morbidity and mortality. Idiopathic Pulmonary Fibrosis (IPF is characterized by alveolar epithelial cell injury, interstitial inflammation, fibroblast proliferation and collagen accumulation within the lung parenchyma. Keratinocyte Growth Factor (KGF, also known as FGF-7 is a critical mediator of pulmonary epithelial repair through stimulation of epithelial cell proliferation. During repair, the lung not only uses resident cells after injury but also recruits circulating bone marrow-derived cells (BMDC. Several groups have used Mesenchymal Stromal Cells (MSCs as therapeutic vectors, but little is known about the potential of Hematopoietic Stem cells (HSCs. Using an inducible lentiviral vector (Tet-On expressing KGF, we were able to efficiently transduce both MSCs and HSCs, and demonstrated that KGF expression is induced in a regulated manner both in vitro and in vivo. We used the in vivo bleomycin-induced lung fibrosis model to assess the potential therapeutic effect of MSCs and HSCs. While both populations reduced the collagen accumulation associated with bleomycin-induced lung fibrosis, only transplantation of transduced HSCs greatly attenuated the histological damage. Using double immunohistochemistry, we show that the reduced lung damage likely occurs through endogenous type II pneumocyte proliferation induced by KGF. Taken together, our data indicates that bone marrow transplantation of lentivirus-transduced HSCs can attenuate lung damage, and shows for the first time the potential of using an inducible Tet-On system for cell based gene therapy in the lung.

  6. Lentivirus-mediated knockdown of eukaryotic translation initiation factor 3 subunit D inhibits proliferation of HCT116 colon cancer cells.

    Science.gov (United States)

    Yu, Xiaojun; Zheng, Bo'an; Chai, Rui

    2014-12-12

    Dysregulation of protein synthesis is emerging as a major contributory factor in cancer development. eIF3D (eukaryotic translation initiation factor 3 subunit D) is one member of the eIF3 (eukaryotic translation initiation factor 3) family, which is essential for initiation of protein synthesis in eukaryotic cells. Acquaintance with eIF3D is little since it has been identified as a dispensable subunit of eIF3 complex. Recently, eIF3D was found to embed somatic mutations in human colorectal cancers, indicating its importance for tumour progression. To further probe into its action in colon cancer, we utilized lentivirus-mediated RNA interference to knock down eIF3D expression in one colon cancer cell line HCT116. Knockdown of eIF3D in HCT116 cells significantly inhibited cell proliferation and colony formation in vitro. Flow cytometry analysis indicated that depletion of eIF3D led to cell-cycle arrest in the G2/M phase, and induced an excess accumulation of HCT116 cells in the sub-G1 phase representing apoptotic cells. Signalling pathways responsible for cell growth and apoptosis have also been found altered after eIF3D silencing, such as AMPKα (AMP-activated protein kinase alpha), Bad, PRAS40 [proline-rich Akt (PKB) substrate of 40 kDa], SAPK (stress-activated protein kinase)/JNK (c-Jun N-terminal kinase), GSK3β and PARP [poly(ADP-ribose) polymerase]. Taken together, these findings suggest that eIF3D might play an important role in colon cancer progression.

  7. In vitro growth and maturation of isolated caprine preantral follicles: Influence of insulin and FSH concentration, culture dish, coculture, and oocyte size on meiotic resumption.

    Science.gov (United States)

    Silva, G M; Brito, I R; Sales, A D; Aguiar, F L N; Duarte, A B G; Araújo, V R; Vieira, L A; Magalhães-Padilha, D M; Lima, L F; Alves, B G; Silveira, L B R; Lo Turco, E G; Rodrigues, A P; Campello, C C; Wheeler, M B; Figueiredo, J R

    2017-03-01

    The aims of this study were: (1) to evaluate the effect of different insulin concentrations, alone or in combination with either a fixed FSH concentration or increasing FSH concentrations on the in vitro culture of isolated caprine preantral follicles and (2) to analyze the efficiency of two IVM media and maturation culture systems (with or without coculture with in vivo grown oocytes) on the meiosis resumption. Secondary follicles were cultured for 18 days in a basic medium supplemented with low- or high-insulin concentration alone or with a fixed FSH concentration or with increasing FSH concentrations. Oocytes grown in vivo or in vitro were matured alone or cocultured. The high-insulin concentration associated with fixed FSH treatment had higher meiotic resumption rate (P rates of germinal vesicle, germinal vesicle breakdown, metaphase I, metaphase II (MII), meiotic resumption, and oocyte diameter were similar between the maturation media. In conclusion, a basic medium supplemented with 10-μg/mL insulin and 100-μg/mL FSH throughout the culture period improved meiotic resumption rate and produced MII oocytes from caprine preantral follicles cultured in vitro. The MII rate was similar between in vivo and in vitro grown oocytes ≥110 μm. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Detection and quantification of bovine, ovine and caprine milk percentages in protected denomination of origin cheeses by reversed-phase high-performance liquid chromatography of beta-lactoglobulins.

    Science.gov (United States)

    Ferreira, Isabel M P L V O; Caçote, Helena

    2003-10-10

    A method for detecting and quantifying bovine, ovine and caprine milk mixtures in milk and cheeses by means of reversed-phase high-performance liquid chromatography (RP-HPLC) of beta-lactoglobulins is described. Gradient elution was carried out with a flow rate of 0.5 ml/min and a temperature of 45 degrees C, using a mixture of two solvents: solvent A (0.1% TFA in water) and solvent B (0.09% TFA in 80% aqueous acetonitrile, v/v). The effluent was monitored at 215 nm. Under the conditions used different chromatographic patterns were obtained for bovine, ovine and caprine whey proteins. Each milk type presented different retention times for beta-lactoglobulin peaks. Binary mixtures of bovine and ovine or bovine and caprine raw milks containing 1, 2, 5, 10, 20, 30, 50, 75 and 95% (v/v) of bovine milk, as well as ovine and caprine milk mixtures containing 1, 2, 5, 10, 20, 30, 50, 75 and 95% (v/v) of ovine milk were used for cheese making. Cheeses were prepared and ripened, according to traditional methods. Milk mixtures, fresh and ripened cheeses were analyzed. A linear relationship was established between log 10 of beta-lactoglobulin peaks ratio (calculated as peak area values ratio) and log 10 of the relative percentage of bovine or ovine milk. The ratio between beta-lactoglobulin peaks was not affected by the degree of ripening. Thus, enabling the quantification of milk type percentage, with a detection limit of 2%. This technique allowed quantification of milk species within the concentration range of 5-95%. The method was successfully applied for authenticity evaluation and quantitative determination of ovine and caprine milk percentages of commercial protected denomination of origin (PDO) cheeses.

  9. Development of a lentivirus vector-based assay for non-destructive monitoring of cell fusion activity.

    Directory of Open Access Journals (Sweden)

    Zeinab Neshati

    Full Text Available Cell-to-cell fusion can be quantified by endowing acceptor and donor cells with latent reporter genes/proteins and activators of these genes/proteins, respectively. One way to accomplish this goal is by using a bipartite lentivirus vector (LV-based cell fusion assay system in which the cellular fusion partners are transduced with a flippase-activatable Photinus pyralis luciferase (PpLuc expression unit (acceptor cells or with a recombinant gene encoding FLPeNLS+, a nuclear-targeted and molecularly evolved version of flippase (donor cells. Fusion of both cell populations will lead to the FLPe-dependent generation of a functional PpLuc gene. PpLuc activity is typically measured in cell lysates, precluding consecutive analysis of one cell culture. Therefore, in this study the PpLuc-coding sequence was replaced by that of Gaussia princeps luciferase (GpLuc, a secretory protein allowing repeated analysis of the same cell culture. In myotubes the spread of FLPeNLS+ may be limited due to its nuclear localization signal (NLS causing low signal outputs. To test this hypothesis, myoblasts were transduced with LVs encoding either FLPeNLS+ or an NLS-less version of FLPe (FLPeNLS- and subsequently co-cultured in different ratios with myoblasts containing the FLPe-activatable GpLuc expression cassette. At different times after induction of cell-to-cell fusion the GpLuc activity in the culture medium was determined. FLPeNLS+ and FLPeNLS- both activated the latent GpLuc gene but when the percentage of FLPe-expressing myoblasts was limiting, FLPeNLS+ generally yielded slightly higher signals than FLPeNLS- while at low acceptor-to-donor cell ratios FLPeNLS- was usually superior. The ability of FLPeNLS+ to spread through myofibers and to induce reporter gene expression is thus not limited by its NLS. However, at high FLPe concentrations the presence of the NLS negatively affected reporter gene expression. In summary, a rapid and simple chemiluminescence assay for

  10. Genome-wide association identifies multiple genomic regions associated with susceptibility to and control of ovine lentivirus.

    Directory of Open Access Journals (Sweden)

    Stephen N White

    Full Text Available BACKGROUND: Like human immunodeficiency virus (HIV, ovine lentivirus (OvLV is macrophage-tropic and causes lifelong infection. OvLV infects one quarter of U.S. sheep and induces pneumonia and body condition wasting. There is no vaccine to prevent OvLV infection and no cost-effective treatment for infected animals. However, breed differences in prevalence and proviral concentration have indicated a genetic basis for susceptibility to OvLV. A recent study identified TMEM154 variants in OvLV susceptibility. The objective here was to identify additional loci associated with odds and/or control of OvLV infection. METHODOLOGY/PRINCIPAL FINDINGS: This genome-wide association study (GWAS included 964 sheep from Rambouillet, Polypay, and Columbia breeds with serological status and proviral concentration phenotypes. Analytic models accounted for breed and age, as well as genotype. This approach identified TMEM154 (nominal P=9.2×10(-7; empirical P=0.13, provided 12 additional genomic regions associated with odds of infection, and provided 13 regions associated with control of infection (all nominal P<1 × 10(-5. Rapid decline of linkage disequilibrium with distance suggested many regions included few genes each. Genes in regions associated with odds of infection included DPPA2/DPPA4 (empirical P=0.006, and SYTL3 (P=0.051. Genes in regions associated with control of infection included a zinc finger cluster (ZNF192, ZSCAN16, ZNF389, and ZNF165; P=0.001, C19orf42/TMEM38A (P=0.047, and DLGAP1 (P=0.092. CONCLUSIONS/SIGNIFICANCE: These associations provide targets for mutation discovery in sheep susceptibility to OvLV. Aside from TMEM154, these genes have not been associated previously with lentiviral infection in any species, to our knowledge. Further, data from other species suggest functional hypotheses for future testing of these genes in OvLV and other lentiviral infections. Specifically, SYTL3 binds and may regulate RAB27A, which is required for enveloped

  11. A new approach for studying prehistoric herd management in arid areas: intra-tooth isotopic analyses of archaeological caprine from IranUne nouvelle approche pour l'étude de la gestion préhistorique des troupeaux en zones arides: analyses isotopiques intra-dentaires de caprinés archéologiques d'Iran

    Science.gov (United States)

    Bocherens, Hervé; Mashkour, Marjan; Billiou, Daniel; Pellé, Eric; Mariotti, André

    2001-01-01

    Carbon and oxygen isotopic variations in archaeological tooth enamel from Iran have been used to investigate prehistoric herd management. Oxygen isotopic variations in domestic caprines are more important than in wild equids, indicating a seasonal consumption of 18O-depleted drinking water. Since the plants consumed at the same time were partly C 4, it is presumed that the access to this 18O-depleted water was controlled by humans, and that the water came from wells or underground canalisations. This methodology is expected to provide valuable information on herd management in the past in arid areas.

  12. Caprine and ovine Greek dairy products: The official German method generates false-positive results due to κ-casein gene polymorphism.

    Science.gov (United States)

    Tsartsianidou, V; Triantafillidou, D; Karaiskou, N; Tarantili, P; Triantafillidis, G; Georgakis, E; Triantafyllidis, A

    2017-05-01

    Caseins are widely used for species identification of dairy products. Isoelectric focusing (IEF) of para-κ-casein peptide is used as the official German method for the differentiation between caprine (isoform A) and ovine (isoform B) dairy products, based on their different isoelectric points. The discrimination between Greek goat and ewe dairy products using IEF has, however, been shown to be problematic because of the existence of the ewe isoform in milk from Greek indigenous dairy goats. This could be due to nucleotide polymorphisms within the goat κ-casein gene of Greek indigenous breeds, which alter the isoelectric point of the para-κ-casein peptide and lead to false positive results. Previous DNA analysis of the goat κ-casein gene has shown high levels of polymorphism; however, no such information is available for Greek indigenous dairy goats. Therefore, 87 indigenous dairy goats were sequenced at exon IV of κ-casein gene. In total, 9 polymorphic sites were detected. Three nonsynonymous point mutations were identified, which change the isoelectric point of the goat para-κ-casein peptide so that it appears identical to that of the ewe peptide. Ten composite genotypes were reconstructed and 6 of them included the problematic point mutations. For the verification of genetic results, IEF was carried out. Both goat and ewe patterns appeared in the problematic genotypes. The frequency of these genotypes could be characterized as moderate (0.23) to high (0.60) within Greek indigenous breeds. However, this is not an issue restricted to Greece, as such genotypes have been detected in various non-Greek goat breeds. In conclusion, IEF based on the official German method is certainly inappropriate for ovine and caprine discrimination concerning Greek dairy goat products, and consequently a new method should be established. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Suppression of HLA expression by lentivirus-mediated gene transfer of siRNA cassettes and in vivo chemoselection to enhance hematopoietic stem cell transplantation.

    Science.gov (United States)

    Hacke, Katrin; Falahati, Rustom; Flebbe-Rehwaldt, Linda; Kasahara, Noriyuki; Gaensler, Karin M L

    2009-01-01

    Current approaches for hematopoietic stem cell (HSC) and organ transplantation are limited by donor and host-mediated immune responses to allo-antigens. Application of these therapies is limited by the toxicity of preparative and post-transplant immunosuppressive regimens and a shortage of appropriate HLA-matched donors. We have been exploring two complementary approaches for genetically modifying donor cells that achieve long-term suppression of cellular proteins that elicit host immune responses to mismatched donor antigens, and provide a selective advantage to genetically engineered donor cells after transplantation. The first approach is based on recent advances that make feasible targeted down-regulation of HLA expression. Suppression of HLA expression could help to overcome limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors. Accordingly, we have recently investigated whether knockdown of HLA by RNA interference (RNAi) enables allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors that integrate into genomic DNA, thereby permanently modifying transduced donor cells. Lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA achieved efficient and dose-dependent reduction in surface expression of HLA in human cells, and enhanced resistance to allo-reactive T lymphocyte-mediated cytotoxicity, while avoiding non-MHC restricted killing. Complementary strategies for genetic engineering of HSC that would provide a selective advantage for transplanted donor cells and enable successful engraftment with less toxic preparative and immunosuppressive regimens would increase the numbers of individuals to whom HLA suppression therapy could be offered. Our second strategy is to provide a mechanism for in vivo selection of genetically modified HSC and other donor cells. We have

  14. The interferon-induced antiviral protein PML (TRIM19) promotes the restriction and transcriptional silencing of lentiviruses in a context-specific, isoform-specific fashion.

    Science.gov (United States)

    Masroori, Nasser; Merindol, Natacha; Berthoux, Lionel

    2016-03-22

    The promyelocytic leukemia (PML) protein, a type I interferon (IFN-I)-induced gene product and a member of the tripartite motif (TRIM) family, modulates the transcriptional activity of viruses belonging to various families. Whether PML has an impact on the replication of HIV-1 has not been fully addressed, but recent studies point to its possible involvement in the restriction of HIV-1 in human cells and in the maintenance of transcriptional latency in human cell lines in which HIV-1 is constitutively repressed. We investigated further the restriction of HIV-1 and a related lentivirus, SIVmac, by PML in murine cells and in a lymphocytic human cell line. In particular, we studied the relevance of PML to IFN-I-mediated inhibition and the role of individual human isoforms. We demonstrate that both human PML (hPML) and murine PML (mPML) inhibit the early post-entry stages of the replication of HIV-1 and a related lentivirus, SIVmac. In addition, HIV-1 was transcriptionally silenced by mPML and by hPML isoforms I, II, IV and VI in MEFs. This PML-mediated transcriptional repression was attenuated in presence of the histone deacetylase inhibitor SAHA. In contrast, depletion of PML had no effect on HIV-1 gene expression in a human T cell line. PML was found to contribute to the inhibition of HIV-1 by IFN-I. Specifically, IFN-α and IFN-β treatments of MEFs enhanced the PML-dependent inhibition of HIV-1 early replication stages. We show that PML can inhibit HIV-1 and other lentiviruses as part of the IFN-I-mediated response. The restriction takes place at two distinct steps, i.e. reverse transcription and transcription, and in an isoform-specific, cellular context-specific fashion. Our results support a model in which PML activates innate immune antilentiviral effectors. These data are relevant to the development of latency reversal-inducing pharmacological agents, since PML was previously proposed as a pharmacological target for such inhibitors. This study also has

  15. Resistance of Major Histocompatibility Complex Class B (MHC-B) to Nef-Mediated Downregulation Relative to that of MHC-A Is Conserved among Primate Lentiviruses and Influences Antiviral T Cell Responses in HIV-1-Infected Individuals.

    Science.gov (United States)

    Mwimanzi, Francis; Toyoda, Mako; Mahiti, Macdonald; Mann, Jaclyn K; Martin, Jeffrey N; Bangsberg, David; Brockman, Mark A; Goulder, Philip; Kirchhoff, Frank; Brumme, Zabrina L; Ndung'u, Thumbi; Ueno, Takamasa

    2018-01-01

    Patient-derived HIV-1 subtype B Nef clones downregulate HLA-A more efficiently than HLA-B. However, it remains unknown whether this property is common to Nef proteins across primate lentiviruses and how antiviral immune responses may be affected. We examined 263 Nef clones from diverse primate lentiviruses including different pandemic HIV-1 group M subtypes for their ability to downregulate major histocompatibility complex class A (MHC-A) and MHC-B from the cell surface. Though lentiviral Nef proteins differed markedly in their absolute MHC-A and MHC-B downregulation abilities, all lentiviral Nef lineages downregulated MHC-A, on average, 11 to 32% more efficiently than MHC-B. Nef genotype/phenotype analyses in a cohort of HIV-1 subtype C-infected patients ( n = 168), together with site-directed mutagenesis, revealed Nef position 9 as a subtype-specific determinant of differential HLA-A versus HLA-B downregulation activity. Nef clones harboring nonconsensus variants at codon 9 downregulated HLA-B (though not HLA-A) significantly better than those harboring the consensus sequence at this site, resulting in reduced recognition of infected target cells by HIV-1-specific CD8 + effector cells in vitro Among persons expressing protective HLA class I alleles, carriage of Nef codon 9 variants was also associated with reduced ex vivo HIV-specific T cell responses. Our results demonstrate that Nef's inferior ability to downregulate MHC-B compared to that of MHC-A is conserved across primate lentiviruses and suggest that this property influences antiviral cellular immune responses. IMPORTANCE Primate lentiviruses encode the Nef protein that plays an essential role in establishing persistent infection in their respective host species. Nef interacts with the cytoplasmic region of MHC-A and MHC-B molecules and downregulates them from the infected cell surface to escape recognition by host cellular immunity. Using a panel of Nef alleles isolated from diverse primate lentiviruses

  16. Whole genome analysis of selected human and animal rotaviruses identified in Uganda from 2012 to 2014 reveals complex genome reassortment events between human, bovine, caprine and porcine strains.

    Directory of Open Access Journals (Sweden)

    Josephine Bwogi

    Full Text Available Rotaviruses of species A (RVA are a common cause of diarrhoea in children and the young of various other mammals and birds worldwide. To investigate possible interspecies transmission of RVAs, whole genomes of 18 human and 6 domestic animal RVA strains identified in Uganda between 2012 and 2014 were sequenced using the Illumina HiSeq platform. The backbone of the human RVA strains had either a Wa- or a DS-1-like genetic constellation. One human strain was a Wa-like mono-reassortant containing a DS-1-like VP2 gene of possible animal origin. All eleven genes of one bovine RVA strain were closely related to those of human RVAs. One caprine strain had a mixed genotype backbone, suggesting that it emerged from multiple reassortment events involving different host species. The porcine RVA strains had mixed genotype backbones with possible multiple reassortant events with strains of human and bovine origin.Overall, whole genome characterisation of rotaviruses found in domestic animals in Uganda strongly suggested the presence of human-to animal RVA transmission, with concomitant circulation of multi-reassortant strains potentially derived from complex interspecies transmission events. However, whole genome data from the human RVA strains causing moderate and severe diarrhoea in under-fives in Uganda indicated that they were primarily transmitted from person-to-person.

  17. Staphylococcus aureus from 152 cases of bovine, ovine and caprine mastitis investigated by Multiple-locus variable number of tandem repeat analysis (MLVA).

    Science.gov (United States)

    Bergonier, Dominique; Sobral, Daniel; Feßler, Andrea T; Jacquet, Eric; Gilbert, Florence B; Schwarz, Stefan; Treilles, Michaël; Bouloc, Philippe; Pourcel, Christine; Vergnaud, Gilles

    2014-10-02

    Staphylococcus aureus is one of the main etiological agents of mastitis in ruminants. In the present retrospective study, we evaluated the potential interest of a previously described automated multiple loci Variable Number of Tandem Repeats (VNTR) Assay (MLVA) comprising 16 loci as a first line tool to investigate the population structure of S. aureus from mastitis. We determined the genetic diversity of S. aureus strains from cases of clinical and subclinical mastitis in dairy cattle (n = 118, of which 16 were methicillin-resistant), sheep (n = 18) and goats (n = 16). The 152 strains could be subdivided into 115 MLVA genotypes (including 14 genotypes for the ovine strains and 15 genotypes for the caprine strains). This corresponds to a discriminatory index (D) value of 0.9936. Comparison with published MLVA data obtained using the same protocol applied to strains from diverse human and animal origins revealed a low number (8.5%) of human-related MLVA genotypes among the present collection. Eighteen percent of the S. aureus mastitis collection belonged to clonal complexes apparently not associated with other pathological conditions. Some of them displayed a relatively low level of diversity in agreement with a restricted ecological niche. These findings provide arguments suggesting that specific S. aureus lineages particularly adapted to ruminant mammary glands have emerged and that MLVA is a convenient tool to provide a broad overview of the population, owing to the availability via internet of databases compiling published MLVA genotypes.

  18. Detection of Chlamydophila (Chlamydia) abortus and Toxoplasma gondii in smears from cases of ovine and caprine abortion by the streptavidin-biotin method.

    Science.gov (United States)

    Szeredi, L; Bacsadi, A

    2002-11-01

    Fetal membranes from 59 cases of ovine and six of caprine abortion from a total of 52 flocks or herds were collected. Immunohistochemical examination of cotyledons fixed in formalin and embedded in paraffin wax detected Chlamydophila abortus in 44 (68%) cases. Immunocytochemical examination of smears made from the surface of fetal membranes detected the organism in 37 (57%) cases. Light microscopical examination of such smears stained by Stamp's method detected C. abortus in 26 (40%) cases. The streptavidin-biotin method described proved to have 100% specificity and 84% sensitivity in the detection of C. abortus in cotyledon smears. Sensitivity could probably be increased still further by the simultaneous examination of smears made from the cut surface of several cotyledons. In five cases Toxoplasma gondii was detected in the cotyledons by immunohistochemical examination. In three of these cases the presence of T. gondii was revealed also by immunocytological examination. In four cases, simultaneous C. abortus and T. gondii infection of the cotyledons was observed. The two pathogens and the lesions caused by them occurred in separate locations. Copyright 2002 Elsevier Science Ltd.

  19. The RNA-binding proteins FMR1, rasputin and caprin act together with the UBA protein lingerer to restrict tissue growth in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Roland Baumgartner

    Full Text Available Appropriate expression of growth-regulatory genes is essential to ensure normal animal development and to prevent diseases like cancer. Gene regulation at the levels of transcription and translational initiation mediated by the Hippo and Insulin signaling pathways and by the TORC1 complex, respectively, has been well documented. Whether translational control mediated by RNA-binding proteins contributes to the regulation of cellular growth is less clear. Here, we identify Lingerer (Lig, an UBA domain-containing protein, as growth suppressor that associates with the RNA-binding proteins Fragile X mental retardation protein 1 (FMR1 and Caprin (Capr and directly interacts with and regulates the RNA-binding protein Rasputin (Rin in Drosophila melanogaster. lig mutant organs overgrow due to increased proliferation, and a reporter for the JAK/STAT signaling pathway is upregulated in a lig mutant situation. rin, Capr or FMR1 in combination as double mutants, but not the respective single mutants, display lig like phenotypes, implicating a redundant function of Rin, Capr and FMR1 in growth control in epithelial tissues. Thus, Lig regulates cell proliferation during development in concert with Rin, Capr and FMR1.

  20. The RNA-binding proteins FMR1, rasputin and caprin act together with the UBA protein lingerer to restrict tissue growth in Drosophila melanogaster.

    Science.gov (United States)

    Baumgartner, Roland; Stocker, Hugo; Hafen, Ernst

    2013-01-01

    Appropriate expression of growth-regulatory genes is essential to ensure normal animal development and to prevent diseases like cancer. Gene regulation at the levels of transcription and translational initiation mediated by the Hippo and Insulin signaling pathways and by the TORC1 complex, respectively, has been well documented. Whether translational control mediated by RNA-binding proteins contributes to the regulation of cellular growth is less clear. Here, we identify Lingerer (Lig), an UBA domain-containing protein, as growth suppressor that associates with the RNA-binding proteins Fragile X mental retardation protein 1 (FMR1) and Caprin (Capr) and directly interacts with and regulates the RNA-binding protein Rasputin (Rin) in Drosophila melanogaster. lig mutant organs overgrow due to increased proliferation, and a reporter for the JAK/STAT signaling pathway is upregulated in a lig mutant situation. rin, Capr or FMR1 in combination as double mutants, but not the respective single mutants, display lig like phenotypes, implicating a redundant function of Rin, Capr and FMR1 in growth control in epithelial tissues. Thus, Lig regulates cell proliferation during development in concert with Rin, Capr and FMR1.

  1. Bovine and Caprine Brucellosis in Bangladesh: Bayesian evaluation of four serological tests, true prevalence, and associated risk factors in household animals.

    Science.gov (United States)

    Ahasan, Md Shamim; Rahman, Md Siddiqur; Rahman, A K M Anisur; Berkvens, Dirk

    2017-01-01

    A cross-sectional study was carried out to estimate the true prevalence of Brucella spp. and identify allied risk factors/indicators associated with brucellosis in the Dinajpur and Mymensingh districts of Bangladesh. A total 320 stratified random blood samples were collected and tested in parallel for Brucella antibodies using Rose Bengal (RBT), slow agglutination (SAT), and indirect and competitive ELISA. In addition, a structured questionnaire was administered to each household herd owner to gather information regarding potential risk factors. Both univariate and multivariate logistic regression analyses were used to identify potential risk factors or indicators at animal level. A Bayesian approach was used to estimate the true prevalence of brucellosis along with the test performances (Se and Sp). The estimated animal level true prevalence in cattle was 9.70 % (95 % CPI 5.0-16 %) and in goat 6.3 % (95 % CPI 2.8-11.0 %). The highest sensitivity was achieved by SAT ranges from 69.6 to 78.9 %, and iELISA was found to be more specific (97.4 to 98.8 %) in comparison with other tests. On the other hand, a significant level of (P tests can be recommended to apply alone for the diagnosis of bovine and caprine brucellosis.

  2. Whole genome analysis of selected human and animal rotaviruses identified in Uganda from 2012 to 2014 reveals complex genome reassortment events between human, bovine, caprine and porcine strains.

    Science.gov (United States)

    Bwogi, Josephine; Jere, Khuzwayo C; Karamagi, Charles; Byarugaba, Denis K; Namuwulya, Prossy; Baliraine, Frederick N; Desselberger, Ulrich; Iturriza-Gomara, Miren

    2017-01-01

    Rotaviruses of species A (RVA) are a common cause of diarrhoea in children and the young of various other mammals and birds worldwide. To investigate possible interspecies transmission of RVAs, whole genomes of 18 human and 6 domestic animal RVA strains identified in Uganda between 2012 and 2014 were sequenced using the Illumina HiSeq platform. The backbone of the human RVA strains had either a Wa- or a DS-1-like genetic constellation. One human strain was a Wa-like mono-reassortant containing a DS-1-like VP2 gene of possible animal origin. All eleven genes of one bovine RVA strain were closely related to those of human RVAs. One caprine strain had a mixed genotype backbone, suggesting that it emerged from multiple reassortment events involving different host species. The porcine RVA strains had mixed genotype backbones with possible multiple reassortant events with strains of human and bovine origin.Overall, whole genome characterisation of rotaviruses found in domestic animals in Uganda strongly suggested the presence of human-to animal RVA transmission, with concomitant circulation of multi-reassortant strains potentially derived from complex interspecies transmission events. However, whole genome data from the human RVA strains causing moderate and severe diarrhoea in under-fives in Uganda indicated that they were primarily transmitted from person-to-person.

  3. Immobilized Lentivirus Vector on Chondroitin Sulfate-Hyaluronate Acid-Silk Fibroin Hybrid Scaffold for Tissue-Engineered Ligament-Bone Junction

    Directory of Open Access Journals (Sweden)

    Liguo Sun

    2014-01-01

    Full Text Available The lack of a fibrocartilage layer between graft and bone remains the leading cause of graft failure after anterior cruciate ligament (ACL reconstruction. The objective of this study was to develop a gene-modified silk cable-reinforced chondroitin sulfate-hyaluronate acid-silk fibroin (CHS hybrid scaffold for reconstructing the fibrocartilage layer. The scaffold was fabricated by lyophilizing the CHS mixture with braided silk cables. The scanning electronic microscopy (SEM showed that microporous CHS sponges were formed around silk cables. Each end of scaffold was modified with lentiviral-mediated transforming growth factor-β3 (TGF-β3 gene. The cells on scaffold were transfected by bonded lentivirus. In vitro culture demonstrated that mesenchymal stem cells (MSCs on scaffolds proliferated vigorously and produced abundant collagen. The transcription levels of cartilage-specific genes also increased with culture time. After 2 weeks, the MSCs were distributed uniformly throughout scaffold. Deposited collagen was also found to increase. The chondral differentiation of MSCs was verified by expressions of collagen II and TGF-β3 genes in mRNA and protein level. Histology also confirmed the production of cartilage extracellular matrix (ECM components. The results demonstrated that gene-modified silk cable-reinforced CHS scaffold was capable of supporting cell proliferation and differentiation to reconstruct the cartilage layer of interface.

  4. Regression of established renal cell carcinoma in nude mice using lentivirus-transduced human T cells expressing a human anti-CAIX chimeric antigen receptor

    Directory of Open Access Journals (Sweden)

    Agnes Shuk-Yee Lo

    2014-01-01

    Full Text Available Carbonic anhydrase IX (CAIX is a tumor-associated antigen and marker of hypoxia that is overexpressed on > 90% of clear-cell type renal cell carcinoma (RCC but not on neighboring normal kidney tissue. Here, we report on the construction of two chimeric antigen receptors (CARs that utilize a carbonic anhydrase (CA domain mapped, human single chain antibody (scFv G36 as a targeting moiety but differ in their capacity to provide costimulatory signaling for optimal T cell proliferation and tumor cell killing. The resulting anti-CAIX CARs were expressed on human primary T cells via lentivirus transduction. CAR-transduced T cells (CART cells expressing second-generation G36-CD28-TCRζ exhibited more potent in vitro antitumor effects on CAIX+ RCC cells than first-generation G36-CD8-TCRζ including cytotoxicity, cytokine secretion, proliferation, and clonal expansion. Adoptive G36-CD28-TCRζ CART cell therapy combined with high-dose interleukin (IL-2 injection also lead to superior regression of established RCC in nude mice with evidence of tumor cell apoptosis and tissue necrosis. These results suggest that the fully human G36-CD28-TCRζ CARs should provide substantial improvements over first-generation mouse anti-CAIX CARs in clinical use through reduced human anti-mouse antibody responses against the targeting scFv and administration of lower doses of T cells during CART cell therapy of CAIX+ RCC.

  5. The downregulation of CD4 and MHC-I by primate lentiviruses: a paradigm for the modulation of cell surface receptors.

    Science.gov (United States)

    Piguet, V; Schwartz, O; Le Gall, S; Trono, D

    1999-04-01

    The human and simian immunodeficiency viruses (HIV and SIV) downregulate the cell surface expression of CD4, their primary receptor, and of class I histocompatibility complex (MHC-I), a critical mediator of immune recognition. While the first of these effects seems important to preserve viral infectivity, the second likely promotes immune evasion. Three HIV-1 proteins, Nef, Env and Vpu, contribute to downregulate CD4, Env forms a complex with CD4 in the endoplasmic reticulum, thereby retaining the receptor in this compartment. Nef and Vpu, on the other hand, act as connectors between CD4 and specific intracellular trafficking pathways, targeting the receptor for degradation in the lysosome and the proteasome, respectively. Some of the downstream partners of the viral proteins in these events have been identified, and include the adaptor complex of clathrin-coated pits, the beta subunit of COP-I coatomer, and the ubiquitin pathway-related h-beta TrCP protein. HIV-induced MHC-I downregulation, mostly the effect of Nef, also reflects a redistribution of this receptor, with its accumulation in the Golgi. The modalities of this process, however, are as yet imperfectly understood. New evidence indicates that the mechanisms employed by primate lentiviruses to downmodulate CD4 and MHC-I are also exploited by a number of cellular regulatory processes.

  6. Compostagem e vermicompostagem de dejetos de caprinos: efeito das estações do ano Composting and vermicomposting caprine dejections: effect of season

    Directory of Open Access Journals (Sweden)

    Ana C. Amorim

    2005-04-01

    Full Text Available A caprinocultura brasileira cresceu consideravelmente nos últimos anos, elevando a produção de resíduos, fato que justifica o estudo de práticas de reciclagem, tais como a compostagem e a vermicompostagem, pois, além da agregação de valor com a produção do composto, representa um meio de saneamento na área rural. Para o desenvolvimento deste trabalho, foram utilizados dejetos coletados de caprinos em diferentes faixas etárias, mantidos em sistema de semiconfinamento e com regime alimentar único. O objetivo principal foi avaliar os efeitos das estações do ano sobre os processos de compostagem e vermicompostagem. As reduções na quantidade de matéria seca (MS foram de 53,7; 53,4; 51,4 e 47,8% para a compostagem e 57,4; 51,0; 41,4 e 53,6% para a vermicompostagem nas estações de verão, outono, inverno e primavera, respectivamente. Observaram-se maiores reduções na relação C/N durante o verão e outono, em relação à primavera e ao inverno, para ambos os processos. As equações de redução de volume, na compostagem, foram: y = -0,0512x + 1,0233; y = -0,0552x + 1,1766; y = -0,0521x + 1,1656 e y = -0,0558x + 1,3227, para as estações primavera, outono, inverno e verão, respectivamente, (x = número de semanas e y = volume, em m³.Brazilian caprine raising has grown considerably in the last years and has elevated the waste production, what justifies the study of recycling practices of composting and vemicomposting because their aggregation values with the fertilizers production, and also represent a sanitation way in the rural zone. In this study, caprines of different ages, maintained in semi confinement system and with the same diet feeding were used. The main objective was evaluating the effect of the season on the composting and vermicomposting process. The dry matter reduction was of 53.7; 53.4; 51.4 and 47.8% for composting process and 57.4; 51.0; 41.4 and 53.6% for vermicomposting in Summer, Autumn, Winter and Spring

  7. Impacts de croisement d’absorption sur l'élevage caprin dans le sud tunisien : cas de la délégation de Mareth

    Directory of Open Access Journals (Sweden)

    Amor Gaddour

    2012-12-01

    Full Text Available L’importance particulière de la chèvre locale, en tant que ressource génétique indispensable pour la valorisation des parcours des régions arides, incite à déployer des efforts pour sa caractérisation et la mise au point de méthodologies de son amélioration génétique. La présente étude vise l'établissement des caractéristiques phénotypiques et génétiques de la population caprine locale ainsi que sa diversité biologique et ses aptitudes adaptatives. On se propose d’évaluer le comportement génétique et productif de la chèvre locale dans un schéma d’amélioration génétique. Au niveau des élevages, le croisement a été appliqué sans restrictions techniques de manière à générer un amalgame génétique dans les différents modes de production. C'est pourquoi nous avons exécuté une enquête aux prés de 85 éleveurs caprins de la délégation de Mareth, où le croisement est adopté dans les différents systèmes d'élevage. Les résultats montrent que la conduite n'est pas suffisamment maîtrisée, même en intensif, pour profiter des avantages de croisement. A cet égard la conduite des reproducteurs et le renouvellement ne considèrent pas les spécificités des génotypes, comme le saisonnement sexuel et les risques de la consanguinité. Certaines exigences génétiques, tel que l'abattage des mâles F1, ne sont que peu connues et respectées par les éleveurs ce qui entrave l'optimisation des ressources génétiques disponibles. La tendance générale est l'usage des races à viande comme races amélioratrices ce qui s'illustre par le choix accru de la race Damasquine. Mots clés : chèvre locale ; amélioration génétique ; impact de croisement ; races amélioratrices ; enquête ; oasis ; Tunisie.

  8. Analysis of microRNAs Expression Profiles in Madin-Darby Bovine Kidney Cells Infected With Caprine Parainfluenza Virus Type 3

    Directory of Open Access Journals (Sweden)

    Jizong Li

    2018-03-01

    Full Text Available Caprine parainfluenza virus type 3 (CPIV3 is a newly emerging pathogenic respiratory agent infecting both young and adult goats, and it was identified in eastern China in 2013. Cellular microRNAs (miRNAs have been reported to be important modulators of the intricate virus-host interactions. In order to elucidate the role of miRNAs in madin-darby bovine kidney (MDBK cells during CPIV3 infection. In this study, we performed high-throughput sequencing technology to analyze small RNA libraries in CPIV3-infected and mock-infected MDBK cells. The results showed that a total of 249 known and 152 novel candidate miRNAs were differentially expressed in MDBK cells after CPIV3 infection, and 22,981 and 22,572 target genes were predicted, respectively. In addition, RT-qPCR assay was used to further confirm the expression patterns of 13 of these differentially expressed miRNAs and their mRNA targets. Functional annotation analysis showed these up- and downregulated target genes were mainly involved in MAPK signaling pathway, Jak-STAT signaling pathway, Toll-like receptor signaling pathway, p53 signaling pathway, focal adhesion, NF-kappa B signaling pathway, and apoptosis, et al. To our knowledge, this is the first report of the comparative expression of miRNAs in MDBK cells after CPIV3 infection. Our finding provides information concerning miRNAs expression profile in response to CPIV3 infection, and offers clues for identifying potential candidates for antiviral therapies against CPIV3.

  9. Genetic variants and effects on milk traits of the caprine paired-like homeodomain transcription factor 2 (PITX2) gene in dairy goats.

    Science.gov (United States)

    Zhao, Haiyu; Wu, Xianfeng; Cai, Hanfang; Pan, Chuanying; Lei, Chuzhao; Chen, Hong; Lan, Xianyong

    2013-12-15

    The paired-like homeodomain transcription factor 2 (PITX2) gene plays a critical role in cell proliferation, differentiation, hematopoiesis and organogenesis. This gene regulates several genes' expressions in the Wnt/beta-catenin and POU1F1 pathways, thereby probably affecting milk performance. The goal of this study was to characterize the genetic variants of the PITX2 gene and test their associations with milk traits in dairy goats. Herein, four novel single nucleotide polymorphisms (SNPs), AC_000163:g.18117T>C, g.18161C>G, g.18322C>A and g.18353T>C, within the caprine PITX2 gene, were found in two famous Chinese dairy goat breeds. These SNPs mapping at Cys28Arg, Pro42Pro, IVS1+79C>A and IVS1+110T>C, were genotyped by the MvaI, SmaI, MspI and RsaI aCRS-RFLP or PCR-RFLP methods, respectively. Accordingly, two main haplotypes (CGCT and CGCC) were identified among the specimens. Association testing revealed that the SmaI and RsaI polymorphisms were significantly associated with the milk fat content, milk lactose content and milk density (PPITX2 gene had the significant effects on milk traits. Hence, the RsaI and SmaI loci could be regarded as two DNA markers for selecting superior milk performance in dairy goats. These preliminary findings not only would extend the spectrum of genetic variation of the goat PITX2 gene, but also would contribute to implementing marker-assisted selection (MAS) in breeding and genetics in dairy goats. © 2013.

  10. Clinical protection against caprine herpesvirus 1 genital infection by intranasal administration of a live attenuated glycoprotein E negative bovine herpesvirus 1 vaccine

    Directory of Open Access Journals (Sweden)

    Meurens François

    2007-12-01

    Full Text Available Abstract Background Caprine herpesvirus 1 (CpHV-1 is responsible of systemic diseases in kids and genital diseases leading to abortions in goats. CpHV-1 is widespread and especially in Mediterranean countries as Greece, Italy and Spain. CpHV-1 is antigenically and genetically closely related to bovine herpesvirus 1 (BoHV-1. Taking into account the biological properties shared by these two viruses, we decided in the current study to assess the protection of a live attenuated glycoprotein E (gE negative BoHV-1 vaccine against a genital CpHV-1 infection in goats. Results The vaccine was inoculated intranasally twice three weeks apart followed by a subsequent CpHV-1 intravaginal challenge which is the natural route of infection in three goats. To analyse the safety and the efficacy of this marker vaccine, two groups of three goats served as controls: one immunised with a virulent CpHV-1 and one uninoculated until the challenge. Goats were clinically monitored and all sampling procedures were carried out in a blind manner. The vaccine did not induce any undesirable local or systemic reaction and goats did not excrete gE-negative BoHV-1. After challenge, a significant reduction in disease severity was observed in immunised goats. Moreover, goats immunised with either gE-negative BoHV-1 or CpHV-1 exhibited a significant reduction in the length and the peak of viral excretion. Antibodies neutralising both BoHV-1 and CpHV-1 were raised in immunised goats. Conclusion Intranasal application of a live attenuated gE-negative BoHV-1 vaccine is able to afford a clinical protection and a reduction of virus excretion in goats challenged by a CpHV-1 genital infection.

  11. Two Different Macaviruses, ovine herpesvirus-2 and caprine herpesvirus-2, behave differently in water buffaloes than in cattle or in their respective reservoir species.

    Directory of Open Access Journals (Sweden)

    Anina B J Stahel

    Full Text Available The ongoing global spread of "exotic" farm animals, such as water buffaloes, which carry their native sets of viruses, may bear unknown risks for the animals, into whose ecological niches the former are introduced and vice versa. Here, we report on the occurrence of malignant catarrhal fever (MCF on Swiss farms, where "exotic" water buffaloes were kept together with "native" animals, i.e. cattle, sheep, and goats. In the first farm with 56 water buffaloes, eight cases of MCF due to ovine herpesvirus-2 (OvHV-2 were noted, whereas additional ten water buffaloes were subclinically infected with either OvHV-2 or caprine herpesvirus-2 (CpHV-2. On the second farm, 13 water buffaloes were infected with CpHV-2 and two of those succumbed to MCF. In neither farm, any of the two viruses were detected in cattle, but the Macaviruses were present at high prevalence among their original host species, sheep and goats, respectively. On the third farm, sheep were kept well separated from water buffaloes and OvHV-2 was not transmitted to the buffaloes, despite of high prevalence of the virus among the sheep. Macavirus DNA was frequently detected in the nasal secretions of virus-positive animals and in one instance OvHV-2 was transmitted vertically to an unborn water buffalo calf. Thus, water buffaloes seem to be more susceptible than cattle to infection with either Macavirus; however, MCF did not develop as frequently. Therefore, water buffaloes seem to represent an interesting intermediate-type host for Macaviruses. Consequently, water buffaloes in their native, tropic environments may be vulnerable and endangered to viruses that originate from seemingly healthy, imported sheep and goats.

  12. A caprine herpesvirus 1 vaccine adjuvanted with MF59™ protects against vaginal infection and interferes with the establishment of latency in goats.

    Directory of Open Access Journals (Sweden)

    Mariarosaria Marinaro

    Full Text Available The immunogenicity and the efficacy of a beta-propiolactone-inactivated caprine herpesvirus 1 (CpHV-1 vaccine adjuvanted with MF59™ were tested in goats. Following two subcutaneous immunizations, goats developed high titers of CpHV-1-specific serum and vaginal IgG and high serum virus neutralization (VN titers. Peripheral blood mononuclear cells (PBMC stimulated in vitro with inactivated CpHV-1 produced high levels of soluble IFN-gamma and exhibited high frequencies of IFN-gamma producing cells while soluble IL-4 was undetectable. On the other hand, control goats receiving the inactivated CpHV-1 vaccine without adjuvant produced only low serum antibody responses. A vaginal challenge with virulent CpHV-1 was performed in all vaccinated goats and in naïve goats to assess the efficacy of the two vaccines. Vaginal disease was not detected in goats vaccinated with inactivated CpHV-1 plus MF59™ and these animals had undetectable levels of infectious challenge virus in their vaginal washes. Goats vaccinated with inactivated CpHV-1 in the absence of adjuvant exhibited a less severe disease when compared to naïve goats but shed titers of challenge virus that were similar to those of naïve goats. Detection and quantitation of latent CpHV-1 DNA in sacral ganglia in challenged goats revealed that the inactivated CpHV-1 plus MF59™ vaccine was able to significantly reduce the latent viral load when compared either to the naïve goats or to the goats vaccinated with inactivated CpHV-1 in the absence of adjuvant. Thus, a vaccine composed of inactivated CpHV-1 plus MF59™ as adjuvant was strongly immunogenic and induced effective immunity against vaginal CpHV-1 infection in goats.

  13. Rapid detection of novel caprine parainfluenza virus type 3 (CPIV3) using a TaqMan-based RT-qPCR.

    Science.gov (United States)

    Li, Jizong; Li, Wenliang; Mao, Li; Hao, Fei; Yang, Leilei; Zhang, Wenwen; Jiang, Jieyuan

    2016-10-01

    Parainfluenza virus type 3 (PIV3) is one of the most important respiratory pathogens for humans and many animals. A novel caprine PIV3 (CPIV3) was recently identified and isolated from Chinese goat flocks with respiratory disease. In order to develop rapid and sensitive methods for CPIV3 detection in infected goats, a TaqMan RT-qPCR was established in this study based on the primers and probe designed to amplify a 150 nucleotide-long region located within the M gene of the virus. The method was able to detect about 1.0×10(1) DNA copies/μL with an efficiency of 99.6% and a R(2) value of 0.997. There were no cross-reaction observed using this technique against peste des petits ruminants virus (PPRV), border disease virus (BDV), bluetongue virus (BTV) and bovine viral diarrhea virus (BVDV). One hundred and fourteen samples, including nasal swabs, feces swabs, sera, hearts, livers, spleens, lungs, kidneys, tracheas and hilar lymph nodes (HLNs) from six challenged goats, were evaluated by this technique. Using TaqMan RT-qPCR, CPIV3 was positively detected in 51 of 114 samples (44.74%), which was higher than RT-PCR (27.19%, 31/114) and virus isolation (14.9%, 17/114), respectively. The method also gave higher positive detection rate (35%, 42/120) than RT-PCR (28.33%, 34/120) from clinical samples. These data indicated that this method could be used for faster and more accurate monitoring of viral load, disease progression and vaccination efficacy of CPIV3 in goat flocks. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Implantation of silicon dioxide-based nanocrystalline hydroxyapatite and pure phase beta-tricalciumphosphate bone substitute granules in caprine muscle tissue does not induce new bone formation

    Directory of Open Access Journals (Sweden)

    Ghanaati Shahram

    2013-01-01

    Full Text Available Abstract Background Osteoinductive bone substitutes are defined by their ability to induce new bone formation even at heterotopic implantation sites. The present study was designed to analyze the potential osteoinductivity of two different bone substitute materials in caprine muscle tissue. Materials and methods One gram each of either a porous beta-tricalcium phosphate (β-TCP or an hydroxyapatite/silicon dioxide (HA/SiO2-based nanocrystalline bone substitute material was implanted in several muscle pouches of goats. The biomaterials were explanted at 29, 91 and 181 days after implantation. Conventional histology and special histochemical stains were performed to detect osteoblast precursor cells as well as mineralized and unmineralized bone matrix. Results Both materials underwent cellular degradation in which tartrate-resistant acid phosphatase (TRAP-positive osteoclast-like cells and TRAP-negative multinucleated giant cells were involved. The ß-TCP was completely resorbed within the observation period, whereas some granules of the HA-groups were still detectable after 180 days. Neither osteoblasts, osteoblast precursor cells nor extracellular bone matrix were found within the implantation bed of any of the analyzed biomaterials at any of the observed time points. Conclusions This study showed that ß-TCP underwent a faster degradation than the HA-based material. The lack of osteoinductivity for both materials might be due to their granular shape, as osteoinductivity in goat muscle has been mainly attributed to cylindrical or disc-shaped bone substitute materials. This hypothesis however requires further investigation to systematically analyze various materials with comparable characteristics in the same experimental setting.

  15. Induction of hepatocyte-like cells from mouse embryonic stem cells by lentivirus-mediated constitutive expression of Foxa2/Hnf4a.

    Science.gov (United States)

    Liu, Tao; Zhang, Shichang; Xiang, Dedong; Wang, Yingjie

    2013-11-01

    Hepatocytes can be generated from embryonic stem cells (ESCs) using inducers such as chemical compounds and cytokines, but issues related to low differentiation efficiencies remain to be resolved. Recent work has shown that overexpression of lineage-specific transcription factors can directly cause cells phenotypic changes, including differentiation, trans-differentiation, and de-differentiation. We hypothesized that lentivirus-mediated constitutive expression of forkhead box A2 (Foxa2) and hepatocyte nuclear factor 4 alpha (Hnf4a) could promote inducing mouse ESCs to hepatocyte-likes cells. First, ESC lines that stably expressed Foxa2, Hnf4a, or Foxa2/Hnf4a were constructed via lentiviral expression vectors. Second, observations of cell morphology changes were made during the cell culture process, followed by experiments examining teratoma formation. Then, the effects of constitutive expression of Foxa2 and Hnf4a on hepatic differentiation and maturation were determined by measuring the marker gene expression levels of Albumin, α-fetoprotein, Cytokeratin18, and α1-antitrypsin. The results indicate that constitutive expression of Foxa2 and Hnf4a does not affect ESCs culture, teratoma formation, or the expression levels of the specific hepatocyte genes under autonomous differentiation. However, with some assistance from inducing factors, Foxa2 significantly increased the hepatic differentiation of ESCs, whereas the expression of Hnf4a alone or Foxa2/Hnf4a could not. Differentiated CCE-Foxa2 cells were more superior in expressing several liver-specific markers and protein, storing glycogen than differentiated CCE cells. Therefore, our method employing the transduction of Foxa2 would be a valuable tool for the efficient generation of functional hepatocytes derived from ESCs. © 2013 Wiley Periodicals, Inc.

  16. In vivo molecular imaging and radionuclide (131I) therapy of human nasopharyngeal carcinoma cells transfected with a lentivirus expressing sodium iodide symporter.

    Science.gov (United States)

    Shi, Shuo; Zhang, Min; Guo, Rui; Miao, Ying; Hu, Jiajia; Xi, Yun; Li, Biao

    2015-01-01

    Despite recent improvements in the survival rates for nasopharyngeal carcinoma (NPC), novel treatment strategies are required to improve distant metastasis-free survival. The sodium iodine symporter (NIS) gene has been applied for in vivo imaging and cancer therapy. In this study, we examined the potential of NIS gene therapy as a therapeutic approach in NPC by performing non-invasive imaging using 125I and 131I therapy in vivo. We constructed a lentiviral vector expressing NIS and enhanced green fluorescent protein (EGFP) under the control of the human elongation factor-1α (EF1α) promoter, and stably transfected the vector into CNE-2Z NPC cells to create CNE-2Z-NIS cells. CNE-2Z and CNE-2Z-NIS tumor xenografts were established in nude mice; 125I uptake, accumulation and efflux were measured using micro-SPECT/CT imaging; the therapeutic effects of treatment with 131I were assessed over 25 days by measuring tumor volume and immunohistochemical staining of the excised tumors. qPCR, immunofluorescence and Western blotting confirmed that CNE-2Z-NIS cells expressed high levels of NIS mRNA and protein. CNE-2Z-NIS cells and xenografts took up and accumulated significantly more 125I than CNE-2Z cells and xenografts. In vitro, 131I significantly reduced the clonogenic survival of CNE-2Z-NIS cells. In vivo, 131I effectively inhibited the growth of CNE-2Z-NIS xenografts. At the end of 131I therapy, CNE-2Z-NIS xenograft tumor cells expressed higher levels of NIS and caspase-3 and lower levels of Ki-67. Lentiviruses effectively delivered and mediated long-lasting expression of NIS in CNE-2Z cells which enabled uptake and accumulation of radioisotopes and provided a significant therapeutic effect in an in vivo model of NPC. NIS-mediated radioiodine treatment merits further investigation as a potentially effective, low toxicity therapeutic strategy for NPC.

  17. Nonsynonymous changes of equine lentivirus receptor-1 (ELR1) gene in amino acids involved in the interaction with equine infectious anemia virus (EIAV).

    Science.gov (United States)

    Corbi-Botto, C M; Sadaba, S A; Zappa, M E; Peral-García, P; Díaz, S

    2017-06-01

    Equine lentivirus receptor-1 (ELR1) has been characterized as the specific functional receptor that mediates equine infectious anemia virus (EIAV) entrance to horse macrophages. This receptor is tumor necrosis factor receptor superfamily member 14 (TNFRSF14). The aim of this study was to investigate the occurrence of allelic variants in the coding sequence of equine TNFRSF14 gene by screening for single-nucleotide polymorphisms (SNPs) in different equine populations. Forty seven horse samples were randomly selected from a reservoir of EIAV-seropositive and seronegative samples collected from different outbreaks and regions of Argentina. DNA samples were scanned via PCR and direct sequencing of exon 3 and exon 5 of TNFRSF14 gene. A total of 21 SNPs were identified, of which 11 were located in coding sequences. Within exon 5, four SNPs caused nonsynonymous substitutions, while two other SNPs caused synonymous substitutions in crucial residues (Ser112 and Thr114) implicated in the interaction with EIAV. Despite some of exon 5 variants occurred exclusively in EIAV-positive or EIAV-negative horses, critical residues for the function of the mature protein were conserved, accounting for selective pressures in favor of preserving the specific function of TNFRSF members and the host immune response. To our knowledge, this is the first report of the existence of allelic variations involving some crucial amino acid residues in horse ELR1. Further, it could be an initial step to test the possible functional relevance and relationship of these variants with EIAV infection and disease progression as well as to develop preventive strategies. Copyright © 2017. Published by Elsevier Ltd.

  18. Lentivirus vector driven by polybiquitin C promoter without woodchuck posttranscriptional regulatory element and central polypurine tract generates low level and short-lived reporter gene expression.

    Science.gov (United States)

    Ngai, Siew Ching; Rosli, Rozita; Nordin, Norshariza; Veerakumarasivam, Abhi; Abdullah, Syahril

    2012-05-01

    Lentivirus (LV) encoding woodchuck posttranscriptional regulatory element (WPRE) and central polypurine tract (cPPT) driven by CMV promoter have been proven to act synergistically to increase both transduction efficiency and gene expression. However, the inclusion of WPRE and cPPT in a lentiviral construct may pose safety risks when administered to human. A simple lentiviral construct driven by an alternative promoter with proven extended duration of gene expression without the two regulatory elements would be free from the risks. In a non-viral gene delivery context, gene expression driven by human polybiquitin C (UbC) promoter resulted in higher and more persistent expression in mouse as compared to cytomegalovirus (CMV) promoter. In this study, we measured the efficiency and persistency of green fluorescent protein (GFP) reporter gene expression in cells transduced with LV driven by UbC (LV/UbC/GFP) devoid of the WPRE and cPPT in comparison to the established LV construct encoding WPRE and cPPT, driven by CMV promoter (LV/CMV/GFP). However, we found that LV/UbC/GFP was inferior to LV/CMV/GFP in many aspects: (i) the titer of virus produced; (ii) the levels of reporter gene expression when MOI value was standardized; and (iii) the transduction efficiency in different cell types. The duration of reporter gene expression in selected cell lines was also determined. While the GFP expression in cells transduced with LV/CMV/GFP persisted throughout the experimental period of 14 days, expression in cells transduced with LV/UbC/GFP declined by day 2 post-transduction. In summary, the LV driven by the UbC promoter without the WPRE and cPPT does not exhibit enhanced or durable transgene expression. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Effects of lentivirus-mediated CREB expression in the dorsolateral striatum: memory enhancement and evidence for competitive and cooperative interactions with the hippocampus.

    Science.gov (United States)

    Kathirvelu, Balachandar; Colombo, Paul J

    2013-11-01

    Neural systems specialized for memory may interact during memory formation or recall, and the results of interactions are important determinants of how systems control behavioral output. In two experiments, we used lentivirus-mediated expression of the transcription factor CREB (LV-CREB) to test if localized manipulations of cellular plasticity influence interactions between the hippocampus and dorsolateral striatum. In Experiment 1, we tested the hypothesis that infusion of LV-CREB in the dorsolateral striatum facilitates memory for response learning, and impairs memory for place learning. LV-CREB in the dorsolateral striatum had no effect on response learning, but impaired place memory; a finding consistent with competition between the striatum and hippocampus. In Experiment 2, we tested the hypothesis that infusion of LV-CREB in the dorsolateral striatum facilitates memory for cue learning, and impairs memory for contextual fear conditioning. LV-CREB in the dorsolateral striatum enhanced memory for cue learning and, in contrast to our prediction, also enhanced memory for contextual fear conditioning, consistent with a cooperative interaction between the striatum and hippocampus. Overall, the current experiments demonstrate that infusion of LV-CREB in the dorsolateral striatum (1) increases levels of CREB protein locally, (2) does not alter acquisition of place, response, cue, or contextual fear conditioning, (3) facilitates memory for cue learning and contextual fear conditioning, and (4) impairs memory for place learning. Taken together, the present results provide evidence that LV-CREB in the dorsolateral striatum can enhance memory formation and cause both competitive and cooperative interactions with the hippocampus. Copyright © 2013 Wiley Periodicals, Inc.

  20. Bicistronic lentiviruses containing a viral 2A cleavage sequence reliably co-express two proteins and restore vision to an animal model of LCA1.

    Directory of Open Access Journals (Sweden)

    Jonathan D Verrier

    Full Text Available The disease processes underlying inherited retinal disease are complex and are not completely understood. Many of the corrective gene therapies designed to treat diseases linked to mutations in genes specifically expressed in photoreceptor cells restore function to these cells but fail to stop progression of the disease. There is growing consensus that effective treatments for these diseases will require delivery of multiple therapeutic proteins that will be selected to treat specific aspects of the disease process. The purpose of this study was to design a lentiviral transgene that reliably expresses all of the proteins it encodes and does so in a consistent manner among infected cells. We show, using both in vitro and in vivo analyses, that bicistronic lentiviral transgenes encoding two fluorescent proteins fused to a viral 2A-like cleavage peptide meet these expression criteria. To determine if this transgene design is suitable for therapeutic applications, we replaced one of the fluorescent protein genes with the gene encoding guanylate cyclase-1 (GC1 and delivered lentivirus carrying this transgene to the retinas of the GUCY1*B avian model of Leber congenital amaurosis-1 (LCA1. GUCY1*B chickens carry a null mutation in the GC1 gene that disrupts photoreceptor function and causes blindness at hatching, a phenotype that closely matches that observed in humans with LCA1. We found that treatment of these animals with the 2A lentivector encoding GC1 restored vision to these animals as evidenced by the presence of optokinetic reflexes. We conclude that 2A-like peptides, with proper optimization, can be successfully incorporated into therapeutic vectors designed to deliver multiple proteins to neural retinal. These results highlight the potential of this vector design to serve as a platform for the development of combination therapies designed to enhance or prolong the benefits of corrective gene therapies.

  1. Molecular In Vivo Imaging Using a Noninvasive Cardiac-Specific MLC-2v Promoter Driven Dual-Gene Recombinant Lentivirus Monitoring System.

    Directory of Open Access Journals (Sweden)

    Miao Zhang

    Full Text Available Our study aimed to demonstrate the feasibility of using the sodium/iodide symporter (NIS to monitor vascular endothelial growth factor (VEGF165 expression in vivo.We constructed a recombinant lentivirus plasmid with the MLC-2v promoter driving the sodium/iodide symporter (NIS reporter gene linked to the VEGF165 gene. Expression of NIS and VEGF gene were identified by Western blot. On days 2 and 54, 99mTc-MIBI imaging was used to evaluate changes in myocardial ischemia. Noninvasive 125I micro-SPECT/CT imaging was used to assess the expression of NIS reporter gene dynamically over the next 2 months.Western blot analysis showed that both NIS and VEGF165 were highly expressed in rat cardiomyoblast H9C2 cells transduced with Lenti-MLC-2v-NIS--VEGF165. 125I micro-SPECT/CT reporter imaging showed higher uptake in mouse myocardium transduced with Lenti-MLC-2v-VEGF165-IRES-NIS. NIS expression peaked on day 1 after transduction followed by a progressive decline to negligible levels by day 21. On day 1, mean 125I activity value in group 1 was higher than that in group 2 (P 0.05. In group 1 (test group, 99mTc-MIBI SPECT/CT revealed improvements in perfusion and wall thickening in the apical anterior wall. Mean IOD values of NIS and CD34 were significantly higher in group 1 than group 3 (P<0.05. Our study proved mean I-125 uptake was significantly correlated with mean IOD value of NIS and CD34 (P<0.05.This study demonstrates the feasibility of using the NIS gene to monitor VEGF165 expression in a mouse myocardial ischemia model.

  2. In vivo molecular imaging and radionuclide (131I therapy of human nasopharyngeal carcinoma cells transfected with a lentivirus expressing sodium iodide symporter.

    Directory of Open Access Journals (Sweden)

    Shuo Shi

    Full Text Available Despite recent improvements in the survival rates for nasopharyngeal carcinoma (NPC, novel treatment strategies are required to improve distant metastasis-free survival. The sodium iodine symporter (NIS gene has been applied for in vivo imaging and cancer therapy. In this study, we examined the potential of NIS gene therapy as a therapeutic approach in NPC by performing non-invasive imaging using 125I and 131I therapy in vivo.We constructed a lentiviral vector expressing NIS and enhanced green fluorescent protein (EGFP under the control of the human elongation factor-1α (EF1α promoter, and stably transfected the vector into CNE-2Z NPC cells to create CNE-2Z-NIS cells. CNE-2Z and CNE-2Z-NIS tumor xenografts were established in nude mice; 125I uptake, accumulation and efflux were measured using micro-SPECT/CT imaging; the therapeutic effects of treatment with 131I were assessed over 25 days by measuring tumor volume and immunohistochemical staining of the excised tumors.qPCR, immunofluorescence and Western blotting confirmed that CNE-2Z-NIS cells expressed high levels of NIS mRNA and protein. CNE-2Z-NIS cells and xenografts took up and accumulated significantly more 125I than CNE-2Z cells and xenografts. In vitro, 131I significantly reduced the clonogenic survival of CNE-2Z-NIS cells. In vivo, 131I effectively inhibited the growth of CNE-2Z-NIS xenografts. At the end of 131I therapy, CNE-2Z-NIS xenograft tumor cells expressed higher levels of NIS and caspase-3 and lower levels of Ki-67.Lentiviruses effectively delivered and mediated long-lasting expression of NIS in CNE-2Z cells which enabled uptake and accumulation of radioisotopes and provided a significant therapeutic effect in an in vivo model of NPC. NIS-mediated radioiodine treatment merits further investigation as a potentially effective, low toxicity therapeutic strategy for NPC.

  3. Sero-prevalence and associated risk factors of peste des petits ruminants and contagious caprine pleuro-pneumonia in goats and sheep in the Southern Zone of Tanzania.

    Science.gov (United States)

    Mbyuzi, Albano O; Komba, Erick V G; Kimera, Sharadhuli I; Kambarage, Dominic M

    2014-09-01

    A retrospective Sero-prevalence analysis was conducted in 2012 in order to find out whether contagious caprine pleuro-pneumonia (CCPP) and peste des petits ruminants (PPR) had already been introduced in Mtwara and Lindi regions of Southern Tanzania by 2007 and 2009. A total of 477 randomly selected sera from a bank of 3500 small ruminant samples that were collected as part of Rift Valley Fever surveillance of 2007 in Mtwara and Lindi regions were used in this study. Seroconversion was also evaluated in the 504 sera that were collected in 2009 as part of disease outbreak investigations in Tandahimba and Newala districts of Mtwara region. Seroconversions to CCPP and PPR were tested using competitive ELISA. In addition, information on different variables available in the existing surveillance forms gathered during sampling was used in the analysis of risk factors associated with seropositivity to the two diseases. The overall seroprevalence of CCPP for the sera of 2007 and 2009 in goats was 52.1% (n=447) and 35.5% (n=434) respectively; while in sheep the seroprevalence was 36.7% (n=30) and 22.9% (n=70) respectively. Seroconversion to PPR in goats and sheep was 28.7% (n=434) and 35.7% (n=70) respectively based on the sera of 2009. However, no antibodies were detected in the 2007 sera. Mixed infections were detected in 7.4% (n=434) of the goat and 12.9% (n=70) of sheep samples. Significant risk factors associated with seropositivity to CCPP in 2007 included introduction of new animals in flocks (OR=3.94; 95% CI 1.86-8.36; p<0.001) and raising animals in government farms (OR=4.92; 95% CI 1.57-15.76; p=0.02); whereas, seropositivity to CCPP in 2009 increased with introduction of new animals in flocks (OR=18.82; 95% CI 8.06-43.96; p<0.001), raising animals in government farms (OR=4.04; 95% CI 2.69-6.42; p<0.001) and raising animals in Newala district (OR=2.35; 95% CI 1.53-3.62; p<0.001). On the other hand, predictors for seropositivity to PPR in 2009 were introduction of

  4. PREVALÊNCIA SOROLÓGICA DA MAEDI-VISNA EM REBANHOS OVINOS DA MICRORREGIÃO DE JUAZEIRO - BAHIA POR MEIO DO TESTE DE IMUNODIFUSÃO EM GEL DE ÁGAR

    Directory of Open Access Journals (Sweden)

    PRISCILA MARTINEZ MARTINEZ

    2011-06-01

    Full Text Available The introduction of new breeds, aiming at increasing productivity, caused the change in the health profile of herds. Among the diseases introduced in Brazil lentiviroses of small ruminants (LVPR stand out,represented by caprine arthritis encephalitis (CAE and the maedi-visna (MV. In order to obtain data concerning the presence of maedi visna (MV in sheep herds in the microregion of Juazeiro, Bahia, 91 9 serum samples were evaluated by agar gel immunodiffusion (AGID. Thesamples were collected in eight cities that make up this microregion Juazeiro, Sento Sé, Sobradinho, Pilão Arcado, Campo Alegre Lourdes, Remanso, Casa Nova and Curaçá considering how representative eachmunicipality is within the totalilty of animals. It was observed that 0.34% of the sampled sheep showed positive reaction in the AGID. It was concluded that the MV occurs with low prevalence in the studied microregion, probably due to the predominance of locallyadapted breeds.

  5. Risk factors for subclinical intramammary infection in dairy goats in two longitudinal field studies evaluated by Bayesian logistic regression

    DEFF Research Database (Denmark)

    Koop, Gerrit; Collar, Carol A.; Toft, Nils

    2013-01-01

    are imperfect tests, particularly lacking sensitivity, which leads to misclassification and thus to biased estimates of odds ratios in risk factor studies. The objective of this study was to evaluate risk factors for the true (latent) IMI status of major pathogens in dairy goats. We used Bayesian logistic......, caprine arthritis encephalitis-virus infection status, and kidding season), and uncontrollable risk factors (parity, lactation stage, milk yield, pregnancy status, and breed) were measured in the Dutch study, the Californian study or in both studies. Bayesian logistic regression models were constructed...... in which the true (but latent) infection status was linked to the joint test results, as functions of test sensitivity and specificity. The latent IMI status was the dependent variable in the logistic regression model with risk factors as independent variables and with random herd and goat effects...

  6. Prevalência para tuberculose caprina no semi-árido paraibano Prevalence for caprine tuberculosis in semi-arid of Paraíba

    Directory of Open Access Journals (Sweden)

    Walkyria Antunes Pignata

    2009-07-01

    and ages from 84 herds in the microregion of Monteiro, State of Paraíba, Northeast Brazil, were tuberculinized by the Comparative Cervical Test (CCT. Interpretation of the CCT was checked by calculation of the difference obtained between skin measures correspondent to respective tuberculins, before and 72 hours after inoculation: negative, when bovine PPD is smaller than avian PPD or larger in up to 1.8mm; suspicious or inconclusive, reaction to bovine PPD larger than avian PPD between 1.9 and 2.4mm; positive, reaction to bovine PPD larger than or equal to avian PPD in 2.5mm. From goats submitted to CCT, 0.47% (9/1866 reacted positively (95% CI = 0.23%-0.94%. The prevalence of positive herds to caprine tuberculosis was 10.71% (95% CI = 5.02-19.37%. When submitted to necropsy and histopathologic examination, a positive goat at tuberculin test presented tuberculosis-like lesions. The presence of Acid-Alcohol Resistant Bacilli (BAAR was also detected by direct bacterioscopy; in relation to herd size, herds with larger number of animals ( >25 with high incidence of the disease, and presence of the infection was evidenced in properties that raised cattle in association with goats and did not carry out tuberculin tests in cattle.

  7. Utilization of solar electric fence for containment of caprine in familiar production of the Pernambuco semi-arid region; Utilizacao de cerca eletrica solar para confinamento de caprinos na producao familiar do semi-arido pernambucano

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Heitor Scalambrini; Costa Neto, Guilherme [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Nucleo de Apoio a Projetos de Energias Renovaveis], Email: naper@ufpe.br; Araujo, Kassia; Silva, Gerson Flavio da; Raquel, Karine [ONG NAPER SOLAR, Recife, PE (Brazil). Centro de Estudos e Projetos], Email: nsolar@terra.com.br

    2006-07-01

    The Center for Studies and Projects - Naper Solar is an NGO, which works for the dissemination of use of alternative energies resources in the semi-arid Brazilian Northeast in collaboration with the Federal University of Pernambuco. It has implemented caprine raising systems in the back lands of Pajeu in the State of Pernambuco making use of electrified fences energized by solar energy.This project was executed in a joint effort with the City Halls of Afogados da Ingazeira e Sao Jose do Egito and the NGOs Diaconia and the Northeast Woman House and has benefited 20 families of farmers from 9 rural communities. It is funded by a Technical Cooperation Program established between the National Fund for the Environment - Ministry for the Environment and the Netherlands Government. The implemented system, in opposition to the traditional extensive production system, allow for a more animal sanitary control - minimizing the risks of contamination; a more controlled and balanced feeding system - taking into account the weight gaining factor together with pasture management, leading the a guarantee of food supply for the animals. Other advantages of this system include the reduction of fence cost and less deforesting. Electrical fences used in the contention of caprine are built with only 4 straight wires, fixed with isolators on wood posts spaced 10 m from each other, while the conventional fences use 9 barbed-wire lines fixed with clamps on posts spaced 1 m from each other. Therefore, the use of electrical fences instead of the conventional one represent a cost reduction, which can go as high as 40 % of the total cost. Besides that the electrical fences have low maintenance cost, easier and faster installation and relocation. The fenced areas vary from 0.5 ha to 4 ha for the raising of 5 to 50 animals. In the electrification of a fence one needs one photovoltaic module, one electrifier, a battery, isolators (passage and corner), electric ground rods and a thunderbolt

  8. Lentivirus-mediated interleukin-1β (IL-1β) knock-down in the hippocampus alleviates lipopolysaccharide (LPS)-induced memory deficits and anxiety- and depression-like behaviors in mice.

    Science.gov (United States)

    Li, Mengmeng; Li, Chenli; Yu, Hanjie; Cai, Xiongxiong; Shen, Xinbei; Sun, Xin; Wang, Jinting; Zhang, Yanhua; Wang, Chuang

    2017-09-20

    Recent evidence has suggested that peripheral inflammatory responses induced by lipopolysaccharides (LPS) play an important role in neuropsychiatric dysfunction in rodents. Interleukin-1β (IL-1β), a pro-inflammatory cytokine, has been proposed to be a key mediator in a variety of behavioral dysfunction induced by LPS in mice. Thus, inhibition of IL-1β may have a therapeutic benefit in the treatment of neuropsychiatric disorders. However, the precise underlying mechanism of knock-down of IL-1β in repairing behavioral changes by LPS remains unclear. The mice were treated with either IL-1β shRNA lentivirus or non-silencing shRNA control (NS shRNA) lentivirus by microinjection into the dentate gyrus (DG) regions of the hippocampus. After 7 days of recovery, LPS (1 mg/kg, i.p.) or saline was administered. The behavioral task for memory deficits was conducted in mice by the novel object recognition test (NORT), the anxiety-like behaviors were evaluated by the elevated zero maze (EZM), and the depression-like behaviors were examined by the sucrose preference test (SPT) and the forced swimming test (FST). Furthermore, the levels of malondialdehyde (MDA), superoxide dismutase (SOD), nuclear factor erythroid-derived 2-like 2 (Nrf2), heme oxygenase 1 (HO1), IL-1β, tumor necrosis factor (TNF-α), neuropeptide VGF (non-acronymic), and brain-derived neurotrophic factor (BDNF) were assayed. Our results demonstrated that IL-1β knock-down in the hippocampus significantly attenuated the memory deficits and anxiety- and depression-like behaviors induced by LPS in mice. In addition, IL-1β knock-down ameliorated the oxidative and neuroinflammatory responses and abolished the downregulation of VGF and BDNF induced by LPS. Collectively, our findings suggest that IL-1β is necessary for the oxidative and neuroinflammatory responses produced by LPS and offers a novel drug target in the IL-1β/oxidative/neuroinflammatory/neurotrophic pathway for treating neuropsychiatric disorders

  9. Biodigestão anaeróbia de dejetos de caprinos obtidos nas diferentes estações do ano Anaerobic digestion of caprine manure in different seasons

    Directory of Open Access Journals (Sweden)

    Ana C. Amorim

    2004-04-01

    Full Text Available Foram utilizados dejetos produzidos por caprinos, em diferentes estádios fisiológicos e submetidos ao mesmo regime alimentar, nas quatro estações do ano. O objetivo foi avaliar o efeito das estações do ano sobre a digestão anaeróbia de resíduos de caprinos em biodigestores modelo batelada com volume útil de 60 L de substrato em fermentação e mantidos sob temperatura ambiente. Foram avaliadas as produções de biogás, as reduções de sólidos voláteis (SV, os potenciais de produção (m³ de biogás/kg de substrato, de estrume, de sólidos totais (ST ou sólidos voláteis, os números mais prováveis de coliformes totais e fecais, e a composição do biogás. As reduções de SV foram de 38; 34; 33 e 39% para o verão, outono, inverno e primavera, respectivamente. Os totais de biogás produzidos foram de 1,06 m³ no verão, 0,88 m³ no outono, 0,88 m³ no inverno e 0,99 m³ na primavera, e os potenciais de produção médios foram de 0,02 m³ de biogás/kg de substrato e 0,2 m³ de biogás/kg de estrume para todas as estações. As reduções médias de coliformes totais e fecais foram de 99,99% em todas as estações, e os teores máximos de CH4 no biogás foram 88,3; 84,6; 80,6 e 79,2%, para o verão, outono, inverno e primavera, respectivamente.The dejections produced by caprines were used, in different physiologic states and submitted to the same alimentary regime, in the four seasons of the year.This study was carried out in 60 L batch digesters at ambient temperature and aimed to evaluate the effect of the season on the anaerobic digestion of caprine manure. The biogas production, volatile solids (VS reduction, the potential production (m³ of biogas/kg of substrate, manure, total solids (TS or VS, the removal of total and fecal coliforms and the biogas composition were evaluated. The VS reductions were of 38; 34; 33 and 39% for Summer, Autumn, Winter and Spring, respectively. The biogas production were of 1.06 m³ in Summer

  10. Testicular arteries systematization based on different levels of scrotal configuration in caprines Sistematização da artéria testicular em caprinos segundo a configuração escrotal

    Directory of Open Access Journals (Sweden)

    Mônica Marco de Almeida

    2008-08-01

    Full Text Available The objective of this study was to describe the distribution of testicular arterial vessels in caprines with different degrees of scrotal division. Scrotal configurations were classified as follows; Group I: scrotum without bipartition; Group II: scrotum showing a ventral division until the middle of the testis; and, Group III: scrotal separation extended beyond the middle of the testis. A colored vinyl acetate solution was injected into 60 testicular arteries (30 pairs. After, the samples were submitted to corrosion cast method to obtain tubular vascular models for macroscopic analysis. We observed that the testicular arteries emerge from the abdominal aorta, cross the inguinal canal to become coiled and involved by the pampiniform plexus. Close to the caudal extremity of the testis, the arteries become divided in cranial and caudal branches that emit collateral vessels to originate emerging branches. Testicles with intermediate level of scrotal division (group II showed a smaller amount of those branches than the others, being the most populated the ventrolateral and the dorsolateral quadrants. The origin, distribution and localization of the testicular arteries did not show any differences related to the degree of scrotal division in caprines.O objetivo deste trabalho foi analisar a distribuição dos vasos arteriais nos testículos em caprinos com diferentes graus de divisão escrotal. A configuração escrotal foi classificada da seguinte forma: Grupo I: constituído por caprinos com escroto único, Grupo II: com escroto separado até a metade do testículo e Grupo III: com separação escrotal estendendo-se além da metade do testículos. As artérias foram injetadas e coradas com solução de acetado de vinil, sendo os orgãos (30 pares submetidos à corrossão para obtenção dos moldes vasculares. As artérias testiculares emergem da aorta abdominal, com trajeto retilíneo, atravessam o canal inguinal, apresentam-se espiraladas e

  11. Alterações oftálmicas associadas à intoxicação experimental por closantel em caprinos Ophthalmic changes associated with the experimental poisoning by closantel in caprine

    Directory of Open Access Journals (Sweden)

    R. Ecco

    2008-02-01

    Full Text Available Alterações oftálmicas foram experimentalmente induzidas em caprinos após superdosagem com o anti-helmíntico closantel. Foram usados cinco caprinos com sete a oito meses de idade, produtos do cruzamento da raça Saanen com a Pardo Alpino. Os animais mostraram sinais de intoxicação entre quatro e cinco dias após a administração do closantel. Os sinais clínicos caracterizaram-se principalmente por distúrbios neurológicos centrais e cegueira. Ao exame clínico, observaram-se midríase bilateral, perda do reflexo pupilar à luz e cegueira bilateral. À oftalmoscopia indireta, foram observadas degeneração aguda de retina e papiledema. As alterações crônicas mostravam disco óptico acinzentado, atrofia de vasos e da retina. Nos fundos tapetal e não-tapetal notavam-se áreas de despigmentação e lesões irregulares castanho-amareladas. As alterações histológicas consistiam em perda dos neurônios da camada ganglionar e das células da camada nuclear interna e externa da retina. As alterações agudas no nervo óptico e na substância branca do encéfalo foram de degeneração espongiforme. As alterações crônicas do nervo óptico caracterizavam-se por extensa necrose e infiltração de células Gitter.Ophthalmic alterations were experimentally induced after overdose with the anthelmintic closantel. Five seven to eight- months-old, Saanen x Alpine caprine were used. The animals showed clinical signs of toxicosis four to five days after the administration of closantel. Clinical signs were primarily characterized by central nervous disturbances and blindness. Clinically, bilateral mydriasis, loss of pupillary light reflex, and blindness were observed. At indirect ophthalmoscopic examination, there was acute retinal degeneration and papilledema. Chronic ocular changes consisted of paleness of the optic disc, vascular atrophy, and retinal atrophy. Areas of pigment loss and irregular yellowish-brown foci were present in the tapetal

  12. Caprine in utero learning and feed neophobia

    NARCIS (Netherlands)

    Vu Hai, P.

    2017-01-01

    Environmental driven changes in meat goat production systems in Vietnam require the use of new feedstuffs in the diets for goats. The introduction of novel feedstuffs to young goats is often associated with a reduced feed intake, daily gain and welfare. The work presented here investigated different

  13. Effect of bone morphogenetic protein-7 (BMP-7 on in vitro survival of caprine preantral follicles Efeito da proteína morfogenética óssea 7 (BMP-7 para a sobrevivência in vitro de folículos pré-antrais caprinos

    Directory of Open Access Journals (Sweden)

    Valdevane R. Araújo

    2010-04-01

    Full Text Available This study was conducted in order to verify the effect of different concentrations of BMP-7 in the in vitro survival and development of caprine preantral follicles. Fragments of caprine ovarian cortical tissue were cultured for 1 or 7 days in Minimum Essential Medium (MEM+ supplemented with different concentrations of BMP-7 (1, 10, 50 or 100ng/ml. Non-cultured fragments or those cultured for 1 or 7 days were processed for classical histology and transmission electron microscopy (TEM. Parameters such as follicular survival, activation and growth were evaluated. The results showed that, after 1 or 7 days of culture, the percentage of morphologically normal follicles was significantly reduced in all treatments when compared with fresh control, except at 1ng/ml of BMP-7 for 1 day. In addition, the concentration of 10ng/ml of BMP-7 significantly increases follicular diameter from day 1 to 7 of culture. There was no influence of the other concentrations of BMP-7 regarding to the follicular and oocyte diameter. Ultrastructure studies confirmed follicular integrity after 7 days of culture in 1ng/ml BMP-7. In conclusion, small concentrations of BMP-7 can improve the survival and growth of caprine preantral follicles during in vitro culture.O presente trabalho foi conduzido de modo a se verificar o efeito de diferentes concentrações da BMP-7 no desenvolvimento in vitro de folículos pré-antrais caprinos. Fragmentos de tecido cortical ovariano caprino foram cultivados por 1 ou 7 dias em Minimum Essential Medium (MEM+ suplementado com diferentes concentrações de BMP-7 (1, 10, 50 ou 100ng/ml. Os fragmentos não cultivados ou aqueles cultivados por 1 ou 7 dias foram processados para histologia clássica e microscopia eletrônica de transmissão (TEM, sendo avaliados parâmetros morfológicos indicativos de viabilidade, ativação e crescimento. Os resultados mostraram que o percentual de folículos morfologicamente normais diminuiu significativamente em

  14. Produção de antígeno nucleoprotéico do vírus da artrite-encefalite caprina e comparação com o do vírus Maedi-Visna para utilização em teste de imunodifusão em ágar gel CAEV nucleoproteic antigen production and comparison with Maedi-Visna antigen in the immunodiffusion test

    Directory of Open Access Journals (Sweden)

    Silvio R. O. Abreu

    1998-04-01

    Full Text Available Foi feita uma comparação entre os antígenos (Ag, preparados a partir dos vírus Maedi-Visna (MVV e Artrite-encefalite Caprina (CAEV para detecção de anticorpos contra o CAEV em 120 amostras de soro caprino. A sensibilidade e especificidade relativa da imunodifusão em ágar gel (IDAG usando-se Ag MVV em relação ao Ag CAEV, foi 77,3% e 100%, respectivamente (X2, pA comparison of Maedi-Visna virus (MVV and Caprine Arthritis-encephalitis virus (CAEV antigens for detection of antibodies to CAEV was performed using sera from 120 goats. The sensitivity and specificity of the immunodiffusion test using MVV antigen compared to that of CAEV antigen was 77.3% and 100%, respectively (X2, p < 0.01. These results suggested that only CAEV antigen should be used in immunodiffusion tests for CAEV diagnosis.

  15. Advances in Diagnosis of Respiratory Diseases of Small Ruminants

    Directory of Open Access Journals (Sweden)

    Sandip Chakraborty

    2014-01-01

    Full Text Available Irrespective of aetiology, infectious respiratory diseases of sheep and goats contribute to 5.6 percent of the total diseases of small ruminants. These infectious respiratory disorders are divided into two groups: the diseases of upper respiratory tract, namely, nasal myiasis and enzootic nasal tumors, and diseases of lower respiratory tract, namely, peste des petits ruminants (PPR, parainfluenza, Pasteurellosis, Ovine progressive pneumonia, mycoplasmosis, caprine arthritis encephalitis virus, caseous lymphadenitis, verminous pneumonia, and many others. Depending upon aetiology, many of them are acute and fatal in nature. Early, rapid, and specific diagnosis of such diseases holds great importance to reduce the losses. The advanced enzyme-linked immunosorbent assays (ELISAs for the detection of antigen as well as antibodies directly from the samples and molecular diagnostic assays along with microsatellites comprehensively assist in diagnosis as well as treatment and epidemiological studies. The present review discusses the advancements made in the diagnosis of common infectious respiratory diseases of sheep and goats. It would update the knowledge and help in adapting and implementing appropriate, timely, and confirmatory diagnostic procedures. Moreover, it would assist in designing appropriate prevention protocols and devising suitable control strategies to overcome respiratory diseases and alleviate the economic losses.

  16. Característica histológica, ultra-estrutural e produção de nitrito de folículos pré-antrais caprinos cultivados in vitro na ausência ou presença de soro Histological and ultrastructural feature and nitrite production of caprine preantral follicles in vitro cultured in the presence or absence of serum

    Directory of Open Access Journals (Sweden)

    J.B. Bruno

    2008-12-01

    Full Text Available Avaliou-se o efeito da adição de diferentes tipos e concentrações de soro sobre o desenvolvimento e a sobrevivência de folículos ovarianos pré-antrais (FOPA caprinos in vitro. Além disso, verificou-se a relação entre as concentrações de nitrito presentes no meio de cultivo e a viabilidade folicular. Cada par ovariano foi dividido em 29 fragmentos, sendo um destinado ao controle. Os fragmentos foram cultivados por um ou sete dias em meio essencial mínimo suplementado (MEM+ ou MEM+ com diferentes concentrações (10 ou 20% de soro fetal bovino (SFB, soro de cabra em estro (SCE ou soro de cabra em diestro (SCD. Na análise morfológica após sete dias, apenas o tratamento com 10% de SFB apresentou percentual de FOPA normais similar ao MEM+ (P>0,05. A análise ultra-estrutural dos folículos cultivados por sete dias com MEM+ ou MEM+ com 10% de SFB mostrou danos oocitários, porém células da granulosa normais. A análise do meio de cultivo revelou correlação positiva entre a viabilidade folicular e a produção de nitrito. A suplementação com soro não melhorou a viabilidade de FOPA e a concentração de nitrito no meio de cultivo funcionou como um indicador da viabilidade das células da granulosa de FOPA caprinos cultivados in vitro.The effect of the addition of different types and concentrations of sera on the viability and development of caprine preantal follicles (PAF in vitro cultured was analyzed. In addition, it was evaluated the correlation between nitrite concentrations in culture medium and folicular viability. Each ovarian pair was divided in 29 fragments and one was used as control. The fragments were cultured for one or seven days in minimal essential medium (MEM+ or MEM+ with different concentrations of (10 or 20% bovine fetal serum (BFS, estrous goat serum (EGS, or diestrous goat serum (DGS. After seven days, the morphological analysis showed that only the treatment with 10% BFS maintained the percentage of normal

  17. Método eletroforético rápido para detecção da adulteração do leite caprino com leite bovino Fast electrophoretic detection method of adulteration of caprine milk by bovine milk

    Directory of Open Access Journals (Sweden)

    A.S. Egito

    2006-10-01

    Full Text Available Avaliaram-se os métodos de eletroforese em gel de poliacrilamida (PAGE em presença de uréia (uréia-PAGE e dodecil sulfato de sódio (SDS-PAGE para identificar a adulteração do leite de cabra pela adição do leite de vaca. Um método foi otimizado para preparação do caseinato de sódio em poucos minutos para análise eletroforética. Uréia-PAGE foi o método mais apropriado para identificação desse tipo de fraude, em decorrência da presença da caseína alfas1 com migração mais rápida no leite bovino. A presença da alfas1-caseína bovina foi detectada a partir da adição de 2,5% de leite de vaca utilizando uréia-PAGE. O limite de detecção, a repetibilidade, o tempo para execução indicaram que esse método pode ser aplicado como rotina no controle de qualidade do leite de cabra recebido pelas indústrias de processamento.Polyacrylamide gel electrophoresis (PAGE in presence of urea (urea-PAGE or sodium dodecyl sulfate (SDS-PAGE was evaluated to detect the presence of cow milk added to goat milk. A method was optimized to prepare sodium caseinate from milk in few minutes. After that, the sodium caseinate was analyzed by PAGE. The urea-PAGE was the most appropriated method to identify adulteration as caprine and bovine alphas1-caseins displayed different migration rates. When cow milk was added to goat milk at different proportions, the presence of bovine alphas1-casein was detected in the mixture by urea-PAGE for a minimal proportion of 2.5% of cow milk added to goat milk. The good sensitivity, the repeatability and the short time for execution indicate that the described method will be able to be routinely applied for the quality control of goat milk in dairy industry.

  18. Arteriviruses, Pegiviruses, and Lentiviruses Are Common among Wild African Monkeys.

    Science.gov (United States)

    Bailey, Adam L; Lauck, Michael; Ghai, Ria R; Nelson, Chase W; Heimbruch, Katelyn; Hughes, Austin L; Goldberg, Tony L; Kuhn, Jens H; Jasinska, Anna J; Freimer, Nelson B; Apetrei, Cristian; O'Connor, David H

    2016-08-01

    Nonhuman primates (NHPs) are a historically important source of zoonotic viruses and are a gold-standard model for research on many human pathogens. However, with the exception of simian immunodeficiency virus (SIV) (family Retroviridae), the blood-borne viruses harbored by these animals in the wild remain incompletely characterized. Here, we report the discovery and characterization of two novel simian pegiviruses (family Flaviviridae) and two novel simian arteriviruses (family Arteriviridae) in wild African green monkeys from Zambia (malbroucks [Chlorocebus cynosuros]) and South Africa (vervet monkeys [Chlorocebus pygerythrus]). We examine several aspects of infection, including viral load, genetic diversity, evolution, and geographic distribution, as well as host factors such as age, sex, and plasma cytokines. In combination with previous efforts to characterize blood-borne RNA viruses in wild primates across sub-Saharan Africa, these discoveries demonstrate that in addition to SIV, simian pegiviruses and simian arteriviruses are widespread and prevalent among many African cercopithecoid (i.e., Old World) monkeys. Primates are an important source of viruses that infect humans and serve as an important laboratory model of human virus infection. Here, we discover two new viruses in African green monkeys from Zambia and South Africa. In combination with previous virus discovery efforts, this finding suggests that these virus types are widespread among African monkeys. Our analysis suggests that one of these virus types, the simian arteriviruses, may have the potential to jump between different primate species and cause disease. In contrast, the other virus type, the pegiviruses, are thought to reduce the disease caused by human immunodeficiency virus (HIV) in humans. However, we did not observe a similar protective effect in SIV-infected African monkeys coinfected with pegiviruses, possibly because SIV causes little to no disease in these hosts. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  19. Self-association of the Lentivirus protein, Nef

    Directory of Open Access Journals (Sweden)

    Garcia J Victor

    2010-09-01

    Full Text Available Abstract Background The HIV-1 pathogenic factor, Nef, is a multifunctional protein present in the cytosol and on membranes of infected cells. It has been proposed that a spatial and temporal regulation of the conformation of Nef sequentially matches Nef's multiple functions to the process of virion production. Further, it has been suggested that dimerization is required for multiple Nef activities. A dimerization interface has been proposed based on intermolecular contacts between Nefs within hexagonal Nef/FynSH3 crystals. The proposed dimerization interface consists of the hydrophobic B-helix and flanking salt bridges between R105 and D123. Here, we test whether Nef self-association is mediated by this interface and address the overall significance of oligomerization. Results By co-immunoprecipitation assays, we demonstrated that HIV-1Nef exists as monomers and oligomers with about half of the Nef protomers oligomerized. Nef oligomers were found to be present in the cytosol and on membranes. Removal of the myristate did not enhance the oligomerization of soluble Nef. Also, SIVNef oligomerizes despite lacking a dimerization interface functionally homologous to that proposed for HIV-1Nef. Moreover, HIV-1Nef and SIVNef form hetero-oligomers demonstrating the existence of homologous oligomerization interfaces that are distinct from that previously proposed (R105-D123. Intracellular cross-linking by formaldehyde confirmed that SF2Nef dimers are present in intact cells, but surprisingly self-association was dependent on R105, but not D123. SIVMAC239Nef can be cross-linked at its only cysteine, C55, and SF2Nef is also cross-linked, but at C206 instead of C55, suggesting that Nefs exhibit multiple dimeric structures. ClusPro dimerization analysis of HIV-1Nef homodimers and HIV-1Nef/SIVNef heterodimers identified a new potential dimerization interface, including a dibasic motif at R105-R106 and a six amino acid hydrophobic surface. Conclusions We have demonstrated significant levels of intracellular Nef oligomers by immunoprecipitation from cellular extracts. However, our results are contrary to the identification of salt bridges between R105 and D123 as necessary for self-association. Importantly, binding between HIV-1Nef and SIVNef demonstrates evolutionary conservation and therefore significant function(s for oligomerization. Based on modeling studies of Nef self-association, we propose a new dimerization interface. Finally, our findings support a stochastic model of Nef function with a dispersed intracellular distribution of Nef oligomers.

  20. Effect Of Acute Caprine Trypanosomiasis On Haemoglobin, Urea ...

    African Journals Online (AJOL)

    Haemoglobin concentation of the infected goats was only slightly decreased. However, the serum urea level was significantly increased (P <0.05) while Cl, K+ and HCO3 levels were slightly increased above pre-infection values by week two post infection (PI). Serum Na+ increased only in the first week PI but returned to ...

  1. Prevalence of Contagious Caprine Pleuropneumonia in Goats in ...

    African Journals Online (AJOL)

    A total of 320 goat sera were examined for the presence of specific antibodies against Mycoplasma capricolum subsp. capripneumoniae using competitive ELISA. Of the sera tested, 206 (64.4%) were positive for CCPP. The seroprevalence of CCPP was significantly (P < 0.05) higher in adult (54.9%) than in young (45.1%) ...

  2. Development of a novel vaccine for contagious caprine ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    This project will use cutting-edge synthetic biology tools to construct a vaccine for CCPP that will grow efficiently, express protective Mccp antigens, and be used either as a live or inactivated vaccine. This 24-month project is a collaboration between the University of Bern in Switzerland, the Institut national de la recherche ...

  3. Development of a novel vaccine for contagious caprine ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... grow efficiently, express protective Mccp antigens, and be used either as a live or inactivated vaccine. This 24-month project is a collaboration between the University of Bern in Switzerland, the Institut national de la recherche agronomique at the University of Bordeaux, France, and the J. Craig Venter Institute in the USA.

  4. La gestion de la reproduction caprine au travers des femelles ...

    African Journals Online (AJOL)

    SARAH

    31 juil. 2015 ... interviewing the sellers at the various points of sale. The number of males and females was done by the counting made once a week in every point of sale. Females, chosen at random, identified according to the set of teeth, were subjected to ultrasound to determine gestation. For the descriptive study, the ...

  5. Cytokine and antibody production in naturally occuring caprine ...

    African Journals Online (AJOL)

    http://dx.doi.org/10.4314/tv.v23i1.4567 · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and Conditions of Use · Contact AJOL · News. OTHER RESOURCES... for Researchers · for Journals · for Authors · for Policy Makers ...

  6. Identification of novel SNP in caprine β-lactoglobulin gene

    Indian Academy of Sciences (India)

    goats (Chianese et al. 2000). A polymorphism in the pro- moter region of each Italian Girgentana goat with reduced β-LG content has recently been identified but has not been. Keywords. β-lactoglobulin gene; polymorphism; PCR-SSCP; milk traits; Mahabadi goat. Journal of Genetics, DOI 10.1007/s12041-016-0662-x, Vol.

  7. Transmissibility of caprine scrapie in ovine transgenic mice

    Science.gov (United States)

    Scrapie is a transmissible spongiform encephalopathy or prion disease of domestic sheep and goats. The current US and Canadian control programs are based on diagnosis by identification of abnormal prion protein in brain or lymphoid tissues with selective culling of genetically susceptible sheep exp...

  8. Haplotype combination of the caprine PC1 gene sequence variants ...

    Indian Academy of Sciences (India)

    Proprotein convertase 1 (PC1) is an endopeptidase involved in proteolytic processing of peptide hormone precursors in granules of the regulated secretory pathway of endocrine cells. Mutations in PC1 gene are related to obesity-related traits which may influence the performance of animals, and therefore it has been the ...

  9. [Epidemiology of caprine and ovine brucellosis in Formosa province, Argentina].

    Science.gov (United States)

    Russo, Ana M; Mancebo, Orlando A; Monzón, Carlos M; Gait, Juan J; Casco, Rubén D; Torioni de Echaide, Susana M

    2016-01-01

    An epidemiological study of brucellosis was carried out in 516 goats and mixed flocks (goat/sheep) from the three agro-ecological regions of Formosa province, Argentina. Serum samples from a total of 25401 goats and 2453 sheeps were analyzed using buffered plate agglutination test (BPAT) and complement fixation test (CFT). Bacteriological and PCR analyses on milk samples from goats in three flocks with a history of brucellosis and recent abortions were also performed. Brucellosis was detected in four of the nine departments of the province with an overall prevalence of 2% and an intra-flock prevalence ranging between 1% and 40%. The proportion of infected flocks was 3.6%, 12% and 36% for the eastern, central and western regions, respectively. Brucella melitensis bv. 1 was isolated efrom goats for the first time in the province. The expected fragments of 827bp from the omp2ab gene (Brucella spp.) and 731bp from the insert IS711 (B. melitensis) were amplified by PCR. Detection of antibodies by BPAT and FCT in sheep cohabiting with goats suggests that infections could have been caused by B. melitensis, posing an additional risk to public health. Control and eradication programs for brucellosis should consider mixed flocks as a single epidemiological unit. The results indicate that brucellosis by B. melitensis bv1 is highly endemic in the central and western regions of Formosa province. Copyright © 2015 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  10. Outbreak of caprine abortion by Toxoplasma gondii in Midwest Brazil

    Directory of Open Access Journals (Sweden)

    Flávio Henrique Bravim Caldeira

    2011-11-01

    Full Text Available An outbreak of abortion by Toxoplasma gondii in goats on a farm in the Brazilian Midwest is reported. Gross lesions were not observed in seven aborted fetuses submitted to the Veterinary Pathology Laboratory, Federal University of Mato Grosso, for necropsy investigation. The main histologic lesions were mononuclear cell pneumonia and necrotizing encephalitis in varying degrees of intensity. PCR for Brucella abortus and Neospora caninum and aerobic cultures were negative in all cases. Antibody titles against T. gondii varying from 1:1024 to 1:32.768 were detected in serum samples from four aborted goats. Nested-PCR assay for T. gondii were positive in brain samples of all cases submitted. These findings indicate that T. gondii infection should be considered in the diagnosis of abortion in goats in Midwest Brazil.

  11. Evidence of environmental pollution in caprine brains obtained from ...

    African Journals Online (AJOL)

    All the metals analysed showed relatively high concentrations in the olfactory bulb suggesting ongoing environmental pollution. The findings suggest that this type of investigation in the brain of goats or other animals can assist in knowing the level of human exposure to environmental pollutants (especially metals) in ...

  12. Rocket and Two Dimensional Immunoelectrophoresis in Diagnosis of Caprine Brucellosis.

    Science.gov (United States)

    Mehrabani, Davood; Gholami, Zahra; Kohanteb, Jamshid; Sepehrimanesh, Masood; Hosseini, Seyed Mohammad Hossein

    2015-08-01

    Brucellosis is a major bacterial zoonosis of global importance with the causative organisms of Gram-negative facultative intracellular pathogens. The aims of this study were to standardize two immunoelectrophoretic techniques, rocket and cross immunoelectrophoresis, and compare their results with other conventional serodiagnostic tests. Sera from 15 sheep, without any history of brucellosis vaccination, infected with Brucella melitensis M16 subcutaneously, were employed in a comparison of culture, precipitating, and immunoelectrophoretic tests. A 125 days serologic follow-up was performed after the infection was started. As a reference, these tests also done in the five healthy sheep. The results obtained with the rocket immunoelectrophoresis test correlated very well with those of the cross immunoelectrophoresis, whereas results of other tests such as culture, Rose Bengal, standard tube agglutination and 2-mercaptoethanol seruagglutination tests were inferior. As agglutination test shows cross reaction and a prozone phenomenon, and in blood culture, the bacteria is not always detectable, so they are time consuming rocket and cross immunoelectrophoresis are recommended because their results can be obtained in a shorter time.

  13. Identification of novel SNP in caprine β-lactoglobulin gene

    Indian Academy of Sciences (India)

    were same among the genotypic patterns while differences were related to T deletion and insertion (-/T) at nucleotide position. 93 with frequencies 0.22 and ... Blood samples were randomly collected from 143 Mahabadi goats reared in the .... SSCP patterns of β-LG gene in Iranian Mahabadi goats. goat milk (milk, fat% and ...

  14. Ante mortem Studies on Natural Caprine Besnoitiosis | Njenga ...

    African Journals Online (AJOL)

    The chronic disease was characterized with alopecia, hyperkeratosis mainly of the face, carpus, hock and brisket. Eighty three percent of the goats in poor body condition had 100 or more cysts per eye. Those in fair and good body condition easily succumbed to pneumonia. This indicates that the number of cysts in the eye ...

  15. Ethnoveterinary medicines used for ruminants in British Columbia, Canada

    Science.gov (United States)

    Lans, Cheryl; Turner, Nancy; Khan, Tonya; Brauer, Gerhard; Boepple, Willi

    2007-01-01

    Background The use of medicinal plants is an option for livestock farmers who are not allowed to use allopathic drugs under certified organic programs or cannot afford to use allopathic drugs for minor health problems of livestock. Methods In 2003 we conducted semi-structured interviews with 60 participants obtained using a purposive sample. Medicinal plants are used to treat a range of conditions. A draft manual prepared from the data was then evaluated by participants at a participatory workshop. Results There are 128 plants used for ruminant health and diets, representing several plant families. The following plants are used for abscesses: Berberis aquifolium/Mahonia aquifolium Echinacea purpurea, Symphytum officinale, Bovista pila, Bovista plumbea, Achillea millefolium and Usnea longissima. Curcuma longa L., Salix scouleriana and Salix lucida are used for caprine arthritis and caprine arthritis encephalitis.Euphrasia officinalis and Matricaria chamomilla are used for eye problems. Wounds and injuries are treated with Bovista spp., Usnea longissima, Calendula officinalis, Arnica sp., Malva sp., Prunella vulgaris, Echinacea purpurea, Berberis aquifolium/Mahonia aquifolium, Achillea millefolium, Capsella bursa-pastoris, Hypericum perforatum, Lavandula officinalis, Symphytum officinale and Curcuma longa. Syzygium aromaticum and Pseudotsuga menziesii are used for coccidiosis. The following plants are used for diarrhea and scours: Plantago major, Calendula officinalis, Urtica dioica, Symphytum officinale, Pinus ponderosa, Potentilla pacifica, Althaea officinalis, Anethum graveolens, Salix alba and Ulmus fulva. Mastitis is treated with Achillea millefolium, Arctium lappa, Salix alba, Teucrium scorodonia and Galium aparine. Anethum graveolens and Rubus sp., are given for increased milk production.Taraxacum officinale, Zea mays, and Symphytum officinale are used for udder edema. Ketosis is treated with Gaultheria shallon, Vaccinium sp., and Symphytum officinale. Hedera

  16. Ethnoveterinary medicines used for ruminants in British Columbia, Canada.

    Science.gov (United States)

    Lans, Cheryl; Turner, Nancy; Khan, Tonya; Brauer, Gerhard; Boepple, Willi

    2007-02-26

    The use of medicinal plants is an option for livestock farmers who are not allowed to use allopathic drugs under certified organic programs or cannot afford to use allopathic drugs for minor health problems of livestock. In 2003 we conducted semi-structured interviews with 60 participants obtained using a purposive sample. Medicinal plants are used to treat a range of conditions. A draft manual prepared from the data was then evaluated by participants at a participatory workshop. There are 128 plants used for ruminant health and diets, representing several plant families. The following plants are used for abscesses: Berberis aquifolium/Mahonia aquifolium Echinacea purpurea, Symphytum officinale, Bovista pila, Bovista plumbea, Achillea millefolium and Usnea longissima. Curcuma longa L., Salix scouleriana and Salix lucida are used for caprine arthritis and caprine arthritis encephalitis. Euphrasia officinalis and Matricaria chamomilla are used for eye problems. Wounds and injuries are treated with Bovista spp., Usnea longissima, Calendula officinalis, Arnica sp., Malva sp., Prunella vulgaris, Echinacea purpurea, Berberis aquifolium/Mahonia aquifolium, Achillea millefolium, Capsella bursa-pastoris, Hypericum perforatum, Lavandula officinalis, Symphytum officinale and Curcuma longa. Syzygium aromaticum and Pseudotsuga menziesii are used for coccidiosis. The following plants are used for diarrhea and scours: Plantago major, Calendula officinalis, Urtica dioica, Symphytum officinale, Pinus ponderosa, Potentilla pacifica, Althaea officinalis, Anethum graveolens, Salix alba and Ulmus fulva. Mastitis is treated with Achillea millefolium, Arctium lappa, Salix alba, Teucrium scorodonia and Galium aparine. Anethum graveolens and Rubus sp., are given for increased milk production. Taraxacum officinale, Zea mays, and Symphytum officinale are used for udder edema. Ketosis is treated with Gaultheria shallon, Vaccinium sp., and Symphytum officinale. Hedera helix and Alchemilla

  17. The Norwegian Healthier Goats program--modeling lactation curves using a multilevel cubic spline regression model.

    Science.gov (United States)

    Nagel-Alne, G E; Krontveit, R; Bohlin, J; Valle, P S; Skjerve, E; Sølverød, L S

    2014-07-01

    In 2001, the Norwegian Goat Health Service initiated the Healthier Goats program (HG), with the aim of eradicating caprine arthritis encephalitis, caseous lymphadenitis, and Johne's disease (caprine paratuberculosis) in Norwegian goat herds. The aim of the present study was to explore how control and eradication of the above-mentioned diseases by enrolling in HG affected milk yield by comparison with herds not enrolled in HG. Lactation curves were modeled using a multilevel cubic spline regression model where farm, goat, and lactation were included as random effect parameters. The data material contained 135,446 registrations of daily milk yield from 28,829 lactations in 43 herds. The multilevel cubic spline regression model was applied to 4 categories of data: enrolled early, control early, enrolled late, and control late. For enrolled herds, the early and late notations refer to the situation before and after enrolling in HG; for nonenrolled herds (controls), they refer to development over time, independent of HG. Total milk yield increased in the enrolled herds after eradication: the total milk yields in the fourth lactation were 634.2 and 873.3 kg in enrolled early and enrolled late herds, respectively, and 613.2 and 701.4 kg in the control early and control late herds, respectively. Day of peak yield differed between enrolled and control herds. The day of peak yield came on d 6 of lactation for the control early category for parities 2, 3, and 4, indicating an inability of the goats to further increase their milk yield from the initial level. For enrolled herds, on the other hand, peak yield came between d 49 and 56, indicating a gradual increase in milk yield after kidding. Our results indicate that enrollment in the HG disease eradication program improved the milk yield of dairy goats considerably, and that the multilevel cubic spline regression was a suitable model for exploring effects of disease control and eradication on milk yield. Copyright © 2014

  18. Ethnoveterinary medicines used for ruminants in British Columbia, Canada

    Directory of Open Access Journals (Sweden)

    Brauer Gerhard

    2007-02-01

    Full Text Available Abstract Background The use of medicinal plants is an option for livestock farmers who are not allowed to use allopathic drugs under certified organic programs or cannot afford to use allopathic drugs for minor health problems of livestock. Methods In 2003 we conducted semi-structured interviews with 60 participants obtained using a purposive sample. Medicinal plants are used to treat a range of conditions. A draft manual prepared from the data was then evaluated by participants at a participatory workshop. Results There are 128 plants used for ruminant health and diets, representing several plant families. The following plants are used for abscesses: Berberis aquifolium/Mahonia aquifolium Echinacea purpurea, Symphytum officinale, Bovista pila, Bovista plumbea, Achillea millefolium and Usnea longissima. Curcuma longa L., Salix scouleriana and Salix lucida are used for caprine arthritis and caprine arthritis encephalitis.Euphrasia officinalis and Matricaria chamomilla are used for eye problems. Wounds and injuries are treated with Bovista spp., Usnea longissima, Calendula officinalis, Arnica sp., Malva sp., Prunella vulgaris, Echinacea purpurea, Berberis aquifolium/Mahonia aquifolium, Achillea millefolium, Capsella bursa-pastoris, Hypericum perforatum, Lavandula officinalis, Symphytum officinale and Curcuma longa. Syzygium aromaticum and Pseudotsuga menziesii are used for coccidiosis. The following plants are used for diarrhea and scours: Plantago major, Calendula officinalis, Urtica dioica, Symphytum officinale, Pinus ponderosa, Potentilla pacifica, Althaea officinalis, Anethum graveolens, Salix alba and Ulmus fulva. Mastitis is treated with Achillea millefolium, Arctium lappa, Salix alba, Teucrium scorodonia and Galium aparine. Anethum graveolens and Rubus sp., are given for increased milk production.Taraxacum officinale, Zea mays, and Symphytum officinale are used for udder edema. Ketosis is treated with Gaultheria shallon, Vaccinium sp., and

  19. Dados sorológicos sobre a presença e distribuição da artrite-encefalite caprina (CAE no Estado da Bahia , Brasil.

    Directory of Open Access Journals (Sweden)

    A. Figueredo

    2005-03-01

    Full Text Available RESUMO: Para verificar a soroprevalência da artrite-encefalite caprina (Cae foram analisadas 1605 amostras de hemo-soros de caprinos pertencentes a rebanhos localizados em nove microrregiões geográficas e distribuídos em 24 municípios do Estado da Bahia, os quais nos foram enviados para exame no Laboratório de Viroses da Escola de Medicina Veterinária. A população estudada compreendeu animais de criatórios de leite e corte, de manejo intensivo, semi-intensivo e extensivo, das raças: alpina, anglo-nubiana, boer, mambrina, saanen, toggenburg e sem raça definida(SRD. Foram positivos ao teste de imunodifusão em ágar gel (IDAG 215 (13,4% hemo-soros de caprinos. Nas raças sanen, alpina e anglo-nubiana foram encontradas um maior número de animais positivos, respectivamente 77 (18,92%, 80 (16,06% e 49 (15,76%. Entre as amostras positivas a maior frequência foi de fêmeas 194 (90,23% e adultos 193 (89,77%. Os resultados obtidos comprovam a existência da CAE na região e a necessidade de novas pesquisas que avaliem o índice de infecção dos animais e as formas de prevenção e controle da doença, PALAVRAS CHAVE: Artrite – encefalite caprina, teste da imunidade, fusão em agar gel, doenças em caprinos SUMMARY: To verify the soroprevalency of the caprine arthritis-encephalitis (CAE 1605 samples of goats hemo-serums belonging to flocks located in nine geographical microrregiões were analyzed and distributed in 24 municipal districts of the State of Bahia. This samples were sent to Laboratory of Viruses of the Veterinary Medicine School to analysis. The studied population understood animals of herd of milk and court, of intensive, semi-intensive and extensive handling, of the races: alpine, anglo-nubiana, boer, mambrina, saanen, toggenburg and without race defined(SRD. They were positive to the agar gel imunodifusion test (IDAG 215 (13,4% goats hemo-serums. In the races

  20. The Norwegian Healthier Goats programme--a financial cost-benefit analysis.

    Science.gov (United States)

    Nagel-Alne, G Elise; Asheim, Leif J; Hardaker, J Brian; Sølverød, Liv; Lindheim, Dag; Valle, Paul S

    2014-05-01

    The aim of this study was to evaluate the profitability to dairy goat farmers of participating in the Healthier Goats disease control and eradication programme (HG), which was initiated in 2001 and is still running. HG includes the control and eradication of caprine arthritis encephalitis (CAE), caseous lymphadenitis (CLA) and paratuberculosis (Johne's disease) in Norwegian goat herds. The profitability of participation was estimated in a financial cost-benefit analysis (CBA) using partial budgeting to quantify the economic consequences of infectious disease control through HG versus taking no action. Historical data were collected from 24 enrolled dairy goat herds and 21 herds not enrolled in HG, and supplemented with information from a questionnaire distributed to the same farmers. Expert opinions were collected to arrive at the best possible estimates. For some input parameters there were uncertainty due to imperfect knowledge, thus these parameters were modelled as PERT probability distributions and a stochastic simulation model was built. The CBA model was used to generate distributions of net present value (NPV) of farmers' net cash flows for choosing to enroll versus not enrolling. This was done for three selected milk quota levels of 30000L, 50000L and 70000L, and both for before and after the introduction of a reduced milk price for the non-enrolled. The NPVs were calculated over time horizons of 5, 10 and 20 years using an inflation-adjusted discount rate of 2.8% per annum. The results show that participation in HG on average was profitable over a time horizon of 10 years or longer for quota levels of 50000L and 70000L, although not without risk of having a negative NPV. If farmers had to pay all the costs themselves, participation in HG would have been profitable only for a time horizon beyond 20 years. In 2012, a reduced milk price was introduced for farmers not enrolled in HG, changing the decision criteria for farmers, and thus, the CBA. When the

  1. Evidence of scrapie transmission to sheep via goat milk.

    Science.gov (United States)

    Konold, Timm; Thorne, Leigh; Simmons, Hugh A; Hawkins, Steve A C; Simmons, Marion M; González, Lorenzo

    2016-09-17

    Previous studies confirmed that classical scrapie can be transmitted via milk in sheep. The current study aimed to investigate whether scrapie can also be transmitted via goat milk using in vivo (new-born lambs fed milk from scrapie-affected goats due to the unavailability of goat kids from guaranteed scrapie-free herds) and in vitro methods (serial protein misfolding cyclic amplification [sPMCA] on milk samples). In an initial pilot study, new-born lambs of two different prion protein gene (PRNP) genotypes (six VRQ/VRQ and five ARQ/ARQ) were orally challenged with 5 g brain homogenate from two scrapie-affected goats to determine susceptibility of sheep to goat scrapie. All sheep challenged with goat scrapie brain became infected based on the immunohistochemical detection of disease-associated PrP (PrP(sc)) in lymphoid tissue, with an ARQ/ARQ sheep being the first to succumb. Subsequent feeding of milk to eight pairs of new-born ARQ/ARQ lambs, with each pair receiving milk from a different scrapie-affected goat, resulted in scrapie in the six pairs that received the largest volume of milk (38-87 litres per lamb), whereas two pairs fed 8-9 litres per lamb, and an environmental control group raised on sheep milk from healthy ewes, did not show evidence of infection when culled at up to 1882 days of age. Infection in those 12 milk recipients occurred regardless of the clinical status, PrP(sc) distribution, caprine arthritis-encephalitis virus infection status and PRNP polymorphisms at codon 142 (II or IM) of the donor goats, but survival time was influenced by PRNP polymorphisms at codon 141. Serial PMCA applied to a total of 32 milk samples (four each from the eight donor goats collected throughout lactation) detected PrP(sc) in one sample each from two goats. The scrapie agent was present in the milk from infected goats and was able to transmit to susceptible species even at early preclinical stage of infection, when PrP(sc) was undetectable in the brain of the

  2. Hybrid Lentivirus-transposon Vectors With a Random Integration Profile in Human Cells

    DEFF Research Database (Denmark)

    Staunstrup, Nicklas H; Moldt, Brian; Mátés, Lajos

    2009-01-01

    Sleeping Beauty (SB) transposon vectors have a significantly safer insertion profile, but efficient delivery into relevant cell/tissue types is a limitation. In an attempt to combine the favorable features of the two vector systems we established a novel hybrid vector technology based on SB transposase...... directs efficient transposon mobilization from DNA circles in vector-transduced cells. Both transfected plasmid DNA and transduced IDLVs can serve as the source of active transposase. Most important, we demonstrate that the SB transposase overrides the natural lentiviral integration pathway and directs...... vector integration less frequently toward transcriptional units, resulting in a random genomic integration profile. The novel hybrid vector system combines the attractive features of efficient gene delivery by viral transduction and a safer genomic integration profile by DNA transposition....

  3. Targeting Prostate Cancer for Gene Therapy Utilizing Lentivirus and Oncolytic VSV Virus

    Science.gov (United States)

    2010-04-01

    Approved for public release; distribution unlimited The views, opinions and/or findings contained in this report are those of the...Exp Neurol, 2006. 65(9): p. 846-54. 13. Msaouel, P ., A . Dispenzieri, and E . Galanis, Clinical testing of engineered oncolytic measles virus strains...using ex vivo gene transfer as vaccines for the treatment of genitourinary malignancies. Cancer Chemother Pharmacol, 2000. 46 Suppl: p. S67-72. 32

  4. Restriction of the felid lentiviruses by a synthetic feline TRIM5-CypA fusion.

    Science.gov (United States)

    Dietrich, Isabelle; McEwan, William A; Hosie, Margaret J; Willett, Brian J

    2011-10-15

    Gene therapy approaches to the treatment of HIV infection have targeted both viral gene expression and the cellular factors that are essential for virus replication. However, significant concerns have been raised regarding the potential toxic effects of such therapies, the emergence of resistant viral variants and unforeseen biological consequences such as enhanced susceptibility to unrelated pathogens. Novel restriction factors formed by the fusion of the tripartite motif protein (TRIM5) and cyclophilin A (CypA), or "TRIMCyps", offer an effective antiviral defence strategy with a very low potential for toxicity. In order to investigate the potential therapeutic utility of TRIMCyps in gene therapy for AIDS, a synthetic fusion protein between feline TRIM5 and feline CypA was generated and transduced into cells susceptible to infection with feline immunodeficiency virus (FIV). The synthetic feline TRIMCyp was highly efficient at preventing infection with both HIV and FIV and the cells resisted productive infection with FIV from either the domestic cat or the puma. Feline TRIMCyp and FIV infection of the cat offers a unique opportunity to evaluate TRIMCyp-based approaches to genetic therapy for HIV infection and the treatment of AIDS. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Immune responses are required to terminate viremia in equine infectious anemia lentivirus infection.

    OpenAIRE

    Perryman, L E; O'Rourke, K I; McGuire, T C

    1988-01-01

    Six normal and four immunodeficient horses were injected with a cloned variant of equine infectious anemia virus (EIAV). The six normal horses had detectable EIAV in their plasma by 7 days postinjection. During their primary viremic episode, which was accompanied by fever and anemia, maximum titers of EIAV in plasma ranged from 10(3.8) to 10(4.8) 50% tissue culture infective doses per ml. All six normal horses cleared detectable virus from their plasma by 21 to 35 days after injection. Horses...

  6. Viroporin potential of the lentivirus lytic peptide (LLP domains of the HIV-1 gp41 protein

    Directory of Open Access Journals (Sweden)

    Garry Robert F

    2007-11-01

    Full Text Available Abstract Background Mechanisms by which HIV-1 mediates reductions in CD4+ cell levels in infected persons are being intensely investigated, and have broad implications for AIDS drug and vaccine development. Virally induced changes in membrane ionic permeability induced by lytic viruses of many families contribute to cytopathogenesis. HIV-1 induces disturbances in plasma membrane ion transport. The carboxyl terminus of TM (gp41 contains potential amphipathic α-helical motifs identified through their structural similarities to naturally occurring cytolytic peptides. These sequences have been dubbed lentiviral lytic peptides (LLP -1, -2, and -3. Results Peptides corresponding to the LLP domains (from a clade B virus partition into lipid membranes, fold into α-helices and disrupt model membrane permeability. A peptide corresponding to the LLP-1 domain of a clade D HIV-1 virus, LLP-1D displayed similar activity to the LLP-1 domain of the clade B virus in all assays, despite a lack of amino acid sequence identity. Conclusion These results suggest that the C-terminal domains of HIV-1 Env proteins may form an ion channel, or viroporin. Increased understanding of the function of LLP domains and their role in the viral replication cycle could allow for the development of novel HIV drugs.

  7. Life History of the Oldest Lentivirus: Characterization of ELVgv Integrations in the Dermopteran Genome

    Czech Academy of Sciences Publication Activity Database

    Hron, Tomáš; Farkašová, Helena; Padhi, A.; Pačes, Jan; Elleder, Daniel

    2016-01-01

    Roč. 33, č. 10 (2016), s. 2659-2669 ISSN 0737-4038 R&D Projects: GA MŠk(CZ) LK11215 Institutional support: RVO:68378050 Keywords : endogenous retrovirus * dermoptera * TRIM5 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.202, year: 2016

  8. Simplified lentivirus vector production in protein-free media using polyethylenimine-mediated transfection.

    Science.gov (United States)

    Kuroda, Hitoshi; Kutner, Robert H; Bazan, Nicolas G; Reiser, Jakob

    2009-05-01

    During the past 12 years, lentiviral vectors have emerged as valuable tools for transgene delivery because of their ability to transduce nondividing cells and their capacity to sustain long-term transgene expression. Despite significant progress, the production of high-titer high-quality lentiviral vectors is cumbersome and costly. The most commonly used method to produce lentiviral vectors involves transient transfection using calcium phosphate (CaP)-mediated precipitation of plasmid DNAs. However, inconsistencies in pH can cause significant batch-to-batch variations in lentiviral vector titers, making this method unreliable. This study describes optimized protocols for lentiviral vector production based on polyethylenimine (PEI)-mediated transfection, resulting in more consistent lentiviral vector stocks. To achieve this goal, simple production methods for high-titer lentiviral vector production involving transfection of HEK 293T cells immediately after plating were developed. Importantly, high titers were obtained with cell culture media lacking serum or other protein additives altogether. As a consequence, large-scale lentiviral vector stocks can now be generated with fewer batch-to-batch variations and at reduced costs and with less labor compared to the standard protocols.

  9. Neutralizing activities of caprine antibodies towards conserved regions of the HCV envelope glycoprotein E2

    Directory of Open Access Journals (Sweden)

    El-Shenawy Reem

    2011-08-01

    Full Text Available Abstract Anti HCV vaccine is not currently available and the present antiviral therapies fail to cure approximately half of the treated HCV patients. This study was designed to assess the immunogenic properties of genetically conserved peptides derived from the C-terminal region of HVR-1 and test their neutralizing activities in a step towards developing therapeutic and/or prophylactic immunogens against HCV infection. Antibodies were generated by vaccination of goats with synthetic peptides derived from HCV E2. Viral neutralizing capacity of the generated anti E2 antibodies was tested using in vitro assays. Goats immunized with E2 synthetic peptides termed p412 [a.a 412-419], p430 [a.a 430-447] and p517 [a.a 517-531] generated high titers of antibody responses 2 to 4.5 fold higher than comparable titers of antibodies to the same epitopes in chronic HCV patients. In post infection experiments of native HCV into cultured Huh7.5 cells anti p412 and anti p 517 were proven to be neutralizing to HCV genotype 4a from patients' sera (87.5% and 75% respectively. On the contrary anti p430 exhibited weak viral neutralization capacity on the same samples (31.25%. Furthermore Ab mixes containing anti p430 exhibited reduced viral neutralization properties. From these experiments one could predict that neutralization by Abs towards different E2-epitopes varies considerably and success in the enrichment of neutralization epitope-specific antibodies may be accompanied by favorable results in combating HCV infection. Also, E2 conserved peptides p517 and p412 represent potential components of a candidate peptide vaccine against HCV infection.

  10. Characterization of human mucin (MUC15) and identification of ovine and caprine orthologs

    DEFF Research Database (Denmark)

    Pallesen, Lone Tjener; Pedersen, Lise Refstrup Linnebjerg; Petersen, Torben Ellebæk

    2008-01-01

    expression in placenta, salivary gland, thyroid gland, trachea, esophagus, kidney, testis, and the leukemia K-562 cell line. Furthermore, moderate expression was seen in the pancreas, adult and fetal lung, fetal kidney, lymph node, adult and fetal thymus, and parietal lobe. Structural motifs for interactions...

  11. Caprine hepatic lipidosis induced through the intake of low levels of dietary cobalt.

    Science.gov (United States)

    Johnson, Eugene H; Al-Habsi, Khalid; Kaplan, Evelyn; Srikandakumar, Anandarajah; Kadim, Isam T; Annamalai, Kanthi; Al-Busaidy, Rashid; Mahgoub, Osman

    2004-09-01

    Forty-one, 10-week-old newly weaned goats were randomly allocated into two groups, namely control (n=22) and treated (n=19). Kids in both groups were fed Rhodegrass hay ad libitum that contained lipidosis associated with low liver levels of cobalt. Only one (5.3%) of the treated goats developed hepatic lipidosis. Contrary to previous reports that suggested that goats are less sensitive to low levels of dietary cobalt than sheep, it is apparent that this is not the case with Omani goats. This is the first report of the induction of hepatic lipidosis in goats due to feeding low levels of cobalt in their diet.

  12. Isolation and Identification of Sodium Fluoroacetate Degrading Bacteria from Caprine Rumen in Brazil

    Directory of Open Access Journals (Sweden)

    Expedito K. A. Camboim

    2012-01-01

    Full Text Available The objective of this paper was to report the isolation of two fluoroacetate degrading bacteria from the rumen of goats. The animals were adult goats, males, crossbred, with rumen fistula, fed with hay, and native pasture. The rumen fluid was obtained through the rumen fistula and immediately was inoculated 100 μL in mineral medium added with 20 mmol L−1 sodium fluoroacetate (SF, incubated at 39°C in an orbital shaker. Pseudomonas fluorescens (strain DSM 8341 was used as positive control for fluoroacetate dehalogenase activity. Two isolates were identified by 16S rRNA gene sequencing as Pigmentiphaga kullae (ECPB08 and Ancylobacter dichloromethanicus (ECPB09. These bacteria degraded sodium fluoroacetate, releasing 20 mmol L−1 of fluoride ion after 32 hours of incubation in Brunner medium containing 20 mmol L−1 of SF. There are no previous reports of fluoroacetate dehalogenase activity for P. kullae and A. dichloromethanicus. Control measures to prevent plant intoxication, including use of fences, herbicides, or other methods of eliminating poisonous plants, have been unsuccessful to avoid poisoning by fluoroacetate containing plants in Brazil. In this way, P. kullae and A. dichloromethanicus may be used to colonize the rumen of susceptible animals to avoid intoxication by fluoroacetate containing plants.

  13. Isolation and Identification of Sodium Fluoroacetate Degrading Bacteria from Caprine Rumen in Brazil

    OpenAIRE

    Expedito K. A. Camboim; Arthur P. Almeida; Michelle Z. Tadra-Sfeir; Felício G. Junior; Paulo P. Andrade; Chris S. McSweeney; Marcia A. Melo; Franklin Riet-Correa

    2012-01-01

    The objective of this paper was to report the isolation of two fluoroacetate degrading bacteria from the rumen of goats. The animals were adult goats, males, crossbred, with rumen fistula, fed with hay, and native pasture. The rumen fluid was obtained through the rumen fistula and immediately was inoculated 100  μ L in mineral medium added with 20 mmol L−1 sodium fluoroacetate (SF), incubated at 39°C in an orbital shaker. Pseudomonas fluorescens (strain DSM 8341) was used as positive control ...

  14. Sperm subpopulational dinamycs during the cryopreservation procedure in caprine (Capra aegagrus hircus ejaculates

    Directory of Open Access Journals (Sweden)

    Barbas JP

    2017-08-01

    Full Text Available The objective of the present research was to determine specific sperm subpopulational dynamics in different processing steps during cryopreservation process by using objective functional sperm kinematic descriptors in goat ejaculates. Fresh ejaculates (n=40 collected from eight bucks were analised for volume, concentration, sperm viability, acrosome integrity, and sperm motility using computer-assisted sperm analysis (CASA system. Eight sperm kinematic descriptors (VCL, VSL, VAP, LIN, STR, BCF, ALH, and WOB were assessed using CASA system after five different handling step (1st: fresh semen collection (F; 2nd: 1st washing/centrifugation step (1WC; 3rd: 2nd washing / centrifugation step (2WC; 4th: cooling step at 4ºC (CL; and 5th: post-thawing step at 37ºC (PT during a standard cryopreservation protocol for goat semen. The results obtained from the kinematic parameters were analysed by using Principal Component Analysis (PCA and multivariate clustering procedures to identify specific kinematic subpopulations and establish the relationship between the distribution of the subpopulations found and the functional sperm motility in each step. Except for the 1st (SbpF1-SbpF3 and 4th (SbpCL1-SbpCL3 intervals, four sperm kinematic subpopulations (Sbp1LC1-Sbp1LC4, Sbp2LC1-Sbp2LC4 and SbpPD1-SbpPD4 were observed. Based on kinematic velocity parameters and the subpopulation disclosed, rapid, slow, vigorous, passive, non-progressive and progressive sperm were discerned. Moreover, based on kinematic linearity parameters and depending on the subpopulation uncovered, curvilinear, regular-linear, parabolic and erratic-non-linear trajectories were detected. Subpopulations remained varible throughout handling steps and multiple significant differences among the sperm kinematic parameters were observed (p<0.001 as well as in the frequency of distribution of kinematic subpopulations among steps (p<0.05. In conclusion, this study confirms the variability and heterogeneity of goat sperm kinematic patterns throughout the cryopreservation process. The relationships among sperm subpopulation structure and the different handling steps were particularlly relevant, specially after the cooling and the post-thawing steps, when effects derived from these critical handling steps were evident and altered drastically the sperm motion patterns

  15. Pathogenesis and inflammatory response in experimental caprine mastitis due to Staphylococcus chromogenes.

    Science.gov (United States)

    Lasagno, M; Ortiz, M; Vissio, C; Yaciuk, R; Bonetto, C; Pellegrino, M; Bogni, C; Odierno, L; Raspanti, C

    2018-03-01

    Coagulase-negative staphylococci (CNS) are the most frequently isolated bacteria in cases of subclinical mastitis in dairy cows. CNS species may differ in their pathogenicity, but very little is known about their virulence factors or their immune response in intramammary infections. To our knowledge, no experimental studies into the mastitis pathogenesis caused by CNS have been described in lactating goats. The aim of this study was to induce an experimentally Staphylococcus chromogenes mastitis in lactating goats aimed at verifying if the model can be used to evaluate the inflammatory response, the dynamics of infection and the pathological findings within the first hours of intramammary inoculation. Six Saanen goats in mid-lactation were inoculated with 1 × 10 7 colony forming units of S. chromogenes. Bacterial growth peaked in milk from the challenged right halves of the mammary glands (RMG) at 4 h post inoculation (PI). Shedding of viable bacteria showed a marked decrease at 12 h PI. An increase in mean somatic cell counts was observed in the milk samples from 8 h PI onwards. Mild clinical signs were evoked by intramammary inoculation. Staphylococcus chromogenes could be isolated in tissue from all RMG. Histological examination of specimens of the RMG and lymph nodes of the goats showed an increased inflammatory response throughout the experiment with respect to control halves. In conclusion, the experimental inoculation of S. chromogenes in lactating goats is capable of eliciting an inflammatory response and capable of causing pathological changes. This research represents a preliminary study for a better knowledge of the mastitis pathogenesis caused by S. chromogenes. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. RC3/neurogranin structure and expression in the caprine brain in relation to congenital hypothyroidism

    NARCIS (Netherlands)

    Piosik, P. A.; van Groenigen, M.; Ponne, N. J.; Bolhuis, P. A.; Baas, F.

    1995-01-01

    In view of the profound effects of thyroid hormone deficiency on the central nervous system (CNS), neuronal genes regulated by thyroid hormone could potentially be involved in the development of the CNS. Expression of the neuronal gene RC3/neurogranin was shown to be induced by thyroid hormone in

  17. Effects of polymorphisms in ovine and caprine prion protein alleles on cell-free conversion

    Directory of Open Access Journals (Sweden)

    Eiden Martin

    2011-02-01

    Full Text Available Abstract In sheep polymorphisms of the prion gene (PRNP at the codons 136, 154 and 171 strongly influence the susceptibility to scrapie and bovine spongiform encephalopathy (BSE infections. In goats a number of other gene polymorphisms were found which are suspected to trigger similar effects. However, no strong correlation between polymorphisms and TSE susceptibility in goats has yet been obtained from epidemiological studies and only a low number of experimental challenge data are available at present. We have therefore studied the potential impact of these polymorphisms in vitro by cell-free conversion assays using mouse scrapie strain Me7. Mouse scrapie brain derived PrPSc served as seeds and eleven recombinant single mutation variants of sheep and goat PrPC as conversion targets. With this approach it was possible to assign reduced conversion efficiencies to specific polymorphisms, which are associated to low frequency in scrapie-affected goats or found only in healthy animals. Moreover, we could demonstrate a dominant-negative inhibition of prion polymorphisms associated with high susceptibility by alleles linked to low susceptibility in vitro.

  18. Degradation of spent craft brewer’s yeast by caprine rumen hyper ammonia-producing bacteria

    Science.gov (United States)

    Spent brewer’s yeast has long been included in ruminant diets as a protein supplement. However, modern craft beers often include more hops (Humulus lupulus L.) compounds than traditional recipes. These compounds include alpha and beta-acids, which are antimicrobial to the rumen hyper ammonia-produci...

  19. Isolation and Identification of Sodium Fluoroacetate Degrading Bacteria from Caprine Rumen in Brazil

    Science.gov (United States)

    Camboim, Expedito K. A.; Almeida, Arthur P.; Tadra-Sfeir, Michelle Z.; Junior, Felício G.; Andrade, Paulo P.; McSweeney, Chris S.; Melo, Marcia A.; Riet-Correa, Franklin

    2012-01-01

    The objective of this paper was to report the isolation of two fluoroacetate degrading bacteria from the rumen of goats. The animals were adult goats, males, crossbred, with rumen fistula, fed with hay, and native pasture. The rumen fluid was obtained through the rumen fistula and immediately was inoculated 100 μL in mineral medium added with 20 mmol L−1 sodium fluoroacetate (SF), incubated at 39°C in an orbital shaker. Pseudomonas fluorescens (strain DSM 8341) was used as positive control for fluoroacetate dehalogenase activity. Two isolates were identified by 16S rRNA gene sequencing as Pigmentiphaga kullae (ECPB08) and Ancylobacter dichloromethanicus (ECPB09). These bacteria degraded sodium fluoroacetate, releasing 20 mmol L−1 of fluoride ion after 32 hours of incubation in Brunner medium containing 20 mmol L−1 of SF. There are no previous reports of fluoroacetate dehalogenase activity for P. kullae and A. dichloromethanicus. Control measures to prevent plant intoxication, including use of fences, herbicides, or other methods of eliminating poisonous plants, have been unsuccessful to avoid poisoning by fluoroacetate containing plants in Brazil. In this way, P. kullae and A. dichloromethanicus may be used to colonize the rumen of susceptible animals to avoid intoxication by fluoroacetate containing plants. PMID:22919294

  20. Activation of innate immune genes in caprine blood leukocytes after systemic endotoxin challenge

    DEFF Research Database (Denmark)

    Salvesen, Øyvind; Reiten, Malin R; Heegaard, Peter M. H.

    2016-01-01

    Sepsis is a serious health problem associated with a range of infectious diseases in animals and humans. Early events of this syndrome can be mimicked by experimental administration of lipopolysaccharides (LPS). Compared with mice, small ruminants and humans are highly sensitive to LPS, making go...... insights into the dynamic regulation of innate immune genes, as well as raising new questions regarding the importance of ISGs and extrahepatic APPs in leukocytes after systemic endotoxin challenge....... goats valuable in inflammatory models. We performed a longitudinal study in eight Norwegian dairy goats that received LPS (0.1 μg/kg, Escherichia coli O26:B6) intravenously. A control group of five goats received corresponding volumes of sterile saline. Clinical examinations were performed continuously...... with the acute phase response, type I interferon signaling, LPS cascade and apoptosis, in addition to cytokines and chemokines were targeted. Pro-inflammatory genes, such as IL1B, CCL3 and IL8, were significantly up-regulated. Interestingly, increased mRNA levels of seven interferon stimulated genes (ISGs) were...

  1. Biological activity evaluation of cloned and expressed caprine growth hormone from local Pakistani goat breed beetal

    International Nuclear Information System (INIS)

    Butt, H.I.; Shahzad, M.I.; Bashir, Q.

    2011-01-01

    Growth hormone cDNA of local goat breed-beetal was amplified by RT PCR and gene including leader sequence was cloned in pTZR57 cloning vector. The cGH-pTZR57 clone was confirmed by restriction digestion and sequence analyses before finally sub-cloning the gene in pND- a mammalian expression vector. The clones were again confirmed by restriction digestion and PCR analyses. Highly purified, supercoiled cGH-pND construct was used to transfect Vero cell lines for expression studies. The in vitro expression of cGH was checked by dot-ELISA technique. After confirming its in vitro cell line based expression, the construct was injected to 4 weeks old balb/c mice intramuscularly. Two animals were euthanized per week till four weeks to monitor the in vivo biological activity by evaluating the tibia epiphyseal width and body weight gain assays. Significant increase in tibia epiphyseal width and gain in body weight was observed from vaccinated animals. The study supports the concept that DNA based therapeutics are an efficient and cost effective method for gene delivery and in vivo transgene expressions. (author)

  2. Effects of polymorphisms in ovine and caprine prion protein alleles on cell-free conversion.

    Science.gov (United States)

    Eiden, Martin; Soto, Elizabeth Ortega; Mettenleiter, Thomas C; Groschup, Martin H

    2011-02-15

    In sheep polymorphisms of the prion gene (PRNP) at the codons 136, 154 and 171 strongly influence the susceptibility to scrapie and bovine spongiform encephalopathy (BSE) infections. In goats a number of other gene polymorphisms were found which are suspected to trigger similar effects. However, no strong correlation between polymorphisms and TSE susceptibility in goats has yet been obtained from epidemiological studies and only a low number of experimental challenge data are available at present. We have therefore studied the potential impact of these polymorphisms in vitro by cell-free conversion assays using mouse scrapie strain Me7. Mouse scrapie brain derived PrPSc served as seeds and eleven recombinant single mutation variants of sheep and goat PrPC as conversion targets. With this approach it was possible to assign reduced conversion efficiencies to specific polymorphisms, which are associated to low frequency in scrapie-affected goats or found only in healthy animals. Moreover, we could demonstrate a dominant-negative inhibition of prion polymorphisms associated with high susceptibility by alleles linked to low susceptibility in vitro.

  3. Experimental caprine neosporosis: the influence of gestational stage on the outcome of infection.

    Science.gov (United States)

    Porto, Wagnner José Nascimento; Regidor-Cerrillo, Javier; Kim, Pomy de Cássia Peixoto; Benavides, Julio; Silva, Ana Clécia dos Santos; Horcajo, Pilar; Oliveira, Andrea Alice da Fonseca; Ferre, Ignacio; Mota, Rinaldo Aparecido; Ortega-Mora, Luis Miguel

    2016-02-11

    Here, we assessed outcome of experimental infection by Neospora caninum in goats intravenously inoculated with 10(6) tachyzoites of the Nc-Spain7 isolate at 40 (G1), 90 (G2) and 120 (G3) days of gestation. Infected goats had fever between 5 and 9 days post inoculation (dpi); all were seropositive at the time of abortion/birth. Foetal death occurred in G1 from 10 to 21 dpi (n = 7) and in G2 from 27 to 35 dpi (n = 4). Goats in G2 also had seropositive stillbirth (n = 1) and healthy kids (n = 2). G3 goats (n = 7) had 3 seropositive and 3 seronegative weak kids, and 2 seronegative healthy kids. Parasite DNA detection in placentomes was 100% in G2, 85.7% in G3 and in G1 was detected only in placentomes from the goats with foetal losses from 17 dpi (100%). Parasites were detected in foetal/kid brain (>85.7%) and liver (≥ 50%) of G2 and G3, and in G1 after 17 dpi (100%). The highest parasite loads were detected in the placentomes of G1 from 17 dpi and G2, and in foetal tissues of G1 from 17 dpi and G3. Multifocal necrotic lesions were observed in the placentas of the three groups, but they were larger and more frequent in G1 and G2. Similar lesions were observed in foetal tissues, but they were more frequent in G3. These findings suggest that, as observed in cattle and sheep, the clinical consequences of N. caninum in pregnant goats are dependent in part on the time of gestation when animals were infected.

  4. La rentabilité du caprin au travers du taux de gestation observé ...

    African Journals Online (AJOL)

    SARAH

    30 sept. 2016 ... supérieure au t théorique, il s'en suivait une différence significative entre les deux moyennes. Pour les effectifs supérieurs à 30, l'analyse reposait sur le test de. Fischer pour la décision. RESULTATS. Fréquence des mise-bas : En étude descriptive des élevages les moyennes mensuelles de mise-bas (0,2-.

  5. Benzofuran ketone dosage-dependent rayless goldenrod (Isocoma pluriflora) toxicosis in a caprine model

    Science.gov (United States)

    The objectives of this study were to determine the dosage of benzofuran ketone compounds (tremetone, 3-hydroxytremetone, dehydrotremetone, and 3-oxyangeloyltremetone) and the duration of exposure to these compounds required to produce clinical signs and the associated pathological changes of rayles ...

  6. Ovine and Caprine Brucellosis (Brucella melitensis in Aborted Animals in Jordanian Sheep and Goat Flocks

    Directory of Open Access Journals (Sweden)

    Assadullah Samadi

    2010-01-01

    Full Text Available Two hundred and fifty five biological samples were collected from 188 animals (81 sheep and 107 goats during the lambing season from September 2009 to April 2010 from the Mafraq region of Jordan. Sampled animals belonged to 93 sheep and goat flocks that had abortion cases in the region. One hundred and seven (41.9% biological samples were positive for the omp2 primers that were able to identify all Brucella species in the collected samples which were obtained from 86 aborted animals (86/188=45.7%. Using the B. melitensis insertion sequence 711 (IS711 primers on the 107 omp2 positive samples, only 61 confirmed to be positive for B. melitensis. These positive samples were obtained from 28 sheep and 33 goats. The prevalence rate of B. melitensis was 27.1% (51/188 among aborted animals. For differentiation between vaccine strain and field strain infection, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP method using PstI endonuclease enzyme was used. Vaccination with Rev-1 in the last year (OR=2.92, CI: 1.1–7.7 and grazing at common pasture (OR=2.78, CI: 1.05–7.36 were statistically significant (P≤.05 risk factors positively associated with the occurrence of brucellosis in sheep and goat flocks.

  7. Dermatopathology of Caprine Scabies and Protective Immunity in Sensitised Goats Against Sarcoptes scabiei Reinfestation

    Directory of Open Access Journals (Sweden)

    Simson Tarigan

    2002-12-01

    Full Text Available The purpose of this study was to compare macroscopic dermatopathology in naïve and sensitised goats, and to assess protective immunity possessed by sensitised goats against Sarcoptes scabiei challenge. Eighteen goats were allocated evenly into 3 groups; group 1 sensitised with the mite twice, group 2 once and group 3 was not sensitised (naïve. Sensitisation was done by infesting goats with the mites on the auricle and infestation was allowed to progress for 7 weeks, then the goats were treated with Ivermectin to obtain complete recovery. After sensitisation, all sensitised and naïve goats were infested with the mites on the auricles. Infestation in the sensitised goat caused severe immediate hypersensitivity that resulted in severe peracute pustular dermatitis. After one week, however, the lesion waned slowly. At 7 weeks post infestation, the remnant of lesion could only be perceived by palpation on the primary site of infestation as a mild papular dermatitis. Infestation on the naïve goats, in contrast, produced slowly progressing lesions which at 7-week post infestation, it ended up with severe crusted scabies affecting almost the whole skin. Antigens responsible for the immediate hypersensitivity which are supposedly contained in the mite secretions or excretions are immunologically protective but unlikely to have the capacity to induce a complete protection against mite challenge in immunised animals. This notion is based on the fact obtained from this study that goats sensitised twice did not possess a higher immune protection against mite challenge than goats sensitised once.

  8. Manufacture of Third-Generation Lentivirus for Preclinical Use, with Process Development Considerations for Translation to Good Manufacturing Practice

    OpenAIRE

    Gándara, Carolina; Affleck, Valerie; Stoll, Elizabeth Ann

    2018-01-01

    Lentiviral vectors are used in laboratories around the world for in vivo and ex vivo delivery of gene therapies, and increasingly clinical investigation as well as preclinical applications. The third-generation lentiviral vector system has many advantages, including high packaging capacity, stable gene expression in both dividing and post-mitotic cells, and low immunogenicity in the recipient organism. Yet, the manufacture of these vectors is challenging, especially at high titers required fo...

  9. Profound Differences in Virus Population Genetics Correspond to Protection from CD4 Decline Resulting from Feline Lentivirus Coinfection

    Directory of Open Access Journals (Sweden)

    Abinash Padhi

    2010-12-01

    Full Text Available CD4 decline is a hallmark of disease onset in individuals infected with Feline Immunodeficiency Virus (FIV or Human Immunodeficiency Virus type 1 (HIV-1. Cats that are infected with a poorly replicating, apathogenic FIV (PLV prior to exposure to a virulent FIV strain (FIVC maintain CD4 numbers by mechanisms that are not correlated with a measurable adaptive immune response or reduction in circulating viral load. We employed population genetic approaches based on the 3' portion of the viral genome to estimate the population structure of FIVC from single and dual infected cats. In dual infected cats, FIVC effective population size was decreased during the initial viral expansion phase, and after three weeks of infection, the population declined sharply. The FIVC population recovered to pre-bottleneck levels approximately seven weeks post-FIVC infection. However, the population emerging from the bottleneck in dual infected cats was distinct based on estimates of temporal population structure and substitution profiles. The transition to transversion rate ratio (k increased from early to late phases in dual infected cats due primarily to a decrease in transversions whereas in single infected cats, k declined over time. Although one clone with extensive G to A substitutions, indicative of host cytidine deaminase editing, was recovered from a dual infected cat during the bottleneck, the post bottleneck population had an overall reduction in G to A substitutions. These data are consistent with a model of PLV-induced host restriction, putatively involving host DNA editing, that alters the dynamics of FIVC throughout the course of infection leading to disease attenuation.

  10. Complete genome sequences of two genotype A2 small ruminant lentiviruses isolated from infected U.S. sheep

    Science.gov (United States)

    Two distinct subgroups of genotype A2 SRLVs have been identified in the U.S. that infect sheep in association with their transmembrane protein 154 (TMEM154) diplotypes. Here, we report the first two complete genome sequences for SRLV strains infecting U.S. sheep belonging to genotype A2, subgroups 1...

  11. Cryptosporidium ubiquitum, C. muris and Cryptosporidium deer genotype in wild cervids and caprines in the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Kotková, Michaela; Němejc, K.; Sak, Bohumil; Hanzal, V.; Květoňová, Dana; Hlásková, Lenka; Čondlová, Šárka; McEvoy, J.; Kváč, Martin

    2016-01-01

    Roč. 63, 25 January (2016), č. článku 003. ISSN 1803-6465 R&D Projects: GA ČR GA15-01090S Institutional support: RVO:60077344 Keywords : Cryptosporidiidae * epidemiology * phylogeny * SSU * gp60 Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 1.082, year: 2016

  12. Regional distribution and accumulation of lead in caprine brain tissues following a long-term oral dosing regimen.

    Science.gov (United States)

    Steuerwald, Amy J; Blaisdell, Frank S; Geraghty, Ciaran M; Parsons, Patrick J

    2014-01-01

    It is well known that the brain is a key target organ for lead (Pb)-induced toxicity, with exposure potentially resulting in numerous adverse neurological effects. However, information on the distribution and accumulation of Pb within different brain regions is scarce. In this study, Pb uptake and accumulation were characterized in brain and related tissues obtained from a convenience sample of goats dosed with Pb. Tissues were harvested postmortem from 10 animals (9 dosed and 1 undosed) that are used to produce blood Pb pools for the New York State Department of Health's Proficiency Testing program. Whole brains were subdivided into 14 distinct anatomical regions to explore interregional differences. Related tissues included the olfactory epithelium and spinal cord. Where sufficient tissue mass permitted, further subdivision into smaller sections was carried out to examine intraregional Pb variability. Determination of Pb content in these tissues was accomplished using inductively coupled plasma mass spectrometry (ICP-MS), with accuracy assessed using reference materials certified for Pb. Lead content (dry weight) varied from <10 ng/g, that is, below the method detection limit, to as much as 4.45 × 10(4) ng/g Pb. Olfactory epithelium Pb content was several orders of magnitude greater than found in other regions analyzed. Enrichment of Pb was also observed in the olfactory bulb and choroid plexus. Data for each region analyzed were pooled from all goats to identify regions with the greatest propensity for Pb accumulation. Data related to Pb content were also assessed individually within each goat and significant differences in Pb content between regions were determined.

  13. 'La Fiebre de Malta': An interface of Farmers and Caprine Brucellosis Control Policies in the Bajio Region, Mexico

    NARCIS (Netherlands)

    Oseguera Montiel, D.; Udo, H.M.J.; Frankena, K.; Zijpp, van der A.J.

    2017-01-01

    This article shows that socio-economic factors, defined here as practices, knowledge, interests, beliefs and experiences have a role in the adoption of brucellosis control strategies in the Bajío region, Mexico. We combined qualitative and quantitative methods to show that socio-economic factors

  14. Hops (Humulus lupulus) ß-acid as an inhibitor of caprine rumen hyper-ammonia-producing bacteria in vitro

    Science.gov (United States)

    Antimicrobial plant secondary metabolites increase rumen efficiency and decrease waste products (i.e. ammonia, methane) in some cases. A promising source of bioactive secondary metabolites is the hops plant (Humulus lupulus L.), which produces '-acid, a suite of structurally similar, potent antibact...

  15. OCORRÊNCIA DE LENTIVÍRUS DE PEQUENOS RUMINANTES NO SEMIÁRIDO BAIANO E PERFIL DA CAPRINO/OVINOCULTURA NA REGIÃO

    Directory of Open Access Journals (Sweden)

    Silvia Ines Sardi

    2012-12-01

    Full Text Available The aim of this study was to analyze the occurrence of Small Ruminants Lentiviruses (SRLV: Caprine arthrite encephalitis virus, CAEV, and Maedi-Visna, MVV and characterize the social/economical profile of the farms in the semi-arid region of Portal do Sertão, Sisal e Bacia do Jacuípe, in the state of Bahia, Brazil. Sera from goats (n= 1046 and sheep (704 were collected to detect antibodies against CAEV and MVV by Agar Immunodifusion (AGID and ELISA and Western Blot for CAEV. A questionnaire was applied to each farm where sera were collected in order to define the social/economical profile. The results obtained by AGID showed no positive goats and sheep for infection by CAEV or MVV, respectively, but 5/755 sera were positive for CAEV by ELISA and confirmed by Western blot. The questionnaire analysis showed a low technical profile in the smallholders, under familiar management, whose flocks were raised in an extensive system destined to self-consumption or local trading. In conclusion, this work demonstrated a low incidence of SRLV, and that the production in the farms of the semi-arid region is based mainly in goat and sheep herds without specific breed, destined for for self-consumption or local commercialization.

  16. Hybrid lentivirus-phiC31-int-NLS vector allows site-specific recombination in murine and human cells but induces DNA damage.

    Directory of Open Access Journals (Sweden)

    Nicolas Grandchamp

    Full Text Available Gene transfer allows transient or permanent genetic modifications of cells for experimental or therapeutic purposes. Gene delivery by HIV-derived lentiviral vector (LV is highly effective but the risk of insertional mutagenesis is important and the random/uncontrollable integration of the DNA vector can deregulate the cell transcriptional activity. Non Integrative Lentiviral Vectors (NILVs solve this issue in non-dividing cells, but they do not allow long term expression in dividing cells. In this context, obtaining stable expression while avoiding the problems inherent to unpredictable DNA vector integration requires the ability to control the integration site. One possibility is to use the integrase of phage phiC31 (phiC31-int which catalyzes efficient site-specific recombination between the attP site in the phage genome and the chromosomal attB site of its Streptomyces host. Previous studies showed that phiC31-int is active in many eukaryotic cells, such as murine or human cells, and directs the integration of a DNA substrate into pseudo attP sites (pattP which are homologous to the native attP site. In this study, we combined the efficiency of NILV for gene delivery and the specificity of phiC31-int for DNA substrate integration to engineer a hybrid tool for gene transfer with the aim of allowing long term expression in dividing and non-dividing cells preventing genotoxicity. We demonstrated the feasibility to target NILV integration in human and murine pattP sites with a dual NILV vectors system: one which delivers phiC31-int, the other which constitute the substrate containing an attB site in its DNA sequence. These promising results are however alleviated by the occurrence of significant DNA damages. Further improvements are thus required to prevent chromosomal rearrangements for a therapeutic use of the system. However, its use as a tool for experimental applications such as transgenesis is already applicable.

  17. Generation of a human embryonic stem cell line, NERCe003-A-1, with lentivirus vector-mediated inducible CTNNB1 overexpression

    Directory of Open Access Journals (Sweden)

    Yang Wang

    2018-04-01

    Full Text Available The human embryonic stem cell (hESC line NERCe003-A-1 was generated by introducing lentiviral-vector–mediated tetracycline-inducible β-catenin expression into a normal hESC line, NERCe003-A. The resulting cell line can overexpress the β-catenin protein, encoded by the CTNNB1 gene, after exposure to doxycycline (Dox. CTNNB1 gene expression was confirmed by quantitative PCR (qPCR and immunofluorescence assays. Further characterization confirmed that the NERCe003-A-1 cell line expresses typical pluripotency markers and has the ability to form the three germ layers both in vitro and in vivo.

  18. Gene delivery in malignant B cells using the combination of lentiviruses conjugated to anti-transferrin receptor antibodies and an immunoglobulin promoter.

    Science.gov (United States)

    Leoh, Lai Sum; Morizono, Kouki; Kershaw, Kathleen M; Chen, Irvin S Y; Penichet, Manuel L; Daniels-Wells, Tracy R

    2014-01-01

    We previously developed an antibody-avidin fusion protein (ch128.1Av) specific for the human transferrin receptor 1 (TfR1; CD71) to be used as a delivery vector for cancer therapy and showed that ch128.1Av delivers the biotinylated plant toxin saporin-6 into malignant B cells. However, as a result of widespread expression of TfR1, delivery of the toxin to normal cells is a concern. Therefore, we explored the potential of a dual targeted lentiviral-mediated gene therapy strategy to restrict gene expression to malignant B cells. Targeting occurs through the use of ch128.1Av or its parental antibody without avidin (ch128.1) and through transcriptional regulation using an immunoglobulin promoter. Flow cytometry was used to detect the expression of enhanced green fluorescent protein (EGFP) in a panel of cell lines. Cell viability after specific delivery of the therapeutic gene FCU1, a chimeric enzyme consisting of cytosine deaminase genetically fused to uracil phosphoribosyltransferse that converts the 5-fluorocytosine (5-FC) prodrug into toxic metabolites, was monitored using the MTS or WST-1 viability assay. We found that EGFP was specifically expressed in a panel of human malignant B-cell lines, but not in human malignant T-cell lines. EGFP expression was observed in all cell lines when a ubiquitous promoter was used. Furthermore, we show the decrease of cell viability in malignant plasma cells in the presence of 5-FC and the FCU1 gene. The present study demonstrates that gene expression can be restricted to malignant B cells and suggests that this dual targeted gene therapy strategy may help to circumvent the potential side effects of certain TfR1-targeted protein delivery approaches. Copyright © 2014 John Wiley & Sons, Ltd.

  19. Expression of nerve growth factor carried by pseudotyped lentivirus improves neuron survival and cognitive functional recovery of post-ischemia in rats.

    Science.gov (United States)

    Cao, Jia-Yu; Lin, Yong; Han, Yan-Fei; Ding, Sheng-Hao; Fan, Yi-Ling; Pan, Yao-Hua; Zhao, Bing; Guo, Qin-Hua; Sun, Wen-Hua; Wan, Jie-Qing; Tong, Xiao-Ping

    2018-02-06

    Nerve growth factor (NGF) has been reported to prevent neuronal damage and contributes to the functional recovery in animal brain injury models and human ischemic disease as well. We aimed to investigate a potential therapeutic effect of NGF gene treatment in ischemic stroke and to estimate the functional recovery both at the cellular and cognitive levels in an ischemia rat model. After microinjection of pseudolentivirus-delivered β-NGF into an established ischemic stroke model in rats (tMCAO), we estimated neuronal cell apoptosis with TUNEL labeling and neurogenesis by cell proliferation marker Ki67 staining in both ischemic core and penumbra of striatum. Furthermore, we used behavioral functional tests, Morris water maze performance, to evaluate cognitive functional recovery in vivo and propose a potential underlying mechanism. We found that pseudolentivirus-mediated delivery of β-NGF gene into the brain induced high expression in striatum of the infarct core area after ischemia in rats. The β-NGF overexpression in the striatal infarction core after ischemia not only improved neuronal survival by reducing cell apoptosis and increasing cell proliferation, but also rescued cognitive functional impairment through upregulation of GAP-43 protein expression in tMCAO rat model of ischemia. This study demonstrates a potential β-NGF gene therapy by utilization of pseudolentivirus in ischemia and indicates future applications of NGF gene treatment in ischemic patients. © 2018 John Wiley & Sons Ltd.

  20. Radiochemotherapy of hepatocarcinoma via lentivirus-mediated transfer of human sodium iodide symporter gene and herpes simplex virus thymidine kinase gene

    Energy Technology Data Exchange (ETDEWEB)

    Chen Libo, E-mail: libochen888@hotmail.com [Department of Nuclear Medicine, Shanghai Sixth People' s Hospital, Shanghai Jiao Tong University, Shanghai 200233 (China); Guo Guoying [Xinyuan Institute of Medicine and Biotechnology, School of Life Sciences, Zhejiang Sci-Tech University, Hangzhou 310018 (China); Liu Tianjing; Guo Lihe [Division of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Zhu Ruisen [Department of Nuclear Medicine, Shanghai Sixth People' s Hospital, Shanghai Jiao Tong University, Shanghai 200233 (China)

    2011-07-15

    Herpes simplex virus thymidine kinase (HSV-TK) gene/ganciclovir (GCV) system has been widely used as a traditional gene therapy modality, and the sodium/iodide symporter gene (NIS) has been found to be a novel therapeutic gene. Since the therapeutic effects of radioiodine therapy or prodrug chemotherapy on cancers following NIS or HSV-TK gene transfer need to be enhanced, this study was designed to investigate the feasibility of radiochemotherapy for hepatocarcinoma via coexpression of NIS gene and HSV-TK gene. Methods: HepG2 cells were stably transfected with NIS, TK and GFP gene via recombinant lentiviral vector and named HepG2/NTG. Gene expression was examined by reverse transcriptase polymerase chain reaction, fluorescence imaging and iodide uptake. The therapeutic effects were assessed by MTT assay and clonogenic assay. Results: HepG2/NTG cells concentrated {sup 125}I{sup -} up to 76-fold higher than the wild-type cells within 20 min, and the efflux happened with a T{sub 1/2eff} of less than 10 min. The iodide uptake in HepG2/NTG cells was specifically inhibited by sodium perchlorate. Dose-dependent toxicity to HepG2/NTG cells by either GCV or {sup 131}I was revealed by clonogenic assay and MTT assay, respectively. The survival rate of HepG2/NTG cells decreased to 49.7%{+-}2.5%, 43.4%{+-}2.8% and 8.6%{+-}1.2% after exposure to {sup 131}I, GCV and combined therapy, respectively. Conclusion: We demonstrate that radiochemotherapy of hepatocarcinoma via lentiviral-mediated coexpression of NIS gene and HSV-TK gene leads to stronger killing effect than single treatment, and in vivo studies are needed to verify these findings.

  1. Immobilized Lentivirus Vector on Chondroitin Sulfate-Hyaluronate Acid-Silk Fibroin Hybrid Scaffold for Tissue-Engineered Ligament-Bone Junction

    OpenAIRE

    Sun, Liguo; Li, Hongguo; Qu, Ling; Zhu, Rui; Fan, Xiangli; Xue, Yingsen; Xie, Zhenghong; Fan, Hongbin

    2014-01-01

    The lack of a fibrocartilage layer between graft and bone remains the leading cause of graft failure after anterior cruciate ligament (ACL) reconstruction. The objective of this study was to develop a gene-modified silk cable-reinforced chondroitin sulfate-hyaluronate acid-silk fibroin (CHS) hybrid scaffold for reconstructing the fibrocartilage layer. The scaffold was fabricated by lyophilizing the CHS mixture with braided silk cables. The scanning electronic microscopy (SEM) showed that micr...

  2. Phenotypic and Functional Attributes of Lentivirus Modified CD19-specific Human CD8+ Central Memory T Cells Manufactured at Clinical Scale

    OpenAIRE

    Wang, Xiuli; Naranjo, Araceli; Brown, Christine E.; Bautista, Cherrilyn; Wong, ChingLam W.; Chang, Wen-Chung; Aguilar, Brenda; Ostberg, Julie R.; Riddell, Stanley R.; Forman, Stephen J.; Jensen, Michael C.

    2012-01-01

    A key determinant of the therapeutic potency of adoptive T cell transfer is the extent to which infused cells can persist and expand in vivo. Ex vivo propagated virus-specific and chimeric antigen receptor (CAR) redirected anti-tumor CD8+ effector T cells derived from CD45RA−CD62L+ central memory (TCM) precursors engraft long-term and reconstitute functional memory following adoptive transfer. Here, we describe a clinical-scale, closed system, immunomagnetic selection method to isolate CD8+ T...

  3. Partial Correction of Psoriasis upon Genetic Knock-Down of Human TNF-α by Lentivirus-Encoded shRNAs in a Xenograft Mouse Model

    DEFF Research Database (Denmark)

    Jakobsen, Maria; Stenderup, Karin; Rosada, Cecilia

    characteristics of human psoriasis skin. Blockade of TNF- function with specific inhibitors at the protein level has resulted in a rapid clinical improvement in psoriasis patients, demonstrating that TNF- inhibition offers a promising therapy of psoriasis. Whether TNF- -encoding RNA is a valid therapeutic target...... taken three weeks after injection. qPCR-based measurements of TNF- mRNA in skin treated with lentiviral vector-encoded TNF- shRNA demonstrated a 50% reduction in the level of TNF- mRNA. Most interestingly, the epidermal thickness of the human psoriatic plaques was reduced relative to mice treated...

  4. Blocking the Wnt/β-Catenin Pathway by Lentivirus-Mediated Short Hairpin RNA Targeting β-Catenin Gene Suppresses Silica-Induced Lung Fibrosis in Mice

    Science.gov (United States)

    Wang, Xin; Dai, Wujing; Wang, Yanrang; Gu, Qing; Yang, Deyi; Zhang, Ming

    2015-01-01

    Silicosis is a form of occupational lung disease caused by inhalation of crystalline silica dust. While the pathogenesis of silicosis is not clearly understood, the Wnt/β-catenin signaling pathway is thought to play a major role in lung fibrosis. To explore the role of Wnt/β-catenin pathway in silicosis, we blocked Wnt/β-catenin pathway both in silica-treated MLE-12 cells (a mouse pulmonary epithelial cell line) and in a mouse silicosis model by using a lentiviral vector expressing a short hairpin RNA silencing β-catenin (Lv-shβ-catenin). In vitro, Lv-shβ-catenin significantly decreased the expression of β-catenin, MMP2 and MMP9, and secretion of TGF-β1. In vivo, intratracheal treatment with Lv-shβ-catenin significantly reduced expression of β-catenin in the lung and levels of TGF-β1 in bronchoalveolar lavage fluid, and notably attenuated pulmonary fibrosis as evidenced by hydroxyproline content and collagen I\\III synthesis in silica-administered mice. These results indicate that blockade of the Wnt/β-catenin pathway can prevent the development of silica-induced lung fibrosis. Thus Wnt/β-catenin pathway may be a target in prevention and treatment of silicosis. PMID:26340635

  5. Effect of lentivirus-mediated shRNA inactivation of HK1, HK2, and HK3 genes in colorectal cancer and melanoma cells.

    Science.gov (United States)

    Kudryavtseva, Anna V; Fedorova, Maria S; Zhavoronkov, Alex; Moskalev, Alexey A; Zasedatelev, Alexander S; Dmitriev, Alexey A; Sadritdinova, Asiya F; Karpova, Irina Y; Nyushko, Kirill M; Kalinin, Dmitry V; Volchenko, Nadezhda N; Melnikova, Nataliya V; Klimina, Kseniya M; Sidorov, Dmitry V; Popov, Anatoly Y; Nasedkina, Tatiana V; Kaprin, Andrey D; Alekseev, Boris Y; Krasnov, George S; Snezhkina, Anastasiya V

    2016-12-22

    The switch from oxidative phosphorylation to glycolysis in proliferating cancer cells, even under aerobic conditions, has been shown first in 1926 by Otto Warburg. Today this phenomenon is known as the "Warburg effect" and recognized as a hallmark of cancer. The metabolic shift to glycolysis is associated with the alterations in signaling pathways involved in energy metabolism, including glucose uptake and fermentation, and regulation of mitochondrial functions. Hexokinases (HKs), which catalyze the first step of glycolysis, have been identified to play a role in tumorigenesis of human colorectal cancer (CRC) and melanoma. However, the mechanism of action of HKs in the promotion of tumor growth remains unclear. The purpose of the present study was to investigate the effect of silencing of hexokinase genes (HK1, HK2, and HK3) in colorectal cancer (HT-29, SW 480, HCT-15, RKO, and HCT 116) and melanoma (MDA-MB-435S and SK-MEL-28) cell lines using short hairpin RNA (shRNA) lentiviral vectors. shRNA lentiviral plasmid vectors pLSLP-HK1, pLSLP-HK2, and pLSLP-HK3 were constructed and then transfected separately or co-transfected into the cells. HK2 inactivation was associated with increased expression of HK1 in colorectal cancer cell lines pointing to the compensation effect. Simultaneous attenuation of HK1 and HK2 levels led to decreased cell viability. Co-transfection with shRNA vectors against HK1, HK2, and HK3 mRNAs resulted in a rapid cell death via apoptosis. We have demonstrated that simultaneous inactivation of HK1 and HK2 was sufficient to decrease proliferation and viability of melanoma and colorectal cancer cells. Our results suggest that HK1 and HK2 could be the key therapeutic targets for reducing aerobic glycolysis in examined cancers.

  6. Tightly regulated and homogeneous transgene expression in human adipose-derived mesenchymal stem cells by lentivirus with tet-off system.

    Directory of Open Access Journals (Sweden)

    Hiroyuki Moriyama

    Full Text Available Genetic modification of human adipose tissue-derived multilineage progenitor cells (hADMPCs is highly valuable for their exploitation in therapeutic applications. Here, we have developed a novel single tet-off lentiviral vector platform. This vector combines (1 a modified tetracycline (tet-response element composite promoter, (2 a multi-cistronic strategy to express an improved version of the tet-controlled transactivator and the blasticidin resistance gene under the control of a ubiquitous promoter, and (3 acceptor sites for easy recombination cloning of the gene of interest. In the present study, we used the cytomegalovirus (CMV or the elongation factor 1 α (EF-1α promoter as the ubiquitous promoter, and EGFP was introduced as the gene of interest. hADMPCs transduced with a lentiviral vector carrying either the CMV promoter or the EF-1α promoter were effectively selected by blasticidin without affecting their stem cell properties, and EGFP expression was strictly regulated by doxycycline (Dox treatment in these cells. However, the single tet-off lentiviral vector carrying the EF-1α promoter provided more homogenous expression of EGFP in hADMPCs. Intriguingly, differentiated cells from these Dox-responsive cell lines constitutively expressed EGFP only in the absence of Dox. This single tet-off lentiviral vector thus provides an important tool for applied research on hADMPCs.

  7. Optimization of Soft Tissue Management, Spacer Design, and Grafting Strategies for Large Segmental Bone Defects using the Chronic Caprine Tibial Defect Model

    Science.gov (United States)

    2016-12-01

    reconstructed into 3D volumes using a modified tent-Feldkamp algorithm and calibrated to mg/cm3 of HA using an air/water/hydroxyapatite phantom scanned...inner layer” (zone immediately adjacent to the spacer) and an “outer” layer. “C” Samples were minced and incubated in 10 ml of prepared digest...modeling algorithms fail when the data contains missing values; one exception to that are Bayesian based algorithms . The data collected was missing

  8. 'La fiebre de Malta': An Interface of Farmers and Caprine Brucellosis Control Policies in the Bajío Region, Mexico.

    Science.gov (United States)

    Oseguera Montiel, D; Udo, H M J; Frankena, K; van der Zijpp, A

    2017-02-01

    This article shows that socio-economic factors, defined here as practices, knowledge, interests, beliefs and experiences have a role in the adoption of brucellosis control strategies in the Bajío region, Mexico. We combined qualitative and quantitative methods to show that socio-economic factors with regard to goat husbandry and brucellosis control are not taken into account in the current policy to combat the disease in Mexico. Farmers ranked constraints like the price of goat milk more important than the control of the disease. The impact of brucellosis in goats is hidden to farmers, and the term brucellosis is still a strange name to them; it is better known as 'la fiebre de Malta' (Malta fever), which farmers are aware of and which they avoid by not drinking goat milk. Brucellosis control measures cause losses such as abortion due to vaccination and ear infections due to ear tagging. In the villages of the state of Michoacán, the uptake of a vaccination and testing programme was almost complete because it was offered for free, whereas in villages of Jalisco, vaccination was not adopted thoroughly because the cost of vaccination was high for farmers and because of a lack of veterinarians offering the service. Neither compensation for culling suspected infected goats does exist nor the infrastructure, like slaughterhouses, to ensure that goats that are brucellosis seropositive are not resold to neighbouring farmers. This article disputes the idea that brucellosis is confined to the lack of awareness and participation of farmers in control measures, but rather that policies are promulgated without a good knowledge of goat husbandry and farmers' perceptions. We claim that governmental authorities should reformulate the policy to take into account socio-economic factors shaping farmers' behaviour so that effective control measures will be adopted by goat farmers. © 2015 Blackwell Verlag GmbH.

  9. Antimicrobial effects of hops (Humulus lupulus) beta-acid on the growth and ammonia production of caprine ruminal hyper-ammonia-producing bacteria

    Science.gov (United States)

    Goats and other ruminants require the symbiotic microbes that live in the rumen to digest fiberous plant tissues. However, some rumen microbes impede animal health and performance. The hyper-ammonia-producing bacteria (HAB) catabolize nutitionally important amino acids, and produce ammonia (NH3). ...

  10. Optimization of Soft Tissue Management, Spacer Design, and Grafting Strategies for Large Segmental Bone Defects using the Chronic Caprine Tibial Defect Model

    Science.gov (United States)

    2015-12-01

    Foundation for the Advancement of Military Medicine Bethesda, MD 20817 REPORT DATE: December 2015 TYPE OF REPORT: Final Report PREPARED FOR: U.S...D’Alleyrand) Dr. D’Alleyrand had continued his interaction with Drs. Pluhar and Muschler and the veterinary staff at Cleveland Clinic during the animal...Colonies in Culture, A. International , Editor. 2012. 11. APPENDICES: Attach all appendices that contain information that supplements, clarifies or

  11. Characterization of a caprine beta-lactoglobulin pseudogene, identification and chromosomal localization by in situ hybridization in goat, sheep and cow.

    Science.gov (United States)

    Folch, J M; Coll, A; Hayes, H C; Sànchez, A

    1996-10-24

    A beta-lactoglobulin (beta-LG) pseudogene has been isolated and sequenced (7634 bp) in goat. Its structure is remarkably similar to that of the beta-LG gene with all seven exons placed in the same relative position. The pseudogene seems to have originated by gene duplication, but a non uniform distribution of similarities along the sequence suggests that events of gene conversion have also occurred during its evolution. The comparison of the predicted ancestral protein encoded by the pseudogene shows its evolutionary relationship to the monomeric beta-LG II forms of the beta-LG reported in some non-ruminant species. Southern-blot analysis shows that similar pseudogenes are also found in the genome of sheep and cow. The pseudogene has been mapped by fluorescent in situ hybridization (FISH) to sheep chromosome 3p28 and cattle and goat chromosomes 11q28, in the same mapped position as that found for the beta-LG gene in all these species.

  12. Osmosis and viscoelasticity both contribute to time-dependent behaviour of the intervertebral disc under compressive load: A caprine in vitro study.

    Science.gov (United States)

    Emanuel, Kaj S; van der Veen, Albert J; Rustenburg, Christine M E; Smit, Theodoor H; Kingma, Idsart

    2018-03-21

    The mechanical behaviour of the intervertebral disc highly depends on the content and transport of interstitial fluid. It is unknown, however, to what extent the time-dependent behaviour can be attributed to osmosis. Here we investigate the effect of both mechanical and osmotic loading on water content, nucleus pressure and disc height. Eight goat intervertebral discs, immersed in physiological saline, were subjected to a compressive force with a pressure needle inserted in the nucleus. The loading protocol was: 10 N (6 h); 150 N (42 h); 10 N (24 h). Half-way the 150 N-phase (24 h), we eliminated the osmotic gradient by adding 26% poly-ethylene glycol to the surrounding fluid. For 62 additional discs, we determined the water content of both nucleus and annulus after 6, 24, 48, or 72 h. The compressive load was initially counterbalanced by the hydrostatic pressure in the nucleus. The load forced 4.3% of the water out of the nucleus, which reduced nucleus pressure by 44(±6)%. Reduction of the osmotic gradient disturbed the equilibrium disc height, and a significant loss of annulus water content was found. Remarkably, pressure and water content of the nucleus pulposus remained unchanged. This shows that annulus water content is important in the response to axial loading. After unloading, in the absence of an osmotic gradient, there was substantial viscoelastic recovery of 53(±11)% of the disc height, without a change in water content. However, for restoration of the nucleus pressure and for full restoration of disc height, restoration of the osmotic gradient was needed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Polymorphism of the caprine malic enzyme 1 ( ME1) gene and its association with milk quality traits in Murciano-Granadina goats.

    Science.gov (United States)

    Zidi, A; Serradilla, J M; Jordana, J; Carrizosa, J; Urrutia, B; Polvillo, O; González-Redondo, P; Gallardo, D; Amills, M; Fernández-Cabanás, V M

    2010-12-01

    Malic enzyme 1 plays a fundamental role in lipid metabolism because it yields a significant amount of the NADPH necessary for fatty acid biosynthesis. In ruminants, however, its contribution to this biochemical process seems to be less relevant than in other livestock species. In this study, we have partially sequenced the goat ME1 gene with the aim of identifying polymorphic sites. Structural analysis of the goat ME1 amino acid partial sequence evidenced the existence of two dinucleotide-binding motifs, located at positions 158 to 163 (GLGDLG) and 301 to 306 (GAGEAA), and three amino acid residues (E245, D246 and D269) involved in the binding of Mn2+ and strongly conserved among mammalian species. Moreover, multiple sequence alignment allowed us to identify four single nucleotide polymorphisms at exons 5 (c.483C > T), 6 (c.667G > A), 9 (c.927C > T) and 11 (c.1200G > A). The effects of ME1 genotype on milk production and composition traits were investigated in a Murciano-Granadina goat population. None of the associations found reached statistical significance after applying Benjamini-Hochberg correction. At most, associations with uncorrected P-values below 0.01 were observed for C16:0, C18:1n-9t and total conjugated linoleic acids. These negative results reinforce the notion that ME1 plays an ancillary role in ruminant lipogenesis.

  14. Perfil eletroforético e concentração de imunoglobulinas G (IgG do soro sanguíneo de cabras Saanen com mastite experimental induzida por Staphylococcus aureus suplementadas com vitamina E Electrophoretic profile and concentration of immunoglobulins G (IgG in blood serum of Saanen goats with experimental mastitis induced by Staphylococcus aureus suplemented with vitamin E

    Directory of Open Access Journals (Sweden)

    Joandes H. Fonteque

    2010-01-01

    ório localizado na glândula mamária.The objective was to evaluate the electrophoretic profile of proteins and serum concentration of immunoglobulin G (IgG in Saanen goats with mastitis experimentally induced by Staphylococcus aureus (dl-α-tocopherol acetated. 14 adult goats, (supplemented with vitamin E DL-α-tocopherol primiparous pregnant, seronegative for caprine arthritis encephalitis (CAEV, clinically healthy, were divided into two groups of seven animals: Not supplemented group (G1 and group supplemented with 2.000 UI of DL-α-tocopherol (G2 Vit E, by intramuscular injection on the day of the parturition and seven days later. At the 9th day after delivery 300 UFCs of the S. aureus ATCC 225923 strain were inoculated into the left half of the mammary gland of each animal. The mastitis was determined through collection of milk samples for evidence of infection by means of bacteriological examination, somatic cell count (SCC and California Mastitis Test (CMT. Then samples were collected after 12, 24, 48 and 72 hours, antimicrobial intra-mammary gland treatment was initiated, with new evaluation 48 hours after treatment. The electrophoretic profile of serum protein of the goats, showed five fractions, as follows: albumin and globulin (α, β1, β2 e γ-globulin. There was an increase in the production of γ-globulin and lower production of β2-globulin fraction 12 hours after infection, and faster decrease in the supplemented group, showing the influence of vitamin E in the production of acute phase proteins. There was no influence of vitamin E in the serum concentration of immunoglobulin G (IgG in supplemented animals. The supplementation with vitamin E increased the concentration of immunoglobulin and decreased the production of acute phase proteins, probably the antioxidant effect minimizing the tissue injury during the inflammatory process in the mammary gland.

  15. Lentivirus-mediated overexpression of OTULIN ameliorates microglia activation and neuroinflammation by depressing the activation of the NF-κB signaling pathway in cerebral ischemia/reperfusion rats.

    Science.gov (United States)

    Xu, Hongbei; Qin, Wenyi; Hu, Xiao; Mu, Song; Zhu, Jun; Lu, Wenhao; Luo, Yong

    2018-03-15

    Ischemic stroke-induced neuroinflammation is mainly mediated by microglial cells. The nuclear factor kappa B (NF-κB) pathway is the key transcriptional pathway that initiates inflammatory responses following cerebral ischemia. OTULIN, a critical negative regulator of the NF-κΒ signaling pathway, exerts robust effects on peripheral immune cell-mediated inflammation and is regarded as an essential mediator for repressing inflammation in vivo. The effect of OTULIN on inflammatory responses in the central nervous system (CNS) was previously unstudied. This current study investigated the anti-inflammatory effect of OTULIN both in vitro and in vivo in ischemic stroke models. Sprague-Dawley (SD) rats were subjected to transient middle cerebral artery occlusion (tMCAO) or an intraperitoneal injection of lipopolysaccharide (LPS). Overexpression of the OTULIN gene was utilized to observe the effect of OTULIN on ischemic stroke outcomes. The effect of OTULIN overexpression on microglia-mediated neuroinflammation was examined in rat primary microglia (PM) and in the microglial cell line N9 after induction by oxygen-glucose deprivation (OGD)-treated neuronal medium. The activation and inflammatory responses of microglia were detected using immunofluorescence, ELISA, and qRT-PCR. The details of molecular mechanism were assessed using Western blotting. In the tMCAO rats, the focal cerebral ischemia/reperfusion injury induced a continuous increase in OTULIN expression within 72 h, and OTULIN expression was increased in activated microglial cells. OTULIN overexpression obviously decreased the cerebral infarct volume, improved the neurological function deficits, and reduced neuronal loss at 72 h after reperfusion, and it also inhibited the activation of microglia and attenuated the release of TNF-α, IL-1β, and IL-6 by suppressing the NF-κB pathway at 24 h after tMCAO. In vitro, OTULIN overexpression inhibited the microglia-mediated neuroinflammation by reducing the production of TNF-α, IL-1β, and IL-6 via depressing the NF-κB pathway in both PM and N9 cells. OTULIN provides a potential therapeutic target for ischemic brain injury by ameliorating the excessive activation of microglial cells and neuroinflammation through repressing the NF-κB signaling pathway.

  16. Influence of CSN1S2 protein from Caprine milk Etawah Breed (EB) on histology of microglial cells in rat (Rattus norvegicus) Type-2 diabetes mellitus (T2DM)

    Science.gov (United States)

    Rika, Margareth; Fatchiyah

    2017-11-01

    Type-2 diabetes mellitus (T2DM) is a degenerative disease that causes an imbalance in the metabolism. The aim of this research is to determine the influences of CSN1S2 on the structure of microglial cells in T2DM. Rats (Rattus norvegicus) were divided into eight groups of treatment with looping three times each between treatment groups (CM) Control. The control is given a milk treatment with doses of 375 mg/kg (CM375), 750 mg/kg (CM750), and 1500 mg/kg (CM1500), T2DM (DMK), and T2DM with CSN1S2 375 mg/kg dose (DM375), 750mg/kg (DM750), and 1500 mg/kg (DM1500). The animal model T2DM was induced by a high-fat diet in the form of feed followed by injection of STZ (dose of 25 mg/kg of animal treatment) and treatment of CSN1S2 for 28 days. Brain organs were taken and analysed in histopathology stained by Hematoxylin-eosin (HE) and observed using Olympus BX53. Based on the results, it was concluded that CSN1S2 protein is influential for induction of microglial cell proliferation in animal models of T2DM, as immunity responds to the inflammatory condition in T2DM.

  17. Acyl-CoA synthetase short-chain family member 2 (ACSS2) is regulated by SREBP-1 and plays a role in fatty acid synthesis in caprine mammary epithelial cells.

    Science.gov (United States)

    Xu, Huifen; Luo, Jun; Ma, Gongzhen; Zhang, Xueying; Yao, Dawei; Li, Ming; Loor, Juan J

    2018-02-01

    Sterol regulatory element binding protein 1 (SREBP-1) is well-known as the master regulator of lipogenesis in rodents. Acyl-CoA synthetase short-chain family member 2 (ACSS2) plays a key role in lipogenesis by synthesizing acetyl-CoA from acetate for lipogenesis. ATP citrate lyase (ACLY) catalyzes the conversion of citrate and coenzyme A to acetyl-CoA, hence, it is also important for lipogenesis. Although ACSS2 function in cancer cells has been elucidated, its essentiality in ruminant mammary lipogenesis is unknown. Furthermore, ACSS2 gene promoter and its regulatory mechanisms have not known. Expression of ACSS2 was high in lipid synthesizing tissues, and its expression increased during lactation compared with non-lactating period. Simultaneous knockdown of both ACSS2 and ACLY by siRNA in primary goat mammary epithelial cells decreased (p < 0.05) the mRNA abundance of genes associated with de novo fatty acid synthesis (FASN, ACACA, SCD1) and triacylglycerol (TAG) synthesis (DGAT1, DGAT2, GPAM, and AGPAT6). Genes responsible for lipid droplet formation and secretion (PLIN2 and PLIN3) and fatty acid oxidation (ATGL, HSL, ACOX, and CPT1A) all decreased (p < 0.05) after ACSS2 and ACLY knockdown. Total cellular TAG content and lipid droplet formation also decreased. Use of a luciferase reporter assay revealed a direct regulation of ACSS2 by SREBP-1. Furthermore, SREBP-1 interacted with an SRE (SREBP response element) spanning at -475 to -483 bp on the ACSS2 promoter. Taken together, our results revealed a novel pathway that SREBP-1 may regulate fatty acid and TAG synthesis by regulating the expression of ACSS2. © 2017 Wiley Periodicals, Inc.

  18. Livestock Vaccine Innovation Fund | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... the lives of smallholder livestock farmers for the better. African swine fever · Avian influenza · East Coast fever · Hemorrhagic septicemia · Contagious caprine pleuropneumonia · Babesiosis · Rift Valley fever · Newcastle disease · Contagious caprine pleuropneumonia – Heartwater · CRISPR/cas9 gene editing platform ...

  19. cDNA cloning, structural analysis, SNP detection and tissue ...

    Indian Academy of Sciences (India)

    The present study was conducted to clone and sequence the full-length coding sequence of the caprine IGF1 gene from Attappady Black and Malabari breeds, two indigenous goat breeds of south India, to analyse its structure, and to ascertainthe relative abundance of IGF1 mRNA in different tissues. The caprine IGF1 ...

  20. Polymorphism of the DQA2 gene in goats.

    Science.gov (United States)

    Zhou, H; Hickford, J G H; Fang, Q

    2005-05-01

    Variation in the caprine DQA2 gene was investigated using PCR-single-strand conformational polymorphism (SSCP) and DNA sequencing. Eleven DQA2 alleles were defined by SSCP patterns from 23 goats. All the caprine alleles shared high sequence homology to ovine DQA2 sequences, and exhibited a pattern of polymorphism similar to DQA2 alleles from sheep and cattle but different from caprine DQA1 sequences. Thirty-eight AA positions in the alpha1 domain of caprine DQA2 molecules were polymorphic, and a high degree of polymorphism was observed in the putative antigen-binding region, with 74% of the positions being polymorphic. Phylogenetic analysis of caprine, ovine, and bovine DQA sequences revealed that the caprine DQA2 sequences identified here grouped with ovine DQA2, bovine DQA2, DQA3, and DQA4 sequences but are separate from the group of caprine DQA1 alleles. Nine of the caprine DQA2 sequences were more similar to ovine DQA2 alleles, whereas the remaining two were more closely related to ovine DQA2-like and bovine DQA3 alleles. This finding suggests that the caprine DQA2 sequences may represent two loci, which probably arose by either gene duplication or gene conversion events. Allelic lineages were evident for both DQA2 and DQA2-like loci, supporting the trans-species mode of evolution of major histocompatibilitly complex genes. The high level of polymorphism and similarity between caprine and ovine DQA2 alleles suggests that the DQA2 gene may play an important role in immune responses to shared pathogens.

  1. Assessment of listing and categorisation of animal diseases within the framework of the Animal Health Law (Regulation (EU) No 2016/429)

    DEFF Research Database (Denmark)

    EFSA Panel on Animal Health and Welfare (AHAW); More, Simon; Bøtner, Anette

    2017-01-01

    of contagious caprine pleuropneumonia according to disease prevention and control rules as in Annex IV and Article 8 on the list of animal species related to contagious caprine pleuropneumonia. The assessment has been performed following a methodology composed of information collection and compilation, expert...... of the AHL, for the application of the disease prevention and control rules referred to in points (d) and (e) of Article 9(1). The assessment here performed on compliance with the criteria as in Section 1 of Annex IV referred to in point (a) of Article 9(1) is inconclusive. The animal species to be listed......Contagious caprine pleuropneumonia has been assessed according to the criteria of the Animal Health Law (AHL), in particular criteria of Article 7 on disease profile and impacts, Article 5 on the eligibility of contagious caprine pleuropneumonia to be listed, Article 9 for the categorisation...

  2. Suspicion de la résistance aux benzimidazoles chez les strongles ...

    African Journals Online (AJOL)

    Suspicion de la résistance aux benzimidazoles chez les strongles gastrointestinaux du caprin à Lubumbashi, R.D. Congo. EV Okombe, SEW Pongombo. Abstract. Cent vingt-quatre caprins sélectionnés dans deux fermes de la région de Lubumbashi en R.D. Congo, ont été examinés en utilisant le test de réduction de ...

  3. Le FIVB annonce le financement de quatre autres projets | CRDI ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    5 avr. 2018 ... Peste porcine africaine · Grippe aviaire · Theilériose bovine · Septicémie hémorragique · Pleuropneumonie contagieuse caprine · Babésiose · Fièvre de la vallée du Rift · Maladie de Newcastle · Pleuropneumonie contagieuse caprine – cowdriose · Plateforme de modification génétique CRISPR/cas9.

  4. Fonds d'innovation en vaccins pour le bétail | CRDI - Centre de ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... éleveurs de bétail. Peste porcine africaine · Grippe aviaire · Theilériose bovine · Septicémie hémorragique · Pleuropneumonie contagieuse caprine · Babésiose · Fièvre de la vallée du Rift · Maladie de Newcastle · Pleuropneumonie contagieuse caprine – cowdriose · Plateforme de modification génétique CRISPR/cas9 ...

  5. Abortion in small ruminants in the Netherlands between 2006 and 2011.

    Science.gov (United States)

    van den Brom, R; Lievaart-Peterson, K; Luttikholt, S; Peperkamp, K; Wouda, W; Vellema, P

    2012-07-01

    During five successive lambing seasons between 2006 and 2011, 453 submissions of abortion material, 282 of ovine and 171 of caprine origin, were examined at the Animal Health Service in the Netherlands. Infectious agents as the most plausible cause of the abortion were found in 48 percent of the ovine submissions and in 34 percent of the caprine submissions. Submission of both aborted fetus and placental membranes increased the diagnostic yield of laboratory investigations (17 percent and 21 percent for ovine and caprine submissions, respectively). The main infectious causes of abortion in sheep were Chlamydia abortus, Campylobacter spp., Toxoplasma gondii, Listeria spp., and Yersinia pseudotuberculosis. The main infectious causes of abortion in goats were Coxiella burnetii, Chlamydia abortus, Listeria spp., Toxoplasma gondii, and Campylobacter spp. In 42 percent of the ovine and in 56 percent of the caprine submissions a causal agent was not identified. Furthermore, in 12 percent of the ovine and 10 percent of the caprine submissions evidence of placentitis, indicative of an infectious cause of the abortion, was found, but no infectious agent was identified. Most infectious causes of ovine and caprine abortion have zoonotic potential. Humans, especially pregnant women, who are in close contact with lambing sheep or goats should be aware of the importance of precautionary hygiene measures.

  6. Enhancing Propriospinal Relays to Improve Functional Recovery after SCI

    Science.gov (United States)

    2016-10-01

    pilot studies to examine regeneration and sprouting mediated by inhibiting PTEN using our peptides. 15. SUBJECT TERMS 16. SECURITY CLASSIFICATION...we injected HiRet/GFP/Lentivirus into the lumbar spinal cord. This lentivirus uses the Rabies-G envelope protein for high efficiency retrograde

  7. Genomic diversity and antigenic variation of HIV-1: links between pathogenesis, epidemiology and vaccine development

    NARCIS (Netherlands)

    Goudsmit, J.; Back, N. K.; Nara, P. L.

    1991-01-01

    Recent analysis of primate lentivirus genomes indicates that lentiviruses have infected primates for hundreds of years. The pathogenicity of such viruses may fluctuate due to the high evolution rate of some parts of the viral genome. Fixed nucleic acid substitutions in the gag gene appear to be

  8. A single center 14 years study of infectious complications leading to hospitalization of patients with primary antibody deficiencies

    Directory of Open Access Journals (Sweden)

    Setareh Mamishi

    Full Text Available Primary antibody deficiencies (PADs are a heterogeneous group of disorders, characterized by hypogammaglobulinemia and increased susceptibility to bacterial infections, leading to hospitalizations. This study was performed to determine the main infectious causes of hospital admissions in selective Iranian patients with PADs. Forty patients with PADs, who were admitted to the Infectious Ward of Children's Medical Center Hospital during a 14-year period, were reviewed in this study. There were 115 documented episodes of hospital admission during a 14-year period. The average length of hospital stay was 33.30 ± 25.72 days. Pneumonia was the most prominent infection leading to hospitalization among these patients (n = 48, followed by gastroenteritis (n = 23. Other less frequent causes of hospitalization were fever and neutropenia, septic arthritis, encephalitis, orbital cellulitis, sepsis, urinary tract infection, meningitis, oral ulcer, and lung abscess. The most common causative organisms of diarrhea were: Giardia lamblia, followed by Candida albicans, and Salmonella sp. Many patients with PADs suffer from repeated infections leading to hospitalization, in spite of immunoglobulin replacement therapy. Respiratory tract infections were the prominent cause of hospitalization among studied patients, followed by gastrointestinal infections.

  9. THE COMPARING OF ANTIMICROBIAL ACTIVITY OF CSN1S2 PROTEIN OF FRESH MILK AND YOGHURT GOAT BREED ETHAWAH INHIBITED THE PATHOGENIC BACTERIA.

    Science.gov (United States)

    Triprisila, Lidwina Faraline; Suharjono, Suharjono; Christianto, Antonius; Fatchiyah, Fatchiyah

    2016-07-24

    Goat milk is reported to have antimicrobial activity of several pathogen bacteria that contained on food materials. The research related with antimicrobial activity of Alpha-S2 casein from goat milk is relatively less than other casein components. Herein, we reported the antimicrobial activity of caprine Alpha-S2 Casein (CSN1S2) protein from Ethawah breed goat milk and yoghurt in Gram positive ( Listeria monocytogenes , Staphylococcus aureus and Bacillus cereus ) and negative pathogen bacteria ( Escherichia coli, Salmonella typhi and Shigella flexneri ). Those bacteria were known as pathogens that caused gastrointestinal infection. Serial dilution and agar diffusion analysis with three different concentrations of caprine CSN1S2, 1.25 mg/ml, 2.5 mg/ml, and 5 mg/ml were used to test the inhibition effect of protein on the viability of bacteria cells. The inhibitory activity of caprine CSN1S2 was based on dose dependent manner. Agar diffusion analysis was showed the larger diameter of clear zone at B. cereus and S. flexneri . The serial dilution analysis was shown the inhibition of almost in all groups of bacteria with concentration 5 mg/ml higher by CSN1S2 protein of goat fresh milk than yogurt. The inhibitory activity caprine CSN1S2 protein of fresh milk was shown a vary inhibition clear zone with optimal concentration 5 mg/ml, however CSN1S2 protein of goat yogurt intermediate effectively was only in gram negative bacteria. The weakness bacteria against inhibition activity caprine CSN1S2 protein was B. cereus (Gram positive) and S. flexneri (Gram negative). Meanwhile the strongest bacteria against inhibition activity caprine CSN1S2 protein was S. typhi (Gram negative), may cause in this bacteria has lipopolysaccharide prevent to interact with that protein as proper. This study result concluded that the caprine CSN1S2 protein has inhibition activity in opposition to pathogenic bacteria by optimal concentration 5 mg/ml in all bacteria and indicated caprine CSN1S2

  10. [Abortion in humans caused by Chlamydophila abortus (Chlamydia psittaci serovar 1)].

    Science.gov (United States)

    Pospischil, A; Thoma, R; Hilbe, M; Grest, P; Zimmermann, D; Gebbers, J O

    2002-09-01

    On a farm housing cattle and goats an abortion storm occurred affecting 50% of the goats during the lambing season 2000/2001. In one of three investigated caprine abortions Chlamydophila abortus could be identified as etiology. During this time a pregnant woman (pregnancy week 19/20) had contact with aborting goats. She developed a severe generalized infection and aborted. The placenta contained Chlamydophila abortus shown by immunohistochemistry and PCR. Aim of the present case report is to alert veterinarians about the potential zoonotic risk of ovine/caprine abortions.

  11. Le FIVB annonce le financement de cinq autres projets | CRDI ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    10 avr. 2018 ... ... Septicémie hémorragique · Pleuropneumonie contagieuse caprine · Babésiose · Fièvre de la vallée du Rift / l'entérotoxémie / la bactérie Pasteurella · Maladie de Newcastle · Pleuropneumonie contagieuse caprine – cowdriose · Plateforme de modification génétique CRISPR/cas9 · Fièvre de la vallée du ...

  12. Feasibility of Measuring Immune Resp, Activation in Foreskin/Mucosa in HIV-, Uncircumcised High-HIV-risk MSM, Lima Peru

    Science.gov (United States)

    2015-12-10

    HIV Infections; Acquired Immunodeficiency Syndrome; Lentivirus Infections; Retroviridae Infections; RNA Virus Infections; Virus Diseases; Sexually Transmitted Diseases, Viral; Sexually Transmitted Diseases; Immunologic Deficiency Syndromes; Immune System Diseases; Slow Virus Diseases

  13. Feline immunodeficiency virus: Studies on pathogenesis and vaccine development

    NARCIS (Netherlands)

    C.H.J. Siebelink (Kees)

    1995-01-01

    textabstractFeline immunodeficiency virus (FIV) is classified as a member of the genus Lentivirus (subfamily Lentivirinae) of the Retroviridae family on basis of its morphology, biochemical characteristics, genomic organization, Mg'+ dependent reverse transcriptase, and nucleotide sequence homology

  14. Feline Immunodeficiency Virus Evolutionarily Acquires Two Proteins, Vif and Protease, Capable of Antagonizing Feline APOBEC3.

    Science.gov (United States)

    Yoshikawa, Rokusuke; Takeuchi, Junko S; Yamada, Eri; Nakano, Yusuke; Misawa, Naoko; Kimura, Yuichi; Ren, Fengrong; Miyazawa, Takayuki; Koyanagi, Yoshio; Sato, Kei

    2017-06-01

    The interplay between viral and host proteins has been well studied to elucidate virus-host interactions and their relevance to virulence. Mammalian genes encode apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3 (APOBEC3) proteins, which act as intrinsic restriction factors against lentiviruses. To overcome APOBEC3-mediated antiviral actions, lentiviruses have evolutionarily acquired an accessory protein, viral infectivity factor (Vif), and Vif degrades host APOBEC3 proteins via a ubiquitin/proteasome-dependent pathway. Although the Vif-APOBEC3 interaction and its evolutionary significance, particularly those of primate lentiviruses (including HIV) and primates (including humans), have been well investigated, those of nonprimate lentiviruses and nonprimates are poorly understood. Moreover, the factors that determine lentiviral pathogenicity remain unclear. Here, we focus on feline immunodeficiency virus (FIV), a pathogenic lentivirus in domestic cats, and the interaction between FIV Vif and feline APOBEC3 in terms of viral virulence and evolution. We reveal the significantly reduced diversity of FIV subtype B compared to that of other subtypes, which may associate with the low pathogenicity of this subtype. We also demonstrate that FIV subtype B Vif is less active with regard to feline APOBEC3 degradation. More intriguingly, we further reveal that FIV protease cleaves feline APOBEC3 in released virions. Taken together, our findings provide evidence that a lentivirus encodes two types of anti-APOBEC3 factors, Vif and viral protease. IMPORTANCE During the history of mammalian evolution, mammals coevolved with retroviruses, including lentiviruses. All pathogenic lentiviruses, excluding equine infectious anemia virus, have acquired the vif gene via evolution to combat APOBEC3 proteins, which are intrinsic restriction factors against exogenous lentiviruses. Here we demonstrate that FIV, a pathogenic lentivirus in domestic cats, antagonizes feline APOBEC3

  15. Induction of morphological and functional differentiation of human ...

    Indian Academy of Sciences (India)

    Samaneh Sharif

    2017-10-31

    Oct 31, 2017 ... streptomycin (0.1 mg/mL, Gibco), and L-glutamine (2 mM,. Gibco). 2.2 Lentivirus production and titration. Transgene lentivirus vector of miR-124 with the flank- ing sequences (*200 bps at each end) was PCR-am- plified from human genomic DNA. The PCR products were cloned into plenti-III-GFP carrying ...

  16. Productive Infection of Human Peripheral Blood Mononuclear Cells by Feline Immunodeficiency Virus: Implications for Vector Development

    OpenAIRE

    Johnston, James; Power, Christopher

    1999-01-01

    Feline immunodeficiency virus (FIV) is a lentivirus causing immune suppression and neurological disease in cats. Like primate lentiviruses, FIV utilizes the chemokine receptor CXCR4 for infection. In addition, FIV gene expression has been demonstrated in immortalized human cell lines. To investigate the extent and mechanism by which FIV infected primary and immortalized human cell lines, we compared the infectivity of two FIV strains, V1CSF and Petaluma, after cell-free infection. FIV genome ...

  17. Browse Title Index

    African Journals Online (AJOL)

    Items 201 - 250 of 437 ... Vol 5, No 2 (2008), Isolation and characterization of Pasteurella multocida from caprine pneumonic lungs, Abstract. EI Ugochukwu. Vol 8, No 1 (2011), Ixodid ticks of cattle in Borno and Yours truly, Obe states of northeastern Nigeria: Breed and coat colour preference, Abstract. MN Opara, NO Ezeh.

  18. Author Details

    African Journals Online (AJOL)

    Heybe, A. Vol 57, No 3 (2009) - Articles A serosurvey of Bovine Brucellosis in three cattle-rearing regions of Somaliland (Northern Somalia) Abstract · Vol 57, No 3 (2009) - Articles A seroprevalence study of ovine and caprine brucellosis in three main regions of Somaliland (Northern Somalia) Abstract. ISSN: 0378-9721.

  19. Search Results | Page 15 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2018-01-12

    Results 141 - 150 of 8518 ... Engineering a wild fast-growing Mycoplasma bacterium to generate a novel vaccine for contagious caprine pleuropneumonia. The CCPP bacterium causes sick animals to experience severe symptoms and die within 7-10 days. Published date. January 12, 2018. Research in Action. Food and ...

  20. RESEARCH ARTICLE

    Indian Academy of Sciences (India)

    Navya

    4Department of animal Nutrition, CVAS, Mannuthy. Kerala Veterinary and Animal Sciences University ... IGF1 is secretary pathway protein with 49 amino acid long signal peptide with 19 phosphorylation sites. Caprine IGF1 amino acid sequence was 83–99% identical to other species, with highest identity with the ruminants.

  1. Ghana Journal of Science - Vol 40 (2000)

    African Journals Online (AJOL)

    The prevalence and gross pathologic lesions of ovine and caprine pneumonia caused by bacterial agent in Zaria, Nigeria · EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. MA Raji, AT Adogwa, AJ Natala, SB Oladele, 3-8. http://dx.doi.org/10.4314/gjs.v40i1.15867 ...

  2. Pheno- and genotyping of Pasteurella multocida isolated from goat ...

    African Journals Online (AJOL)

    In this study, phenotype, capsular type and some virulence factors (pfha1, tbpA, and toxA) of caprine Pasteurella multocida were described in 10 isolates from goat. Two biochemical biovars were recognized among the isolates based on dulcitol and sorbitol fermentation. The isolates belonged to biovars P. multocida sub.

  3. Spinal fusion using adipose stem cells seeded on a radiolucent cage filler : a feasibility study of a single surgical procedure in goats

    NARCIS (Netherlands)

    Kroeze, Robert J.; Smit, Theo H.; Vergroesen, Pieter P.; Bank, Ruud A.; Stoop, Reinout; van Rietbergen, Bert; van Royen, Barend J.; Helder, Marco N.

    2015-01-01

    To assess the feasibility of a one-step surgical concept, employing adipose stem cells (ASCs) and a novel degradable radiolucent cage filler (poly-L-lactide-co-caprolactone; PLCL), within polyetheretherketone cages in a stand-alone caprine spinal fusion model. A double-level fusion study was

  4. Spinal fusion using adipose stem cells seeded on a radiolucent cage filler: a feasibility study of a single surgical procedure in goats

    NARCIS (Netherlands)

    Kroeze, R.J.; Smit, T.H.; Vergroesen, P.P.A.; Bank, R.A.; Stoop, R.; van Rietbergen, B.; van Royen, B.J.; Helder, M.N.

    2015-01-01

    Purpose: To assess the feasibility of a one-step surgical concept, employing adipose stem cells (ASCs) and a novel degradable radiolucent cage filler (poly-L-lactide-co-caprolactone; PLCL), within polyetheretherketone cages in a stand-alone caprine spinal fusion model. Methods: A double-level fusion

  5. Spinal fusion using adipose stem cells seeded on a radiolucent cage filler: a feasibility study of a single surgical procedure in goats

    NARCIS (Netherlands)

    Kroeze, R.J.; Smit, T.H.; Vergroesen, P.P.; Bank, R.A.; Stoop, R.; Rietbergen, B. van; Royen, B.J. van; Helder, M.N.

    2015-01-01

    PURPOSE: To assess the feasibility of a one-step surgical concept, employing adipose stem cells (ASCs) and a novel degradable radiolucent cage filler (poly-L-lactide-co-caprolactone; PLCL), within polyetheretherketone cages in a stand-alone caprine spinal fusion model. METHODS: A double-level fusion

  6. Spinal fusion using adipose stem cells seeded on a radiolucent cage filler: a feasibility study of a single surgical procedure in goats

    NARCIS (Netherlands)

    Kroeze, Robert J.; Smit, Theo H.; Vergroesen, Pieter P.; Bank, Ruud A.; Stoop, Reinout; van Rietbergen, Bert; van Royen, Barend J.; Helder, Marco N.

    2015-01-01

    To assess the feasibility of a one-step surgical concept, employing adipose stem cells (ASCs) and a novel degradable radiolucent cage filler (poly-L-lactide-co-caprolactone; PLCL), within polyetheretherketone cages in a stand-alone caprine spinal fusion model. A double-level fusion study was

  7. Call 2_Innovation to improve existing livestock vaccines (FR)

    International Development Research Centre (IDRC) Digital Library (Canada)

    Musa Mulongo

    de dollars canadiens sur cinq ans et vise à appuyer l'élaboration, la production et la commercialisation de vaccins novateurs contre ..... Annexe 1. Liste des maladies admissibles au financement du Fonds d'innovation en vaccins pour le bétail. Anaplasmose bovine. Anthrax. Babésiose bovine. Clavelée et variole caprine.

  8. Search Results | Page 14 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 131 - 140 of 8491 ... Addressing maternal and child health in fragile contexts. Creative solutions can overcome barriers to access to health services in fragile contexts. Webpage ... Engineering a wild fast-growing Mycoplasma bacterium to generate a novel vaccine for contagious caprine pleuropneumonia. The CCPP ...

  9. A Retrospective Study of Common Diseases of Animals in a Private ...

    African Journals Online (AJOL)

    0.28%), canine distemper 11(0.21%), food poisoning, fracture, infectious canine hepatitis presenting ... (83.3%), followed by bovine 383(7.23%), ovine 260(4.9%), caprine 170(3.2%), porcine 50(0.94%), feline 19(0.35%) and equine 1(0.02%).

  10. the composition of the milk of the african dwarf goat, springbok

    African Journals Online (AJOL)

    portant, particularly the composition of the mother's milk. Ben-Shaul (1963) has given the composition of the milk of a large number of wild animals but those of the blue duiker. (CephaJophus monticola), springbok (Antidorcas morsupialis) and the African dwarf goat (Caprine spp.) were not included. These three animals are.

  11. Detection of virulence-associated genes in Brucella melitensis ...

    African Journals Online (AJOL)

    Ibrahim Eldaghayes

    2018-03-20

    Mar 20, 2018 ... isolated from goats. This discrepancies may indicate that B. melitensis field strains prevailing in Egypt are more virulent than the strains of B. melitensis isolated from caprines in Iran. As, it was emphasized that the. T4SS of Brucella encoded by the virB operon is a major virulence factor (Delrue et al., 2005).

  12. 9 CFR 121.3 - VS select agents and toxins.

    Science.gov (United States)

    2010-01-01

    ... encephalopathy agent; Camel pox virus; Classical swine fever virus; Ehrlichia ruminantium (Heartwater); Foot-and-mouth disease virus; Goat pox virus; Japanese encephalitis virus; Lumpy skin disease virus; Malignant... capripneumoniae (contagious caprine pleuropneumonia); Mycoplasma mycoides subspecies mycoides small colony (MmmSC...

  13. Search Results | Page 14 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 131 - 140 of 8491 ... Can South Asia address barriers to women's paid work? Around the ... Engineering vaccines against hemorrhagic septicemia in ruminants. Hemorrhagic ... Engineering a wild fast-growing Mycoplasma bacterium to generate a novel vaccine for contagious caprine pleuropneumonia. The CCPP ...

  14. 37(4) All.cdr

    African Journals Online (AJOL)

    HP

    The species observed to be slaughtered during the 3 months study (from. November 2011 - January 2012) were bovine, caprine and ovine. The total number of animals slaughtered were 424 cattle (i.e. 177 males and 247 females), 754 goats (i.e. 119 males and 635 females) and 138 sheep (i. e. 21 males and 117 females).

  15. Are we prepared for emerging and re-emerging diseases ...

    African Journals Online (AJOL)

    In animals, the major epidemic diseases reported were Contagious Bovine Pleuropneumonia, Contagious Caprine Pleuropneumonia, Peste des petits ruminants and Giraffe Ear and Skin Diseases. Some epidemics have been reported in both human and animal populations including Rift Valley fever and anthrax.

  16. Effect of methanolicstem-bark extract of Commiphora pedunculata ...

    African Journals Online (AJOL)

    Several medicinal plants have been used in Nigerian communities as antidotes for snakebite complications without scientific validation. In this study, the effect of the methanolic extract of Commiphora pedunculata on recalcification time of bovine, caprine, ovine and came lid plasma treated with Najani gricollis venom was ...

  17. 1 RESEARCH ARTICLE Genetic diversity of Cahi DRB and DQB ...

    Indian Academy of Sciences (India)

    DADA

    adenocarcinoma (OPA) was reported by Larruskain et al. (2010) in sheep. However as far as studies on goat are concerned, there are very few caprine DRB and DQB1 sequences in Gene Bank. Similarly, there is a scarcity of research database for allelic association of DRB and DQB alleles with disease resistance or.

  18. Effect of Concurrent Trypanosoma brucei Infection on ...

    African Journals Online (AJOL)

    The effect of concurrent Trypanosoma bruceiinfection on caprine haemonchosis was investigated in Red Sokoto (Maradi) goats infected with either Haemonchus contortus alone or concurrently with Trypanosoma brucei. The goats infected with H. contortus alone manifested clinical disease that was mild and without ...

  19. Browse Title Index

    African Journals Online (AJOL)

    Items 151 - 200 of 683 ... Vol 61, No 3 (2013), Cross-Sectional Study on Contagious Caprine Pleuro Pneumonia in Selected Districts of Karamoja Region in Uganda, Abstract. B S Emmanuel, A Chrisostom, .... Vol 59, No 4 (2011), Effect of Insulin on Fever in Endotoxic Sheep, Abstract. FY Obese, BK Whitlock, B Steele, TH ...

  20. Effects of storage temperature and extension media on motility of ...

    African Journals Online (AJOL)

    The survivability of caprine spermatozoa was compared in semen extenders prepared from the conventional egg-yolk citrate and goat-milk citrate. Motility was comparable in both sets of extenders during the first 24 hours post-extension when extended ejaculates were stored at either room temperature (28 OC) or ...

  1. Sud du Sahara | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Read more about Energy efficiency optimum strategies for low carbon development in emerging economies: Comparative research. Langue English. Read more about Development of a novel vaccine for contagious caprine pleuropneumonia based on a fast-growing Mycoplasma feriruminatoris chassis. Langue English.

  2. Seroprevalence of ruminant brucellosis in three selected local ...

    African Journals Online (AJOL)

    A serological survey of brucellosis was carried out in three selected local government areas of Taraba state to determine the current status of the disease in the field, especially in the nomadic Fulani breeding herds. A test using the Brucella abortus Rose Bengal Plate Test antigen to test the sera of bovine, ovine and caprine ...

  3. LVIF announces eight more funded projects | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2018-04-05

    Apr 5, 2018 ... It brings vaccine researchers, manufacturers, and distributors together to achieve lasting impact. Read more about the newest projects being funded under the Livestock Vaccine Innovation Fund: Newcastle disease · Contagious caprine pleuropneumonia – Heartwater · CRISPR/cas9 gene editing platform ...

  4. The prevalence and clinico-haematological changes of protozoan ...

    African Journals Online (AJOL)

    One hundred and fifty eight samples were collected from various species of food animals, namely bovine, ovine, porcine and caprine to investigate the prevalence of various natural haemoparasitic protozoan infections namely trypanosomosis, anaplasmosis, babesiosis and theileriosis. Most importantly, the bovine and ...

  5. Jiajie Sun

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics. Jiajie Sun. Articles written in Journal of Genetics. Volume 91 Online resources 2012 pp e54-e59. Haplotype combination of the caprine PC1 gene sequence variants and association with growth traits in Chinese Haimen breed · Jiajie Sun Jing Xue Chunlei Zhang Xianyong Lan Chuzhao ...

  6. cDNA cloning, structural analysis, SNP detection and tissue ...

    Indian Academy of Sciences (India)

    THOMAS NAICY

    Abstract. Insulin-like growth factor 1 (IGF1) plays an important role in growth, reproduction, foetal development and cell proliferation. The present study was conducted to clone and sequence the full-length coding sequence of the caprine IGF1 gene from. Attappady Black and Malabari breeds, two indigenous goat breeds of ...

  7. Bronchoalveolar Lavage Fluid Cellular and Haematological ...

    African Journals Online (AJOL)

    olayemitoyin

    These and other factors influence the pattern of pneumonia complex in goats. We investigated the bronchoalveolar lavage fluid (BALf) cellular changes and haematological response in different types of caprine pneumonia in Nigeria. Haematological indices and BALf cells were analysed from 300 goats randomly selected ...

  8. The effects of climatic factors on the occurrence and gross ...

    African Journals Online (AJOL)

    The bacterial agents of ovine and caprine pneumonia and associated gross pathological lesions were studied for a period of ten years (1985-1995). Bacteriological data were obtained from the necropsy report books of the Microbiology and Pathology Dagnostic units of the Department of Vetinary Pathology and ...

  9. Polymorphism of the VEGF gene and its association with growth ...

    African Journals Online (AJOL)

    Thus, mutations of this gene may exert a significant influence on animal growth. We screened the exons of the caprine VEGF gene using PCR-SSCP and DNA sequencing methods in 459 individuals from four goat breeds to identify sequence variations that may have an effect on protein structure and function, and might be ...

  10. Development of a nanoparticle vaccine for a major killer of cattle ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2018-01-12

    Jan 12, 2018 ... The control of ECF will be significant for smallholder farmers in Africa because it will lead to better livestock health, improved food/nutrition security, and enhanced economic ... Engineering a wild fast-growing Mycoplasma bacterium to generate a novel vaccine for contagious caprine pleuropneumonia.

  11. Search Results | Page 15 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2018-01-12

    Results 141 - 150 of 8502 ... Engineering a wild fast-growing Mycoplasma bacterium to generate a novel vaccine for contagious caprine pleuropneumonia. The CCPP bacterium causes sick animals to experience severe symptoms and die within 7-10 days. Published date. January 12, 2018. Research in Action. Food and ...

  12. Search Results | Page 18 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 171 - 180 of 8531 ... Addressing maternal and child health in fragile contexts. Creative solutions can overcome barriers to access to health services in fragile contexts. Webpage ... Engineering a wild fast-growing Mycoplasma bacterium to generate a novel vaccine for contagious caprine pleuropneumonia. The CCPP ...

  13. Maurice Car̊me'i lihtsad laulud lastele / Helle Michelson

    Index Scriptorium Estoniae

    Michelson, Helle, 1929-

    2003-01-01

    Car̊me, Maurice. Muinasjutud Caprine'ile / tõlkinud Helle Michelson. [Tallinn] : Tiritamm, 2002 ; Car̊me, Maurice. Naeruhull kirsipuu : [luuletused] / prantsuse keelest tõlkinud Helvi Jürisson. [Tallinn] : Tiritamm, 2002 ; Car̊me, Maurice. Margareetapäev : [jutustused] / tõlkinud Helle Michelson. [Tallinn] : Varrak, 2000

  14. 1 LETTER TO THE EDITOR Rabies in Tanzania: The need for a ...

    African Journals Online (AJOL)

    dog bites and were able to get proper wound management and post exposure prophylaxis. (PEP) to prevent the development of symptomatic rabies. In addition ... (feline), horses (equine) and goats/sheep (caprine/ovine) were also positive for rabies; thus confirming that rabies affects a wide range of warm blooded animals.

  15. Prion Protein Gene Polymorphisms in Turkish Native Goat Breeds ...

    Indian Academy of Sciences (India)

    Navya

    is converted into an abnormal protease-resistant isoform (PrPSc), which accumulates in the central nervous system ..... native breeds may be special in maintaining very valuable genetic diversity. Our caprine PRNP gene survey supports this view by showing that Turkish breeds are genetically diverse and that they share a ...

  16. Sensitive and rapid detection of Mycoplasma capricolum subsp ...

    African Journals Online (AJOL)

    SAM

    2014-05-21

    May 21, 2014 ... The LAMP assay was able to detect MCCP in tissue. Key words: Mycoplasma capricolum subsp. Capripneumoniae, loop-mediated isothermal amplification, rapid detection. INTRODUCTION. Contagious caprine pleuropneumonia (CCPP) is a severe infectious disease of goats caused by Mycoplasma.

  17. Variability in assays used for detection of lentiviral infection in bobcats (Lynx rufus), pumas (Puma concolor), and ocelots (Leopardus pardalis)

    Science.gov (United States)

    Franklin, S.P.; Troyer, J.L.; TerWee, J.A.; Lyren, L.M.; Kays, R.W.; Riley, S.P.D.; Boyce, W.M.; Crooks, K.R.; VandeWoude, S.

    2007-01-01

    Although lentiviruses similar to feline immunodeficiency virus (FIV) are known to infect numerous felid species, the relative utility of assays used for detecting lentiviral infection has not been compared for many of these hosts. We tested bobcats (Lynx rufus), pumas (Felis concolor), and ocelots (Leopardus pardalis) for exposure to lentivirus using five different assays: puma lentivirus (PLV), African lion lentivirus (LLV), and domestic cat FIV-based immunoblots, a commercially available enzyme-linked immunosorbent assay (ELISA) kit, and nested polymerase chain reaction (PCR). Puma lentivirus immunoblots identified more seropositive individuals than the other antibody-detection assays. The commercial ELISA provided a fair ability to recognize seropositive samples when compared with PLV immunoblot for screening bobcats and ocelots, but not pumas. Polymerase chain reaction identified fewer positive samples than PLV immunoblot for all three species. Immunoblot results were equivalent whether the sample tested was serum, plasma, or whole blood. The results from this study and previous investigations suggest that the PLV immunoblot has the greatest ability to detect reactive samples when screening wild felids of North America and is unlikely to produce false positive results. However, the commercial ELISA kit may provide ap adequate alternative for screening of some species and is more easily adapted to field conditions. ?? Wildlife Disease Association 2007.

  18. DEVELOPMENT AND STANDARDIZATION OF AN INDIRECT ELISA FOR THE DIAGNOSIS MAEDI-VISNA IN SHEEP DESENVOLVIMENTO E PADRONIZAÇÃO DE UM ELISA INDIRETO PARA DIAGNÓSTICO DE MAEDI VISNA EM OVINOS

    Directory of Open Access Journals (Sweden)

    Tânia Valeska Medeiros Dantas

    2008-04-01

    Full Text Available The objective of this work was to develop and standardize an indirect ELISA for diagnosis of Maedi Visna (MV infection. The antigen was produced from the supernatants of caprine synovial membrane (CSM cell monolayers inoculated with Maedi Visna virus (MVV, strain K1514, by cycles of freezing and thawed, and clarified by centrifugation at 3000 g for 40 min. The clarified suspension was precipitated with PEG 8000 and centrifugated at 12000 g for 60 min; the pellet was resuspended in buffer TNE and layered onto a sucrose cushion by centrifugation at 42000 g for 105 min. The pellet was resuspended in PBS containing phenylmethylsulphonyl fluoride (PMSF. The ELISA was performed in 96 wells plates, incubated for 1 h at 37 ºC. The reaction was detected by incubation with the enzyme substrate and o-phenylenediamine (OPD during 15 min.  The tests were compared using 175 sera samples. The concentration of the antigen was 2 µg/mL and the best dilution of the sera was 1:100. ELISA detected more positive samples (22.9% than AGID (6.3% and presented a better sensitivity than AGID and, although the specificity was below the expected, it could already be recomended in the diagnosis of MVV infection.KEY WORDS: ELISA, MaediVisna, serologic diagnosis, sheep lentivirus. O objetivo deste trabalho foi desenvolver e padronizar um ELISA indireto para diagnóstico de Maedi Visna (MV. Produziu-se o antígeno em sobrenadantes de cultivo celular de membrana sinovial caprina (MSC inoculado com o Maedi Visna Vírus (MVV cepa K1514, que passou por ciclos de congelamento e descongelamento, sendo logo após clarificado

  19. Legislative requirements for the identification and traceability of farm animals within the European Union.

    Science.gov (United States)

    Ammendrup, S; Füssel, A E

    2001-08-01

    European Community (EC) legislation requires identification and registration of bovine, ovine, caprine and porcine animals. For intra-Community trade, bovine animals must be accompanied by a passport and the required health certificate, and identified by a tag on each ear. The principles of active identification of bovine animals (by ear tags) and of ovine, caprine and porcine animals (by ear tags or tattoos) are harmonised within the EC. International passports are issued and recognised only for registered Equidae. The life-number was introduced as an instrument to allow uninterrupted identification of Equidae using passports. The principles of issuing and recording such numbers have been outlined by the affected industries, but require official approval. Active identification of Equidae using electronic devices is not regulated by EC legislation, but research in livestock is underway.

  20. Antibody escape kinetics of equine infectious anemia virus infection of horses.

    Science.gov (United States)

    Schwartz, Elissa J; Nanda, Seema; Mealey, Robert H

    2015-07-01

    Lentivirus escape from neutralizing antibodies (NAbs) is not well understood. In this work, we quantified antibody escape of a lentivirus, using antibody escape data from horses infected with equine infectious anemia virus. We calculated antibody blocking rates of wild-type virus, fitness costs of mutant virus, and growth rates of both viruses. These quantitative kinetic estimates of antibody escape are important for understanding lentiviral control by antibody neutralization and in developing NAb-eliciting vaccine strategies. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. Protective effects of broadly neutralizing immunoglobulin against homologous and heterologous equine infectious anemia virus infection in horses with severe combined immunodeficiency.

    Science.gov (United States)

    Taylor, Sandra D; Leib, Steven R; Wu, Wuwei; Nelson, Robert; Carpenter, Susan; Mealey, Robert H

    2011-07-01

    Using the equine infectious anemia virus (EIAV) lentivirus model system, we previously demonstrated protective effects of broadly neutralizing immune plasma in young horses (foals) with severe combined immunodeficiency (SCID). However, in vivo selection of a neutralization-resistant envelope variant occurred. Here, we determined the protective effects of purified immunoglobulin with more potent broadly neutralizing activity. Overall, protection correlated with the breadth and potency of neutralizing activity in vitro. Four of five SCID foals were completely protected against homologous challenge, while partial protection occurred following heterologous challenge. These results support the inclusion of broadly neutralizing antibodies in lentivirus control strategies.

  2. 2022-IJBCS-Article-Innocent Tshibongui

    African Journals Online (AJOL)

    hp

    Mots clés : Caprins, appétibilité, légumineuses, saison sèche, Congo (RD), Adenodolichos rhomboideus. INTRODUCTION. La région du Sud-Est de la RD Congo est caractérisée par une ... vert et poussent sur des sols contaminés. Parmi ces espèces, ... les sols moyennement à fortement contaminé par les métaux lourds ...

  3. Élevage de la chèvre laitière et production de plantes à racines en ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Plus de 80 % des Tanzaniens vivent en milieu rural et comptent sur l'agriculture et l'élevage pour leur subsistance. Les revenus et la nourriture qu'ils tirent de la production animale proviennent en premier lieu de l'élevage bovin et, en second lieu, de l'élevage caprin. Malheureusement, la manière dont les chèvres sont ...

  4. Current status of brucellosis in Latin America

    OpenAIRE

    Szyfres, Boris; Centro Panamericano de Zoonosis, Azul, Argentina; Blood, Benjamín D.; Centro Panamericano de Zoonosis, Azul, Argentina; Moya, Víctor; Centro Panamericano de Zoonosis, Azul, Argentina

    2014-01-01

    The authors have summarized the information available to them regarding the problem of human and animal brucellosis in Latin America. Animal brucellosis in Latin American countries is a widespread infection. In cattle attacked in preference to animal milk which reaches its highest prevalence. The suina and caprine brucellosis is second in magnitude. In beef cattle, the infection is lower than in the previous groups, and in sheep there is a small percentage of reactants significant title, ther...

  5. 1933-IJBCS-Article-Victor Okombe

    African Journals Online (AJOL)

    hp

    Service de Pharmacologie, Toxicologie et Thérapeutique, Faculté de Médecine Vétérinaire,. Université de Lubumbashi, B.P. 1825 Lubumbashi, République Démocratique du Congo. *Auteur correspondant, E-mail : vokombe@yahoo.fr; Tél : (+243) 81 815 25 87. RESUME. Cent vingt-quatre caprins sélectionnés dans deux ...

  6. THE COMPARING OF ANTIMICROBIAL ACTIVITY OF CSN1S2 PROTEIN OF FRESH MILK AND YOGHURT GOAT BREED ETHAWAH INHIBITED THE PATHOGENIC BACTERIA

    OpenAIRE

    Triprisila, Lidwina Faraline; Suharjono, Suharjono; Christianto, Antonius; Fatchiyah, Fatchiyah

    2016-01-01

    Background: Goat milk is reported to have antimicrobial activity of several pathogen bacteria that contained on food materials. The research related with antimicrobial activity of Alpha-S2 casein from goat milk is relatively less than other casein components. Herein, we reported the antimicrobial activity of caprine Alpha-S2 Casein (CSN1S2) protein from Ethawah breed goat milk and yoghurt in Gram positive (Listeria monocytogenes, Staphylococcus aureus and Bacillus cereus) and negative pathoge...

  7. 9 CFR 130.14 - User fees for FADDL veterinary diagnostics.

    Science.gov (United States)

    2010-01-01

    ... diagnostics. 130.14 Section 130.14 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE....00 $155.00 $160.00 $165.00 Caprine antiserum, any agent 1 mL 184.00 189.00 195.00 202.00 Cell culture... slides or plates Slide 49.00 50.00 51.00 53.00 Reference animal tissues for immunohistochemistry Set 171...

  8. [Materno-fetal infection by Chlamydia psittaci transmitted by the goat: a new zoonosis?].

    Science.gov (United States)

    Berthier, M; Bonneau, D; Marechaud, M; Oriot, D; Deshayes, M; Levillain, P; Magnin, G

    1991-01-01

    A case report is given of spontaneous abortion at 32 weeks brought about by Chlamydia psittaci following contact with a herd of goats. Severe symptoms were observed post-natally in this woman. Nine cases of materno-foetal infection with this pathogen are known, however, the source of infection is usually ewes suffering abortive chlamydiosis. Goats may also be infected, but caprine origin for the disease in pregnant women has not been reported previously.

  9. Epidemiology of gastrointestinal helminthiasis of small ruminants in ...

    African Journals Online (AJOL)

    Urquhart, G.M., Armour, J., Duncan, J.L., Dunn, A.M. and Jennings, F.W., 1996. Veterinary Parasitology. 2nd edition. Blackwell Science. Valcárcel, F. and García, R. C., 1999. Prevalence and seasonal pattern of caprine trichostrongyles in a dry area of central Spain. J Vet Med., 6:673-680. Vercruysse, J. and Claerebout, E., ...

  10. Le FIVB annonce le financement de huit autres projets | CRDI ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    5 avr. 2018 ... Découvrez les derniers récents projets soutenus par le Fonds d'innovation en matière de vaccins pour le bétail : Maladie de Newcastle · Pleuropneumonie contagieuse caprine – cowdriose · Plateforme de modification génétique CRISPR/cas9 · Entérotoxémie, la bactérie Pasteurella et la fièvre de la vallée ...

  11. cDNA cloning, structural analysis, SNP detection and tissue ...

    Indian Academy of Sciences (India)

    THOMAS NAICY

    E-mail: naicy@kvasu.ac.in. and conception rate ... transformed into DH5α strain of Escherichia coli and the clones harbouring ... Primer pairs for caprine IGF1 and GAPDH were designed using Primer3 software (table 1). RTq-PCR was conducted in a 25 μL reaction volume containing 50 ng of cDNA and 2× Max- ima SYBR ...

  12. MOLECULAR-PHYLOGENETIC CHARACTERIZATION AND ANTIMICROBIAL RESISTANCE OF Escherichia coli ISOLATED FROM GOATS WITH DIARRHEA

    Directory of Open Access Journals (Sweden)

    Rodrigo Almeida Guimarães

    2015-10-01

    Full Text Available Neonatal diarrhea determines significant changes in feed conversion, causing productivity loss in caprine herds. The antimicrobial resistance in bacteria is characterized as an important public health issue; therefore, Escherichia coli may be characterized as an important pathogen due to expressing virulence mechanisms responsible for significant clinical conditions in humans and animals. The present study evaluated the presence of E. coli among 117 caprine fecal samples and analyzed the isolates for antimicrobial resistance. Suggestive colonies were submitted to biochemical screening followed by genotypic group determination and phylogenetic analysis; further, the samples were submitted to antimicrobials susceptibility test. E. coli, Salmonella spp, Shigella sonnei and Enterobacter aerogenes were identified. E. coli isolates were phylogenetically classified as B2 (9/39, D (19/39, B1 (7/39 e A (4/29 groups. The analysis of the isolates also revealed the presence of K99 (04/39 and Stx (02/39 virulence factors. Antimicrobial susceptibility test revealed sensitive isolates to Chloramphenicol, Streptomycin, Amoxicillin and Ciprofloxacin, being all resistant to Lincomycin, Vancomycin and Penicillin. The results support the need of establishing restricted protocols for antimicrobial use, a fundamental procedure for health improvement in Brazilian caprine herds.

  13. Diferentes origens do Hormônio Folículo Estimulante (FSH influenciam a viabilidade e o desenvolvimento de folículos pré-antrais caprinos

    Directory of Open Access Journals (Sweden)

    Deborah de Melo Magalhães

    2009-10-01

    Full Text Available The aim of this study was to evaluate the effects of pituitary (pFSH or recombinant (rFSH FSH on the survival and growth of caprine preantral follicles. Caprine ovarian tissues were in vitro cultured for one or seven days in Minimum Essential Medium (MEM alone or containing 10, 50, 100 and 1000 ng/ml of pFSH or rFSH. Control tissues (non-cultured and those cultured were processed for histological and ultrastructural studies. In addition, follicular and oocyte diameter were analysed. After seven days of culture, only 50 ng/ml of rFSH maintained the percentage of normal follicles similar to control. Moreover, 10 ng/ml of pFSH and all the concentrations of rFSH promoted primordial follicles activation. In addition, the presence of 50 ng/ml of rFSH promoted the highest follicular diameter at day seven of culture. In conclusion, 50 ng/ml of rFSH maintained the ultrastructural integrity of caprine preantral follicles, promoted primordial follicles activation and further growth of cultured follicles.

  14. Identification of Chlamydiae and Mycoplasma species in ruminants with ocular infections.

    Science.gov (United States)

    Gupta, S; Chahota, R; Bhardwaj, B; Malik, P; Verma, S; Sharma, M

    2015-02-01

    Infectious keratoconjunctivitis (IKC) is a highly contagious ocular inflammatory condition, which is often reported in domestic small and large ruminants. Multiple infectious aetiologies are reported to be involved, but information about the role of certain fastidious bacterial pathogens such as chlamydiae and mycoplasmas is limited in India. Hence, this study was performed to determine the role of these pathogens and their identification by molecular approach. A total of 53 samples from 31 ovine, 14 caprine and eight bovine having clinical symptoms were collected and tested using species-specific PCR tests for chlamydiae and mycoplasmas followed by nucleotide sequence analysis. The results showed 77.41, 14.29 and 25% samples were chlamydiae positive in ovine, caprine and bovine, respectively, whereas 41.93, 14.29 and 37.5% prevalence of mycoplasma infection was detected in ovine, caprine and bovines, respectively. Chlamydophila abortus, Chlamydophila psittaci, Mycoplasma arginini and Mycoplasma hyorhinis were detected from tested samples. To the best of our knowledge, this is the first time these species are identified in IKC cases from India. Coinfection of both chlamydial and mycoplasmal species was detected in eight IKC cases of ovine which suggest synergistic roles played by both chlamydiae and mycoplasma in IKC samples. © 2014 The Society for Applied Microbiology.

  15. Goats' milk xanthine oxidoreductase is grossly deficient in molybdenum.

    Science.gov (United States)

    Atmani, Djebbar; Benboubetra, Mustapha; Harrison, Roger

    2004-02-01

    Xanthine oxidoreductase (XOR) was purified from goats' milk. The u.v.-visible absorption spectrum was essentially identical to those of the corresponding bovine and human milk enzymes and showed an A280/A450 ratio of 5.20+/-0.12, indicating a high degree of purity. Like bovine and human milk XORs, enzyme purified from goats' milk showed a single band on SDS-PAGE corresponding to a subunit with approximate Mr 150,000. On Western blotting, mouse monoclonal anti-human XOR antibody cross-reacted with purified caprine and bovine XORs. The specific xanthine oxidase activity of goats' milk XOR, however, was very much lower than that of bovine XOR, although NADH oxidase activities of XOR from the two sources were similar. In these respects, the caprine milk XOR mirrors the human milk enzyme, in which case the kinetic effects have previously been attributed to relatively low molybdenum content. The molybdenum content of goats' milk XOR also was shown to be relatively low, with 0.09 atoms Mo per subunit, compared with 055 atoms Mo per subunit for the bovine enzyme. A parallel purification of human milk XOR showed 0.03 atoms Mo per subunit. The possible physiological significance of the low molybdenum content of the caprine milk enzyme and of its correspondingly low enzymic activity is discussed.

  16. Toxoplasma gondii and Neospora caninum infections in goat abortions from Argentina.

    Science.gov (United States)

    Unzaga, J M; Moré, G; Bacigalupe, D; Rambeaud, M; Pardini, L; Dellarupe, A; De Felice, L; Gos, M L; Venturini, M C

    2014-12-01

    The aims of this study were to identify the occurrence of Toxoplasma gondii and Neospora caninum abortions in goats from Argentina by serological, macroscopical and microscopical examination and bioassay, and to characterize the obtained isolates by molecular techniques. For this purpose, 25 caprine fetal fluids, 18 caprine fetal brains and 10 caprine placentas from 8 dairy/meat goat farms from Argentina were analyzed. Gestational age of the aborted fetuses was determined in 18 cases. Protozoal infections were detected by at least one of the applied diagnostic techniques in 44% (11/25) of examined fetuses; specifically, 24% (6/25) were positive to T. gondii, 8% (2/25) were positive to N. caninum and 12% (3/25) were positive to both parasites. In this study IFAT titers were similarly distributed in younger and older fetuses. Macroscopical and microscopical examination of one placenta revealed chalky nodules in the fetal cotyledons and normal intercotyledonary areas, as well as necrosis and calcification of mesenchymal cells in villi. Tachyzoites were observed in peritoneal wash from 2 mice inoculated with brain and a pool of brain and placenta of two fetuses. Cell culture growth of tachyzoites was achieved from one inoculated mouse, and confirmed as T. gondii by PCR. The T. gondii isolate was identified as atypical or non-canonical by nested-PCR-RFLP. This is the first study that investigated the involvement of N. caninum and T. gondii in cases of goat abortion in Argentina. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  17. The sequence and phylogenesis of the ?-globin genes of Barbary sheep (Ammotragus lervia), goat (Capra hircus), European mouflon (Ovis aries musimon) and Cyprus mouflon (Ovis aries ophion).

    Science.gov (United States)

    Pirastru, Monica; Multineddu, Chiara; Mereu, Paolo; Sannai, Mara; El Sherbini, El Said; Hadjisterkotis, Eleftherios; Nàhlik, Andràs; Franceschi, Paul; Manca, Laura; Masala, Bruno

    2009-09-01

    In order to investigate the polymorphism of ?-globin chain of hemoglobin amongst caprines, the linked (I)? and (II)? globin genes of Barbary sheep (Ammotragus lervia), goat (Capra hircus), European mouflon (Ovis aries musimon), and Cyprus mouflon (Ovis aries ophion) were completely sequenced, including the 5? and 3? untranslated regions. European and Cyprus mouflons, which do not show polymorphic ? globin chains, had almost identical ? globin genes, whereas Barbary sheep exhibit two different chains encoded by two nonallelic genes. Four different ? genes were observed and sequenced in goat, validating previous observations of the existence of allelic and nonallelic polymorphism. As in other vertebrates, interchromosomal gene conversion appears to be responsible for such polymorphism. Evaluation of nucleotide sequences at the level of molecular evolution of the (I)?-globin gene family in the caprine taxa suggests a closer relationship between the genus Ammotragus and Capra. Molecular clock estimates suggest sheep-mouflon, goat-aoudad, and ancestor-caprine divergences of 2.8, 5.7, and 7.1 MYBP, respectively.

  18. CLINICO-PATHOLOGICAL PROFILE AND FREQUENCY OF MYCOPLASMA MYCOIDES SUBSP. CAPRI INFECTION IN GOATS IN NORTHERN ZONE OF KHYBER-PAKHTUNKHWA, PAKISTAN

    Directory of Open Access Journals (Sweden)

    Said Sajjad Ali Shah

    2017-07-01

    Full Text Available Caprine mycoplasmoses are important diseases of goats and occur worldwide. The current study was designed with the objective of investigating the frequency and clinico-pathological profile of caprine mycoplasmosis in two districts in the northern zone of Khyber Pakhtunkhwa, Pakistan. Three hundred nasal swabs were collected, 150 each for Swat and Buner from goats showing clinical signs of respiratory mycoplasmosis. In districts Swat and Buner, 21.3% and 31.3% samples were mycoplasma positive (respectively. All isolates were identified as Mycoplasma mycoides subsp. capri by biochemical and growth inhibition testing. Blood and serum samples from 30 mycoplasma positive goats were collected for studying hematological and blood biochemistry profile. Hematological results showed that there was a significant decrease (P<0.05 in Total Erythrocyte Count (TEC, Packed Cell Volume (PCV and hemoglobin concentration while significant increase (P<0.05 in the Mean Corpuscular Hemoglobin and Mean Corpuscular Volume value was recorded. Blood biochemistry revealed that total serum protein and albumin were decreased significantly (P<0.05 while there was a significant increase (P<0.05 in serum glutamic pyruvate transaminase (SGPT and globulin fraction of serum. It can be concluded that Mycoplasma mycoides subsp. capri is the most prevalent species of caprine respiratory mycoplasmas in the northern zone of Khyber Pakhtunkhwa.

  19. [Comparison of efficiency and cytotoxicity of different transfection reagents in transfecting RIP140-siRNA into Kupffer cells].

    Science.gov (United States)

    Li, Ji; Liu, Zuojin

    2015-12-01

    To compare the efficiency and cytotoxicity of different transfection reagents used in transfection of RIP140-siRNA into Kupffer cells to optimize the transfection conditions. Kupffer cells were transfected with RIP140-siRNA labeled with GFP as the reporter gene using lipofectamine 2000, Roche reagent (X-treme GENE siRNA Transfection Reagent) and puro screening lentivirus (1.0×10(8) TU/mL) as the transfection reagents. The transfection effect was observed under a fluorescent inverted microscope, and laser scanning confocal microscopy was used to analyze RIP140 expression in trasnfected Kupffer cells. Flow cytometry was performed to detect cell apoptosis, and CCK-8 test was used to evaluate the cell proliferation inhibition. RT-RCR and Western blotting were performed to detect the expressions of RIP140 mRNA and protein in the trasnfected cells. Puro screening lentivirus yielded the highest cell transfection efficiency, which exceeded 90%, followed by Roche reagent and then by lipofectamine 2000. Flow cytometry and CCK-8 test showed that the cytotoxicity was the mildest with Roche reagent, moderate with lentivirus, and severe with lipofectamine 2000. The cells trasnfected with lentivirus showed a significantly lower RIP140 expression than cells trasnfected with lipofectamine 2000 and Roche reagent (Ptransfection, as compared with the other two trasnfection reagents, can achieve good transfection efficiency with a relativelty low cytotoxicity, and allows for better controllability and stability of the trasnfectiion conditions.

  20. Stemcell Information: SKIP000917 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available iPS cell line iPS cell line human ES-like Research Grade Lentivirus OCT3/4, SOX2, c-MYC and KLF4 Yes No ... HEScGRO (catalog... number|SCM020; Millipore, Billerica, MA, USA) with 25%|mTeSR1 medium (catalog number 05850; St

  1. Equine infectious anemia virus replication is upregulated during differentiation of blood monocytes from acutely infected horses.

    OpenAIRE

    Sellon, D C; Walker, K M; Russell, K E; Perry, S T; Covington, P; Fuller, F J

    1996-01-01

    Equine infectious anemia virus is a lentivirus that replicates in mature tissue macrophages of horses. Ponies were infected with equine infectious anemia virus. During febrile episodes, proviral DNA was detectable, but viral mRNA was not detectable. As cultured blood monocytes from these ponies differentiated into macrophages, viral expression was upregulated. In situ hybridization confirmed that viral transcription occurred in mature macrophages.

  2. Injection parameters and virus dependent choice of promoters to improve neuron targeting in the nonhuman primate brain.

    Science.gov (United States)

    Lerchner, W; Corgiat, B; Der Minassian, V; Saunders, R C; Richmond, B J

    2014-03-01

    We, like many others, wish to use modern molecular methods to alter neuronal functionality in primates. For us, this requires expression in a large proportion of the targeted cell population. Long generation times make germline modification of limited use. The size and intricate primate brain anatomy poses additional challenges. We surved methods using lentiviruses and serotypes of adeno-associated viruses (AAVs) to introduce active molecular material into cortical and subcortical regions of old-world monkey brains. Slow injections of AAV2 give well-defined expression of neurons in the cortex surrounding the injection site. Somewhat surprisingly we find that in the monkey the use of cytomegalovirus promoter in lentivirus primarily targets glial cells but few neurons. In contrast, with a synapsin promoter fragment the lentivirus expression is neuron specific at high transduction levels in all cortical layers. We also achieve specific targeting of tyrosine hydroxlase (TH)- rich neurons in the locus coeruleus and substantia nigra with a lentvirus carrying a fragment of the TH promoter. Lentiviruses carrying neuron specific promoters are suitable for both cortical and subcortical injections even when injected quickly.

  3. MiR?590 Promotes Transdifferentiation of Porcine and Human Fibroblasts Toward a Cardiomyocyte?Like Fate by Directly Repressing Specificity Protein 1

    OpenAIRE

    Singh, Vivek P.; Mathison, Megumi; Patel, Vivekkumar; Sanagasetti, Deepthi; Gibson, Brian W.; Yang, Jianchang; Rosengart, Todd K.

    2016-01-01

    Background Reprogramming of cardiac fibroblasts into induced cardiomyocyte?like cells represents a promising potential new therapy for treating heart disease, inducing significant improvements in postinfarct ventricular function in rodent models. Because reprogramming factors effective in transdifferentiating rodent cells are not sufficient to reprogram human cells, we sought to identify reprogramming factors potentially applicable to human studies. Methods and Results Lentivirus vectors expr...

  4. The Comparative Value of Feline Virology Research: Can Findings from the Feline Lentiviral Vaccine Be Translated to Humans?

    Science.gov (United States)

    Hosie, Margaret J; Techakriengkrai, Navapon; Bęczkowski, Paweł M; Harris, Matthew; Logan, Nicola; Willett, Brian J

    2017-01-28

    Feline immunodeficiency virus (FIV) is a lentivirus of domestic cats that shares several similarities with its human counterpart, human immunodeficiency virus (HIV). Their analogies include genomic organization, lymphocyte tropism, viral persistence and induction of immunodeficiency. FIV is the only lentivirus for which a commercial vaccine is registered for prevention in either human or veterinary medicine. This provides a unique opportunity to investigate the mechanisms of protection induced by lentivirus vaccines at the population level and might contribute to the development of efficacious HIV vaccines. As well as having comparative value for vaccine studies, FIV research has shed some light on the relationship between lentiviral tropism and pathogenesis. Recent studies in our laboratory demonstrated that the interaction between FIV and its primary receptor changes as disease progresses, reminiscent of the receptor switch observed as disease progresses in HIV infected individuals. Here we summarise findings illustrating that, in addition to its veterinary significance, FIV has comparative value, providing a useful model to explore lentivirus-host interactions and to examine potential immune correlates of protection against HIV infection.

  5. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...

  6. Stemcell Information: SKIP000857 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available human fetal lung fibroblasts (ATCC, Teddington, UK) 胎児肺繊維芽細胞由来iPS細胞 human ES-like Research Grade Lentivirus ...-015-0255-2 Comparison of intraspinal and intrathecal implantation of induced pluripotent stem cell-derived

  7. mediated RNA interference in bovine fibroblast cells

    African Journals Online (AJOL)

    Jane

    2011-08-03

    Aug 3, 2011 ... Melanocortin receptor 4 (MC4R) is a key element in the mechanisms used to regulate both aspects of keeping the balance between energy uptake and energy expenditure. MC4R was knocked down by lentivirus-mediated shRNA expressing plasmids, which were controlled by the U6 promoter in bovine.

  8. 75 FR 66381 - Cellular, Tissue and Gene Therapies Advisory Committee; Notice of Meeting

    Science.gov (United States)

    2010-10-28

    ...] Cellular, Tissue and Gene Therapies Advisory Committee; Notice of Meeting AGENCY: Food and Drug...: Cellular, Tissue and Gene Therapies Advisory Committee. General Function of the Committee: To provide... Competent Retrovirus (RCR)/Lentivirus (RCL) in Retroviral and Lentiviral Vector Based Gene Therapy Products...

  9. African Journal of Biotechnology - Vol 10, No 7 (2011)

    African Journals Online (AJOL)

    Effects of deoxycycline induced lentivirus encoding FasL gene on apoptosis of Th1 cells · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. H Luo, T Wang, A Luo, J Wang, Y Zhao, H Jiang, Q Shi, 1081-1087 ...

  10. PROTEIN AGREGATION MODELS OF PARKINSONS DISEASE USING VIRAL VECTORS, PROTEASOME INHIBITION AND INOCULATION OF PREFORMED FIBRILS IN THE GOTTINGEN MINIPIG CNS

    DEFF Research Database (Denmark)

    Glud, Andreas Nørgaard; Lillethorup, Thea Pinholt; Landeck, Natalie

    SYN) fibrils, overexpressing aSYN using Lentivirus (LV) and Adeno Assosiated Virus (AAV) vectors or proteasome inhibition in the nigrostriatal system, we hope to create a new porcine models for PD. Methods: Using conventional human-intended stereotaxic neurosurgery methods, we apply aSYN or preformed fibrils...

  11. 76 FR 40381 - Government-Owned Inventions; Availability for Licensing

    Science.gov (United States)

    2011-07-08

    ... Contact: David A. Lambertson, PhD; 301-435-4632; [email protected] . Efficient Production of... inventors have recently developed a stable cell line for large scale production. Benefits: Improving the... C.P., et al. Lentivirus-mediated bifunctional cell labeling for in vivo melanoma study. Pigment Cell...

  12. The unusual nucleotide content of the HIV RNA genome results in a biased amino acid composition of HIV proteins

    NARCIS (Netherlands)

    Berkhout, B.; van Hemert, F. J.

    1994-01-01

    Extremely high frequencies of the A nucleotide are found in the RNA genomes of the lentivirus group of retroviruses. It is presently unknown what molecular force is responsible for this A-pressure. In this manuscript, we demonstrate a correlation between this 'A-pressure' and the amino acid-usage of

  13. Cellular Restriction Factors of Feline Immunodeficiency Virus

    Directory of Open Access Journals (Sweden)

    Carsten Münk

    2011-10-01

    Full Text Available Lentiviruses are known for their narrow cell- and species-tropisms, which are determined by cellular proteins whose absence or presence either support viral replication (dependency factors, cofactors or inhibit viral replication (restriction factors. Similar to Human immunodeficiency virus type 1 (HIV-1, the cat lentivirus Feline immunodeficiency virus (FIV is sensitive to recently discovered cellular restriction factors from non-host species that are able to stop viruses from replicating. Of particular importance are the cellular proteins APOBEC3, TRIM5α and tetherin/BST-2. In general, lentiviruses counteract or escape their species’ own variant of the restriction factor, but are targeted by the orthologous proteins of distantly related species. Most of the knowledge regarding lentiviral restriction factors has been obtained in the HIV-1 system; however, much less is known about their effects on other lentiviruses. We describe here the molecular mechanisms that explain how FIV maintains its replication in feline cells, but is largely prevented from cross-species infections by cellular restriction factors.

  14. Cellular Restriction Factors of Feline Immunodeficiency Virus

    Science.gov (United States)

    Zielonka, Jörg; Münk, Carsten

    2011-01-01

    Lentiviruses are known for their narrow cell- and species-tropisms, which are determined by cellular proteins whose absence or presence either support viral replication (dependency factors, cofactors) or inhibit viral replication (restriction factors). Similar to Human immunodeficiency virus type 1 (HIV-1), the cat lentivirus Feline immunodeficiency virus (FIV) is sensitive to recently discovered cellular restriction factors from non-host species that are able to stop viruses from replicating. Of particular importance are the cellular proteins APOBEC3, TRIM5α and tetherin/BST-2. In general, lentiviruses counteract or escape their species’ own variant of the restriction factor, but are targeted by the orthologous proteins of distantly related species. Most of the knowledge regarding lentiviral restriction factors has been obtained in the HIV-1 system; however, much less is known about their effects on other lentiviruses. We describe here the molecular mechanisms that explain how FIV maintains its replication in feline cells, but is largely prevented from cross-species infections by cellular restriction factors. PMID:22069525

  15. Evaluation of vaccination strategies against infection with feline immunodeficiency virus (FIV) based on recombinant viral vectors expressing FIV Rev and OrfA

    NARCIS (Netherlands)

    Huisman, W.; Schrauwen, E.J.A.; Tijhaar, E.; Süzer, Y.; Pas, S.D.; Amerongen, van G.; Sutter, G.; Rimmelzwaan, G.F.; Osterhaus, A.D.M.E.

    2008-01-01

    In recent years it has become clear that cell-mediated immunity is playing a role in the control of lentivirus infections. In particular, cytotoxic T lymphocyte responses have been associated with improved outcome of infection, especially those directed against the regulatory proteins like Rev and

  16. Incidence of infection in 39-month-old ewes with TMEM154 diplotypes "1 1," "1 3," and "3 3" after natural exposure to ovine progressive pneumonia virus

    Science.gov (United States)

    Production and well-being of sheep and goats in many countries are harmfully impacted by small ruminant lentiviruses (SRLV) that cause incurable, progressive diseases. Susceptibility to ovine progressive pneumonia virus (OPPV), the North American form of SRLV, is influenced by variants of the ovine...

  17. Changes in Expression of Dopamine, Its Receptor, and Transporter in Nucleus Accumbens of Heroin-Addicted Rats with Brain-Derived Neurotrophic Factor (BDNF) Overexpression.

    Science.gov (United States)

    Li, Yixin; Xia, Baijuan; Li, Rongrong; Yin, Dan; Liang, Wenmei

    2017-06-09

    BACKGROUND The aim of this study was to explore how changes in the expression of BDNF in MLDS change the effect of BDNF on dopamine (DA) neurons, which may have therapeutic implications for heroin addiction. MATERIAL AND METHODS We established a rat model of heroin addiction and observed changes in the expression of BDNF, DA, dopamine receptor (DRD), dopamine transporter (DAT), and other relevant pathways in NAc. We also assessed the effect of BDNF overexpression in the NAc, behavioral changes of heroin-conditioned place preference (CPP), and naloxone withdrawal in rats with high levels of BDNF. We established 5 adult male rat groups: heroin addiction, lentivirus transfection, blank virus, sham operation, and control. The PCR gene chip was used to study gene expression changes. BDNF lentivirus transfection was used for BDNF overexpression. A heroin CPP model and a naloxone withdrawal model of rats were established. RESULTS Expression changes were found in 20 of the 84 DA-associated genes in the NAc of heroin-addicted rats. Weight loss and withdrawal symptoms in the lentivirus group for naloxone withdrawal was less than in the blank virus and the sham operation group. These 2 latter groups also showed significant behavioral changes, but such changes were not observed in the BDNF lentivirus group before or after training. DRD3 and DAT increased in the NAc of the lentivirus group. CONCLUSIONS BDNF and DA in the NAc are involved in heroin addiction. BDNF overexpression in NAc reduces withdrawal symptoms and craving behavior for medicine induced by environmental cues for heroin-addicted rats. BDNF participates in the regulation of the dopamine system by acting on DRD3 and DAT.

  18. Improving expression of reporter transgene in stem cell by construction of different lentiviral vectors

    Energy Technology Data Exchange (ETDEWEB)

    Tae, Seong Ho; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of); Le, Uyenchi N.; Padmanabhan, Parasuraman [Singapore Bio-Imaging Imaging Consortium, Singapore (Singapore)

    2007-07-01

    For stem cell trafficking applications, it is imperative to express transgenes at desired and stable levels. In recent years, lentivirus-mediated gene transfer was shown to be an efficient method to stably introduce genetic modifications in target cells, even if these are in proliferative or nonproliferative states. Moreover, transgene expression levels can be controlled by using different promoters. The present study was designed to compare the potency of various promoters regulating expression of imaging reporter genes in embryonic H9c2 cardiomyoblasts derived from rat heart. Lentiviral vector was produced by the transient transfection of plasmids carrying required genes and those encoding for virus coating proteins into 293T cells. Harvested viral constructs were incubated with Hela and H9c2 cells, respectively. Transgene expressions were detected by several imaging modalities and evaluated by enzymatic assays. Results - We observed that the level of stable transgene expression in lentivirus-transduced myoblasts could be modulated over several orders of magnitude, with the Ubiquitin (Ub) promoter exhibiting the highest activity, intermediate expression was observed with the CAG promoter, whereas expression observed with the CMV promoter was very weak. We observed that the level of stable transgene expression in lentivirus-transduced myoblasts could be modulated over several orders of magnitude, with the Ubiquitin (Ub) promoter exhibiting the highest activity, intermediate expression was observed with the CAG promoter, whereas expression observed with the CMV promoter was very weak. Here we show that lentivirus-mediated gene transfer allows efficient and stable transgene expression in embryonic cardiomyoblasts in vitro and that transgene expression levels can be varied by using different well-characterized gene promoters. In vivo trials about gene expression will probably further determine the potential of long-term trafficking stem cells using lentivirus.

  19. Improving expression of reporter transgene in stem cell by construction of different lentiviral vectors

    International Nuclear Information System (INIS)

    Tae, Seong Ho; Min, Jung Joon; Le, Uyenchi N.; Padmanabhan, Parasuraman

    2007-01-01

    For stem cell trafficking applications, it is imperative to express transgenes at desired and stable levels. In recent years, lentivirus-mediated gene transfer was shown to be an efficient method to stably introduce genetic modifications in target cells, even if these are in proliferative or nonproliferative states. Moreover, transgene expression levels can be controlled by using different promoters. The present study was designed to compare the potency of various promoters regulating expression of imaging reporter genes in embryonic H9c2 cardiomyoblasts derived from rat heart. Lentiviral vector was produced by the transient transfection of plasmids carrying required genes and those encoding for virus coating proteins into 293T cells. Harvested viral constructs were incubated with Hela and H9c2 cells, respectively. Transgene expressions were detected by several imaging modalities and evaluated by enzymatic assays. Results - We observed that the level of stable transgene expression in lentivirus-transduced myoblasts could be modulated over several orders of magnitude, with the Ubiquitin (Ub) promoter exhibiting the highest activity, intermediate expression was observed with the CAG promoter, whereas expression observed with the CMV promoter was very weak. We observed that the level of stable transgene expression in lentivirus-transduced myoblasts could be modulated over several orders of magnitude, with the Ubiquitin (Ub) promoter exhibiting the highest activity, intermediate expression was observed with the CAG promoter, whereas expression observed with the CMV promoter was very weak. Here we show that lentivirus-mediated gene transfer allows efficient and stable transgene expression in embryonic cardiomyoblasts in vitro and that transgene expression levels can be varied by using different well-characterized gene promoters. In vivo trials about gene expression will probably further determine the potential of long-term trafficking stem cells using lentivirus

  20. Frequent transmission of immunodeficiency viruses among bobcats and pumas

    Science.gov (United States)

    Franklin, S.P.; Troyer, J.L.; TerWee, J.A.; Lyren, L.M.; Boyce, W.M.; Riley, S.P.D.; Roelke, M.E.; Crooks, K.R.; VandeWoude, S.

    2007-01-01

    With the exception of human immunodeficiency virus (HIV), which emerged in humans after cross-species transmissions of simian immunodeficiency viruses from nonhuman primates, immunodeficiency viruses of the family Lentiviridae represent species-specific viruses that rarely cross species barriers to infect new hosts. Among the Felidae, numerous immunodeficiency-like lentiviruses have been documented, but only a few cross-species transmissions have been recorded, and these have not been perpetuated in the recipient species. Lentivirus seroprevalence was determined for 79 bobcats (Lynx rufus) and 31 pumas (Puma concolor) from well-defined populations in Southern California. Partial genomic sequences were subsequently obtained from 18 and 12 seropositive bobcats and pumas, respectively. Genotypes were analyzed for phylogenic relatedness and genotypic composition among the study set and archived feline lentivirus sequences. This investigation of feline immunodeficiency virus infection in bobcats and pumas of Southern California provides evidence that cross-species infection has occurred frequently among these animals. The data suggest that transmission has occurred in multiple locations and are most consistent with the spread of the virus from bobcats to pumas. Although the ultimate causes remain unknown, these transmission events may occur as a result of puma predation on bobcats, a situation similar to that which fostered transmission of HIV to humans, and likely represent the emergence of a lentivirus with relaxed barriers to cross-species transmission. This unusual observation provides a valuable opportunity to evaluate the ecological, behavioral, and molecular conditions that favor repeated transmissions and persistence of lentivirus between species. Copyright ?? 2007, American Society for Microbiology. All Rights Reserved.

  1. Optimization of in vitro cell labeling methods for human umbilical cord-derived mesenchymal stem cells.

    Science.gov (United States)

    Tao, R; Sun, T-J; Han, Y-Q; Xu, G; Liu, J; Han, Y-F

    2014-01-01

    Human umbilical cord-derived mesenchymal stem cells (hUCMSCs) are a novel source of seed cells for cell therapy and tissue engineering. However, in vitro labeling methods for hUCMSCs need to be optimized for better detection of transplanted cells. To identify the most stable and efficient method for labeling hUCMSCs in vitro. hUCMSCs were isolated using a modified enzymatic digestion procedure and cultured. hUCMSCs of passage three (P3) were then labeled with BrdU, PKH26, or lentivirus-GFP and passaged further. Cells from the first labeled passage (LP1), the fourth labeled passage (LP4) and later passages were observed using a fluorescence microscope. The differentiation potential of LP4 cells was assessed by induction with adipogenic and osteogenic medium. Flow cytometry was used to measure the percentage of labeled cells and the percentage of apoptotic or dead cells. The labeling efficiencies of the three hUCMSC-labeling methods were compared in vitro. BrdU, PKH26, and lentivirus-GFP all labeled LP1 cells with high intensity and clarity. However, the BrdU labeling of the LP4 cells was vague and not localized to the cell nuclei; LP9 cells were not detected under a fluorescence microscope. There was also a significant decrease in the fluorescence intensity of PKH26-labeled LP4 cells, and LP11 cells were not detected under a fluorescence microscope. However, the fluorescence of LP4 cells labeled with lentivirus-GFP remained strong, and cells labeled with lentivirus-GFP were detected up to LP14 under a fluorescence microscope. Statistical analyses indicated that percentages of LP1 cells labeled with PKH26 and lentivirus-GFP were significantly higher than that of cells labeled with BrdU (p 0.05) was observed between the death rates of labeled and unlabeled cells. Lentivirus-GFP is a valid method for long-term in vitro labeling, and it may be used as a long-term hUCMSC tracker following transplantation in vivo.

  2. Polar Lipids of Burkholderia pseudomallei Induce Different Host Immune Responses

    Science.gov (United States)

    Gonzalez-Juarrero, Mercedes; Mima, Naoko; Trunck, Lily A.; Schweizer, Herbert P.; Bowen, Richard A.; Dascher, Kyle; Mwangi, Waithaka; Eckstein, Torsten M.

    2013-01-01

    Melioidosis is a disease in tropical and subtropical regions of the world that is caused by Burkholderia pseudomallei. In endemic regions the disease occurs primarily in humans and goats. In the present study, we used the goat as a model to dissect the polar lipids of B. pseudomallei to identify lipid molecules that could be used for adjuvants/vaccines or as diagnostic tools. We showed that the lipidome of B. pseudomallei and its fractions contain several polar lipids with the capacity to elicit different immune responses in goats, namely rhamnolipids and ornithine lipids which induced IFN-γ, whereas phospholipids and an undefined polar lipid induced strong IL-10 secretion in CD4+ T cells. Autologous T cells co-cultured with caprine dendritic cells (cDCs) and polar lipids of B. pseudomallei proliferated and up-regulated the expression of CD25 (IL-2 receptor) molecules. Furthermore, we demonstrated that polar lipids were able to up-regulate CD1w2 antigen expression in cDCs derived from peripheral blood monocytes. Interestingly, the same polar lipids had only little effect on the expression of MHC class II DR antigens in the same caprine dendritic cells. Finally, antibody blocking of the CD1w2 molecules on cDCs resulted in decreased expression for IFN-γ by CD4+ T cells. Altogether, these results showed that polar lipids of B. pseudomallei are recognized by the caprine immune system and that their recognition is primarily mediated by the CD1 antigen cluster. PMID:24260378

  3. Polar lipids of Burkholderia pseudomallei induce different host immune responses.

    Directory of Open Access Journals (Sweden)

    Mercedes Gonzalez-Juarrero

    Full Text Available Melioidosis is a disease in tropical and subtropical regions of the world that is caused by Burkholderia pseudomallei. In endemic regions the disease occurs primarily in humans and goats. In the present study, we used the goat as a model to dissect the polar lipids of B. pseudomallei to identify lipid molecules that could be used for adjuvants/vaccines or as diagnostic tools. We showed that the lipidome of B. pseudomallei and its fractions contain several polar lipids with the capacity to elicit different immune responses in goats, namely rhamnolipids and ornithine lipids which induced IFN-γ, whereas phospholipids and an undefined polar lipid induced strong IL-10 secretion in CD4(+ T cells. Autologous T cells co-cultured with caprine dendritic cells (cDCs and polar lipids of B. pseudomallei proliferated and up-regulated the expression of CD25 (IL-2 receptor molecules. Furthermore, we demonstrated that polar lipids were able to up-regulate CD1w2 antigen expression in cDCs derived from peripheral blood monocytes. Interestingly, the same polar lipids had only little effect on the expression of MHC class II DR antigens in the same caprine dendritic cells. Finally, antibody blocking of the CD1w2 molecules on cDCs resulted in decreased expression for IFN-γ by CD4(+ T cells. Altogether, these results showed that polar lipids of B. pseudomallei are recognized by the caprine immune system and that their recognition is primarily mediated by the CD1 antigen cluster.

  4. Comparaison de la souche 7784 hypovirulente de Mycoplasma agalactiae à la souche type virulente PG2 par la technique d'hybridation soustractive suppressive

    OpenAIRE

    Bonnefin, Nathalie

    2003-01-01

    Mycoplasma agalactiae est l'agent principal responsable de l'agalactie contagieuse des ovins et caprins, un syndrome largement répandu dans le monde et regroupant des atteintes mammaires, articulaires et oculaires. Afin de rechercher les bases moléculaires du pouvoir pathogène de M. agalactiae, la technique d'hybridation soustractive suppressive, qui permet l'identification de séquences présentes dans un génome mais absentes d'un autre, a été utilisée. Deux souches de M. agalactiae ont été co...

  5. Comparison of ureaplasmas from sheep and goats with Ureaplasma diversum and U. urealyticum.

    Science.gov (United States)

    Howard, C J; Pocock, D H

    1983-10-01

    Ureaplasmas isolated from sheep and goats were compared by immunofluorescence with antisera prepared in calves and by PAGE of polypeptides labelled by growth in the presence of [35S]methionine. The ovine and caprine strains constituted two groups defined by serology and polypeptide composition that were not related to the animal species from which they originated. Strains representing these two groups were compared with Ureaplasma urealyticum (human isolates) and U. diversum (bovine isolates). They could not be classified with either but were more similar to the U. diversum strains.

  6. Suspected zoonotic transmission of rotavirus group A in Danish adults

    DEFF Research Database (Denmark)

    Midgley, S. E.; Hjulsager, Charlotte Kristiane; Larsen, Lars Erik

    2012-01-01

    Group A rotaviruses infect humans and a variety of animals. In July 2006 a rare rotavirus strain with G8P[14] specificity was identified in the stool samples of two adult patients with diarrheoa, who lived in the same geographical area in Denmark. Nucleotide sequences of the VP7, VP4, VP6, and NSP4...... genes of the identified strains were identical. Phylogenetic analyses showed that both Danish G8P[14] strains clustered with rotaviruses of animal, mainly, bovine and caprine, origin. The high genetic relatedness to animal rotaviruses and the atypical epidemiological features suggest that these human G8...

  7. Potassium salts of fatty acids as precipitating agents of alkaline earth metal ions

    International Nuclear Information System (INIS)

    Skrylev, L.D.; Sin'kova, L.A.

    1977-01-01

    Regularities have been studied of precipitation of ions of alkaline-earth elements with caprilate, pelargonate, caprinate, undecanate, laurate, tridecanate, myristate, pentadecanate, palmitate, and stearate of potassium. It has been shown that completeness of precipitation of metal ions is determined by the nature of alkaline-earth metal and potassium salt as well as by pH value and temperature of the solution. The study of temperature dependence of soaps of alkaline-earth metals makes it possible to calculate the heats of dissolution of laurates of alkaline-earth metals, and a change in entropy and free energy

  8. Comparative Diagnosis of Serum IgG1 and Coproantigen ELISA for Fasciolosis Detection of Goats in Mexico

    OpenAIRE

    Villa-Mancera, Abel; Molina-Mendoza, Pedro; Hern?ndez-Guzm?n, Karina; Olivares-P?rez, Jaime; Sarracent-P?rez, Jorge; Zumaquero-R?os, Jos?

    2016-01-01

    The objective of present study was to determine the prevalence of natural caprine fasciolosis in the Mixteca region of Mexico using coproantigen and serum IgG1 ELISA tests for comparative purposes. A total of 1070 serum and faecal samples were analyzed for IgG1 antibodies and coproantigens, using ELISA with E/S products as antigen and a monoclonal antibody-based sandwich ELISA. Prevalence of 73.46% was found using the serological ELISA and a percentage of 77.20 was found for coproantigen ELIS...

  9. Lentiviral mediated transgenesis by in vivo manipulation of spermatogonial stem cells.

    Directory of Open Access Journals (Sweden)

    Lalit Sehgal

    Full Text Available This report describes a technique for the generation of transgenic mice by in vivo manipulation of spermatogonial stem cells with a high rate of success. Spermatogonial stem cells (SSCs in pre-pubescent animals were infected in vivo with recombinant lentiviruses expressing EGFP-f and mated with normal females. All male pre-founder mice produced transgenic pups with an overall success rate of over 60%. The transgene was heritable and the pre-founder mice could be used in multiple mating experiments. This technology could be used to perform overexpression/knockdown screens in vivo using bar-coded lentiviruses, thus permitting the design of genetic screens in the mouse. Further, this technology could be adapted to other laboratory animals resulting in the generation of model systems that closely approximate human development and disease.

  10. Lentiviral vectors containing mouse Csf1r control elements direct macrophage-restricted expression in multiple species of birds and mammals

    Science.gov (United States)

    Pridans, Clare; Lillico, Simon; Whitelaw, Bruce; Hume, David A

    2014-01-01

    The development of macrophages requires signaling through the lineage-restricted receptor Csf1r. Macrophage-restricted expression of transgenic reporters based upon Csf1r requires the highly conserved Fms-intronic regulatory element (FIRE). We have created a lentiviral construct containing mouse FIRE and promoter. The lentivirus is capable of directing macrophage-restricted reporter gene expression in mouse, rat, human, pig, cow, sheep, and even chicken. Rat bone marrow cells transduced with the lentivirus were capable of differentiating into macrophages expressing the reporter gene in vitro. Macrophage-restricted expression may be desirable for immunization or immune response modulation, and for gene therapy for lysosomal storage diseases and some immunodeficiencies. The small size of the Csf1r transcription control elements will allow the insertion of large “cargo” for applications in gene therapy and vaccine delivery. PMID:26015955

  11. In vitro incorporation of a cell-binding protein to a lentiviral vector using an engineered split intein enables targeted delivery of genetic cargo.

    Science.gov (United States)

    Chamoun-Emanuelli, Ana M; Wright, Gus; Roger, Smith; Münch, Robert C; Buchholz, Christian J; Chen, Zhilei

    2015-12-01

    Gene therapy represents a promising therapeutic paradigm for addressing many disorders, but the absence of a vector that can be robustly and reproducibly functionalized with cell-homing functionality to mediate the delivery of genetic cargo specifically to target cells following systemic administration has stood as a major impediment. In this study, a high-affinity protein-protein pair comprising a splicing-deficient naturally split intein was used as molecular Velcro to append a HER2/neu-binding protein (DARPin) onto the surface of a binding-deficient, fusion-competent lentivirus. HER2/neu-specific lentiviruses created using this in vitro pseudotyping approach were able to deliver their genetic reporter cargo specifically to cells that express the target receptor at high levels in a co-culture. We envision that the described technology could provide a powerful, broadly applicable platform for the incorporation of cell-targeting functionality onto viral vectors. © 2015 Wiley Periodicals, Inc.

  12. Lessons in AIDS vaccine development learned from studies of equine infectious, anemia virus infection and immunity.

    Science.gov (United States)

    Craigo, Jodi K; Montelaro, Ronald C

    2013-12-02

    Equine infectious anemia (EIA), identified in 1843 [1] as an infectious disease of horses and as a viral infection in 1904, remains a concern in veterinary medicine today. Equine infectious anemia virus (EIAV) has served as an animal model of HIV-1/AIDS research since the original identification of HIV. Similar to other lentiviruses, EIAV has a high propensity for genomic sequence and antigenic variation, principally in its envelope (Env) proteins. However, EIAV possesses a unique and dynamic disease presentation that has facilitated comprehensive analyses of the interactions between the evolving virus population, progressive host immune responses, and the definition of viral and host correlates of immune control and vaccine efficacy. Summarized here are key findings in EIAV that have provided important lessons toward understanding long term immune control of lentivirus infections and the parameters for development of an enduring broadly protective AIDS vaccine.

  13. Lessons in AIDS Vaccine Development Learned from Studies of Equine Infectious, Anemia Virus Infection and Immunity

    Directory of Open Access Journals (Sweden)

    Jodi K. Craigo

    2013-12-01

    Full Text Available Equine infectious anemia (EIA, identified in 1843 [1] as an infectious disease of horses and as a viral infection in 1904, remains a concern in veterinary medicine today. Equine infectious anemia virus (EIAV has served as an animal model of HIV-1/AIDS research since the original identification of HIV. Similar to other lentiviruses, EIAV has a high propensity for genomic sequence and antigenic variation, principally in its envelope (Env proteins. However, EIAV possesses a unique and dynamic disease presentation that has facilitated comprehensive analyses of the interactions between the evolving virus population, progressive host immune responses, and the definition of viral and host correlates of immune control and vaccine efficacy. Summarized here are key findings in EIAV that have provided important lessons toward understanding long term immune control of lentivirus infections and the parameters for development of an enduring broadly protective AIDS vaccine.

  14. Inhibiting the Ins and Outs of HIV Replication: Cell-Intrinsic Antiretroviral Restrictions at the Plasma Membrane

    Science.gov (United States)

    Foster, Toshana L.; Pickering, Suzanne; Neil, Stuart J. D.

    2018-01-01

    Like all viruses, human immunodeficiency viruses (HIVs) and their primate lentivirus relatives must enter cells in order to replicate and, once produced, new virions need to exit to spread to new targets. These processes require the virus to cross the plasma membrane of the cell twice: once via fusion mediated by the envelope glycoprotein to deliver the viral core into the cytosol; and secondly by ESCRT-mediated scission of budding virions during release. This physical barrier thus presents a perfect location for host antiviral restrictions that target enveloped viruses in general. In this review we will examine the current understanding of innate host antiviral defences that inhibit these essential replicative steps of primate lentiviruses associated with the plasma membrane, the mechanism by which these viruses have adapted to evade such defences, and the role that this virus/host battleground plays in the transmission and pathogenesis of HIV/AIDS. PMID:29354117

  15. Phylogenetic analysis to define feline immunodeficiency virus subtypes in 31 domestic cats in South Africa

    Directory of Open Access Journals (Sweden)

    R. Kann

    2006-06-01

    Full Text Available Feline immunodeficiency virus (FIV, a lentivirus, is an important pathogen of domestic cats around the world and has many similarities to human immunodeficiency virus (HIV. A characteristic of these lentiviruses is their extensive genetic diversity, which has been an obstacle in the development of successful vaccines. Of the FIV genes, the envelope gene is the most variable and sequence differences in a portion of this gene have been used to define 5 FIV subtypes (A, B, C, D and E. In this study, the proviral DNA sequence of the V3-V5 region of the envelope gene was determined in blood samples from 31 FIV positive cats from 4 different regions of South Africa. Phylogenetic analysis demonstrated the presence of both subtypes A and C, with subtype A predominating. These findings contribute to the understanding of the genetic diversity of FIV.

  16. Microbial agents in macroscopically healthy mammary gland tissues of small ruminants

    Directory of Open Access Journals (Sweden)

    Liliana Spuria

    2017-11-01

    Full Text Available Background Health of mammary glands is fundamental for milk and dairy products hygiene and quality, with huge impacts on consumers welfare. Methods This study aims to investigate the microbial agents (bacteria, fungi and lentiviruses isolated from 89 macroscopically healthy udders of regularly slaughtered small ruminants (41 sheep, 48 goats, also correlating their presence with the histological findings. Multinomial logistic regression was applied to evaluate the association between lesions and positivity for different microbial isolates, animal age and bacteria. Results Twenty-five samples were microbiologically negative; 138 different bacteria were isolated in 64 positive udders. Coagulase-negative staphylococci were the most prevalent bacteria isolated (46.42%, followed by environmental opportunists (34.76%, others (10.14% and pathogens (8.68%. Most mammary glands showed coinfections (75%. Lentiviruses were detected in 39.3% of samples. Histologically, chronic non-suppurative mastitis was observed in 45/89 glands, followed by chronic mixed mastitis (12/89 and acute suppurative mastitis (4/89. Only 28 udders were normal. Histological lesions were significantly associated with the animal species and lentiviruses and coagulase-negative staphylococci infections. Goats had significantly higher risk to show chronic mixed mastitis compared to sheep. Goats showed a significantly lower risk (OR = 0.26; 95% CI [0.06–0.71] of being infected by environmental opportunists compared to sheep, but higher risk (OR = 10.87; 95% CI [3.69–37.77] of being infected with lentiviruses. Discussion The results of the present study suggest that macroscopically healthy glands of small ruminants could act as a reservoir of microbial agents for susceptible animals, representing a potential risk factor for the widespread of acute or chronic infection in the flock.

  17. Transduction of hematopoietic stem cells to stimulate RNA interference against feline infectious peritonitis.

    Science.gov (United States)

    Anis, Eman A; Dhar, Madhu; Legendre, Alfred M; Wilkes, Rebecca P

    2017-06-01

    Objectives The goals of the study were: (1) to develop and evaluate non-replicating lentivirus vectors coding for feline coronavirus (FCoV)-specific micro (mi)RNA as a potential antiviral therapy for feline infectious peritonitis (FIP); (2) to assess the feasibility of transducing hematopoietic stem cells (HSCs) with ex vivo introduction of the miRNA-expressing lentivirus vector; and (3) to assess the ability of the expressed miRNA to inhibit FCoV replication in HSCs in vitro. Methods HSCs were obtained from feline bone marrow and replicated in vitro. Three lentiviruses were constructed, each expressing a different anti-FCoV miRNA. HSCs were stably transduced with the miRNA-expressing lentivirus vector that produced the most effective viral inhibition in a feline cell line. The effectiveness of the transduction and the expression of anti-FCoV miRNA were tested by infecting the HSCs with two different strains of FCoV. The inhibition of coronavirus replication was determined by relative quantification of the inhibition of intracellular viral genomic RNA synthesis using real-time, reverse-transcription PCR. The assessment of virus replication inhibition was determined via titration of extracellular virus using the TCID 50 assay. Results Inhibition of FCoV was most significant in feline cells expressing miRNA-L2 that targeted the viral leader sequence, 48 h postinfection. miRNA-L2 expression in stably transduced HSCs resulted in 90% and 92% reductions in FIPV WSU 79-1146 genomic RNA synthesis and extracellular virus production, respectively, as well as 74% and 80% reduction in FECV WSU 79-1683 genomic RNA synthesis and extracellular virus production, respectively, as compared with an infected negative control sample producing non-targeting miRNA. Conclusions and relevance These preliminary results show that genetic modification of HSCs for constitutive production of anti-coronavirus miRNA will reduce FCoV replication.

  18. Equine infectious anemia virus replication is upregulated during differentiation of blood monocytes from acutely infected horses.

    Science.gov (United States)

    Sellon, D C; Walker, K M; Russell, K E; Perry, S T; Covington, P; Fuller, F J

    1996-01-01

    Equine infectious anemia virus is a lentivirus that replicates in mature tissue macrophages of horses. Ponies were infected with equine infectious anemia virus. During febrile episodes, proviral DNA was detectable, but viral mRNA was not detectable. As cultured blood monocytes from these ponies differentiated into macrophages, viral expression was upregulated. In situ hybridization confirmed that viral transcription occurred in mature macrophages. PMID:8523576

  19. Genetic Variation of HIV: Viral Load and Genotypic Diversity in Relation to Viral Pathogenesis and Treatment

    Science.gov (United States)

    1993-07-20

    natural history and pathogenesis of HIV-I infection as occurs in infections by equine infectious anemia virus (5). 3. Quantification of Total... infectious anemia virus (EIAV), and simian immunodeficiency virus (SIV) which infect different animal species (3,4). For these other lentiviruses, there is...quantitative HIV-1 DNA and RNA levels determined by PCR and titers of cell-free infectious HIV-1 virus cultured from plasma. 3. Determine the relation between

  20. The HIV-1 transcriptional activator Tat has potent nucleic acid chaperoning activities in vitro

    OpenAIRE

    Kuciak, Monika; Gabus, Caroline; Ivanyi-Nagy, Roland; Semrad, Katharina; Storchak, Roman; Chaloin, Olivier; Muller, Sylviane; Mély, Yves; Darlix, Jean-Luc

    2008-01-01

    The human immunodeficiency virus type 1 (HIV-1) is a primate lentivirus that causes the acquired immunodeficiency syndrome (AIDS). In addition to the virion structural proteins and enzyme precursors, that are Gag, Env and Pol, HIV-1 encodes several regulatory proteins, notably a small nuclear transcriptional activator named Tat. The Tat protein is absolutely required for virus replication since it controls proviral DNA transcription to generate the full-length viral mRNA. Tat can also regulat...

  1. Stemcell Information: SKIP000260 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available x?Ref=GM23761&PgId=166 ... 21490598 10.1038/nature09915 Modelling schizophrenia using human induced pluripot... SKIP000260 ... Diseased GM23761 GM23761 ... 統合失調症 F20 Schizophrenia 181500 ... ...h Shizophrenia(SCZD) . | 統合失調症患者線維芽細胞(GM01835)由来iPS細胞株| human ES-like -- Lentivirus Oct4, Sox2, Klf4, c-Myc,

  2. Characterization of Equine Infectious Anemia Virus Integration in the Horse Genome

    OpenAIRE

    Liu, Qiang; Wang, Xue-Feng; Ma, Jian; He, Xi-Jun; Wang, Xiao-Jun; Zhou, Jian-Hua

    2015-01-01

    Human immunodeficiency virus (HIV)-1 has a unique integration profile in the human genome relative to murine and avian retroviruses. Equine infectious anemia virus (EIAV) is another well-studied lentivirus that can also be used as a promising retro-transfection vector, but its integration into its native host has not been characterized. In this study, we mapped 477 integration sites of the EIAV strain EIAVFDDV13 in fetal equine dermal (FED) cells during in vitro infection. Published integrati...

  3. Lessons in AIDS Vaccine Development Learned from Studies of Equine Infectious, Anemia Virus Infection and Immunity

    OpenAIRE

    Craigo, Jodi K.; Montelaro, Ronald C.

    2013-01-01

    Equine infectious anemia (EIA), identified in 1843 [1] as an infectious disease of horses and as a viral infection in 1904, remains a concern in veterinary medicine today. Equine infectious anemia virus (EIAV) has served as an animal model of HIV-1/AIDS research since the original identification of HIV. Similar to other lentiviruses, EIAV has a high propensity for genomic sequence and antigenic variation, principally in its envelope (Env) proteins. However, EIAV possesses a unique and dynamic...

  4. Equine Endothelial Cells Support Productive Infection of Equine Infectious Anemia Virus

    OpenAIRE

    Maury, Wendy; Oaks, J. Lindsay; Bradley, Sarahann

    1998-01-01

    Previous cell infectivity studies have demonstrated that the lentivirus equine infectious anemia virus (EIAV) infects tissue macrophages in vivo and in vitro. In addition, some strains of EIAV replicate to high titer in vitro in equine fibroblasts and fibroblast cell lines. Here we report a new cell type, macrovascular endothelial cells, that is infectible with EIAV. We tested the ability of EIAV to infect purified endothelial cells isolated from equine umbilical cords and renal arteries. Inf...

  5. Antigenic variation: Molecular and genetic mechanisms of relapsing disease

    Energy Technology Data Exchange (ETDEWEB)

    Cruse, J.M.; Lewis, R.E.

    1987-01-01

    This book contains 10 chapters. They are: Contemporary Concepts of Antigenic Variation; Antigenic Variation in the Influenza Viruses; Mechanisms of Escape of Visna Lentiviruses from Immunological Control; A Review of Antigenic Variation by the Equine Infectious Anemia Virus; Biologic and Molecular Variations in AIDS Retrovirus Isolates; Rabies Virus Infection: Genetic Mutations and the Impact on Viral Pathogenicity and Immunity; Immunobiology of Relapsing Fever; Antigenic Variation in African Trypanosomes; Antigenic Variation and Antigenic Diversity in Malaria; and Mechanisms of Immune Evasion in Schistosomiasis.

  6. Identifying the Conditions Under Which Antibodies Protect Against Infection by Equine Infectious Anemia Virus

    OpenAIRE

    Schwartz, Elissa J.; Smith?, Robert J.

    2014-01-01

    The ability to predict the conditions under which antibodies protect against viral infection would transform our approach to vaccine development. A more complete understanding is needed of antibody protection against lentivirus infection, as well as the role of mutation in resistance to an antibody vaccine. Recently, an example of antibody-mediated vaccine protection has been shown via passive transfer of neutralizing antibodies before equine infectious anemia virus (EIAV) infection of horses...

  7. Inhibiting the Ins and Outs of HIV replication:Cell-intrinsic antiretroviral restrictions at the plasma membrane

    OpenAIRE

    Foster, Toshana L.; Pickering, Suzanne; Neil, Stuart J.D.

    2018-01-01

    Like all viruses, human immunodeficiency viruses (HIVs) and their primate lentivirus relatives must enter cells in order to replicate and, once produced, new virions need to exit to spread to new targets. These processes require the virus to cross the plasma membrane of the cell twice: once via fusion mediated by the envelope glycoprotein to deliver the viral core into the cytosol; and secondly by ESCRT-mediated scission of budding virions during release. This physical barrier thus presents a...

  8. BHD Tumor Cell Line and Renal Cell Carcinoma Line | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    Scientists at the National Cancer Institute  have developed a novel renal cell carcinoma (RCC) cell line designated UOK257, which was derived from the surgical kidney tissue of a patient with hereditary Birt-Hogg-Dube''''(BHD) syndrome and companion cell line UOK257-2 in which FLCN expression has been restored by lentivirus infection. The NCI Urologic Oncology Branch seeks parties interested in licensing or collaborative research to co-develop, evaluate, or commercialize kidney cancer tumor cell lines.

  9. Host-virus interactions of mammalian endogenous retroviruses

    OpenAIRE

    Farkašová, Helena

    2017-01-01

    Endogenous retroviruses (ERVs) originate by germline infection and subsequent mendelian inheritance of their exogenous counterparts. With notable exceptions, all mammalian ERVs are evolutionarily old and fixed in the population of its host species. Some groups of retroviruses were believed not to be able to form endogenous copies. We discovered an additional endogenous Lentivirus and a first endogenous Deltaretrovirus. Both of these groups were previously considered unable to form endogenous ...

  10. Generation of induced pluripotent stem cells (iPSCs) stably expressing CRISPR-based synergistic activation mediator (SAM)

    DEFF Research Database (Denmark)

    Xiong, Kai; Zhou, Yan; Hyttel, Poul

    2016-01-01

    Human fibroblasts were engineered to express the CRISPR-based synergistic activation mediator (SAM) complex: dCas9-VP64 and MS2-P65-HSF1. Two induced pluripotent stem cells (iPSCs) clones expressing SAM were established by transducing these fibroblasts with lentivirus expressing OCT4, SOX2, KLF4...... a novel, useful tool to investigate genetic regulation of stem cell proliferation and differentiation through CRISPR-mediated activation of endogenous genes....

  11. Accessory Genes Confer a High Replication Rate to Virulent Feline Immunodeficiency Virus

    OpenAIRE

    Troyer, Ryan M.; Thompson, Jesse; Elder, John H.; VandeWoude, Sue

    2013-01-01

    Feline immunodeficiency virus (FIV) is a lentivirus that causes AIDS in domestic cats, similar to human immunodeficiency virus (HIV)/AIDS in humans. The FIV accessory protein Vif abrogates the inhibition of infection by cat APOBEC3 restriction factors. FIV also encodes a multifunctional OrfA accessory protein that has characteristics similar to HIV Tat, Vpu, Vpr, and Nef. To examine the role of vif and orfA accessory genes in FIV replication and pathogenicity, we generated chimeras between tw...

  12. Anti-fibrogenic effects of the anti-microbial peptide cathelicidin in murine colitis-associated fibrosis.

    Science.gov (United States)

    Yoo, Jun Hwan; Ho, Samantha; Tran, Deanna Hoang-Yen; Cheng, Michelle; Bakirtzi, Kyriaki; Kukota, Yuzu; Ichikawa, Ryan; Su, Bowei; Tran, Diana Hoang-Ngoc; Hing, Tressia C; Chang, Irene; Shih, David Q; Issacson, Richard E; Gallo, Richard L; Fiocchi, Claudio; Pothoulakis, Charalabos; Koon, Hon Wai

    2015-01-01

    Cathelicidin (LL-37 in human and mCRAMP in mice) represents a family of endogenous antimicrobial peptides with anti-inflammatory effects. LL-37 also suppresses collagen synthesis, an important fibrotic response, in dermal fibroblasts. Here we determined whether exogenous cathelicidin administration modulates intestinal fibrosis in two animal models of intestinal inflammation and in human colonic fibroblasts. C57BL/6J mice (n=6 per group) were administered intracolonically with a trinitrobenzene sulphonic acid (TNBS) enema to induce chronic (6-7 weeks) colitis with fibrosis. mCRAMP peptide (5 mg/kg every 3 day, week 5-7) or cathelicidin gene ( Camp )-expressing lentivirus (10 7 infectious units week 4) were administered intracolonically or intravenously, respectively. 129Sv/J mice were infected with Salmonella typhimurium orally to induce cecal inflammation with fibrosis. Camp expressing lentivirus (10 7 infectious units day 11) was administered intravenously. TNBS-induced chronic colitis was associated with increased colonic collagen (col1a2) mRNA expression. Intracolonic cathelicidin (mCRAMP peptide) administration or intravenous delivery of lentivirus-overexpressing cathelicidin gene significantly reduced colonic col1a2 mRNA expression in TNBS-exposed mice, compared to vehicle administration. Salmonella infection also caused increased cecal inflammation associated with collagen (col1a2) mRNA expression that was prevented by intravenous delivery of Camp -expressing lentivirus. Exposure of human primary intestinal fibroblasts and human colonic CCD-18Co fibroblasts to transforming growth factor-beta1 (TGF-beta1) and/or insulin-like growth factor 1 induced collagen protein and mRNA expression, that was reduced by LL-37 (3-5 µM) through a MAP kinase-dependent mechanism. Cathelicidin can reverse intestinal fibrosis by directly inhibiting collagen synthesis in colonic fibroblasts.

  13. Clonality of mouse and human cardiomyogenesis in vivo

    OpenAIRE

    Hosoda, Toru; D'Amario, Domenico; Cabral-Da-Silva, Mauricio Castro; Zheng, Hanqiao; Padin-Iruegas, M. Elena; Ogorek, Barbara; Ferreira-Martins, João; Yasuzawa-Amano, Saori; Amano, Katsuya; Ide-Iwata, Noriko; Cheng, Wei; Rota, Marcello; Urbanek, Konrad; Kajstura, Jan; Anversa, Piero

    2009-01-01

    An analysis of the clonality of cardiac progenitor cells (CPCs) and myocyte turnover in vivo requires genetic tagging of the undifferentiated cells so that the clonal marker of individual mother cells is traced in the specialized progeny. CPC niches in the atria and apex of the mouse heart were infected with a lentivirus carrying EGFP, and the destiny of the tagged cells was determined 1–5 months later. A common integration site was identified in isolated CPCs, cardiomyocytes, endothelial cel...

  14. A protocol for generation of transgenic mice by manipulating spermatogonial stem cells in vivo.

    OpenAIRE

    sprotocols

    2015-01-01

    Authors: Lalit Sehgal, Rahul Thorat, Nileema Khapare, Amitabha Mukhopadhaya, Mugdha Sawant & Sorab Dalal ### Abstract This protocol describes a technique for the generation of transgenic mice by in-vivo manipulation of spermatogonial stem cells (SSCs) with a high rate of success. In this study SSCs in pre-pubescent animals were infected in vivo with recombinant lentiviruses expressing EGFP-f and mated with normal females. All male pre-founder mice produced transgenic pups with an over...

  15. Reduced Genetic Diversity in Lymphoid and Central Nervous System Tissues and Selection-Induced Tissue-Specific Compartmentalization of Neuropathogenic SIVsmmFGb during Acute Infection

    OpenAIRE

    Reeve, Aaron B.; Patel, Kalpana; Pearce, Nicholas C.; Augustus, Katherine V.; Domingues, Heber G.; O'Neil, Shawn P.; Novembre, Francis J.

    2009-01-01

    The simian lentivirus strain SIVsmmFGb is a viral swarm population inducing neuropathology in over 90% of infected pigtailed macaques and serves as a reliable model for HIV neuropathogenesis. However, little is understood about the genetic diversity of this virus, how said diversity influences the initial seeding of the central nervous system and lymph nodes, or whether the virus forms distinct genetic compartments between tissues during acute infection. In this study, we establish that our S...

  16. Anemia infecciosa equina en una yegua pony (Equss caballus). Estudio clinico patologico

    OpenAIRE

    P.A. Flores-Flores

    2015-01-01

    La anemia infecciosa equina (AIE), es una enfermedad infecto contagiosa que afecta a équidos: caballos y ponis (Equss caballus), mulas y burros (E. asinus), ocasionada por el Lentivirus de la familia Retroviridae, subfamilia Orthoretrovirinae. La infección produce cuadros febriles recurrentes, anemia autoinmune, ictericia y edema; el curso clínico de la enfermedad puede ser agudo o crónico, y alta letalidad de los animales afectados. En el prese...

  17. Molecular cloning of feline immunodeficiency virus.

    OpenAIRE

    Olmsted, R A; Barnes, A K; Yamamoto, J K; Hirsch, V M; Purcell, R H; Johnson, P R

    1989-01-01

    Feline immunodeficiency virus (FIV) is a T-lymphotropic retrovirus associated with immunodeficiency and opportunistic infections in cats. The discovery of FIV provides an opportunity for the development of a small animal model for AIDS. To initiate the molecular and biological characterization of FIV, cDNA clones were synthesized and used to isolate a proviral clone of FIV. Molecular cross-hybridization analysis of FIV with five lentiviruses revealed that nucleotide-sequence similarities exis...

  18. Molecular and biological characterization of equine infectious anemia virus Rev.

    Science.gov (United States)

    Carpenter, Susan; Dobbs, Drena

    2010-01-01

    Equine infectious anemia virus (EIAV) is one of the most divergent members of the lentivirus subfamily of retroviruses and is considered a useful comparative model for molecular studies of lentivirus replication. The Rev protein of EIAV is functionally homologous with other lentiviral Revs and facilitates export of incompletely spliced viral mRNAs through a Crm1-dependent pathway. The trans- and cis-acting elements that mediate EIAV Rev function are similar to, but distinct from, the well-characterized elements in human immunodeficiency virus (HIV-1), the prototypical Rev protein. In addition, the EIAV rev sequence is highly variable in vivo, and changes in Rev phenotype correlate with changes in clinical stages of EIAV infection. This review summarizes the molecular biology of EIAV Rev-RRE interactions and the consequences of Rev variation in vivo. A comparative perspective of Rev activity may enhance understanding of an essential lentiviral protein and stimulate new strategies for treatment and prevention of lentivirus infections in vivo.

  19. Equine Infectious Anemia Virus (EIAV): what has HIV's country cousin got to tell us?

    Science.gov (United States)

    Leroux, Caroline; Cadoré, Jean-Luc; Montelaro, Ronald C

    2004-01-01

    Equine Infectious Anemia Virus (EIAV) is a lentivirus, of the Retrovirus family, with an almost worldwide distribution, infecting equids. It causes a persistent infection characterized by recurring febrile episodes associating viremia, fever, thrombocytopenia, and wasting symptoms. The disease is experimentally reproducible by inoculation of Shetland ponies or horses with EIAV pathogenic strains. Among lentiviruses, EIAV is unique in that, despite a rapid virus replication and antigenic variation, most animals progress from a chronic stage characterized by recurring peaks of viremia and fever to an asymptomatic stage of infection. The inapparent carriers remain infective for life, as demonstrated by experimental transfer of blood to naive animals. The understanding of the correlates of this immune control is of great interest in defining vaccine strategies. Research on EIAV, this "country cousin" of HIV (Human Immunodeficiency Virus), over the last five decades has produced some interesting results on natural immunological control of lentivirus replication and disease and on the nature and role of virus variation in persistence and pathogenesis. These studies are of interest in the context of HIV and efforts to develop a vaccine. This review will focus on some of the most recent results.

  20. CIAPIN1 gene silencing enhances chemosensitivity in a drug-resistant animal model in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Wang, X.M.; Gao, S.J.; Guo, X.F.; Sun, W.J. [Department of Oncology, The Second Affiliated Hospital, Harbin Medical University, Harbin (China); Yan, Z.Q. [Department of Breast Surgery, The Second Affiliated Hospital, Harbin Medical University, Harbin (China); Wang, W.X.; Xu, Y.Q.; Lu, D. [Department of Oncology, The Second Affiliated Hospital, Harbin Medical University, Harbin (China)

    2014-03-21

    Overexpression of cytokine-induced apoptosis inhibitor 1 (CIAPIN1) contributes to multidrug resistance (MDR) in breast cancer. This study aimed to evaluate the potential of CIAPIN1 gene silencing by RNA interference (RNAi) as a treatment for drug-resistant breast cancer and to investigate the effect of CIAPIN1 on the drug resistance of breast cancer in vivo. We used lentivirus-vector-based RNAi to knock down CIAPIN1 in nude mice bearing MDR breast cancer tumors and found that lentivirus-vector-mediated silencing of CIAPIN1 could efficiently and significantly inhibit tumor growth when combined with chemotherapy in vivo. Furthermore, Western blot analysis showed that both CIAPIN1 and P-glycoprotein expression were efficiently downregulated, and P53 was upregulated, after RNAi. Therefore, we concluded that lentivirus-vector-mediated RNAi targeting of CIAPIN1 is a potential approach to reverse MDR of breast cancer. In addition, CIAPIN1 may participate in MDR of breast cancer by regulating P-glycoprotein and P53 expression.

  1. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma [Retraction

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-12-01

    Full Text Available Huang W, Huang H, Wang L, Hu J, Song W. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma. OncoTargets and Therapy. 2017;10:2825–2833.This article has been retracted at the request of the Editor-in-Chief of OncoTargets and Therapy. It was brought to the attention of the Editorial team by the authors that in Lentivirus package and transfection part of the Materials and Methods section, the authors noted “a nontargeting shRNA (5′-GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3′ was used as control”. Recently the authors were advised by the supplier of the lentivirus there was an error in the illustration concerning the control group sequence. The correct sequence should be TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT rather than GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT. The authors cannot confirm that the sequence carried by the control group lentivirus was TTCTCCGAACGTGTCACGTCTCGA GACGTGACACGTTCGGAGAATTTTT so they have decided to respectfully retract this original research paper and perform the experiments again to retest the data. This retraction relates to

  2. Cyclophilin A interacts with diverse lentiviral capsids

    Directory of Open Access Journals (Sweden)

    Emerman Michael

    2006-10-01

    Full Text Available Abstract Background The capsid (CA protein of HIV-1 binds with high affinity to the host protein cyclophilin A (CypA. This binding positively affects some early stage of the viral life-cycle because prevention of binding either by drugs that occupy that active site of cyclophilin A, by mutation in HIV-1 CA, or RNAi that knocks down intracellular CypA level diminishes viral infectivity. The closely related lentivirus, SIVcpz also binds CypA, but it was thought that this interaction was limited to the HIV-1/SIVcpz lineage because other retroviruses failed to interact with CypA in a yeast two-hybrid assay. Results We find that diverse lentiviruses, FIV and SIVagmTAN also bind to CypA. Mutagenesis of FIV CA showed that an amino acid that is in a homologous position to the proline at amino acid 90 of HIV-1 CA is essential for FIV interactions with CypA. Conclusion These results demonstrate that CypA binding to lentiviruses is more widespread than previously thought and suggest that this interaction is evolutionarily important for lentiviral infection.

  3. Plasma leptin determination in ruminants: effect of nutritional status and body fatness on plasma leptin concentration assessed by a specific RIA in sheep.

    Science.gov (United States)

    Delavaud, C; Bocquier, F; Chilliard, Y; Keisler, D H; Gertler, A; Kann, G

    2000-05-01

    A specific leptin RIA was developed to assess concentrations of leptin in ovine plasma, and was shown to be efficient with bovine and caprine plasma. A specific, high-affinity antibody was generated against recombinant ovine leptin which, when used in a competitive leptin RIA, provided valid estimates of linearity (r=+0.989-0.998), recovery (102%), repeatability (13%) and limit of sensitivity (0.83 ng/ml for 100 microl sample size). Serial dilutions of five ovine, bovine or caprine plasma samples showed good linearity and parallelism with the recombinant ovine leptin standard curve. A comparison of this RIA was made with a commercial 'multi-species' RIA kit using 56 ovine plasma samples. Major differences were found in assay sensitivity. Non-lactating, non-pregnant, ovariectomized ewes were fed a ration for 65 days which provided 90+/-9% (control; n=12) or 39+/-2% of maintenance energy requirements (underfed; n=16) in order to analyse the respective effects of body fatness (estimated by either an in vivo dilution technique or body condition scoring) and of nutritional status on plasma leptin concentration. There was a significant positive correlation between body fatness or body condition score and plasma leptin levels (r=+0.68, Pnutritional status (17%).

  4. Microtubule-dependent association of AKAP350A and CCAR1 with RNA stress granules

    International Nuclear Information System (INIS)

    Kolobova, Elena; Efimov, Andrey; Kaverina, Irina; Rishi, Arun K.; Schrader, John W.; Ham, Amy-Joan; Larocca, M. Cecilia; Goldenring, James R.

    2009-01-01

    Recent investigations have highlighted the importance of subcellular localization of mRNAs to cell function. While AKAP350A, a multifunctional scaffolding protein, localizes to the Golgi apparatus and centrosomes, we have now identified a cytosolic pool of AKAP350A. Analysis of AKAP350A scaffolded complexes revealed two novel interacting proteins, CCAR1 and caprin-1. CCAR1, caprin-1 and AKAP350A along with G3BP, a stress granule marker, relocate to RNA stress granules after arsenite treatment. Stress also caused loss of AKAP350 from the Golgi and fragmentation of the Golgi apparatus. Disruption of microtubules with nocodazole altered stress granule formation and changed their morphology by preventing fusion of stress granules. In the presence of nocodazole, arsenite induced smaller granules with the vast majority of AKAP350A and CCAR1 separated from G3BP-containing granules. Similar to nocodazole treatment, reduction of AKAP350A or CCAR1 expression also altered the size and number of G3BP-containing stress granules induced by arsenite treatment. A limited set of 69 mRNA transcripts was immunoisolated with AKAP350A even in the absence of stress, suggesting the association of AKAP350A with mRNA transcripts. These results provide the first evidence for the microtubule dependent association of AKAP350A and CCAR1 with RNA stress granules

  5. DNA homologies and serologic relationships among ureaplasmas from various hosts.

    Science.gov (United States)

    Barile, M F

    1986-01-01

    The available data on the serologic and genomic relationships among the established and unspeciated Ureaplasma species and serovars isolated from various hosts can be summarized as follows. Ureaplasma urealyticum (human) is composed of 14 serovars separated into two genomic clusters. Ureaplasma diversum (bovine) is antigenically complex, has three serologic clusters and requires the three representative antisera to identify all U. diversum strains. The nonhuman primate strains form four serologic groups, and each serogroup is composed of strains isolated from primates belonging to one of four distinct zoologic primate families. The ovine-caprine strains have two serologic clusters. Canine strains form four serologic clusters but serovars 1 and 2 are closely related by DNA homology. Avian strains belong to one serogroup with two genomic clusters. The DNA homology data indicate that phenotypic information alone, including antigenic serotypic data, is not always adequate for species designation among the ureaplasmas and that comparative analyses of the genome provide invaluable data for establishing new species. Although there are only two established species, the published data support the contention that the nonhuman primate, ovine-caprine, canine, feline and avian ureaplasmas are genomically and phenotypically distinct from each other based on the serologic, polyacrylamide gel electrophoresis protein and DNA cleavage patterns and DNA homology studies and that these ureaplasmas from various hosts may represent new species or subspecies within the genus.

  6. Effect of plant oils in the diet on performance and milk fatty acid composition in goats fed diets based on grass hay or maize silage.

    Science.gov (United States)

    Bernard, Laurence; Shingfield, Kevin J; Rouel, Jacques; Ferlay, Anne; Chilliard, Yves

    2009-01-01

    Based on the potential benefits to long-term human health there is interest in developing sustainable nutritional strategies for reducing saturated and increasing specific unsaturated fatty acids in ruminant milk. The impact of plant oil supplements to diets containing different forages on caprine milk fatty acid composition was examined in two experiments using twenty-seven Alpine goats in replicated 3 x 3 Latin squares with 28 d experimental periods. Treatments comprised of no oil (control) or 130 g/d of sunflower-seed oil (SO) or linseed oil (LO) supplements added to diets based on grass hay (H; experiment 1) or maize silage (M; experiment 2). Milk fat content was enhanced (Pdiets, resulting in 17, 15 and 14% increases in milk fat secretion, respectively. For both experiments, plant oils decreased (Pplant oil composition and forage in the diet. In conclusion, plant oils represent an effective strategy for altering the fatty acid composition of caprine milk, with evidence that the basal diet is an important determinant of ruminal unsaturated fatty acid metabolism in the goat.

  7. Seroprevalence of Q fever in sheep and goat flocks with a history of abortion in Iran between 2011 and 2012

    Directory of Open Access Journals (Sweden)

    Javad Asadi

    2013-06-01

    Full Text Available The purpose of this study was to estimate the seroprevalence of Coxiella burnetii infection in sheep and goat flocks with a history of abortion in different areas of Iran. One thousand and one hundred ovine and 180 caprine samples from 43 sheep and goat flocks in four counties located in the Northeast (Mashhad, Central (Isfahan, Western (Arak, and Southwest (Shiraz Iran were collected randomly between March 2011 and April 2012. The CHEKIT Q fever ELISA kit was used to identify specific antibodies against C. burnetii in sheep and goats. The results showed that the overall seroprevalence of C. burnetii in sheep and goats was 19.5% and 27.2%, respectively. There was a significant difference in seropositivity between sheep and goats (P<0.05. Central Iran significantly had the highest prevalence among the studied areas, especially in goat coxiellosis (23.8% and 40.8% in sheep and goats, respectively. The lowest prevalence in sheep was 12.8% in Northeast Iran while in Western Iran C. burnetii antibodies were absent in goats. The higher prevalence of Q fever in Central Iran may be partly due to persistent favourable conditions to spread C. burnetii in this area including drought and dust storms that originated from neighbouring Iraq and Kuwait. In conclusion, the present study demonstrated the relatively high prevalence of Q fever in sheep and goat flocks with a history of abortion. Therefore, Q fever could be responsible for considerable numbers of ovine and caprine abortions in Iran.

  8. Plasmids in Mycoplasma species isolated from goats and sheep and their preliminary typing

    Directory of Open Access Journals (Sweden)

    Nascimento Elmiro R.

    1999-01-01

    Full Text Available One-hundred-five (105 clinical isolates of mycoplasma from caprine origin and one isolate from ovine were surveyed for plasmids, which were present in thirty-three (31% of them. These mycoplasmas originated from 13 herds. Ten of them were symptomatic for mycoplasmal disease (mastitis, polyarthritis, septicemia and three herds were asymptomatic, i.e., clinically normal. Twenty-eight isolates were Mycoplasma mycoides subspecies mycoides LC (large colony or caprine biotype, four were Mycoplasma capricolum subsp. capricolum and one was Mycoplasma cottewii. The isolated plasmids were linearized by EcoRI, EcoRV, EcoRI and EcoRV or BamHI and EcoRV, and were of five sizes (1.1, 1.6, 1.7, 1.8, and 1.9 Kbp. Based on restriction enzyme digestion and size of the linearized supercoiled extrachromosomal DNA, five plasmid types were recovered (p1II, p2III, p2V, p3I, and p4IV. The small size of these DNA elements probably exclude replicative forms of DNA virus, which are equal or larger than 8.0 Kbp.

  9. A specific pattern of splicing for the horse αS1-Casein mRNA and partial genomic characterization of the relevant locus

    Directory of Open Access Journals (Sweden)

    Guérin Gérard

    2002-07-01

    Full Text Available Abstract Mares' milk has a composition very different from that of cows' milk. It is much more similar to human milk, in particular in its casein fraction. This study reports on the sequence of a 994 bp amplified fragment corresponding to a horse αS1-Casein (αS1-Cn cDNA and its comparison with its caprine, pig, rabbit and human counterparts. The alignment of these sequences revealed a specific pattern of splicing for this horse primary transcript. As in humans, exons 3', 6' and 13' are present whereas exons 5, 13 and 14 are absent in this equine mRNA sequence. BAC clones, screened from a horse BAC library, containing the αS1-Cn gene allowed the mapping of its locus by FISH on equine chromosome 3q22.2-q22.3 which is in agreement with the Zoo-FISH results. Genomic analysis of the αS1-Cn gene showed that the region from the second exon to the last exon is scattered within a nucleotide stretch nearly 15-kb in length which is quite similar in size to its ruminant and rabbit counterparts. The region between αS1- and β-Cn genes, suspected to contain cis-acting elements involved in the expression of all clustered casein genes, is similar in size (ca. 15-kb to the caprine and mouse intergenic region.

  10. Phospholipid classes and fatty acid composition of ewe’s and goat’s milk

    Directory of Open Access Journals (Sweden)

    Zancada, L.

    2013-06-01

    Full Text Available The content, distribution of individual species, and the fatty acid composition of phospholipids (PL from ewe’s and goat’s milk were analyzed. The binding of enterotoxigenic and uropathogenic Escherichia coli strains to PL and the inhibition of bacterial hemagglutination by PL were addressed using high performance thin-layer chromatography-overlay assays and microtiter plates, respectively. Ovine and caprine milk contained more PL than bovine milk but less than human milk. The profile of individual PL was similar, including sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine and phosphatidylinositol in both ovine and caprine milk. Regarding the fatty acid composition, a high content of long-chain fatty acids (more than C16 and unsaturated fatty acids, with C18:1 as the most abundant was found in ovine and caprine milk PL. Ovine milk has longer and less saturated fatty acids while caprine milk has shorter and more saturated ones. Neither the adhesion of any bacterial strains assayed to the individual PL from ovine or caprine milk nor the inhibition of bacterial hemagglutination by PL were observed. These are important constituents of the milk fat globule membrane, but it seems that they do not play a role in the defence of new-borns against bacteria if the results obtained are taken into account.Se ha analizado el contenido, distribución de las especies individuales y la composición en ácidos grasos de los fosfolípidos (FL de la leche de oveja y de cabra. Se ha estudiado también la unión de cepas enterotoxigénicas y uropatogénicas de Escherichia coli a estos compuestos y el efecto de los FL sobre la hemaglutinación provocada por estas bacterias mediante inmunodetección en placa y ensayos en placas multipocillo, respectivamente. La leche de oveja y de cabra contiene más FL que la de vaca, pero menos que la leche humana. El perfil de FL individuales es similar en la leche de oveja y de cabra e incluye

  11. Stem cells with FGF4-bFGF fused gene enhances the expression of bFGF and improves myocardial repair in rats

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xiang-Qi; Chen, Liang-Long, E-mail: xhzlyx@126.com; Fan, Lin; Fang, Jun; Chen, Zhao-Yang; Li, Wei-Wei

    2014-04-25

    Highlights: • BFGF exists only in the cytoplasm of live cells. • BFGF cannot be secreted into the extracellular space to promote cell growth. • We combine the secretion-promoting signal peptide of FGF4. • We successfully modified BMSCs with the fused genes of FGF4-bFGF. • We promoted the therapeutic effects of transplanted BMSCs in myocardial infarction. - Abstract: The aim of this study was to investigate whether the modification of bone marrow-derived mesenchymal stem cells (BMSCs) with the fused FGF4 (fibroblast growth factor 4)-bFGF (basic fibroblast growth factor) gene could improve the expression and secretion of BFGF, and increase the efficacies in repairing infarcted myocardium. We used In-Fusion technique to construct recombinant lentiviral vectors containing the individual gene of bFGF, enhanced green fluorescent protein (EGFP), or genes of FGF4-bFGF and EGFP, and then transfected these lentiviruses into rat BMSCs. We conducted an in vitro experiment to compare the secretion of bFGF in BMSCs infected by these lentiviruses and also examined their therapeutic effects in the treatment of myocardial infraction in a rodent study. Sixty rats were tested in the following five conditions: Group-SHAM received only sham operation as controls; Group-AMI received only injection of placebo PBS buffer; Group-BMSC, Group-bFGF and Group-FGF4-bFGF received implantation of BMSCs with empty lentivirus, bFGF lentivirus, and FGF4-bFGF lentivirus, respectively. Our results found out that the transplanted FGF4-bFGF BMSCs had the highest survival rate, and also the highest myocardial expression of bFGF and microvascular density as evidenced by Western blotting and immunohistochemistry, respectively. As compared to other groups, the Group-FGF4-BFGF rats had the lowest myocardial fibrotic fraction, and the highest left ventricular ejection fraction. These results suggest that the modification of BMSCs with the FGF4-bFGF fused gene can not only increase the expression of

  12. Double transduction of a Cre/LoxP lentiviral vector: a simple method to generate kidney cell-specific knockdown mice.

    Science.gov (United States)

    Nam, Bo Young; Kim, Dong Ki; Park, Jung Tak; Kang, Hye-Young; Paeng, Jisun; Kim, Seonghun; Park, Jimin; Um, Jae Eun; Oh, Hyung Jung; Han, Seung Hyeok; Yoo, Tae-Hyun; Kang, Shin-Wook

    2015-12-15

    In a lentivirus-based gene delivery system, the incorporated gene is continuously expressed for a long time. In this study, we devised a simple way to knock down a specific gene in a kidney cell-specific pattern in adult mice by lentivirus-assisted transfer of short hairpin RNA (shRNA). Kidney collecting duct (CD)-specific aquaporin-3 (AQP3)-knockdown mice were generated by consecutive injection of Hoxb7-Cre-expressing lentivirus (LV-Hoxb7 Cre) and loxP-AQP3 shRNA-expressing lentivirus (LV-loxP shAQP3) in adult C57BL6/J mice. LV-Hoxb7 Cre was designed to express mCherry, while LV-loxP shAQP3 was designed with a floxed enhanced green fluorescent protein (EGFP)-tagged stop sequence, and thus EGFP would be expressed only in the absence of Cre recombination. In mice treated with LV-Hoxb7 Cre alone, mCherry protein expression, which indicates the presence of Cre recombinase, occurred only in CD cells. However, LV-loxP shAQP3 injection alone resulted in an increase in EGFP expression in all kidney cells, indicating the transcription of the floxed region. When LV-Hoxb7 Cre and LV-loxP shAQP3 were sequentially transduced, EGFP expression was attenuated while mCherry expression was sustained in CD cells, demonstrating a CD cell-specific recombination of the floxed region. AQP3 expression in mice injected with LV-Hoxb7 Cre or LV-loxP shAQP3 alone did not differ, but consecutive injection of LV-Hoxb7 Cre and LV-loxP shAQP3 significantly reduced AQP3 expression in CD cells. However, the expression levels of AQP3 were not altered in other cell types. Double transduction of Cre- and loxP-based lentivirus can easily generate kidney cell-specific knockdown mice, and this method might be applicable to other species. Copyright © 2015 the American Physiological Society.

  13. Interspecies and seasonal differences of retinol in dairy ruminant´s milk

    Directory of Open Access Journals (Sweden)

    Lucia Hodulová

    2015-08-01

    Full Text Available Milk is an essential source of macronutrients and among lipophilic vitamins is significant source of retinol. The contribution of milk to the reference daily intake for retinol varies from 11% to 16%, worldwide. The most consumed dairy products are fresh, dehydrated and condensed milk in which the amonuts of retinol are not modified to those of in whole milk. Retinol is essential to ensure a good functionality of the immune system and plays a critical role in vision, reproduction, cell differentiation as well as growth and development and is found only in animal tissues. The aim of our study was to evaluate the interspecies differences in the retinol concentration of whole raw bovine, caprine and ovine milk and to observe seasonal variation of retinol in bulk tank milk samples. Samples of raw milk were colleceted on different farms in the Czech Republic between 2013 and 2014. Retinol was measured by ultra high performance liquid chromatography with UV detection (325 nm in isocratic mode after alkaline saponification with methanolic potassium hydroxide solution and liquid-liquid extraction into non polar organic solvent of whole raw milk. To avoid vitamin losses or degradation during the procedure, antioxidants were added to the sample extraction media. Our results indicate significant interspecies differences between bovine and ovine milk and caprine and ovine milk. Concentration of retinol is very similar in bovine and caprine milk 0.96 ±0.11 mg/L, 0.94 ±0.25 mg/L, respectively. The mean concentration in sheep´s milk is 1.75 ±0.24 mg/L. The seasonal variation of retinol in raw bovine milk was detected as high significant, with the highest concentration during winter. These results contribute to the nutrition evaluation of milk in the Czech Republic and indicate, that the sheep´s milk is the best source of retinol among the milks of ruminants kept in the Czech Republic, however it is not used in its fluid form for human consumption.

  14. Can Chlamydia abortus be transmitted by embryo transfer in goats?

    Science.gov (United States)

    Oseikria, M; Pellerin, J L; Rodolakis, A; Vorimore, F; Laroucau, K; Bruyas, J F; Roux, C; Michaud, S; Larrat, M; Fieni, F

    2016-10-01

    The objectives of this study were to determine (i) whether Chlamydia abortus would adhere to or penetrate the intact zona pellucida (ZP-intact) of early in vivo-derived caprine embryos, after in vitro infection; and (ii) the efficacy of the International Embryo Transfer Society (IETS) washing protocol for bovine embryos. Fifty-two ZP-intact embryos (8-16 cells), obtained from 14 donors were used in this experiment. The embryos were randomly divided into 12 batches. Nine batches (ZP-intact) of five embryos were incubated in a medium containing 4 × 10(7)Chlamydia/mL of AB7 strain. After incubation for 18 hours at 37 °C in an atmosphere of 5% CO2, the embryos were washed in batches in 10 successive baths of a phosphate buffer saline and 5% fetal calf serum solution in accordance with IETS guidelines. In parallel, three batches of ZP-intact embryos were used as controls by being subjected to similar procedures but without exposure to C. abortus. The 10 wash baths were collected separately and centrifuged for 1 hour at 13,000 × g. The washed embryos and the pellets of the 10 centrifuged wash baths were frozen at -20 °C before examination for evidence of C. abortus using polymerase chain reaction. C. abortus DNA was found in all of the infected batches of ZP-intact embryos (9/9) after 10 successive washes. It was also detected in the 10th wash fluid for seven batches of embryos, whereas for the two other batches, the last positive wash bath was the eighth and the ninth, respectively. In contrast, none of the embryos or their washing fluids in the control batches were DNA positive. These results report that C. abortus adheres to and/or penetrates the ZP of in vivo caprine embryos after in vitro infection, and that the standard washing protocol recommended by the IETS for bovine embryos, failed to remove it. The persistence of these bacteria after washing makes the embryo a potential means of transmission of the bacterium during embryo transfer from

  15. The BOC ELISA, a ruminant-specific AMH immunoassay, improves the determination of plasma AMH concentration and its correlation with embryo production in cattle.

    Science.gov (United States)

    Arouche, Nassim; Picard, Jean-Yves; Monniaux, Danielle; Jamin, Soazik P; Vigier, Bernard; Josso, Nathalie; Cate, Richard L; di Clemente, Nathalie; Taieb, Joëlle

    2015-11-01

    Plasma anti-Müllerian hormone (AMH) concentrations have been recently found to be predictive of the number of embryos recovered after FSH superovulatory treatment in the cow. However, the sensitivity of the Active Müllerian-inhibiting substance/AMH ELISA (ref. 10-14400; DSL-Beckman-Coulter) used to make these measurements in bovine plasma samples is low because it was developed to measure human AMH levels. To overcome this limitation, we developed an immunoassay specific for the bovine (B), ovine (O), and caprine (C) species, the bovine-ovine-caprine (BOC) ELISA. For this purpose, we produced recombinant bovine AMH for standardization, and we used monoclonal antibodies raised against bovine AMH, previously prepared by our laboratory. We evaluated the precision, accuracy, specificity, limit of detection, and functional sensitivity of the assay. The intra-assay coefficient of variation ranged between 3.4% and 11.3% for AMH concentrations between 23.68 and 1.74 ng/mL, and the interassay coefficient of variation ranged between 4.8% and 20.5% for concentrations between 25.53 and 1.42 ng/mL, respectively. The assay displayed a good linearity, had a detection limit of 0.4 ng/mL and a functional sensitivity of 1.4 ng/mL. It also cross-reacted with ovine and caprine AMHs. Both the mean and median AMH levels measured in 40 cow plasma samples using the BOC ELISA were approximately 44 fold higher than the mean and median AMH levels measured with the Active Müllerian-inhibiting substance/AMH ELISA. Moreover, a higher correlation was observed between the average number of embryos recovered from each cow after superovulatory treatment and AMH concentrations measured with the BOC ELISA. This BOC ELISA provides a very efficient tool for evaluating the ovarian follicular reserve of cows and predicting their embryo production capacity. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. A novel enterovirus species identified from severe diarrheal goats

    Science.gov (United States)

    Liu, Yajing; Deng, Yingrui; Zhu, Lisai; Guo, Changming; Tu, Changchun; Wang, Xinping

    2017-01-01

    Backgrounds The Enterovirus genus of the family of Picornaviridae consists of 9 species of Enteroviruses and 3 species of Rhinoviruses based on the latest virus taxonomy. Those viruses contribute significantly to respiratory and digestive disorders in human and animals. Out of 9 Enterovirus species, Enterovirus E-G are closely related to diseases affecting on livestock industry. While enterovirus infection has been increasingly reported in cattle and swine, the enterovirus infections in small ruminants remain largely unknown. Methods Virology, molecular and bioinformatics methods were employed to characterize a novel enterovirus CEV-JL14 from goats manifesting severe diarrhea with morbidity and mortality respectively up to 84% and 54% in China. Results CEV-JL14 was defined and proposed as a new Enterovirus species L within the genus of Enterovirus of the family Picornaviridae. CEV-JL14 had a complete genome sequence of 7461 nucleotides with an ORF encoding 2172 amino acids, and shared 77.1% of genomic sequence identity with TB4-OEV, an ovine enterovirus. Comparison of 5’-UTR and structural genes of CEV-JL14 with known Enterovirus species revealed highly genetic variations among CEV-JL14 with known Enterovirus species. VP1 nucleotide sequence identities of CEV-14 were 51.8%-53.5% with those of Enterovirus E and F, 30.9%-65.3% with Enterovirus G, and 43.8–51. 5% with Enterovirus A-D, respectively. CEV-JL14 was proposed as a novel species within the genus of Enterovirus according to the current ICTV demarcation criteria of enteroviruses. Conclusions CEV-JL14 clustered phylogenetically to neither Enterovirus E and F, nor to Enterovirus G. It was defined and proposed as novel species L within the genus of Enterovirus. This is the first report of caprine enterovirus in China, the first complete genomic sequence of a caprine enterovirus revealed, and the unveiling of significant genetic variations between ovine enterovirus and caprine enterovirus, thus broadening the

  17. Effect of C3G gene on apoptosis and proliferation of H9C2 cardiomyocytes

    Directory of Open Access Journals (Sweden)

    Dong-yan YANG

    2015-10-01

    Full Text Available Objective To study the effect of C3G gene on apoptosis and proliferation of H9C2 cardiomyocytes and its mechanism. Methods The RNA lentivirus was constructed, and pCXN2-Flag plasmid (empty plasmid and pCXN2-Flag-hC3G plasmid (over-expressed human C3G mRNA were purchased. H9C2 cardiomyocytes were respectively infected and transfected with blank reagent, negative lentivirus, C3G siRNA lentivirus, C3G siRNA lentivirus+pCXN2-Flag plasmid and C3G siRNA lentivirus+pCXN2-Flag-hC3G plasmid with stochastic method. Thus the experiments were randomly divided into five groups, namely blank group, negative control group, C3G silence group, C3G silence+empty plasmid group, and C3G silence+C3G overexpression group. Seventy two hours after plasmid transfection, the expression of C3G mRNA was detected by PT-RCR, cell apoptosis was determined by flow cytometry, cell proliferation rate was determined by MTT, and the protein levels of C3G, p-ERK1/2, Bax and Flag were determined by Western blotting. Results As screened by puromycin, it was found that more than 85% of the cells in negative control group and C3G silence group were labeled with green fluorescent protein, showing that more than 85% of the cells were infected with lentivirus. Compared with blank group and negative control group, the expressed Bax protein and cell apoptosis rate were increased significantly (P<0.01, P<0.05, and the expression levels of C3G mRNA, C3G protein and p-ERK1/2 protein and the cell proliferation rate were remarkably decreased in C3G silence group and C3G silence+empty plasmid group (P<0.01, P<0.05; Compared with C3G silence group and C3G silence+empty plasmid group, the expression level of Bax protein and the cell apoptosis rate were decreased obviously (P<0.01, P<0.05, while the expression levels of C3G mRNA, C3G protein and p-ERK1/2 protein and the cell proliferation rate were remarkably increased in C3G silence+C3G overexpression group (P<0.01, P<0.05. Conclusion C3G

  18. Fluorescent labelling of intestinal epithelial cells reveals independent long-lived intestinal stem cells in a crypt

    International Nuclear Information System (INIS)

    Horita, Nobukatsu; Tsuchiya, Kiichiro; Hayashi, Ryohei; Fukushima, Keita; Hibiya, Shuji; Fukuda, Masayoshi; Kano, Yoshihito; Mizutani, Tomohiro; Nemoto, Yasuhiro; Yui, Shiro; Okamoto, Ryuichi; Nakamura, Tetsuya; Watanabe, Mamoru

    2014-01-01

    Highlights: • Lentivirus mixed with Matrigel enables direct infection of intestinal organoids. • Our original approach allows the marking of a single stem cell in a crypt. • Time-lapse imaging shows the dynamics of a single stem cell. • Our lentivirus transgene system demonstrates plural long-lived stem cells in a crypt. - Abstract: Background and aims: The dynamics of intestinal stem cells are crucial for regulation of intestinal function and maintenance. Although crypt stem cells have been identified in the intestine by genetic marking methods, identification of plural crypt stem cells has not yet been achieved as they are visualised in the same colour. Methods: Intestinal organoids were transferred into Matrigel® mixed with lentivirus encoding mCherry. The dynamics of mCherry-positive cells was analysed using time-lapse imaging, and the localisation of mCherry-positive cells was analysed using 3D immunofluorescence. Results: We established an original method for the introduction of a transgene into an organoid generated from mouse small intestine that resulted in continuous fluorescence of the mCherry protein in a portion of organoid cells. Three-dimensional analysis using confocal microscopy showed a single mCherry-positive cell in an organoid crypt that had been cultured for >1 year, which suggested the presence of long-lived mCherry-positive and -negative stem cells in the same crypt. Moreover, a single mCherry-positive stem cell in a crypt gave rise to both crypt base columnar cells and transit amplifying cells. Each mCherry-positive and -negative cell contributed to the generation of organoids. Conclusions: The use of our original lentiviral transgene system to mark individual organoid crypt stem cells showed that long-lived plural crypt stem cells might independently serve as intestinal epithelial cells, resulting in the formation of a completely functional villus

  19. Construction of an Anticancer Fusion Peptide (ACFP) Derived from Milk Proteins and an Assay of Anti-ovarian Cancer Cells in vitro.

    Science.gov (United States)

    Zhou, Juan; Yang, Xue; Zhang, Wenxiao; Wang, Jing; Wei, Cai; Gu, Fang; Lei, Ting; Qin, Yide

    2017-01-01

    Some bioactive peptides derived from natural resources or synthesized by rational design have been shown to have very good anticancer effects. We designed an anticancer fusion peptide (ACFP) based on the structure of bovine lactoferricin (LfcinB) and hexapeptide (PGPIPN) derived from bovine milk protein. To prepare ACFP through genetic engineering and study its antiovarian cancer activity. ACFP gene was produced by a flexible link arm connecting LfcinB and PGPIPN. ACFP was inductively expressed in Escherichia coli by the recombinant plasmid pGEX-KG-ACFP. ACFP was prepared and purified by affinity chromatography, and identified by polyacrylamide gel electrophoresis (PAGE), high-performance liquid chromatography (HPLC) and mass spectrometry (MS). Recombinant lentivirus vectors were produced by cotransfecting 293T cells with constructed plasmid pLJM1-ACFP, envelope plasmid Δ8.91 and pVSVG using Lipofectamine. ACFP gene was transfected into ovarian cancer cells by pLJM1-ACFP lentivirus. Cell Viability was assayed by the methyl thiazolyl tetrazolium (MTT). The apoptosis of ovarian cancer SKOV3 cells was measured by flow cytometry and observed by Hoechst33258 staining. ACFP was successfully prepared and purified by genetic engineering. ACFP more effectively inhibited the viability of human ovarian cancer SKOV3 cells than the single parent peptides in vitro. ACFP was found to have no cytotoxicity towards untransformed cells. The ACFP gene in cancer cells infected with pLJM1-ACFP lentivirus could significantly inhibit the viability of SKOV3 cells and induce their apoptosis. ACFP is a potential therapeutic agent for the treatment of ovarian cancer. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  20. Selection of a rare neutralization-resistant variant following passive transfer of convalescent immune plasma in equine infectious anemia virus-challenged SCID horses.

    Science.gov (United States)

    Taylor, Sandra D; Leib, Steven R; Carpenter, Susan; Mealey, Robert H

    2010-07-01

    Vaccines preventing HIV-1 infection will likely elicit antibodies that neutralize diverse strains. However, the capacity for lentiviruses to escape broadly neutralizing antibodies (NAbs) is not completely understood, nor is it known whether NAbs alone can control heterologous infection. Here, we determined that convalescent immune plasma from a horse persistently infected with equine infectious anemia virus (EIAV) neutralized homologous virus and several envelope variants containing heterologous principal neutralizing domains (PND). Plasma was infused into young horses (foals) affected with severe combined immunodeficiency (SCID), followed by challenge with a homologous EIAV stock. Treated SCID foals were protected against clinical disease, with complete prevention of infection occurring in one foal. In three SCID foals, a novel neutralization-resistant variant arose that was found to preexist at a low frequency in the challenge inoculum. In contrast, SCID foals infused with nonimmune plasma developed acute disease associated with high levels of the predominant challenge virus. Following transfer to an immunocompetent horse, the neutralization-resistant variant induced a single febrile episode and was subsequently controlled in the absence of type-specific NAb. Long-term control was associated with the presence of cytotoxic T lymphocytes (CTL). Our results demonstrate that immune plasma with neutralizing activity against heterologous PND variants can prevent lentivirus infection and clinical disease in the complete absence of T cells. Importantly, however, rare neutralization-resistant envelope variants can replicate in vivo under relatively broad selection pressure, highlighting the need for protective lentivirus vaccines to elicit NAb responses with increased breadth and potency and/or CTL that target conserved epitopes.