WorldWideScience

Sample records for capitata wiedemann diptera

  1. Aphaereta ceratitivora sp. n. (Hymenoptera, Braconidae, a new parasitoid of Ceratitis capitata (Wiedemann (Diptera, Tephritidae from the Azores

    Directory of Open Access Journals (Sweden)

    Kees van Achterberg

    2012-09-01

    Full Text Available A new gregarious larval-pupal endoparasitoid of Ceratitis capitata (Wiedemann (Diptera: Tephritidae is described and illustrated: Aphaereta ceratitivora sp. n. (Braconidae: Alysiinae: Alysiini.

  2. Pos-harvest control of Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) in guava fruits (Psidium guajava L.).; Controle pos-colheita de Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) em frutos de goiaba (Psidium guajava L.)

    Energy Technology Data Exchange (ETDEWEB)

    Doria, Hayda Oliveira Souza

    2006-07-01

    The objective of this work is to evaluate the effect of the treatment with steam heating, hot water and gamma radiation of Co-60 on eggs and fruit flies larvae (Ceratitis capitata Wiedemann, 1824) (Diptera: Tephritidae), and analyze the effect of these treatments in the fruit quality (chemical composition)

  3. Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Anne M. Costa

    2011-09-01

    Full Text Available Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Studies on Ceratitis capitata, a world fruit pest, can aid the implementation of control programs by determining the plants with higher vulnerability to attacks and plants able to sustain their population in areas of fly distribution. The objective of the present study was to evaluate the influence of eight tropical fruits on the following biological and behavioral parameters of C. capitata: emergence percentage, life cycle duration, adult size, egg production, longevity, fecundity, egg viability, and oviposition acceptance. The fruits tested were: acerola (Malpighia glabra L., cashew (Anacardium occidentale L., star fruit (Averrhoa carambola L., guava (Psidium guajava L., soursop (Annona muricata L., yellow mombin (Spondias mombin L., Malay apple (Syzygium malaccense L., and umbu (Spondias tuberosa L.. The biological parameters were obtained by rearing the recently hatched larvae on each of the fruit kinds. Acceptance of fruits for oviposition experiment was assessed using no-choice tests, as couples were exposed to two pieces of the same fruit. The best performances were obtained with guava, soursop, and star fruit. Larvae reared on cashew and acerola fruits had regular performances. No adults emerged from yellow mombin, Malay apple, or umbu. Fruit species did not affect adult longevity, female fecundity, or egg viability. Guava, soursop, and acerola were preferred for oviposition, followed by star fruit, Malay apple, cashew, and yellow mombin. Oviposition did not occur on umbu. In general, fruits with better larval development were also more accepted for oviposition.Influência de diferentes frutos tropicais em aspectos biológicos e comportamentais da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Estudos em Ceratitis capitata, uma praga agrícola, pode auxiliar

  4. Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Anne M. Costa

    2011-09-01

    Full Text Available Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Studies on Ceratitis capitata, a world fruit pest, can aid the implementation of control programs by determining the plants with higher vulnerability to attacks and plants able to sustain their population in areas of fly distribution. The objective of the present study was to evaluate the influence of eight tropical fruits on the following biological and behavioral parameters of C. capitata: emergence percentage, life cycle duration, adult size, egg production, longevity, fecundity, egg viability, and oviposition acceptance. The fruits tested were: acerola (Malpighia glabra L., cashew (Anacardium occidentale L., star fruit (Averrhoa carambola L., guava (Psidium guajava L., soursop (Annona muricata L., yellow mombin (Spondias mombin L., Malay apple (Syzygium malaccense L., and umbu (Spondias tuberosa L.. The biological parameters were obtained by rearing the recently hatched larvae on each of the fruit kinds. Acceptance of fruits for oviposition experiment was assessed using no-choice tests, as couples were exposed to two pieces of the same fruit. The best performances were obtained with guava, soursop, and star fruit. Larvae reared on cashew and acerola fruits had regular performances. No adults emerged from yellow mombin, Malay apple, or umbu. Fruit species did not affect adult longevity, female fecundity, or egg viability. Guava, soursop, and acerola were preferred for oviposition, followed by star fruit, Malay apple, cashew, and yellow mombin. Oviposition did not occur on umbu. In general, fruits with better larval development were also more accepted for oviposition.

  5. Flutuação populacional de Anastrepha fraterculus (Wiedemann e Ceratitis capitata (Wiedemann (Diptera, Tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Population fluctuation of Anastrepha fraterculus (Wiedemann and Ceratitis capitata (Wiedemann (Diptera, Tephritidae in peach orchards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-01-01

    Full Text Available This paper presents the study of population fluctuation of Anastrepha fraterculus (Wiedemann, 1824 and Ceratitis capitata (Wiedemann, 1830 in peach orchards in Porto Alegre city. The peak for A. fraterculus was in November and December and for C. capitata in December and January. There was no significant difference among the population levels in the cultivars Fla 13-72, Premier and Marli.

  6. Influence of protein on feeding behavior of Ceratitis capitata Wiedemann (Diptera: Tephritidae): comparison between immature males and females

    Energy Technology Data Exchange (ETDEWEB)

    Placido-Silva, Maria do C.; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Dept. de Biologia

    2005-07-15

    The objective of this work was to compare the influence of dietary protein on performance and feeding behavior of immature males and females of Ceratitis capitata (Wiedemann). The protein source was beer yeast at 6.5 and 1.5 g.100 ml-1. The following parameters were evaluated: percentage of emergence, total life cycle, adult size, diet consumption, feeding preference and discrimination threshold for yeast. Immature adults showed similar protein requirements regardless of sex. Both males and females showed similar feeding behavior, preferring to feed on the diet with higher protein content. The discrimination threshold for levedure in both sexes was 0.4 g.100 ml-1. We concluded that immature males of C. capitata show similar protein requirements as the immature females. (author)

  7. Seasonal occurrence of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae in southern Syria

    Directory of Open Access Journals (Sweden)

    Mansour Mohammed

    2016-09-01

    Full Text Available Population fluctuations of the Mediterranean fruit fly (medfly, Ceratitis capitata, were investigated between 1999 and 2001 at several locations representing fruit production areas in the southern part of Syria (Damascus Ghota, Zabadani, Sargaiah, Rankus, Orneh and Ain Al-Arab. Medfly adults were monitored weekly all year around using Jackson traps baited with trimedlure dispensers. Larvae were also sampled in Damascus Ghota by collecting fruits from ripe or ripening fruit trees and recording the number of larvae emerged from these fruits. In addition, suspected overwintering refuges were sampled at weekly intervals during the three coldest months of the year (December – February and the number of collected larvae was recorded. The results of trap catches and fruit sampling studies showed a similar pattern of occurrence of medfly populations in the study areas, particularly in Damascus Ghota, during the three years of the study. In Damascus Ghota, flies were caught continuously from early June to late December with some variability between years. Two distinct periods of high fly activity were observed: the first one occurred in August and the second in November with a much higher amplitude. In general, seasonal fluctuations in the pattern of occurrence were influenced by differences in temperature and abundance of preferred host fruits. Traps on fig Ficus carica and oriental persimmon Diospyros kaki trees caught the highest numbers of flies, and fruits collected from these trees showed the highest level of infestation, reaching 100% for fig fruit late in the season. Sampling fruits (in Damascus Ghota from trees during the three coldest months of the year showed that a small population of medfly larvae was able to survive winter conditions in prickly pear Opuntia vulgaris fruit left on the trees. In the other areas of the study (Zabadani, Sargaiah, Rankus, Orneh and Ain Al-Arab, only a few flies were caught.

  8. Mating choice of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influence of male ageing on mating success; Escolha de parceiro para acasalamento em Ceratitis capitata (Wiedemann)(Diptera: Tephritidae): influencia do envelhecimento dos machos no sucesso de copula

    Energy Technology Data Exchange (ETDEWEB)

    Silva Neto, Alberto M. da; Dias, Vanessa S.; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral], e-mail: bio.alberto@gmail.com, e-mail: vanessasidias@hotmail.com, e-mail: ibravo@ufba.br

    2009-09-15

    The objective of this study was to evaluate the effect of male ageing on male pheromone release and mating success of Ceratitis capitata (Wiedemann). The effects of male ageing on mating were evaluated on fi ve and 21 d-old males by assessing their mating success (males chosen by a female for copulation) and the amount of males releasing the sex pheromone. The mating success was evaluated by using several ratios of young to older males by increasing the number of older males:young males from 1:1 to 5:1. The mating success of the 1:1 ratio was also evaluated in fi eld cages. The evaluation of the mating success (in the 1:1 ratio) showed a clear preference of the females for young males. Sex pheromone emission was much more common on young than older males. Even in cases were older males were more abundant (ratios 2:1 and 3:1), females still chose the young males. However, females could not distinguish young from older males in ratios of 4:1 or 5:1. Our data indicate that the ageing of C. capitata males has a considerable negative effect on their reproductive success, especially if they are found in a proportion any lower than 3:1. (author)

  9. Importance of adult protein ingestion on the mating success of Ceratitis capitata Wiedemann males (Diptera: Tephritidae); Importancia da ingestao de proteina na fase adulta para o sucesso de acasalamento dos machos de Ceratitis capitata Wiedemann (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Silva Neto, Alberto M. da; Dias, Vanessa S.; Joachim-Bravo, Iara S., E-mail: bio.alberto@gmail.co, E-mail: vanessasidias@hotmail.co, E-mail: ibravo@ufba.b [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral

    2010-04-15

    The importance of the protein ingestion during the adult stage on the mating success of males of Ceratitis capitata Wiedemann was evaluated in experiments of laboratory and fi eld cage. In laboratory, the effects of protein ingestion during the fi rst four or 12 days of the male adult life was assessed by the following parameters: mating success (capacity of being chosen by the female) and the number of males that give out pheromonal signals. Some experiments of mating success had been carried through with males in different ratios. In these tests, the number of males which had ingested protein (an unique male) was remained constant and the number of males fed without protein was gradually increased from 1:1 to 1:5. In the fi eld cages, the mating success experiments were done using a 1:1 ratio. The results showed that the protein ingestion in the fi rst four days of life did not influence any of the analyzed parameters. When the period of ingestion of protein was extended to 12 days, protein-fed males fed produced more pheromonal signals and had a higher mating success when at a 1:1 ratio in laboratory and fi eld cage assays. In laboratory, females randomly chose males in any other tested ratio (1:2, 1:3, 1:4 and 1:5), indicating that the female may lose the perception to identify the male who ingested protein in the fi rst 12 days. (author)

  10. Effects of different protein concentrations on longevity and feeding behavior of two adult populations of Ceratitis capitata Wiedemann (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Placido-Silva, Maria do Carmo; Silva Neto, Alberto M. da; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Dept. de Biologia Geral; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia Ciencias e Letras. Dept. de Biologia

    2006-11-15

    The effects of protein intake on two adult male and female populations of Ceratitis capitata Wiedemann were assessed. One population consisted of flies reared for twenty years in the laboratory (Lab-pop); the other population consisted both of flies reared in the laboratory for approximately fifteen years and of the periodically introduced wild flies (Hybrid-pop). Three diets were tested: a no-yeast diet and two diets containing yeast (protein source) at the concentrations 6.5 g or 1.5 g per 100 ml diet. The parameters analyzed were: adult longevity, diet intake with and without yeast, and discrimination threshold for yeast. Protein intake increased Lab-pop adult longevity and did not affect longevity of the Hybrid-pop. Longevity in each population was similar for males and females fed on the same diet. Food behavior were similar for male and female adults of both populations; all preferred diets containing protein (yeast). Males and females in both populations ingested similar amounts of each diet. The discrimination threshold for yeast was similar for all males (0.5 g yeast/100 ml diet); Lab-pop females were able to detect the presence of smaller quantities of yeast in their diet, thus having a higher discrimination capacity (0.4 g/100 ml diet) as compared to the Hybrid-pop females (0.6 g/ 100 ml diet). (author)

  11. Avaliação da qualidade de frutos de café atacados por Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae Evaluation of the quality of coffee fruit attacked by Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    F.J. Cividanes

    1993-09-01

    Full Text Available Foram usadas plantas de Coffea arabica L., variedade Catuaí Vermelho, localizadas no Campus da Escola Superior de Agricultura "Luiz de Queiroz" - USP, Piracicaba,SP, para avaliação dos danos que Ceratitis capitata (Wied., 1824 pode causar aos frutos do cafeeiro. Os resultados mostraram que o ataque de C. capitula não causou queda prematura dos frutos, mas aumentou a queda de cerejas e foram encontradas, fortes evidências, com base na atividade da enzima polifenol oxidase e lixiviação de potássio, que cerejas atacadas podem produzir bebida de café de qualidade inferior.The present work was carried out using trees of Coffea arabica L. variety Red Catuaí grown at Escola Superior de Agricultura "Luiz de Queiroz" - Campus of the University of São Paulo, Piracicaba,SP. The objective was to estimate damages that Ceratitis capitata (Wied., 1824 can cause to coffee fruits. The results showed that C.capitata did not cause premature fruit fall, but it increased berry fall. The activity of the enzyme polyphenol oxidase and potassium lixiviatiou give strong evidences that atacked coffee beans produce coffee beverage of inferior quality.

  12. Infestation of grape Vitis vinifera by Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) in sub-medium Sao Francisco valley, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Habibe, Tuffi C.; Viana, Rodrigo E.; Damasceno, Itala Cruz; Malavasi, Aldo [Biofabrica Moscamed Brasil, Juazeiro, BA (Brazil). Distrito Industrial do Sao Francisco; Nascimento, Antonio S., E-mail: antnasc@cnpmf.embrapa.b [EMBRAPA Mandioca e Fruticultura Tropical, Cruz das Almas, BA (Brazil); Paranhos, Beatriz A.J.; Haji, Francisca Nemaura P., E-mail: bjodao@cpatsa.embrapa.b [EMBRAPA Semi-Arido, Petrolina, PE (Brazil); Carvalho, Raimundo S. [Agencia de Defesa Agropecuaria da Bahia (ADAB), Salvador, BA (Brazil)

    2006-07-01

    The objective of this study was to assess the infestation level in grapes, Vitis vinifera, by the medfly,Ceratitis capitata in the Sao Francisco River Valley. The adult population was monitored with Jackson trap baited with trimedlure. Samples of grapes for larval infestation assessment were taken along three months, with a total of 116 kg. The average FTD (flies/trap/day) for medfly males was 0.26. The number of pupae obtained from the fruit samples was 471; 287 adults emerged (60.4%), all Ceratitis capitata. The infestation level was 4.0 pupa/kg of fresh fruit. We conclude that grape is a medfly host in SFV, occasionally causing high damage to production. (author)

  13. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Polychronis Rempoulakis

    Full Text Available The Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera: Tephritidae is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT as a component of area-wide integrated pest management (AW-IPM approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS that has a white pupae (wp and temperature sensitive lethal (tsl mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C. The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2 strain and the transgenic strain VIENNA 8-1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8-1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8-1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8-1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were

  14. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae).

    Science.gov (United States)

    Rempoulakis, Polychronis; Taret, Gustavo; Haq, Ihsan Ul; Wornayporn, Viwat; Ahmad, Sohel; Sto Tomas, Ulysses; Dammalage, Thilakasiri; Gembinsky, Keke; Franz, Gerald; Cáceres, Carlos; Vreysen, Marc J B

    2016-01-01

    The Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT) as a component of area-wide integrated pest management (AW-IPM) approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS) that has a white pupae (wp) and temperature sensitive lethal (tsl) mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C). The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2) strain and the transgenic strain VIENNA 8-1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8-1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8-1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8-1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were equally

  15. Machos Virgens e Acasalados de Ceratitis capitata Wiedemann (Diptera: Tephritidae Apresentam o mesmo Sucesso de Cópula e a mesma Capacidade de Inibição de Recópula das Fêmeas?

    Directory of Open Access Journals (Sweden)

    Luiza Santana

    2014-08-01

    Virgin and Mated Males of Ceratitis capitata Wiedemann (Diptera: Tephritidae Have the Same Mating Success and the Same Ability to Inhibit Female Remating? Abstract. Ceratitis capitata Wiedemann is a polyphagous species that damages fruits and affects their production and consumption. One of the techniques to manage this pest is the Sterile Insect Technique, which consists in releasing sterile males in nature to compete with wild males for mating. The success of this technique is associated with the ability of sterile male in being selected by the female and in preventing female remating with other males. This paper aims to evaluate the influence of male reproductive status in mating success and in female remating inhibition. Tests for evaluating the latency to mate and copula duration were performed to evaluate latency to mate and copula duration based on different male status. In remating inhibition tests, females mated with virgin and mated males, were exposed to other males one day after the first mating so the rate of remating could be evaluated. The results showed that males of different reproductive status had no differences in mating success and in female remating inhibition. The latency to mate and copula duration were similar for both male status as well. Our results suggest that, assuming that the sterile males have the same basic biology of no sterile males, in SIT, after released in nature, mated males can have the same success in mating and female remating inhibition as virgin males.

  16. Some aspects of the behavior at different ages of Ceratitis capitata (Wiedemann, 1824) (Diptera-Tephritidae) irradiated with gamma rays; Alguns aspectos do comportamento em diferentes idades de Ceratitis capitata (Wiedemann, 1824) (Diptera-tephritidae) irradiadas com radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Ivone Midori

    1988-08-01

    The present work was carried out in the laboratory of the Entomology Section of the Nuclear Energy for Agriculture Center (CENA) in Piracicaba, Sao Paulo state, Brazil, to determine the effects different gamma radiation doses on the reproductive potential of males and the flight behavior of Ceratitis capitata (Wied.). For all the treatments with gamma radiation a Cobalt-60 source type Gamma beam-650 was used, with activity of approximately 13,410 x 10{sup B} Bq. (4,967 Ci.), and the dose rate of 2.000 Gy per hour. The doses used were 80 Gy, 100 Gy and 120 Gy. The three doses employed affected more the longevity of males than the females and the number of spermatozoid found lower in the irradiated insects compared with the control, with no significant differences between doses. The insects irradiated with 80 Gy showed activity similar to the control population until four days after emergence: afterwards they were more active than the unirradiated. The gamma irradiation diminished the take-off ability of the insects. (author). 59 refs., 9 figs., 9 tabs.

  17. Solid phase microextraction of volatile emissions of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influence of fly sex, age, and mating status.

    Science.gov (United States)

    Alfaro, Cristina; Vacas, Sandra; Zarzo, Manuel; Navarro-Llopis, Vicente; Primo, Jaime

    2011-01-12

    Considerable efforts have been devoted to understanding the courtship behavior and pheromone communication of medflies; however, the sex pheromone composition is still a controversial subject. The discovery of new components affecting medfly behavior would be of interest for medfly control methods based on semiochemicals. This work describes volatile compounds emitted by Ceratitis capitata collected using solid phase microextraction. The volatile study was conducted according to an experimental design with three factors (sex, age, and mating status) assumed to be relevant for better understanding the chemical communication. Emission data were treated by means of principal component analysis, a statistical methodology not previously applied to the study of volatiles emitted by fruit flies. The characterization of emission patterns could be useful for the selection of compounds to be further investigated in biological assays to improve knowledge of the key semiochemicals involved in medfly behavior.

  18. Selection of a Bacillus pumilus strain highly active against Ceratitis capitata (Wiedemann) larvae.

    Science.gov (United States)

    Molina, C Alfonso; Caña-Roca, Juan F; Osuna, Antonio; Vilchez, Susana

    2010-03-01

    Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), the Mediterranean fruit fly (medfly), is one of the most important fruit pests worldwide. The medfly is a polyphagous species that causes losses in many crops, which leads to huge economic losses. Entomopathogenic bacteria belonging to the genus Bacillus have been proven to be safe, environmentally friendly, and cost-effective tools to control pest populations. As no control method for C. capitata based on these bacteria has been developed, isolation of novel strains is needed. Here, we report the isolation of 115 bacterial strains and the results of toxicity screening with adults and larvae of C. capitata. As a result of this analysis, we obtained a novel Bacillus pumilus strain, strain 15.1, that is highly toxic to C. capitata larvae. The toxicity of this strain for C. capitata was related to the sporulation process and was observed only when cultures were incubated at low temperatures before they were used in a bioassay. The mortality rate for C. capitata larvae ranged from 68 to 94% depending on the conditions under which the culture was kept before the bioassay. Toxicity was proven to be a special characteristic of the newly isolated strain, since other B. pumilus strains did not have a toxic effect on C. capitata larvae. The results of the present study suggest that B. pumilus 15.1 could be considered a strong candidate for developing strategies for biological control of C. capitata.

  19. Comportamento Reprodutivo de Ceratitis capitata Wiedemann (Diptera: Tephritidae: Efeito do Tamanho dos Machos Sobre o Seu Sucesso de Cópula.

    Directory of Open Access Journals (Sweden)

    Alberto Silva Neto

    2012-11-01

    Abstract. This work evaluated the influence of size on the copula success in Ceratitis capitata (Wiedemann. To assure the production of different adult sizes (big and small, two groups of larvae had been fed with different protein concentrations. Subsequently, adult males of both groups had been compared in terms of copula success and amount of males who showed the first step of courtship (emission of sexual pheromone. The copula success in laboratory was evaluated with males in some ratios, which the number of big males with five days of life (an unique male in relation to a gradual increase of small males with same age kept constant. The tested ratios had been 1:1, 1:2, 1:3, 1:4, 1:5, and 1:10. In the experiments of copula success in the 1:1 ratio and the ones of pheromone emission, they had been tested small male of different ages (five, nine or 13 days, whereas the age of the big males kept constant (five days. Experiments of copula success in the 1:1 ratio had been also carried through in field cage. It was prove that the big males had taken advantage in all the parameters analyzed in laboratory, emitting pheromone and having a bigger copula success, exactly when the age of the small males was varied. The size effect was so significant, that in the ratio of 1 big male for 10 small males, the females had still chosen the big males. In field cage, the results had been similar to the ones of laboratory.

  20. Toxic effect of citrus peel constituents on Anastrepha fraterculus Wiedemann and Ceratitis capitata Wiedemann immature stages.

    Science.gov (United States)

    Ruiz, María J; Juárez, María L; Alzogaray, Raúl A; Arrighi, Federico; Arroyo, Lorena; Gastaminza, Gerardo; Willink, Eduardo; Bardón, Alicia del Valle; Vera, Teresa

    2014-10-15

    The toxicity of essential oils from the citrus peel has been proposed as the major resistance mechanism offered by citrus to fruit fly infestation. We evaluated the insecticidal activity of the ether extracts from the lemon (Citrus limon [L.] Burm.) and grapefruit (C. paradisi Macfadyen) peel as well as from limonene and citral against Anastrepha fraterculus (Wiedemann) and Ceratitis capitata (Wiedemann) immature stages. We also evaluated the toxicity of the extracts at two ripening stages. Extracts proved toxic to A. fraterculus egg and larvae. The lemon and grapefruit extracts showed the same toxicity in both fruit fly species. For A. fraterculus eggs, citral was more toxic than limonene; for larvae, they showed equal toxicity. Anastrepha fraterculus eggs were more sensitive than C. capitata eggs. In conclusion, we provide evidence of chemical resistance mechanisms that could account for the nonhost condition of lemon for A. fraterculus.

  1. Compatibility of entomopathogenic nematodes and aqueous plant extracts aiming at the control of fruit fly Ceratitis capitata (Wiedemann (Diptera: TephritidaeCompatibilidade de nematóides entomopatogênicos e extratos vegetais aquosos visando o controle da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Cristhiane Rohde

    2013-06-01

    Full Text Available Currently, the fruit fly Ceratitis capitata (Diptera: Tephritidae has been controlled mainly by the chemical method, which is responsible for environmental and public health impacts. It has often been ineffective due to development of resistant insect populations. Thus, it has necessary to research new effective and less impacting control forms. In this sense, the use of entomopathogenic nematodes and plant extracts has been effective for controlling this pest. However, studies are needed to assess the compatibility between these methods, aiming at their use in integrated management programs for this pest. The aim of this study was to evaluate the compatibility of the nematodes Steinernema carpocapsae ALL and Heterorhabditis sp. JPM4 with aqueous extracts prepared from dried plant of cinnamon leaf, twig and fruit (Melia azedarach, rue leaf (Ruta graveolens, ginger (Zingiber officinale and garlic (Allium sativum for the control of C. capitata. The bioassay was carried out in completely randomized design with four replicates per treatment. Each replication consisted of a glass tube containing 1 mL of plant extract 40% w/v and 1 mL suspension of entomopathogenic nematodes with 1800 JI/mL for S. carpocapsae ALL and 600 JI/mL for Heterorhabditis sp. JPM4. The viability and infectivity of this nematode were evaluated on C. capitata larvae after 48 and 120 hours. It was found that all extracts reduced the viability and infectivity of both nematodes and they were incompatible after 120 hours of exposure. The nematode Heterorhabditis sp. JPM4 was more sensitive than the S. carpocapsae ALL as it showed, in the first 48 hours, a reduction in the viability and infectivity of more than 80 and 75%, respectively, when exposed to all the extracts except the ginger.A mosca-das-frutas Ceratitis capitata (Diptera: Tephritidae tem sido controlada, principalmente, pelo método químico, que é o responsável por impactos ambientais e na saúde pública e, muitas

  2. Biological and morphological aspects of Diachasmimorpha longicaudata (Ashmead, 1905) (Hymenoptera: Braconidae) on irradiated larva of Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae);Aspectos biologicos e morfologicos de Diachasmimorpha longicaudata (Ashmead, 1905) (Hymenoptera: Braconidae) criado em larvas irradiadas de Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Valle, Giuliana Etore do

    2006-07-01

    The objective of this work was evaluate some biological and morphological aspects of Diachasmimorpha longicaudata on irradiated and not irradiated larva of bisexual and tsl strains of Ceratitis capitata. The experiments were developed at the Laboratorio de Irradiacao de Alimentos e Radioentomologia (LIARE) of CENA/USP. For gamma radiation treatment it was used a Cobalt-60 source, model Gamma beam-650. Larva of bisexual strain were irradiated with 65 Gy and the tsl strain with 45 Gy. Experiments were carried out at room temperature of 25 +- 2 deg C, 75 +- 5 % RH and 14 hours of photo phase. After irradiation, the bisexual strain larva were exposed to adults of D. longicaudata for parasitization and parameters of percentage adult emergency and rate of male and female of D. longicaudata were observed. For tsl strain, were used larva from the first and the fourth collection only, and the following parameters were observed: percentage of adult emergency, rate of male and female, and the average unitary volume and weight of pupae at the 8{sup th} and 16 days after the parasitism date. Other parameters evaluated for tsl strain related to the parasitoid morphology such as, the length of the body, antenna, tibia and ovipositor. As result, both of the first and second experiments, the rate of parasitism was satisfactory, as well as showed larger incidence of females than males in parasitized larva, discarding the possibility that gamma radiation interfere in the sexual rate. No significant differences were observed on pupae volume. Some differences on pupae weight were observed at 8th and 16th day after the parasitism date, which should be associated to pre-emerging flies (8th day) and empty pupa (16th day). None significant difference was observed on morphological parameters, so one can conclude that gamma radiation treatment did not interfere in these quality parameters of the parasitoid. (author)

  3. Medhost: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), version 3.0

    Science.gov (United States)

    The Mediterranean fruit fly (Medfly), Ceratitis capitata (Wiedemann), causes direct damage to fruits and vegetables through oviposition and larval feeding. Rigorous quarantine procedures are currently enforced to prevent domestic and transnational spread of Medfly. Accessible and reliable informatio...

  4. Survival of Wild Adults of Ceratitis capitata (Wiedemann under Natural Winter Conditions in North East Spain

    Directory of Open Access Journals (Sweden)

    E. Peñarrubia-María

    2012-01-01

    Full Text Available The overwintering of the Mediterranean fruit fly (medfly, Ceratitis capitata (Wiedemann at the northern limits of its geographic distribution is not yet well known. With the aim of estimating the survival rate of medfly adults in northeast Spain under natural winter conditions, a two-winter-season trial was carried out. A control was carried out in a climatic chamber at 25°C. The results showed that medfly adults were unable to survive the entire winter season in the Girona area. Climatic conditions, including the daily minimum temperature, daily maximum temperature and the high rainfall, appeared to be involved in adult mortality in winter.

  5. Export of commercial Hass avocados from Argentina poses negligible risk of Ceratitis capitata (Diptera: Tephritidae) infestation.

    Science.gov (United States)

    Villagrán, M Elvira; Willink, Eduardo; Vera, M Teresa; Follett, Peter

    2012-08-01

    Argentina has to meet quarantine restrictions because of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), to export 'Hass' avocados, Persea americana Miller, to certain countries. Hass avocado at the hard, mature green stage is potentially a conditional nonhost for C. capitata and could open export markets without the need for a quarantine treatment. Trapping data from 1998 to 2006 showed that C. capitata was present in avocado orchards, particularly early in the harvest season. The host status of hard, mature green Hass avocado to C. capitata was evaluated using laboratory and field cage tests under no-choice conditions and by assessing natural levels of infestation in commercially harvested fruit from the main avocado production area. In total, 2,250 hard, mature green avocado fruit were exposed to 11,250 gravid females for 24 or 48 h after harvest in laboratory or field cages, and no infestations were found. During 11 seasons, 5,949 fruit in total were sampled from the trees and 992 fruit were collected from the ground, and in none of them were any live or dead fruit fly larvae found. Inspection of >198,000 commercial fruit at the packinghouse from 1998 to 2011 showed no symptoms of fruit fly infestation. These data exceed the published standards for determination of nonhost status, as well as the Probit 9 standard for development of quarantine treatments. Hass avocado harvested at the hard, mature green stage was not infested by C. capitata and seems to pose a negligible quarantine risk. As a consequence, no postharvest treatment or other quarantine actions should be required by importing countries.

  6. Selection of Ceratitis capitata (Diptera: Tephritidae) specific recombinant monoclonal phage display antibodies for prey detection analysis.

    Science.gov (United States)

    Monzó, César; Urbaneja, Alberto; Ximénez-Embún, Miguel; García-Fernández, Julia; García, José Luis; Castañera, Pedro

    2012-01-01

    Several recombinant antibodies against the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), one of the most important pests in agriculture worldwide, were selected for the first time from a commercial phage display library of human scFv antibodies. The specificity and sensitivity of the selected recombinant antibodies were compared with that of a rabbit polyclonal serum raised in parallel using a wide range of arthropod species as controls. The selected recombinant monoclonal antibodies had a similar or greater specificity when compared with classical monoclonal antibodies. The selected recombinant antibodies were successfully used to detect the target antigen in the gut of predators and the scFv antibodies were sequenced and compared. These results demonstrate the potential for recombinant scFv antibodies to be used as an alternative to the classical monoclonal antibodies or even molecular probes in the post-mortem analysis studies of generalist predators.

  7. Quarantine treatment against mediterranean fruit fly (Ceratitis capitata Wiedemann) in mangoes haden variety (Mangifera indica) with gamma irradiation (Co 60)

    OpenAIRE

    Peña C., María E.; Laboratorio de Bromatología Facultad de Farmacia y Bioquímica de la Universidad Nacional Mayor de San Marcos, Lima, Perú.; Guillen E., Rafael; Servicio Nacional de Sanidad Agraria - SENASA.; Arias A., Gladys C.; Laboratorio de Bromatología Facultad de Farmacia y Bioquímica de la Universidad Nacional Mayor de San Marcos, Lima, Perú.

    2014-01-01

    Tephritidae fruit flies are among the most damaging pests of fruit crops worldwide Ceratitis capitata Wiedemann, for instance, can infest more than 250 fruit and vegetable crop species, and constitutes the main phytosanitary restrict for export purposes. The investigation was carried out in a SENASA’s Production Center of Sterile Fruit Flies and PIMU’s laboratory; it was supervised by an OIEA’s irradiation expert. This research comprised two stages: 1) Determine the minimum irradiation dose t...

  8. Export of commercial 'Hass' avocados from Argentina poses negligible risk of ceratitis capitata (Diptera: Tephritidae) infestation

    Science.gov (United States)

    Quarantine restrictions due to the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), prevent Argentina from exporting avocados, Persea americana Miller, cv. Hass, to certain countries. Hass avocado at the hard, mature green stage is potentially a conditional nonhost for C. capitata, which cou...

  9. The distribution, relative abundance, and seasonal phenology of Ceratitis capitata, Ceratitis rosa, and Ceratitis cosyra (Diptera: Tephritidae) in South Africa.

    Science.gov (United States)

    De Villiers, Marelize; Manrakhan, Aruna; Addison, Pia; Hattingh, Vaughan

    2013-10-01

    Ceratitis capitata (Wiedemann), Ceratitis rosa Karsch, and Ceratitis cosyra (Walker) are fruit fly species (Diptera: Tephritidae) of economic importance in South Africa. These pests cause direct damage to a number of commercially produced fruit and are of phytosanitary concern. A study was conducted to determine the distribution, relative abundance, and seasonal occurrence of the three species in different climatic regions of South Africa. The relative abundance and seasonal phenology of C. capitata and C. rosa were also compared between production areas and home gardens in Stellenbosch, Western Cape. Yellow bucket traps baited with Biolure were used to trap the flies over a 2-yr period in the different sampling areas. Different fruit types were sampled in Stellenbosch to determine fruit fly infestation. C. capitata was found to have a widespread distribution in South Africa, whereas C. rosa were absent from or only present in low numbers in the drier regions. C. cosyra was restricted to the North East and East coast, following a similar pattern to the distribution of marula, Sclerocarrya birrea, an important wild host. Fruit in home gardens provided a breeding ground for C. capitata and C. rosa and a source for infestation of orchards when fruit started to mature, highlighting the need for an area-wide strategy for the control of fruit flies.

  10. One Metarhizium brunneum Strain, Two Uses to Control Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Yousef, M; Garrido-Jurado, I; Quesada-Moraga, E

    2014-10-01

    We determined the virulence and insecticidal activity of the hypocrealean fungus Metarhizium brunneum (Petch) strain EAMb 09/01-Su and its crude extract against Mediterranean fruit fly Ceratitis capitata Wiedemann (Diptera: Tephritidae) and we evaluated the combined use of the fungus with its crude extract. We also determined the effect of fermentation time, temperature, and initial pH of the M. brunneum culture medium on the insecticidal activity of the crude extract. When C. capitata adults were sprayed with a conidial suspension, the strain EAMb 09/01-Su caused 100% mortality with a mean lethal time (LT50) of 5.6 d and mean lethal concentration (LC50) of 2.84 f#x2013; 10(7) conidia per milliliter. Fermentation time significantly affected the lethality of the crude extract when it was provided to C. capitata per os. The highest level of mortality (73.3%) and the shortest median survival time (25.5 h) was obtained from 15-d-old cultures. The crude extract was demonstrated to be thermostable, given that the mortality was >50% at 48 h when the extract had been heated to 100°C for 3 h. Lastly, the optimum initial pH for maximum crude extract activity in terms of mortality ranged between 7 and 9. Additivity was observed for all M. brunneum EAMb 09/01-Su strain crude extract combinations tested, indicating compatibility between products. We concluded that the M. brunneum EAMb 09/01-Su strain is a promising tool for medfly control alone or in combination with its crude extract.

  11. Host status of avocado ('Hass') to Ceratitis capitata, Ceratitis rosa, and Ceratitis cosyra (Diptera: Tephritidae) in South Africa.

    Science.gov (United States)

    de Graaf, J

    2009-08-01

    Ceratitis capitata (Wiedemann), Ceratitis rosa Karsch, and Ceratitis cosyra (Walker) (Diptera: Tephritidae) are pests potentially associated with avocado (Persea americana Mill.) in South Africa. The aim of the study was to determine the host status of 'Hass' avocado to these tephritid pests over 4 yr. Unpunctured harvested avocado was exposed to fruit flies in the laboratory under no-choice conditions for 24 h. In field studies, each species was exposed for 48 h under no-choice conditions to avocado attached to the tree. Fruit was harvested immediately, 4, 8 and 18 d after exposure. In all the experiments, the fruit was incubated at 25 degrees C for 49 d after harvest. Hass avocado fruit was sourced from pack-houses throughout the avocado production areas and inspected for any internal pests. Similar inspections were done from 2005 to 2008 at arrival in Europe following standard export procedures. Analysis indicated that Hass avocado is a conditional nonhost for C. capitata and a poor but potential host for C. rosa and C. cosyra. No requirement for a risk mitigation treatment for C. capitata on South African Hass avocado was found. Fruit sampling data did not produce any infested fruit, suggesting that natural conditions and/or existing procedures functioning in a systems approach are likely to mitigate the quarantine risks of C. rosa and C. cosyra on Hass avocado in South Africa.

  12. Field Efficacy of a Metarhizium anisopliae-Based Attractant-Contaminant Device to Control Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Navarro-Llopis, V; Ayala, I; Sanchis, J; Primo, J; Moya, P

    2015-08-01

    Biological control of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) using entomopathogenic fungi is being studied as a viable control strategy. The efficacy of a Metarhizium anisopliae (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae)-based attractant-contaminant device (ACD) to control C. capitata was evaluated in a medium-scale (40 ha) 2-yr field trial using a density of 24 ACD per ha. Results showed that this density was adequate to efficiently reduce fruitfly populations and that the inoculation dishes (IDs) needed replacing mid-season to provide protection for the entire season. In this study, fungal treatment was even more effective than conventional chemical treatment. Population dynamics in fungus-treated fields along with the infectivity study of field-aged IDs in the laboratory found that the ACD remained effective for at least 3 mo. The results suggest M. anisopliae-based ACD can be used to control C. capitata in the field. The implications of its use, especially as a tool in an integrated pest management program, are discussed.

  13. Ammonium Acetate Enhances the Attractiveness of a Variety of Protein-Based Baits to Female Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Piñero, Jaime C; Souder, Steven K; Smith, Trevor R; Fox, Abbie J; Vargas, Roger I

    2015-04-01

    Ammonia and its derivatives are used by female fruit flies (Diptera: Tephritidae) as volatile cues to locate protein-rich food needed to produce their eggs. This need for external protein sources has led to the development of behaviorally based control strategies such as food-based lures and insecticidal baits targeting pestiferous fruit fly species. In field cage studies conducted in Hawaii, we examined the behavioral response of laboratory-reared male and female Mediterranean fruit fly, Ceratitis capitata (Wiedemann), to seven commercially available protein baits and to beer waste, a relatively inexpensive and readily available substance. Each material was tested alone or in combination with either ammonium acetate or ammonium carbonate. For the majority of baits evaluated, the presence of ammonium acetate, but not ammonium carbonate, elicited a significantly greater level of response of female C. capitata compared with the protein baits alone. The addition of ammonium acetate to selected baits increased bait attractiveness to a level comparable with that elicited by the most widely used spinosad-based protein bait, GF-120. Our findings indicate that the addition of ammonium acetate to commercially available proteinaceous baits and to beer waste can greatly improve their attractiveness to C. capitata, potentially increasing the bait's effectiveness for fruit fly monitoring and suppression.

  14. Conditional embryonic lethality to improve the sterile insect technique in Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Franz Gerald

    2009-01-01

    Full Text Available Abstract Background The sterile insect technique (SIT is an environment-friendly method used in area-wide pest management of the Mediterranean fruit fly Ceratitis capitata (Wiedemann; Diptera: Tephritidae. Ionizing radiation used to generate reproductive sterility in the mass-reared populations before release leads to reduction of competitiveness. Results Here, we present a first alternative reproductive sterility system for medfly based on transgenic embryonic lethality. This system is dependent on newly isolated medfly promoter/enhancer elements of cellularization-specifically-expressed genes. These elements act differently in expression strength and their ability to drive lethal effector gene activation. Moreover, position effects strongly influence the efficiency of the system. Out of 60 combinations of driver and effector construct integrations, several lines resulted in larval and pupal lethality with one line showing complete embryonic lethality. This line was highly competitive to wildtype medfly in laboratory and field cage tests. Conclusion The high competitiveness of the transgenic lines and the achieved 100% embryonic lethality causing reproductive sterility without the need of irradiation can improve the efficacy of operational medfly SIT programs.

  15. Sperm-less males modulate female behaviour in Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Gabrieli, Paolo; Scolari, Francesca; Di Cosimo, Alessandro; Savini, Grazia; Fumagalli, Marco; Gomulski, Ludvik M; Malacrida, Anna R; Gasperi, Giuliano

    2016-12-01

    In the Mediterranean fruit fly, Ceratitis capitata (Wiedemann)(Diptera: Tephritidae), mating has a strong impact on female biology, leading to a decrease in sexual receptivity and increased oviposition and fecundity. Previous studies suggest that sperm transfer may play a role in inducing these behavioural changes. Here we report the identification of a medfly innexin gene, Cc-inx5, whose expression is limited to the germ-line of both sexes. Through RNA interference of this gene, we generated males without testes and, consequently, sperm, but apparently retaining all the other reproductive organs intact. These sperm-less males were able to mate and, like their wild-type counterparts, to induce in their partners increased oviposition rates and refractoriness to remating. Interestingly, matings to sperm-less males results in oviposition rates higher than those induced by copulation with control males. In addition, the observed female post-mating behavioural changes were congruent with changes in transcript abundance of genes known to be regulated by mating in this species. Our results suggest that sperm transfer is not necessary to reduce female sexual receptivity and to increase oviposition and fecundity. These data pave the way to a better understanding of the role/s of seminal components in modulating female post-mating responses. In the long term, this knowledge will be the basis for the development of novel approaches for the manipulation of female fertility, and, consequently, innovative tools to be applied to medfly control strategies in the field.

  16. Medhost: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann),Version 2.0

    Science.gov (United States)

    MEDHOST,Version 2.0 is the second revision of:"MEDHOST: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly,Ceratitis capitata(Wiedemann),Version 1.0," which was released in 1998 as a Windows-based executable database and listed all plant species reported as hosts of Medit...

  17. Effective sampling range of a synthetic protein-based attractant for Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Studies were conducted in Honduras to determine sampling range for female-targeted food-based synthetic attractants for pest tephritid fruit flies. Field studies were conducted in shaded coffee and adults of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), were captured. Traps (38 traps ...

  18. Pathogenicity of Beauveria bassiana isolated from Moroccan Argan forests soil against larvae of Ceratitis capitata (Diptera: Tephritidae) in laboratory conditions.

    Science.gov (United States)

    Imoulan, Abdessamad; Elmeziane, Abdellatif

    2014-03-01

    The Mediterranean fruit fly, Ceratitis capitata Wiedemann (Diptera: Tephritidae), is the major tephritid pest in Morocco. This pest survives in Moroccan forests Argania spinosa and continually invades the nearest agricultural areas. Entomopathogenic fungi are an interesting tool for fruit fly control and hold a useful alternative to conventional insecticides. However, primary selection of effective pathogens should be taken in laboratory condition prior to applying them in the field. Here, we used third late instar larvae of C. capitata to investigate the effectiveness of 15 local Beauveria bassiana isolates. Results showed that all isolates were able to infect the larval stage, producing a large mortality rate in puparia ranging from 65 to 95 % and caused significant reduction in adult emergence. The fungal treatments revealed that the mycosis occurred also in adults escaping infection as pupariating larvae. The percentage of mycosed puparia was highest in strain TAM6.2 (95 %) followed by ERS4.16 (90 %), therefore they were the most virulent. Median lethal concentration (LC₅₀) was studied for five isolates at four concentrations ranging from 10⁵ to 10⁸ conidia ml⁻¹. The results showed that the slopes of regression lines for B. bassiana ERS4.16 (slope = 0.386) and TAM6.2 (slope = 0.41) were the most important and had the lowest LC₅₀ values (2.85 × 10³ and 3.16 × 10³ conidia ml⁻¹ respectively). This investigation suggests that the soil of Argan forests contains pathogenic B. bassiana isolates and highlights for the first time their potential as biological control toward C. capitata larval stage in Morocco.

  19. A review of hymenopterous parasitoid guilds attacking Anastrepha spp. and Ceratitis capitata (Diptera: Tephritidae) in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Ovruski, Sergio M.; Orono, Luis E.; Nunez-Campero, Segundo; Schliserman, Pablo; Albornoz-Medina, Patricia; Bezdjian, Laura P.; Nieuwenhove, Guido A. Van; Martin, Cristina B. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    This study provides detailed information on the diversity, abundance, guilds, host plant and host fly ranges, distribution, and taxonomic status of hymenopterous parasitoid species associated with Ceratitis capitata (Wiedemann) and Anastrepha spp. (A. fraterculus (Wiedemann) and A. schultzi Blanchard) in Argentina. Moreover, the article also argues future needs regarding the use of some parasitoid species as an alternative tool in fruit fly management programs of the National Fruit Fly Control and Eradication Program (PROCEM-Argentina). Data used for this work were obtained from numerous old and recent published articles on fruit fly parasitoids in Argentina. (author)

  20. Characterisation of novel Bacillus thuringiensis isolates against Aedes aegypti (Diptera: Culicidae) and Ceratitis capitata (Diptera: Tephridae).

    Science.gov (United States)

    Elleuch, Jihen; Tounsi, Slim; Ben Hassen, Najeh Belguith; Lacoix, Marie Noël; Chandre, Fabrice; Jaoua, Samir; Zghal, Raida Zribi

    2015-01-01

    Bacillus thuringiensis is successfully used in pest management strategies as an eco-friendly bioinsecticide. Isolation and identification of new strains with a wide variety of target pests is an ever growing field. In this paper, new B. thuringiensis isolates were investigated to search for original strains active against diptera and able to produce novel toxins that could be used as an alternative for the commercial H14 strain. Biochemical and molecular characterization revealed a remarkable diversity among the studied strains. Using the PCR method, cry4C/Da1, cry30Ea, cry39A, cry40 and cry54 genes were detected in four isolates. Three strains, BLB355, BLB196 and BUPM109, showed feeble activities against Aedes aegypti larvae. Interestingly, spore-crystal mixtures of BLB361, BLB30 and BLB237 were found to be active against Ceratitis capitata with an LC50 value of about 65.375, 51.735 and 42.972 μg cm(-2), respectively. All the studied strains exhibited important mortality levels using culture supernatants against C. capitata larvae. This suggests that these strains produce a wide range of soluble factors active against C. capitata larvae.

  1. A new record of Fannia pusio (Wiedemann) (Diptera:Fanniidae) from Malaysia.

    Science.gov (United States)

    Omar, B; Kurahashi, H; Jeffery, J; Yasohdha, N; Lau, S Y; John, M C; Marwi, M A; Zuha, R M; Ahmad, M S

    2007-12-01

    Fannia pusio (Wiedemann) (Diptera: Fanniidae) is newly recorded from Malaysia. This record is based on 1male symbol 1female symbol from Sarawak, east Malaysia and 1male symbol 2female symbol from Selangor, peninsular Malaysia. It is included in the pusio group of Fannia wherein are included Fannia femoralis (Stein), Fannia howardi Malloch, Fannia trimaculata (Stein), Fannia leucosticta (Meigen) and Fannia punctiventris Malloch. The male of Fannia pusio is differentiated from other members of the group by the following features: hind femur with a swelling bearing a number of setae that are usually curled at tip; squamae creamy; tergite 1+2 broadly grey dusted at sides.

  2. Toxomerus duplicatus Wiedemann, 1830 (Diptera: Syrphidae preying on Microtheca spp. (Coleoptera: Chrysomelidae larvae

    Directory of Open Access Journals (Sweden)

    VS Sturza

    Full Text Available Microtheca spp. (Coleoptera: Chrysomelidae are insect pests primarily related to Brassicaceae crops. In the State of Rio Grande do Sul (RS, southern Brazil, they are found on forage turnip, Raphanus sativus L. var. oleiferus Metzg., which is commonly grown during fall/winter seasons. This work reports the predation of Microtheca spp. larvae by Toxomerus duplicatus Wiedemann, 1830 (Diptera: Syrphidae larvae, on forage turnip crop, in Santa Maria, RS. This register provides new information about Microtheca spp. natural enemies in Brazil, which might be a new option for integrate pest management of these species.

  3. Response of female Ceratitis capitata (Diptera: Tephritidae) to a spinosad bait and polymer matrix mixture with extended residual effect in Hawaii.

    Science.gov (United States)

    Piñero, Jaime C; Souder, Steven K; Gomez, Luis E; Mau, Ronald F L; Vargas, Roger I

    2011-12-01

    The effectiveness of foliar applications of protein baits against pestiferous fruit flies (Tephritidae) can be adversely affected by a rapid loss of attractive volatile compounds and by rainfall due to the high water solubility of the baits. In a large coffee, Coffea arabica L., plantation in Hawaii with high and low populations of Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), the relative attractiveness of GF-120 NF Naturalyte Fruit Fly Bait as either a 40% (vol:vol) spray solution (= GF-120 NF) or as a formulated proprietary amorphous polymer matrix (= GF-120 APM) was compared. The GF-120 APM formulations contained either, 25, 50, or 75% of GF-120 NF (wt:wt). All baits were tested in association with visually attractive yellow bait stations as a way of standardizing the evaluations. With both high and low C. capitata populations, significantly more females were attracted to the fresh sprayed GF-120 NF than to any of the three fresh GF-120 APM formulations. The attractiveness of GF-120 sprayed decreased significantly after 1 wk, whereas 1-wk-old GF-120 APM formulations were as attractive as similar fresh formulations. GF-120 APM 75% aged for 3 wk outperformed similarly-aged sprayed GF-120 NF with comparatively high C. capitata populations. With low populations, both GF-120 APM 75% and GF-120 APM 50% aged for 2 wk outperformed the similarly aged sprayed GF-120 NF. Combined findings indicate that APM mixed with either 50 or 75% GF-120 applied to bait stations can be attractive to female C. capitata for up to 3 wk longer than the standard sprayed GF-120 NF.

  4. Capture of Anastrepha suspensa and sterile male Ceratitis capitata (Diptera: Tephritidae) in multilure traps versus phase 4 traps

    Science.gov (United States)

    Field trials were conducted in south Florida to compare capture of wild Caribbean fruit flies, Anastrepha suspensa (Loew), and sterile male Mediterranean fruit flies, Ceratitis capitata (Wiedemann), in Multilure traps, which are McPhail-type traps that use an aqueous solution to retain attracted fli...

  5. Field estimates of attraction of Ceratitis capitata to Trimedlure and Bactrocera dorsalis (Diptera: Tephritidae) to methyl eugenol in varying environments

    Science.gov (United States)

    Measuring and modeling the attractiveness of semiochemical-baited traps is of significant importance to detection, delimitation and control of invasive pests. Here we describe the results of field mark-release-recapture experiments with Ceratitis capitata (Wiedemann) and Bactrocera dorsalis (Hendel)...

  6. Development of phytosanitary cold treatments for oranges infested with Bactrocera invadens and B. zonata (Diptera: Tephritidae) by comparison...existing cold treatment schedules for Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Phytosanitary cold treatments are attempted for Bactrocera invadens Drew, Tsuruta, and White and Bactrocera zonata (Saunders) by comparison with Ceratitis capitata (Wiedemann). Oranges were infested by puncturing holes in the peel and allowing tephritids to oviposit in the holes. The treatments were...

  7. Hot-water phytosanitary treatment against Ceratitis capitata (Diptera: Tephritidae) in 'Ataulfo' mangoes.

    Science.gov (United States)

    Hernández, Emilio; Rivera, Pedro; Bravo, Bigail; Toledo, Jorge; Caro-Corrales, José; Montoya, Pablo

    2012-12-01

    We determined the thermal death rate constants and mortality curves for the eggs and different instars of Ceratitis capitata (Mediterranean fruit fly) (Wiedemann) submerged in isolation in water at 44, 46, and 48 degrees C and submerged within fruits of Mangifera indica (mango) (L.) in water at 43.1, 44.1, 45.1, and 46.1 degrees C. The first instar was the most tolerant to this treatment, with estimated times for achieving 99.9968% mortality of 103.28, 92.73, and 92.49 min at temperatures of 43.1, 44.1, and 45.1 degrees C, respectively. The results of the study indicate that 'Ataulfo' mangoes weighing capitata while maintaining market quality at least for 15 d.

  8. Primeiro relato de Spalangia nigroaenea Curtis, 1839 (Hymenoptera: pteromalidae em pupas de fannia pusio (Wiedemann, 1830 (Diptera: fanniidae no Brasil First report of Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae in pupae of Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae in Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Henrique Marchiori

    2008-10-01

    Full Text Available Relata-se a primeira ocorrência do parasitóide Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae em pupas de Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae, no Brasil. Pupas de F. pusio foram coletadas em armadilhas utilizando-se fezes humanas como atrativo para os adultos. Obtiveram-se 10 pupas, das quais duas estavam parasitadas por S. nigroaenea, verificando-se uma porcentagem de parasitismo de 20,0%.The first occurrence in Brazil of the parasitoid Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae in pupae of Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae is reported. Pupae of F. pusio were collected in traps using human feces to attract the adults. Ten pupae were obtained, of which two were parasitized by S. nigroaenea, thus demonstrating a parasitism rate of 20.0%.

  9. Parasitóides de Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae coletados em pupários no substrato rim bovino Parasitoids of Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae collected in pupae in the bovine kidney

    Directory of Open Access Journals (Sweden)

    Jean Patrick Bonani

    2006-04-01

    Full Text Available Objetivou-se com este estudo, identificar as principais espécies de parasitóides de Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae, em Lavras, Minas Gerais, Brasil, cujas larvas foram alimentadas com rim bovino. As coletas foram realizadas durante o período de agosto de 2003 a março de 2004. Um total de 921 parasitóides foram coletados em 942 pupas dessa mosca. A prevalência natural de parasitismo foi de 97%.The study aimed at identifying the main parasitoids of Peckia chrysostoma (Wiedemann, 1830 (Diptera: Sarcophagidae. The larvae were feed on bovine kidney. Samplings were conducted from August 2003 to March 2004, in Lavras, Minas Gerais State, Brazil. A total of 921 parasitoids in 942 pupae fly were collected. The prevalence natural parasitism was 97%.

  10. [Parasitic effect of Opius concolor (Spzl) (Hymenoptera, Braconidae) on an intermediate host Ceratitis capitata Wied (Diptera, Trypetidae)].

    Science.gov (United States)

    Ben Hamouda, M H; Ben Salah, H

    1984-01-01

    The parasitic incidence of Opius concolor (Hymenoptera, Braconidae) on a replacement host, Ceratitis capitata (Diptera, Trypetidae) was studied using polyacrylamide gel electrophoresis and immunoelectrophoresis methods. A noticeable modification of C. capitata proteins was observed when parasited by O. concolor. But the most important phenomenon is the finding of common antigens between the host and the parasite. These results are discussed with regard to trophic and parasitic behaviour of the parasite.

  11. Eurytoma sp. (Hymenoptera: Pteromalidae como parasitóide de Fannia pusio (Wiedemann (Diptera: Fanniidae no Brasil Eurytoma sp. (Hymenoptera: Pteromalidae as a parasitoid of Fannia pusio (Wiedemann (Diptera: Fanniidae in Brazil

    Directory of Open Access Journals (Sweden)

    C.H. Marchiori

    2007-08-01

    Full Text Available This study reports, for the first time, the occurrence of Eurytoma sp. (Hymenoptera: Pteromalidae as parasitoid of Fannia pusio (Wiedemann (Diptera: Fanniidae found in chicken dung in Itumbiara, Goiás, Brazil. Manure samples, collected at two weeks intervals, were taken to the laboratory and the pupae were extracted by water flotation. Each pupa was placed in capsules of colorless gelatin until the emergence of dipterous or their parasitoids. The parasitism was 1.3%.

  12. Eurytoma sp. (Hymenoptera: Pteromalidae) como parasitóide de Fannia pusio (Wiedemann) (Diptera: Fanniidae) no Brasil Eurytoma sp. (Hymenoptera: Pteromalidae) as a parasitoid of Fannia pusio (Wiedemann) (Diptera: Fanniidae) in Brazil

    OpenAIRE

    C.H. Marchiori

    2007-01-01

    This study reports, for the first time, the occurrence of Eurytoma sp. (Hymenoptera: Pteromalidae) as parasitoid of Fannia pusio (Wiedemann) (Diptera: Fanniidae) found in chicken dung in Itumbiara, Goiás, Brazil. Manure samples, collected at two weeks intervals, were taken to the laboratory and the pupae were extracted by water flotation. Each pupa was placed in capsules of colorless gelatin until the emergence of dipterous or their parasitoids. The parasitism was 1.3%.

  13. Primeiro relato de Spalangia nigroaenea Curtis, 1839 (Hymenoptera: pteromalidae) em pupas de fannia pusio (Wiedemann, 1830) (Diptera: fanniidae) no Brasil First report of Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae) in pupae of Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae) in Brazil

    OpenAIRE

    Carlos Henrique Marchiori; Vanessa Alves Alvarenga

    2008-01-01

    Relata-se a primeira ocorrência do parasitóide Spalangia nigroaenea Curtis, 1839 (Hymenoptera: Pteromalidae) em pupas de Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae), no Brasil. Pupas de F. pusio foram coletadas em armadilhas utilizando-se fezes humanas como atrativo para os adultos. Obtiveram-se 10 pupas, das quais duas estavam parasitadas por S. nigroaenea, verificando-se uma porcentagem de parasitismo de 20,0%.The first occurrence in Brazil of the parasitoid Spalangia nigroaenea Cur...

  14. Composition and anti-insect activity of essential oils from Tagetes L. species (Asteraceae, Helenieae) on Ceratitis capitata Wiedemann and Triatoma infestans Klug.

    Science.gov (United States)

    López, Sandra B; López, María L; Aragón, Liliana M; Tereschuk, María L; Slanis, Alberto C; Feresin, Gabriela E; Zygadlo, Julio A; Tapia, Alejandro A

    2011-05-25

    Essential oils from four species of the genus Tagetes L. (Asteraceae, Helenieae) collected in Tucumán province, Argentina, were evaluated for their chemical composition, toxicity, and olfactory activity on Mediterranean fruit fly Ceratitis capitata Wiedemann adults and for repellent properties on Triatoma infestans (Klug) (Chagas disease vector). Yields of essential oils range from 0.2 to 0.8% (v/w). The same main constituents among Tagetes minuta L., Tagestes rupestris Cabrera, and Tagetes terniflora Kunth, (cis-trans)-ocimenes, (cis-trans)-tagetones, and (cis-trans)-ocimenones showed important differences in their relative compositions. Tagetes filifolia Lag. was characterized by the recognized phenylpropanoids methylchavicol and trans-anethole as the main components. LD(50) was ≤20 μg/insect in topical bioassays. T. rupestris was the most toxic to C. capitata females, whereas the other oils presented similar toxicities against males and females. Tagetes rupestris oil attracted both sexes of C. capitata at 5 μg, whereas T. minuta showed opposite activities between males (attractant) and females (repellent). Oils from T. minuta and T. filifolia were the most repellent to T. infestans. The results suggest that compositions of essential oils influence their insecticidal and olfactory properties. The essential oils from Tagetes species show an important potential as infochemical agents on insects' behaviors. This study highlights the chemical variability of essential oils as a source of variation of anti-insect properties.

  15. Development of phytosanitary cold treatments for oranges infested with Bactrocera invadens and Bactrocera zonata (Diptera: Tephritidae) by comparison with existing cold treatment schedules for Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Hallman, Guy J; Myers, Scott W; El-Wakkad, Mokhtar F; Tadrous, Meshil D; Jessup, Andrew J

    2013-08-01

    Phytosanitary cold treatments were tested for Bactrocera invadens Drew, Tsuruta, and White and Bactrocera zonata (Saunders) using comparisons with Ceratitis capitata (Wiedemann). Oranges were infested by puncturing holes in the peel and allowing tephritids to oviposit in the holes. The treatments were initiated when the larvae reached late third instar because previous research had shown that stage to be the most cold tolerant for all three species. Results show that B. invadens is not more cold tolerant than C. capitata and B. zonata at 1.0 +/- 0.1 degrees C and lend support to the use of C. capitata cold treatment schedules for B. invadens. It cannot be concluded that B. zonata is not more cold tolerant than C. capitata.

  16. An Additional Phytosanitary Cold Treatment Against Ceratitis capitata (Diptera: Tephritidae) in 'Oroblanco' Citrus Fruit.

    Science.gov (United States)

    Gazit, Yoav; Kaspi, Roy

    2017-01-12

    For 'Oroblanco' ('Sweetie'), the sweet seedless pummelo-grapefruit hybrid, when exported from Israel to Japan, the standard cold treatment against Ceratitis capitata (Wied.) (Diptera: Tephritidae) is conducted at ≤ 1.5 °C, for 16 d. In recent years, the transportation means of exported citrus was changed from reefer vessels to individual refrigerated containers, where the fruit bulk is relatively small and may be exposed to temperature fluctuations and to the risk of chilling injuries. To reduce this risk, Israel proposed to Japan to increase the treatment temperature and extend its duration to 2.2 °C and 18 d, respectively. This study shows that the proposed treatment effectively kills the third instar larva of C. capitata, in Oroblanco.

  17. Parasitóides de Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae) coletados em Caldas Novas, Goiás, Brasil Parasitoids of Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae) collected in Caldas Novas, Goiás, Brasil

    OpenAIRE

    Carlos Henrique Marchiori; Otacílio Moreira Silva Filho; Francilene Cardoso Alves Fortes; Rélia Rodrigues Brunes; Rauer Ferreira Borges; Patricia Luzia Pereira Gonçalves; Juliana Fischer Laurindo

    2005-01-01

    Com este estudo, objetivou-se verificar as espécies de insetos parasitando Fannia pusio (Wiedemann, 1830) (Diptera: Fanniidae)em Caldas Novas, Goiás, de agosto de 2003 a maio de 2004, empregando como atrativo de alimentação iscas formadas por fezes humanas, fígado bovino e peixe, com pupas sendo isoladas pelo método da flutuação, em água e individualizadas em cápsulas de gelatina até a emergência das moscas e/ou dos seus parasitóides. As porcentagens de parasitismo apresentada por Pachycrepoi...

  18. Population Fluctuation of Ceratitis capitata (Diptera: Tephritidae) as a Function of Altitude in Eastern Guatemala.

    Science.gov (United States)

    Flores, S; Montoya, P; Ruiz-Montoya, L; Villaseñor, A; Valle, A; Enkerlin, W; Liedo, P

    2016-08-01

    Population fluctuations of Ceratitis capitata (Wiedemann) were evaluated over a period of 12 mo in four altitudinal strata (400-750, 750-1,100, 1,100-1,450, and 1,450-1,800 meters above sea level, masl) in Eastern Guatemala. Within each altitudinal range, sampling plots were established in coffee plantations and adjacent areas, in which Jackson traps were set and baited with Trimedlure. Coffee berries and other host fruits were collected. Population density was lowest at the 400-750 masl stratum and highest at 1,450-1,800 masl. At every altitudinal range, the fluctuations of the pest were associated mainly with the availability of ripe coffee berries as a primary host. From 750-1,450 masl, the pest was also associated with the availability of sweet orange and mandarins in commercial and backyard orchards. The highest densities of the pest were recorded in the dry season. Citrus were the main alternate host where ripe coffee berries were not available. This knowledge on population dynamics of C. capitata will contribute to develop more effective area-wide pest management strategies including the use of sterile insects, natural enemies, and bait sprays.

  19. MEDHOST: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), version 1.1

    Science.gov (United States)

    This monograph is a compendium of all plant species reported as hosts of C. capitata (or potential hosts based on mere appearance on some lists). There are 353 species (312 have valid genera and species names and 41 have species identified as "sp." or "spp.") included in the monograph; 79 species ha...

  20. Pupal development of Ceratitis capitata (Diptera: Tephritidae) and Diachasmimorpha longicaudata (Hymenoptera: Braconidae) at different moisture values in four soil types.

    Science.gov (United States)

    Bento, F de M M; Marques, R N; Costa, M L Z; Walder, J M M; Silva, A P; Parra, J R P

    2010-08-01

    This study aimed to evaluate adult emergence and duration of the pupal stage of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), and emergence of the fruit fly parasitoid, Diachasmimorpha longicaudata (Ashmead), under different moisture conditions in four soil types, using soil water matric potential. Pupal stage duration in C. capitata was influenced differently for males and females. In females, only soil type affected pupal stage duration, which was longer in a clay soil. In males, pupal stage duration was individually influenced by moisture and soil type, with a reduction in pupal stage duration in a heavy clay soil and in a sandy clay, with longer duration in the clay soil. As matric potential decreased, duration of the pupal stage of C. capitata males increased, regardless of soil type. C. capitata emergence was affected by moisture, regardless of soil type, and was higher in drier soils. The emergence of D. longicaudata adults was individually influenced by soil type and moisture factors, and the number of emerged D. longicaudata adults was three times higher in sandy loam and lower in a heavy clay soil. Always, the number of emerged adults was higher at higher moisture conditions. C. capitata and D. longicaudata pupal development was affected by moisture and soil type, which may facilitate pest sampling and allow release areas for the parasitoid to be defined under field conditions.

  1. Attraction of Ceratitis capitata (Diptera: Tephritidae) and Nontarget Insects to the Attractant BioLure and its Individual Components in Hawaii.

    Science.gov (United States)

    BioLure, a synthetic food attractant for Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) that uses a combination of three chemical components (ammonium acetate, trimethylamine hydrochloride and putrescine), was deployed in MultiLure traps in predominantly native forests, non-native forests,...

  2. Insecticidal Activity of a Destruxin-Containing Extract of Metarhizium brunneum Against Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Lozano-Tovar, M D; Garrido-Jurado, I; Lafont, F; Quesada-Moraga, E

    2015-04-01

    Tephritid fruit flies are major pests that limit fruit production around the world; they cause important damages, increasing directly and indirectly annual costs, and their management is predominately based on the use of chemical insecticides. This research investigated the insecticidal activity of the crude extract obtained of Metarhizium brunneum Petch EAMb 09/01-Su strain and its capacity to secrete secondary metabolites including destruxins (dtx). Dtx A and A2 had insecticidal activity against Ceratitis capitata (Wiedemann) when administered per os. The crude extract of seven Metarhizium and one Beauveria isolates were evaluated per os against medfly adults. The crude extracts of the isolate EAMb 09/01-Su resulted in mortality ranging between 95 and 100% at 48 h. The high-pressure liquid chromatography profile showed two active peaks (F5B and F6 subfractions) related with dtx A2 and dtx A, which caused 70 and 100% mortality on C. capitata at 48 h postfeeding, respectively. The LC50 was 104.92 ppm of dtx A, contained in the F6 subfraction, and the LT50 was 4.16 h at a concentration of 400 ppm of dtx A contained in the F6 subfraction. Moreover, the average survival time of adults exposed to this subfraction was 12.6 h with only 1 h of exposure. The insecticide metabolites of the F6 subfraction of the EAMb 09/01-Su isolate retained >90% of its insecticidal activity after exposure to 60°C for 2 h and 120°C for 20 min. These results highlight the potential of this strain as a source of new insecticidal compounds of natural origin for fruit fly control.

  3. Toxicity of naturally occurring Bio-fly and chitosan compounds to control the Mediterranean fruit fly Ceratitis capitata (Wiedemann).

    Science.gov (United States)

    Rabea, E I; Nasr, H M; Badawy, M E I; El-Gendy, I R

    2015-01-01

    The efficacy of five compounds of a biopolymer chitosan and Bio-fly (Beauveria bassiana fungus) as biopesticide was evaluated on Ceratitis capitata under laboratory conditions. The inhibitory effects on acetylcholinesterase (AChE) and adenosinetriphosphatase (ATPase) as biochemical indicators were also determined in vivo. The results indicated that B. bassiana based Bio-fly exhibited significant toxicity against C. capitata (LC50 = 3008 and 3126 mg/L after 48 h in females and males, respectively) followed by the derivatives of chitosan, N-(4-propylbenzyl)chitosan and N-(2-nitrobenzyl)chitosan. Bio-fly displayed remarkable inhibition of AChE activity (IC50 = 2220 mg/L) while N-(2-chloro,6-flourobenzyl)chitosan, N-(4-propylbenzyl)chitosan and N-(3,4-methylenedioxybenzyl) chitosan had no significant difference in inhibitory action. In adult males, N-(2-nitrobenzyl)chitosan exhibited the highest inhibitory action (IC50 = 6569 mg/L). In addition, the toxic effects of the tested compounds on the activity of ATPase indicated that highly significant inhibition was found with N-(4-propylbenzyl)chitosan with an IC50 of 8194 and 8035 mg/L, in females and males, respectively.

  4. Oviposition preference hierarchy in Ceratitis capitata (Diptera, Tephritidae: influence of female age and experience

    Directory of Open Access Journals (Sweden)

    Joachim-Bravo Iara S.

    2001-01-01

    Full Text Available The influence of two factors, age and previous experience, on the oviposition hierarchy preference of Ceratitis capitata (Wiedemann, 1824 females was studied. Two populations were analyzed: one reared in laboratory during 17 years and the other captured in nature. In the first experiment the oviposition preference for four fruits, papaya, orange, banana and apple was tested at the beginning of oviposition period and 20 days past. The results showed that the wild females as much the laboratory ones had an oviposition preference hierarchy at the beginning of peak period of oviposition. However this hierarchic preference disappeared in a later phase of life. In the second experiment the females were previously exposed to fruits of different hierarchic positions and afterwards their choice was tested in respect to the oviposition preference for those fruits. The results showed that there was an influence of the previous experience on the posterior choice of fruits to oviposition when the females were exposed to fruits of lower hierarchic position.

  5. Parasitóides de Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae coletados em Caldas Novas, Goiás, Brasil Parasitoids of Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae collected in Caldas Novas, Goiás, Brasil

    Directory of Open Access Journals (Sweden)

    Carlos Henrique Marchiori

    2005-12-01

    Full Text Available Com este estudo, objetivou-se verificar as espécies de insetos parasitando Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidaeem Caldas Novas, Goiás, de agosto de 2003 a maio de 2004, empregando como atrativo de alimentação iscas formadas por fezes humanas, fígado bovino e peixe, com pupas sendo isoladas pelo método da flutuação, em água e individualizadas em cápsulas de gelatina até a emergência das moscas e/ou dos seus parasitóides. As porcentagens de parasitismo apresentada por Pachycrepoideus vindemmiae (Rondani, 1875 (Hymenoptera: Pteromalidae, Spalangia nigra Latrielle, 1805 (Hymenoptera: Pteromalidae Paraganaspis egeria Díaz, Gallardo & Walsh., 1996 (Hymenoptera: Figitidae e Spalangia drosophilae Ashmead, 1887 (Hymenoptera: Pteromalidae foram de 4,3, 1,5 0,9 e 0,6%, respectivamente. A porcentagem total de parasitismo observada foi de 7,4%. Relata-se a primeira ocorrência de S. nigra em pupas de F. pusio no Brasil.The aim of this study was to report the insect species parasitizing Fannia pusio (Wiedemann, 1830 (Diptera: Fanniidae, in Caldas Novas, State of Goiás, between August 2003 and May 2004. Flies were attracted to baits consisting of human feces, bovine liver and fish, with the pupae being isolated by the flotation method, in water, and individually placed in gelatin capsules until the emergence of the flies and/or their parasitoids. The parasitism percentages presented by Pachycrepoideus vindemmiae (Rondani, 1875 (Hymenoptera: Pteromalidae, Spalangia nigra Latrielle, 1805 (Hymenoptera: Pteromalidae, Paraganaspis egeria Díaz, Gallardo & Walsh, 1996 (Hymenoptera: Figitidae and Spalangia drosophilae Ashmead, 1887 (Hymenoptera: Pteromalidae were 4.3, 1.5, 0.9 and 0.6%, respectively. The total percentage of parasitism was 7.4%. This study reports the first occurrence of S. nigra in pupae of F. pusio in Brazil.

  6. Brachymeria podagrica (Fabricius (Hymenoptera: Chalcididae as a parasitoid of Chrysomya albiceps (Wiedemann (Diptera: Calliphoridae: first report in Brazil

    Directory of Open Access Journals (Sweden)

    Marchiori C.H.

    2002-01-01

    Full Text Available Este trabalho relata a primeira ocorrência do parasitóide Brachymeria podagrica (Fabricius, 1787 parasitando estádios imaturos de Chrysomya albiceps (Wiedemann (Diptera: Calliphoridae no Brasil. Utilizaram-se armadilhas contendo como isca vísceras de galinha. As pupas foram obtidas pelo método de flutuação. Elas foram colocadas individualmente em cápsulas de gelatina e mantidas até a emergência das moscas e/ou dos parasitóides. Foram obtidas 29 pupas de C. albiceps, quatro das quais emergiram parasitóides. A prevalência de parasitismo foi de 13,7%.

  7. Description of third instar larvae of Ceratitis fasciventris, C. anonae, C. rosa (FAR complex) and C. capitata (Diptera, Tephritidae).

    Science.gov (United States)

    Steck, Gary J; Ekesi, Sunday

    2015-01-01

    Third instar larvae of members of the Ceratitis FAR complex, including Ceratitis fasciventris (Bezzi), Ceratitis anonae Graham, and Ceratitis rosa Karsch are described and compared with those of Ceratitis capitata (Wiedemann). Diagnostic characters, such as presence vs. absence of a secondary tooth on the mandibles, previously used to separate Ceratitis capitata from Ceratitis rosa, are shown to vary in each species. Significant variation in diagnostic morphological characters among populations of Ceratitis rosa from east and south Africa is documented; however, the differences are not simply congruent with the R1 and R2 designations based on other studies. Quantitative measures of numerous morphological characters are consistently smaller in the larvae of Ceratitis fasciventris and distinguish them from other species of the FAR complex. Larvae of Ceratitis capitata can be distinguished from those of the FAR complex by characters such as absence of accessory plates of the oral ridges, the shape of the anterior spiracle, and the pattern of dorsal spinules. Previous studies indicated that absence of accessory lobes separate the genus Ceratitis from Bactrocera, but this is shown to be incorrect, as accessory lobes are in fact present in several species of Ceratitis.

  8. Description of third instar larvae of Ceratitis fasciventris, C. anonae, C. rosa (FAR complex) and C. capitata (Diptera, Tephritidae)

    Science.gov (United States)

    Steck, Gary J.; Ekesi, Sunday

    2015-01-01

    Abstract Third instar larvae of members of the Ceratitis FAR complex, including Ceratitis fasciventris (Bezzi), Ceratitis anonae Graham, and Ceratitis rosa Karsch are described and compared with those of Ceratitis capitata (Wiedemann). Diagnostic characters, such as presence vs. absence of a secondary tooth on the mandibles, previously used to separate Ceratitis capitata from Ceratitis rosa, are shown to vary in each species. Significant variation in diagnostic morphological characters among populations of Ceratitis rosa from east and south Africa is documented; however, the differences are not simply congruent with the R1 and R2 designations based on other studies. Quantitative measures of numerous morphological characters are consistently smaller in the larvae of Ceratitis fasciventris and distinguish them from other species of the FAR complex. Larvae of Ceratitis capitata can be distinguished from those of the FAR complex by characters such as absence of accessory plates of the oral ridges, the shape of the anterior spiracle, and the pattern of dorsal spinules. Previous studies indicated that absence of accessory lobes separate the genus Ceratitis from Bactrocera, but this is shown to be incorrect, as accessory lobes are in fact present in several species of Ceratitis. PMID:26798272

  9. Mitochondrial Single Nucleotide Polymorphisms in Ceratitis capitata (Diptera: Tephritidae) Can Distinguish Sterile, Released Flies from Wild Flies in Various Regions of the World.

    Science.gov (United States)

    Parubrub, Arlene; Reyes, Ruel; Smallridge, Catherine J; Woods, Bill; Haymer, David

    2015-02-01

    In areas infested with pest species such as the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), many programs rely heavily on the sterile insect technique (SIT) as a form of biological control. However, when SIT treatments are used both for control of established infestations and for occasional outbreaks, for several reasons, programs are often unable to adequately quantify the success of this approach. Chief among these are difficulties associated with reliably and rapidly determining the strain of origin of males recaptured during and after the SIT program. In this study, we describe the use of a DNA-based marker that can be used to rapidly and reliably distinguish males originating from the two sterile strains that are most widely used in SIT rearing facilities from males originating from wild strains of various regions of the world. This method uses polymerase chain reaction amplification of material from individual specimens to directly analyze DNA sequence variants found within a portion of the mitochondrial ND4 subunit 4 (ND4) gene to identify single nucleotide polymorphisms (SNPs) that are diagnostic of different strains. Specifically, the SNPs described here reliably distinguish individual flies originating from the Vienna 7 and Vienna 8 strains used for sterile release from wild flies infesting various areas including Western Australia, Guatemala, and Hawaii. The availability of such markers for determination of the strain of origin of specimens, either from whole specimens or body parts (including their sperm), has great potential to improve the ability to monitor and quantify the success of any sterile release program.

  10. Field Estimates of Attraction of Ceratitis capitata to Trimedlure and Bactrocera dorsalis (Diptera: Tephritidae) to Methyl Eugenol in Varying Environments.

    Science.gov (United States)

    Manoukis, Nicholas C; Siderhurst, Matthew; Jang, Eric B

    2015-06-01

    Measuring and modeling the attractiveness of semiochemical-baited traps is of significant importance to detection, delimitation, and control of invasive pests. Here, we describe the results of field mark-release-recapture experiments with Ceratitis capitata (Wiedemann) and Bactrocera dorsalis (Hendel) to estimate the relationship between distance from a trap baited with trimedlure and methyl eugenol, respectively, and probability of capture for a receptive male insect. Experiments were conducted using a grid of traps with a central release point at two sites on Hawaii Island, a Macadamia orchard on the East side of the island and a lava field on the West side. We found that for B. dorsalis and methyl eugenol there is a 65% probability of capture at ∼36 m from a single trap, regardless of habitat. For C. capitata, we found a 65% probability of capture at a distance of ∼14 m from a single trap in the orchard and 7 m in the lava field. We also present results on the spatial and temporal pattern of recaptures. The attraction data are analyzed via a hyperbolic secant-based capture probability model.

  11. Capacidad dispersiva de Ceratitis capitata (Diptera: Tephritidae entre valles agrícolas en San Juan, Argentina

    Directory of Open Access Journals (Sweden)

    Leonardo M. DÍAZ

    2008-01-01

    Full Text Available Ceratitis capitata (Wiedemann, díptero tefrítido cosmopolita originario del norte de África, es la principal plaga de los frutales en muchos países de América. El objetivo de este trabajo fue conocer las características de la capacidad de dispersión de Ceratitis capitata , mediante la liberación de moscas estériles en condiciones de campo, con el propósito de predecir las posibles invasiones de valles agrícolas vecinos. Se liberaron 54.000 moscas estériles marcadas de ambos sexos, en localidades del valle de Tulum, cercanas a los ingresos de los valles de Ullum y Zonda. Para el monitoreo del vuelo dispersivo se instalaron trampas Jackson y Mc Phail. Se capturaron 1.213 adultos durante el periodo de muestreo. No hubo propagación de los adultos liberados desde el valle de Tulum a los valles de Ullum y Zonda. La presencia de hospederos, posición geográfica de cada Quebrada y la orientación respecto al viento predominante, podrían explicar la diferencia de difusión entre ambas Quebradas. La dispersión duró cinco semanas. La distancia media de los adultos liberados fue de 3.764 m (S= 2.897 m sin encontrar diferencias entre ambos sexos.

  12. A new record for Lispe orientalis Wiedemann, 1824 (Diptera: Muscidae) from peninsular Malaysia.

    Science.gov (United States)

    Chew, W K; Kurahashi, H; Nazni, W A; Heo, C C; Heah, S K; Jeffery, J; Lee, H L

    2012-09-01

    Lispe orientalis Wiedemann, 1824 is recorded for the first time in peninsular Malaysia. Specimens were collected from a mushroom cultivation farm in Genting Highlands, Pahang (3°25'18"N 101°47'48"E). Previously, this species had been recorded from Azerbaijin, India, Russia, Tajikistan, Thailand, Turkey and South Korea. The male of Lispe orientalis can be determined by the following characteristics: body non-metallic, ashy gray, third antennal segment black, R5 cell not narrow apically, hind metatarsus normal, legs entirely black, femora with long bristle-like hairs on av and pv surfaces, hind tibia without av and pv seta and the palpi orangish in colour.

  13. Desenvolvimento Pós-embrionário de Ophyra aenescens (Wiedemann, 1830 (Diptera: Muscidae em Diferentes Dietas, sob Condições de Laboratório

    Directory of Open Access Journals (Sweden)

    José Mario d'Almeida

    1999-01-01

    Full Text Available Post-embryonic Development of Ophyra aenescens (Wiedemann, 1830 (Diptera: Muscidae, in Different Diets, under Laboratory Conditions - The performance of various diets (bovine meat, fish- sardine, shrimp, dog faeces, and banana in Ophyra aenescens development was evaluated. The biology was studied in an incubator (BOD at 27±1oC and 80±10% of RH. The developmental time from larvae to adult, the developmental time and viability of larvae and pupae, the weight of pupae as well as the sex ratio of the emerging adults were also determined. Beef and shrimp were the more efficient diets for rearing O. aenescens.

  14. Relación entre tiempo de desarrollo larvario y fecundidad de la hembra en Ceratitis capitata (Diptera:Tephritidae Relationship between time of larval development and fecundity in the female of Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Fanny C. Manso

    2006-07-01

    Full Text Available Se estudió la relación entre tiempo de desarrollo larvario y fecundidad en la hembra de Ceratitis capitata Wiedemann, comparando individuos de una cepa salvaje, con individuos de una cepa portadora de la mutación sw , la cual provoca atrasos en el desarrollo larvario. Se observaron caracteres de la morfología del ovario y su herencia entre los segregantes, para «tiempo de desarrollo» en la progenie del cruzamiento entre mutante y silvestre. El estudio mostró que las hembras sw (- que quedan muy retrasadas en su desarrollo, tienen menos ovariolas y una distribución de tamaños de óvulos menos homogénea que las que se desarrollan antes. Se encontró asimismo que entre las larvas de tipo salvaje, las más retrasadas también producen hembras con menor número de ovariolas y menos huevos totalmente desarrollados, que las que se desarrollan antes. Tanto en las hembras sw (- como en las sw(+ , los atrasos del desarrollo obran en desmedro de la postura de huevos de las hembras que se desarrollan más tarde, efecto que se manifiesta en el número menor de ovariolas y en las diferencias del ritmo de maduración del ovario. Bajo condiciones apropiadas de cría, las hembras mutantes para sw son capaces de alcanzar la misma fecundidad que las normales.We studied the relationship between the development time in the larva stage and the resulting female fecundity, in Ceratitis capitata Wiedemann wild-type individuals compared to mutant individuals showing slow development (sw. We observed the morphology of the ovaries in the progenies of the crossing between mutant and wild-type strains, comparing females segregating by «development time». This study showed that sw(- females developing later have got less ovarioles, and a more heterogeneous distribution of ovules, than females developing earlier. It was also found that the wild type females developing late also produce lower numbers both of ovarioles and fully developed ova, than those developing

  15. Phorcotabanus cinereus (Wiedemann, 1821 (Diptera, Tabanidae, an ornithophilic species of Tabanid in Central Amazon, Brazil

    Directory of Open Access Journals (Sweden)

    Limeira-de-Oliveira Francisco

    2002-01-01

    Full Text Available In Central Amazon, Brazil, the tabanid Phorcotabanus cinereus (Wiedemann was recorded attacking the native duck Cairina moschata (Linnaeus (Anseriformes, Anatidae. The flight and behavior of the tabanid during the attacks and the host's defenses were videotaped and analyzed in slow motion. The tabanid was recorded flying rapidly around the heads of the ducks before landing. Landing always took place on the beak, and then the tabanid walked to the fleshy caruncle on the basal part of the beak to bite and feed. Firstly the duck defends itself through lateral harsh head movements, and then, when it is being bitten, it defends itself by rubbing its head on the body, or dipping the head into water, when swimming. If disturbed, the fly resumed the same pattern of flight as before and would generally try to land again on the same host and bite in the same place. This feeding activity was observed predominantly between 9:30 am and 4:30 pm and always in open areas, near aquatic environments, from June 1996 to January 1997, the dry season in Central Amazon. To test the attractiveness of other animals to P. cinereus, mammals, caimans and domestic and wild birds were placed in suitable habitat and the response of P. cinereus observed. P. cinereus did not attack these animals, suggesting that this species has a preference for ducks, which are plentiful in the region.

  16. Introducción y producción en laboratorio de Diachasmimorpha tryon i y Diachasmimorpha longicaudata (Hymenoptera: Braconidae para el control biológico de Ceratitis capitata (Diptera: Tephritidae en la Argentina Introduction and laboratory production of Diachasmimorpha tryoni and Diachasmimorpha longicaudata (Hymenoptera: Braconidae for the biological control of Ceratitis capitata (Diptera: Tephritidae in Argentina

    Directory of Open Access Journals (Sweden)

    Sergio M. Ovruski

    2003-12-01

    Full Text Available Con el propósito de reanudar la utilización de enemigos naturales contra la especie exótica Ceratitis capitata (Wiedemann, fueron introducidos a la Argentina en 1999 los agentes de control biológico Diachasmimorpha tryoni (Cameron y Diachasmimorpha longicaudata (Ashmead, dos endoparasitoides de larvas de tefrítidos. Por este motivo, en este trabajo se describen los procedimientos de cría en laboratorio del huésped y de ambas especies de parasitoides y, se presentan y discuten los resultados de un año de producción de D. tryoni y D. longicaudata a mediana escala (enero-diciembre/2000. Se realizó un análisis comparativo de los datos obtenidos sobre la producción de descendientes, proporción sexual, porcentaje de parasitismo y viabilidad de puparios por jaula de cría durante 15 generaciones entre ambas especies de parasitoides exóticos, utilizando como huésped larvas de C. capitata del tercer estadio de siete días de edad. Además, se discuten las posibilidades para implementar el control biológico aumentativo contra C. capitata y Anastrepha fraterculus (Wiedemann en el país.The biocontrol agents Diachasmimorpha tryoni (Cameron and Diachasmimorpha longicaudata (Ashmead, two endoparasitoids of fruit fly larvae, were introduced to Argentina in 1999 with the purpose of renewing the employment of natural enemies against Ceratitis capitata (Wiedemann. For this reason, the general procedure and maintenance of the host and parasitoids rearing in the laboratory are described, and the results of one year insectary production (January-December/2000 of both D. tryoni and D. longicaudata are discussed. Data are presented of the progeny production, offpring sex ratio, host parasitism percentage, and pupal viability per parasitoid rearing cage during 15 generations of D. longicaudata and D. tryoni reared using late third instar larvae of C. capitata. New perspectives are discussed on the establishment of a biological control program for C

  17. Taxonomic revision and cladistic analysis of the Neotropical genus Acrochaeta Wiedemann, 1830 (Diptera: Stratiomyidae: Sarginae).

    Science.gov (United States)

    Fachin, Diego Aguilar; Amorim, Dalton De Souza

    2015-11-30

    The Neotropical genus Acrochaeta Wiedemann is revised and a cladistics analysis of the genus based on morphological characters is presented. This paper raises the total number of extant Acrochaeta species from 10 to 14 with the description of nine new species, the synonymy of one species, the transfer of five species to other genera and the transfer of one species of Merosargus to Acrochaeta. The new species described (of which eight are from Brazil and one from Bolivia and Peru) are Acrochaeta asapha nov. sp., A. balbii nov. sp., A. dichrostyla nov. sp., A. polychaeta nov. sp., A. pseudofasciata nov. sp., A. pseudopolychaeta nov. sp., A. rhombostyla nov. sp. A. ruschii nov. sp. and A. stigmata nov. sp. The primary types of all Acrochaeta species were studied at least from photos, when possible with the study of dissected male or female terminalia. A. mexicana Lindner is proposed as a junior synonym of A. flaveola Bigot. M. chalconota (Brauer) comb. nov., M. degenerata (Lindner) comb. nov., M. longiventris (Enderlein) comb. nov. and M. picta (Brauer) comb. nov. are herein transferred from Acrochaeta to Merosargus Loew, and Chrysochlorina elegans (Perty) comb. nov. is transferred from Acrochaeta to Chrysochlorina James. A. convexifrons (McFadden) comb. nov. is transferred from Merosargus to Acrochaeta. The limits of the genus and its insertion in the Sarginae are considered, and an updated generic diagnosis is provided. All species of the genus are redescribed and diagnosed, and illustrated with photos of the habitus, thorax, wing, and drawings of the antenna and male and female terminalia. Distribution maps are provided for the species, along with an identification key for adults of all species. Parsimony analyses were carried out under equal and implied weight. Our matrix includes 43 terminal taxa--of which 26 are outgroup species from four different sargine genera--and 59 adult morphological characters. The phylogenetic analysis supports the monophyly of

  18. Relación entre tiempo de desarrollo larvario y fecundidad de la hembra en Ceratitis capitata (Diptera:Tephritidae

    Directory of Open Access Journals (Sweden)

    Fanny C. MANSO

    2006-01-01

    Full Text Available Se estudió la relación entre tiempo de desarrollo larvario y fecundidad en la hembra de Ceratitis capitata Wiedemann, comparando individuos de una cepa salvaje, con individuos de una cepa portadora de la mutación sw, la cual provoca atrasos en el desarrollo larvario. Se observaron caracteres de la morfología del ovario y su herencia entre los segregantes, para «tiempo de desarrollo» en la progenie del cruzamiento entre mutante y silvestre. El estudio mostró que las hembras sw(- que quedan muy retrasadas en su desarrollo, tienen menos ovariolas y una distribución de tamaños de óvulos menos homogénea que las que se desarrollan antes. Se encontró asimismo que entre las larvas de tipo salvaje, las más retrasadas también producen hembras con menor número de ovariolas y menos huevos totalmente desarrollados, que las que se desarrollan antes. Tanto en las hembras sw(- como en las sw(+, los atrasos del desarrollo obran en desmedro de la postura de huevos de las hembras que se desarrollan más tarde, efecto que se manifiesta en el número menor de ovariolas y en las diferencias del ritmo de maduración del ovario. Bajo condiciones apropiadas de cría, las hembras mutantes para sw son capaces de alcanzar la misma fecundidad que las normales.

  19. Comparison of aggregation and feeding responses by normal and irradiated fruit flies, Ceratitis capitata and Anastrepha suspensa (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Galun, R.; Gothilf, S.; Blondheim, S.; Sharp, J.L.; Mazor, M.; Lachman, A.

    1985-12-01

    Olfactory, aggregatory, and feeding responses of normal (untreated) laboratory stocks of Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann), and of Caribbean fruit fly (caribfly), Anastrepha suspensa (Loew), were compared to those of flies irradiated (10 krad in air) 2 days before eclosion. Females of both species consumed greater quantities of protein hydrolysate solutions, entered protein hydrolysate-baited olfactory traps, and aggregated on agar plates containing protein hydrolysate in greater numbers than males of the same age and condition. However, male medflies consumed more sucrose than did females of the same age and condition. In the medfly, irradiation resulted in reduced olfactory response, reduced total food intake by flies of both sexes, and a significant reduction in aggregation on and intake of protein hydrolysate by females and of sugar consumption by males. In the irradiated caribfly, there was a significant reduction in olfactory response of females to yeast hydrolysate. In both sexes, aggregation on and consumption of yeast hydrolysate were reduced. Effects of irradiation on feeding behavior are discussed in relation to the biology of the flies and their control by the sterile insect release method.

  20. Risk of introducing exotic fruit flies, Ceratitis capitata, Ceratitis cosyra, and Ceratitis rosa (Diptera: Tephritidae), into southern China.

    Science.gov (United States)

    Li, Baini; Ma, Jun; Hu, Xuenan; Liu, Haijun; Wu, Jiajiao; Chen, Hongjun; Zhang, Runjie

    2010-08-01

    Exotic fruit flies (Ceratitis spp.) are often serious agricultural pests. Here, we used, pathway analysis and Monte Carlo simulations to assess the risk of introduction of Ceratitis capitata (Wiedemann), Ceratitis cosyra (Walker), and Ceratitis rosa Karsch, into southern China with fruit consignments and incoming travelers. Historical data, expert opinions, relevant literature, and archives were used to set appropriate parameters in the pathway analysis. Based on the ongoing quarantine/ inspection strategies of China, as well as the interception records, we estimated the annual number of each fruit fly species entering Guangdong province undetected with commercially imported fruit, and the associated risk. We also estimated the gross number of pests arriving at Guangdong ports with incoming travelers and the associated risk. Sensitivity analysis also was performed to test the impact of parameter changes and to assess how the risk could be reduced. Results showed that the risk of introduction of the three fruit fly species into southern China with fruit consignments, which are mostly transported by ship, exists but is relatively low. In contrast, the risk of introduction with incoming travelers is high and hence deserves intensive attention. Sensitivity analysis indicated that either ensuring all shipments meet current phytosanitary requirements or increasing the proportion of fruit imports sampled for inspection could substantially reduce the risk associated with commercial imports. Sensitivity analysis also provided justification for banning importation of fresh fruit by international travelers. Thus, inspection and quarantine in conjunction with intensive detection were important mitigation measures to reduce the risk of Ceratitis spp. introduced into China.

  1. O complexo holosericeus de Ommatius Wiedemann no Brasil: nova espécie e primeiro registro do grupo ampliatus para o País e novos registros para o grupo holosericeus (Diptera, Asilidae

    Directory of Open Access Journals (Sweden)

    Rodrigo Vieira

    2011-12-01

    Full Text Available O complexo holosericeus de Ommatius Wiedemann no Brasil: nova espécie e primeiro registro do grupo ampliatus para o país e novos registros para o grupo holosericeus (Diptera, Asilidae. Neste trabalho é descrita uma nova espécie de Ommatius Wiedemann, 1821 para o estado do Amazonas, pertencente ao grupo ampliatus. Além disso, são fornecidos novos registros, variações taxonômicas, ilustrações e descrição das estruturas das terminálias masculina e feminina para as espécies do grupo holosericeus.

  2. Captures of Wild Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae (Diptera: Tephritidae) in Traps with Improved Multilure TMR Dispensers Weathered in California.

    Science.gov (United States)

    Vargas, Roger I; Souder, Steven K; Morse, Joseph G; Grafton-Cardwell, Elizabeth E; Haviland, David R; Kabashima, John N; Faber, Ben A; Mackey, Bruce; Cook, Peter

    2016-04-01

    During 2012–2013, solid Mallet TMR (trimedlure [TML], methyl eugenol [ME], raspberry ketone [RK]) wafers impregnated with DDVP (2, 2-dichlorovinyl dimethyl phosphate) insecticide were weathered during summer (8 wk) and winter (12 wk) in five California citrus-growing counties (Kern, Ventura, Orange, Tulare, and Riverside). In addition, TMR wafers without DDVP and with a Hercon Vaportape II insecticidal strip were compared with TMR dispensers with DDVP at Exeter and Riverside. Weathered treatments were shipped every week (overnight delivery) to Hawaii and frozen for a later bioassay in a 1,335-ha coffee plantation near Numila, Kauai Island, HI, where Mediterranean fruit fly, Ceratitis capitata (Wiedemann), oriental fruit fly, Bactrocera dorsalis Hendel, and melon fly, Bactrocera cucurbitae Coquillett, were all present. We compared trap captures of the three species, C. capitata, B. dorsalis, and B. cucurbitae, for the five different weathering locations. Captures of C. capitata, B. dorsalis, and B. cucurbitae with Mallet TMR dispensers (with DDVP) were not significantly different for the five locations. Captures with the Mallet TMR dispenser without DDVP and Vaportape were similar to those for Mallet TMR with DDVP, although there were some slight location differences. In conclusion, based on these results, the Mallet TMR dispenser could potentially be used in California habitats where large numbers of detection traps are currently deployed. Use of Vaportape with dispensers would not require them to be registered with US Environmental Protection Agency (EPA). Dispensers for use as Male Annihilation Technique (MAT) devices will be tested further in Hawaii.

  3. Chrysomya albiceps (Wiedemann and Hemilucilia segmentaria (Fabricius (Diptera, Calliphoridae used to estimate the postmortem interval in a forensic case in Minas Gerais, Brazil

    Directory of Open Access Journals (Sweden)

    Cecília Kosmann

    2011-12-01

    Full Text Available ABSTRACT. Chrysomya albiceps (Wiedemann and Hemilucilia segmentaria (Fabricius (Diptera, Calliphoridae used to estimate the postmortem interval in a forensic case in Minas Gerais, Brazil. The corpse of a man was found in a Brazilian highland savanna (cerrado in the state of Minas Gerais. Fly larvae were collected at the crime scene and arrived at the laboratory three days afterwards. From the eight pre-pupae, seven adults of Chrysomya albiceps (Wiedemann, 1819 emerged and, from the two larvae, two adults of Hemilucilia segmentaria (Fabricius, 1805 were obtained. As necrophagous insects use corpses as a feeding resource, their development rate can be used as a tool to estimate the postmortem interval. The post-embryonary development stage of the immature collected on the body was estimated as the difference between the total development time and the time required for them to become adults in the lab. The estimated age of the maggots from both species and the minimum postmortem interval were four days. This is the first time that H. segmentaria is used to estimate the postmortem interval in a forensic case.

  4. Manipulation of the microbiota of mass-reared Mediterranean fruit flies Ceratitis capitata (Diptera: Tephritidae) improves sterile male sexual performance.

    Science.gov (United States)

    Ben Ami, Eyal; Yuval, Boaz; Jurkevitch, Edouard

    2010-01-01

    The sterile insect technique (SIT) is a method of biological control whereby millions of factory reared sterile male insects are released into the field. This technique is commonly used to combat the Mediterranean fruit fly (Ceratitis capitata, Diptera: Tephritidae). Sterile medfly males are less competent in attracting and mating with wild females, a property commonly linked to the irradiation process responsible for the sterilization. As bacteria are important partners in the fly's life cycle, we used molecular analytical methods to study the community structure of the gut microbiota in irradiated male medflies. We find that the sterilizing irradiation procedure affects the gut bacterial community structure of the Mediterranean fruit fly. Although the Enterobacteriaceae family remains the dominant bacterial group present in the gut, the levels of Klebsiella species decreases significantly in the days after sterilization. In addition, we detected substantial differences in some bacterial species between the mass rearing strain Vienna 8 and the wild strain. Most notable among these are the increased levels of the potentially pathogenic species Pseudomonas in the industrial strain. Testing the hypothesis that regenerating the original microbiota community could result in enhanced competitiveness of the sterile flies, we found that the addition of the bacterial species Klebsiella oxytoca to the postirradiation diet enables colonization of these bacteria in the gut while resulting in decreased levels of the Pseudomonas sp. Feeding on diets containing bacteria significantly improved sterile male performance in copulatory tests. Further studies will determine the feasibility of bacterial amelioration in SIT operations.

  5. The Process of Intromission in the Mediterranean Fruit Fly, Ceratitis capitata (Diptera: Tephritidiae

    Directory of Open Access Journals (Sweden)

    William G. Eberhard

    1995-01-01

    Full Text Available The distiphallus of the male of Ceratitis capitata is folded back 180° onto the basiphallus during the early stages of intromission, and is then unfolded within the female. Repeated folding and unfolding may occur within the female. Two membranous sacs on the distiphallus are capable of rhythmic cycles of inflation and deflation. Inflations of the sac near the base of the distiphallus probably help propel the aedeagus deeper into the female, along with periodic stiffening of the basiphallus; inflation of the larger, distal sac may drive the genital rod (which does not transfer sperm into the ventral receptacle.

  6. Pathogenicity of Metarhizium anisopliae for Ceratitis capitata (Wied.) (Diptera: Tephritidae) in soil with different pesticides.

    Science.gov (United States)

    Mochi, Dinalva A; Monteiro, Antonio C; De Bortoli, Sergio A; Dória, Háyda O S; Barbosa, José C

    2006-01-01

    This research intended to investigate if the presence of pesticides in the soil could affect the pathogenicity of Metarhizium anisopliae Metsch. (Sorokin) for Ceratitis capitata (Wied.) and assess the effect of conidia application as suspension or dry conidia. The fungicides chlorothalonyl and tebuconazol, the acaricide abamectin, the insecticide trichlorfon, and the herbicide ametrin were applied at the manufacturer-recommended doses. Soil samples were placed in glass flasks and were given the fungus as conidial suspension or dry. After pesticide application, 20 3rd-instar larvae were placed in the soil. The flasks were sealed with voile fabric and incubated at 27 +/- 0.5 masculineC for nine days, until adult emergence; incubation continued for four more days at room temperature. The total insect survival was significantly affected and pathogenic activity was detected from the pupa stage on. Pupa survival was reduced (Ptebuconazole reduced (86.2% and 82.5%, respectively) the survival period of C. capitata compared to the control (95.0%). The techniques used for conidia application did not influence the total insect survival rate, but conidial suspension applied on soil surface reduced survival during the pupae and adult phases.

  7. Photosensitizing effect of hematoporphyrin IX on immature stages of Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Pujol-Lereis, Luciana Mercedes; Massaldi, Ana; Rabossi, Alejandro; Quesada-Allué, Luis Alberto

    2010-01-01

    Immature stages of Ceratitis capitata were tested as a model for hematoporphyrin IX (HP IX) phototoxicity. The lethal concentration 50 (LC(50)) of HP IX in the food was determined during postembryonic development until adult emergence as 0.173 mm (95% CI: 0.138-0.209). The corresponding HP IX LC(50) during the dispersal period alone was 0.536 mm (95% CI: 0.450-0.633). HP IX toxicity was compared against Phloxine B (PhB) (0.5 mm). HP IX elicited a mortality of 90.87%, which was mainly concentrated during prepupal and early pupal stages. PhB mortality was much lower (56.88%) and occurred mainly during the adult pharate stage. A direct correlation between light-dependent HP IX mortality, evidence of reactive oxygen species (ROS) and lipid peroxidation (conjugated dienes and thiobarbituric acid reactive substances) was established in C. capitata larvae. ROS were found to be very significant in both the brain and in the gut.

  8. Transgenic sexing system for Ceratitis capitata (Diptera: Tephritidae) based on female-specific embryonic lethality.

    Science.gov (United States)

    Ogaugwu, Christian E; Schetelig, Marc F; Wimmer, Ernst A

    2013-01-01

    Fruit fly pest species have been successfully controlled and managed via the Sterile Insect Technique (SIT), a control strategy that uses infertile matings of sterile males to wild females to reduce pest populations. Biological efficiency in the field is higher if only sterile males are released in SIT programs and production costs are also reduced. Sexing strains developed in the Mediterranean fruit fly Ceratitis capitata (medfly) through classical genetics are immensely beneficial to medfly SIT programs but exhibit reduced fertility and fitness. Moreover, transfer of such classical genetic systems to other tephritid species is difficult. Transgenic approaches can overcome this limitation of classical genetic sexing strains (GSSs), but had resulted so far in transgenic sexing strains (TSSs) with dominant lethality at late larval and pupal stages. Here we present a transgene-based female-specific lethality system for early embryonic sexing in medfly. The system utilizes the sex-specifically spliced transformer intron to restrict ectopic mRNA translation of the pro-apoptotic gene hid(Ala5) to females only. The expression of this lethal effector gene is driven by a tetracycline-repressible transactivator gene tTA that is under the control of promoters/enhancers of early-acting cellularization genes. Despite observed position effects on the sex-specific splicing, we could effectively establish this early-acting transgenic sexing system in the medfly C. capitata. After satisfactory performance in large scale tests, TSSs based on this system will offer cost-effective sexing once introduced into SIT programs. Moreover, this approach is straight forward to be developed also for other insect pest and vector species.

  9. Revision of the genus Macrostomus Wiedemann (Diptera: Empididae: Empidinae: II. The pictipennis species-group Revisão do gênero Macrostomus Wiedemann (Diptera: Empididae: Empidinae: II. O grupo de espécies pictipennis

    Directory of Open Access Journals (Sweden)

    José Albertino Rafael

    2010-09-01

    Full Text Available All species of Macrostomus Wiedemann allied with Macrostomus pictipennis (Bezzi, are treated in the pictipennis species-group. Three currently recognized species and four new species are included, namely M. cervicicauda Smith, M. cysticercus Smith, M. manauara, sp. nov. from Brazil (Amazonas and Pará states, M. pacaraima, sp. nov. from Brazil (Roraima, Amazonas and Pará states, M. pictipennis (Bezzi, M. smithi, sp. nov. from Guyana and Brazil (Roraima State and M. utinga, sp. nov. from Brazil (Pará State. All primary types were examined and a key to species is presented.As espécies de Macrostomus Wiedemann afins de Macrostomus pictipennis (Bezzi estão sendo tratadas no grupo M. pictipennis, o qual inclui três espécies já descritas e quarto espécies novas, a saber: M. cervicicauda Smith, M. cysticercus Smith, M. manauara, sp. nov. do Brasil (Amazonas e Pará, M. pictipennis (Bezzi, M. smithi, sp. nov. da Guiana e Brasil (Roraima, M. utinga, sp. nov. do Brasil (Pará e M. pacaraima, sp. nov. do Brasil (Roraima, Amazonas e Pará. Todos os tipos primários foram examinados e uma chave para espécie é apresentada.

  10. Molecular cloning and expression of nanos in the Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Ogaugwu, Christian E; Wimmer, Ernst A

    2013-01-01

    The gene nanos (nos) is a maternal-effect gene that plays an important role in posterior patterning and germ cell development in early stage embryos. nos is known from several diverse insect species, but has so far not been described for any Tephritid fruit fly. Here, we report the molecular cloning and expression pattern of the nos orthologous gene, Ccnos, in the Mediterranean fruit fly Ceratitis capitata, which is a destructive pest of high agricultural importance. CcNOS contains 398 amino acids and has a C-terminal region with two conserved CCHC zinc-binding motifs known to be essential for NOS function. Transcripts of Ccnos were confirmed by in situ hybridization to be maternally-derived and localized to the posterior pole of early stage embryos. Regulatory regions of nos have been employed in genetic engineering in some dipterans such as Drosophila and mosquitoes. Given the similarity in spatial and temporal expression between Ccnos and nos orthologs from other dipterans, its regulatory regions will be valuable to generate additional genetic tools that can be applied for engineering purposes to improve the fight against this devastating pest.

  11. Irradiation of Ceratitis capitata, Anastrepha fraterculus and Anastrepha obliqua larvae (Diptera: Tephritidae) on an artificial diet; Irradiacao de larvas de Ceratitis capitata, Anastrepha fraterculus e Anastrepha obliqua (Diptera: Tephritidae) em dieta artificial

    Energy Technology Data Exchange (ETDEWEB)

    Raga, A.; Sato, M.E.; Suplicy Filho, N.; Potenza, M.R. [Instituto Biologico, Sao Paulo, SP (Brazil); Yamazaki, M.C.R. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)

    1992-01-01

    The aim of the experiment was to establish gamma radiation dose levels sufficient to prevent the emergence of adults, and thus to serve as parameters for disinfestation of hosts of the fruit-flies Ceratitis capitata, Anastrepha fraterculus, and Anastrepha obliqua. Four-, 5,6-, and 7-day-old larvae of the 3 species were tested. Pupation was unaffected by 40 Gy for C. capitata, and by 100 Gy for A. fraterculus and A. obliqua. Gamma radiation doses necessary to prevent development of adults from larvae were 30 Gy, 20 Gy and 20 Gy for C. capitata, A. obliqua respectively. (author). 10 refs, 6 tabs.

  12. Aphaereta sp. (Hymenoptera: Braconidae: Alysiinae) as a natural enemy to Peckia chrysostoma (Wiedemann) (Diptera: Sarcophagidae), in Brazil.

    Science.gov (United States)

    Marchiori, C H; Pereira, L A; Filho, O M

    2003-02-01

    This paper reports the first occurence of the parasite Aphaereta sp. (Hymenoptera: Braconidae: Alysiinae) which was collected from Peckia chrysostoma pupae (Diptera: Sarcophagidae) by means of traps containing some fish baits in a wood area close to the Agronomy college (Faculdade of Agronomia) in Itumbiara, Goiás, in the period from March to September, 2001. A total of 362 gregarious specimens of parasitoids from 26 pupae of P. chrysostoma. Aphaereta sp. was collected, with several individuals emerging from the same pupae.

  13. Análise de sobrevivência e estimativa de entropia para Sarconesia chlorogaster (Wiedemann (Diptera, Calliphoridae Survival analysis and estimation of entropy of Sarconesia chlorogaster (Wiedemann (Diptera, Calliphoridae

    Directory of Open Access Journals (Sweden)

    Maurício O. Moura

    1999-01-01

    Full Text Available The life expectancy of Sarconesia chlorogaster (Wiedemann, 1830 reared in artificial diet and controlled temperatures chamber set at 27±1oC, 70±10% RH and 12 hours of photophase was analysed using entropy (H. Entropy (H was used to quantify the distribuition of deaths between ages and then quantify the impact of mortality on life expectancy. The entropy values obtained for males (H=0,245 and females (H=0,299 were intermediary between the theoretical values of H=0,5 and H=0 suggesting a tendency toward rectangular distribuitions in both sexes. The effect of mortality across ali ages on expectation of life was different at each age. For males the highest values were found between days 10 and 20 and between days 15 and 25 for females. This íindings imply that small changes in female mortality will have a greater impact on female life expectancy than will have on male expectation of life.

  14. Effects of pesticides used on citrus grown in Spain on the mortality of Ceratitis capitata (Diptera: Tephritidae) Vienna-8 strain sterile males.

    Science.gov (United States)

    Juan-Blasco, María; Sabatier-Muñoz, Beatriz; Argilés, Rafael; Jacas, Josep A; Ortego, Félix; Urbaneja, Alberto

    2013-06-01

    Vienna-8 sterile males are currently released in Spain to reduce wild populations of the medfly. Because pesticides are required to maintain populations of some citrus key pests below economic thresholds, there is a need to evaluate the effects of pesticides commonly used in citrus on Vienna-8 males. Males were exposed to differently aged residues of eight pesticides. Abamectin, etofenprox, etoxazole, petroleum spray oil, pymetrozine, and pyriproxyfen resulted harmless to Vienna-8 males. However, fresh residues of chlorpyrifos and spinosad caused high mortalities and had residual effects until 21 and 28 d after treatment, respectively. Following the same method, the lethal effects of chlorpyrifos and spinosad on Ceratitis capitata (Wiedemann) wild-type (wt) males were determined. Surprisingly, these pesticides resulted more toxic for wt than for Vienna-8 males. To determine whether these results could be attributed to intrinsic characteristics of the pesticides or to behavioral differences among Vienna-8 and wt males, a topical application trial was conducted. Vienna-8 males were twice as susceptible to chlorpyrifos as wt males, whereas their susceptibility to spinosad was slightly lower. These results in intrinsic toxicity did not directly explain the differences observed in the extended-laboratory tests with these pesticides. We hypothesize that the lower flight activity ofVienna-8 males relative to wt conspecifics can explain the lower risk observed for Vienna-8 males in the residual tests. Our results should be taken into account when planning area-wide Sterile Insect Technique programs against C. capitata especially in those areas where treatments with chlorpyrifos are approved.

  15. A new mechanised cultural practice to reduce Ceratitis capitata Wied. populations in area-wide IPM

    Directory of Open Access Journals (Sweden)

    P. Chueca

    2013-11-01

    Full Text Available The Mediterranean fruit fly (or medfly, Ceratitis capitata (Wiedemann (Diptera: Tephritidae, affects most of the fruit species grown in temperate and tropical climate regions, causing significant economic damage. One of the classical cultural strategies against this pest is to gather and bury the remaining fruit after harvest, but this is economically unfeasible today. Wood shredders already available in current Spanish groves can be used to grind or crush fruits laying on the soil as an alternative to this practice and to the use of pesticides in area-wide integrated pest management (IPM. With the purpose of evaluating this alternative, the initial step of this study was to perform laboratory tests to assess the efficacy of crushing and grinding as a method for controlling medflies. The results showed that grinding was 78% effective against larval stages, while crushing resulted in a 17% efficacy, leading us to choose the first alternative. As a second step, the operational parameters (type of cutting tool, shaft rotation speed and tractor speed of the wood shredders were adjusted to efficiently carry out this practice under field conditions. Finally, the effect of the mechanised grinding of fallen fruit on C. capitata populations was evaluated for two consecutive years in commercial citrus orchards. The results showed a significant 27-46% reduction in C. capitata populations the following spring, thus demonstrating that the newly proposed mechanised alternative can be included in the current area-wide IPM of the pest in Spain.

  16. Transcriptome analysis in Ceratitis capitata to unveil genes involved in ageing-maturation process

    Directory of Open Access Journals (Sweden)

    V. San Andrés

    2013-07-01

    Full Text Available The sterile insect technique (SIT is widely used in integrated programmes against the Mediterranean fruit fly, Ceratitis capitata (Wiedemann (Diptera: Tephritidae. Information on the age distribution of insects, and more particularly, the knowledge of wild female reproductive status (mature or not at the time of the sterile male release is one of the key factors for the success of the SIT. In recent years, sequencing analysis has become an important tool in molecular biology. In this work we present a genome-wide expression analysis based on SSH (substractive sequence hybridization and EST (expressed sequence tag sequencing and macroarray expression analysis to identify signature genes related to the ageing-maturing process in C. capitata, leading to the successful identification of new putative candidate genes of reproductive status in medfly that would serve as molecular markers for ageing. We have sorted out 94 unigenes from 873 single-pass ESTs, of which 57% have homology with known genes. Ageing-maturing process in C. capitata presents a marked expression pattern accompanied by the increase of transcription level of genes involved in reproduction (vitellogenins, chorion proteins and male-specific serum proteins. Other identified cDNAs (43% with a differential expression pattern would be also candidates but deserve further studies, as they belong to the unknown function class.

  17. Fitness improvement of mass-reared sterile males of Ceratitis capitata (Vienna 8 strain) (Diptera: Tephritidae) after gut enrichment with probiotics.

    Science.gov (United States)

    Hamden, Heithem; Guerfali, Meriem M'Saad; Fadhl, Selma; Saidi, Mouldi; Chevrier, Claude

    2013-04-01

    Successful mass rearing is crucial for sterile insect technique programs. It has been shown that the sterilizing process using gammaradiation results in damage to midgut tissue, cellular organelles, and gut microbiota of flies. This can be responsible for the inferiority of sterile males compared with wild males. A bacteria-enhanced diet could contribute to the improvement of the fly's fitness. We investigated ways of increasing the competitiveness of mass-reared Mediterranean fruit fly, Ceratitis capitata (Wiedemann) sterile males. We tested the hypothesis that the addition of beneficial bacteria to the larvae's diet would lead to a significant increase in their levels in the gut of the sterile adults and consequently improve their size and fitness. As expected, enriching the diet of mass-rearing Vienna-8 strain larvae with beneficial bacteria (Klebsiella pneumonia, Enterobacter spp., and Citrobacter freundii) resulted in increase in the number of Enterobacteriacae communities inhabiting the male's gut and a subsequent significant increase in the size of males and other morphometric traits and enhanced sexual performance of males at emergence.

  18. The role of protein in the sexual behaviour of males of Ceratitis capitata (Diptera: Tephritidae: mating success, copula duration and number of copulations

    Directory of Open Access Journals (Sweden)

    Iara Sordi Joachim-Bravo

    2009-09-01

    Full Text Available In this paper, we investigated the influence of protein ingestion during the early adult phase on the sexual behavior of males of Ceratitis capitata (Wiedemann, 1824. The following parameters were evaluated: mating success (ability to be chosen by females, number of copulations, and copula duration. Experiments were carried out using a fifteen-year old laboratory lineage with the occasional introduction of wild flies. Two groups of adult males fed a high-protein diet during their larval phase were given either a high-protein diet (based on Brewer's yeast, concentration = 6.5 g/100 ml or a no-protein diet. Both groups of males were exposed to females fed either a high-protein diet or a no-protein diet and were subsequently evaluated for the parameters listed above. All experiments were conducted at 25ºC, 70% R.H. and with a photoperiod of L12:D12. The number of copulations was the only parameter affected by adult diet. Males fed a high-protein diet and exposed to females fed a no-protein diet had a greater number of copulations compared with males fed a no-protein diet.

  19. Study of some biological aspects of the blowfly Chrysomya albiceps (Wiedemann 1819 (Diptera: Calliphoridae in Jeddah, Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Layla A.H. Al-Shareef

    2016-03-01

    Full Text Available We reared Chrysomya albiceps (Wiedemann 1819 unadult stages (first larval instar, second larval instar, third larval instar and pupal stage under four constant temperatures. Results proved that increasing temperature from 20 to 25, 30 and 35 °C reduced total larval stage duration (9–6, 4.83 and 4.75 days, respectively and pupal duration (7, 5.5, 4 and 1.5 days, respectively. C. albiceps larvae at first instar reached adult stage in the longest time at 20 °C (16 days, and in the shortest time at 35 °C (6.25 days. The accumulation degree-day (ADD at 20, 25, 30, 35 °C for first larval instar were 8.86, 13.86, 18.86, 23.86 DD, for second larval instar were 10.5, 12, 17, 22 DD and for third larval instar were 35.88, 42.08, 43.97, 56.43 DD. Heat requirements for larval stage at different temperatures; 20, 25, 30 and 35 °C (49.68, 63.12, 75.01 and 97.47 DD were more than the pupal requirements at the same temperatures (39.78, 58.76, 62.73 and 31.02 DD. Total heat requirements for C. albiceps to develop from the first larval instar to adult eclosion were the lowest at 20 °C (89.46 DD and the highest at 30 °C (129.138 DD. Decreasing of temperature increased larval body length at the same age. The development curves for C. albiceps were established at four constant temperatures using larval length and the time since egg hatching.

  20. Development of a transgenic sexing system based on female-specific embryonic lethality in Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    The Sterile Insect Technique (SIT) is more efficient and cost-effective when only sterile males are released. A female-specific lethality system based on a female-specifically spliced intron was developed for transgenic sexing in Ceratitis capitata (Fu et al., 2007) possibly to overcome the fitness ...

  1. Trapping Female Medflies (Ceratitis capitata) by Broadcast of Male Calling Song

    Science.gov (United States)

    2003-07-01

    UNCLASSIFIED Defense Technical Information Center Compilation Part Notice ADP022884 TITLE: Trapping Female Medflies [ Ceratitis capitata ] by Broadcast...component part numbers comprise the compilation report: ADP022883 thru ADP023022 UNCLASSIFIED Trapping Female Medflies ( Ceratitis capitata ) by...systems for Ceratitis capitata (Diptera: Tephritidae) in seven countries," J. Econ. Entomol. 92, 156-164. 2. Hendrichs, J., Franz, G., and Rendon, P

  2. Uma nova espécie de Strebla Wiedemann, 1824 (Diptera, Streblidae, Streblinae sobre Anoura caudifer (E. Geoffroy, 1818 (Chiroptera, Phyllostomidae, Glossophaginae

    Directory of Open Access Journals (Sweden)

    Graciolli Gustavo

    2003-01-01

    Full Text Available A new species of Strebla Wiedemann, S. carvalhoi sp. nov., collected, on Anoura caudifer (E. Geoffroy, 1818 from Southern of Brazil, is described. Drawings of the postvertex, occipital plates, gonopods and tergite VII are provided.

  3. Improving the sterile sperm identification method for its implementation in the Area-wide Sterile Insect Technique Program against Ceratitis capitata (Diptera: Tephritidae) in Spain.

    Science.gov (United States)

    Juan-Blasco, M; Urbaneja, A; San Andrés, V; Castañera, P; Sabater-Muñoz, B

    2013-12-01

    The success of sterile males in area-wide sterile insect technique (aw-SIT) programs against Ceratitis capitata (Wiedemann) is currently measured by using indirect methods as the wild:sterile male ratio captured in monitoring traps. In the past decade, molecular techniques have been used to improve these methods. The development of a polymerase chain reaction-restriction fragment-length polymorphism-based method to identify the transfer of sterile sperm to wild females, the target of SIT, was considered a significant step in this direction. This method relies on identification of sperm by detecting the presence of Y chromosomes in spermathecae DNA extract complemented by the identification of the genetic origin of this sperm: Vienna-8 males or wild haplotype. However, the application of this protocol to aw-SIT programs is limited by handling time and personnel cost. The objective of this work was to obtain a high-throughput protocol to facilitate the routine measurement in a pest population of sterile sperm presence in wild females. The polymerase chain reaction-restriction fragment-length polymorphism markers previously developed were validated in Mediterranean fruit fly samples collected from various locations worldwide. A laboratory protocol previously published was modified to allow for the analysis of more samples at the same time. Preservation methods and preservation times commonly used for Mediterranean fruit fly female samples were assessed for their influence on the correct molecular detection of sterile sperm. This high-throughput methodology, as well as the results of sample management presented here, provide a robust, efficient, fast, and economical sterile sperm identification method ready to be used in all Mediterranean fruit fly SIT programs.

  4. Analysis of Seasonal Risk for Importation of the Mediterranean Fruit Fly, Ceratitis capitata (Diptera: Tephritidae), via Air Passenger Traffic Arriving in Florida and California.

    Science.gov (United States)

    Szyniszewska, A M; Leppla, N C; Huang, Z; Tatem, A J

    2016-09-04

    The Mediterranean fruit fly, Ceratitis capitata (Wiedemann), is one of the most economically damaging pests in the world and has repeatedly invaded two major agricultural states in the United States, Florida and California, each time requiring costly eradication. The Mediterranean fruit fly gains entry primarily in infested fruit carried by airline passengers and, since Florida and California each receive about 13 million international passengers annually, the risk of Mediterranean fruit fly entering the United States is potentially very high. The risk of passengers bringing the pest into Florida or California from Mediterranean fruit fly-infested countries was determined with two novel models, one estimated seasonal variation in airline passenger number and the other defined the seasonal and spatial variability in Mediterranean fruit fly abundance. These models elucidated relationships among the risk factors for Mediterranean fruit fly introduction, such as amount of passenger traffic, routes traveled, season of travel, abundance of Mediterranean fruit fly in countries where flights departed, and risk of the pest arriving at destination airports. The risk of Mediterranean fruit fly being introduced into Florida was greatest from Colombia, Brazil, Panama, Venezuela, Argentina, and Ecuador during January-August, whereas primarily the risk to California was from Brazil, Panama, Colombia, and Italy in May-August. About three times more Mediterranean fruit flies were intercepted in passenger baggage at airports in Florida than California, although the data were compromised by a lack of systematic sampling and other limitations. Nevertheless, this study achieved the goal of analyzing available data on seasonal passenger flow and Mediterranean fruit fly population levels to determine when surveillance should be intensified at key airports in Florida and California.

  5. Treatment post harvest of Citrus sinensis infested with Ceratitis capitata (Wied., 1824) (Diptera: Tephritidae) using gamma radiation

    Energy Technology Data Exchange (ETDEWEB)

    Albergaria, Nuno M.M. Soares de; Bortoli, Sergio A. de, E-mail: nmendes@terra.com.b, E-mail: bortoli@fcav.unesp.b [UNESP, Jaboticabal, SP (Brazil). Faculdade de Ciencias Agrarias e Veterinarias. Depto. de Fitossanidade; Doria, Hayda O.S., E-mail: hosd75@terra.com.b [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Medicina. Dept. de Biologia; Arthur, Valter, E-mail: varthur@cena.usp.b [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil). Lab. de Radiobiologia e Ambiente

    2009-07-01

    This work was carried out to evaluate the effect of irradiation on fruit fly (Ceratitis capitata) eggs and larvae (first, second, third instars), in 'Valencia' oranges; and evaluate the effect of the irradiation on the chemical composition of the fruits. Fruits were artificially infested with the immature stages of the fruit fly and treated with 0, 10, 20, 30, 40, 50, 100, 150 and 200 Gy Cobalt-60 doses. By the results obtained it is possible to conclude that: third instar larvae are more tolerant to irradiation treatments; the dose of 50 Gy causes sterility to the adults emerged from all immature stages irradiated. (author)

  6. Intensity of Attack Caused by Mediterranean Fruit Fly Ceratitis capitata Wiedem. (Diptera, Tephritidae on Mandarin along the Montenegrin Seacoast

    Directory of Open Access Journals (Sweden)

    Sanja Radonjić

    2011-01-01

    Full Text Available Along the Montenegrin seacoast, all cultivated citrus species (mandarin, orange, lemon,grapefruit, fig, loquat and ziziphus were detected as host plants of the Ceratitis capitata Wiedem.Among those found, in economic sense, the most important host plant is mandarinUnšiu.Intensity of the attack were monitored on mandarin in 2003 and 2004 in localities Baošići,Lastva Grbaljska and Bar, and was determined as higher in 2003. The first symptoms ofattack were detected, depending on locality, from middle of September until beginning ofOctober, one to two months earlier then in 2004. The maximum number of larvae per fruitwere detected in October and November (average from 13.44±0.16 to 22.82±0.13. Timeof the first symptoms appearence on mandarin in September and October 2003 and in November2004, indicate on crucial importance of alternative host plants (figs and loquat forreproduction and increasing of C. capitata population, because later during a season its intensityof attack on mandarin, depend largely on their presence.

  7. Evaluación de colores para la oviposición de Ceratitis capitata (Diptera, Tephritidae en Argentina

    Directory of Open Access Journals (Sweden)

    Lorena Suárez

    2013-04-01

    Full Text Available Ceratitis capitata es una de las principales plagas de la fruticultura mundial y en Argentina es la Mosca de los Frutos de mayor abundancia y distribución. El desarrollo de una trampa artificial de oviposición, puede ser una herramienta útil de monitoreo para hembras grávidas. El objetivo de este trabajo fue evaluar la capacidad atrayente para la oviposición de C. capitata sobre esferas de agar de color amarillo, rojo, verde, negro y sin color; en condiciones de laboratorio. Se observaron diferencias estadísticamente significativas, siendo las esferas rojas y negras las más atractivas sobre las verdes, amarillas y sin color. En laboratorio, la mayor atracción alcanzada por el rojo y negro sustentaría la hipótesis de que el fuerte contraste respecto al fondo incrementaría la atracción de los colores más oscuros.

  8. Producción masiva y simultánea de machos de Ceratitis capitata (Diptera: Tephritidae y parasitoides Dichasmimorpha longicaudata (Hymenoptera: Braconidae Massive and simultaneous production of Ceratitis capitata (Diptera: Tephritidae males and Diachasmimorpha longicaudata (Hymenoptera: Braconidae parasitoids

    Directory of Open Access Journals (Sweden)

    Silvia N. López

    2006-12-01

    Full Text Available En la línea de sexado genético «Cast191» las hembras de Ceratitis capitata son homocigotas para el gen slow , lo que reduce su velocidad de desarrollo; los machos son heterocigotas y muestran una velocidad de desarrollo normal. Esta característica permitió producir, con Cast191, machos estériles por un lado, y parasitoides criados sobre las larvas remanentes por el otro. Nuestro objetivo con este trabajo fue producir ambos insumos simultáneamente y a una escala mayor que hasta ahora. Además, bajo estas condiciones, y en un intento por aumentar la separación entre sexos, se aplicó a las larvas del primer estadío un pulso de 15º C, durante 1 ó 2 días, luego del cual se las mantuvo a 20º C ó 25º C, hasta que entraron al estado de pupa, luego se mantuvo todo el material a 25º C. La mejor separación de sexos, lograda con el tratamiento a 20º C sin pulso de frío, se usó para comparar la calidad del parasitoide Diachasmimorpha longicaudata, criado sobre las larvas obtenidas tras la separación de los machos, con aquellos criados sobre la línea salvaje. Para ello, este tratamiento de separación fue aplicado en la cría de la mosca, y el material remanente de dieta con larvas fue expuesto al parasitoide. La tasa de parasitismo obtenida fue semejante a la hallada sobre la línea salvaje, y la tasa sexual de la F 1 del parasitoide presentó un sesgo hacia las hembras aún mayor. Se discute la factibilidad de utilizar la línea Cast191 de C. Capitata, para la producción a mayor escala de machos de mosca y para la cría masiva del parasitoide D. longicaudata.In the genetic sexing strain «Cast191», the females of Ceratitis capitata are homozygous for the mutation slow , slowing down their rate of development, and the males are heterozygous, having a normal rate of development. This feature made Cast191 capable of producing sterile males, on one hand, and parasitoids that are reared on the remaining larvae, on the other. The

  9. Quarantine treatment to Ceratitis capitata (Wied., 1824) (Diptera: Tephritidae) in orange fruits (Citrus sinensis).; Tratamento quarentenario para Ceratitis capitata (Wied., 1824) (Diptera: Tephritidae) em frutos de laranja (Citrus sinensis)

    Energy Technology Data Exchange (ETDEWEB)

    Albergaria, Nuno Miguel Mendes Soares de

    2005-07-01

    This work was carried out to evaluate the effect of thermal treatments (vapour heat and hot water) and irradiation on Ceratitis capitata eggs and larvae (first, second and third instars), in 'Valencia' oranges; the relation between temperature and exposition time to vapour heat and hot water on fruit fly immature; the relation among the different doses of radiation on fruit fly immature and evaluate the effect of the treatments (thermal treatments and irradiation) on the chemical composition of the fruits. It was evaluated the heat absorption and loose of heat by the fruit. For thermal treatments it was used temperatures of 44 and 46 deg C for 15,30,60, 90 and 120 minutes and a control. For irradiation were used the doses: 10,20, 30, 40, 50, 100, 150 and 200 Gy. By the results obtained it is possible to conclude that: to the control of eggs and larvae (first, second and third instars) the treatment with vapour heat was less efficient than the hot water treatment; the thermal treatments of C. capitata eggs and larvae (first and second and third instars) can be recommended with vapor heat at 46 deg C at 152.2 minutes or with hot water at 46 deg C at 84.8 minutes, achieving the quarantine request; third instar larvae are more tolerant to the thermal and irradiation treatments; the treatment with irradiation can be recommended for quarantine treatment of ali immature stages evaluated with the dose of 72.88 Gy; the dose of 50 Gy causes sterility to the adults emerged from ali immature stages irradiated; treatments do not cause any change in the chemical proprieties in the orange fruits var. 'Valencia'. (author)

  10. Area-wide suppression of the Mediterranean fruit fly, Ceratitis capitata, and the Oriental fruit fly, Bactrocera dorsalis, in Kamuela, Hawaii.

    Science.gov (United States)

    Vargas, Roger I; Piñero, Jaime C; Mau, Ronald F L; Jang, Eric B; Klungness, Lester M; McInnis, Donald O; Harris, Ernest B; McQuate, Grant T; Bautista, Renato C; Wong, Lyle

    2010-01-01

    The United States Department of Agriculture's Agricultural Research Service initiated an area-wide fruit fly management program in Hawaii in 2000. The first demonstration site was established in Kamuela, Hawaii, USA. This paper documents suppression of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), and the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), in a 40 km2 area containing urban, rural and agricultural zones during a 6 year period. The suppression techniques included sanitation, GF-120 NF Naturalyte Fruit Fly Bait sprays, male annihilation, Biolure traps, and parasitoids against C. capitata and B. dorsalis. In addition, small numbers of sterile males were released against B. dorsalis. Substantial reductions in fruit infestation levels were achieved for both species (90.7 and 60.7% for C. capitata and B. dorsalis, respectively) throughout the treatment period. Fruit fly captures in the 40 km2 treatment area were significantly lower during the 6 year period than those recorded in three non-treated areas. The strategy of combining suppression techniques in an area-wide approach is discussed.

  11. Insecticidal effects of various concentrations of selected extractions of Cestrum parqui on adult and immature Ceratitis capitata.

    Science.gov (United States)

    Zapata, Nelson; Budia, Flor; Viñuela, Elisa; Medina, Pilar

    2006-04-01

    Aqueous extracts of Cestrum parqui L'Héritier (Solanaceae) were evaluated at different concentrations in several stages of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae). For adults, the study was extended to extracts obtained with several solvents of an increasing degree of polarity. Aqueous extracts from C. parqui showed a high toxicity to neonate larvae when ingested through diet, inhibiting pupation at a concentration above 0.6%. Lower concentrations delayed the larval development and reduced the percentages of pupae formed and adult emergence. An LC50 = 0.9% after 3 d of continuous ingestion of C. parqui aqueous extracts could be calculated, whereas extracts obtained with organic compounds were nearly innocuous except with the use of the solvent methanol/water (80:20), the more polar of those tested, that killed 12.5% of adults. Aqueous extracts were also harmful to adults by diminishing the reproductive potential, which implies a significant effect on the offspring. Egg contact with insecticide or dipping third instars did not cause any adverse effect, supporting the hypothesis that only by means of ingestion can the toxic compounds of C. parqui reach the target. Our results showed that C. parqui components causing C. capitata mortality are mostly dissolved in water and not in organic solvents, which point out their polar character.

  12. Field trials of solid triple lure (trimedlure, methyl eugenol, raspberry ketone, and DDVP) dispensers for detection and male annihilation of Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae (Diptera: Tephritidae) in Hawaii.

    Science.gov (United States)

    Vargas, Roger I; Souder, Steven K; Mackey, Bruce; Cook, Peter; Morse, Joseph G; Stark, John D

    2012-10-01

    Solid Mallet TMR (trimedlure [TML], methyl eugenol [ME], raspberry ketone [RK]) wafers and Mallet CMR (ceralure, ME, RK, benzyl acetate) wafers impregnated with DDVP (2,2-dichlorovinyl dimethyl phosphate) insecticide were measured in traps as potential detection and male annihilation technique (MAT) devices. Comparisons were made with 1) liquid lure and insecticide formulations, 2) solid cones and plugs with an insecticidal strip, and 3) solid single and double lure wafers with DDVP for captures of Mediterranean fruit fly, Ceratitis capitata (Wiedemann); oriental fruit fly, Bactrocera dorsalis Hendel; and melon fly, B. cucurbitae Coquillett. Bucket and Jackson traps were tested in a coffee plantation near Eleele, Kauai Island, HI (trials at high populations) and avocado orchards near Kona, HI Island, HI (trials at low populations). Captures of all three species with Mallet TMR were not different from Mallet CMR; therefore, subsequent experiments did not include Mallet CMR because of higher production costs. In MAT trials near Eleele, HI captures in AWPM traps with Mallet TMR wafers were equal to any other solid lure (single or double) except the Mallet ME wafer. In survey trials near Kona, captures of C. capitata, B. cucurbitae, and B. dorsalis with Mallet TMR wafers were equal to those for the standard TML, ME, and C-L traps used in FL and CA. A solid Mallet TMR wafer is safer, more convenient to handle, and may be used in place of several individual lure and trap systems, potentially reducing costs of large survey and detection programs in Florida and California, and MAT programs in Hawaii.

  13. Temperature-dependent development and survival of Brazilian populations of the Mediterranean fruit fly, Ceratitis capitata, from tropical, subtropical and temperate regions.

    Science.gov (United States)

    Ricalde, Marcelo P; Nava, Dori E; Loeck, Alci E; Donatti, Michele G

    2012-01-01

    The Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is one of the principal exotic pests affecting Brazilian production in the northeastern and southeastern regions of Brazil. In the south, it is has potential as a serious threat to temperate-climate fruit farms, since it is already found in urban and suburban communities in this region. We studied the biological characteristics of C. capitata populations from Pelotas-RS (temperate climate), Petrolina-PE (tropical), and Campinas-SP (subtropical). Ceratitis capitata biology was studied under controlled temperature (15, 20, 25, 30, and 35 ± 1 °C), 70 ± 10% RH, and 14:10 L:D photoperiod. The duration and survival rate of the egg, larval, and pupal stages were evaluated and the thermal requirements of these three populations were determined. The duration and survival of these developmental stages varied with temperature, with similar values for the three populations, except for some variation in the egg phase. Egg to adult developmental time for all three populations was inversely proportional to temperature; from 15 to 30 °C developmental time varied from 71.2 to 17.1, 70.2 to 17.1, and 68.5 to 16.9 days, respectively. Survival during development was affected at 15 to 30 °C, and differed significantly from survival at 20 to 25 °C. At 35 °C, immature stages did not develop. The basal temperature and degree-day requirement were similar for all immature stages except for the egg stage. The basal temperatures and thermal constants were 9.30 and 350, 8.47 and 341, and 9.60 °C and 328 degree-days for the Pelotas, Petrolina, and Campinas populations, respectively. Results suggested that survival and thermal requirements are similar for these tropical, subtropical, and temperate populations of C. capitata, and demonstrate the species' capacity to adapt to different climate conditions.

  14. Beckwith-Wiedemann syndrome

    Science.gov (United States)

    ... Wiedemann syndrome References Jones KL, Jones M, Del Campo M, eds. Smith's Recognizable Patterns of Human Malformation . ... Ogilvie, PhD, and the A.D.A.M. Editorial team. Related MedlinePlus Health Topics Growth Disorders Browse ...

  15. Insecticidal activity of a Moroccan strain of Streptomyces phaeochromogenes LD-37 on larvae, pupae and adults of the Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Samri, S E; Baz, M; Ghalbane, I; El Messoussi, S; Zitouni, A; El Meziane, A; Barakate, M

    2017-04-01

    The Mediterranean fruit fly (medfly), Ceratitis capitata, is considered the most important fruit pest worldwide. Its management is mainly based on the use of chemical insecticides. Although these conventional pesticides are effective at high doses, they cause considerable human health and environment problems. Thus, the aim of this study was to assess insecticidal activity of Moroccan actinobacteria against C. capitata. A total of 12 preselected actinobacteria isolated from various Moroccan habitats were screened for their insecticidal activity against larvae, pupae and adults of C. capitata. Four actinobacteria isolates were significantly active against the first-instar larvae, and nine were active against the medfly adult, while no significant mortality was obtained against the third-instar larval and pupal stages. Among the selected isolates, the biological screening revealed that strain Streptomyces LD-37, which showed 99.4% similarity with Streptomyces phaeochromogenes, exhibited the maximal corrected larval mortality of 98%. Moreover, the isolates AS1 and LD-37 showed the maximum significant corrected mortality against adults of 32.5 and 28.2%, respectively. The crude extract obtained from a fermented culture of strain S. phaeochromogenes LD-37 was separated into six fractions by thin layer chromatography. Fractions F3 and F4 caused a significant corrected larval mortality of 66.7 and 53.3%, respectively; whereas the maximum reduction in adult emergence was obtained with fraction F4. This finding could be useful for utilizing S. phaeochromogenes LD-37 as an alternative to chemical insecticides in pest management of C. capitata.

  16. Delivery of Nucleic Acids through Embryo Microinjection in the Worldwide Agricultural Pest Insect, Ceratitis capitata.

    Science.gov (United States)

    Gabrieli, Paolo; Scolari, Francesca

    2016-10-01

    The Mediterranean fruit fly (medfly) Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is a pest species with extremely high agricultural relevance. This is due to its reproductive behavior: females damage the external surface of fruits and vegetables when they lay eggs and the hatched larvae feed on their pulp. Wild C. capitata populations are traditionally controlled through insecticide spraying and/or eco-friendly approaches, the most successful being the Sterile Insect Technique (SIT). The SIT relies on mass-rearing, radiation-based sterilization and field release of males that retain their capacity to mate but are not able to generate fertile progeny. The advent and the subsequent rapid development of biotechnological tools, together with the availability of the medfly genome sequence, has greatly boosted our understanding of the biology of this species. This favored the proliferation of new strategies for genome manipulation, which can be applied to population control. In this context, embryo microinjection plays a dual role in expanding the toolbox for medfly control. The ability to interfere with the function of genes that regulate key biological processes, indeed, expands our understanding of the molecular machinery underlying medfly invasiveness. Furthermore, the ability to achieve germ-line transformation facilitates the production of multiple transgenic strains that can be tested for future field applications in novel SIT settings. Indeed, genetic manipulation can be used to confer desirable traits that can, for example, be used to monitor sterile male performance in the field, or that can result in early life-stage lethality. Here we describe a method to microinject nucleic acids into medfly embryos to achieve these two main goals.

  17. Chemosterilant bait stations coupled with sterile insect technique: an integrated strategy to control the Mediterranean fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Navarro-Llopis, V; Vacas, S; Sanchis, J; Primo, J; Alfaro, C

    2011-10-01

    During 2008 and 2009, the efficacy of the combination of two Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), control techniques, sterile insect technique (SIT) and a chemosterilant bait station system (Adress), was tested in three crops: citrus (Citrus spp.), stone fruit (Prunus spp.), and persimmon (Diospyros spp.). Two thousand sterile males were released per ha each week in the whole trial area (50,000 ha, SIT area). For 3,600 ha, within the whole trial area, 24 Adress traps per ha were hung (SIT + Adress area). Ten SIT + Adress plots and 10 SIT plots in each of three different fruit crops were arranged to assess Mediterranean fruit fly population densities and fruit damage throughout the trial period. To evaluate the efficacy of each treatment, the male and female populations were each monitored from August 2008 to November 2009, and injured fruit was assessed before harvest. Results showed a significant reduction in the C. capitata population in plots treated with both techniques versus plots treated only with the SIT. Likewise, a corresponding reduction in the percentage of injured fruit was observed. These data indicate the compatibility of these techniques and suggest the possibility of using Adress coupled with SIT to reduce C. capitata populations in locations with high population densities, where SIT alone is not sufficiently effective to suppress fruit fly populations to below damaging levels.

  18. Infectivity of Four Entomopathogenic Nematodes in Relation to Environmental Factors and Their Effects on the Biochemistry of the Medfly Ceratitis capitata (Wied.) (Diptera: Tephritidae).

    Science.gov (United States)

    Shaurub, E H; Soliman, N A; Hashem, A G; Abdel-Rahman, A M

    2015-12-01

    Late third instars of the medfly, Ceratitis capitata (Wied.), migrate from the host fruit into the soil and leaf litter beneath host trees, where they may become a target for entomopathogenic nematodes (EPNs). The effects of ultraviolet (UV) light, temperature, soil type (texture), and soil moisture level on infectivity of the four tested EPNs Heterorhabditis bacteriophora AS1, H. bacteriophora HP88, Steinernema carpocapsae ALL, and Steinernema riobrave ML29 to late third instars of C. capitata were evaluated. Biochemical alterations induced by the most virulent nematodes were quantified. The nematode infectivity decreased with increase in exposure time to UV light, whereas it increased with increase in temperature. Infectivity increased in sandy soil, whereas it decreased in silt and clay soils. Soils with high moisture levels decreased infectivity. Based on the 50% lethal concentration (LC50), H. bacteriophora AS1 and S. carpocapsae ALL were the most virulent heterorhabditid and steinernematid nematodes, respectively, with the highest virulence for H. bacteriophora AS1. The nematodes caused significant decline in total protein and cholesterol content of larvae and caused reduced activity of transaminases and phosphatases. In contrast, they significantly enhanced total glucose content. It can be concluded that the most optimum environmental conditions of the tested nematodes to elicit their infectivity against late third instars of C. capitata were sandy soil with 10% moisture level, ambient temperature of 25°C, and no exposure to UV. The EPNs tested can affect late third instars of C. capitata by targeting different biochemical molecules in different metabolic pathways. The interaction between them and the host larvae appears to be primarily nutritional.

  19. Efectos de la edad de la generación parental en la biología reproductiva de Ceratitis capitata Wied. (Diptera: Trypetidae)

    OpenAIRE

    Andrés, Mª.P.; Muñiz, Mariano

    1993-01-01

    Se ha realizado un estudio con parejas aisladas de Ceratitis capitata Wied. para determinar la influencia de la edad de los padres, tanto en la calidad de las pupas, fecundidad, fertilidad y longevidad de los adultos de la primera generación filial, como en el desarrollo larvario, actividad reproductora y eficacia biológica de los descendientes originados por adultos de edad avanzada en cuatro generaciones sucesivas. De los resultados obtenidos se deduce que la edad de los prog...

  20. Identification of pheromone components and their binding affinity to the odorant binding protein CcapOBP83a-2 of the Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Siciliano, P; He, X L; Woodcock, C; Pickett, J A; Field, L M; Birkett, M A; Kalinova, B; Gomulski, L M; Scolari, F; Gasperi, G; Malacrida, A R; Zhou, J J

    2014-05-01

    The Mediterranean fruit fly (or medfly), Ceratitis capitata (Wiedemann; Diptera: Tephritidae), is a serious pest of agriculture worldwide, displaying a very wide larval host range with more than 250 different species of fruit and vegetables. Olfaction plays a key role in the invasive potential of this species. Unfortunately, the pheromone communication system of the medfly is complex and still not well established. In this study, we report the isolation of chemicals emitted by sexually mature individuals during the "calling" period and the electrophysiological responses that these compounds elicit on the antennae of male and female flies. Fifteen compounds with electrophysiological activity were isolated and identified in male emissions by gas chromatography coupled to electroantennography (GC-EAG). Within the group of 15 identified compounds, 11 elicited a response in antennae of both sexes, whilst 4 elicited a response only in female antennae. The binding affinity of these compounds, plus 4 additional compounds known to be behaviourally active from other studies, was measured using C. capitata OBP, CcapOBP83a-2. This OBP has a high homology to Drosophila melanogaster OBPs OS-E and OS-F, which are associated with trichoid sensilla and co-expressed with the well-studied Drosophila pheromone binding protein LUSH. The results provide evidence of involvement of CcapOBP83a-2 in the medfly's odorant perception and its wider specificity for (E,E)-α-farnesene, one of the five major compounds in medfly male pheromone emission. This represents the first step in the clarification of the C. capitata and pheromone reception pathway, and a starting point for further studies aimed towards the creation of new powerful attractants or repellents applicable in the actual control strategies.

  1. Associação entre larvas de Chrysomya megacephala (Fabricius e Chrysomya albiceps (Wiedemann, Chrysomya megacephala (Fabricius e Cochliomyia macellaria (Fabricius (Calliphoridae, Diptera sob condições de laboratório Association between Chrysomya megacephala (Fabricius and Chrysomya albiceps (Wiedemann, Chrysomya megacephala (Fabricius and Cochliomyia macellaria (Fabricius larvae (Calliphoridae, Diptera, under laboratory conditions

    Directory of Open Access Journals (Sweden)

    Valéria Magalhães Aguiar-Coelho

    1995-01-01

    Full Text Available This paper intends to recognize some aspects of interspecific relationships between Chrysomya megacephala (Fabricius and C. albiceps (Wiedemann and between C. megacephala and Cochliomyia macellaria (Fabricius larvae in laboratory. A diet consisting of decomposing horse flesh was used, and the relation of 1 larva/g diet was established. The development of the two species was done in pure and associated cultures. The association with Chrysomya albiceps influenced the post-embrionary development period and the weight of mature larvae of the C. megacephala, reducing their. Such weight decrease, along with the predation of larvae of C. megacephala larvae, yelded a decrease in survival in all of the stages. Larvae of this species showed an increase in its weight when associated with Cochliomyia macellaria. The native species responded to the association by reducing its body weigth and its viability. This association doesnt influence the duration of post-embrionary development.

  2. Ammonium acetate enhances the attractiveness of a variety of protein-based baits to female Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Ammonia and its derivatives are used largely by female fruit 32 flies (Diptera: Tephritidae) as volatile cues to locate protein-rich food needed to produce their eggs. This need for external protein sources has led to the development of behaviorally-based control strategies such a food-based lures a...

  3. Quarantine cold treatments for Ceratitis capitata and Anastrepha fraterculus (Diptera: Tephritidae) for citrus in Argentina: conclusions after 10 years of research

    Energy Technology Data Exchange (ETDEWEB)

    Willink, Eduardo; Gastaminza, Gerardo; Salvatore, Analia; Gramajo, M. Cecilia; Acenolaza, Mariana; Avila, Rosana; Favre, Paola, E-mail: ewillink@eeaoc.org.a [Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman (Argentina)

    2006-07-01

    Argentina has quarantine restrictions in some markets due to the presence of two quarantine fruit fly pests: Ceratitis capitata and Anastrepha fraterculus. One alternative is the use of cold quarantine treatments during transport of the commodities. Since 1996, the Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman, Argentina, has developed different cold quarantine treatments for citrus. In the present work we present all the data the EEAOC generated in the last ten years in order to facilitate the development of such cold treatments. Fruit flies were obtained from the colonies reared at EEAOC. Four citrus species were analyzed: lemon, grapefruit, orange and tangerines. Different varieties were analyzed for each fruit species. Sensitivity trials aiming at determine the most tolerant stage as well as to asses if there is any influence of varieties on cold tolerance were performed. Finally we compared the tolerance to cold between the two species. Sensitivity trials showed that mature larvae (L3) are the most tolerant stage for both fruit fly species. There was no effect of the varieties and the two fruit fly species were equally sensible to cold. Our results provide strong evidence in favor of concluding that any cold treatment developed for C. capitata is effective for A. fraterculus. (author)

  4. ANÁLISE FAUNÍSTICA E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM BELMONTE, BAHIA

    Directory of Open Access Journals (Sweden)

    MÍRIAN DA SILVA SANTOS

    2011-01-01

    Full Text Available This study was carried out in a mixed orchard in the municipality of Belmonte, in the southernmost region of Bahia and it aimed at characterizing the fruit fly (Diptera: Tephritidae population using faunistic analysis and studying its population fluctuation. The study was conducted from August 2007 to August 2009. Fruit fly captures were carried out using McPhail traps baited with protein hydrolisate at 5%. Weekly, the captured insects found in traps were transferred to plastic vials, one vial per trap, filled with 70% ethanol and taken to the laboratory for identification. A total of 9,709 fruit flies was captured, out of which 9,477 specimens were Anastrepha (5,908 females and 3,569 males and 232 specimens were Ceratitis capitata (Wiedemann (201 females and 31 males. Nine species of Anastrepha were recorded: Anastrepha bahiensis (Lima (2.59%, Anastrepha distincta (Greene (2.71%, Anastrepha fraterculus (Wiedemann (59.37%, Anastrepha leptozona (Hendel (0.02%, Anastrepha manihoti (Lima (0.02%, Anastrepha obliqua (Macquart (2.98%, Anastrepha serpentina (Wiedemann (0.07%, Anastrepha sororcula Zucchi (29.14%, Anastrepha zenildae Zucchi (0.22%, and C. capitata (2.88%. Anastrepha fraterculus and A. sororcula were the dominant species and only A. fraterculus was constant on the orchard. The values of the Simpson (0.51 and of Shannon (01.35 indices were intermediate and the modified Hill index was 0.49, indicating a medium diversity. The high est capturevalues of Anastrepha spp. occurred from July to December 2008, with a population peak in September.

  5. New record of Pterotaenia fasciata (Wiedemann (Diptera, Ulidiidae in Brazil, a probably mechanical vector of enteric bacteria Novo registro de Pterotaenia fasciata (Wiedemann (Diptera, Ulidiidae no Brasil, um provável vetor mecânico de enterobactérias

    Directory of Open Access Journals (Sweden)

    Anderson Sena Barnabe

    2007-03-01

    Full Text Available Pterotaenia fasciata is commonly recorded in rural areas in Argentina, but during a Diptera survey study developed in a reservoir which retains storm water from polluted canals in an urban area of Taboão da Serra municipality, SP, Brazil, we could capture P. fasciata adults. Enteric bacteria Escherichia coli T. Escherich, 1885 and Proteus sp. were isolated from P. fasciata collected in traps inside the reservoir and around it. Fecal coliforms and E. coli were found in the water of the reservoir. These records suggest that a high abundance of this species at urban areas with inadequate sewage canals should reveal these muscoid dipterans as mechanical vectors of enteric bacteria.Pterotaenia fasciata é encontrada freqüentemente em áreas rurais na Argentina, mas durante um estudo de levantamento de Diptera em um reservatório de retenção de enchentes em uma área urbana do município de Taboão da Serra, SP, Brasil, foram capturados adultos de P. fasciata. As enterobactérias Escherichia coli T. Escherich, 1885 e Proteus sp. foram isoladas de P. fasciata coletada em armadilhas no reservatório e em seu entorno. Coliformes fecais e E. coli foram encontrados na água do reservatório. Esses registros sugerem que a alta abundância dessa espécie em áreas urbanas sem saneamento básico poderia indicar esses dípteros muscóides como vetores mecânicos de enterobactérias.

  6. Producción masiva y simultánea de machos de Ceratitis capitata (Diptera: Tephritidae y parasitoides Dichasmimorpha longicaudata (Hymenoptera: Braconidae

    Directory of Open Access Journals (Sweden)

    Silvia N. LÓPEZ

    2006-01-01

    Full Text Available En la línea de sexado genético «Cast191» las hembras de Ceratitis capitata son homocigotas para el gen slow , lo que reduce su velocidad de desarrollo; los machos son heterocigotas y muestran una velocidad de desarrollo normal. Esta característica permitió producir, con Cast191, machos estériles por un lado, y parasitoides criados sobre las larvas remanentes por el otro. Nuestro objetivo con este trabajo fue producir ambos insumos simultáneamente y a una escala mayor que hasta ahora. Además, bajo estas condiciones, y en un intento por aumentar la separación entre sexos, se aplicó a las larvas del primer estadío un pulso de 15º C, durante 1 ó 2 días, luego del cual se las mantuvo a 20º C ó 25º C, hasta que entraron al estado de pupa, luego se mantuvo todo el material a 25º C. La mejor separación de sexos, lograda con el tratamiento a 20º C sin pulso de frío, se usó para comparar la calidad del parasitoide Diachasmimorpha longicaudata, criado sobre las larvas obtenidas tras la separación de los machos, con aquellos criados sobre la línea salvaje. Para ello, este tratamiento de separación fue aplicado en la cría de la mosca, y el material remanente de dieta con larvas fue expuesto al parasitoide. La tasa de parasitismo obtenida fue semejante a la hallada sobre la línea salvaje, y la tasa sexual de la F1 del parasitoide presentó un sesgo hacia las hembras aún mayor. Se discute la factibilidad de utilizar la línea Cast191 de C. Capitata, para la producción a mayor escala de machos de mosca y para la cría masiva del parasitoide D. longicaudata.

  7. Wiedemann: color y exilio

    Directory of Open Access Journals (Sweden)

    Juan Gustavo Cobo Borda

    1995-01-01

    Full Text Available El exiliado mantiene viva, en la retina de la memoria, los colores de su inicial contacto con el mundo. Al nacer en Munich en 1905 e interesarse por las artes plásticas, las primeras visiones de Guillermo Wiedemann bien pudieran fijarse en los caballos azules de Franz Marc o en las remotas tierras vírgenes de ese adánico primitivismo con que los expresionistas alemanes de la nueva sensibilidad huían hacia la naturaleza, trátese del bosque verde o las cumbres recubiertas de nieve. La choza africana o lo~ archipiélagos del Pacífico donde los tótems de Gauguin todavía arden, con sensualidad ancestral, en la penumbra salvaje.

  8. Tratamento hidrotérmico na mortalidade de larvas de Ceratitis capitata (Weidmann, 1824 (Diptera: Tephritidae em tangerina (Citrus reticulata Blanco = Effect of hydrothermal treatment on the mortality of fruit fly (Ceratitis capitata Weidmann, 1824 (Diptera: Tephritidae larvae in tangerine fruit (Citrus reticulata Blanco

    Directory of Open Access Journals (Sweden)

    Edson Batista Lopes

    2008-12-01

    Full Text Available O objetivo dessa pesquisa foi avaliar a eficiência do tratamento hidrotérmico no controle de larvas de C. capitata em frutos de tangerina para fins quarentenários. Tangerinas da variedade ‘Dancy’ infestadas por larvas de Ceratitis capitata foram submetidas aostratamentos hidrotérmicos de 46±1°C e 50±1°C, em diferentes tempos de exposição. Para a temperatura de 46±1°C foram utilizados nove períodos de exposição: 0, 5, 10, 15, 20, 25, 30, 35 e 40 min. Na temperatura de 50±1°C, utilizaram-se sete tempos de exposição: 0, 5,10, 15, 20, 25 e 30 min., sendo o tempo (0 infestado e sem tratamento para as duas temperaturas. Cada tratamento foi composto de cinco repetições com dois frutos. Frutos maduros e semi-maduros infestados foram imersos em água quente, visando quantificar ototal de larvas vivas e mortas, sendo que, um grupo de frutos foi mantido sem imersão como controle. Os índices quarentenários, na temperatura de 46±1°C foram atingidos aos 32,0 e 35,3 min. para frutos maduros e semi-maduros, respectivamente. Na temperatura de50±1°C, os índices quarentenários foram atingidos aos 20,8 e 21,7 minutos para os frutos maduros e semi-maduros, respectivamente. A mortalidade das larvas de C. capitata foi crescente com o aumento da temperatura e o tempo de exposição.This research aimed to evaluate the efficiency of hydrothermaltreatment in the control of C. capitata larvae in tangerine fruit for quarantine safety. Tangerines fruits infested by larvae of Mediterranean fruit fly Ceratitis capitata were submitted to hydrothermal treatment at 46±1°C and 50±1°C for different exposure times. The fruits were selected in two maturity stages (ripe and semi-ripe and immersed in hot water. For temperature at 46±1°C, nine exposure times were used: 0, 5, 10, 15, 20, 25, 30, 35 and 40 minutes. The same procedure was used for temperature at 50±1°C, where the exposure times were: 0, 5, 10, 15, 20, 25 and 30 minutes. Infested

  9. Insecticidal Activity of Basil Oil, trans-Anethole, Estragole, and Linalool to Adults of Ceratitis capitata, Bactrocera dorsalis, and B. cucurbitae

    Science.gov (United States)

    Pest tephritid fruit flies, Ceratitis capitata (Wiedemann), Bactrocera dorsalis (Hendel), and B. cucurbitae (Cocquillett) are among the species of economic significance. Their management has primarily relied on the use of food baits, male attractants and their combinations with insecticides. Basil o...

  10. A comparative assessment of the response of three fruit fly species (Diptera: Tephritidae) to a spinosad-based bait: effect of ammonium acetate, female age, and protein hunger.

    Science.gov (United States)

    Piñero, J C; Mau, R F L; Vargas, R I

    2011-08-01

    Ammonia-releasing substances are known to play an important role in fruit fly (Diptera: Tephritidae) attraction to food sources, and this information has been exploited for the development of effective synthetic food-based lures and insecticidal baits. In field studies conducted in Hawaii, we examined the behavioural response of wild female oriental fruit fly (Bactrocera dorsalis (Hendel)), melon fly (B. cucurbitae (Coquillett)), and Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) to spinosad-based GF-120 NF Naturalyte Fruit Fly Bait(©) formulated to contain either 0, 1 or 2% ammonium acetate. Use of visually-attractive yellow bait stations for bait application in the field allowed for proper comparisons among bait formulations. Field cage tests were also conducted to investigate, using a comparative behavioural approach, the effects of female age and protein starvation on the subsequent response of F1 generation B. cucurbitae and B. dorsalis to the same three bait formulations that were evaluated in the field. Our field results indicate a significant positive effect of the presence, regardless of amount, of AA in GF-120 for B. dorsalis and B. cucurbitae. For C. capitata, there was a significant positive linear relationship between the relative amounts of AA in bait and female response. GF-120 with no AA was significantly more attractive to female C. capitata, but not to female B. dorsalis or B. cucurbitae, than the control treatment. Our field cage results indicate that the effects of varying amounts of AA present in GF-120 can be modulated by the physiological stage of the female flies and that the response of female B. cucurbitae to GF-120 was consistently greater than that of B. dorsalis over the various ages and levels of protein starvation regimes evaluated. Results are discussed in light of their applications for effective fruit fly suppression.

  11. Hidrogenionic potential (pH of the attractant, trap density and control threshold for Ceratitis capitata (DIPTERA: TEPHRITIDAE on Hamlin oranges in São Paulo central region, Brazil

    Directory of Open Access Journals (Sweden)

    Paulo Eduardo Branco Paiva

    2013-06-01

    Full Text Available This study evaluated the effect of initial pH values of 4.5, 6.5 and 8.5 of the attractant (protein bait Milhocina® and borax (sodium borate in the field, on the capture of fruit flies in McPhail traps, using 1, 2, 4 and 8 traps per hectare, in order to estimate control thresholds in a Hamlin orange grove in the central region of the state of São Paulo. The most abundant fruit fly species was Ceratitis capitata, comprising almost 99% of the fruit flies captured, of which 80% were females. The largest captures of C. capitata were found in traps baited with Milhocina® and borax at pH 8.5. Captures per trap for the four densities were similar, indicating that the population can be estimated with one trap per hectare in areas with high populations. It was found positive relationships between captures of C. capitata and the number of Hamlin oranges damaged, 2 and 3 weeks after capture. It was obtained equations that correlate captures and damage levels which can be used to estimate control thresholds. The average loss caused in Hamlin orange fruits by C. capitata was 2.5 tons per hectare or 7.5% of production.

  12. Puncture resistance in 'Sharwil' avocado to oriental fruit fly and Mediterranean fruit fly (Diptera: Tephritidae) oviposition.

    Science.gov (United States)

    Follett, Peter A

    2009-06-01

    The physiological basis for host antibiosis or nonpreference to a quarantine pest is often not understood. Studies are needed on the mechanisms that impart resistance to better understand how resistance might fail. Experiments were conducted to examine the infestability of 'Sharwil' avocados by oriental fruit fly, Bactrocera dorsalis (Hendel), and Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), after harvest and to quantify the effect of avocado skin hardness on resistance to infestation by oriental fruit fly. Infestation rate increased with decreasing fruit firmness, but fruit were generally poor hosts. Fruit with a patch of skin removed produced more flies than intact fruit, suggesting that skin puncture resistance was an important deterrent to oviposition. This study showed that fruit can be infested within 1 d after harvest, suggesting that fruit should be transferred to fruit fly-proof containers as they are harvested to minimize the risk of attack. Although risk of infestation is negatively correlated with fruit firmness, even some hard fruit may become infested. Therefore, fruit firmness cannot be used alone as an indicator to ensure fruit fly-free 'Sharwil' avocados. Measuring fruit firmness may be a useful component of a multiple component systems approach as an additional safeguard to reduce risk of infestation.

  13. Efficacy of wax matrix bait stations for Mediterranean Fruit Flies (Diptera: Tephritidae)

    Science.gov (United States)

    Tests were conducted that evaluated efficacy of wax matrix bait stations for Ceratitis capitata (Wiedemann) adults in Guatemala. Bait stations were exposed to outdoor conditions to determine effect of weathering on longevity as indicated by bait station age. Results of laboratory tests found that ba...

  14. Exposure to tea tree oil enhances the mating success of male Mediterranean fruit flies (Diptera: Tephritidae)

    Science.gov (United States)

    The aroma of various plant essential oils has been shown to enhance the mating competitiveness of males of the Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann). Laboratory observations revealed that male medflies show strong short-range attraction to tea tree oil (TTO hereafter) deri...

  15. Cold storage enhances the efficacy and margin of security in postharvest irradiation treatments against fruit flies (Diptera: Tephritidae).

    Science.gov (United States)

    Follett, Peter A; Snook, Kirsten

    2013-10-01

    Cold storage is used to preserve fruit quality after harvest during transportation in marketing channels. Low temperature can be a stressor for insects that reduces survivorship, and cold storage may contribute to the efficacy of postharvest quarantine treatments such as irradiation against quarantine insect pests. The combined effect of irradiation and cold storage was examined in a radiation-tolerant fruit fly, Bactrocera cucurbitae Coquillet (melon fly), and a radiation-intolerant fruit fly, Ceratitis capitata (Wiedemann) (Mediterranean fruit fly) (Diptera: Tephritidae). Third instars on diet or in papaya were treated with a sublethal radiation dose of 30 Gy and stored at 4 or 11 degrees C for 3-13 d and held for adult emergence. For both fruit fly species, survival of third instars to the adult stage generally decreased with increasing cold storage duration at 4 or 11 degrees C in diet or papaya. Survivorship differences were highly significant for the effects of substrate (diet > papaya), temperature (11 > 4 degrees C),and irradiation (0 > 30 Gy). Few Mediterranean fruit flies survived in any cold storage treatment after receiving a radiation dose of 30 Gy. No melon fly larvae survived to the adult stage after irradiation and 11 d cold storage at 4 or 11 degrees C in papayas. Cold storage enhances the efficacy and widens the margin of security in postharvest irradiation treatments. Potentially irradiation and cold storage can be used in combination to reduce the irradiation exposure requirements of quarantine treatments.

  16. Thermal death kinetics of Mediterranean, Malaysian, melon, and oriental fruit fly (Diptera: Tephritidae) eggs and third instars.

    Science.gov (United States)

    Armstrong, John W; Tang, Juming; Wang, Shaojin

    2009-04-01

    The late-aged egg and third-instar life stages of laboratory-reared Malaysian fruit fly, Bactrocera latifrons (Hendel); Mediterranean fruit fly, Ceratitis capitata (Wiedemann); melon fly, B. cucurbitae Coquillett; and oriental fruit fly, B. dorsalis (Hendel), (Diptera: Tephritidae); and the third instars of wild Mediterranean fruit fly were exposed to thermal treatments. A heating block system was used to determine the thermal death kinetics of the four fruit fly species. Treatments consisted of heating the fruit fly life stages to 44, 46, 48, and 50 degrees C and holding for different times ranging from 0 to 120 min depending on the thermal mortality response and time required to obtain 100% mortality for each species and life stage. The 0.5-order kinetic model had the best fit to the survival ratio for all the treatment temperatures and was used to predict lethal times. The thermal death time (TDT) curves showed a tolerance order of Mediterranean fruit fly eggs fruit fly third instar thermotolerance from Hawaii and Israel showed that Israel Mediterranean fruit fly was more thermotolerant. A comparison of minimum treatment times at a given temperature required to obtain 100% mortality of laboratory-reared Malaysian, Mediterranean (Hawaii and Israel strains), melon, Mexican, and oriental fruit fly eggs or third instars and wild Mediterranean fruit fly (Hawaii strain) eggs or third instars showed that oriental fruit fly was the most thermotolerant among the third instars, and the difference in heat tolerance between third instars and eggs was negligible at 50 degrees C.

  17. Update of host plant list of Anastrepha fraterculus and Ceratitis capitata in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Orono, Luis E.; Albornoz-Medina, Patricia; Nunez-Campero, Segundo; Nieuwenhove, Guido A. van; Bezdjian, Laura P.; Martin, Cristina B.; Schliserman, Pablo; Ovruski, Sergio M. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    The study displays a complete picture of the host range of the two economically important fruit fly species in Argentina, the native Anastrepha fraterculus (Wiedemann) (South American Fruit Fly) and the exotic Ceratitis capitata (Wiedemann) (Mediterranean Fruit Fly or Medfly). This work provides information on the fruit type of each plant species, associated tephritid species, habitat where the fruit was collected, geographical location of each fruit collection area (latitude, longitude, and altitude), phyto geographic regions where each area is located, as well as a general description of the landscape characteristics of those habitats where the fruit samples with fly larvae were collected. A complete, detailed bibliographic review was made in order to provide all the relevant information needed for host use in natural setting. (author)

  18. Genetics Home Reference: Beckwith-Wiedemann syndrome

    Science.gov (United States)

    ... of origin is marked during the formation of egg and sperm cells. Beckwith-Wiedemann syndrome is often associated with ... random events during the formation of reproductive cells (eggs and sperm) or in the earliest stages of development before ...

  19. Beckwith-Wiedemann syndrome: dental management.

    LENUS (Irish Health Repository)

    Garvey, M T

    1997-06-01

    Beckwith-Wiedemann syndrome (BWS) comprises multiple congenital anomalies with a risk of childhood tumours. Macroglossia is the most common manifestation. Two cases are presented to illustrate the importance of early referral and the role of preventive dentistry.

  20. Scanning electron microscopy of the male genitalia of Sarcophagidae (Diptera

    Directory of Open Access Journals (Sweden)

    Hugo de Souza Lopes

    1990-03-01

    Full Text Available The male genitalia of nine species of Sarcophagidae (Diptera - Goniophyto honsuensis Rohdendorf, 1962, Tricharaea brevicornis (Wiedemann, 1830, Chaetoravinia derelicta (Walker, 1852, Austrohartigia spinigena (Rondani, 1864, Chrysagria duodecimpunctata Townsend, 1935, Boettcheria bisetosa Parker, 1914, Lipoptilocnema lanei Townsend, 1934, L. crispina (Lopes, 1938 and Euboettcheria alvarengai Lopes & Tibana, 1982 - were examined by scanning electron microscope (SEM and the main morphological features are descirbed.

  1. Captures of bactrocera fruit flies (Diptera: Tephritidae) and nontarget insects in biolure and torula yeast traps in Hawaii

    Science.gov (United States)

    BioLure, a synthetic food attractant for Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) that uses a combination of three chemical components (ammonium acetate, trimethylamine hydrochloride and putrescine), was deployed in MultiLure traps in predominantly native forests, non-native forests,...

  2. Trap capture of three economically important fruit fly species (Diptera: Tephritidae): evaluation of a solid formulation containing multiple male lures in a Hawaiian coffee field.

    Science.gov (United States)

    Shelly, Todd; Nishimoto, Jon; Kurashima, Rick

    2012-08-01

    Invasive fruit flies (Diptera: Tephritidae) pose a global threat to agriculture through direct damage to food crops and the accompanying trade restrictions that often result. Early detection is vital to controlling fruit flies, because it increases the probability of limiting the growth and spread of the invasive population and thus may greatly reduce the monetary costs required for eradication or suppression. Male-specific lures are an important component of fruit fly detection, and three such lures are used widely: trimedlure (TML), cue lure (CL), and methyl eugenol (ME), attractive to Mediterranean fruit fly, Ceratitis capitata (Wiedemann); melon fly, Bactrocera cucurbitae (Coquillett); and oriental fruit fly, Bactrocera dorsalis (Hendel), respectively. In California, Florida, and Texas, the two Bactrocera lures are applied to separate species-specific traps as liquids (with a small amount of the insecticide naled added), whereas TML is delivered as a solid plug in another set of traps. Thus, the detection protocol involves considerable handling time as well as potential contact with a pesticide. The purpose of this study was to compare trap capture between liquid male lures and "trilure" wafers that contain TML, ME, raspberry ketone (RK, the hydroxy equivalent of CL), and the toxicant DDVP embedded within a solid matrix. Field studies were conducted in a Hawaiian coffee (Coffea arabica L.) field where the three aforementioned species co-occur, showed that the wafer captured at least as many flies as the liquid baits for all three species. This same result was obtained in comparisons using both fresh and aged (6-wk) baits. Moreover, the wafers performed as well as the single-lure traps in an ancillary experiment in which TML plugs were substituted for liquid TML. Additional experiments demonstrated explicitly that the presence of ME and RK had no effect on captures of C. capitata males and similarly that the presence of TML had no effect on the capture of B

  3. Soil application of Beauveria bassiana to control Ceratitis capitata in semi field conditions.

    Science.gov (United States)

    Ali, Ali; Sermann, Helga; Lerche, Sandra; Büttner, Carmen

    2009-01-01

    The Mediterranean fruit fly Ceratitis capitata (Wiedemann) is a highly polyphagous pest of economic importance cultures in Syria, as in many other parts of the world. The potential of the entomopathogenic fungus Beauveria bassiona BALS (VUIL.) strain 412 against adults of Mediterranean fruit fly C. capitata was evaluated in semi field conditions during the summer. Soil (5-7 cm high) was filled into plastic container (27 cm x 32 cm). In one container 75 pupae, two days before emergency, were spread uniformly on the soil. Then the pupae were covered with soil (4-5 cm layer). After that, 30 ml suspension of fungal spores (4 x 10(8) spores/ml) was applied to the soil surface using a dash bottle. This corresponded to a spore density of 1.3 x 10(7) spores/cm2 on soil. Water and food (1:4 yeast, sucrose) were placed in the cages for the emerged flies. The semi-field evaluation of B. bassiana revealed a fly mortality of about 46% compared to 16% in the control. In addition 72% of dead flies were moulded in the treatment. These results indicated that the entomopathogenic fungus B. bassiana was pathogen against the adults of C. capitata not only in the laboratory condition but also under field condition. That means B. bassiana could decrease the offspring of C. capitata. Therefore B. bassiana could be an effective factor to control C. capitata in combination with other control methods, used in IPM program in the field.

  4. PARASITOIDES (HYMENOPTERA DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE NO SEMIÁRIDO DO ESTADO DO CEARÁ, BRASIL

    Directory of Open Access Journals (Sweden)

    ELTON LUCIO ARAUJO

    2015-09-01

    Full Text Available RESUMO As moscas-das-frutas (Diptera: Tephritidae, Anastrepha spp. e Ceratitis capitata(Wiedemann, são importantes pragas da fruticultura no Brasil. Para desenvolver um sistema sustentável de manejo integrado para este grupo de pragas, é fundamental conhecer os parasitoides (Hymenoptera que podem regular as populações destes tefritídeos. Portanto, o objetivo deste estudo foi relatar a diversidade, a distribuição geográfica e as relações tritróficas dos himenópteros parasitoides de moscas-das-frutas, na região do Baixo Jaguaribe, no semiárido do Estado do Ceará, Brasil. Foram realizadas coletas de frutos em sete municípios da região, no período de maio de 2010 amaio de 2013. Os frutos foram levados para o laboratório, onde foram contados, pesados, colocados em bandejas plásticas com vermiculita e fechadas com tecido voile. Após sete dias, a vermiculita foi peneirada para a obtenção dos pupários das moscas-das-frutas que, em seguida, foram contados e acondicionados em placas de Petri, onde permaneceram até a emergência dos adultos (moscas e/ou parasitoides. Quatro espécies de parasitoides foram encontradas: Doryctobracon areolatus(Szépligeti, Opius bellus Gahan, Utetes anastrephae(Viereck (Braconidae e Tetrastichus giffardianusSilvestri (Eulophidae,sendo o mais frequente e com maior distribuição geográfica na região, D. areolatus. Doryctobracon areolatusfoi mais comum em associação com espécies de Anastrepha - A. sororcula Zucchi, A. obliqua (Mcquart e A. zenildae Zucchi, em frutos nativos e com C. capitata em frutos exóticos. Tetrastichus giffardianus foi obtido apenas em associação com C. capitata, em frutos nativos e exóticos. Estas informações podem servir de base para inserção de parasitoides em futuros programas de manejo integrado de moscas-das-frutas, nas condições do Semiárido brasileiro.

  5. Controle da infestação natural de ceratitis capitata (Wied., 1824 (Diptera, Tephritidae em pêssegos(Prunus persica através das radiações gama Control of naturally infested peaches (Prunus persica by mediterranean fruit fly (Ceratitis capitata through the use of gamma radiation

    Directory of Open Access Journals (Sweden)

    V. Arthur

    1993-12-01

    Full Text Available Determinou-se a dose desinfestante de radiações gama para pêssegos, Prunus persica, infestados com larvas da mosca do Mediterrâneo, Ceratitis capitata. Utilizaram-se frutas de procedência conhecida no campo fazendo-se uma amostragem prévia, constatando-se que cada fruta continha em média nove larvas do último ínstar da mosca praga. As frutas foram irradiadas em uma fonte de Cobalto-60 com as seguintes doses de radiação gama: 0 (test., 25, 50, 100, 200, 400, 600, 800, 1000 e 1200 Gy, sob uma taxa de 58 Gy por minuto. Após a irradiação as frutas foram colocadas em câmaras climatizadas com a temperatura variando entre 23 e 27°C e a umidade relativa variando entre 65 e 75%. Aguardou-se que as larvas deixassem as frutas e se transformassem em pupas e adultos. A dose letal para larvas, pelos resultados obtidos no experimento, concluiu-se ser de 600 Gy. A dose letal para pupas provenientes de larvas irradiadas dentro das frutas foi de 50 Gy, impedindo totalmente a emergência de adultos.Determination of the dose of gamma radiation to disinfest peaches, Prunus pérsica infested with larvae of Ceratitis capitata (Wied., 1824 was made. Fruits were collected in the field, each one holding about nine larvae of the last instar of the fruit-fly. The fruits were irradiated with Cobalt-60 gamma radiation source at the following doses: 0 (control, 25, 50, 100, 200, 400, 600, 800, 1000 and 1200 Gy; at a dose rate of 58 Gy per minute. After irradiation the fruits were kept in a climatic chamber with the temperature adjusted between 23 and 27°C, and relative humidity between 65 and 75 percent, until the larvae left the fruits and were transformed into pupae and adults. It was concluded that the lethal dose of gamma radiation for larvae at the last instar, in naturally infested peaches, was 600 Gy and the dose of 50 Gy inhibited completely the emergency of adults.

  6. Oogênese em Fannia pusio (Wiedemann, 1830 e Fannia heydenni (Wiedemann, 1830 (Diptera, Fanniidae

    Directory of Open Access Journals (Sweden)

    Márcia Souto Couri

    1990-01-01

    Full Text Available Oogenesis in Fannia pusio and Fannia heydenii was divided into a series of eight stages (stage I - germarium; stage VIII - mature egg, which are characterized and illustrated. Comments on similar researches and a comparison with related data in literature are also included.

  7. Oogênese em Fannia pusio (Wiedemann, 1830) e Fannia heydenni (Wiedemann, 1830) (Diptera, Fanniidae)

    OpenAIRE

    Márcia Souto Couri

    1990-01-01

    Oogenesis in Fannia pusio and Fannia heydenii was divided into a series of eight stages (stage I - germarium; stage VIII - mature egg), which are characterized and illustrated. Comments on similar researches and a comparison with related data in literature are also included.

  8. Evidence for potential of managing some african fruit fly species (Diptera: Tephritidae) using the mango fruit fly host-marking pheromone

    Science.gov (United States)

    We investigated conspecific and heterospecific oviposition host discrimination among four economically important fruit fly pests of mango in Africa (Ceratitis capitata, Wiedemann; C. fasciventris, Bezzi; C. rosa, Karsch, and C. cosyra, Walker) with regard to host-marking behavior and fecal matter aq...

  9. CASE REPORT OF BECKWITH-WIEDEMANN SYNDROME

    Directory of Open Access Journals (Sweden)

    Ravikanth

    2014-06-01

    Full Text Available In 1963 Beckwith presented a report on the first patient with extreme cytomegaly of adrenal cortex, hyperplasia of kidneys as well as pancreas and Leydig cell hyperplasia. Wiedemann completed description of the new syndrome by adding umbilical hernia and macroglossia. The diagnosis is made based on the clinical signs of omphalocele. [7] or some other umbilical deformity, macroglossia. [8] congenital asymmetry, visceromegaly (liver, pancreas, and kidneys. Newborn with macrosomia, macroglossia first differential diagnosis are infant of diabetic mother, congenital hypothyroidism etc. IDM can be identified easily with history of maternal diabetes. So congenital hypothyroidism is next common diagnosis and will be treated as hypothyroidism. If TSH, T3 and T4 are not clearly indicative of congenital hypothyroidism next consider the Beckwith Wiedemann syndrome in differential diagnosis of large for gestational age.

  10. Síndrome de Beckwith Wiedemann

    Directory of Open Access Journals (Sweden)

    Dania Faxas Rodríguez

    2015-12-01

    Full Text Available Se presenta el caso de un paciente, atendido en el Servicio de Pediatría del Hospital General Docente “14 de Junio” del municipio de Jobabo, provincia de Las Tunas. El paciente es portador de un síndrome de Beckwith Wiedemann, enfermedad de posible origen genético autosómico dominante, cuyo diagnóstico se fundamenta en criterios clínicos mayores y menores. Se expusieron los resultados del examen clínico y de las investigaciones complementarias. Se realizó una revisión de la literatura médica sobre el tema.

  11. Determination of the dose of gamma radiation sterilization for assessment of biological parameters of male Ceratitis capitada (Diptera: Tephritidae), tsl - Vienna 8 strain; Determinacao da dose de radiacao gama esterilizante pela avaliacao dos parametros biologicos de machos de Ceratitis capitata (Diptera: Tephritidae), linhagem tsl - Vienna 8

    Energy Technology Data Exchange (ETDEWEB)

    Rocha, Aline Cristina Pereira da

    2011-07-01

    The Vienna-8, tsl (temperature sensitive lethal) strain of Ceratitis capitata, by presenting mutations that facilitate the mass rearing and release only of sterile males in the field, has been used in (Sterile Insect Technique) programmes. The objective of this study was to determine the radiation dose that provides the highest level of sterility for Vienna-8, tsl males assessing their biological parameters that indicate the quality of sterile males to be released. Brown pupae (males) of the tsl strain were obtained from the mass rearing of the Food Irradiation and Radio entomology laboratory of CENA/USP, and they were irradiated (with gamma radiation - {sup 60}Co) 24 hours before the emergence at rates of 0, 30, 60, 90 and 120 Gy. The determination of the sterilizing dose was based on fertility of sexually mature females of the bisexual strain and not irradiated, mated with males of different treatments. Eggs were collected daily during 6 days, were counted and it was possible to estimate fecundity, and assess the hatching rate. The emergence and flight ability were determined by following the protocol of quality control manual for FAO/IAEA/USDA (2003). To assess the longevity under nutritional stress, the insects were kept a period of 48 h after emergence in the absence of water and food, and after this period, mortality was recorded. The size of the testes (left and right) was obtained by dissecting irradiated and non-irradiated males at the eighth day of life, and measure the testes in an ocular micrometer, considering the maximum length and width of each sample. To determine the sperm number was necessary to dissect the males and break their testicles. No difference was observed in emergence rate, flight ability and longevity of irradiated and non-irradiated males, nor in the fecundity of females mated with males of different treatments. The sterilizing dose that resulted in lower fertility of females was 120 Gy, with 1.5% hatching. Considering the parameters

  12. Potential geographical distributions of the fruit flies Ceratitis capitata, Ceratitis cosyra, and Ceratitis rosa in China.

    Science.gov (United States)

    Li, Baini; Ma, Jun; Hu, Xuenan; Liu, Haijun; Zhang, Runjie

    2009-10-01

    There have been relatively few attempts to model the distributions of the fruit flies Ceratitis capitata (Wiedemann), Ceratitis cosyra (Walker), and Ceratitis rosa Karsch in China, but the geographic distributions of these species are of considerable concern in terms of biosecurity. In this study, two different modeling methods (genetic algorithm for rule-set prediction [GARP] and maximum entropy species distribution modeling [Maxent]) were used to predict the potential distributions of these three fly species in China, by using distribution records and a set of environmental predictor variables. The results showed that Maxent performed well, compared with modeling by GARP, at each test threshold. For all three species, the results predicted by Maxent agreed with the observed distributions in Africa and in other parts of the world. In China, C. capitata seems to have the highest number of favorable habitat areas, relative to C. cosyra and C. rosa, i.e., Yunnan, Guizhou, Guangxi, Guangdong, Hainan, Fujian, Sichuan and Chongqing, whereas C. cosyra has the smallest range of suitable areas, i.e., Yunnan, some parts of Hainan and Sichuan. The suitable areas for C. rosa are mainly restricted to Yunnan, Hainan, southern Guangdong, and a few areas of Sichuan. The indications are that on the whole, Southwest and South China are the areas with the highest risk for establishment from these three fly species. Jackknife tests reveal that environmental variables associated with temperature have the strongest influence on the potential distributions of all three species relative to other variables.

  13. The Mediterranean fruit fly (Ceratitis capitata in Iran: genetic diversity and comparison with other countries

    Directory of Open Access Journals (Sweden)

    M. Rajabiyan

    2015-04-01

    Full Text Available The Mediterranean fruit fly, Ceratitis capitata (Wiedemann is an economically important pest on fruits all over the world. The origin of this fly is thought to be from Africa, but it has recently expanded its distribution in many geographic regions including Iran. Due to the wide spread of this pest in Iran and its serious damage to fruit on trees, including citrus orchards of northern Iran, the present study was conducted firstly to investigate genetic diversity within populations of C. capitata based on the sequences of three mitochondrial DNA (mtDNA genes including cytochrome C oxidase I (COI, NAHD dehydrogenase subunits 4 and 5 (ND4 and ND5 and secondly to compare the Iranian haplotypes with those found in other countries. Results of this study indicated low levels of genetic diversity (four, four and three haplotypes among different populations of this pest, respectively for the COI, ND4 and ND5 genes in northern Iranian populations. The genetic similarity and very low levels of genetic diversity of northern Iranian populations suggest that the pest colonisation occurred relatively recently. In addition, haplotypes of Mazandaran province are similar to haplotypes of those countries that have recently been infected by this pest.

  14. Moscas frugívoras (Diptera, Tephritoidea coletadas em Aquidauana, MS Frugivorous flies (Diptera, Tephritoidea collected in Aquidauana, MS

    Directory of Open Access Journals (Sweden)

    Sérgio Roberto Rodrigues

    2006-03-01

    Full Text Available No Brasil as moscas frugívoras são pragas importantes de frutas e hortaliças. O conhecimento da flutuação populacional dessas espécies em cada bioma é um importante requisito para a adoção de estratégia de controle de pragas nos agroecossistemas. O objetivo desse trabalho foi avaliar a diversidade de espécies de moscas-das-frutas infestantes de frutas silvestres e cultivadas em Aquidauana, MS. Vinte e uma espécies de frutas foram amostradas de fevereiro de 2003 a janeiro de 2004. As espécies de Tephritidae encontradas foram: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 e Ceratitis capitata (Wiedemann, 1824. Os frugívoros Lonchaeidae e Muscidae encontrados foram: Neosilba sp. e Atherigona orientalis (Schiner, 1868, respectivamente. Um total de 2.568 moscas foram coletadas, das quais 2.394 representadas pela mosca-do-Mediterrâneo C. capitata. A associação entre moscas frugívoras e espécies de frutas é discutida.In Brazil, frugivorous flies represent important pests of fruits and vegetables. Information on populational fluctuation of these species in each biome is an important requirement for the adoption of a strategy of pest control in the agroecosystems. The objective of this paper is to assess the diversity of fruit fly species occurring in wild and cultived fruits in Aquidauana, MS. Twenty-nine fruit species were sampled from February 2003 to January 2004. The Tephritidae species recovered were: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 and Ceratitis capitata (Wiedemann, 1824. The frugivorous Lonchaeidae and Muscidae recovered were: Neosilba sp. and Atherigona orientalis (Schiner, 1868, respectively. A total of 2.568 flies were obtained, from which 2.394 flies were the Mediterranean fruit fly, C. capitata. The association between frugivorous flies and the fruit species is discussed.

  15. Análise faunêstica de moscas-das-frutas (diptera, tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Faunal study of fruit flies (Diptera, Tephritidae in peach or-chards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-12-01

    Full Text Available In order to characterizc the peach trees ecosystem in Porto Alegre related to tephrilidea species, a faunal study was developed over the data of the collects of these insects with traps in tvvelve months. For the characterization of the communities, constancy, abundance and frequency index were determined. Relation between sex were obtained by correlation matrix, sexual proportion and sexual rates. Anastrepha fratercalus (Wiedemann, 1830 was abundant, constant and frequent, Ceratitis capitata (Wiedemann, 1824 was accessory and Anastrepha grandis (Macquart, 1845 accidental. A greatcr number of females than males was observed.

  16. Insecticidal activity of basil oil, trans-anethole, estragole, and linalool to adult fruit flies of Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae.

    Science.gov (United States)

    Chang, Chiou Ling; Cho, Il Kyu; Li, Qing X

    2009-02-01

    Basil oil and its three major active constituents (trans-anethole, estragole, and linalool) obtained from basil (Oscimum basilicum L.) were tested on three tephritid fruit fly species [Ceratitis capitata (Wiedemann), Bactrocera dorsalis (Hendel), and Bactrocera cucurbitae (Coquillett)] for insecticidal activity. All test chemicals acted fast and showed a steep dose-response relationship. The lethal times for 90% mortality/knockdown (LT90) of the three fly species to 10% of the test chemicals were between 8 and 38 min. The toxic action of basil oil in C. capitata occurred significantly faster than in B. cucurbitae but slightly faster than in B. dorsalis. Estragole acted faster in B. dorsalis than in C. capitata and B. cucurbitae. Linalool action was faster in B. dorsalis and C. capitata than in B. cucurbitae. trans-Anethole action was similar to all three species. Methyl eugenol acted faster in C. capitata and B. cucurbitae than in B. dorsalis. When linalool was mixed with cuelure (attractant to B. cucurbitae male), its potency to the three fly species decreased as the concentration of cuelure increased. This was due to linalool hydrolysis catalyzed by acetic acid from cuelure degradation, which was confirmed by chemical analysis. When methyl eugenol (B. dorsalis male attractant) was mixed with basil oil, trans-anethole, estragole, or linalool, it did not affect the toxicity of basil oil and linalool to B. dorsalis, but it did significantly decrease the toxicity of trans-anethole and estragole. Structural similarity between methyl eugenol and trans-anethole and estragole suggests that methyl eugenol might act at a site similar to that of trans-anethole and estragole and serve as an antagonist if an action site exists. Methyl eugenol also may play a physiological role on the toxicity reduction.

  17. Macroglossia and Beckwith-Wiedemann syndrome

    Directory of Open Access Journals (Sweden)

    Krasić Dragan

    2011-01-01

    Full Text Available Introduction. In 1963 Beckwith presented a report on the first patient with extreme cytomegaly of adrenal cortex, hyperplasia of kidneys and pancreas and Leydig cell hyperplasia. Wiedemann completed description of the new syndrome by adding umbilical hernia and macroglossia. The diagnosis is made based on the clinical signs of omphalocele or some other umbilical deformity, macroglossia, congenital asymmetry, visceromegaly (liver, pancreas, and kidneys. Case Outline. A 16-month-old male child was admitted for examination because of macroglossia. He underwent examination on several occasions by an endocrinologist due to recurrent hypoglycaemic crisis. The patient was observed by a paediatric neurophysicatrist for disorders of mental development. Hypoglycaemia, muscular hypotonia of the anterior abdominal wall with umbilical hernia and macroglossia were observed by clinical examination. Inratraoral examination revealed macroglossia with microstomia, suckling and swallowing difficulties, hypotonia of the perioral muscles with increased salivation. It was therefore decided to perform surgical reduction of the prominent tongue and develop good condition for nutrition, speech function and the development of orofacial system. Conclusion. The diagnosis of macroglossia is based on subjective clinical criteria such as the morphology and amount of protrusion of the tongue, difficulty in articulating sounds, breathing, and hypersalivation. Some authors have suggested that the tongue size may be analyzed radiographically with a cephalogram. Treatment of macroglossia is controversial because of the absence of objective clinical criteria.

  18. Medfly Ceratitis capitata as Potential Vector for Fire Blight Pathogen Erwinia amylovora: Survival and Transmission.

    Directory of Open Access Journals (Sweden)

    Mónica Ordax

    Full Text Available Monitoring the ability of bacterial plant pathogens to survive in insects is required for elucidating unknown aspects of their epidemiology and for designing appropriate control strategies. Erwinia amylovora is a plant pathogenic bacterium that causes fire blight, a devastating disease in apple and pear commercial orchards. Studies on fire blight spread by insects have mainly focused on pollinating agents, such as honeybees. However, the Mediterranean fruit fly (medfly Ceratitis capitata (Diptera: Tephritidae, one of the most damaging fruit pests worldwide, is also common in pome fruit orchards. The main objective of the study was to investigate whether E. amylovora can survive and be transmitted by the medfly. Our experimental results show: i E. amylovora can survive for at least 8 days inside the digestive tract of the medfly and until 28 days on its external surface, and ii medflies are able to transmit the bacteria from inoculated apples to both detached shoots and pear plants, being the pathogen recovered from lesions in both cases. This is the first report on E. amylovora internalization and survival in/on C. capitata, as well as the experimental transmission of the fire blight pathogen by this insect. Our results suggest that medfly can act as a potential vector for E. amylovora, and expand our knowledge on the possible role of these and other insects in its life cycle.

  19. Male-specific phosphorylated SR proteins in adult flies of the Mediterranean fruitfly Ceratitis capitata.

    Science.gov (United States)

    Saccone, Giuseppe; Louis, Christos; Zhang, Hongyou; Petrella, Valeria; Di Natale, Manuela; Perri, Maria; Salvemini, Marco

    2014-01-01

    Alternative splicing is a widely used mechanism of gene regulation in sex determination pathways of Insects. In species from orders as distant as Diptera, Hymenoptera and Coleoptera, female differentiation relies on the activities of conserved splicing regulators, TRA and TRA-2, promoting female-specific expression of the global effector doublesex (dsx). Less understood is to what extent post-translational modifications of splicing regulators plays a role in this pathway. In Drosophila melanogaster phosphorylation of TRA, TRA-2 and the general RBP1 factor by the LAMMER kinase doa (darkener of apricot) is required for proper female sex determination. To explore whether this is a general feature of the pathway we examined sex-specific differences in phosphorylation levels of SR splicing factors in the dipteran species D. melanogaster, Ceratitis capitata (Medfly) and Musca domestica (Housefly). We found a distinct and reproducible pattern of male-specific phosphorylation on protein extracts enriched for SR proteins in C. capitata suggesting that differential phosphorylation may also contribute to the regulation of sex-specific splicing in the Medfly.

  20. Medfly Ceratitis capitata as Potential Vector for Fire Blight Pathogen Erwinia amylovora: Survival and Transmission.

    Science.gov (United States)

    Ordax, Mónica; Piquer-Salcedo, Jaime E; Santander, Ricardo D; Sabater-Muñoz, Beatriz; Biosca, Elena G; López, María M; Marco-Noales, Ester

    2015-01-01

    Monitoring the ability of bacterial plant pathogens to survive in insects is required for elucidating unknown aspects of their epidemiology and for designing appropriate control strategies. Erwinia amylovora is a plant pathogenic bacterium that causes fire blight, a devastating disease in apple and pear commercial orchards. Studies on fire blight spread by insects have mainly focused on pollinating agents, such as honeybees. However, the Mediterranean fruit fly (medfly) Ceratitis capitata (Diptera: Tephritidae), one of the most damaging fruit pests worldwide, is also common in pome fruit orchards. The main objective of the study was to investigate whether E. amylovora can survive and be transmitted by the medfly. Our experimental results show: i) E. amylovora can survive for at least 8 days inside the digestive tract of the medfly and until 28 days on its external surface, and ii) medflies are able to transmit the bacteria from inoculated apples to both detached shoots and pear plants, being the pathogen recovered from lesions in both cases. This is the first report on E. amylovora internalization and survival in/on C. capitata, as well as the experimental transmission of the fire blight pathogen by this insect. Our results suggest that medfly can act as a potential vector for E. amylovora, and expand our knowledge on the possible role of these and other insects in its life cycle.

  1. Eggs of Ephestia kuehniella and Ceratitis capitata, and motile stages of the astigmatid mites Tyrophagus putrescentiae and Carpoglyphus lactis as factitious foods for Orius spp.

    Science.gov (United States)

    Bonte, Jochem; de Walle, Anaïs Van; Conlong, Des; De Clercq, Patrick

    2015-11-17

    Several factitious foods were assessed for rearing the anthocorid predators Orius thripoborus (Hesse) and Orius naivashae (Poppius) (Hemiptera: Anthocoridae) in the laboratory. Developmental and reproductive traits of both Orius species were examined when offered frozen eggs of the Mediterranean flour moth, Ephestia kuehniella Zeller, frozen processed eggs of the medfly, Ceratitis capitata Wiedemann, or mixed motile stages of the astigmatid mites Tyrophagus putrescentiae (Schrank) or Carpoglyphus lactis (L). Whereas C. lactis and T. putresecentiae proved to be an inferior food for rearing O. thripoborus and O. naivashae, eggs of C. capitata eggs fully supported development and reproduction of both predators. Results on medfly eggs were similar or slightly inferior to those on E. kuehniella eggs, which is the standard food for culturing these anthocorid bugs. O. thripoborus could be maintained for four consecutive generations on C. capitata eggs indicating that processed medfly eggs can be a suitable and cheaper alternative to E. kuehniella eggs for prolonged rearing of these Orius spp. This article is protected by copyright. All rights reserved.

  2. Wiedemann effect of Fe-Ga based magnetostrictive wires

    Institute of Scientific and Technical Information of China (English)

    Li Ji-Heng; Gao Xue-Xu; Zhu Jie; Bao Xiao-Qian; Cheng Liang; Xie Jian-Xin

    2012-01-01

    (Fe83Gal7)gsCr2 wires each with a diameter of 0.7 mm are prepared by hot swaging and warm drawing from the casting rods directly,because the ductility of Fe83Ga17alloy is improved by adding Cr element.The Wiedemann twists and dependences on magnetostrictions of Fes3Ga17 and (Fes3Ga17)98Cr2 wires are investigated.The largest observed Wiedemann twists of 245 s.cm-1 and 182 s.cm-1 are detected in the annealed Fe83Ga17 and (Fe83Ga17)98Cr2 wires,respectively.The magnetostrictions of the annealed Fes3Ga17 and (FesaGa17)98Cr2 wires are 160 ppm and 107 ppm,respectively.The maximum of the Wiedemann twist increases with magnetostriction increasing.However the magnetostriction is just one important factor that affects the Wiedemann effect of alloy wire,and the relationship between magnetostriction and Wiedemann effect is a complex function rather than a simple function.

  3. Wing Morphometry and Acoustic Signals in Sterile and Wild Males: Implications for Mating Success in Ceratitis capitata.

    Science.gov (United States)

    de Souza, João Maria Gomes Alencar; de Lima-Filho, Paulo Augusto; Molina, Wagner Franco; de Almeida, Lúcia Maria; de Gouveia, Milson Bezerra; de Macêdo, Francisco Pepino; Laumann, Raul Alberto; Paranhos, Beatriz Aguiar Jordão

    2015-01-01

    The sterile insect technique (SIT) is widely utilized in the biological control of fruit flies of the family Tephritidae, particularly against the Mediterranean fruit fly. This study investigated the interaction between mating success and morphometric variation in the wings and the production of acoustic signals among three male groups of Ceratitis capitata (Wiedemann): (1) wild males, (2) irradiated with Co-60 (steriles), and (3) irradiated (steriles) and treated with ginger oil. The canonical variate analysis discriminated two groups (males irradiated and males wild), based on the morphological shape of the wings. Among males that emit buzz signals, wild males obtained copulation more frequently than males in Groups 2 and 3. The individuals of Group 3 achieved more matings than those in Group 2. Wild males displayed lower pulse duration, higher intervals between pulses, and higher dominant frequency. Regarding the reproductive success, the morphological differences in the wings' shape between accepted and nonaccepted males are higher in wild males than in the irradiated ones. The present results can be useful in programs using the sterile insect technique for biological control of C. capitata.

  4. 地中海实蝇幼虫分子鉴定%Molecular identification for larvae of Ceratitis capitata

    Institute of Scientific and Technical Information of China (English)

    叶军; 周国梁; 易建平; 吴家教; 阮长浩; 梁帆; 郑建中; 王文兵

    2007-01-01

    通过对从秘鲁进口的葡萄中截获实蝇类幼虫进行ITS区和线粒体CO Ⅰ,COⅡ,COⅢ、ND5基因序列的扩增和测序,并与GenBank中对应的序列进行比对,结果表明,截获样品ITS区序列和地中海实蝇Ceratitis capitata(Wiedemann)同源性为95.16%(其中ITS1为99.52%,ITS2为86.2%),线粒体COⅠ,COⅡ,COⅢ,ND5基因序列和地中海实蝇C.capitata同源性为100%,99.9%,99.5%,99.8%;基于CO Ⅰ序列构建的系统发育树中,幼虫样品和地中海实蝇最为接近.根据序列分析和系统发育关系分析的结果,将截获的实蝇类幼虫鉴定为地中海实蝇C.capitata.

  5. Wing Morphometry and Acoustic Signals in Sterile and Wild Males: Implications for Mating Success in Ceratitis capitata

    Directory of Open Access Journals (Sweden)

    João Maria Gomes Alencar de Souza

    2015-01-01

    Full Text Available The sterile insect technique (SIT is widely utilized in the biological control of fruit flies of the family Tephritidae, particularly against the Mediterranean fruit fly. This study investigated the interaction between mating success and morphometric variation in the wings and the production of acoustic signals among three male groups of Ceratitis capitata (Wiedemann: (1 wild males, (2 irradiated with Co-60 (steriles, and (3 irradiated (steriles and treated with ginger oil. The canonical variate analysis discriminated two groups (males irradiated and males wild, based on the morphological shape of the wings. Among males that emit buzz signals, wild males obtained copulation more frequently than males in Groups 2 and 3. The individuals of Group 3 achieved more matings than those in Group 2. Wild males displayed lower pulse duration, higher intervals between pulses, and higher dominant frequency. Regarding the reproductive success, the morphological differences in the wings’ shape between accepted and nonaccepted males are higher in wild males than in the irradiated ones. The present results can be useful in programs using the sterile insect technique for biological control of C. capitata.

  6. Sarcosaprophagous Diptera assemblages in natural habitats in central Spain: spatial and seasonal changes in composition.

    Science.gov (United States)

    Martín-Vega, D; Baz, A

    2013-03-01

    The composition and spatial distribution of sarcosaprophagous Diptera assemblages were studied using carrion-baited traps along a bioclimatic gradient of natural habitats in central Spain throughout the different seasons during 1 year. Calliphoridae and Muscidae were the most abundant families, accounting for, respectively, 41.9% and 35.1% of all Diptera specimens collected. Other abundant families were Heleomyzidae (8.4%), Sarcophagidae (6.9%) and Piophilidae (5.1%). Fly assemblage compositions differed among bioclimatic levels, with Chrysomya albiceps (Wiedemann) (Diptera: Calliphoridae) being the dominant species in mesomediterranean habitats, Muscina levida (Harris) (Diptera: Muscidae) the dominant species in supramediterranean habitats, and Prochyliza nigrimana (Meigen) (Diptera: Piophilidae) the dominant species in oromediterranean habitats. Differences in assemblage composition were also found among seasons. Thermophobic species such as Calliphora vicina Robineau-Desvoidy (Diptera: Calliphoridae) and some species of Heleomyzidae were well represented during autumn, winter and spring in the three bioclimatic levels sampled. By contrast, thermophilic species such as Ch. albiceps and Lucilia sericata (Meigen) (Diptera: Calliphoridae) and most Muscidae and Sarcophagidae species were more abundant during summer and in mesomediterranean habitats located at lower elevations. Knowledge of the preferences of some species for certain habitats may be of ecological and forensic value and may establish a starting point for further research.

  7. Seasonality of the Mediterranean Fruit Fly (Diptera: Tephritidae) on Terceira and Sao Jorge Islands, Azores, Portugal

    Science.gov (United States)

    Pimentel, R.; Lopes, D.J.H.; Mexia, A.M.M.; Mumford, J.D.

    2017-01-01

    Population dynamics studies are very important for any area-wide control program as they provide detailed knowledge about the relationship of Medfly [Ceratitis capitata (Wiedemann)] life cycle with host availability and abundance. The main goal of this study is to analyse seasonality of C. capitata in Terceira and Sao Jorge Islands (Azores archipelago) using field and laboratory data collected during (2010–2014) CABMEDMAC (MAC/3/A163) project. The results from Sao Jorge Island indicate significantly lower male/female ratio than on Terceira Island. This is an important finding specially regarding when stablishing the scenario parameters for a sterile insect technique application in each island. The population dynamics of C. capitata are generally linked with host fruit availability and abundance. However, on Terceira Island fruit infestation levels are not synchronized with the trap counts. For example, there was Medfly infestations in some fruits [e.g., Solanum mauritianum (Scop.)] while in the nearby traps there were no captures at the same time. From this perspective, it is important to denote the importance of wild invasive plants, on the population dynamics of C. capitata, as well important to consider the possibility of having different densities of traps according to the characteristics of each area in order to improve the network of traps surveillance’s sensitivity on Terceira Island. PMID:28082349

  8. Nasal encephalocele in a child with Beckwith-Wiedemann syndrome

    NARCIS (Netherlands)

    Broekman, Marike L. D.; Hoving, Eelco W.; Kho, Kuan H.; Speleman, Lucienne; Sen Han, K.; Hanlo, Patrick W.

    2008-01-01

    Beckwith-Wiedemann syndrome (BWS) is a rare congenital syndrome characterized by gigantism, macroglossia, exophthalmos, postpartum hypoglycemia, and multiple midline defects such as omphalocele. The authors describe, to the best of their knowledge, the first case of a child in whom BWS was diagnosed

  9. How functional genomics will impact fruit fly pest control: the example of the Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Scolari, Francesca; Gomulski, Ludvik M; Gabrieli, Paolo; Manni, Mosè; Savini, Grazia; Gasperi, Giuliano; Malacrida, Anna R

    2014-01-01

    The highly invasive agricultural insect pest Ceratitis capitata (Diptera: Tephritidae) is the most thoroughly studied tephritid fruit fly at the genetic and molecular levels. It has become a model for the analysis of fruit fly invasions and for the development of area-wide integrated pest management (AW-IPM) programmes based on the environmentally-friendly Sterile Insect Technique (SIT). Extensive transcriptome resources and the recently released genome sequence are making it possible to unravel several aspects of the medfly reproductive biology and behaviour, opening new opportunities for comparative genomics and barcoding for species identification. New genes, promotors and regulatory sequences are becoming available for the development/improvement of highly competitive sexing strains, for the monitoring of sterile males released in the field and for determining the mating status of wild females. The tools developed in this species have been transferred to other tephritids that are also the subject of SIT programmes.

  10. Identification and expression profiling of Ceratitis capitata genes coding for β-hexosaminidases.

    Science.gov (United States)

    Pasini, Maria E; Intra, Jari; Gomulski, Ludvik M; Calvenzani, Valentina; Petroni, Katia; Briani, Federica; Perotti, Maria Elisa

    2011-02-15

    The goal of this study was to identify the genes coding for β-N-acetylhexosaminidases in the Mediterranean fruit fly (medfly) Ceratitis capitata, one of the most destructive agricultural pests, belonging to the Tephritidae family, order Diptera. Two dimeric β-N-acetylhexosaminidases, HEXA and HEXB, have been recently identified on Drosophila sperm. These enzymes are involved in egg binding through interactions with complementary carbohydrates on the surface of the egg shell. Three genes, Hexosaminidase 1 (Hexo1), Hexosaminidase 2 (Hexo2) and fused lobes (fdl), encode for HEXA and HEXB subunits. The availability of C. capitata EST libraries derived from embryos and adult heads allowed us to identify three sequences homologous to the D. melanogaster Hexo1, Hexo2 and fdl genes. Here, we report the expression profile analysis of CcHexo1, CcHexo2 and Ccfdld in several tissues, organs and stages. Ccfdl expression was highest in heads of both sexes and in whole adult females. In the testis and ovary the three genes showed distinct spatial and temporal expression patterns. All the mRNAs were detectable in early stages of spermatogenesis; CcHexo2 and Ccfdl were also expressed in early elongating spermatid cysts. All three genes are expressed in the ovarian nurse cells. CcHexo1 and Ccfdl are stage specific, since they have been observed in stages 12 and 13 during oocyte growth, when programmed cell death occurs in nurse cells. The expression pattern of the three genes in medfly gonads suggests that, as their Drosophila counterparts, they may encode for proteins involved in gametogenesis and fertilization.

  11. Cloning, sequence identification and expression profile analysis of α-L-fucosidase gene from the Mediterranean fruit fly Ceratitis capitata.

    Science.gov (United States)

    Intra, Jari; Perotti, Maria-Elisa; Pasini, Maria Enrica

    2011-04-01

    The Mediterranean fruit fly Ceratitis capitata (Diptera: Tephritidae) is one of the most destructive agricultural pests, a polyphagus insect of relevant economic importance and is widespread in many regions around the world. It is the best-studied fruit fly pest at genetic and molecular level and much has been learned on its ecology and behaviour. An α-L-fucosidase has been recently hypothesized to be involved in sperm-egg interactions in Drosophila melanogaster and in other Drosophila species. Here, a complete cDNA encoding a putative α-L-fucosidase of the medfly was amplified using the reverse polymerase chain reaction (RT-PCR) with degenerate based on the conserved coding sequence information of several insect α-L-fucosidases, cloned and sequenced (GenBank accession no. FJ177429). The coding region consisted of 1482 bp which encoded a 485-residues protein (named CcFUCA) with a predicted molecular mass of 56.1 kDa. The deduced protein sequence showed 75% amino acid identity to D. melanogaster α-L-fucosidase, and in fact the phylogenetic tree analysis revealed that CcFUCA had closer relationships with the α-L-fucosidases of drosophilid species. The tissue expression analysis indicated that CcFuca was expressed in a single transcript in all tissues, suggesting a ubiquitous localization pattern of the encoded protein. Our findings provide novel insights on a gene encoding a protein potentially involved in primary gamete interactions in C. capitata.

  12. Nitric oxide synthase-dependent NADPH-diaphorase activity in the optic lobes of male and female Ceratitis capitata mutants

    Directory of Open Access Journals (Sweden)

    E Roda

    2009-06-01

    Full Text Available Nitric oxide (NO is acknowledged as a messenger molecule in the nervous system with a pivotal role in the modulation of the chemosensory information. It has been shown to be present in the optic lobes of several insect species. In the present study, we used males and females from four different strains of the medfly Ceratitis capitata (Diptera, Tephritidae: or; or,wp (both orange eyed; w,M360 and w,Heraklion (both white eyed, as models to further clarify the involvement of NO in the mutants’ visual system and differences in its activity and localization in the sexes. Comparison of the localization pattern of NO synthase (NOS, through NADPH-diaphorase (NADPHd staining, in the optic lobes of the four strains, revealed a stronger reaction intensity in the retina and in the neuropile region lamina than in medulla and lobula. Interestingly, the intensity of NADPHd staining differs, at least in some strains, in the optic lobes of the two sexes; all the areas are generally strongly labelled in the males of the or and w,M360 strains, whereas the w,Heraklion and or,wp mutants do not show evident sexdependent NADPHd staining. Taken as a whole, our data point to NO as a likely transmitter candidate in the visual information processes in insects, with a possible correlation among NOS distribution, eye pigmentation and visual function in C. capitata males. Moreover, NO could influence behavioural differences linked to vision in the two sexes.

  13. Diptera Brachycera found inside the esophagus of a mummified adult male from the early XIX century, Lisbon, Portugal

    Directory of Open Access Journals (Sweden)

    Márcia Souto Couri

    2008-03-01

    Full Text Available Fly puparia and adult fragments of diptera muscid were found inside the esophagus of a mummified body from the early XIX century, buried inside the crypt of the Sacrament Church (Lisbon, Portugal. The identification of the material revealed a monospecific colonization by Ophyra capensis (Wiedemann (Diptera: Muscidae, a species known to invade corpses in the ammoniacal fermentation wave. This species can be found in corpses kept indoors, not available to the early waves of blowflies (Diptera: Calliphoridae. In the present case, the number of pupae and their developmental stage suggest that the female invaded the mummified corpse through the partially opened mouth and the oviposition took place directly inside the esophagus. This is the first case of O. capensis infesting internal organs of an intact corpse. The use of chemical products for the embalming process probably explains why external colonization did not occur.

  14. THE BRINE SHRIMP (ARTEMIA SALINA) LETHALITY OF Brassica oleracea var. capitata

    OpenAIRE

    O.T. TÜZÜN, E. GÜRKAN, F. HIRLAK,

    2015-01-01

    This work covers up the bio-activities of the five fractions obtained from the ethanolic extract of Brassica oleracea var. capitata (Cruciferae).Key Words: Brassica oleracea var. capitata, Brine shrimp (Artemia salina)

  15. Temporal Diversity and Abundance Patterns of Parasitoids of Fruit-Infesting Tephritidae (Diptera) in the Argentinean Yungas: Implications for Biological Control.

    Science.gov (United States)

    Schliserman, Pablo; Aluja, Martin; Rull, Juan; Ovruski, Sergio M

    2016-10-01

    A 4-yr study was done to analyze seasonal patterns underlying host plant-fruit fly-parasitoid interactions in a secondary forest in the Argentinean Yunga and its importance for the implementation of conservation and augmentative biological control. Larval-pupal hymenopteran parasitoids associated with all host plants and fruit fly species were identified and the seasonal occurrence of fruit, infestation levels, parasitism percentage, and relative parasitoid abundance were determined. Three fruit fly species in two genera were found in association with surveyed plants, two of which (Ceratitis capitata (Wiedemann) and Anastrepha fraterculus (Wiedemann)) are of major economic importance. Infestation levels were strongly influenced by environmental factors and peak fruit availability. Five fruit fly parasitoid species were recovered from fly pupae, four braconid species, and one figitid. Time windows for fruit fly population growth were pinpointed. Based on results, the present analysis proposes an effective fruit fly biological control strategy tailored for the northwestern Argentinean citrus-producing area.

  16. PRESENCE OF THE MEDITERRANEAN FRUIT FLY(Ceratitis capitata Wied. IN SELECTED OLIVE ORCHARDS OF CENTRAL DALMATIA

    Directory of Open Access Journals (Sweden)

    M. Bjeliš

    2007-12-01

    Full Text Available Mediterranean fruit fly (Ceratitis capitata Wiedemann is a regular pest of large number of cultivated and wild host plants in Dalmatia. However, this pest does not develop either inside fruits of cultivated olive - Olea europaea sativa or wild olive „ mastrinka“ - Olea europaea oleaster. The main objective of this research was to prove regular presence, time of appearance and flight duration of the Mediterranean fruit fly inside selected orchards of central Dalmatia. During the four years of research, from 2001 to 2004 by using of traps and parapheromone trimedlure, the regular presence of the Mediterranean fruit fly was proved inside four selected orchards on the area of cities of Split and Kaštela, with differences in adult caught between localities and years. During the 2001 year, on the three locations in the area of city of Kaštela, the highest capture during the total research period was recorded, while on the locations in Split, the highest capture was recorded during 2003 year, but also significant during 2001 year. The lowest number of adult, less than 5 flies/trap was captured on all four locations during 2002 year.

  17. Morphology of immature stages of Hemipyrellia ligurriens (Wiedemann) (Diptera: Calliphoridae) for use in forensic entomology applications.

    Science.gov (United States)

    Sukontason, Kabkaew L; Sribanditmongkol, Pongruk; Chaiwong, Tarinee; Vogtsberger, Roy C; Piangjai, Somsak; Sukontason, Kom

    2008-09-01

    In forensic investigations, all immature stages of flies (egg, larvae, and puparium) can serve as entomological evidence at death scenes. These insects are primarily used to estimate the post mortem interval (PMI), but can also be involved in the analysis of toxic substances, determining manner of death, and in indicating relocation of a corpse in homicide cases. In this study, we present the morphology of the egg, larvae, and puparium of Hemipyrellia ligurriens, a blow fly species of forensic importance in Thailand. Examination was conducted using scanning electron microscopy (SEM). The egg stage was found to display a relatively wide plastron region (or median hatch line area) that spans almost the entire length of the egg. The median hatch line is oriented in an upright position. External chorionic sculpture of the egg is present in a hexagonal pattern whose reticular boundaries are slightly elevated. In the larval stages, the most prominent morphological changes were detected upon comparison of the first to the second instar; whereas, the differences between second and third instar larvae were less obvious outside of the increase in number of posterior spiracular slits. Most of the major differences involve body size and structure of the anterior and posterior spiracles. Each anterior spiracle in both the second and third instars projects five to seven papillae apically. Each posterior spiracular disc of a third instar exhibits a complete peritreme, three spiracular slits, and a prominent button that is ventromedially located. The puparium is coarctate and features a clustered bubble membrane comprised of approximately 57 mammillate structures positioned dorsolaterally on each side of the first abdominal segment in young puparia. This feature is replaced by short, tubular respiratory horns in aged puparia. This study provides more detailed exposure of important morphological features that can be used for accurate identification of immature stages of H. ligurriens. Information presented can aid in forensic investigations involving this fly species.

  18. Ultrastructure of immature stages of the black dump fly: Ophyra aenescens (Wiedemann, 1830) (Diptera: Muscidae: Azeliinae).

    Science.gov (United States)

    Cortinhas, Lucas Barbosa; Mendonça, Paloma Martins; Barbosa, Rodrigo Rocha; Queiroz, Margareth Maria de Carvalho

    2016-06-01

    Ophyra aenescens (black dump fly) originally belonged to the New World, however, now it is spread worldwide. This fly is a mechanical vector of some pathogenic microorganisms and eggs of the human botfly (Dermatobia hominis). The adults are associated with decaying matter and the immature stages colonize animal and human corpses. It is considered an important muscid species for forensic entomology. The aim of this study was to describe the morphology of the eggs, the three larval instars and the puparia of O. aenescens using scanning electron microscopy (SEM). The spiracular opening of the first instar has an interruption in the middle of its length. Comparing to the other instar, the ventral tubercles are only developed in the first instar. The anterior spiracles have a variation in the numbers of spiracular ramification. The puparia morphology is similar to the third instar larvae, however the cephalic region is retracted and on the third thoracic segment, a respiratory structure is present. In conclusion, the SEM technique used and the results obtained are helpful to describe and differentiate the immature stages of O. aenescens and consequently support forensic and medical entomology.

  19. The Preimaginal Stages of Cryptotylus unicolor (Wiedemann and Tabanus nebulosus ornativentris Kroeber (Tabanidae-Diptera-Insecta

    Directory of Open Access Journals (Sweden)

    Coscarón S

    1998-01-01

    Full Text Available A larva with peculiar very long pubescence on the integument, the pupa of Cryptotylus unicolor, and the larva and pupa of Tabanus nebulosus ornativentris are described and illustrated

  20. Ocorrência e Sazonalidade de Muscóides (Diptera, Calliphoridae de Importância Sanitária no Município de Itaboraí, RJ, Brasil

    Directory of Open Access Journals (Sweden)

    José Batista-da-Silva

    2010-04-01

    Abstract. This work was carried out to contribute to the knowledge of Calliphoridae flies (Diptera in Itaboraí, RJ, Brazil and quantify the predominant species of health importance. The flies were captured in eight different points in the city over a one year period, always using fish as bait, separated by species and kept properly in an entomological box in the Laboratório de Transmissores de Leishmaniose (Setor de Entomologia Médica e Forense - IOC / FIOCRUZ, RJ. A total of 1792 Calliphoridae flies were captured, belonging to seven (7 species: Chloroprocta idioidea (Robineau-Desvoidy (0.11%, Chrysomya megacephala (Fabricius (87.94%, Chrysomya albiceps (Wiedemann (6.70%, Chrysomya putoria (Wiedemann (1.23%, Cochliomyia macellaria (Fabricius (0.56%, Hemilucilia segmentaria (Fabricius (0.33%, Lucilia eximia (Wiedemann (3.13%.

  1. In vivo bioinsecticidal activity toward Ceratitis capitata (fruit fly) and Callosobruchus maculatus (cowpea weevil) and in vitro bioinsecticidal activity toward different orders of insect pests of a trypsin inhibitor purified from tamarind tree (Tamarindus indica) seeds.

    Science.gov (United States)

    Araújo, Carina L; Bezerra, Ingrid W L; Oliveira, Adeliana S; Moura, Fabiano T; Macedo, Leonardo L P; Gomes, Carlos E M; Barbosa, Aulus E A D; Macedo, Francisco P; Souza, Tánia M S; Franco, Octavio L; Bloch-J, Carlos; Sales, Mauricio P

    2005-06-01

    A proteinaceous inhibitor with high activity against trypsin-like serine proteinases was purified from seeds of the tamarind tree (Tamarindus indica) by gel filtration on Shephacryl S-200 followed by a reverse-phase HPLC Vidac C18 TP. The inhibitor, called the tamarind trypsin inhibitor (TTI), showed a Mr of 21.42 kDa by mass spectrometry analysis. TTI was a noncompetitive inhibitor with a Ki value of 1.7 x 10(-9) M. In vitro bioinsecticidal activity against insect digestive enzymes from different orders showed that TTI had remarkable activity against enzymes from coleopteran, Anthonomus grandis (29.6%), Zabrotes subfasciatus (51.6%), Callosobruchus maculatus (86.7%), Rhyzopertha dominica(88.2%), and lepidopteron, Plodia interpuncptella (26.7%), Alabama argillacea (53.8%), and Spodoptera frugiperda (75.5%). Also, digestive enzymes from Diptera, Ceratitis capitata (fruit fly), were inhibited (52.9%). In vivo bioinsecticidal assays toward C. capitata and C. maculatus larvae were developed. The concentration of TTI (w/w) in the artificial seed necessary to cause 50% mortality (LD50) of larvae was 3.6%, and that to reduce mass larvae by 50.0% (ED50) was 3.2%. Furthermore, the mass C. capitata larvae were affected at 53.2% and produced approximately 34% mortality at a level of 4.0% (w/w) of TTI incorporated in artificial diets.

  2. Prenatal diagnosis of Beckwith-Wiedemann syndrome by two- and three-dimensional ultrasonography

    Directory of Open Access Journals (Sweden)

    Edward Araujo Junior

    2013-12-01

    Full Text Available Beckwith-Wiedemann syndrome is a genetic syndrome characterized by macroglossia, omphalocele, fetal gigantism and neonatal hypoglycemia. The authors report a case of Beckwith-Wiedemann syndrome diagnosed in a 32-year-old primigravida in whom two-dimensional ultrasonography revealed the presence of abdominal wall cyst, macroglossia and polycystic kidneys. Three-dimensional ultrasonography in rendering mode was of great importance to confirm the previous two-dimensional ultrasonography findings.

  3. The putative-farnesoic acid O-methyl transferase (FAMeT) gene of Ceratitis capitata: characterization and pre-imaginal life expression.

    Science.gov (United States)

    Vannini, Laura; Ciolfi, Silvia; Spinsanti, Giacomo; Panti, Cristina; Frati, Francesco; Dallai, Romano

    2010-02-01

    Farnesoic acid O-methyl transferase (FAMeT) is the enzyme involved in the penultimate step of insect juvenile hormone (JH) biosynthesis and is thus a key regulator in insect development and reproduction. We report the characterization of the putative-FAMeT in the medfly or Mediterranean fruit fly, Ceratitis capitata. This gene was identified by suppressive subtractive hybridization and completely sequenced by the screening of a medfly cDNA library. The obtained sequence was analyzed for conserved protein domain identification and its expression profile was evaluated by quantitative Real-Time PCR in medfly pre-imaginal life. The tissue expression of the isolated gene was verified by in situ hybridization on third instar larvae sections. The characterization of the isolated gene pointed out several typical features of methyl transferase genes. The pre-imaginal putative-FAMeT expression levels were consistent with JH titer change in Diptera. As recognized in some crustaceans, this gene seems to be widely expressed in the medfly as well. Ceratitis capitata is one of the most relevant agricultural pests against which insecticides and the sterile insect technique (SIT) are extensively used in spite of the well-known limitations of these approaches. Although results are not conclusive for the physiological role of the isolated gene, they suggest the characterization of a new gene in the Mediterranean fruit fly potentially involved in JH biosynthesis and may, therefore, have implications for pest control.

  4. Effects of acoustic waves on pupas of Ceratitis capitata. (Wied., 1824) (Diptera: Tephritidae); Efeitos das ondas acusticas em pupas de Ceratitis capitata. (Wied., 1824) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Barros, Adilson Camilo de

    2007-07-01

    The aim of this research has been to investigate the hypothesis that acoustic waves would provoke a measurable effect on a population of fruit flies, a treatment denominated sonication. Ionizing radiation, the causative agent for the treatment designated by irradiation has been used as a reference, as long as its effects on living beings and particularly on insects are widely known. This research also enquiries into the possible effects of acoustic waves and gamma rays. The experiments of sonication were carried out in the Laboratory of Entomology of the Instituto Biologico de Sao Paulo. The experiments of radiation were carried out in the Centro de Tecnologia das Radiacoes - IPEN, located within the campus of the University of Sao Paulo. It has been employed a Gamma cell source model 220 with average activity of 757.069 {+-} 293.484 curies (Ci) and an average doses rate of 3.106 {+-} 0.245 kilo grays per hour (kGy/h). Levels applied to the sonication treatment, in hertz and kilo Hertz were: 0 Hz (control) ; 5.0 Hz; 10.0 Hz; 20.0 Hz; 40.0 Hz; 60.0 Hz; 80.0 Hz; 1.0 k Hz; 2.0 k Hz; 10.0 k Hz; 15.0 k Hz e 20.0 k Hz. Irradiation doses applied in Grays were: 5.0 Gy; 7.5 Gy; 10.0 Gy; 12.5 Gy; 15 Gy; 50 Gy; 100 Gy; 150 Gy and 200 Gy. It has been used an acoustic tube made of glass - 40.6 cm in length and 9.1 cm in diameter - and sinusoidal waves originated from three acoustic sources, with response in decibels, which sound intensity varied from 93.60 {+-} 1.51 dB to 123.96 {+-} 0.23 dB. Final results have pointed to evidences that would justify the rejection of null hypothesis H{sub 0}, to which the average of the treatments due to acoustic waves do not differ significantly from each other.(author)

  5. Diversity and synanthropy of Calliphoridae (Diptera) in the region of Rio Claro, SP, Brazil.

    Science.gov (United States)

    De Souza, C R; Zuben, C J V

    2012-06-01

    Dipteran blowflies (Calliphoridae) are of great medical and hygienic importance as vectors of pathogens and as parasites of living and dead tissue, and their association with carrion allows their use in forensic entomology. The objective of this study was to determine the synanthropic index of adult Calliphoridae (Diptera) collected in Rio Claro, São Paulo. Sampling occurred between September 2009 and August 2010. Traps baited with sardines, beef liver, and minced meat were assessed for five consecutive days per month in three distinct ecological areas representing urban, rural, and forest environments. The most abundant species was Lucilia eximia (Wiedemann), followed by Chrysomya albiceps (Wiedemann) and Chrysomya megacephala (Fabricius). Lucilia eximia was the only species present in all seasons and the only species collected during the winter. The season with the lowest abundance was winter, with 69 (5.5%) specimens, and spring was the season with the greatest number of specimens collected (774-61.8%). The only species found outside inhabited areas (synanthropic) was Lucilia cuprina (Wiedemann), with a synanthropy index (SI) value of +5.7. The SI values for the other species were negative, showing a preference for uninhabited areas. The rural and urban areas were most similar in terms of species composition as were the beef and sardine baits. Among the baits used, liver attracted the greatest abundance of calliphorids, whereas minced meat attracted the greatest diversity.

  6. The significance of genetic polymorphisms within and between founder populations of Ceratitis capitata (Wied. from Argentina.

    Directory of Open Access Journals (Sweden)

    Alicia Basso

    Full Text Available BACKGROUND: The Mediterranean fruit fly Ceratitis Capitata (DIPTERA: Tephritidae is a major agricultural pest in Argentina. One main cause for the success of non-contaminant control programs based on genetic strategies is compatibility between natural and laboratory germplasms. A comprehensive characterization of the fruit fly based on genetic studies and compatibility analysis was undertaken on two founder populations from the provinces of Buenos Aires and Mendoza, used in pioneering sterile male technique control programmes in our country. The locations are 1,000 km apart from each other. METHODOLOGY/PRINCIPAL FINDINGS: We compared the genetic composition of both populations based on cytological, physiological and morphological characterization. Compatibility studies were performed in order to determine the presence of isolation barriers. Results indicate that the Buenos Aires germplasm described previously is partially different from that of the Mendoza population. Both laboratory colonies are a reservoir of mutational and cytological polymorphisms. Some sexual chromosome variants such as the XL and the YL resulting from attachment of a B-chromosome to the X-chromosome or Y-chromosome behave as a lethal sex-linked factor. Our results also show incompatibility between both germplasms and pre-zygotic isolation barriers between them. Our evidence is consistent with the fact that polymorphisms are responsible for the lack of compatibility. CONCLUSIONS: The genetic control mechanism should be directly produced in the germplasm of the target population in order to favour mating conditions. This is an additional requirement for the biological as well as economic success of control programs based on genetic strategies such as the sterile insect technique. The analysis of representative samples also revealed natural auto-control mechanisms which could be used in modifying pest population dynamics.

  7. The impact of industrial anthropization on mosquito (Diptera, Culicidae) communities in mangrove areas of Guanabara Bay (Rio de Janeiro, Brazil).

    Science.gov (United States)

    de Souza, A S; Couri, M S; Florindo, L

    2012-02-01

    The effects of industrial anthropization on species composition and community diversity of Culicidae (Diptera) were studied in a mangrove area impacted by industrial activities as compared to a preserved area, both around Guanabara Bay in the state of Rio de Janeiro, Brazil. Diversity, equitability, and species richness in Culicidae community differed between the studied areas. Indicator species analysis and correspondence analysis were carried out and indicated that the Sabethini, especially Wyeomyia (Phoniomyia) theobaldi Lane, Wyeomyia (Phoniomyia) fuscipes (Edwards), and a non-identified species of Wyeomyia sp. were associated to the preserved area, whereas Aedes taeniorhynchus Wiedemann and Aedes scapularis (Rondani) to the impacted area.

  8. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae and their parasitoids (Hymenoptera: Braconidae and Figitidae in orchards of guava, loquat and peach

    Directory of Open Access Journals (Sweden)

    MF. Souza-Filho

    Full Text Available This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann, A. obliqua (Macquart, A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker, N. glaberrima (Wiedemann, N. pendula (Bezzi, N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis, as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, D. brasiliensis (Szépligeti, Opius bellus Gahan, and Utetes anastrephae (Viereck, and five figitids: Aganaspis pelleranoi (Brèthes, Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower, Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut, and Trybliographa infuscata Diaz, Gallardo and Uchôa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years.

  9. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae) and their parasitoids (Hymenoptera: Braconidae and Figitidae) in orchards of guava, loquat and peach

    Energy Technology Data Exchange (ETDEWEB)

    Souza-Filho, M.F.; Raga, A. [Instituto Biologico, Campinas, SP (Brazil)], e-mail: miguelf@biologico.sp.gov.br; Azevedo-Filho, J.A. [Agencia Paulista de Tecnologia dos Agronegocios (APTA), Monte Alegre do Sul, SP (Brazil). Polo Regional do Leste Paulista; Strikis, P.C. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Biologia. Dept. de Parasitologia; Guimaraes, J.A. [EMBRAPA Agroindustria Tropical, Fortaleza, CE (Brazil); Zucchi, R.A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola

    2009-02-15

    This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann), A. obliqua (Macquart), A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis), as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck), Doryctobracon areolatus (Szepligeti), D. brasiliensis (Szepligeti), Opius bellus Gahan, and Utetes anastrephae (Viereck), and five figitids: Aganaspis pelleranoi (Brethes), Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower), Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut), and Trybliographa infuscata Diaz, Gallardo and Uchoa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years. (author)

  10. [Susceptibility of six Arabic coffee cultivars to fruit flies (Diptera: Tephritoidea) under shaded and unshaded organic management in Valença, State of Rio de Janeiro, Brazil].

    Science.gov (United States)

    Aguiar-Menezes, Elen L; Souza, Silvana A S; Santos, Carlos M A; Resende, André L S; Strikis, Pedro C; Costa, Janaína R; Ricci, Marta S F

    2007-01-01

    The infestation indices by fruit flies were determined for six cultivars of Coffea arabica L. in shaded and unshaded systems under organic management. The experiment was set in a completely randomized design with a split-split-plot arrangement and four replicates. A 250g-sample of maturing fruits per plot was harvested in May 2005. The cultivars Icatu Amarelo and Catucaí Amarelo were the least susceptible to attack by tephritids in both systems. As for lonchaeids, Oeiras, Catucaí Amarelo and Catuaí Vermelho were the least susceptible cultivars in the shaded system, and there was no difference among the cultivars in the unshaded system. The following tephritid species were obtained: Ceratitis capitata (Wiedemann), Anastrepha fraterculus (Wiedemann) and A. sororcula Zucchi (Tephritidae). Lonchaeids were represented by Neosilba bifida Strikis & Prado, N. certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. pseudopendula (Korytkowski and Ojeda), Dasiops rugifrons Hennig, Neosilba n.sp.10 and Neosilba n.sp.14.

  11. Anticancer properties of Thymbra capitata and Helichrysum italicum essential oils

    Directory of Open Access Journals (Sweden)

    Juliana Poças

    2014-06-01

    It has long been recognised that some EOs have antimicrobial, antibacterial, antioxidant, antiviral, antimycotic, antiparasitic, insecticidal activities. However, studies into their anti-tumoral activities are scarce. This study, indicates that Thymbra capitata and Helichrysum italicum EOs exhibited antitumor activity against RKO and MCF7 cells, deserving further research into both the mechanism of the observed anti-tumour activity and potential cancer therapeutic applications.

  12. Genetics differentiation in the Mediterranean fruit fly, Ceratitis capitata (Wiedemann)%地中海实蝇地理种群遗传分化研究

    Institute of Scientific and Technical Information of China (English)

    林丽莉; 曾玲; 梁广文; 吴佳教; 顾渝娟; 刘海军; 胡学难

    2010-01-01

    以mtDNA的CO Ⅰ基因的部分序列作为分子标记,研究了来自安哥拉、黎巴嫩、刚果共和国、尼日利亚、贝宁、多哥、加纳、科特迪瓦、南非、埃及、法国、约旦、秘鲁、智利、美国佛罗里达和美国夏威夷等16个国家和地区共75个个体的地中海实蝇Ceratitis capitaza地理种群序列特征和单倍型特征,并分析了各种群间的遗传分化水平和进化关系,结果表明,在供试的样品中发现单倍型的数目是29,其中有5种为共享倍型.地中海实蝇各地理种群的遗传多态性水平差异较大,总体遗传距离D等于0.007.非洲南撒哈拉区(安哥拉、刚果、尼日利亚、贝宁、多哥、加纳、科特迪瓦)的种群的单倍型数、单倍型百分比和群内遗传距离等遗传多态性参数值都高于其它供试地区,多样性明显较其他地区丰富.

  13. Behavioral effects of plant essential oils on Ceratitis capitata males – risk versus reward

    Science.gov (United States)

    Plant essential oils have a number of roles in insect pest management. For male Ceratitis capitata, these roles include male-targeted attractants for traps and aromatherapy exposure for increased mating success. Essential oils that affect C. capitata behavior may be from either host or non-host pl...

  14. Hypolipidemic effects of aqueous extract of Acalypha capitata leaves in rats fed on high cholesterol diet

    Institute of Scientific and Technical Information of China (English)

    Nnodim Johnkennedy; Emejulu Adamma; Nwadike Constance Nnedimma

    2011-01-01

    Objective:To evaluate the hypolipidemic effects of aqueous extract of Acalypha capitata (A. capitata) leaves in rats fed on high cholesterol diet. Methods:Cholesterol diet was administered to Wistar rats at a dose of 40 mg per 0.2 mL 3 times daily for 14 days while the control received distilled water. These animals were treated with extract of A. capitata at doses of 100 and 200 mg/kg. Lipid profiles were observed and compared. Results:Administration of A. capitata caused significant decrease in cholesterol, triglyceride and low density lipoprotein-cholesterol when compared with the control (P<0.05) which was dose dependent. Also, it was observed that high density lipoprotein-cholesterol was significantly increased when compared with the control. Conclusions:This observation suggests that the leaf extract of A. capitata could probably serve as a potential natural product for treatment of hyperlipidaemia.

  15. Wiedemann-Steiner Syndrome With 2 Novel KMT2A Mutations.

    Science.gov (United States)

    Min Ko, Jung; Cho, Jae So; Yoo, Yongjin; Seo, Jieun; Choi, Murim; Chae, Jong-Hee; Lee, Hye-Ran; Cho, Tae-Joon

    2017-02-01

    Wiedemann-Steiner syndrome is a rare genetic disorder characterized by short stature, hairy elbows, facial dysmorphism, and developmental delay. It can also be accompanied by musculoskeletal anomalies such as muscular hypotonia and small hands and feet. Mutations in the KMT2A gene have only recently been identified as the cause of Wiedemann-Steiner syndrome; therefore, only 16 patients from 15 families have been described, and new phenotypic features continue to be added. In this report, we describe 2 newly identified patients with Wiedemann-Steiner syndrome who presented with variable severity. One girl exhibited developmental dysplasia of the hip and fibromatosis colli accompanied by other clinical features, including facial dysmorphism, hypertrichosis, patent ductus arteriosus, growth retardation, and borderline intellectual disability. The other patient, a boy, showed severe developmental retardation with automatic self-mutilation, facial dysmorphism, and hypertrichosis at a later age. Exome sequencing analysis of these patients and their parents revealed a de novo nonsense mutation, p.Gln1978*, of KMT2A in the former, and a missense mutation, p.Gly1168Asp, in the latter, which molecularly confirmed the diagnosis of Wiedemann-Steiner syndrome.

  16. Prenatal molecular testing for Beckwith-Wiedemann and Silver-Russell syndromes

    DEFF Research Database (Denmark)

    Eggermann, Thomas; Brioude, Frédéric; Russo, Silvia

    2016-01-01

    Beckwith-Wiedemann and Silver-Russell syndromes (BWS/SRS) are two imprinting disorders (IDs) associated with disturbances of the 11p15.5 chromosomal region. In BWS, epimutations and genomic alterations within 11p15.5 are observed in >70% of patients, whereas in SRS they are observed in about 60...

  17. Finding column depedencies in sparse matrices over $ F_ 2 $ by block Wiedemann

    NARCIS (Netherlands)

    Penninga, O.

    1998-01-01

    Large systems of linear equations over $mathbb{F_2$ with sparse coefficient matrices have to be solved as a part of integer factorization with sieve-based methods such as in the Number Field Sieve algorithm. In this report, we first discuss the Wiedemann algorithm to solve these systems and investig

  18. Beckwith-Wiedemann syndrome and bilateral adrenal pheochromocytoma: sonography and MRI findings

    Energy Technology Data Exchange (ETDEWEB)

    Baldisserotto, Matteo; Peletti, Adriana Barcellos; Araujo, Manoel Angelo de; Pertence, Ana Paula Cardoso; Dora, Marcelo Dourado; Maciel, Elines Oliva; Gaiger, Ana Maria [Hospital da Crianca Conceicao, Departamento de Radiologia, Porto Alegre, RS (Brazil)

    2005-11-01

    Beckwith-Wiedemann syndrome is characterized by a group of clinical abnormalities, the most frequent of which are omphalocele, macroglossia, gigantism, neonatal hypoglycemia and umbilical hernia. The association of this syndrome with malignant tumors is well documented. We report a child with this syndrome associated with bilateral adrenal pheochromocytoma. (orig.)

  19. SNP arrays in Beckwith-Wiedemann syndrome: an improved diagnostic strategy.

    Science.gov (United States)

    Keren, Boris; Chantot-Bastaraud, Sandra; Brioude, Frédéric; Mach, Corinne; Fonteneau, Eric; Azzi, Salah; Depienne, Christel; Brice, Alexis; Netchine, Irène; Le Bouc, Yves; Siffroi, Jean-Pierre; Rossignol, Sylvie

    2013-10-01

    Beckwith-Wiedemann syndrome is an overgrowth disorder with an increased risk of childhood tumors that results from a dysregulation of imprinted gene expression in the 11p15 region. Since epigenetic defects are the most frequent anomalies, first-line diagnostic methods involve methylation analysis. When paternal isodisomy is suspected, it should be confirmed by a second technique capable of distinguishing true 11p15 paternal disomy (patUPD) from paternal 11p15 duplication or 11p15 trisomy. We sought to evaluate the interest of using SNP arrays in the Beckwith-Wiedemann syndrome diagnostic strategy. We analyzed the SNP profiles of 25 Beckwith Wiedemann patients with previously determined methylation indexes. Among them, 3 had 11p15 trisomies, 13 had patUPD, 8 had an inconclusive methylation index and 1 had a normal result. All known trisomies and known patUPDs were detected. Moreover we found 7 low-rate mosaicisms 11p15 patUPDs among the 8 patients with an inconclusive methylation index. We were able to precisely characterize the sizes and mosaicism rates of the anomalies. We demonstrate that SNP arrays are of real diagnostic interest in Beckwith-Wiedemann syndrome: 1) they help to distinguish patUPDs from trisomies more precisely than karyotyping and FISH, 2) they help determine the size and mosaicism rate of patUPDs, 3) they provide complementary information in inconclusive cases, helping to distinguish low-rate patUPD mosaicism from other BWS-related molecular defects.

  20. Global assessment of seasonal potential distribution of Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Anna M Szyniszewska

    Full Text Available The Mediterranean fruit fly (Medfly is one of the world's most economically damaging pests. It displays highly seasonal population dynamics, and the environmental conditions suitable for its abundance are not constant throughout the year in most places. An extensive literature search was performed to obtain the most comprehensive data on the historical and contemporary spatio-temporal occurrence of the pest globally. The database constructed contained 2328 unique geo-located entries on Medfly detection sites from 43 countries and nearly 500 unique localities, as well as information on hosts, life stages and capture method. Of these, 125 localities had information on the month when Medfly was recorded and these data were complemented by additional material found in comprehensive databases available online. Records from 1980 until present were used for medfly environmental niche modeling. Maximum Entropy Algorithm (MaxEnt and a set of seasonally varying environmental covariates were used to predict the fundamental niche of the Medfly on a global scale. Three seasonal maps were also produced: January-April, May-August and September-December. Models performed significantly better than random achieving high accuracy scores, indicating a good discrimination of suitable versus unsuitable areas for the presence of the species.

  1. Global assessment of seasonal potential distribution of Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Szyniszewska, Anna M; Tatem, Andrew J

    2014-01-01

    The Mediterranean fruit fly (Medfly) is one of the world's most economically damaging pests. It displays highly seasonal population dynamics, and the environmental conditions suitable for its abundance are not constant throughout the year in most places. An extensive literature search was performed to obtain the most comprehensive data on the historical and contemporary spatio-temporal occurrence of the pest globally. The database constructed contained 2328 unique geo-located entries on Medfly detection sites from 43 countries and nearly 500 unique localities, as well as information on hosts, life stages and capture method. Of these, 125 localities had information on the month when Medfly was recorded and these data were complemented by additional material found in comprehensive databases available online. Records from 1980 until present were used for medfly environmental niche modeling. Maximum Entropy Algorithm (MaxEnt) and a set of seasonally varying environmental covariates were used to predict the fundamental niche of the Medfly on a global scale. Three seasonal maps were also produced: January-April, May-August and September-December. Models performed significantly better than random achieving high accuracy scores, indicating a good discrimination of suitable versus unsuitable areas for the presence of the species.

  2. Effect of dietary components on larval life history characteristics in the medfly (Ceratitis capitata: Diptera, Tephritidae.

    Directory of Open Access Journals (Sweden)

    William J Nash

    Full Text Available BACKGROUND: The ability to respond to heterogenous nutritional resources is an important factor in the adaptive radiation of insects such as the highly polyphagous Medfly. Here we examined the breadth of the Medfly's capacity to respond to different developmental conditions, by experimentally altering diet components as a proxy for host quality and novelty. METHODOLOGY/PRINCIPAL FINDINGS: We tested responses of larval life history to diets containing protein and carbohydrate components found in and outside the natural host range of this species. A 40% reduction in the quantity of protein caused a significant increase in egg to adult mortality by 26.5%±6% in comparison to the standard baseline diet. Proteins and carbohydrates had differential effects on larval versus pupal development and survival. Addition of a novel protein source, casein (i.e. milk protein, to the diet increased larval mortality by 19.4%±3% and also lengthened the duration of larval development by 1.93±0.5 days in comparison to the standard diet. Alteration of dietary carbohydrate, by replacing the baseline starch with simple sugars, increased mortality specifically within the pupal stage (by 28.2%±8% and 26.2%±9% for glucose and maltose diets, respectively. Development in the presence of the novel carbohydrate lactose (milk sugar was successful, though on this diet there was a decrease of 29.8±1.6 µg in mean pupal weight in comparison to pupae reared on the baseline diet. CONCLUSIONS: The results confirm that laboratory reared Medfly retain the ability to survive development through a wide range of fluctuations in the nutritional environment. We highlight new facets of the responses of different stages of holometabolous life histories to key dietary components. The results are relevant to colonisation scenarios and key to the biology of this highly invasive species.

  3. Partial KCNQ1OT1 hypomethylation: A disguised familial Beckwith–Wiedemann syndrome as a sporadic adrenocortical tumor

    Directory of Open Access Journals (Sweden)

    Dorra H'mida Ben-Brahim

    2015-03-01

    Full Text Available Beckwith–Wiedemann syndrome has a wide spectrum of complications such as embryonal tumors, namely adrenocortical tumor. Tumor predisposition is one of the most challenging manifestations of this syndrome. A 45-day old female with a family history of adrenocortical tumor presented with adrenocortical tumor. The case raised suspicion of a hereditary Beckwith–Wiedemann syndrome, therefore molecular analysis was undertaken. The results revealed partial KCNQ1OT1 hypomethylation in the infant's blood DNA which was associated with a complete loss of methylation in the infant's adrenocortical tumor tissue. It is unique for familial Beckwith–Wiedemann syndrome caused by KCNQ1OT1 partial hypomethylation to manifest solely through adrenocortical tumor. Incomplete penetrance and specific tissue mosaicism could provide explanations to this novel hereditary Beckwith–Wiedemann syndrome presentation.

  4. Effects of within-generation thermal history on the flight performance of Ceratitis capitata: colder is better.

    Science.gov (United States)

    Esterhuizen, Nanike; Clusella-Trullas, Susana; van Daalen, Corne E; Schoombie, Ruben E; Boardman, Leigh; Terblanche, John S

    2014-10-01

    The influence of thermal history on temperature-dependent flight performance was investigated in an invasive agricultural pest insect, Ceratitis capitata (Diptera: Tephritidae). Flies were exposed to one of four developmental acclimation temperatures (Tacc: 15, 20, 25, 30°C) during their pupal stage and tested at these temperatures (Ttest) as adults using a full-factorial study design. Major factors influencing flight performance included sex, body mass, Ttest and the interaction between Ttest and Tacc. Successful flight performance increased with increasing Ttest across all acclimation groups (from 10% at 15°C to 77% at 30°C). Although Tacc did not affect flight performance independently, it did have a significant interaction effect with Ttest. Multiple comparisons showed that flies which had been acclimated to 15°C and 20°C performed better than those acclimated to 25°C and 30°C when tested at cold temperatures, but warm-acclimated flies did not outperform cold-acclimated flies at warmer temperatures. This provides partial support for the 'colder is better' hypothesis. To explain these results, several flight-related traits were examined to determine whether Tacc influenced flight performance as a consequence of changes in body or wing morphology, whole-animal metabolic rate or cytochrome c oxidase enzyme activity. Although significant effects of Tacc could be detected in several of the traits examined, with an emphasis on sex-related differences, increased flight performance could not be explained solely on the basis of changes in any of these traits. Overall, these results are important for understanding dispersal physiology despite the fact that the mechanisms of acclimation-related changes in flight performance remain unresolved.

  5. Dietas naturais na criação de Chrysomya albiceps (Wiedemann, 1819; Diptera: Calliphoridae): estudo comparado Natural diets to rear Chrysomya albiceps (Wiedemann, 1819; Diptera: Calliphoridae): a comparative study

    OpenAIRE

    Rosemary Cardoso Ribeiro; Eliane Maria Vieira Milward-de-Azevedo

    1997-01-01

    Procurou-se observar o desenvolvimento pós-embrionário de Chrysomya albiceps, testando-se, comparativamente, dietas à base de sardinha e carne eqüina. Os substratos frescos foram previamente mantidos a 30°C de temperatura durante duas horas. Foram inoculadas 50 neolarvas em 100g de dieta por repetição. Utilizaram-se quatro repetições por tratamento. O experimento foi conduzido em condições de laboratório. O peso médio das larvas após o abandono espontâneo das dietas foi de 91,19mg, no sub...

  6. Dietas naturais na criação de Chrysomya albiceps (Wiedemann, 1819; Diptera: Calliphoridae: estudo comparado Natural diets to rear Chrysomya albiceps (Wiedemann, 1819; Diptera: Calliphoridae: a comparative study

    Directory of Open Access Journals (Sweden)

    Rosemary Cardoso Ribeiro

    1997-12-01

    Full Text Available Procurou-se observar o desenvolvimento pós-embrionário de Chrysomya albiceps, testando-se, comparativamente, dietas à base de sardinha e carne eqüina. Os substratos frescos foram previamente mantidos a 30°C de temperatura durante duas horas. Foram inoculadas 50 neolarvas em 100g de dieta por repetição. Utilizaram-se quatro repetições por tratamento. O experimento foi conduzido em condições de laboratório. O peso médio das larvas após o abandono espontâneo das dietas foi de 91,19mg, no substrato à base de carne eqüina e 76,01mg, no substrato à base de sardinha, a diferença foi, portanto, significativa. A taxa de sobrevivência larval registrada foi superior a 80%, enquanto a taxa de sobrevivência pupal foi próxima a 100%. A razão sexual foi próxima a 0,5. A dieta à base de carne eqüina mostrou-se mais adequada ao desenvolvimento de C. albiceps, pois as larvas mantidas neste substrato apresentaram-se mais pesadas, o que potencializa a capacidade reprodutiva do adulto.The objective of the present study was to observe the postembryonic development of Chrysomya albiceps reared on sardines or horse meat and to compare the results. Fresh substratos were maintened m an oven ai 30°C for 2 hours. Fifty newly emerged larvas were inoculated into 100g diel per reptication. Four replications per treatment were used. The experiment was conducted under laboratory conditions. The mean weight of postfeeding larvas was 91.19mg for especimens reared on horse meat and 76.01mg for especimens reared on sardines, with a marked difference between diets. Larval viability was more than 80% for the two diets, while pupal viability was dose to 100%. The sex ratio was about 0.5. The horse meat diet proved to be more adequate for the development of C. albiceps since the larvas weighed more, with consequent potentiations of adult reproductive abilily.

  7. The preparation of the rice coral Montipora capitata nubbins for application in coral-reef ecotoxicology.

    Science.gov (United States)

    Vijayavel, K; Richmond, R H

    2012-04-01

    Securing adequate and appropriate source material for coral-reef ecotoxicology studies is a significant impediment to conducting various experiments supporting the goal of conserving coral-reef ecosystems. Collecting colonies from wild stocks may be counter to protecting coral reef populations. To address this issue the rice coral Montipora capitata was used to generate sufficient genetically identical nubbins for research purposes. Growth and survival rates of these laboratory-prepared M. capitata nubbins were studied over a period of 90 days. The resulting data support the conclusion that the laboratory-prepared M. capitata nubbins showed successful growth and survival rates and are the best solution to solve the source material issue for lab experimentation. This paper describes the laboratory method used for the preparation and maintenance of these M. capitata nubbins and discusses the benefits and difficulties of using these nubbins in ecotoxicity studies.

  8. Isolation and characterization of microsatellite loci in tropical forage Stylosanthes capitata Vogel.

    Science.gov (United States)

    Santos, M O; Sassaki, R P; Chiari, L; Resende, R M S; DE Souza, A P

    2009-01-01

    Stylosanthes capitata is an important tropical pasture legume. Knowledge of genetic diversity and structure of S. capitata populations is of great importance for the conservation and germplasm management of this species. Thus, eight microsatellite markers were developed from an S. capitata-enriched library. They were characterized in 20 accessions from the germplasm collection of the Empresa Brasileira de Pesquisa Agropecuária (Embrapa). The observed and expected heterozygosities ranged from 0.16 to 0.85 and from 0.40 to 0.85, respectively. These microsatellites are the first set of molecular markers from this species and will contribute towards studies of genetic diversity, conservation and breeding of S. capitata.

  9. Influência da dieta no desenvolvimento oogênico de Fannia pusio (Wiedemann, 1830 (Diptera, Fanniidae

    Directory of Open Access Journals (Sweden)

    Márcia Souto Couri

    1990-01-01

    Full Text Available Females of Fannia pusio were submitted to three different diets (sugar, fish and sugar + liver, which influence in the oogenetic development was observed. The oogenesis was completed in the 15th. day, both under sugar or sugar + liver diets. This species proved to be autogenous for the first ovarian cycle.

  10. Estudo morfologico e histoquimico das glandulas sexuais acessorias de chrysomya putoria durante a ovogenese (wiedemann) (diptera : calliphoridae)

    OpenAIRE

    1995-01-01

    Resumo: Chrysomya putoria é uma mosca varejeira normalmente associada a locais com precárias condições de higiene. Na natureza ela cria-se em carcaças e no esterco que acumula-se sob as gaiolas de galinhas poedeiras. Esta mosca está no Brasil a cerca de duas décadas mas na Áftica, seu local de origem, ela é descrita como díptero causador facultativo de miíase. As glândulas sexuais acessórias de temeas tem um importante papel em diferentes etapas da fertilização do ovo e sua ausência experimen...

  11. Influência da dieta no desenvolvimento oogênico de Fannia pusio (Wiedemann, 1830) (Diptera, Fanniidae)

    OpenAIRE

    Márcia Souto Couri

    1990-01-01

    Females of Fannia pusio were submitted to three different diets (sugar, fish and sugar + liver), which influence in the oogenetic development was observed. The oogenesis was completed in the 15th. day, both under sugar or sugar + liver diets. This species proved to be autogenous for the first ovarian cycle.

  12. Bionomy of two flies of sanitary and forensic importance: Peckia (Sarcodexia lambens (Wiedemann and Oxysarcodexia amorosa (Schiner (Diptera, Sarcophagidae

    Directory of Open Access Journals (Sweden)

    Alexandre da Silva Xavier

    2015-09-01

    Full Text Available ABSTRACTThis study aims to elucidate the bionomy of Peckia(Sarcodexia lambens and Oxysarcodexia amorosa to provide data for medical, veterinary and forensic entomology analyses. We analyzed larval stage duration (L1–L3, weight of the mature larvae (L3, pupal stage duration, L1–adult duration, adult emergence and viability of larvae and adults of both species. Larval viability of P. (S. lambens was 82% and the mean duration of the larval stage was 3.51 ± 0.99 days. The mature larvae had a mean weight of 33.67 ± 7.13 mg. The mean duration of the pupal stage was 8.26 ± 0.93 days and the mean duration of the L1–adult was 11.53 ± 1.22 days. Mean lifespan for females and males was 39.33 ± 1.52 and 57.33 ± 4.72 days, respectively. Larval viability of O. amorosa was 76% and mean duration of larval stage was 3.51 ± 0.64 days. Mature larvae had a mean weight of 28.28 ± 3.38 mg. Mean duration of the pupal stage was 10.14 ± 0.63 days and mean duration of the L1–adult was 13.60 ± 0.69 days. Mean lifespan for females and males was 83.66 ± 15.94 and 84.00 ± 19.97 days, respectively. Oxysarcodexia amorosa showed a L1–adult stage longer than P. (S. lambens; however both species showed low viability. O. amorosa laid more larvae than P. (S. lambens, this fact may occur because O. amorosa had longer life duration.

  13. Adult population dynamics of the bolivian fruit flies Anastrepha sp. (Diptera: Tephritidae at Municipality Coroico, Department of The La Paz, Bolivia

    Directory of Open Access Journals (Sweden)

    Gonzáles Manuel

    2011-08-01

    Full Text Available The investigation was carried out in Paco (1603 msnm communities, it Marca (1511 msnm and Capellania (1720 msnm, of the Municipality of Coroico, department of La Paz, Bolivia. In orchards frutícolas semicomerciales, they settled 15 traps distributed McPhail in a similar way among areas, five for community, sampling" "points. The censuses were carried out with an interval of 15 days, they were identified and they quantified the mature flies of the fruit. For the captures of the individuals, they settled the traps McPhail, using the attractive (Buminal one and as conserving borax. The traps were distributed in representative parcels, having as main cultivations, orange, mandarin, grapefruit, guava and avocado. The identification taxonómica of the captured species was carried out in the laboratory of the National Program of Control of Flies of the fruit (PROMOSCA, clerk of the National Service of Agricultural Sanity and Alimentary (SENASAG Inocuidad. 1210 mature flies of the fruit were captures, those that grouped for species, sex, capture dates and community, corresponding to the seven carried out censuses. The species of Anastrepha fraterculus (Wiedeman were identified, Anastrepha striata Schiner, Anastrepha serpentine (Wiedeman, Anastrepha sp, Ceratitis capitata (Wiedemann, Blepharoneura sp Loew, Hexaresta sp Hering, Hexachaeta sp Loew, Tomoplagia sp Coquillett, Tetreuaresta sp Hendel, being that of more presence Anastrepha fraterculus (Wiedeman with 818 and Ceratitis capitata (Wiedemann, with 354. The temperature and presence of spices put up frutícolas of flies of the fruit in maturation state explain the observed fluctuations.

  14. Glycosidases in the plasma membrane of Ceratitis capitata spermatozoa.

    Science.gov (United States)

    Intra, Jari; De Caro, Daniela; Perotti, Maria-Elisa; Pasini, Maria Enrica

    2011-02-01

    Fruit flies in the family Tephritidae are rated among the world's most destructive agricultural pests. The Mediterranean fruit fly Ceratitis capitata is emerging as a model organism to study the fertilization in Insects. Three integral proteins with glycosidase activity are present in the plasma membrane of spermatozoa. The glycosidases have been purified and characterized. We have demonstrated the presence of three enzymes, a β-N-acetylhexosaminidase, an α-mannosidase and an α-l-fucosidase. The molecular mass of the native enzymes estimated by gel filtration was 160 kDa for β-N-acetylhexosaminidase, 310 kDa for α-mannosidase and 140 kDa for α-l-fucosidase. SDS-PAGE showed that β-N-acetylhexosaminidase is a dimer of a single protein of 73 kDa, α-mannosidase consists of six subunits with different molecular weights and α-l-fucosidase is a dimer made up by two different monomers. Characterization of the purified enzymes included glycosylation pattern, pI, optimal pH, substrate preference, kinetic properties and thermal stability. Soluble forms similar to the sperm associated glycosidases are present. Polyclonal antibodies raised against synthetic peptides designed from the predicted products of the Drosophila melanogaster genes encoding β-N-acetylhexosaminidase and α-l-fucosidase were used. Immunofluorescence labelling of spermatozoa showed that the enzymes are present in the sperm plasma membrane overlying the acrosome and the tail. This work represents the first report on the characterization in C. capitata of sperm proteins that are potentially involved in primary gamete recognition.

  15. Threshold Concentration of Limonoids (Azamax) for Preventing Infestation by Mediterranean Fruit Fly (Diptera: Tephritidae).

    Science.gov (United States)

    Silva, M A; Bezerra-Silva, G C D; Vendramim, J D; Forim, M R; Sá, I C G

    2015-04-01

    This study identified the threshold concentration of limonoids for the complete inhibition of oviposition of Ceratitis capitata (Wiedemann) in grapes 'Itália.' Choice and no-choice experiments with the insect were performed. The three no-choice bioassays were conducted following a completely randomized design with 18 treatments (three densities of insects [one, two, or three females]×five concentrations of limonoids and control) and 20 replicates. In a free choice bioassay, two fruits per cage (a treatment grape and a control) were provided for ovipositing. Three densities of insects (one, two, or three females) were used, with 15 replicates. Bioassays were conducted at 25±2°C, 60±10% relative humidity, and a photoperiod of 14:10 (L:D) h. The inhibition of oviposition of C. capitata was concentration dependent, with infestation occurring at lower concentrations of azadirachtin (+3-tigloylazadirachtol) and complete inhibition occurring at concentrations at or exceeding 100 ppm azadirachtin (+28.5 ppm of 3-tigloylazadirachtol), maintaining protective effects even at the most densely populated treatment (three females per fruit). When the pest had a free choice of host grapes (treatment vs. control), severe inhibition was observed at concentrations≥50 ppm azadirachtin (+14.3 ppm of 3-tigloylazadirachtol). We conclude that a threshold concentration of 100 ppm azadirachtin (+28.5 ppm of 3-tigloylazadirachtol) is capable of preventing grape infestation. This concentration is likely to provide a reliable level of protection, as the experimental population density of three females per fruit usually does not occur in the field and wild flies usually have more host options.

  16. Caracterização da fauna de moscas-das-frutas (Diptera: Tephritidae na região de Ponta Grossa, Paraná, Brasil Characterization of the fauna of fruit flies (Diptera: Tephritidae in the region of Ponta Grossa, Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Patricia Elizabeth Husch

    2012-10-01

    Full Text Available Apesar do incentivo e do investimento na produção de frutas no estado do Paraná, pouca informação está disponível sobre as moscas-das-frutas, uma das principais pragas da fruticultura. O presente trabalho teve os objetivos de registrar pela primeira vez a fauna de tefritídeos, na região de Ponta Grossa, e caracterizar a sua comunidade por meio de diferentes índices faunísticos. Adultos de tefritídeos foram coletados por meio de frascos caça-moscas com atrativos alimentares em quatro pomares de agosto a dezembro de 2009. Foi coletado um total de 2.428 tefritídeos distribuídos em sete espécies: Anastrepha fraterculus Wiedemann, Anastrepha montei Lima, Anastrepha pseudoparallela Loew, Anastrepha sororcula Zucchi, Ceratitis capitata Wiedemann, Rhagoletis sp. Loew e Hexachaeta sp. Loew. A. fraterculus foi a única espécie comum aos quatro pomares, ocorrendo com frequência acima de 80%. Este é o primeiro registro de A. montei no Paraná. A. fraterculus, A. sororcula e C. capitata apresentaram os maiores índices de frequência, abundância, dominância e constância, sendo, portanto, consideradas espécies predominantes. O maior índice de diversidade (H'=0,4360 ocorreu no pomar 2, diferindo significativamente dos demais pomares (teste t, PIn spite of encouragement and investment in fruit production in the state of Paraná, little information is available on the fruit flies, a major pest in fruit growing. The present study had the objective of recording for the first time the tephritid fauna in the region of Ponta Grossa, and characterize the insect community through different faunal indices. Adult tephritids were collected by means of flapper bottles with food baits in four orchards from August to December 2009. A total of 2,428 tephritids distributed in seven species were collected: Anastrepha fraterculus Wiedemann, Anastrepha montei Lima, Anastrepha pseudoparallela Loew, Anastrepha sororcula Zucchi, Ceratitis capitata Wiedemann

  17. Evidence for potential of managing some African fruit fly species (Diptera: Tephritidae) using the mango fruit fly host-marking pheromone.

    Science.gov (United States)

    Kachigamba, Donald L; Ekesi, Sunday; Ndungu, Mary W; Gitonga, Linus M; Teal, Peter E A; Torto, Baldwyn

    2012-12-01

    We investigated conspecific and heterospecific oviposition host discrimination among four economically important fruit fly pests of mango in Africa (Ceratitis capitata, Wiedemann; C. fasciventris, Bezzi; C. rosa, Karsch, and C. cosyra, Walker) with regard to host-marking behavior and fecal matter aqueous solutions. The objective of the study was to get insight into the potential of managing these pests using the host-marking technique. Observations were done on mango slices marked by the flies and treated with aqueous solutions of fecal matter of the flies, respectively. In both host-marking and fecal matter experiments, C. cosyra, which is the most destructive species of the four on mango, was exceptional. It only discriminated against hosts treated with its fecal matter but with lower sensitivity while C. capitata and C.fasciventris discriminated against hosts marked by it or treated with its fecal matter and with higher sensitivity. Our results provide evidence for potential of managing some of the major fruit fly species infesting mango in Africa using the host-marking pheromone of the mango fruit fly, C. cosyra.

  18. Permethrin resistance in Aedes albopictus (Diptera: Culicidae) and associated fitness costs.

    Science.gov (United States)

    Chan, Hiang Hao; Zairi, Jaal

    2013-03-01

    Insecticide resistance has become a serious issue in vector management programs. Information on insecticidal resistance and its associated mechanisms is important for successful insecticide resistance management. The selection of a colony of permethrin-resistant Aedes albopictus (Skuse) (Diptera: Culicidae), originating from Penang Island, Malaysia, yielded high larval-specific resistance to permethrin and cross-resistance to deltamethrin. Synergism assays showed that the major mechanism underlying this resistance involves cytochrome P450 monooxygenase. The resistance is autosomal, polygenically inherited and incompletely dominant (D = 0.26). Resistant larvae were reared under different conditions to assess the fitness costs. Under high larval density, larval development time of the resistant SGI strain was significantly longer than the susceptible VCRU strain. In both high- and low-density conditions SGI showed a lower rate of emergence and survival compared with the VCRU strain. Resistant larvae were more susceptible to predation by Toxorhynchites splendens (Wiedemann) (Diptera: Culicidae) larvae. The body size of SGI females reared under high-density conditions was larger compared with females of the susceptible strain. SGI females survived longer when starved than did VCRU females. The energy reserve upon eclosion was positively correlated with the size of the adults.

  19. De novo assembly and transcriptome analysis of the Mediterranean fruit fly Ceratitis capitata early embryos.

    Directory of Open Access Journals (Sweden)

    Marco Salvemini

    Full Text Available The agricultural pest Ceratitis capitata, also known as the Mediterranean fruit fly or Medfly, belongs to the Tephritidae family, which includes a large number of other damaging pest species. The Medfly has been the first non-drosophilid fly species which has been genetically transformed paving the way for designing genetic-based pest control strategies. Furthermore, it is an experimentally tractable model, in which transient and transgene-mediated RNAi have been successfully used. We applied Illumina sequencing to total RNA preparations of 8-10 hours old embryos of C. capitata, This developmental window corresponds to the blastoderm cellularization stage. In summary, we assembled 42,614 transcripts which cluster in 26,319 unique transcripts of which 11,045 correspond to protein coding genes; we identified several hundreds of long ncRNAs; we found an enrichment of transcripts encoding RNA binding proteins among the highly expressed transcripts, such as CcTRA-2, known to be necessary to establish and, most likely, to maintain female sex of C. capitata. Our study is the first de novo assembly performed for Ceratitis capitata based on Illumina NGS technology during embryogenesis and it adds novel data to the previously published C. capitata EST databases. We expect that it will be useful for a variety of applications such as gene cloning and phylogenetic analyses, as well as to advance genetic research and biotechnological applications in the Medfly and other related Tephritidae.

  20. De novo assembly and transcriptome analysis of the Mediterranean fruit fly Ceratitis capitata early embryos.

    Science.gov (United States)

    Salvemini, Marco; Arunkumar, Kallare P; Nagaraju, Javaregowda; Sanges, Remo; Petrella, Valeria; Tomar, Archana; Zhang, Hongyu; Zheng, Weiwei; Saccone, Giuseppe

    2014-01-01

    The agricultural pest Ceratitis capitata, also known as the Mediterranean fruit fly or Medfly, belongs to the Tephritidae family, which includes a large number of other damaging pest species. The Medfly has been the first non-drosophilid fly species which has been genetically transformed paving the way for designing genetic-based pest control strategies. Furthermore, it is an experimentally tractable model, in which transient and transgene-mediated RNAi have been successfully used. We applied Illumina sequencing to total RNA preparations of 8-10 hours old embryos of C. capitata, This developmental window corresponds to the blastoderm cellularization stage. In summary, we assembled 42,614 transcripts which cluster in 26,319 unique transcripts of which 11,045 correspond to protein coding genes; we identified several hundreds of long ncRNAs; we found an enrichment of transcripts encoding RNA binding proteins among the highly expressed transcripts, such as CcTRA-2, known to be necessary to establish and, most likely, to maintain female sex of C. capitata. Our study is the first de novo assembly performed for Ceratitis capitata based on Illumina NGS technology during embryogenesis and it adds novel data to the previously published C. capitata EST databases. We expect that it will be useful for a variety of applications such as gene cloning and phylogenetic analyses, as well as to advance genetic research and biotechnological applications in the Medfly and other related Tephritidae.

  1. Nonlinear heat transport in mesoscopic conductors: Rectification, Peltier effect, and Wiedemann-Franz law

    Science.gov (United States)

    López, Rosa; Sánchez, David

    2013-07-01

    We investigate nonlinear heat properties in mesoscopic conductors using a scattering theory of transport. Our approach is based on a leading-order expansion in both the electrical and thermal driving forces. Beyond linear response, the transport coefficients are functions of the nonequilibrium screening potential that builds up in the system due to interactions. Within a mean-field approximation, we self-consistently calculate the heat rectification properties of a quantum dot attached to two terminals. We discuss nonlinear contributions to the Peltier effect and find departures from the Wiedemann-Franz law in the nonlinear regime of transport.

  2. Caracterização química da amêndoa de coquinho-azedo (Butia capitata var capitata Chemical characterization of nut of Butia capitata var capitata

    Directory of Open Access Journals (Sweden)

    Juliana Pereira Faria

    2008-06-01

    Full Text Available A palmeira Butia capitata var capitata produz o coquinho-azedo, fruto de odor agradável e penetrante, cuja polpa é aproveitada para a produção de um suco saboroso na região norte de Minas Gerais. As sementes apresentam uma amêndoa cuja exploração ainda é bastante limitada. O objetivo deste trabalho foi determinar a composição da amêndoa do coquinho-azedo, visando a avaliar suas possibilidades de uso. Na amêndoa, a composição química (umidade, proteínas, lipídios, cinzas e fibras foi determinada por métodos gravimétricos. Os teores dos principais minerais foram avaliados por espectrofotometria de emissão atômica com fonte de plasma indutivo, e a composição dos ácidos graxos presentes na gordura da semente foi determinada por cromatografia a gás. A amêndoa do coquinho-azedo apresentou 9,9 % de umidade e 57,8 % de lipídios totais, 25,8 % de fibra detergente neutro, 17,6 % de fibra detergente ácido e 1,6 % de cinzas em base seca. A gordura extraída da amêndoa de coquinho-azedo apresentou elevados teores de ácido láurico (42,1 %, que foi seguido pelo ácido oléico (16,9 %. Predominaram os ácidos graxos saturados (78,9 %, principalmente os de cadeia média (C6-C12.The Butia capitata palm tree produce a very aromatic fruit named "coquinho-azedo", which freeze pulp is frequently used to produce agreeable juice in north of Minas Gerais, Brazil. "Coquinho-azedo" kernel contains a nut that is not frequently explored. The purpose of the present study was the chemical characterization of "coquinho-azedo" nut to evaluate the possibilities of its use. The moisture, lipids, ash and fiber contents were determined by gravimetric methods. The mineral profile was characterized by inductively coupled plasma spectrophotometer and the fatty acids profile was characterized by gas chromatography. The coquinho-azedo nut presented 9,9 % of moisture, 57,8 % of total lipid, 25,8 % of neutral detergent fiber, 17,6 % of acid detergent fiber

  3. A microdeletion at 12q24.31 can mimic beckwith-wiedemann syndrome neonatally.

    Science.gov (United States)

    Baple, E; Palmer, R; Hennekam, R C M

    2010-02-01

    We report on a patient who was initially suspected to have Beckwith-Wiedemann syndrome because of recurrent neonatal hypoglycaemias, macroglossia and overgrowth, but in whom no 11p15 abnormality could be found. Follow-up showed continued overgrowth and disturbed glucose homeostasis, a marked developmental delay, and severe behavioural problems especially caused by anxieties. Array comparative genomic hybridization analysis showed a de novo 12q24.31 interstitial deletion, which was confirmed by fluorescence in situ hybridization. The deleted region contains amongst others: HNF1 homeobox A (HNF1A) which is important for the regulation of gene expression in the liver and involved in maturity-onset diabetes of the young type 3 and insulin resistance; acyl-CoA dehydrogenase short chain (ACADS) which encodes an enzyme important in mitochondrial fatty acid beta-oxidation and can cause short-chain acyl-CoA dehydrogenese (SCAD) deficiency, and purinergic receptor P2X7 (P2RX7) which encodes a ligand-gated ion channel, and of which polymorphisms are found with increased frequency in patients with psychiatric disorders, especially anxieties. We conclude the present patient has a hitherto undescribed contiguous gene syndrome, which can initially resemble Beckwith-Wiedemann syndrome.

  4. Moscas-das-frutas (Diptera: Tephritidae em um pomar de goiabeira, no semiárido brasileiro

    Directory of Open Access Journals (Sweden)

    Elton Lucio Araujo

    2013-06-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são pragas-chave na cultura da goiabeira Psidium guajava L., com predominância de diferentes espécies de acordo com a região produtora no Brasil. Os objetivos do presente trabalho foram conhecer a diversidade e analisar parâmetros faunísticos das moscas-das-frutas obtidas em um pomar de goiabeira, no município de Cruzeta, Rio Grande do Norte, situado no semiárido brasileiro. As moscas-das-frutas foram coletadas semanalmente, com auxílio de armadilhas McPhail, tendo como atrativo proteína hidrolisada a 5% v/v. Foram registradas cinco espécies no pomar estudado: Ceratitis capitata (Wied., Anastrepha zenildae Zucchi, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart e Anastrepha dissimilis Stone. Ceratitis capitata foi a espécie mais frequente, constante e dominante, considerada como uma praga invasiva, potencial em pomares de goiabeira no semiárido brasileiro.

  5. Fruit flies (Diptera, Tephritidae) and their associations with native host plants in a remnant area of the highly endangered Atlantic Rain Forest in the State of Espírito Santo, Brazil.

    Science.gov (United States)

    Uramoto, K; Martins, D S; Zucchi, R A

    2008-10-01

    The results presented in this paper refer to a host survey, lasting approximately three and a half years (February 2003-July 2006), undertaken in the Vale do Rio Doce Natural Reserve, a remnant area of the highly endangered Atlantic Rain Forest located in Linhares County, State of Espírito Santo, Brazil. A total of 330 fruit samples were collected from native plants, representing 248 species and 51 plant families. Myrtaceae was the most diverse family with 54 sampled species. Twenty-eight plant species, from ten families, are hosts of ten Anastrepha species and of Ceratitis capitata (Wiedemann). Among 33 associations between host plants and fruit flies, 20 constitute new records, including the records of host plants for A. fumipennis Lima and A. nascimentoi Zucchi. The findings were discussed in the light of their implications for rain forest conservation efforts and the study of evolutionary relationships between fruit flies and their hosts.

  6. Methods to Break Seed Dormancy of Rhynchosia capitata, a Summer Annual Weed Métodos para Romper la Dormancia de Rhynchosia capitata, una Maleza Anual de Verano

    Directory of Open Access Journals (Sweden)

    Hafiz Haider Ali

    2011-09-01

    Full Text Available Dormancy of weed seeds is a significant feature contributing to their survival rate since it helps the weeds to avoid herbicides and other weeding practices along with unfavorable environmental conditions. We investigated the effects of different dormancy breaking treatments on the germination of Rhynchosia capitata, a common summer annual weed, which is emerging as a weed threat in Pakistan. Seeds were soaked in thiourea, KNO3, HCl, HNO3, and H2SO4, and they were also mechanically scarified (sandpaper. Results indicated that R. capitata seeds show signs of physical dormancy that is mainly due to the impermeability of their coat. Mechanical scarification and acid scarification (soaking of seeds in H2SO4 for 60 and 80 min and in HCl for 12 and 15 h were very efficient in breaking dormancy and promoting germination. Seed soaking in HNO3 for 1 to 5 d showed little effect whereas various concentrations of thiourea and KNO3 were ineffective in breaking R. capitata seed dormancy.La dormancia seminal de las malezas es un rasgo significativo contribuyente a su tasa de supervivencia, puesto que ayuda a las malezas a evitar herbicidas y otras prácticas de desmalezado junto con condiciones ambientales desfavorables. Investigamos los efectos de diferentes tratamientos para romper dormancia sobre la germinación de Rhynchosia capitata, una maleza anual estival común en Paquistán. Las semillas se sumergieron en tiourea, KNO3, HCl, HNO3 y H2SO4 y además fueron escarificadas mecánicamente (papel lija. Los resultados indicaron que las semillas de R. capitata muestran signos de dormancia física principalmente debido a impermeabilidad de su cubierta. Escarificación mecánica y ácida (inmersión de semillas en H2SO4 por 60 y 80 min y en HCl por 12 y 15 h fueron muy eficientes para romper dormancia y promover germinación. Las semillas sumergidas en HNO3 por 1 a 5 días mostraron poco efecto, mientras diversas concentraciones de tiourea y KNO3 fueron

  7. Histological features of the pancreas in a patient with congenital hyperinsulinism due to Beckwith-Wiedemann syndrome

    DEFF Research Database (Denmark)

    Christensen, Lene; Christesen, Henrik Boye Thybo; Brusgaard, Klaus

    Introduction: Beckwith-Wiedemann syndrome (BWS) is a genetic disorder with typical features such as macroglossia, abdominal wall defects, macrosomia, visceromegaly and embryonal tumors. Hypoglycemia is reported in about half of all newborns with BWS, usually resolving spontaneously within the first...

  8. No evidence for pathogenic variants or maternal effect of ZFP57 as the cause of Beckwith-Wiedemann Syndrome

    DEFF Research Database (Denmark)

    Boonen, Susanne E; Hahnemann, Johanne M D; Mackay, Deborah

    2012-01-01

    Beckwith-Wiedemann syndrome (BWS) is an overgrowth syndrome, which, in 50-60% of sporadic cases, is caused by hypomethylation of KCNQ1OT1 differentially methylated region (DMR) at chromosome 11p15.5. The underlying defect of this hypomethylation is largely unknown. Recently, recessive mutations...

  9. Susceptibility of the Mediterranean fruit fly (Ceratitis capitata) and the Natal fruit fly (Ceratitis rosa) to entomopathogenic nematodes.

    Science.gov (United States)

    Malan, Antoinette P; Manrakhan, Aruna

    2009-01-01

    The potential of entomopathogenic nematodes, Heterorhabditis bacteriophora, Heterorhabditis zealandica and Steinernema khoisanae, to infect pupariating larvae, pupae and adults of Ceratitis capitata and Ceratitis rosa was investigated in laboratory bioassays. Pupariating larvae and adult flies were susceptible to nematode infection, with no infection recorded for the pupae. Pupariating larvae of C. capitata were generally more susceptible to infection than those of C. rosa. Significantly more larvae of C. capitata were infected by H. bacteriophora. For C. rosa, highest infectivity of larvae was obtained with H. zealandica. In contrast, adults of both species were highly infected by S. khoisanae.

  10. Laboratory evaluation of the chemosterilant lufenuron against Ceratitis capitata, Bactrocera dorsalis, B. cucurbitae, and B. latifrons.

    Science.gov (United States)

    Four species of tephritid fruit flies, Ceratitis capitata, Bactrocera dorsalis, B. cucurbitae, and B. latifrons were evaluated for toxic, developmental, and physiological responses to the chemosterilant lufenuorn incorporated in an agar adult diet and a liquid larval diet. No significant mortality o...

  11. Oviposition preference and larval performance in Ceratitis capitata (Díptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Iara Sordi Joachim-Bravo

    1997-12-01

    Full Text Available Experiments concerning oviposition preference were carried out on Ceratitis capitata to determine whether females are able to preferentially oviposit on natural hosts in which the larvae develop better. The results indicated that the females do not preferentially oviposit on hosts of better nutritive value for the larvae.

  12. Phytochemical and biological studies of Butia capitata Becc. leaves cultivated in Egypt

    Directory of Open Access Journals (Sweden)

    Nagwa Mohamed Ammar

    2014-06-01

    Conclusions: B. capitata leaf extracts were shown to possess variable antioxidant effect, the most promising was methanol extract. Both polar and non polar extracts were proved to have anti-inflammatory activity, the non polar extract was superior in this respect. The bioactivity of the extracts was ascribed to the presence of flavonoids, sterols and α-tocopherol.

  13. Phytochemical and biological studies of Butia capitata Becc. leaves cultivated in Egypt

    Institute of Scientific and Technical Information of China (English)

    Nagwa Mohamed Ammar; Mohammed Said Hefnawy; Sahar Youssef Al-Okbi; Doha Abdou Mohamed; Nabil Khamis El-Sayed; Amira Ahmed El-Anssary; Tom Mabry

    2014-01-01

    Objective: To study the antioxidant and anti-inflammatory activity of Butia capitata (B. capitata) leaf extracts along with phytochemical analysis of the proposed bioactive constituents.Methods:organic solvents and screened for their anti-inflammatory activities in tested animals and in-vitro antioxidant effect. An extensive phytochemical investigation of the bioactive extracts through paper chromatography, thin layer chromatography, column chromatography, gas-liquid chromatography (GLC), high pressure liquid chromatography and spectral analysis. GC-Mass, ultraviolet, hydrogen and carbon nuclear magnetic resonance, electron ionization-mass spectrometry, heteronuclear multiple bond correlation and heteronuclear multiple quantum correlation were carried out.Results:Results showed that different extracts possess promising antioxidant effect and Different successive extracts of B. capitata Becc. leaves were prepared with selective significant anti-inflammatory activity with variable degrees. The results of the phytochemical investigation of the bioactive extracts revealed the presence of volatile substances, lipoidal matter, α-tocopherol, free sugars, polysaccharides and flavonoidal compounds.Conclusions: B. capitata leaf extracts were shown to possess variable antioxidant effect, the most promising was methanol extract. Both polar and non polar extracts were proved to have anti-inflammatory activity, the non polar extract was superior in this respect. The bioactivity of the extracts was ascribed to the presence of flavonoids, sterols and α-tocopherol.

  14. Invasive infection due to Saprochaete capitata in a young patient with hematological malignancies

    Science.gov (United States)

    Parahym, Ana Maria Rabelo de Carvalho; Rolim, Pedro José; da Silva, Carolina Maria; Domingos, Igor de Farias; Gonçalves, Sarah Santos; Leite, Edinalva Pereira; de Morais, Vera Lúcia Lins; Macêdo, Danielle Patrícia Cerqueira; de Lima, Reginaldo Gonçalves; Neves, Rejane Pereira

    2015-01-01

    We report a case of invasive infection due to Saprochaete capitata in a patient with hematological malignancies after chemotherapy treatment and empiric antifungal therapy with caspofungin. Although severely immunocompromised the patient survived been treated with amphotericin B lipid complex associated with voriconazole. PMID:26273269

  15. H19DMR methylation analysis in patients with Beckwith-Wiedemann syndrome and isolated hemihyperplasia

    Directory of Open Access Journals (Sweden)

    Marcus Vinícius de Matos Gomes

    2005-01-01

    Full Text Available Beckwith-Wiedemann syndrome (BWS is a congenital overgrowth disorder of complex and heterogeneous etiology involving alterations in genomic imprinting. The cause of isolated hemihyperplasia (IHH is unknown but might be due to partial or incomplete expression of BWS because both these conditions share predisposition for the same types of neoplasias. We investigated the methylation pattern of the putative imprinting control region H19DMR using peripheral blood from 12 patients, six with clinical features of BWS and six with IHH. All the patients had normal karyotypes and paternal uniparental disomy (UPD was excluded in 10 informative cases. The normal H19DMR methylation pattern was found in eight informative patients, indicating that H19DMR methylation was not related to their condition. We suggest that the absence of neoplasias in the BWS and IHH patients studied might be related to the absence of UPD and to the presence of normal H19DMR methylation.

  16. Ovarian thecal metaplasia of the adrenal gland in association with Beckwith-Wiedemann syndrome

    Institute of Scientific and Technical Information of China (English)

    Eslam; Y; Wassal; Mouhammed; Amir; Habra; Rafael; Vicens; Priya; Rao; Khaled; M; Elsayes

    2014-01-01

    Beckwith-Wiedemann syndrome(BWS) is an overgrowth syndrome associated with increased risk to develop malignancies including adrenocortical carcinoma. Ovarian thecal metaplasia of the adrenal gland is a rare tumorlike mesenchymal lesion in BWS patients that lacks detailed radiological description. We report a 17-yearold female patient with BWS, associated with bilateral Wilms tumor, hepatic hemangiomatosis, pancreatic neuroendocrine tumor, and a phyllodes tumor of the right breast. Surveillance abdominal ultrasound identified a right adrenal mass that was further characterized by computed tomography and magnetic resonance imaging. Radiologically, this mass displayed features that overlap with adrenocortical carcinoma and pheochromocytoma but after pathological examination this proved to be an ovarian thecal metaplasia of the adrenal gland. Adrenal masses in BWS should raise the suspicion for adrenocortical carcinoma though other adrenal tumors including ovarian thecal metaplasia can be seen in these patients.

  17. A perplexing encounter (The poem “Ziemia” by Adam Wiedemann

    Directory of Open Access Journals (Sweden)

    Marcin Jaworski

    2012-01-01

    Full Text Available The poem is interpreted as an ironic self-thematic commentary. The poet’s attitude is critical towards different interpretations: conventional, i.e. based on ambiguity, colloquial or stereotypical and academic, inspired by increasingly new theories. The substantial element in the poem is the relation between the subject (persona and the protagonist that corresponds to and translates into a communicative situation between the author and the reader. The result is complex, intertwined styles and techniques combined with one another. Wiedemann engages in a play with different ways of writing, ironically challenges or undermines poetical strategies to underline the conventionality of literature and communication in general. By doing this, he disturbs the reader by challenging the reader’s reading habits and thus making an impression that the reader is sent away from the poem to a single and unique experience in reality.

  18. The Wiedemann-Franz law in a normal metal-superconductor junction

    Institute of Scientific and Technical Information of China (English)

    R Ghanbari; G Rashedi

    2011-01-01

    In this paper the influence of superconducting correlations on the thermal and charge conductances in a normal metal-superconductor (NS) junction in the clean limit is studied theoretically.First we solve the quasiclassical Eilenberger equations,and using the obtained density of states we can acquire the thermal and electrical conductances for the NS junction.Then we compare the conductance in a normal region of an NS junction with that in a single layer of normal metal (N).Moreover,we study the Wiedemann-Franz (WF) law for these two cases (N and NS).From our calculations we conclude that the behaviour of the NS junction does not conform to the WF law for all temperatures.The effect of the thickness of normal metal on the thermal conductivity is also theoretically investigated in the paper.

  19. Survey of the Genetic Diversity of Forensically Important Chrysomya (Diptera: Calliphoridae) from Egypt.

    Science.gov (United States)

    Salem, Abeer M; Adham, Fatma K; Picard, Christine J

    2015-05-01

    Minimum postmortem interval estimations of a corpse using blow fly larvae in medicolegal investigations require correct identification and the application of appropriate developmental data of the identified fly species. Species identification of forensically relevant blow flies could be very difficult and time consuming when specimens are damaged or in the event of morphologically indistinguishable immature stages, which are most common at crime scenes. In response to this, an alternative, accurate determination of species may depend on sequencing and molecular techniques for identification. Chrysomyinae specimens (n = 158) belonging to three forensically important species [Chrysomya albiceps (Wiedemann), Chrysomya megacephala (F.), and Chrysomya marginalis (Wiedemann)] (Diptera: Calliphoridae) were collected from four locations in Egypt (Giza, Dayrout, Minya, and North Sinai) and sequenced across the mitochondrial cytochrome oxidase subunit I (COI) gene. Phylogenetic analyses using neighbor-joining, maximum likelihood and maximum parsimony methods resulted in the same topological structure and confirmed DNA based identification of all specimens. Interspecific divergence between pairs of species was 5.3% (C. marginalis-C. megacephala), 7% (C. albiceps-C. megacephala), and 8% (C. albiceps-C. marginalis). These divergences are sufficient to confirm the utility of cytochrome oxidase subunit I gene in the molecular identification of these flies in Egypt. Importantly, the maximum intraspecific divergence among individuals within a species was <1% and the least nucleotide divergence between species used for phylogenetic analysis was 3.6%. This study highlights the need for thorough and diverse sampling to capture all of the possible genetic diversity if DNA barcoding is to be used for molecular identification.

  20. Effects of parental age on the fecundity, fertility and longevity of the Mediterranean fruit fly, Ceratitis capitata Wied.

    OpenAIRE

    Muñiz, M.

    1986-01-01

    Investigations with single pair mating have been conducted in order to study the influence of parental age on the adult progeny's longevity and reproductive parameters of t he Mediterranean fruit fly, Ceratitis capitata Wied.

  1. Generation and characterization of Brassica rapa ssp. pekinensis – B. oleracea var. capitata monosomic and disomic alien addition lines

    Indian Academy of Sciences (India)

    Ai xia Gu; Shu Xing Shen; Yan Hua Wang; Jian Jun Zhao; Shu Xin Xuan; Xue Ping Chen; Xiao Feng Li; Shuang Xia Luo; Yu Jing Zhao

    2015-09-01

    Five monosomic alien addition lines (MAALs) of Brassica rapa ssp. pekinensis – B. oleracea var. capitata were obtained by hybridization and backcrossing between B. rapa ssp. pekinensis (female parent) and B. oleracea var. capitata. The alien linkage groups were identified using 42 B. oleracea var. capitata linkage group-specific markers as B. oleracea linkage groups C2, C3, C6, C7 and C8. Based on the chromosomal karyotype of root tip cells, these five MAALs added individual chromosomes from B. oleracea var. capitata: chr 1 (the longest), chr 2 or 3, chr 5 (small locus of 25S rDNA), chr 7 (satellite-carrying) and chr 9 (the shortest). Five disomic alien addition lines were then generated by selfing their corresponding MAALs.

  2. [Robert Schweitzer. Eine Unveröffentlichte Quelle zur Schulgeschichte von Reval Ferdinand Wiedemanns Geschichte des Revaler Gouvernementsgymnasiums aus dem Jahr 1856] / Paul Kaegbein

    Index Scriptorium Estoniae

    Kaegbein, Paul

    2008-01-01

    Arvustus: Robert Schweitzer. Eine Unveröffentlichte Quelle zur Schulgeschichte von Reval Ferdinand Wiedemanns Geschichte des Revaler Gouvernementsgymnasiums aus dem Jahr 1856. - Buch und Bildung im Baltikum. Münster : LIT, 2005. lk. 495-525. Kubermangugümnaasiumi vanemõpetaja Ferdinand Wiedemann kirjutas 1856. aastal kooli ajaloo, mis mingitel põhjustel jäi avaldamata. Tema tööd on kasutanud 1881. aastal Gotthard von Hansen

  3. SYSTEMATIC STUDIES IN TURNERA (TURNERACEAE II. SERIES ANNULARES, CAPITATAE, PAPILLIFERAE AND MICROPHYLLAE ESTUDIOS SISTEMÁTICOS EN TURNERA (TURNERACEAE II. SERIES ANNULARES, CAPITATAE, MICROPHYLEAE Y PAPILLIFERAE

    Directory of Open Access Journals (Sweden)

    María Mercedes Arbo

    2010-11-01

    Full Text Available

    Turnera L. includes around 100 American species and two African ones, arranged in nine series. In this paper, the following four series embracing 21 species are revised: Annulares, Capitatae, Microphyllae and Papilliferae. Six new taxa are described: Thatschbachii, Thatschbachii var. miniata, Tmaracasana,and T.princeps of the seriesCapitatae, Tasymmetrica of the series Microphyllae, and Tcaatingana of the series Papilliferae. The species of these four series share the common features of simple and glandular hairs, generally well-developed floral peduncle, absent pedicel, linear or elliptic prophylls, generally warty or granulate fruit, and a floral tube, appendicular in nature, in that it is the product of the fusion of the lower part of the calyx and corolla, with the staminal filaments adnate only at the base. In the series Annulares,
    Microphyllae and Papilliferae the leaves and young stems are fragrant, the scent being produced by the glandular hairs, and the floral peduncle is shortly adnate to the petiole. Three
    series, Annulares, Capitatae and Microphyllae, have leaves with generally well developed stipules and a disjunct geographical distribution. The series Annulares and Capitatae have nectaries and villous or hirsute styles, while Microphyllae and Papilliferae lack nectaries and their styles are glabrous or somewhat pilose. In some species of Microphyllae the staminal filaments are joined at the base, forming an annular structure 0,05-0,50 mm high. The seeds are peculiar in Annulares, being very short, with a central, prominent and slightly concave chalaza. In the series Capitatae, the flowers are gathered in short, capitate inflorescences, the length of the peduncles being variable or sometimes wanting, and the seeds are obovoid, reticulate or striate. The leaves of Microphyllae are small, with the stipules adnate to the foliar
    base; setiform glandular hairs, similar to those of

  4. Congenital immunodeficiency in an individual with Wiedemann-Steiner syndrome due to a novel missense mutation in KMT2A.

    Science.gov (United States)

    Stellacci, Emilia; Onesimo, Roberta; Bruselles, Alessandro; Pizzi, Simone; Battaglia, Domenica; Leoni, Chiara; Zampino, Giuseppe; Tartaglia, Marco

    2016-09-01

    Wiedemann-Steiner Syndrome (WSS) is an autosomal dominant disorder characterized by hypertrichosis, short stature, intellectual disability, developmental delay, and facial dysmorphism. Since the original reports by Wiedemann and co-workers, and Steiner and Marques, only a few cases have been described. Recently, the clinical variability of the disorder has more precisely been characterized by Jones and co-workers, who also identified heterozygous KMT2A mutations as the molecular defect underlying this condition. Here, we report on a boy with a complex phenotype overlapping WSS but exhibiting epilepsy, feeding difficulties, microcephaly, and congenital immunodeficiency with low levels of immunoglobulins as additional features. Whole exome sequencing allowed identifying a previously unreported de novo KMT2A missense mutation affecting the DNA binding domain of the methyltransferase. This finding expands the clinical phenotype associated with KMT2A mutations to include immunodeficiency and epilepsy as clinically relevant features for this disorder. © 2016 Wiley Periodicals, Inc.

  5. Sjögren, Wiedemann ja liivi keele sõnaraamat. Panus 19. sajandi teadusajalukku / Eberhard Winkler

    Index Scriptorium Estoniae

    Winkler, Eberhard, 1955-

    2009-01-01

    Uuritakse, milline võis olla kummagi teadlase osa esimese liivi keele sõnaraamatu koostamisel: Sjögren, Andreas Johan. Gesammelte Schriften. Band II. Theil I., Joh. Andreas Sjögren's Livische Grammatik nebst Sprachproben ; Band II. Theil II., Joh. Andreas Sjögren's livisch-deutsches und deutsch-livisches Wörterbuch / bearbeitet von Ferdinand Joh. Wiedemann. St. Petersburg, 1861

  6. Sexual Competitiveness of Anastrepha ludens (Diptera: Tephritidae) Males Exposed to Citrus aurantium and Citrus paradisi Essential Oils.

    Science.gov (United States)

    Morató, Santiago; Shelly, Todd; Rull, Juan; Aluja, Martin

    2015-04-01

    Males of the Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) display increased mating competitiveness following exposure to the odor of certain host and nonhost plants, and this phenomenon has been used in the sterile insect technique to boost the mating success of released, sterile males. Here, we aimed to establish whether males of the Mexican fruit fly (Anastrepha ludens (Loew)) gain a mating advantage when exposed to the aroma of two preferred hosts, grapefruit (Citrus paradisi Macfadyen) and bitter orange (Citrus aurantium L.). Under seminatural conditions, we observed that, in trials using wildish males (from a young laboratory colony started with wild flies) exclusively, exposure to the aroma of bitter orange had no effect on male mating success but exposure to the odor grapefruit oil increased male mating success significantly. In a separate test involving both exposed and nonexposed wildish and mass-reared, sterile males, although wildish males were clearly more competitive than sterile males, exposure to grapefruit oil had no detectable effect on either male type. Exposure to oils had no effect on copulation duration in any of the experiments. We discuss the possibility that the positive effect of grapefruit essential oils on wildish male competitiveness may have been linked to exposure of females to grapefruit as a larval food, which may have imprinted them with grapefruit odors during pupal eclosion and biased their response as adults to odors of their maternal host.

  7. Review of magnetostrictive transducers (MsT) utilizing reversed Wiedemann effect

    Science.gov (United States)

    Vinogradov, Sergey; Cobb, Adam; Light, Glenn

    2017-02-01

    Magnetostrictive transduction has been widely utilized in NDE applications, specifically for generation and reception of guided waves for long-range inspection of components such as pipes, vessels, and small tubes. Transverse-motion guided wave modes (e.g., torsional vibrations in pipes) are the most typical choice for long-range inspection applications because the wave motion is in the plane of the structure. Magnetostrictive-based sensors have been available for several years for these wave modes based on the Wiedemann effect. For these sensors, a permanent magnetic bias is applied that is perpendicular to the direction of the propagated guided wave. This bias field strains the material that the guided wave is generated in preferentially in the desired particle motion direction. A time-varying magnetic field oriented parallel to the direction of guided wave propagation is also induced in the material. This time-varying field is induced using an electric coil located near the material surface. The interaction of these two fields produces the guided waves; an inverse effect is used for the receive process. An alternative configuration of a sensor for generating and receiving these traverse-motion guided waves is to swap the biasing and time-varying magnetic fields directions. Since transverse-motion guided wave sensors are typically much longer in the particle motion direction than in the bias field direction, the net effect of this alternative design is that the magnetic biasing length is shorter and different coil designs can be used. Because of this, the alternative design, known as a magnetostrictive transducer (MsT), exhibits a number of unique features compared to the Wiedemann sensor described above, such as: 1) the ability to use smaller rare earth permanent magnets and achieve uniform and self-sustained bias field strengths, 2) the choice of more efficient electric coil arrangements to induce a stronger time-varying magnetic field for a given coil

  8. Response of Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae (Diptera:Tephritidae) to metabolic stress disinfection and disinfestation treatment

    Science.gov (United States)

    Metabolic stress disinfection and disinfestation (MSDD) is a postharvest treatment designed to control pathogens and arthropod pests on commodities that combines short cycles of low pressure/vacuum and high CO2 with ethanol vapor. Experiments were conducted to evaluate the effect of MSDD treatment o...

  9. First record of spotted wing drosophila Drosophila suzukii (Diptera: Drosophilidae in Montenegro

    Directory of Open Access Journals (Sweden)

    Snježana Hrnčić

    2015-01-01

    Full Text Available The spotted wing drosophila Drosophila suzukii Matsumura (Diptera: Drosophilidae is an invasive pest originating from Southeast Asia. It was detected for the first time in Europe in 2008 (Spain and Italy and subsequently in other European countries. It is a highly polyphagous pest that infests healthy, ripening fruit and presents a serious threat to fruit production, particularly of soft skinned fruit. In the first half of October 2013, a new fruit fly species was unexpectedly detected in Tephri traps baited with the three-component female-biased attractant BioLure that is regularly used for monitoring the Mediterranean fruit fly Ceratitis capitata Wiedem. (Diptera: Tephritidae in Montenegro. Brief visual inspection identified the new species as the spotted wing drosophila D. suzukii. The pest was first recorded in several localities on the Montenegrin seacoast around Boka Kotor Bay. After the finding, all Drosophila specimens were collected from traps for further laboratory observation. A quick follow-up monitoring of other Tephri traps was carried out within the next few days on the rest of the seacoast (localities from Tivat to Ulcinj. Additionally, Tephri traps were set up around Lake Skadar and in the city of Podgorica, as well as on fresh fruit markets in Podgorica. The results of this preliminary study showed that D. suzukii was present in all surveyed locations and adults were captured until late December. Both sexes were found in traps with BioLure. Our data show that D. suzukii is present in southern parts of Montenegro and there is a serious threat of its further spreading, particularly towards northern parts of the country where the main raspberry and blueberry production is placed. The results also show that Tephri traps baited with BioLure can be used for detection and monitoring of spotted wing drosophila.

  10. Germline mutation in NLRP2 (NALP2 in a familial imprinting disorder (Beckwith-Wiedemann Syndrome.

    Directory of Open Access Journals (Sweden)

    Esther Meyer

    2009-03-01

    Full Text Available Beckwith-Wiedemann syndrome (BWS is a fetal overgrowth and human imprinting disorder resulting from the deregulation of a number of genes, including IGF2 and CDKN1C, in the imprinted gene cluster on chromosome 11p15.5. Most cases are sporadic and result from epimutations at either of the two 11p15.5 imprinting centres (IC1 and IC2. However, rare familial cases may be associated with germline 11p15.5 deletions causing abnormal imprinting in cis. We report a family with BWS and an IC2 epimutation in which affected siblings had inherited different parental 11p15.5 alleles excluding an in cis mechanism. Using a positional-candidate gene approach, we found that the mother was homozygous for a frameshift mutation in exon 6 of NLRP2. While germline mutations in NLRP7 have previously been associated with familial hydatidiform mole, this is the first description of NLRP2 mutation in human disease and the first report of a trans mechanism for disordered imprinting in BWS. These observations are consistent with the hypothesis that NLRP2 has a previously unrecognised role in establishing or maintaining genomic imprinting in humans.

  11. Silver-Russell Syndrome and Beckwith-Wiedemann Syndrome: Opposite Phenotypes with Heterogeneous Molecular Etiology

    Science.gov (United States)

    Õunap, Katrin

    2016-01-01

    Silver-Russell syndrome (SRS) and Beckwith-Wiedemann syndrome (BWS) are 2 clinically opposite growth-affecting disorders belonging to the group of congenital imprinting disorders. The expression of both syndromes usually depends on the parental origin of the chromosome in which the imprinted genes reside. SRS is characterized by severe intrauterine and postnatal growth retardation with various additional clinical features such as hemihypertrophy, relative macrocephaly, fifth finger clinodactyly, and triangular facies. BWS is an overgrowth syndrome with many additional clinical features such as macroglossia, organomegaly, and an increased risk of childhood tumors. Both SRS and BWS are clinically and genetically heterogeneous, and for clinical diagnosis, different diagnostic scoring systems have been developed. Six diagnostic scoring systems for SRS and 4 for BWS have been previously published. However, neither syndrome has common consensus diagnostic criteria yet. Most cases of SRS and BWS are associated with opposite epigenetic or genetic abnormalities in the 11p15 chromosomal region leading to opposite imbalances in the expression of imprinted genes. SRS is also caused by maternal uniparental disomy 7, which is usually identified in 5-10% of the cases, and is therefore the first imprinting disorder that affects 2 different chromosomes. In this review, we describe in detail the clinical diagnostic criteria and scoring systems as well as molecular causes in both SRS and BWS. PMID:27587987

  12. Taste and speech following surgical tongue reduction in children with Beckwith-Wiedemann syndrome.

    Science.gov (United States)

    Maas, Saskia M; Kadouch, Daniel J; Masselink, Anne-Claire C M; Van Der Horst, Chantal M A M

    2016-06-01

    Beckwith-Wiedemann syndrome (BWS) is an overgrowth disorder in which macroglossia is one of the main signs. We investigated the long-term outcome of tongue surgery reduction (TRS) on taste and speech in patients with BWS who were more than 5 years of age and had undergone surgical anterior wedge resection of the tongue. A questionnaire was used to assess medical history and to determine some aspects of speech, taste, psychological well-being, and degree of satisfaction with regard to TRS and tongue mobility. Speech sound error pattern and degree of intelligibility were measured by a speech therapist, and taste was assessed using a validated test. The degree of both intelligibility and satisfaction with the surgery was high. There were some speech errors; especially the interdental 's', addental 't', and addental 'd' were more noticed. We conclude that anterior wedge resection is an effective technique to treat macroglossia in children with BWS, and that it has no long-term consequences for intelligibility and taste perception and only limited consequences for speech.

  13. Inter-specific coral chimerism: Genetically distinct multicellular structures associated with tissue loss in Montipora capitata

    Science.gov (United States)

    Work, Thierry M.; Forsman, Zac H.; Szabo, Zoltan; Lewis, Teresa D.; Aeby, Greta S.; Toonen, Robert J.

    2011-01-01

    Montipora white syndrome (MWS) results in tissue-loss that is often lethal to Montipora capitata, a major reef building coral that is abundant and dominant in the Hawai'ian Archipelago. Within some MWS-affected colonies in Kane'ohe Bay, Oahu, Hawai'i, we saw unusual motile multicellular structures within gastrovascular canals (hereafter referred to as invasive gastrovascular multicellular structure-IGMS) that were associated with thinning and fragmentation of the basal body wall. IGMS were in significantly greater densities in coral fragments manifesting tissue-loss compared to paired normal fragments. Mesenterial filaments from these colonies yielded typical M. capitata mitochondrial haplotypes (CO1, CR), while IGMS from the same colony consistently yielded distinct haplotypes previously only found in a different Montipora species (Montipora flabellata). Protein profiles showed consistent differences between paired mesenterial filaments and IGMS from the same colonies as did seven microsatellite loci that also exhibited an excess of alleles per locus inconsistent with a single diploid organism. We hypothesize that IGMS are a parasitic cellular lineage resulting from the chimeric fusion between M. capitata and M. flabellata larvae followed by morphological reabsorption of M. flabellata and subsequent formation of cell-lineage parasites. We term this disease Montiporaiasis. Although intra-specific chimerism is common in colonial animals, this is the first suspected inter-specific example and the first associated with tissue loss.

  14. Inter-specific coral chimerism: genetically distinct multicellular structures associated with tissue loss in Montipora capitata.

    Directory of Open Access Journals (Sweden)

    Thierry M Work

    Full Text Available Montipora white syndrome (MWS results in tissue-loss that is often lethal to Montipora capitata, a major reef building coral that is abundant and dominant in the Hawai'ian Archipelago. Within some MWS-affected colonies in Kane'ohe Bay, Oahu, Hawai'i, we saw unusual motile multicellular structures within gastrovascular canals (hereafter referred to as invasive gastrovascular multicellular structure-IGMS that were associated with thinning and fragmentation of the basal body wall. IGMS were in significantly greater densities in coral fragments manifesting tissue-loss compared to paired normal fragments. Mesenterial filaments from these colonies yielded typical M. capitata mitochondrial haplotypes (CO1, CR, while IGMS from the same colony consistently yielded distinct haplotypes previously only found in a different Montipora species (Montipora flabellata. Protein profiles showed consistent differences between paired mesenterial filaments and IGMS from the same colonies as did seven microsatellite loci that also exhibited an excess of alleles per locus inconsistent with a single diploid organism. We hypothesize that IGMS are a parasitic cellular lineage resulting from the chimeric fusion between M. capitata and M. flabellata larvae followed by morphological reabsorption of M. flabellata and subsequent formation of cell-lineage parasites. We term this disease Montiporaiasis. Although intra-specific chimerism is common in colonial animals, this is the first suspected inter-specific example and the first associated with tissue loss.

  15. 78 FR 6227 - Importation of Fresh Apricots From Continental Spain

    Science.gov (United States)

    2013-01-30

    ... fly (Medfly), Ceratitis capitata Wiedemann, The plum fruit moth, Cydia funebrana (Treitschke), Leaf...: Apiognomonia erythrostoma (Pers.), a brown rot fungus; Ceratitis capitata Wiedemann, the Mediterranean fruit... fruit would be cut open to inspect for the internal pest C. capitata. If any of these quarantine...

  16. Large scale artificial rearing of Anastrepha sp.1 aff. fraterculus (Diptera: Tephritidae in Brazil

    Directory of Open Access Journals (Sweden)

    Julio Marcos Melges Walder

    2014-08-01

    Full Text Available Some species of the genus Anastrepha (Diptera: Tephritidae are successfully managed by matching the sterile insect technique with parasitoid releases. Such strategies used in integrated pest management can be implemented only where insect mass-rearing programs are feasible. In this study, we show the process of domestication, rearing technology and quality control data obtained from 54 generations of Anastrepha sp.1 aff. fraterculus (Wiedemann, 1830 kept under fully artificial conditions. Eggs were collected by an artificial oviposition panel consisting of one side of the cage made of blue voile fabric externally covered with a thin layer of silicon rubber. They were then air-bubbled in water at 25 ºC for 48 h before seeding. Larvae were reared on the regular laboratory artificial diet with 66 % of agar reduction turning over a semi-liquid diet, which reduced costs and improved insect quality. The adult and larval diets were composed of local ingredients including hydrolyzed yeast. When large-scale production of this fly is contemplated, the critical stage is larval development. This system of artificial rearing for A. fraterculus sp.1 developed in Brazil, allows for the production of a large number of insects of excellent quality using local ingredients and less agar in diet composition than the original medium used for this species. By reducing the interval of egg collection, the system might be optimized in terms of insect yield and, therefore, meet the demands of A. fraterculus sp.1 with regard to integrated pest management purposes.

  17. Effect of age on cuticular hydrocarbon profiles in adult Chrysomya putoria (Diptera: Calliphoridae).

    Science.gov (United States)

    Braga, Marina Vianna; Pinto, Zeneida Teixeira; Queiroz, Margareth Maria de Carvalho; Blomquist, Gary James

    2016-02-01

    A species-specific complex mixture of highly stable cuticular hydrocarbons (CHCs) covers the external surface of all insects. Components can be readily analyzed by gas chromatography coupled to mass spectrometry (GC-MS) to obtain a cuticular hydrocarbon profile, which may be used as an additional tool for the taxonomic differentiation of insect species and also for the determination of the age and sex of adult and immature forms. We used GC-MS to identify and quantify the CHCs of female and male Chrysomya putoria (Wiedemann, 1818) (Diptera: Calliphoridae) from one to five days old. CHCs ranged from C21 to C35 for females and from C21 to C37 in males. Major compounds were the same for both sexes and were 2-MeC28, C29:1, n-C29, 15-,13-MeC29, 2-MeC30, C31:1, n-C31 and 15-,13-MeC31. The relative abundance of each component, however, varied with age. Cluster Analysis using Bray-Curtis measure for abundance showed that cuticular hydrocarbon profiles are a strong and useful tool for the determination of age in adult C. putoria.

  18. Determination of Calliphoridae (Diptera) fauna and seasonal distribution on carrion in Ankara province.

    Science.gov (United States)

    Sabanoğlu, Burcu; Sert, Osman

    2010-07-01

    This study was conducted from March 2006 to 2007. The aim of the study was to determine the forensically significant Calliphoridae (Diptera) species and their seasonal distribution in Ankara province at Beytepe Campus. Pig carcasses were killed by a veterinary using pentobarbital sodium with intervals from 2 to 3 weeks to a month. Samples were collected from the carcass everyday in the morning, in the afternoon, and at sunset. Temperature and parameters of weather, such as cloudy, sunny, rainy, and snowy, were recorded at each visit. Phaenicia sericata (Meigen), Chrysomya albiceps (Wiedemann), Calliphora vomitoria (Linnaeus), and Calliphora vicina (Robineau-Desvoidy) species, which belong to Calliphoridae family, were collected. It was shown that the seasonal distribution of the collected species was different from each other. The species were determined on carcass between the following times; P. sericata, from April to November; C. albiceps, from May to November; Ca. vomitoria, from February to June and from September to December; and Ca. vicina, from February to May and in June and September. Calliphoridae fauna and its annual seasonal distribution in Turkey on 12 pig carcasses were reported for the first time in this study.

  19. Sensitivity of Ceratitis capitata eggs irradiated in artificial diet and in mango fruits; Sensibilidade de ovos de Ceratitis capitata (WIED.,1824) irradiados em dieta artificial e em frutos de manga (Mangifera indica L.)

    Energy Technology Data Exchange (ETDEWEB)

    Raga, A.; Yasuoka, S.T.; Amorim, E.O.; Sato, M.E.; Suplicy Filho, N. [Instituto Biologico, Campinas, SP (Brazil); Faria, J.T. de [Delegacia Federal de Agricultura, Sao Paulo, SP (Brazil)

    1996-01-01

    The objective of this study was to establish gamma radiation doses required to prevent emergence of Ceratitis capitata adults, from irradiated eggs in artificial diet and mango fruits. Six-, twelve-, twenty-four-, and forty-eight-hour-old eggs were used. Artificial infestation by C. capitata was carried out in mangoes of Haden, Tommy and Keith cultivars. An increase of radiation resistance of C. capitata eggs was observed as a function of the embryonic development and a Probit 9 of 24.67 Gy was estimated for 48-hour-old eggs in artificial diet. No significant influence of mango fruits was found on the efficacy of irradiation. (author). 11 refs., 3 tabs.

  20. Controlled-release panel traps for the Mediterranean fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Leonhardt, B A; Cunningham, R T; Chambers, D L; Avery, J W; Harte, E M

    1994-10-01

    Solid, controlled-release dispensers containing 2 g of the synthetic attractant trimedlure now are used in Jackson traps to detect the Mediterranean fruit fly, Ceratitis capitata (Wiedemann). Panel traps consisting of trimedlure mixed in a sticky substance and spread on the surfaces of a plastic panel are used to delineate the limits of discovered insect infestations in California. We describe the development of controlled-release, polymeric panels that prolong release of trimedlure and a highly attractive analog, ceralure. Attractants were incorporated in a polyethylene matrix to form panels and in a polymer coating on cardboard panels that then were evaluated by biological and chemical assay. In addition, commercial polymer matrix panels were evaluated. Field bioassay tests conducted in Hilo, HI, using released flies and in Guatemala in a natural population showed that the polyethylene matrix panel became brittle and cracked during field exposure and that release rates of the attractants were relatively low. The coated cardboard panels were stable under field conditions and yielded high fly captures for up to 6 wk. Farma Tech commercial panels containing 12.3 and 23.4 g of trimedlure remained highly attractive throughout a 134-d test in Hawaii and appear to be a long-lasting alternative to panels coated with trimedlure in Stikem. The cost of the relatively high dose of trimedlure is offset by the prolonged active life of the panel. Commercial panels from AgriSense (10 g trimedlure and 10 g ceralure) released the attractants at a slower rate and were less attractive.

  1. Field trials of solid triple lure (trimedlure, methyl eugenol, raspberry ketone, and DDVP) dispensers for detection and male annihilation of Ceratitis capitata (Wiedemann), Bactrocera dorsalis (Hendel) and Bactrocera cucurbit

    Science.gov (United States)

    Solid Mallet TMR (trimedlure [TML], methyl eugenol [ME], raspberry ketone [RK]) wafers and Mallet CMR (ceralure, ME, RK, benzyl acetate) wafers impregnated with DDVP insecticide were evaluated in traps as potential detection and male annihilation devices. Comparisons were made with 1) liquid lure a...

  2. Biodiversidade de moscas-das-frutas (Diptera, Tephritoidea em matas nativas e pomares domésticos de dois municípios do Estado do Tocantins, Brasil Biodiversity of fruit flies (Diptera, Tephritoidea in native forests and orchards in two counties of the State of Tocantins, Brazil

    Directory of Open Access Journals (Sweden)

    Darcy A. do Bomfim

    2007-01-01

    Full Text Available Este trabalho apresenta análise faunística comparativa das espécies de moscas-das-frutas capturadas em armadilhas McPhail (junho a dezembro de 2002 com proteína hidrolisada de milho a 5%. Foram comparadas a riqueza de espécies e a estrutura populacional entre ambientes de mata e pomar dos municípios de Palmas e Porto Nacional, TO. Foram capturados 1.748 indivíduos de espécies de três gêneros de Tephritidae: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 e Ceratitis MacLeay, 1829. De Lonchaeidae foram capturadas espécies de três gêneros: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 e Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824. Dezenove espécies de Anastrepha foram coletadas, sendo a maioria dos indivíduos (69,1% de A. obliqua (Macquart, 1835. Não houve diferença significativa (P This paper presents comparative and faunistic analysis of the species of fruit flies captured in McPhail traps (from June to December 2002 baited with 5% corn protein hydrolyzed. Species richness and the patterns of population are compared between forest and orchard environments and between the counties of Palmas and Porto Nacional. A total of 1,748 individuals of Tephritidae belonging to species of three genera were collected: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 and Ceratitis MacLeay, 1829. Species of three genera of Lonchaeidae were also captured: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 and Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824 and nineteen species of the genus Anastrepha were collected. Most of the collected individuals (69.1% belonged to A. obliqua (Macquart, 1935. The average numbers of tephritid individuals in Palmas and native forests were significantly lower than Porto Nacional and orchards, respectively. According to the Shannon diversity index (H' and test t used for comparing the fruit flies fauna among the environments, it was verified that only one comparison showed

  3. Effect of the essential volatile oils isolated from Thymbra capitata (L. Cav. on olive and sunflower oils

    Directory of Open Access Journals (Sweden)

    Pedro, L.

    2003-09-01

    Full Text Available The chemical composition of the volatile constituents of the oils isolated from different parts of Thymbra capitata collected at different developmental stages were analysed by GC and GC/MS. The antioxidant ability of the oils isolated from T. capitata was evaluated determining the peroxide values, on olive and sunflower oils, stored at 60 ºC. These peroxide values were compared with those obtained when BHT, carvacrol and control (without adding antioxidants were used and subjected to the same conditions. The best yield oil was obtained from the whole aerial part of T. capitata collected during the flowering phase. The major component of the oils was carvacrol. Relative high amounts of p-cymene, γ-terpinene and β-caryophyllene were also found. BHT revealed to be the best antioxidant when the olive oil was used. On sunflower oil, the antioxidant ability of BHT was not so evident, being the carvacrol-rich essential oils of T. capitata or carvacrol more important antioxidants.Se analizaron, mediante GC y GC/MS, los componentes volátiles de aceites aislados de las distintas partes de la Thymbra capitata, recogida en diferentes etapas de desarrollo. Se evaluó la actividad antioxidante de estos aceites de la T. capitata, midiendo el índice de peróxidos, en aceites de oliva y girasol, almacenados a 60 ºC. Estos índices de peróxidos se compararon con los obtenidos cuando no se agregó ningún antioxidante (control y cuando se utilizó BHT o carvacrol, en las mismas condiciones de almacenamiento. El mayor rendimiento en aceite se obtuvo de la parte aérea de T. capitata recogida durante la etapa de floración. El componente mayoritario de los aceites fue el carvacrol. También se encontraron, cantidades relativamente elevadas, de p-cimeno, γ-terpineno y β-cariofileno. El mejor antioxidante para el aceite de oliva resultó ser el BHT. En el aceite del girasol, la actividad antioxidante del BHT no fue tan evidente, mientras que el

  4. Sterilization of fruit flies (Diptera: Tephritidae) with X-rays for sterile insect technique programs; Esterilizacao de moscas-das-frutas (Diptera: Tephritidae) com raios-X para programas de tecnica do inseto esteril

    Energy Technology Data Exchange (ETDEWEB)

    Mastrangelo, Thiago de Araujo

    2009-07-01

    Recent fear of acts of terrorism provoked an increase of delays and denials in the shipment of radioisotopes. This truly represented a menace to sterile insect production projects around the world. In order to validate the use of a new kind of low-energy Xray irradiator, a series of radiobiological studies on Ceratitis capitata (tsl-VIENNA 8 strain) (Wied., 1824) (Diptera: Tephritidae) and an Argentinean strain of Anastrepha fraterculus (Wied., 1830) (Diptera: Tephritidae) were carried out, also comparing biological effectiveness between X-rays and traditional {gamma} radiation from {sup 60}Co. Pupae 48- 24 h before adult emergence of C. capitata males and both sexes of A. fraterculus were irradiated with doses ranging from 15 to 120 Gy and 10 to 70 Gy respectively. Doses that induce 50, 90 and 99% of sterility were estimated and the hypothesis of Parallelism for the Probit equations was tested. Doses of 82.7 Gy of X-rays and 128.2 Gy of {gamma} rays (thus, a RBE{approx}1.5) induced 99% sterility on medfly males. The fertility of A. fraterculus fertile females crossed with 41 Gy of X-rays and 62.7 Gy of {gamma} rays decreased in 99% comparing with the control group (RBE{approx}1.5). 99% sterility of A. fraterculus irradiated females was achieved with 60-80 Gy (RBE{approx}0.7). The standard quality control parameters of fecundity, adult emergence, fliers and survival were not significantly affected by the two types of radiation (RBE{approx}1) either for medfly or A. fraterculus (p>0.01), being averages in conformity with the values required by FAO/IAEA/USDA. Only fecundity of irradiated A. fraterculus females was severely reduced with increasing doses and no egg was laid at 70 Gy of both radiations. There were no significant differences between X-rays and {gamma} rays regarding mating indices (RSI for medfly, RII, ISI, MRPI and FRPI for A. fraterculus) (p>0.05), what indicated more random matings for fertile and sterile insects. The results demonstrated that no

  5. Hyperinsulinemic hypoglycemia in Beckwith-Wiedemann syndrome due to defects in the function of pancreatic beta-cell adenosine triphosphate-sensitive potassium channels

    DEFF Research Database (Denmark)

    Hussain, K; Cosgrove, K E; Shepherd, R M

    2005-01-01

    Beckwith-Wiedemann syndrome (BWS) is a congenital overgrowth syndrome that is clinically and genetically heterogeneous. Hyperinsulinemic hypoglycemia occurs in about 50% of children with BWS and, in the majority of infants, it resolves spontaneously. However, in a small group of patients the hypo......Beckwith-Wiedemann syndrome (BWS) is a congenital overgrowth syndrome that is clinically and genetically heterogeneous. Hyperinsulinemic hypoglycemia occurs in about 50% of children with BWS and, in the majority of infants, it resolves spontaneously. However, in a small group of patients...

  6. Estimating SIT-driven population reduction in the Mediterranean fruit fly, Ceratitis capitata, from sterile mating.

    Science.gov (United States)

    Juan-Blasco, M; Sabater-Muñoz, B; Pla, I; Argilés, R; Castañera, P; Jacas, J A; Ibáñez-Gual, M V; Urbaneja, A

    2014-04-01

    Area-wide sterile insect technique (SIT) programs assume that offspring reduction of the target population correlates with the mating success of the sterile males released. However, there is a lack of monitoring tools to prove the success of these programs in real-time. Field-cage tests were conducted under the environmental conditions of the Mediterranean coast of Spain to estimate: (a) the mating success of sterile Vienna-8 (V8) Ceratitis capitata males using molecular markers and (b) their efficacy to reduce C. capitata populations under six release ratios of wild females to wild males to V8 males (1:0:0, 1:1:0, 1:1:1, 1:1:5, 1:1:10, and 1:1:20). Statistical models were developed to predict: (a) the number of females captured in traps, (b) sperm ID (sterile or not) in spermathecae of the trapped females, and (c) the viable offspring produced, using release ratio and temperature as predictors. The number of females captured was affected by relative humidity. However, its influence in the model was low. Female captures were significantly higher in ratios 1:0:0 compared to ratios where V8 males were released. The proportion of V8 sperm in spermathecae increased with temperature and with the number of V8 males released, but leveled off between ratios 1:1:10 and 1:1:20. In all seasons, except winter (no offspring), viable offspring increased with temperature and was lowest for ratio 1:1:20. For the first time, a strong negative relationship between proportion of V8 sperm detected by molecular tools and C. capitata offspring was established. The models obtained should contribute to enhance the efficacy of SIT programs against this pest.

  7. Phytotoxic Effects of Cinnamic Acid on Cabbage (Brassica oleracea var. capitata

    Directory of Open Access Journals (Sweden)

    Singh, N. B.

    2013-04-01

    Full Text Available The present study deals with the effects of exogenous application of cinnamic acid (CA on growth and metabolism in growing seedlings of Brassica oleracea var. capitata (cabbage in hydroponic culture. CA was added at 0.5, 1.0 and 1.5 mM concentrations. CA has shown inhibitory effects on shoot and root length, fresh and dry weight of seedlings. CA significantly decreased the photosynthetic pigments, nitrate reductase activity and protein content. Graded concentrations of CA increased lipid peroxidation and sugar content. The increasing concentrations of CA significantly increased the antioxidative enzyme activities viz. superoxide dismutase, catalase, peroxidase against the oxidative stress caused by CA.

  8. Sex and the single embryo: early deveopment in the Mediterranean fruit fly, Ceratitis capitata

    Directory of Open Access Journals (Sweden)

    Zacharopoulou Antigone

    2010-01-01

    Full Text Available Abstract Background In embryos the maternal-to-zygotic transition (MTZ integrates post-transcriptional regulation of maternal transcripts with transcriptional activation of the zygotic genome. Although the molecular mechanisms underlying this event are being clarified in Drosophila melanogaster, little is know about the embryogenic processes in other insect species. The recent publication of expressed sequence tags (ESTs from embryos of the global pest species Ceratitis capitata (medfly has enabled the investigation of embryogenesis in this species and has allowed a comparison of the embryogenic processes in these two related dipteran species, C. capitata and D. melanogaster, that shared a common ancestor 80-100 mya. Results Using a novel PCR-based sexing method, which takes advantage of a putative LTR retrotransposon MITE insertion on the medfly Y chromosome, the transcriptomes of individual early male and female embryos were analysed using RT-PCR. This study is focused on two crucial aspects of the onset of embryonic development: sex determination and cellular blastoderm formation. Together with the three known medfly genes (Cctransformer, Cctransformer2 and Ccdoublesex, the expression patterns of other medfly genes that are similar to the D. melanogaster sex-determination genes (sisterlessA, groucho, deadpan, Sex-lethal, female lethal d, sans fille and intersex and four cellular blastoderm formation genes (Rho1, spaghetti squash, slow-as-molasses and serendipity-α were analyzed, allowing us to sketch a preliminary outline of the embryonic process in the medfly. Furthermore, a putative homologue of the Zelda gene has been considered, which in D. melanogaster encodes a DNA-binding factor responsible for the maternal-to-zygotic transition. Conclusions Our novel sexing method facilitates the study of i when the MTZ transition occurs in males and females of C. capitata, ii when and how the maternal information of "female-development" is

  9. Glosectomía parcial en paciente portador del síndrome de Beckwith-Wiedemann: relato del caso

    Directory of Open Access Journals (Sweden)

    Victor Diniz Borborema dos Santos

    2015-10-01

    Full Text Available El síndrome de Beckwith-Wiedemann es una alteración congénita con diversas manifestaciones clínicas, de entre las cuales las más prevalentes son la macroglosia (97%, el gigantismo (88% y los defectos de la pared abdominal (80%. Ortodónticamente, la mayoría de los pacientes presentan mordida abierta anterior y relación de clase III de Angle. La macroglosia puede causar problemas estéticos y anomalías funcionales relacionadas con el habla, la masticación, fonación, deglución y respiración, con potencial de obstrucción de las vías respiratorias superiores y disminución de la estabilidad del tratamiento ortoquirúrgico. Con el fin de evitar episodios como este, es necesaria la realización de una glosectomía parcial en algunos pacientes. El presente trabajo realiza consideraciones con relación al diagnóstico y tratamiento de la macroglosia y relata el caso clínico de un paciente portador del síndrome de Beckwith-Wiedemann que fue intervenido por medio de glosectomía parcial, utilizando la técnica preconizada por Obwergeser et al. (1964 y que en un postoperatorio de 3 años presentó resultados cosméticos y funcionales satisfactorios.

  10. Larval endoparasitoids (Hymenoptera of frugivorous flies (Diptera, Tephritoidea reared from fruits of the cerrado of the State of Mato Grosso do Sul , Brazil

    Directory of Open Access Journals (Sweden)

    Manoel A. Uchôa-Fernandes

    2003-01-01

    Full Text Available This paper presents a five years survey of endoparasitoids obtained from the larvae of frugivorous Tephritidae and Lonchaeidae flies. The insects were reared from cultivated and wild fruits collected in areas of the cerrado in the State of Mato Grosso do Sul, Brazil. The flies obtained from 14 host fruit species were eight Anastrepha species, Ceratitis capitata (Wiedemann, 1824 (Tephritidae; Dasiops sp. and Neosilba spp. (Lonchaeidae. Eleven parasitoid species were collected: Braconidae - Asobara anastrephae (Muesebek, 1958, Doryctobracon areolatus (Szépligeti, 1911, D. fluminensis (Costa Lima, 1938, Opius bellus Gahan, 1930 and Utetes anastrephae (Viereck, 1913; Figitidae - Aganaspis nordlanderi Wharton, 1998, Lopheucoila anastrephae (Rhower, 1919, Odontosema anastrephae (Borgmeier, 1935 and Trybliographa infuscata Gallardo, Díaz & Uchôa-Fernandes, 2000 and, Pteromalidae - Spalangia gemina Boucek, 1963 and S. endius Walker, 1839. In all cases only one parasitoid emerged per puparium. D. areolatus was the most abundant and frequent parasitoid of fruit fly species, as was L. anastrephae in Neosilba spp. larvae. This is the first record of A. nordlanderi in the midwestern Brazilian region.

  11. Performance of a Genetically Modified Strain of the Mediterranean Fruit Fly (Diptera: Tephritidae) for Area-Wide Integrated Pest Management With the Sterile Insect Technique.

    Science.gov (United States)

    Ramírez-Santos, Edwin M; Rendón, Pedro; Ruiz-Montoya, Lorena; Toledo, Jorge; Liedo, Pablo

    2016-12-23

    The genetically modified strain of Ceratitis capitata (Wiedemann) VIENNA 8 1260 has two morphological markers that exhibit fluorescence in body and sperm. To assess the feasibility of its use in area-wide integrated pest management (AW-IPM) programs using the sterile insect technique, its rearing performance and quality control profile under small, medium, and large scales was evaluated, as well as in field cages. The VIENNA 8 1260 strain had a lower yield than the control strains, VIENNA 8 with D53 inversion (VIENNA 8) and without D53 inversion (VIENNA 8 D53-). At mass-rearing scale, yield gradually increased in three generations without reaching the control strain values. The VIENNA 8 1260 strain was stable in the genetic sexing mechanism (>99.9%) and expression of fluorescence (100%). In field cages, the VIENNA 8 1260 males reduced the mating potential of wild males in the same magnitude as the VIENNA 8, when evaluated in independent cage tests. However, the relative sterility index and the strain male relative performance index of VIENNA 8 1260 males were significantly lower than those of the VIENNA 8. There were no significant differences in longevity of these strains. The potential application of the VIENNA 8 1260 in AW-IPM programs is further discussed.

  12. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    Science.gov (United States)

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  13. Attraction and Electroantennography responses of the male Mediterranean Fruit Fly, Ceratitis capitata, to natural essential oils and synthetic blends.

    Science.gov (United States)

    Field experiments and long range bioassays were used to understand the difference in attractiveness among various natural essential oils for the Mediterranean Fruit Fly, Ceratitis capitata. Using electroantennography, we have selected various antennally active chemicals and tested their role in the ...

  14. Population genetics of Ceratitis capitata in South Africa: implications for dispersal and pest management.

    Science.gov (United States)

    Karsten, Minette; van Vuuren, Bettine Jansen; Barnaud, Adeline; Terblanche, John S

    2013-01-01

    The invasive Mediterranean fruit fly (medfly), Ceratitis capitata, is one of the major agricultural and economical pests globally. Understanding invasion risk and mitigation of medfly in agricultural landscapes requires knowledge of its population structure and dispersal patterns. Here, estimates of dispersal ability are provided in medfly from South Africa at three spatial scales using molecular approaches. Individuals were genotyped at 11 polymorphic microsatellite loci and a subset of individuals were also sequenced for the mitochondrial cytochrome oxidase subunit I gene. Our results show that South African medfly populations are generally characterized by high levels of genetic diversity and limited population differentiation at all spatial scales. This suggests high levels of gene flow among sampling locations. However, natural dispersal in C. capitata has been shown to rarely exceed 10 km. Therefore, documented levels of high gene flow in the present study, even between distant populations (>1600 km), are likely the result of human-mediated dispersal or at least some form of long-distance jump dispersal. These findings may have broad applicability to other global fruit production areas and have significant implications for ongoing pest management practices, such as the sterile insect technique.

  15. Morphological characterization of the antennal lobes in the Mediterranean fruit fly Ceratitis capitata.

    Science.gov (United States)

    Solari, Paolo; Corda, Valentina; Sollai, Giorgia; Kreissl, Sabine; Galizia, C Giovanni; Crnjar, Roberto

    2016-02-01

    The medfly Ceratitis capitata is one of the most important pests for horticulture worldwide. The knowledge about anatomy and function of the medfly olfactory system is still limited. The first brain structure to process olfactory information in insects is the antennal lobe (AL), which is composed of its functional and morphological units, the olfactory glomeruli. Here, we present a morphological three-dimensional reconstruction of AL glomeruli in adult brains. We used unilateral antennal backfills of olfactory receptor neurons (ORNs) with neural tracers, revealing the AL structure. We recorded confocal stacks acquired from whole-mount specimens, and analyzed them with the software AMIRA. The ALs in C. capitata are organized in glomeruli which are more tightly packed in the anterior part than the posterior one. Axons of ORNs bilaterally connect the ALs through a commissure between the two ALs. This commissure is formed by several distinct fascicles. Contralateral dye transfer suggests the presence of gap junctions connecting ORNs from both antennae. There was no statistical difference between the average volumes of female ALs (204,166 ± 12,554 μm(3)) and of male ALs (190,287 ± 11,823 μm(3)). In most specimens, we counted 53 glomeruli in each AL, seven of which were sexually dimorphic in size.

  16. Metallothionein induction and antioxidative responses in the estuarine polychaeta Capitella capitata (Capitellidae)

    Institute of Scientific and Technical Information of China (English)

    Suriya J; S Bharathiraja; V Sekar; R Rajasekaran

    2012-01-01

    Objective: To evaluate the antioxidant response induced by copper (Cu) exposure inCapitella capitata. The capacity of Cu bioaccumulation was also evaluated through the metal quantification. Methods: Worms were exposed to different concentrations of Cu 50, 100, and 200 μg/L for 7, 14 and 21 days respectively. In all the assays, control groups were run in parallel, employing only saline water (10%). The concentrations of Cu in the digested acidic solutions of worms were determined by using the inductively coupled plasma-Optical emission spectrophotometry. The total protein content and other anti oxidant enzyme activities such as superoxide dismutase (SOD), catalase (CAT) and glutathione S-transferase (GST) were recorded for the experiment period. Results: Bioaccumulation of Cu metals in polychaetes was increased parallel to exposure time. A peak concentration (197.30±12.32 μg/g) of metallothioneins (MTs) was registered at 14th day of 100 μg/L group compared to control group (37.29 μg/g). Catalase activities (CAT) in Cu treated-worms were increased significantly (P<0.05) after 7 and 14 days of exposure. The concentration of Cu had significant (P<0.05) influences on the activity of SOD. The same physiological activity was recorded in GST evaluation. Conclusions: These results of biochemical variables in C. capitata suggest us a useful model species for monitoring of environmental disturbance by heavy metal pollution. Antioxidant defenses were confirmed as sensitive biomarkers for metal stress in polychaete worms.

  17. Bleached Porites compressa and Montipora capitata corals catabolize δ13C-enriched lipids

    Science.gov (United States)

    Grottoli, Andréa G.; Rodrigues, Lisa J.

    2011-09-01

    Corals rely on stored energy reserves (i.e., lipids, carbohydrates, and protein) to survive bleaching events. To better understand the physiological implications of coral bleaching on lipid catabolism and/or synthesis, we measured the δ13C of coral total lipids (δ13CTL) in experimentally bleached (treatment) and non-bleached (control) Porites compressa and Montipora capitata corals immediately after bleaching and after 1.5 and 4 months of recovery on the reef. Overall δ13CTL values in treatment corals were significantly lower than in control corals because of a 1.9 and 3.4‰ decrease in δ13CTL immediately after bleaching in P. compressa and M. capitata, respectively. The decrease in δ13CTL coincided with decreases in total lipid concentration, indicating that corals catabolized δ13C-enriched lipids. Since storage lipids are primarily depleted during bleaching, we hypothesize that they are isotopically enriched relative to other lipid classes. This work further helps clarify our understanding of changes to coral metabolism and biogeochemistry when bleached and helps elucidate how lipid classes may influence recovery from bleaching and ultimately coral survival.

  18. Persistent congenital hyperinsulinism in two patients with Beckwith-Wiedemann syndrome due to mosaic uniparental disomy 11p.

    Science.gov (United States)

    Zarate, Yuri A; Shur, Natasha; Robin, Andrew; Garnica, Adolfo D; Quintos, Jose Bernardo; Schaefer, G Bradley

    2014-09-01

    Congenital hyperinsulinism (CHI) is a rare metabolic disease characterized by inappropriate insulin secretion in the presence of hypoglycemia. We describe the clinical presentation and management of congenital hyperinsulinism and persistent hypoglycemia in two infants. Both patients had an initial clinical diagnosis of Beckwith-Wiedemann syndrome (BWS) but normal methylation analysis for LIT1 and H19 status. Both patients were eventually found to have mosaic uniparental disomy 11p diagnosed by single nucleotide polymorphism (SNP) array in DNA isolated from lymphoblasts and fibroblasts, respectively. We report that patients with mosaic BWS are at increased risk for both transient and refractory hypoglycemia that may need aggressive management with diazoxide, octreotide, high glucose infusion rates, and a frequent feeding regime. Our patient experience supports the case for pursuing further testing in patients with features of BWS with normal methylation studies, karyotype, and SNP arrays on blood. The next logical step is SNP array on skin biopsy to rule out mosaicism.

  19. Fibroadenoma in Beckwith-Wiedemann syndrome with paternal uniparental disomy of chromosome 11p15.5.

    Science.gov (United States)

    Takama, Yuichi; Kubota, Akio; Nakayama, Masahiro; Higashimoto, Ken; Jozaki, Kosuke; Soejima, Hidenobu

    2014-12-01

    Herein is described a case of breast fibroadenomas in a 16-year-old girl with Beckwith-Wiedemann syndrome (BWS) and uniparental disomy (UPD) of chromosome 11p15.5. She was clinically diagnosed with BWS and direct closure was performed for an omphalocele at birth. Subtotal and 90% pancreatectomy were performed for nesidioblastosis at the ages 2 months and 8 years, respectively. Bilateral multiple breast fibroadenomas were noted at the age of 16 and 17 years. In this case, paternal UPD of chromosome 11p15.5 was identified on microsatellite marker analysis. The relevant imprinted chromosomal region in BWS is 11p15.5, and UPD of chromosome 11p15 is a risk factor for BWS-associated tumorigenicity. Chromosome 11p15.5 consists of imprinting domains of IGF2, the expression of which is associated with the tumorigenesis of various breast cancers. This case suggests that fibroadenomas occurred in association with BWS.

  20. Defining species boundaries in the Merodon avidus complex (Diptera, Syrphidae using integrative taxonomy, with the description of a new species

    Directory of Open Access Journals (Sweden)

    Jelena Ačanski

    2016-10-01

    Full Text Available Several recent studies have detected and described complexes of cryptic and sibling species in the genus Merodon (Diptera, Syrphidae. One representative of these complexes is the Merodon avidus complex that contains four sibling species, which have proven difficult to distinguish using traditional morphological characters. In the present study, we use two geometric morphometric approaches, as well as molecular characters of the 5’-end of the mtDNA COI gene, to delimit sibling taxa. Analyses based on these data were used to strengthen species boundaries within the complex, and to validate the status of a previously-recognized cryptic taxon from Lesvos Island (Greece, here described as Merodon megavidus Vujić & Radenković sp. nov. Geometric morphometric results of both wing and surstylus shape confirm the present classification for three sibling species-M. avidus (Rossi, 1790, M. moenium Wiedemann in Meigen, 1822 and M. ibericus Vujić, 2015-and, importantly, clearly discriminate the newly-described taxon Merodon megavidus sp. nov. In addition to our geometric morphometric results, supporting characters were obtained from molecular analyses of mtDNA COI sequences, which clearly differentiated M. megavidus sp. nov. from the other members of the M. avidus complex. Molecular analyses revealed that the earliest divergence of M. ibericus occurred around 800 ky BP, while the most recent separation happened between M. avidus and M. moenium around 87 ky BP.

  1. Susceptibility of low-chill blueberry cultivars to Mediterranean fruit fly, oriental fruit fly, and melon fly (Diptera: Tephritidae).

    Science.gov (United States)

    Follett, Peter A; Zee, Francis T; Hamasaki, Randall T; Hummer, Kim; Nakamoto, Stuart T

    2011-04-01

    No-choice tests were conducted to determine whether fruit of southern highbush blueberry, Vaccinium corymbosum L., hybrids are hosts for three invasive tephritid fruit flies in Hawaii. Fruit of various blueberry cultivars was exposed to gravid female flies of Bactrocera dorsalis Hendel (oriental fruit fly), Ceratitis capitata (Wiedemann) (Mediterranean fruit fly), or Bactrocera cucurbitae Coquillet (melon fly) in screen cages outdoors for 6 h and then held on sand in the laboratory for 2 wk for pupal development and adult emergence. Each of the 15 blueberry cultivars tested were infested by oriental fruit fly and Mediterranean fruit fly, confirming that these fruit flies will oviposit on blueberry fruit and that blueberry is a suitable host for fly development. However, there was significant cultivar variation in susceptibility to fruit fly infestation. For oriental fruit fly, 'Sapphire' fruit produced an average of 1.42 puparia per g, twice as high as that of the next most susceptible cultivar 'Emerald' (0.70 puparia per g). 'Legacy', 'Biloxi', and 'Spring High' were least susceptible to infestation, producing only 0.20-0.25 oriental fruit fly puparia per g of fruit. For Mediterranean fruit fly, 'Blue Crisp' produced 0.50 puparia per g of fruit, whereas 'Sharpblue' produced only 0.03 puparia per g of fruit. Blueberry was a marginal host for melon fly. This information will aid in development of pest management recommendations for blueberry cultivars as planting of low-chill cultivars expands to areas with subtropical and tropical fruit flies. Planting of fruit fly resistant cultivars may result in lower infestation levels and less crop loss.

  2. Assessment of differences between X and gamma rays in order to validate a new generation of irradiators for insect sterilization

    Energy Technology Data Exchange (ETDEWEB)

    Mastrangelo, Thiago; Walder, Julio M.M., E-mail: piaui@cena.usp.b [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil); Parker, Andrew G.; Jessup, Andrew; Orozco-Davila, Dina; Islam, Amirul; Dammalage, Thilakasiri, E-mail: A.Jessup@iaea.or [Joint FAO/IAEA-UN A-2444, Seibersdorf (Austria). Insect Pest Control Subprogramme; Pereira, Rui, E-mail: R.Cardoso-Pereira@iaea.or [Joint FAO/IAEA-UN, Vienna (Austria). Insect Pest Control Subprogramme

    2009-07-01

    Recent fears of terrorism provoked an increase in delays and denials of transboundary shipments of radioisotopes. This represents a serious constraint to sterile insect technique (SIT) programs around the world as they rely on the use of ionizing energy from radioisotopes for insect sterilization. In order to validate a novel Xray irradiator, a series of studies on Ceratitis capitata (Wiedemann) and Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) were carried out, comparing the relative biological effectiveness (RBE) between X-rays and traditional gamma radiation from {sup 60}Co. Male C. capitata pupae and pupae of both sexes of A. fraterculus, both 24 to 48 h before adult emergence, were irradiated with doses ranging from 15 to 120 Gy and 10 to 70 Gy respectively. Estimated mean doses of 91.2 Gy of X and 124.9 Gy of gamma radiation induced 99% sterility in C. capitata males. Irradiated A. fraterculus were 99% sterile at about 40-60 Gy for both radiation treatments. Standard quality control parameters were not significantly affected by the two types of radiation. There were no significant differences between X and gamma radiation regarding mating indices. The RBE did not differ significantly between the tested X and gamma radiation, and X-rays are as biologically effective for SIT purposes as gamma rays are. This work confirms the suitability of this new generation of X-ray irradiators for pest control programs in UN Member States. (author)

  3. Developmental rates of immatures of three Chrysomya species (Diptera: Calliphoridae) under the effect of methylphenidate hydrochloride, phenobarbital, and methylphenidate hydrochloride associated with phenobarbital.

    Science.gov (United States)

    Rezende, Fábio; Alonso, Marcela A; Souza, Carina M; Thyssen, Patrícia J; Linhares, Arício X

    2014-05-01

    Entomotoxicology is focused on obtaining data on necrophagous entomofauna, for criminal investigations purposes. This study aimed to evaluate the effect of different concentrations of methylphenidate hydrochloride, phenobarbital, and their association on the developmental rate, larval and pupal survivorship, and the interval of emergence of adults of Chrysomya albiceps (Wiedemann), Chrysomya megacephala (Fabricius), and Chrysomya putoria (Wiedemann) (Diptera: Calliphoridae). Considering the therapeutic dose (TD) of methylphenidate hydrochloride (0.29 mg/Kg), the concentrations tested were 10× TD, 50× TD, and 100× TD. For phenobarbital, the concentrations used were 1× TD (=150 mg/Kg), 3.3× TD, and 6.7× TD. For the association of the drugs, the combinations used were 10× TD-methylphenidate hydrochloride plus 1× TD-phenobarbital, 50× TD-methylphenidate hydrochloride plus 3.3× TD-phenobarbital, and 100× TD-methylphenidate hydrochloride plus 6.7× TD-phenobarbital. The control group, without addition of drug, was maintained under the same conditions of temperature (25 ± 1 °C), humidity (70 ± 10%), and photoperiod (12 h). Specimens of each group were weighed every 12 h until pupariation. The developmental rate of the three Chrysomya species immatures was monitored. For C. albiceps the developmental time was delayed in 24 h for methylphenidate hydrochloride group and in 12 h for the phenobarbital and the drugs association groups. The effect was observed only at specific ages for C. megacephala, without altering the developmental time. For C. putoria, the developmental time was delayed in 12 h for methylphenidate hydrochloride group and in 24 h for the phenobarbital and the drugs association groups. The emergence interval was similar among all experimental groups, but larval and pupal viabilities were affected in different ways.

  4. Plastid transformation in cabbage (Brassica oleracea L. var. capitata L.) by the biolistic process.

    Science.gov (United States)

    Tseng, Menq-Jiau; Yang, Ming-Te; Chu, Wan-Ru; Liu, Cheng-Wei

    2014-01-01

    Cabbage (Brassica oleracea L. var. capitata L.) is one of the most important vegetable crops grown worldwide. Scientists are using biotechnology in addition to traditional breeding methods to develop new cabbage varieties with desirable traits. Recent biotechnological advances in chloroplast transformation technology have opened new avenues for crop improvement. In 2007, we developed a stable plastid transformation system for cabbage and reported the successful transformation of the cry1Ab gene into the cabbage chloroplast genome. This chapter describes the methods for cabbage transformation using biolistic procedures. The following sections are included in this protocol: preparation of donor materials, coating gold particles with DNA, biolistic bombardment, as well as the regeneration and selection of transplastomic cabbage plants. The establishment of a plastid transformation system for cabbage offers new possibilities for introducing new agronomic and horticultural traits into Brassica crops.

  5. Origanum vulgare and Thymbra capitata Essential Oils from Spain: Determination of Aromatic Profile and Bioactivities.

    Science.gov (United States)

    Carrasco, Alejandro; Perez, Enrique; Cutillas, Ana-Belen; Martinez-Gutierrez, Ramiro; Tomas, Virginia; Tudela, Jose

    2016-01-01

    Oregano (Thymbra capitata and Origanum vulgare) essential oils (EOs), cultivated and extracted in the South-East of Spain, were analysed by GC/MS to determine their composition. (E)-β-Caryophyllene (0.5-4.9%), thymol (0.2-5.8%), p-cymene (3.8-8.2%), γ-terpinene (2.1-10.7%) and carvacrol (58.7-77.4%) were determined as the main molecules. This characterisation was completed with enantioselective gas chromatography, where (-)-(E)-β-caryophyllene, (+)-a- pinene and (+)-β-pinene were determined as the main enantiomers. Antioxidant activity was evaluated positively by several methods, accounting for activity against free radicals and reducing power. Important inhibitory activity on lipoxygenase (LOX) and acetylcholinesterase (AChE) was observed supporting potential anti-inflammatory, anti-Alzheimer and insecticidal activities, mainly due to carvacrol. These properties support the potential use of oregano EOs as natural cosmetic and natural pharmaceutical ingredients.

  6. Experimental and DFT studies on the antioxidant activity of a C-glycoside from Rhynchosia capitata

    Science.gov (United States)

    Praveena, R.; Sadasivam, K.; Kumaresan, R.; Deepha, V.; Sivakumar, Raman

    2013-02-01

    Rhynchosia capitata (=Glycine capitata) Heyne ex roth, was found to possess polyphenolics including flavonoids, which acts as potential antioxidant. The study of ethanolic extract of roots and leaves reveals that the leaves possess high polyphenolics including flavonoids than roots. This was also confirmed by DPPH radical scavenging activity. Leaf powder of the plant was extracted with different solvents by soxhlet apparatus in the order of increasing polarity. The DPPH scavenging activity of methanol fraction was found to be high compared to the crude extract and other fractions. Nitric oxide scavenging activity was dominant in chloroform fraction compared to methanol fraction. Presence of flavonoids especially vitexin, a C-glycoside in methanol and chloroform fractions were confirmed by high pressure thin layer chromatography (HPTLC) analysis. The structural and molecular characteristics of naturally occurring flavonoid, vitexin was investigated in gas phase using density functional theory (DFT) approach with B3LYP/6-311G(d,p) level of theory. Analysis of bond dissociation enthalpy (BDE) reveals that the OH site that requires minimum energy for dissociation is 4'-OH from B-ring. To explore the radical scavenging activity of vitexin, the adiabatic ionization potential, electron affinity, hardness, softness, electronegativity and electrophilic index properties were computed and interpreted. The nonvalidity of Koopman's theorem has been verified by the computation of Eo and Ev energy magnitudes. Interestingly, from BDE calculations it was observed that BDE for 4'-OH, 5-OH and 7-OH are comparatively low for vitexin than its aglycone apigenin and this may be due to the presence of C-8 glucoside in vitexin. To substantiate this, plot of frontier molecular orbital and spin density distribution analysis for neutral and the corresponding radical species for the compound vitexin have been presented.

  7. Sniffing out chemosensory genes from the Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Siciliano, Paolo; Scolari, Francesca; Gomulski, Ludvik M; Falchetto, Marco; Manni, Mosè; Gabrieli, Paolo; Field, Linda M; Zhou, Jing-Jiang; Gasperi, Giuliano; Malacrida, Anna R

    2014-01-01

    The Mediterranean fruit fly, Ceratitis capitata (medfly), is an extremely invasive agricultural pest due to its extremely wide host range and its ability to adapt to a broad range of climatic conditions and habitats. Chemosensory behaviour plays an important role in many crucial stages in the life of this insect, such as the detection of pheromone cues during mate pursuit and odorants during host plant localisation. Thus, the analysis of the chemosensory gene repertoire is an important step for the interpretation of the biology of this species and consequently its invasive potential. Moreover, these genes may represent ideal targets for the development of novel, effective control methods and pest population monitoring systems. Expressed sequence tag libraries from C. capitata adult heads, embryos, male accessory glands and testes were screened for sequences encoding putative odorant binding proteins (OBPs). A total of seventeen putative OBP transcripts were identified, corresponding to 13 Classic, three Minus-C and one Plus-C subfamily OBPs. The tissue distributions of the OBP transcripts were assessed by RT-PCR and a subset of five genes with predicted proteins sharing high sequence similarities and close phylogenetic affinities to Drosophila melanogaster pheromone binding protein related proteins (PBPRPs) were characterised in greater detail. Real Time quantitative PCR was used to assess the effects of maturation, mating and time of day on the transcript abundances of the putative PBPRP genes in the principal olfactory organs, the antennae, in males and females. The results of the present study have facilitated the annotation of OBP genes in the recently released medfly genome sequence and represent a significant contribution to the characterisation of the medfly chemosensory repertoire. The identification of these medfly OBPs/PBPRPs permitted evolutionary and functional comparisons with homologous sequences from other tephritids of the genera Bactrocera and

  8. Sniffing out chemosensory genes from the Mediterranean fruit fly, Ceratitis capitata.

    Directory of Open Access Journals (Sweden)

    Paolo Siciliano

    Full Text Available The Mediterranean fruit fly, Ceratitis capitata (medfly, is an extremely invasive agricultural pest due to its extremely wide host range and its ability to adapt to a broad range of climatic conditions and habitats. Chemosensory behaviour plays an important role in many crucial stages in the life of this insect, such as the detection of pheromone cues during mate pursuit and odorants during host plant localisation. Thus, the analysis of the chemosensory gene repertoire is an important step for the interpretation of the biology of this species and consequently its invasive potential. Moreover, these genes may represent ideal targets for the development of novel, effective control methods and pest population monitoring systems. Expressed sequence tag libraries from C. capitata adult heads, embryos, male accessory glands and testes were screened for sequences encoding putative odorant binding proteins (OBPs. A total of seventeen putative OBP transcripts were identified, corresponding to 13 Classic, three Minus-C and one Plus-C subfamily OBPs. The tissue distributions of the OBP transcripts were assessed by RT-PCR and a subset of five genes with predicted proteins sharing high sequence similarities and close phylogenetic affinities to Drosophila melanogaster pheromone binding protein related proteins (PBPRPs were characterised in greater detail. Real Time quantitative PCR was used to assess the effects of maturation, mating and time of day on the transcript abundances of the putative PBPRP genes in the principal olfactory organs, the antennae, in males and females. The results of the present study have facilitated the annotation of OBP genes in the recently released medfly genome sequence and represent a significant contribution to the characterisation of the medfly chemosensory repertoire. The identification of these medfly OBPs/PBPRPs permitted evolutionary and functional comparisons with homologous sequences from other tephritids of the genera

  9. An agent-based simulation of extirpation of Ceratitis capitata applied to invasions in California.

    Science.gov (United States)

    Manoukis, Nicholas C; Hoffman, Kevin

    2014-01-01

    We present an agent-based simulation (ABS) of Ceratitis capitata ("Medfly") developed for estimating the time to extirpation of this pest in areas where quarantines and eradication treatments were immediately imposed. We use the ABS, implemented in the program MED-FOES, to study seven different outbreaks that occurred in Southern California from 2008 to 2010. Results are compared with the length of intervention and quarantine imposed by the State, based on a linear developmental model (thermal unit accumulation, or "degree-day"). MED-FOES is a useful tool for invasive species managers as it incorporates more information from the known biology of the Medfly, and includes the important feature of being demographically explicit, providing significant improvements over simple degree-day calculations. While there was general agreement between the length of quarantine by degree-day and the time to extirpation indicated by MED-FOES, the ABS suggests that the margin of safety varies among cases and that in two cases the quarantine may have been excessively long. We also examined changes in the number of individuals over time in MED-FOES and conducted a sensitivity analysis for one of the outbreaks to explore the role of various input parameters on simulation outcomes. While our implementation of the ABS in this work is motivated by C. capitata and takes extirpation as a postulate, the simulation is very flexible and can be used to study a variety of questions on the invasion biology of pest insects and methods proposed to manage or eradicate such species.

  10. Estudo taxonômico de Leschenaultia Robineau-Desvoidy (Diptera, Tachinidae

    Directory of Open Access Journals (Sweden)

    Ronaldo Toma

    2002-01-01

    Full Text Available Taxonomic study of Leschenaultia Robineau-Desvoidy (Diptera, Tachinidae. The genus Leschenaultia Robineau-Desvoidy, 1830 is redescribed. Two genera are considered as its junior synonyms: Echinomasicera Townsend, 1915 syn. nov. and Parachaetopsis Blanchard, 1959 syn. nov. Thirty two especies are treated, as follows: 18 described as new, Leschenaultia aldrichi, sp. nov. (Brazil, Santa Catarina, L. arnaudi sp. nov. (Haiti, La Salle, L. bergenstammi sp. nov. (Peru, San Martin, L. bessi sp. nov. (Brazil, Santa Catarina, L. bigoti sp. nov. (Peru, Huanuco, L. blanchardi sp. nov. (Equador, Cuenca, L. braueri sp. nov. (Brazil, Mato Grosso, L. brooksi sp. nov. (Brazil, Rio de Janeiro, L. coquilletti sp. nov. (Brazil, Santa Catarina; L. cortesi sp. nov. (Venezuela, Maracay, L. currani sp. nov. (Brazil, São Paulo, L. loewi sp. nov. (Mexico, Vera Cruz, L. macquarti sp. nov. (U. S. A., Arizona, L. reinhardi sp. nov. (Canada, Quebec, L. sabroskyi sp. nov. from (U. S. A., California, L. schineri sp. nov. (U. S. A., California, L. thompsoni sp. nov. (Mexico, Mexico City, L. townsendi sp. nov. (Mexico, Puebla, and 14 known species, for these, diagnoses are given: L. adusta (Loew, 1872; L. americana (Brauer & Bergenstamm, 1893; L. bicolor (Macquart, 1846 = L. fusca (Townsend, 1916 syn. nov.; = Parachaetopsis proseni Blanchard, 1959 syn. nov.; L. ciliata (Macquart, 1848; L. exul (Townsend, 1892; L. fulvipes (Bigot, 1887; L. grossa Brooks, 1947; L. halisidotae Brooks, 1947; L. hospita Reinhard, 1952; L. hystrix (Townsend, 1915 comb. nov., L. jurinioides (Townsend, 1895; L. leucophrys (Wiedemann, 1830 = Leschenaultia latifrons (Walker, 1852 syn. nov. = Parachaeta nigricalyptrata (Macquart, 1855 syn. nov.; L. montagna (Townsend, 1912; L. nuda Thompson, 1963. One species was not examined, Leschenaultia nigrisquamis (Townsend, 1892, and two were not recognized, L. trichopsis (Bigot, 1887 and L. hirta Robineau-Desvoidy, 1830. Keys for Nearctic and Neotropical species

  11. A metagenomic assessment of the bacteria associated with Lucilia sericata and Lucilia cuprina (Diptera: Calliphoridae).

    Science.gov (United States)

    Singh, Baneshwar; Crippen, Tawni L; Zheng, Longyu; Fields, Andrew T; Yu, Ziniu; Ma, Qun; Wood, Thomas K; Dowd, Scot E; Flores, Micah; Tomberlin, Jeffery K; Tarone, Aaron M

    2015-01-01

    Lucilia Robineau-Desvoidy (Diptera: Calliphoridae) is a blow fly genus of forensic, medical, veterinary, and agricultural importance. This genus is also famous because of its beneficial uses in maggot debridement therapy (MDT). Although the genus is of considerable economic importance, our knowledge about microbes associated with these flies and how these bacteria are horizontally and trans-generationally transmitted is limited. In this study, we characterized bacteria associated with different life stages of Lucilia sericata (Meigen) and Lucilia cuprina (Wiedemann) and in the salivary gland of L. sericata by using 16S rDNA 454 pyrosequencing. Bacteria associated with the salivary gland of L. sericata were also characterized using light and transmission electron microscopy (TEM). Results from this study suggest that the majority of bacteria associated with these flies belong to phyla Proteobacteria, Firmicutes, and Bacteroidetes, and most bacteria are maintained intragenerationally, with a considerable degree of turnover from generation to generation. In both species, second-generation eggs exhibited the highest bacterial phylum diversity (20 % genetic distance) than other life stages. The Lucilia sister species shared the majority of their classified genera. Of the shared bacterial genera, Providencia, Ignatzschineria, Lactobacillus, Lactococcus, Vagococcus, Morganella, and Myroides were present at relatively high abundances. Lactobacillus, Proteus, Diaphorobacter, and Morganella were the dominant bacterial genera associated with a survey of the salivary gland of L. sericata. TEM analysis showed a sparse distribution of both Gram-positive and Gram-negative bacteria in the salivary gland of L. sericata. There was more evidence for horizontal transmission of bacteria than there was for trans-generational inheritance. Several pathogenic genera were either amplified or reduced by the larval feeding on decomposing liver as a resource. Overall, this study provides

  12. Germination ecology of Rhynchosia capitata: an emerging summer weed in Asia Ecologia da germinação de Rhynchosia capitata: planta daninha emergente durante o verão na Ásia

    Directory of Open Access Journals (Sweden)

    H.H. Ali

    2013-06-01

    Full Text Available Rhynchosia capitata is becoming an increasing problem in summer crops, such as cotton, soybean, pearl millet and mungbean in many Asian countries. Laboratory and greenhouse studies have been conducted to determine the effects of several environmental factors on seed germination patterns and seedling emergence of R. capitata. We investigated whether the diverse ecological factors such as temperature, light, salinity, moisture stress, pH, and soil depth affected germination and seedling emergence of R. capitata. Germination increased as temperature increased from 25ºC and significantly reduced at 45ºC. Presence or absence of light did not influence germination. Germination of R. capitata was sensitive to increased salt and moisture stress, as well as to seed burial depth. Only 48% of seeds germinated at 150 mM salt concentration compared to 100% in control (distilled water. Similarly, 15% of seeds germinated at an osmotic potential of ‑0.8 MPa compared to 88% at ‑0.2 MPa. The optimum pH for seed germination of R. capitata was 7 (98% germination, but the seeds also germinated at lower level of pH 5 (85% and at higher level of pH 10 (75%. In seed burial trial, maximum seedling emergence of 93% occurred at 2 cm depth, and seedling did not emerge from a depth of 12 cm. The high germination ability of R. capitata under a wide range of ecological factors suggests that this species is likely to be the one to cause more problems in a near future, if not managed appropriately.A Rhynchosia capitata vem se tornando um problema crescente para culturas de verão como algodão, soja, milheto e feijão-mungo em muitos países asiáticos. Foram feitos estudos de laboratório e estufa para determinar os efeitos de vários fatores ambientais sobre os padrões de germinação das sementes e emergência das plântulas de R. capitata. Diversos fatores ecológicos, tais como, temperatura, luz, salinidade, estresse hídrico, pH e profundidade do solo foram

  13. SENSIBILIDADE DE OVOS DE Ceratitis capitata (WIED., 1824 IRRADIADOS EM DIETA ARTIFICIAL E EM FRUTOS DE MANGA (Mangifera indica L.

    Directory of Open Access Journals (Sweden)

    A RAGA

    1996-01-01

    Full Text Available O objetivo deste trabalho foi determinar as doses de radiação gama que impedissem a emergência de adultos de Ceratitis capitata, a partir de ovos irradiados em dieta artificial e em frutos de manga. Quinhentos ovos de 6, 12, 24 e 48 horas de idade foram irradiados em cada dose. A infestação artificial de ovos ocorreu em mangas das cultivares Haden, Tommy Atkins ou Keitt. Um aumento da radioresistência de ovos foi observado durante o desenvolvimento embrionário, e para ovos de 48 horas em dieta artificial, foi estimado um Probit 9 de 24,67Gy. Não foi observada influência significativa dos frutos de manga na eficiência da irradiação dos ovos, quando comparada com os testes em dieta artificial.The objective of this study was to establish gamma radiation doses required to prevent emergence of Ceratitis capitata (Wied. adults, from irradiated eggs in artificial diet and mango fruits. Six-, twelve-, twenty-four- and fourty-eight-hour-old eggs were used. Artificial infestation by C. capitata was carried out in mangoes of `Haden', `Tommy Atkins' and `Keitt' cultivars. An increase of radiation resistance of C. capitata eggs was observed as a function of the embryonic development and a Probit 9 of 24.67Gy was estimated for 48-hour-old eggs in artificial diet. No significant influence of mango fruits was found on the efficacy of irradiation.

  14. Genomic structure and expression analysis of the RNase kappa family ortholog gene in the insect Ceratitis capitata.

    Science.gov (United States)

    Rampias, Theodoros N; Fragoulis, Emmanuel G; Sideris, Diamantis C

    2008-12-01

    Cc RNase is the founding member of the recently identified RNase kappa family, which is represented by a single ortholog in a wide range of animal taxonomic groups. Although the precise biological role of this protein is still unknown, it has been shown that the recombinant proteins isolated so far from the insect Ceratitis capitata and from human exhibit ribonucleolytic activity. In this work, we report the genomic organization and molecular evolution of the RNase kappa gene from various animal species, as well as expression analysis of the ortholog gene in C. capitata. The high degree of amino acid sequence similarity, in combination with the fact that exon sizes and intronic positions are extremely conserved among RNase kappa orthologs in 15 diverse genomes from sea anemone to human, imply a very significant biological function for this enzyme. In C. capitata, two forms of RNase kappa mRNA (0.9 and 1.5 kb) with various lengths of 3' UTR were identified as alternative products of a single gene, resulting from the use of different polyadenylation signals. Both transcripts are expressed in all insect tissues and developmental stages. Sequence analysis of the extended region of the longer transcript revealed the existence of three mRNA instability motifs (AUUUA) and five poly(U) tracts, whose functional importance in RNase kappa mRNA decay remains to be explored.

  15. Flutuação populacional de Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae na Região Oeste de Santa Catarina, Brasil Population fluctuation of Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae in the Western Region of Santa Catarina State, Brazil

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    2003-01-01

    Full Text Available Fruit flies are the major pests in fruit orchards and require a frequent insecticide aplication control, which increases production cost and chemical residues in fruits. Adults of Anastrepha fraterculus were sampled from twelve peach, plum, orange, tangerine and acid lime orchards in four counties in the Western Region of Santa Catarina. Modified McPhail plastic traps, baited with glucose 10%, were used to collect the flies from October 1998 to September 2000. Trap monitoring, bait replacement and fruit flies sorting by species and sex were done weekly. A total of 4,164 specimens of A. fraterculus was collected and highest population was registered in the county of Chapecó (64,8% of all sampled flies. Adults were collected all year long, with the highest population peaks occurring from December and January, although the fluctuation was different for each fruit species due to their particular phenology and in different years. Positive correlation among temperature, atmospheric humidity and population levels of adults of A. fraterculus was observed. According to the degree days obtained for each year, 4851.9, 4632.9 and 4983.7, respectively in 1998, 1999 and 2000, it was established that A. fraterculus could present an average of 11.2 generations a year.

  16. Respuesta de ecotipos de Stylosanthes capitata a dosis de cobre en solución nutritiva

    Directory of Open Access Journals (Sweden)

    Pizarro Esteban A.

    1986-09-01

    Full Text Available La solución nutritiva de Arnon y Hoagland se modificó a 1/10 para simular las condiciones de acidez y fertilidad del suelo de las sabanas bien drenadas isohipertérmicas de los Llanos Orientales de Colombia. Se usaron seis concentraciones de cobre (0,0.05, 0.1, 0.2, 0.4 Y 0.8 ppm. la solución nutritiva se renovó cada 15 días y se aplicaron nitrógeno (14 ppm/semana e hierro (1 ppm, 3/semana. La cantidad de materia seca producida por los ecotipos y el cultivar Capica en los tratamientos de 0.2, 0.4 Y0.8 ppm Cu, fue relativamente te nula. La producción de materia seca de la parte aérea, raíz y total de la planta fue diferente en los ecotipos de S capitata. Así mismo hubo diferencias significativas en la concentración, absorción y translocación del cobre por lo ecotipos y el cultivar Capica. El requerimiento diferencial de cobre, manifestado en la producción de materia seca en la parte aérea en el nivel 0.05 ppr por los ecotipos CIAT 1693 y 1728 por el cultivar Capica (CIAT 102801, se define como el resultado de las relaciones evolutivas de cada ecotipo con el nivel de cobre disponible en la solución del suelo.In the greenhouse ecotypes of Stylosanthes capitata were cultivated to observe their behavior under different copper concentrations. A nutrient solution based on Arnon and Hoagland's (1/10 was used to simulate the acidity and the fertility of well drained savannas of the Eastern Planes of Colombia. Six concentrations of copper were used (O, 0.05, 0.1, 0.2, 0.4 and 0.8 ppm with rewal of the nutrient solution every 15 days, and applications of nitrogen (14 ppm/week and iron (1 ppm, three times/week. The dry matter quantity produced by the ecotypes and the Capica cultivar under treatments of 0.2, 0.4 and 0.8 ppm Cu, relatively nill. A differential behavior of Stylosanthes capitata ecotypes responses to applied copper was observed in relation to dry matter production in aerial, part, root and total plant. So, there were significant

  17. Excess functional copy of allele at chromosomal region 11p15 may cause Wiedemann-Beckwith (EMG) syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, T.; Saitoh, S.; Jinno, Y.; Niikawa, N.; Matsumoto, T. [Nagasaki Univ. School of Medicine (Japan); Narahara, K. [Okayama Univ. School of Medicine, Okayama (Japan); Fukushima, Y. [Saitama Children`s Hospital, Iwatsuki (Japan)

    1994-02-15

    Wiedemann-Beckwith syndrome (WBS) is a genetic disorder with overgrowth and predisposition to Wilms` tumor. The putative locus of the gene responsible for this syndrome is assigned to chromosome region 11p15.5, and genomic imprinting in this region has been proposed: the paternally derived gene(s) at 11p15.5 is selectively expressed, while the maternally transmitted gene(s) is inactive. The authors examined 18 patients for the parental origin of their 11p15 regions. DNA polymorphism analyses using 6 loci on chromosome 11 showed that 2 patients with duplications of 11p15 regions from their respective fathers and one from the mother, indicating the transmission of an excessive paternal gene at 11p15 to each patient. The result, together with the previous findings in karyotypically normal or abnormal patients and in overgrowth mouse experiments, are consistent with imprinting hypothesis that overexpression of paternally derived gene(s) at 11p15.5, probably the human insulin-like growth factor II (IFG-II) gene, may cause the phenotype. Total constitutional uniparental paternal disomy (UPD) or segmental UPD for the 6 loci examined of chromosome 11 was not observed in our 12 sporadic patients. In order to explain completely the inheritance of this syndrome in patients with various chromosomal constitutions, the authors propose an alternative imprinting mechanism involving the other locus that may be paternally imprinted and may suppress the expression of this gene. 28 refs., 3 figs., 1 tab.

  18. Genome-wide paternal uniparental disomy as a cause of Beckwith-Wiedemann syndrome associated with recurrent virilizing adrenocortical tumors.

    Science.gov (United States)

    Bertoin, F; Letouzé, E; Grignani, P; Patey, M; Rossignol, S; Libé, R; Pasqual, C; Lardière-Deguelte, S; Hoeffel-Fornes, C; Gaillard, D; Previderè, C; Delemer, B; Lalli, E

    2015-06-01

    Beckwith-Wiedemann syndrome (BWS) is an overgrowth syndrome characterized by fetal macrosomia, macroglossia, and abdominal wall defects. BWS patients are at risk to develop Wilms tumor, neuroblastoma, hepatoblastoma, and adrenal tumors. A young woman with BWS features, but with inconclusive genetic evidence for the disease, came to clinical observation for signs of virilization at the age of 16 years. An adrenocortical tumor was diagnosed and surgically resected. The tumor underwent 2 local relapses that were also surgically treated. The patient was also operated to remove a breast fibroadenoma. SNP arrays were used to analyze chromosome abnormalities in normal and tumor samples from the patient and her parents. The patient presented genome-wide mosaic paternal uniparental disomy (patUPD) both in the adrenocortical and the breast tumors, with different degrees of loss of heterozygosity (LOH). The more recent relapses of the adrenocortical tumor showed a loss of part of chromosome 17p that was absent in the first tumor. Analysis of a skin biopsy sample also showed mosaic patUPD with partial LOH, while no LOH was detected in leukocyte DNA. This case shows that virilizing adrenocortical tumors may be a clinical feature of patients with BWS. The SNP array technology is useful to diagnose genome-wide patUPD mosaicism in BWS patients with an inconclusive molecular diagnosis and underlines the tumorigenic potential of the absence of the maternal genome combined with an excess of the paternal genome.

  19. Imprinted anomalies in fetal and childhood growth disorders: the model of Russell-Silver and Beckwith-Wiedemann syndromes.

    Science.gov (United States)

    Netchine, Irène; Rossignol, Sylvie; Azzi, Salah; Brioude, Fréderic; Le Bouc, Yves

    2012-01-01

    Fetal growth is a complex process. Its restriction is associated with morbidity and long term metabolic consequences. Imprinted genes have a critical role in mammalian fetal growth. The human chromosome 11p15 encompasses two imprinted domains regulated by their own differentially methylated region (DMR), also called Imprinted Control Region (ICR1 at the H19/IGF-2 domain, paternally methylated), and ICR2 at the KCNQ1/CDKN1C domain (maternally methylated). Loss of imprinting at these two domains is implicated in two growth disorders clinically opposite. A loss of DNA methylation (LOM) at ICR1 is identified in over 50% of patients with Russell-Silver syndrome (RSS), characterized by intrauterine and postnatal growth retardation, spared cranial growth, frequent body asymmetry and severe feeding difficulties. Inversely, a gain of methylation at ICR1 is found in 10% of patients with Beckwith-Wiedemann syndrome (BWS), an overgrowth syndrome with an enhanced childhood tumor risk. We have identified over 150 RSS patients with 11p15 LOM allowing long-term follow-up studies and proposal of clinical guidelines. We also found that ∼10% of RSS patients and ∼25% of BWS patients have multilocus LOM at imprinted regions other than ICR1 or ICR2 11p15, respectively. Recent studies have identified cis-acting regulatory elements and trans-acting factors involved in the regulation of 11p15 imprinting, establishing new potential mechanisms of RSS and BWS.

  20. Beckwith-Wiedemann syndrome and pseudohypoparathyroidism type Ib in a patient with multilocus imprinting disturbance: a female-dominant phenomenon?

    Science.gov (United States)

    Sano, Shinichiro; Matsubara, Keiko; Nagasaki, Keisuke; Kikuchi, Toru; Nakabayashi, Kazuhiko; Hata, Kenichiro; Fukami, Maki; Kagami, Masayo; Ogata, Tsutomu

    2016-08-01

    Although recent studies have often revealed the presence of multilocus imprinting disturbance (MLID) at differentially methylated regions (DMRs) in patients with imprinting disorders (IDs), most patients exhibit clinical features of the original ID only. Here we report a Japanese female patient with Beckwith-Wiedemann syndrome and pseudohypoparathyroidism type Ib. Molecular studies revealed marked methylation defects (MDs) at the Kv-DMR and the GNAS-DMRs and variable MDs at four additional DMRs, in the absence of a mutation in ZFP57, NLRP2, NLRP7, KHDC3L and NLRP5. It is likely that the MDs at the Kv-DMR and the GNAS-DMRs were sufficient to cause clinically recognizable IDs, whereas the remaining MDs were insufficient to result in clinical consequences or took place at DMRs with no disease-causing imprinted gene(s). The development of MLID and the two IDs of this patient may be due to a mutation in a hitherto unknown gene for MLID, or to a reduced amount of DNA methyltransferase-1 (DNMT1) available for the methylation maintenance of DMRs because of the consumption of DNMT1 by the maintenance of X-inactivation. In support of the latter possibility, such co-existence of two IDs has primarily been identified in female patients, and MLID has predominantly been identified as loss of methylations.

  1. Hypopituitarism in a patient with Beckwith-Wiedemann syndrome due to hypomethylation of KvDMR1.

    Science.gov (United States)

    Baiocchi, Michela; Yousuf, Fatimah Sireen; Hussain, Khalid

    2014-04-01

    Beckwith-Wiedemann syndrome (BWS) is caused by dysregulation of imprinted genes on chromosome 11.p15.5. The syndrome includes overgrowth, macroglossia, organomegaly, abdominal wall defects, hypoglycemia, and long-term malignancy risk. No patient who has BWS has been reported with hypopituitarism. We describe a patient who presented at birth with macrosomia, macroglossia, respiratory distress, jaundice, and hypoglycemia, and who was followed for 4.5 years. Genetic test for BWS was performed, which detected loss of maternal methylation on region KvDMR1 (11p15.5). The hypoglycemia was attributable to hyperinsulinism and was treated with diazoxide and chlorothiazide. She responded well, but the hypoglycemia returned after reducing the diazoxide. It was possible to stop the diazoxide after 2.5 years. On routine follow-up she was noted to be developing short stature. Baseline pituitary and growth hormone (GH) stimulation tests detected GH deficiency and secondary hypothyroidism. A brain MRI showed a small anterior pituitary gland. Thereafter, thyroxine and replacement therapy with GH were started, which resulted in a remarkable improvement in growth velocity. This is the first patient to be reported as having hypopituitarism and BWS. It is unclear if the BWS and the hypopituitarism are somehow connected; however, further investigations are necessary. Hypopituitarism explains the protracted hypoglycemia and the short stature. In our patient, GH therapy seems to be safe, but strict follow-up is required given the increased cancer risk related to BWS.

  2. MACROGLOSSIA AS A CAUSE OF ATYPICAL SWALLOWING: COMPARISON OF EVALUATION AND LOGOPEDIC TREATMENT BETWEEN BECKWITH-WIEDEMANN AND DOWN PATIENTS

    Directory of Open Access Journals (Sweden)

    C. Anichini

    2013-12-01

    Full Text Available Atypical swallowing is the persistence of childlike deglutition at the end of dental eruption. One of the main causes is macroglossia, that is the abnormal enlargement of the tongue. The treatment is logopedic and/or surgical. Children with macroglossia have an increased incidence of respiratory diseases and infections, as well as malocclusions, articulatory defects and aesthetic damage. In this study we focused on two genetic syndromes with macroglossia: Beckwith-Wiedemann Syndrome (BWS and Down Syndrome (DS: 7 patients were evaluated for logopedic treatment: 3 are affected by BWS, 2 are affected by DS. In addition, 2 patients with isolated atypical swallowing were included in the study to emphasize problems connected with atypical swallowing. All the patients underwent a global examination and a personalized logopedic therapy scheme was planned. With the exception of one of them who was lost to follow up and who did not continue with the exercises the speech therapist had recommended, all the children showed good response and compliance with remarkable improvements, thus proving the importance of an early, constant and intensive logopedic treatment.

  3. Clinical and molecular analyses of Beckwith-Wiedemann syndrome: Comparison between spontaneous conception and assisted reproduction techniques.

    Science.gov (United States)

    Tenorio, Jair; Romanelli, Valeria; Martin-Trujillo, Alex; Fernández, García-Moya; Segovia, Mabel; Perandones, Claudia; Pérez Jurado, Luis A; Esteller, Manel; Fraga, Mario; Arias, Pedro; Gordo, Gema; Dapía, Irene; Mena, Rocío; Palomares, María; Pérez de Nanclares, Guiomar; Nevado, Julián; García-Miñaur, Sixto; Santos-Simarro, Fernando; Martinez-Glez, Víctor; Vallespín, Elena; Monk, David; Lapunzina, Pablo

    2016-10-01

    Beckwith-Wiedemann syndrome (BWS) is an overgrowth syndrome characterized by an excessive prenatal and postnatal growth, macrosomia, macroglossia, and hemihyperplasia. The molecular basis of this syndrome is complex and heterogeneous, involving genes located at 11p15.5. BWS is correlated with assisted reproductive techniques. BWS in individuals born following assisted reproductive techniques has been found to occur four to nine times higher compared to children with to BWS born after spontaneous conception. Here, we report a series of 187 patients with to BWS born either after assisted reproductive techniques or conceived naturally. Eighty-eight percent of BWS patients born via assisted reproductive techniques had hypomethylation of KCNQ1OT1:TSS-DMR in comparison with 49% for patients with BWS conceived naturally. None of the patients with BWS born via assisted reproductive techniques had hypermethylation of H19/IGF2:IG-DMR, neither CDKN1 C mutations nor patUPD11. We did not find differences in the frequency of multi-locus imprinting disturbances between groups. Patients with BWS born via assisted reproductive techniques had an increased frequency of advanced bone age, congenital heart disease, and decreased frequency of earlobe anomalies but these differences may be explained by the different molecular background compared to those with BWS and spontaneous fertilization. We conclude there is a correlation of the molecular etiology of BWS with the type of conception. © 2016 Wiley Periodicals, Inc.

  4. New genetic tools for improving SIT in Ceratitis capitata: embryonic lethality and sperm marking

    Energy Technology Data Exchange (ETDEWEB)

    Schetelig, Marc F.; Wimmer, Ernst A. [Georg-August-University, Gottingen (Germany). Johann-Friedrich Blumenbach Institute of Zoology and Anthropology. Gottingen Center for Molecular Biosciences; Scolari, Francesca; Gasperi, Giuliano [Universita di Pavia (Italy). Dipt. di Biologia Animale; Handler, Ernst A. [U.S. Department of Agriculture (USDA/ARS), Gainesville, FL (United States). Agricultural Research Service. Center for Medical, Agricultural and Veterinary Entomology

    2006-07-01

    Environment friendly sterile insect technique (SIT) is being applied effectively as a component of area-wide integrated pest management (AW-IPM) for Ceratitis capitata since 1970s. Nevertheless improved biological strategies are needed to increase the efficacy of AW-IPM. Transgenic approaches should increase and widen the applicability of such programmes to different pest species. In this respect two major strategies are followed: First an approach to cause sterility was designed without interfering with spermatogenesis to maintain males and their sperm as competitive as possible. We followed a strategy, which is based on the expression of a lethal factor under the control of a promoter that is active at early blastoderm stages. The system employs the ectopic expression of a hyperactive pro apoptotic gene that causes embryo-specific lethality when driven by the tetracycline-controlled trans activator tTA under the regulation of a cellularization gene enhancer/promoter. The system has been tested successfully in Drosophila melanogaster (Horn and Wimmer 2003). We tried the direct transfer of the Drosophila system to Ceratitis capitata by injecting the respective constructs that carry Drosophila-derived promoters. Unfortunately, the cellularization specific promoters from Drosophila seem not functional in Ceratitis. Therefore, the corresponding enhancers/promoters from Ceratitis were isolated and subsequently the tTA was brought independently under the control of each enhancer/promoter region. These constructs were injected in Ceratitis for further evaluation. Second, we have engineered a medfly strain carrying a sperm marking system. This strain carries two fluorescent markers. One (turboGFP) marker is under the control of the spermatogenesis specific b2-tubulin promoter from Ceratitis and is therefore sperm specifically expressed. The second (DsRed) is under the control of the poly ubiquitin promoter of Drosophila. Released males from this strain could be

  5. Sublethal effect of neem extract on mediterranean fruit fly adults Efeito subletal de extratos de Azadirachta indica Sobre adultos de Ceratitis capitata

    Directory of Open Access Journals (Sweden)

    Márcio Alves Silva

    2013-03-01

    Full Text Available The sublethal effect of extracts of Azadirachta indica on Ceratitis capitata was evaluated. Two pairs of flies were treated in plastic tubes with cotton placed in plastic cages. An artificial diet (hydrolyzed protein + sugar was provided ad libitum. The extracts affected significantly the longevity of C. capitata. The pre-oviposition period were not significantly affected by the extracts. The A. indica branches extracted with dichloromethane (888 ppm affected significantly the fecundity and fertility, reducing the number of eggs laid to approximately 80 % and the egg hatching by 30 % at the 8th day. Therefore, the neem branches extracted with dichloromethane affected the reproduction of C. capitata.Neste estudo, avaliou-se o efeito subletal de extratos de Azadirachta indica sobre Ceratitis capitata. Os tratamentos em um tubo plástico com algodão foram expostos para dois casais numa gaiola plástica. Nessa gaiola, também foi fornecida dieta artificial (proteína hidrolisada + açúcar ad libitum. Os extratos afetaram significativamente a longevidade de C. capitata. O período de pré-oviposição não foi significativamente afetado pelos extratos. Em contrapartida, o extrato de ramos em diclorometano (888 ppm afetou a fecundidade e a fertilidade, reduzindo em 80% o número de ovos colocados e a viabilidade dos ovos em 30%, no 8º dia. Portanto, o extrato de ramos em diclorometano afeta a reprodução de C. capitata.

  6. Impact of copper toxicity on stone-head cabbage (Brassica oleracea var. capitata) in hydroponics.

    Science.gov (United States)

    Ali, Sajid; Shahbaz, Muhammad; Shahzad, Ahmad Naeem; Khan, Hafiz Azhar Ali; Anees, Moazzam; Haider, Muhammad Saleem; Fatima, Ammara

    2015-01-01

    Arable soils are frequently subjected to contamination with copper as the consequence of imbalanced fertilization with manure and organic fertilizers and/or extensive use of copper-containing fungicides. In the present study, the exposure of stone-head cabbage (Brassica oleracea var. capitata) to elevated Cu(2+) levels resulted in leaf chlorosis and lesser biomass yield at ≥2 µ M. Root nitrate content was not statistically affected by Cu(2+) levels, although it was substantially decreased at ≥5 µ M Cu(2+) in the shoot. The decrease in nitrate contents can be related to lower nitrate uptake rates because of growth inhibition by Cu-toxicity. Shoot sulfate content increased strongly at ≥2 µ M Cu(2+) indicating an increase in demand for sulfur under Cu stress. Furthermore, at ≥2 µM concentration, concentration of water-soluble non-protein thiol increased markedly in the roots and to a smaller level in the shoot. When exposed to elevated concentrations of Cu(2+) the improved sulfate and water-soluble non-protein thiols need further studies for the evaluation of their direct relation with the synthesis of metal-chelating compounds (i.e., phytochelatins).

  7. Impact of copper toxicity on stone-head cabbage (Brassica oleracea var. capitata in hydroponics

    Directory of Open Access Journals (Sweden)

    Sajid Ali

    2015-08-01

    Full Text Available Arable soils are frequently subjected to contamination with copper as the consequence of imbalanced fertilization with manure and organic fertilizers and/or extensive use of copper-containing fungicides. In the present study, the exposure of stone-head cabbage (Brassica oleracea var. capitata to elevated Cu2+ levels resulted in leaf chlorosis and lesser biomass yield at ≥2 µ M. Root nitrate content was not statistically affected by Cu2+ levels, although it was substantially decreased at ≥5 µ M Cu2+ in the shoot. The decrease in nitrate contents can be related to lower nitrate uptake rates because of growth inhibition by Cu-toxicity. Shoot sulfate content increased strongly at ≥2 µ M Cu2+ indicating an increase in demand for sulfur under Cu stress. Furthermore, at ≥2 µM concentration, concentration of water-soluble non-protein thiol increased markedly in the roots and to a smaller level in the shoot. When exposed to elevated concentrations of Cu2+ the improved sulfate and water-soluble non-protein thiols need further studies for the evaluation of their direct relation with the synthesis of metal-chelating compounds (i.e., phytochelatins.

  8. The nitrogen and nitrate economy of butterhead lettuce (Lactuca sativa var capitata L).

    Science.gov (United States)

    Broadley, Martin R; Seginer, Ido; Burns, Amanda; Escobar-Gutiérrez, Abraham J; Burns, Ian G; White, Philip J

    2003-09-01

    Quantifying and simulating the relationships between crop growth, total-nitrogen (total-N) and nitrate-N (NO3--N) concentration can improve crop nutritional husbandry. In this study, the relationship between shoot relative growth rate (RGR) and shoot total-N, organic-N and NO3--N concentration of hydroponically-grown lettuce (Lactuca sativa var. capitata L. cv. Kennedy) was described and simulated. Plants were grown hydroponically for up to 74 d. Nitrogen was supplied throughout (control; T1), or removed at 35 d (T2) and 54 d (T3), respectively, after sowing. The organic-N and NO3--N concentration declined in the shoots of control plants with growth, until commercial maturity approached when organic-N and NO3--N concentration increased. There were sub-linear relationships between both total-N and organic-N concentration, and shoot RGR, in the N-limited treatments, i.e. shoot RGR approached an asymptote at high shoot N concentration. The proportional effects of total-N and organic-N concentration on shoot RGR were independent of plant age. A dynamic simulation model ('Nicolet'), derived previously under different conditions, was used to simulate the growth, dry matter content, organic-N, and NO3--N concentration of lettuce grown under the extreme N-stress conditions experienced by the plants. In view of the largely successful fitting of the model to experimental data, the model was used to interpret the results. Suggestions for model improvement are made.

  9. Transcriptome profiling of sexual maturation and mating in the Mediterranean fruit fly, Ceratitis capitata.

    Directory of Open Access Journals (Sweden)

    Ludvik M Gomulski

    Full Text Available Sexual maturation and mating in insects are generally accompanied by major physiological and behavioural changes. Many of these changes are related to the need to locate a mate and subsequently, in the case of females, to switch from mate searching to oviposition behaviour. The prodigious reproductive capacity of the Mediterranean fruit fly, Ceratitis capitata, is one of the factors that has led to its success as an invasive pest species. To identify the molecular changes related to maturation and mating status in male and female medfly, a microarray-based gene expression approach was used to compare the head transcriptomes of sexually immature, mature virgin, and mated individuals. Attention was focused on the changes in abundance of transcripts related to reproduction, behaviour, sensory perception of chemical stimulus, and immune system processes. Broad transcriptional changes were recorded during female maturation, while post-mating transcriptional changes in females were, by contrast, modest. In male medfly, transcriptional changes were consistent both during maturation and as a consequence of mating. Of particular note was the lack of the mating-induced immune responses that have been recorded for Drosophila melanogaster, that may be due to the different reproductive strategies of these species. This study, in addition to increasing our understanding of the molecular machinery behind maturation and mating in the medfly, has identified important gene targets that might be useful in the future management of this pest.

  10. Transcriptome profiling of sexual maturation and mating in the Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Gomulski, Ludvik M; Dimopoulos, George; Xi, Zhiyong; Scolari, Francesca; Gabrieli, Paolo; Siciliano, Paolo; Clarke, Anthony R; Malacrida, Anna R; Gasperi, Giuliano

    2012-01-01

    Sexual maturation and mating in insects are generally accompanied by major physiological and behavioural changes. Many of these changes are related to the need to locate a mate and subsequently, in the case of females, to switch from mate searching to oviposition behaviour. The prodigious reproductive capacity of the Mediterranean fruit fly, Ceratitis capitata, is one of the factors that has led to its success as an invasive pest species. To identify the molecular changes related to maturation and mating status in male and female medfly, a microarray-based gene expression approach was used to compare the head transcriptomes of sexually immature, mature virgin, and mated individuals. Attention was focused on the changes in abundance of transcripts related to reproduction, behaviour, sensory perception of chemical stimulus, and immune system processes. Broad transcriptional changes were recorded during female maturation, while post-mating transcriptional changes in females were, by contrast, modest. In male medfly, transcriptional changes were consistent both during maturation and as a consequence of mating. Of particular note was the lack of the mating-induced immune responses that have been recorded for Drosophila melanogaster, that may be due to the different reproductive strategies of these species. This study, in addition to increasing our understanding of the molecular machinery behind maturation and mating in the medfly, has identified important gene targets that might be useful in the future management of this pest.

  11. Sperm storage and use in polyandrous females of the globally invasive fruitfly, Ceratitis capitata.

    Science.gov (United States)

    Bertin, Sabrina; Scolari, Francesca; Guglielmino, Carmela R; Bonizzoni, Mariangela; Bonomi, Angelica; Marchini, Daniela; Gomulski, Ludvik M; Gasperi, Giuliano; Malacrida, Anna R; Matessi, Carlo

    2010-11-01

    The medfly, Ceratitis capitata, is an invasive species in which polyandry, associated with sperm precedence, is a common behaviour in the wild. In this species, characterized by internal fertilization, we disclose how the sperm from two males are stored in the female storage organs and how they are used in terms of paternity outcome. The experiments were designed to furnish comparable and unbiased estimates of sperm numbers and progeny in twice-mated females. Results are incorporated in a model through which it is possible to relate the amount of stored sperm with the progeny of twice-mated females. The results show that polyandrous medfly females conserve equal amounts of sperm from the two males to fertilize their eggs. However, we observed a clear advantage of the second male's sperm in siring progeny, which interestingly decreases in favor of the first male as ovipositions progress. The results enable us to exclude differential sperm mortality and suggest that it is the mechanics governing the storage organs which causes the initial, but decreasing second male sperm precedence during the female reproductive life. These outcomes allow us to correlate sperm use in polyandrous females with the mating strategies and invasiveness of this fly.

  12. Thermotolerance and HSP70 expression in the Mediterranean fruit fly Ceratitis capitata.

    Science.gov (United States)

    Kalosaka, Katerina; Soumaka, Elisavet; Politis, Nikos; Mintzas, Anastassios C

    2009-06-01

    The relationship between Hsp70 expression and thermotolerance has been well documented in Drosophila melanogaster. However, there is limited information on this relationship in other insect species. In this report we describe the Hsp70-thermotolerance relationship in one of the major fruit fly pests, Ceratitis capitata (medfly). Hsp70 expression and thermotolerance were assayed at a range of temperatures in several stages of medfly development. The most thermotolerant stage was found to be the late larval stage (100% survival at 41 degrees C) followed by adult flies and late embryos (100% survival at 39 degrees C). These three stages showed a positive relationship between Hsp70 expression and thermotolerance. Mid-larval and mid-embryonic stages were found less thermotolerant and the Hsp70-thermotolerance relationship was not evident. Early embryos did not express Hsp70 at any temperature and exhibited the lowest thermotolerance. The relationship between Hsp70 and inducible thermotolerance was also studied in late larvae. A pretreatment at 37-39 degrees C increased thermotolerance at higher temperatures by approximately 1 degrees C. In parallel, the pretreatment increased Hsp70 expression suggesting a close link between Hsp70 expression and inducible thermotolerance. The increased Hsp70 levels after pretreatment were found to be due to the increased levels of the hsp70 RNA.

  13. Formation and structural organization of the egg-sperm bundle of the scleractinian coral Montipora capitata

    Science.gov (United States)

    Padilla-Gamiño, J. L.; Weatherby, T. M.; Waller, R. G.; Gates, R. D.

    2011-06-01

    The majority of scleractinian corals are hermaphrodites that broadcast spawn their gametes separately or packaged as egg-sperm bundles during spawning events that are timed to the lunar cycle. The egg-sperm bundle is an efficient way of transporting gametes to the ocean surface where fertilization takes place, while minimizing sperm dilution and maximizing the opportunity for gamete encounters during a spawning event. To date, there are few studies that focus on the formation and structure of egg-sperm bundle. This study explores formation, ultrastructure, and longevity of the egg-sperm bundle in Montipora capitata, a major reef building coral in Hawai`i. Our results show that the egg-sperm bundle is formed by a mucus layer secreted by the oocytes. The sperm package is located at the center of each bundle, possibly reflecting the development of male and female gametes in different mesenteries. Once the egg-sperm bundle has reached the ocean surface, it breaks open within 10-35 min, depending on the environmental conditions (i.e., wind, water turbulence). Although the bundle has an ephemeral life span, the formation of an egg-sperm bundle is a fundamental part of the reproductive process that could be strongly influenced by climate change and deterioration of water quality (due to anthropogenic effects) and thus requires further investigation.

  14. Tabanid flies (Insecta: Diptera from Chhattisgarh, India

    Directory of Open Access Journals (Sweden)

    Kailash Chandra

    2015-08-01

    Full Text Available The paper presents an account on the Tabanidae (Diptera from Chhattisgarh, which includes 16 species representing five genera under three subfamilies: Pangoniinae, Chrysopsinae and Tabaninae. Among these species, Haematopota latifascia Ricardo is new addition to the fauna of Chhattisgarh. The distributional area of the collection localities, key characters are also provided. 

  15. Revised irradiation doses to control melon fly, Mediterranean fruit fly, and oriental fruit fly (Diptera: Tephritidae) and a generic dose for tephritid fruit flies.

    Science.gov (United States)

    Follett, Peter A; Armstrong, John W

    2004-08-01

    Currently approved irradiation quarantine treatment doses for Bactrocera cucurbitae (Coquillet), melon fly; Ceratitis capitata (Wiedemann), Mediterranean fruit fly; and Bactrocera dorsalis (Hendel), oriental fruit fly, infesting fruits and vegetables for export from Hawaii to the continental United States are 210, 225, and 250 Gy, respectively. Irradiation studies were initiated to determine whether these doses could be reduced to lower treatment costs, minimize any adverse effects on quality, and support a proposed generic irradiation dose of 150 Gy for fruit flies. Dose-response tests were conducted with late third instars of wild and laboratory strains of the three fruit fly species, both in diet and in fruit. After x-ray irradiation treatment, data were taken on adult emergence, and adult female fecundity and fertility. Melon fly was the most tolerant of the three species to irradiation, and oriental fruit fly was more tolerant than Mediterranean fruit fly. Laboratory and wild strains of each species were equally tolerant of irradiation, and larvae were more tolerant when irradiated in fruit compared with artificial diet. An irradiation dose of 150 Gy applied to 93,666 melon fly late third instars in papayas resulted in no survival to the adult stage, indicating that this dose is sufficient to provide quarantine security. Irradiation doses of 100 and 125 Gy applied to 31,920 Mediterranean fruit fly and 55,743 oriental fruit fly late third instars, respectively, also resulted in no survival to the adult stage. Results support a proposed generic irradiation quarantine treatment dose of 150 Gy for all tephritid fruit flies.

  16. Nieuwe en zeldzame vliegen voor de Nederlandse fauna (Diptera)

    NARCIS (Netherlands)

    Aartsen, van B.

    1997-01-01

    New and rare flies for the Dutch fauna (Diptera) In this paper an overview is given of captures of rare and interesting Diptera, belonging to different families, mainly from the years 19941996. In total 46 species are presented, of which 13 are new to the Dutch fauna (marked with an *), viz.: Spania

  17. Een nieuwe daas voor Nederland: Hybomitra arpadi (Diptera: Tabanidae)

    NARCIS (Netherlands)

    Zeegers, T.

    2002-01-01

    A new horsefly for the Netherlands: Hybomitra arpadi (Diptera: Tabanidae) The horsefly Hybomitra arpadi (Diptera: Tabanidae) is recorded for the first time from the Netherlands. New features for the recognition of the males and some notes on the biology are given.

  18. Beckwith–Wiedemann syndrome and uniparental disomy 11p: fine mapping of the recombination breakpoints and evaluation of several techniques

    Science.gov (United States)

    Romanelli, Valeria; Meneses, Heloisa N M; Fernández, Luis; Martínez-Glez, Victor; Gracia-Bouthelier, Ricardo; F Fraga, Mario; Guillén, Encarna; Nevado, Julián; Gean, Esther; Martorell, Loreto; Marfil, Victoria Esteban; García-Miñaur, Sixto; Lapunzina, Pablo

    2011-01-01

    Beckwith–Wiedemann syndrome (BWS) is a phenotypically and genotypically heterogeneous overgrowth syndrome characterized by somatic overgrowth, macroglossia and abdominal wall defects. Other usual findings are hemihyperplasia, embryonal tumours, adrenocortical cytomegaly, ear anomalies, visceromegaly, renal abnormalities, neonatal hypoglycaemia, cleft palate, polydactyly and a positive family history. BWS is a complex, multigenic disorder associated, in up to 90% of patients, with alteration in the expression or function of one or more genes in the 11p15.5 imprinted gene cluster. There are several molecular anomalies associated with BWS and the large proportion of cases, about 85%, is sporadic and karyotypically normal. One of the major categories of BWS molecular alteration (10–20% of cases) is represented by mosaic paternal uniparental disomy (pUPD), namely patients with two paternally derived copies of chromosome 11p15 and no maternal contribution for that. In these patients, in addition to the effects of IGF2 overexpression, a decreased level of the maternally expressed gene CDKN1C may contribute to the BWS phenotype. In this paper, we reviewed a series of nine patients with BWS because of pUPD using several methods with the aim to evaluate the percentage of mosaicism, the methylation status at both loci, the extension of the pUPD at the short arm and the breakpoints of recombination. Fine mapping of mitotic recombination breakpoints by single-nucleotide polymorphism-array in individuals with UPD and fine estimation of epigenetic defects will provide a basis for understanding the aetiology of BWS, allowing more accurate prognostic predictions and facilitating management and surveillance of individuals with this disorder. PMID:21248736

  19. Genome-wide paternal uniparental disomy mosaicism in a woman with Beckwith-Wiedemann syndrome and ovarian steroid cell tumour.

    Science.gov (United States)

    Gogiel, Magdalena; Begemann, Matthias; Spengler, Sabrina; Soellner, Lukas; Göretzlehner, Ulf; Eggermann, Thomas; Strobl-Wildemann, Gertrud

    2013-07-01

    Uniparental disomy (UPD) of single chromosomes is a well-known molecular aberration in a group of congenital diseases commonly known as imprinting disorders (IDs). Whereas maternal and/or paternal UPD of chromosomes 6, 7, 11, 14 and 15 are associated with specific IDs (Transient neonatal diabetes mellitus, Silver-Russell syndrome, Beckwith-Wiedemann syndrome (BWS), upd(14)-syndromes, Prader-Willi syndrome, Angelman Syndrome), the other autosomes are not. UPD of the whole genome is not consistent with life, in case of non-mosaic genome-wide paternal UPD (patUPD) it leads to hydatidiform mole. In contrast, mosaic genome-wide patUPD might be compatible with life. Here we present a 19-year-old woman with BWS features and initially diagnosed to be carrier of a mosaic patUPD of chromosome 11p15. However, the patient presented further clinical findings not typically associated with BWS, including nesidioblastosis, fibroadenoma, hamartoma of the liver, hypoglycaemia and ovarian steroid cell tumour. Additional molecular investigations revealed a mosaic genome-wide patUPD. So far, only nine cases with mosaic genome-wide patUPD and similar clinical findings have been reported, but these patients were nearly almost diagnosed in early childhood. Summarising the data from the literature and those from our patient, it can be concluded that the mosaic genome-wide patUPD (also known as androgenic/biparental mosaicism) might explain unusual BWS phenotypes. Thus, these findings emphasise the need for multilocus testing in IDs to efficiently detect cases with disturbances affecting more than one chromosome.

  20. Beckwith-Wiedemann syndrome and uniparental disomy 11p: fine mapping of the recombination breakpoints and evaluation of several techniques.

    Science.gov (United States)

    Romanelli, Valeria; Meneses, Heloisa N M; Fernández, Luis; Martínez-Glez, Victor; Gracia-Bouthelier, Ricardo; F Fraga, Mario; Guillén, Encarna; Nevado, Julián; Gean, Esther; Martorell, Loreto; Marfil, Victoria Esteban; García-Miñaur, Sixto; Lapunzina, Pablo

    2011-04-01

    Beckwith-Wiedemann syndrome (BWS) is a phenotypically and genotypically heterogeneous overgrowth syndrome characterized by somatic overgrowth, macroglossia and abdominal wall defects. Other usual findings are hemihyperplasia, embryonal tumours, adrenocortical cytomegaly, ear anomalies, visceromegaly, renal abnormalities, neonatal hypoglycaemia, cleft palate, polydactyly and a positive family history. BWS is a complex, multigenic disorder associated, in up to 90% of patients, with alteration in the expression or function of one or more genes in the 11p15.5 imprinted gene cluster. There are several molecular anomalies associated with BWS and the large proportion of cases, about 85%, is sporadic and karyotypically normal. One of the major categories of BWS molecular alteration (10-20% of cases) is represented by mosaic paternal uniparental disomy (pUPD), namely patients with two paternally derived copies of chromosome 11p15 and no maternal contribution for that. In these patients, in addition to the effects of IGF2 overexpression, a decreased level of the maternally expressed gene CDKN1C may contribute to the BWS phenotype. In this paper, we reviewed a series of nine patients with BWS because of pUPD using several methods with the aim to evaluate the percentage of mosaicism, the methylation status at both loci, the extension of the pUPD at the short arm and the breakpoints of recombination. Fine mapping of mitotic recombination breakpoints by single-nucleotide polymorphism-array in individuals with UPD and fine estimation of epigenetic defects will provide a basis for understanding the aetiology of BWS, allowing more accurate prognostic predictions and facilitating management and surveillance of individuals with this disorder.

  1. Single cell analysis demonstrating somatic mosaicism involving 11p in a patient with paternal isodisomy and Beckwith-Wiedemann Syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Bischoff, F.Z.; McCaskill, C.; Subramanian, S. [Baylor College of Medicine, Houston, TX (United States)] [and others

    1994-09-01

    Beckwith-Wiedemann Syndrome (BWS) is characterized by numerous growth abnormalities including exomphalos, macroglossia, gigantism, and hemihypertrophy or hemihyperplasia. The {open_quotes}BWS gene{close_quotes} appears to be maternally repressed and is suspected to function as a growth factor or regulator of somatic growth, since activation of this gene through a variety of mechanisms appears to result in somatic overgrowth and tumor development. Mosaic paternal isodisomy of 11p has been observed previously by others in patients with BWS by Southern blot analysis of genomic DNA. The interpretation of these results was primarily based on the intensities of the hybridization signals for the different alleles. In our study, we demonstrate somatic mosaicism directly through PCR and single cell analysis. Peripheral blood was obtained from a patient with BWS and initial genomic DNA analysis by PCR was suggestive of somatic mosaicism for paternal isodisomy of 11p. Through micromanipulation, single cells were isolated and subjected to primer extention preamplification. Locus-specific microsatellite marker analyses by PCR were performed to determine the chromosome 11 origins in the preamplified individual cells. Two populations of cells were detected, a population of cells with normal biparental inheritance and a population of cells with paternal isodisomy of 11p and biparental disomy of 11q. Using the powerful approach of single cell analysis, the detected somatic mosaicism provides evidence for a mitotic recombinational event that has resulted in loss of the maternal 11p region and gain of a second copy of paternal 11p in some cells. The direct demonstration of mosaicism may explain the variable phenotypes and hemihypertrophy often observed in BWS.

  2. Prenatal molecular testing for Beckwith-Wiedemann and Silver-Russell syndromes: a challenge for molecular analysis and genetic counseling.

    Science.gov (United States)

    Eggermann, Thomas; Brioude, Frédéric; Russo, Silvia; Lombardi, Maria P; Bliek, Jet; Maher, Eamonn R; Larizza, Lidia; Prawitt, Dirk; Netchine, Irène; Gonzales, Marie; Grønskov, Karen; Tümer, Zeynep; Monk, David; Mannens, Marcel; Chrzanowska, Krystyna; Walasek, Malgorzata K; Begemann, Matthias; Soellner, Lukas; Eggermann, Katja; Tenorio, Jair; Nevado, Julián; Moore, Gudrun E; Mackay, Deborah Jg; Temple, Karen; Gillessen-Kaesbach, Gabriele; Ogata, Tsutomu; Weksberg, Rosanna; Algar, Elizabeth; Lapunzina, Pablo

    2016-06-01

    Beckwith-Wiedemann and Silver-Russell syndromes (BWS/SRS) are two imprinting disorders (IDs) associated with disturbances of the 11p15.5 chromosomal region. In BWS, epimutations and genomic alterations within 11p15.5 are observed in >70% of patients, whereas in SRS they are observed in about 60% of the cases. In addition, 10% of the SRS patients carry a maternal uniparental disomy of chromosome 7 11p15.5. There is an increasing demand for prenatal testing of these disorders owing to family history, indicative prenatal ultrasound findings or aberrations involving chromosomes 7 and 11. The complex molecular findings underlying these disorders are a challenge not only for laboratories offering these tests but also for geneticists counseling affected families. The scope of counseling must consider the range of detectable disturbances and their origin, the lack of precise quantitative knowledge concerning the inheritance and recurrence risks for the epigenetic abnormalities, which are hallmarks of these developmental disorders. In this paper, experts in the field of BWS and SRS, including members of the European network of congenital IDs (EUCID.net; www.imprinting-disorders.eu), put together their experience and work in the field of 11p15.5-associated IDs with a focus on prenatal testing. Altogether, prenatal tests of 160 fetuses (122 referred for BWS, 38 for SRS testing) from 5 centers were analyzed and reviewed. We summarize the current knowledge on BWS and SRS with respect to diagnostic testing, the consequences for prenatal genetic testing and counseling and our cumulative experience in dealing with these disorders.

  3. Multiple genetic loci within 11p15 defined by Beckwith-Wiedemann syndrome rearrangement breakpoints and subchromosomal transferable fragments.

    Science.gov (United States)

    Hoovers, J M; Kalikin, L M; Johnson, L A; Alders, M; Redeker, B; Law, D J; Bliek, J; Steenman, M; Benedict, M; Wiegant, J

    1995-01-01

    Beckwith-Wiedemann syndrome (BWS) involves fetal overgrowth and predisposition to a wide variety of embryonal tumors of childhood. We have previously found that BWS is genetically linked to 11p15 and that this same band shows loss of heterozygosity in the types of tumors to which children with BWS are susceptible. However, 11p15 contains > 20 megabases, and therefore, the BWS and tumor suppressor genes could be distinct. To determine the precise physical relationship between these loci, we isolated yeast artificial chromosomes, and cosmid libraries from them, within the region of loss of heterozygosity in embryonal tumors. Five germ-line balanced chromosomal rearrangement breakpoint sites from BWS patients, as well as a balanced chromosomal translocation breakpoint from a rhabdoid tumor, were isolated within a 295- to 320-kb cluster defined by a complete cosmid contig crossing these breakpoints. This breakpoint cluster terminated approximately 100 kb centromeric to the imprinted gene IGF2 and 100 kb telomeric to p57KIP2, an inhibitor of cyclin-dependent kinases, and was located within subchromosomal transferable fragments that suppressed the growth of embryonal tumor cells in genetic complementation experiments. We have identified 11 transcribed sequences in this BWS/tumor suppressor coincident region, one of which corresponded to p57KIP2. However, three additional BWS breakpoints were > 4 megabases centromeric to the other five breakpoints and were excluded from the tumor suppressor region defined by subchromosomal transferable fragments. Thus, multiple genetic loci define BWS and tumor suppression on 11p15. Images Fig. 1 Fig. 3 PMID:8618920

  4. Revision of the Neotropical Xanthandrus Verral (Diptera, Syrphidae

    Directory of Open Access Journals (Sweden)

    Borges Zuleica M.

    2003-01-01

    Full Text Available The Neotropical genus Xanthandrus Verral, 1901 is revised. Six species are redescribed: X. bucephalus (Wiedemann, 1830, X. cubanus Fluke, 1936, X. mellinoides (Macquart, 1846, X. mexicanus Curran, 1930, X. nitidulus Fluke, 1937, and X. plaumanni Fluke, 1937. Three species are included based on original descriptions: X. flavomaculatus Shannon, 1927, X. palliatus (Fluke, 1945, and X. simplex (Loew, 1861. New synonyms proposed: Argentinomyia longicornis (Walker, 1837 = Xanthandrus biguttatus Hull, 1945 syn. nov., and Xanthandrus bucephalus (Wiedemann, 1830 = Melanostoma quadrinotata Bigot, 1884 syn. nov. Description of terminalia, a key for Neotropical species, and illustrations are also presented.

  5. Nitrate reductase activity in cabbage (Brassica oleracae var. capitata seedlings affected by the different nitrogen fertilizer forms

    Directory of Open Access Journals (Sweden)

    Metin Turan

    2013-12-01

    Full Text Available The effect of different nitrogen fertilizer (potassium nitrate, ammonium nitrate, ammonium sulphate, urea and farmyard manure on nitrate reductase activity in cabbage (Brassica oleracea var. capitata seedlings were studied. pH of the plant growth niedia was higher in the nitrate fertilizer treatment than the ammonium and other fertilizer forms. NO3--N application increased NRA in plant, but NH4+-N decreased NRA in plant. Harvesting date and different fertilizer doses increased NRA while NH4+-N decreased plant nitrate uptake. There was a significant relationship between NRA and fertilizer types.

  6. Captures of wild Ceratitis capitata Bactrocera dorsalis and Bactrocera cucurbitae (Diptera: Tephritidae) in traps with improved multi-lure TMR-Dispensers weathered in California

    Science.gov (United States)

    During 2012-2013 two “attract and kill” systems were weathered in California as potential detection and male annihilation treatments (MAT). Solid Mallet TMR (trimedlure [TML], methyl eugenol [ME], raspberry ketone [RK]) wafers impregnated with DDVP (2, 2-dichlorovinyl dimethyl phosphate) insecticide...

  7. Cryopreservation of Embryos of the Mediterranean Fruit Fly Ceratitis capitata Vienna 8 Genetic Sexing Strain

    Science.gov (United States)

    Augustinos, Antonios A.; Rajamohan, Arun; Kyritsis, Georgios A.; Zacharopoulou, Antigone; Haq, Ihsan ul; Targovska, Asya; Caceres, Carlos; Bourtzis, Kostas; Abd-Alla, Adly M. M.

    2016-01-01

    The Mediterranean fruit fly, Ceratitis capitata, is one of the most serious pests of fruit crops world-wide. During the last decades, area-wide pest management (AW-IPM) approaches with a sterile insect technique (SIT) component have been used to control populations of this pest in an effective and environment-friendly manner. The development of genetic sexing strains (GSS), such as the Vienna 8 strain, has been played a major role in increasing the efficacy and reducing the cost of SIT programs. However, mass rearing, extensive inbreeding, possible bottleneck phenomena and hitch-hiking effects might pose major risks for deterioration and loss of important genetic characteristics of domesticated insect. In the present study, we present a modified procedure to cryopreserve the embryos of the medfly Vienna 8 GSS based on vitrification and used this strain as insect model to assess the impact of the cryopreservation process on the genetic structure of the cryopreserved insects. Forty-eight hours old embryos, incubated at 24°C, were found to be the most suitable developmental stage for cryopreservation treatment for high production of acceptable hatch rate (38%). Our data suggest the absence of any negative impact of the cryopreservation process on egg hatch rate, pupation rates, adult emergence rates and stability of the temperature sensitive lethal (tsl) character on two established cryopreserved lines (flies emerged from cryopreserved embryos), named V8-118 and V8-228. Taken together, our study provides an optimized procedure to cryopreserve the medfly Vienna 8 GSS and documents the absence of any negative impact on the genetic structure and quality of the strain. Benefits and sceneries for utilization of this technology to support operational SIT projects are discussed in this paper. PMID:27537351

  8. Chill-coma recovery time, age and sex determine lipid profiles in Ceratitis capitata tissues.

    Science.gov (United States)

    Pujol-Lereis, Luciana Mercedes; Fagali, Natalia Soledad; Rabossi, Alejandro; Catalá, Ángel; Quesada-Allué, Luis Alberto

    2016-04-01

    The remodeling of membrane composition by changes in phospholipid head groups and fatty acids (FA) degree of unsaturation has been associated with the maintenance of membrane homeostasis under stress conditions. Overall lipid levels and the composition of cuticle lipids also influence insect stress resistance and tissue protection. In a previous study, we demonstrated differences in survival, behavior and Cu/Zn superoxide dismutase gene expression between subgroups of Ceratitis capitata flies that had a reversible recovery from chill-coma and those that developed chilling-injury. Here, we analyzed lipid profiles from comparable subgroups of 15 and 30-day-old flies separated according to their recovery time after a chill-coma treatment. Neutral and polar lipid classes of chill-coma subgroups were separated by thin layer chromatography and quantified by densitometry. FA composition of polar lipids of chill-coma subgroups and non-stressed flies was evaluated using gas chromatography coupled to mass spectrometry. Higher amounts of neutral lipids such as triglycerides, diacylglycerol, wax esters, sterol esters and free esters were found in male flies that recovered faster from chill-coma compared to slower flies. A multivariate analysis revealed changes in patterns of storage and cuticle lipids among subgroups both in males and females. FA unsaturation increased after cold exposure, and was higher in thorax of slower subgroups compared to faster subgroups. The changes in neutral lipid patterns and FA composition depended on recovery time, sex, age and body-part, and were not specifically associated with the development of chilling-injury. An analysis of phospholipid classes showed that the phosphatidylcholine to lysophosphatidylcholine ratio (PC/LPC) was significantly higher, or showed a tendency, in subgroups that may have developed chilling-injury compared to those with a reversible recovery from coma.

  9. Cryopreservation of Embryos of the Mediterranean Fruit Fly Ceratitis capitata Vienna 8 Genetic Sexing Strain.

    Science.gov (United States)

    Augustinos, Antonios A; Rajamohan, Arun; Kyritsis, Georgios A; Zacharopoulou, Antigone; Haq, Ihsan Ul; Targovska, Asya; Caceres, Carlos; Bourtzis, Kostas; Abd-Alla, Adly M M

    2016-01-01

    The Mediterranean fruit fly, Ceratitis capitata, is one of the most serious pests of fruit crops world-wide. During the last decades, area-wide pest management (AW-IPM) approaches with a sterile insect technique (SIT) component have been used to control populations of this pest in an effective and environment-friendly manner. The development of genetic sexing strains (GSS), such as the Vienna 8 strain, has been played a major role in increasing the efficacy and reducing the cost of SIT programs. However, mass rearing, extensive inbreeding, possible bottleneck phenomena and hitch-hiking effects might pose major risks for deterioration and loss of important genetic characteristics of domesticated insect. In the present study, we present a modified procedure to cryopreserve the embryos of the medfly Vienna 8 GSS based on vitrification and used this strain as insect model to assess the impact of the cryopreservation process on the genetic structure of the cryopreserved insects. Forty-eight hours old embryos, incubated at 24°C, were found to be the most suitable developmental stage for cryopreservation treatment for high production of acceptable hatch rate (38%). Our data suggest the absence of any negative impact of the cryopreservation process on egg hatch rate, pupation rates, adult emergence rates and stability of the temperature sensitive lethal (tsl) character on two established cryopreserved lines (flies emerged from cryopreserved embryos), named V8-118 and V8-228. Taken together, our study provides an optimized procedure to cryopreserve the medfly Vienna 8 GSS and documents the absence of any negative impact on the genetic structure and quality of the strain. Benefits and sceneries for utilization of this technology to support operational SIT projects are discussed in this paper.

  10. Evaluation of Food Lures for Capture and Monitoring of Anastrepha fraterculus (Diptera: Tephritidae) on Temperate Fruit Trees.

    Science.gov (United States)

    Rosa, J M da; Arioli, C J; Santos, J P Dos; Menezes-Netto, A C; Botton, M

    2017-03-16

    The Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) is the main pest of fruit trees grown in temperate climates in the southern region of Brazil. The objective of this work was to evaluate the efficiency of the major commercial food lures used in Brazil for trapping and monitoring of A. fraterculus in plum, pear, and feijoa orchards. The assessed lures were hydrolyzed proteins of animal origin (CeraTrap) and plant origin (BioAnastrepha), torula yeast + borax (Torula), and grape juice. Response variables included the rate of adult capture (flies per trap per day, FTD) and the percentage of females captured. We also evaluated the number of times the weekly capture rate exceeded the traditional threshold of 0.5 FTD for each lure. Traps baited with grape juice, currently used for monitoring A. fraterculus in Southern Brazil, captured fewer adults and a lower percentage of females compared with the other lures. CeraTrap trapped a greater number of A. fraterculus adults and, in some cases, a lower percentage of females compared with the other lures in pears. Traps baited with CeraTrap had greater capture rates (FTD), particularly during the stages of fruit maturation and harvest, and even in years with low population density of A. fraterculus, thus demonstrating greater sensitivity in the detection of this pest. These results show that, in order to detect and monitor the presence of A. fraterculus in plum, feijoa, and pear crops, protein-based lures are superior to grape juice, especially the animal protein CeraTrap.

  11. Tissue loss (white syndrome) in the coral Montipora capitata is a dynamic disease with multiple host responses and potential causes

    Science.gov (United States)

    Work, Thierry M.; Russell, Robin; Aeby, Greta S.

    2012-01-01

    Tissue loss diseases or white syndromes (WS) are some of the most important coral diseases because they result in significant colony mortality and morbidity, threatening dominant Acroporidae in the Caribbean and Pacific. The causes of WS remain elusive in part because few have examined affected corals at the cellular level. We studied the cellular changes associated with WS over time in a dominant Hawaiian coral, Montipora capitata, and showed that: (i) WS has rapidly progressing (acute) phases mainly associated with ciliates or slowly progressing (chronic) phases mainly associated with helminths or chimeric parasites; (ii) these phases interchanged and waxed and waned; (iii) WS could be a systemic disease associated with chimeric parasitism or a localized disease associated with helminths or ciliates; (iv) corals responded to ciliates mainly with necrosis and to helminths or chimeric parasites with wound repair; (v) mixed infections were uncommon; and (vi) other than cyanobacteria, prokaryotes associated with cell death were not seen. Recognizing potential agents associated with disease at the cellular level and the host response to those agents offers a logical deductive rationale to further explore the role of such agents in the pathogenesis of WS in M. capitata and helps explain manifestation of gross lesions. This approach has broad applicability to the study of the pathogenesis of coral diseases in the field and under experimental settings.

  12. Cloning and purification of protein kinase CK2 recombinant alpha and beta subunits from the Mediterranean fly Ceratitis capitata.

    Science.gov (United States)

    Kouyanou-Koutsoukou, Sophia; Baier, Andrea; Kolaitis, Regina-Maria; Maniatopoulou, Evanthia; Thanopoulou, Konstantina; Szyszka, Ryszard

    2011-10-01

    The Mediterranean fruit fly Ceratitis capitata is an insect capable of wreaking extensive damage to a wide range of fruit crops. Protein kinase CK2 is a ubiquitous Ser/Thr kinase that is highly conserved among eukaryotes; it is a heterotetramer composed of two catalytic (α) and a dimer of regulatory (β) subunits. We present here the construction of the cDNA molecules of the CK2α and CK2β subunits from the medfly C. capitata by the 5'/3' RACE and RT-PCR methods, respectively. CcCK2α catalytic subunit presents the characteristic and conserved features of a typical protein kinase, similar to the regulatory CcCK2β subunit, that also possess the conserved features of regulatory CK2β subunits, as revealed by comparison of their predicted amino acid sequences with other eukaryotic species. The recombinant CcCK2α and CcCK2β proteins were purified by affinity chromatography to homogeneity, after overexpression in Escherichia coli. CcCK2α is capable to utilize GTP and its activity and is inhibited by polyanions and stimulated by polycations in phosphorylation assays, using purified acidic ribosomal protein P1 as a substrate.

  13. Highly differentiated populations of the freshwater diatom Sellaphora capitata suggest limited dispersal and opportunities for allopatric speciation.

    Science.gov (United States)

    Evans, Katharine M; Chepurnov, Victor A; Sluiman, Hans J; Thomas, Sindu J; Spears, Bryan M; Mann, David G

    2009-08-01

    The diversities and distributions of diatoms are much more complex than was ever imagined. To understand the underlying mechanisms, research must focus on evolutionary processes occurring at a population level and employ sufficiently informative molecular markers. Using ten microsatellites and ITS rDNA sequence data, we investigated the genetic structure of populations of the benthic freshwater diatom Sellaphora capitata (until 2004 a cryptic entity within the S. pupula agg. species complex). This is the first time that microsatellites have been used to investigate the genetic structure of any freshwater or benthic microalga. Using an integrated approach (morphology, DNA barcoding and specificity of the microsatellite primers), we verified the identity of 70 S. capitata isolates obtained from lakes in the UK, Belgium and Australia. Standardized F'(ST) values were very high (>0.4) and in Bayesian analyses, isolates clustered according to their country of origin, with limited evidence of admixture. However, selected isolates from all countries were sexually compatible, a result consistent with limited ITS divergence. Considering the apparent absence of desiccation-resistant resting stages in most diatoms, we conclude that such levels of differentiation are likely to be a consequence of limited dispersal. With restricted dispersal, previously unacknowledged opportunities for allopatric speciation exist, which may help to explain the huge extant diversity of diatoms.

  14. Beckwith-Wiedemann综合征九例及随访%Nine Cases of Beckwith-Wiedemann Syndrome and Their Follow-up

    Institute of Scientific and Technical Information of China (English)

    宋家其; 佘亚雄

    1993-01-01

    收治Beckwith-Wiedemann综合征9例,其中7例为新生儿,男7例,女2例.脐膨出为其最突出的畸形.分析其诊断特点及合并畸形,治疗方法首先解决危及生命的病症:低血糖和脐膨出.强调术前认真检查,术后定期随访,以防合并恶性肿瘤.%Nine cases (male 7,female 2) of Beckwith-Wiedemann syndrome included 7 neonates and 2 of five years old.The most common deformity was omphalocele (9 cases).Besides there were PDA (1),prominent malrotation (1),umbilical hernia(2),and Wilms'tumor(1) etc.The treatment of this syndrome is mainly controlling hypoglycemia and repairing omphalocele.Because there is a tendency of malignant change in Beckwith-Wiedemann syndrome,therefore a long-term followed-up should be emphasized.

  15. Studies on male genitalia of sarcophagidae (Diptera based on scanning electron microscope observations Estudos sobre a genitália masculina de Sarcophagidae (Diptera baseados em observações de microscópio de varredura

    Directory of Open Access Journals (Sweden)

    Antônio Cesar Rios Leite

    1989-06-01

    Full Text Available Male genitalia of Oxyvinia exicisa (Lopes, Oxysarcodexia thomax (Walker, O. fluminensis Lopes, Sarcodexia lambens (Wiedemann, Peckia chrysostoma (Wiedemann and Liopygia ruficornis (Fabricius were studied based on scanning electron microscope photography. Some important details were evidentiated with this method.As genitálias dos machos de Oxyvinia excisa (Lopes, Oxysarcodexia tornax (Walker, O. fluminensis Lopes, sarcodexia lambens (Wiedemann, Peckia chrysostoma (Wiedemann e Liopygia ruficornis (Fabricius foram estudadas com base em fotografias de microscópio de varredura. Alguns detalhes importantes foram evidenciados por este método.

  16. Metalimnobia crane flies (Diptera: Limoniidae) from Korea.

    Science.gov (United States)

    Podenas, Sigitas; Byun, Hye-Woo

    2016-06-30

    Korean species of the crane fly genus Metalimnobia Matsumura, 1911 (Diptera: Limoniidae), are taxonomically revised. Metalimnobia (Metalimnobia) channpayna new species, is described and figured, M. (M.) bifasciata (Schrank, 1781), M. (M.) quadrinotata (Meigen, 1818) and M. (M.) zetterstedti (Tjeder, 1968) are listed for the first time in Korea, new information for previously known species, M. (M.) quadrimaculata (Linnaeus, 1760) is added. Identification key for all Korean Metalimnobia species is given. Wings, male and female terminalia are illustrated for all species.

  17. Numerous transitions of sex chromosomes in Diptera.

    Science.gov (United States)

    Vicoso, Beatriz; Bachtrog, Doris

    2015-04-01

    Many species groups, including mammals and many insects, determine sex using heteromorphic sex chromosomes. Diptera flies, which include the model Drosophila melanogaster, generally have XY sex chromosomes and a conserved karyotype consisting of six chromosomal arms (five large rods and a small dot), but superficially similar karyotypes may conceal the true extent of sex chromosome variation. Here, we use whole-genome analysis in 37 fly species belonging to 22 different families of Diptera and uncover tremendous hidden diversity in sex chromosome karyotypes among flies. We identify over a dozen different sex chromosome configurations, and the small dot chromosome is repeatedly used as the sex chromosome, which presumably reflects the ancestral karyotype of higher Diptera. However, we identify species with undifferentiated sex chromosomes, others in which a different chromosome replaced the dot as a sex chromosome or in which up to three chromosomal elements became incorporated into the sex chromosomes, and others yet with female heterogamety (ZW sex chromosomes). Transcriptome analysis shows that dosage compensation has evolved multiple times in flies, consistently through up-regulation of the single X in males. However, X chromosomes generally show a deficiency of genes with male-biased expression, possibly reflecting sex-specific selective pressures. These species thus provide a rich resource to study sex chromosome biology in a comparative manner and show that similar selective forces have shaped the unique evolution of sex chromosomes in diverse fly taxa.

  18. Antioxidant and Antiproliferative Activities of the Essential Oils from Thymbra capitata and Thymus Species Grown in Portugal

    Directory of Open Access Journals (Sweden)

    Maria Graça Miguel

    2015-01-01

    Full Text Available The antioxidant and antiproliferative activities of the essential oils from Thymbra capitata and Thymus species grown in Portugal were evaluated. Thymbra and Thymus essential oils were grouped into two clusters: Cluster I in which carvacrol, thymol, p-cymene, α-terpineol, and γ-terpinene dominated and Cluster II in which thymol and carvacrol were absent and the main constituent was linalool. The ability for scavenging ABTS•+ and peroxyl free radicals as well as for preventing the growth of THP-1 leukemia cells was better in essential oils with the highest contents of thymol and carvacrol. These results show the importance of these two terpene-phenolic compounds as antioxidants and cytotoxic agents against THP-1 cells.

  19. Transcriptional profiles of mating-responsive genes from testes and male accessory glands of the Mediterranean fruit fly, Ceratitis capitata.

    Directory of Open Access Journals (Sweden)

    Francesca Scolari

    Full Text Available BACKGROUND: Insect seminal fluid is a complex mixture of proteins, carbohydrates and lipids, produced in the male reproductive tract. This seminal fluid is transferred together with the spermatozoa during mating and induces post-mating changes in the female. Molecular characterization of seminal fluid proteins in the Mediterranean fruit fly, Ceratitis capitata, is limited, although studies suggest that some of these proteins are biologically active. METHODOLOGY/PRINCIPAL FINDINGS: We report on the functional annotation of 5914 high quality expressed sequence tags (ESTs from the testes and male accessory glands, to identify transcripts encoding putative secreted peptides that might elicit post-mating responses in females. The ESTs were assembled into 3344 contigs, of which over 33% produced no hits against the nr database, and thus may represent novel or rapidly evolving sequences. Extraction of the coding sequences resulted in a total of 3371 putative peptides. The annotated dataset is available as a hyperlinked spreadsheet. Four hundred peptides were identified with putative secretory activity, including odorant binding proteins, protease inhibitor domain-containing peptides, antigen 5 proteins, mucins, and immunity-related sequences. Quantitative RT-PCR-based analyses of a subset of putative secretory protein-encoding transcripts from accessory glands indicated changes in their abundance after one or more copulations when compared to virgin males of the same age. These changes in abundance, particularly evident after the third mating, may be related to the requirement to replenish proteins to be transferred to the female. CONCLUSIONS/SIGNIFICANCE: We have developed the first large-scale dataset for novel studies on functions and processes associated with the reproductive biology of Ceratitis capitata. The identified genes may help study genome evolution, in light of the high adaptive potential of the medfly. In addition, studies of male

  20. Revision of the family Nothybidae (Diptera: Schizophora).

    Science.gov (United States)

    Lonsdale, O; Marshall, S A

    2016-04-05

    The family Nothybidae (Diptera: Schizophora) is revised. The family consists of 11 species in the single genus Nothybus Rondani, which occurs in Papua New Guinea, Nepal and much of the Oriental Region. Three species are described as new: N. absens spec. nov. (China), N. cataractus spec. nov. (Laos, Thailand) and N. procerus spec. nov. (India). Nothybus longithorax Rondani, 1875 is treated as a junior synonym of N. longicollis (Walker, 1856). Nothybus decorus Meijere, 1924 syn. nov. is included as a junior synonym of N. lineifer Enderlein, 1922.

  1. Rhipidia crane flies (Diptera: Limoniidae) from Korea.

    Science.gov (United States)

    Podenas, Sigitas; Byun, Hye-Woo; Kim, Sam-Kyu

    2016-07-07

    Korean species of the crane fly genus Rhipidia Meigen, 1818 (Diptera: Limoniidae), are taxonomically revised. Rhipidia (Rhipidia) serena, new species, is described and figured. Rhipidia (R.) longa Zhang, Li, Yang, 2014, R. (R.) maculata Meigen, 1818 and R. (R.) sejuga Zhang, Li, Yang, 2014 are recorded for the first time in Korea. Previously known species, Rhipidia (R.) septentrionis Alexander, 1913 is redescribed and illustrated. Identification key for all Korean Rhipidia species is given. Most antennae, wings, male and female terminalia of all species are illustrated for the first time.

  2. Effect of X-ray irradiation on fruit quality of clementine mandarin cv. 'Clemenules'

    Energy Technology Data Exchange (ETDEWEB)

    Alonso, Miquel [Centre de Technologia Postcollita, Institut Valencia d' Investigacions Agraries (IVIA), Ctra. de Montcada a Naquera, km. 4.5, E-46113 Montcada, Valencia (Spain); Palou, Lluis [Centre de Technologia Postcollita, Institut Valencia d' Investigacions Agraries (IVIA), Ctra. de Montcada a Naquera, km. 4.5, E-46113 Montcada, Valencia (Spain)]. E-mail: lluis.palou@ivia.es; Angel del Rio, Miguel [Centre de Technologia Postcollita, Institut Valencia d' Investigacions Agraries (IVIA), Ctra. de Montcada a Naquera, km. 4.5, E-46113 Montcada, Valencia (Spain); Jacas, Josep-Anton [Departament de Ciencies Experimentals, Universitat Jaume I (UJI), Campus del Riu Sec, E-12071 Castello de la Plana (Spain)

    2007-10-15

    The effects of a potential quarantine treatment consisting of exposure to X-ray irradiation against the Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) on 'Clemenules' mandarin quality are presented and compared with those from the standard cold temperature quarantine treatment. X-ray irradiation doses of 0.195 and 0.395 kGy had no detrimental effects on fruit quality (rind color, firmness, juice yield, maturity index, internal volatiles, deterioration index and sensory evaluation). These results therefore indicate that X-ray irradiation is a harmless and highly effective quarantine technique for clementine mandarin and this technique could be as useful as the current cold treatment for 'Clemenules' mandarins.

  3. Effect of X-ray irradiation on fruit quality of clementine mandarin cv. ‘Clemenules’

    Science.gov (United States)

    Alonso, Miquel; Palou, Lluís; Ángel del Río, Miguel; Jacas, Josep-Anton

    2007-10-01

    The effects of a potential quarantine treatment consisting of exposure to X-ray irradiation against the Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) on 'Clemenules' mandarin quality are presented and compared with those from the standard cold temperature quarantine treatment. X-ray irradiation doses of 0.195 and 0.395 kGy had no detrimental effects on fruit quality (rind color, firmness, juice yield, maturity index, internal volatiles, deterioration index and sensory evaluation). These results therefore indicate that X-ray irradiation is a harmless and highly effective quarantine technique for clementine mandarin and this technique could be as useful as the current cold treatment for 'Clemenules' mandarins.

  4. Butia capitata (Mart. Becc. lamina anatomy as a tool for taxonomic distinction from B. odorata (Barb. Rodr. Noblick comb. nov (Arecaceae

    Directory of Open Access Journals (Sweden)

    BRUNO F. SANT'ANNA-SANTOS

    2015-03-01

    Full Text Available The distinction between Butia capitata and B. odorata is based only on a few morphological characteristics, therefore there is a need for additional studies for supporting the separation of the species. As lamina anatomy characteristics are relevant in circumscribing Arecaceae taxa, this work aimed to describe B. capitata lamina anatomy and compare it with B. odorata. Samples from the middle portion of the pinnae were collected and processed in accordance with standard plant anatomy techniques. The epidermis is uniseriate and composed of a thick cuticle and epicuticular waxes into like hooked filaments. The subsidiary cells that arch over the guard cells are located at the hypodermis. The mesophyll is isobilateral and compact. The vascular bundles are collateral with a sclerenchymatic sheath extension that reaches the hypodermis. The stegmata cells have spherical and druse-like silica bodies. The midrib faces the adaxial surface with a thick fibrous layer surrounding the vascular bundles adjacent to the chlorenchyma. The stratified expansion tissue is on the abaxial surface, within the boundary between the mesophyll and midrib. Raphides are only found in B. capitata. Small bundles of the midrib fully surround the fibrous cylinder only in B. odorata. These characteristics are diagnostic and useful for supporting the proposed separation.

  5. Butia capitata (Mart.) Becc. lamina anatomy as a tool for taxonomic distinction from B. odorata (Barb. Rodr.) Noblick comb. nov (Arecaceae).

    Science.gov (United States)

    Sant'anna-Santos, Bruno F; Carvalho Júnior, Wellington G O; Amaral, Vanessa B

    2015-03-01

    The distinction between Butia capitata and B. odorata is based only on a few morphological characteristics, therefore there is a need for additional studies for supporting the separation of the species. As lamina anatomy characteristics are relevant in circumscribing Arecaceae taxa, this work aimed to describe B. capitata lamina anatomy and compare it with B. odorata. Samples from the middle portion of the pinnae were collected and processed in accordance with standard plant anatomy techniques. The epidermis is uniseriate and composed of a thick cuticle and epicuticular waxes into like hooked filaments. The subsidiary cells that arch over the guard cells are located at the hypodermis. The mesophyll is isobilateral and compact. The vascular bundles are collateral with a sclerenchymatic sheath extension that reaches the hypodermis. The stegmata cells have spherical and druse-like silica bodies. The midrib faces the adaxial surface with a thick fibrous layer surrounding the vascular bundles adjacent to the chlorenchyma. The stratified expansion tissue is on the abaxial surface, within the boundary between the mesophyll and midrib. Raphides are only found in B. capitata. Small bundles of the midrib fully surround the fibrous cylinder only in B. odorata. These characteristics are diagnostic and useful for supporting the proposed separation.

  6. Novel RNA viruses producing simultaneous covert infections in Ceratitis capitata. Correlations between viral titers and host fitness, and implications for SIT programs.

    Science.gov (United States)

    Llopis-Giménez, Angel; Maria González, Rosa; Millán-Leiva, Anabel; Catalá, Marta; Llacer, Elena; Urbaneja, Alberto; Herrero, Salvador

    2017-02-01

    The Mediterranean fruit fly (medfly), Ceratitis capitata is a highly polyphagous pest, which infests multiple species of fruits and vegetables worldwide. In addition to the traditional control with chemical insecticides, sterile insect technique (SIT) has been implemented in integrated programs worldwide, and has become an essential measure for the control of this pest. A key issue for SIT is to release sterile males that are sufficiently competitive with males from the wild population. Using sequence information available in public databases, three novel picornaviruses infecting medflies were discovered and named as C. capitata iflavirus 1 and 2 (CcaIV1 and CcaIV2), and C. capitata noravirus (CcaNV). Additional analyses have revealed the presence of CcaIV2 and CcaNV covertly infecting most of the medfly strains used in the different SIT programs around the world, as well as in field captures in the east of Spain. High viral titers of CcaNV were associated with a reduction in the lifespan of males released to the field for the control of this pest, suggesting the possibility that CcaNV may impair the fitness of sterile flies produced by SIT programs.

  7. Nonhost status of commercial Persea americana 'Hass' to Anastrepha ludens, Anastrepha obliqua, Anastrepha serpentina, and Anastrepha striata (Diptera: Tephritidae) in Mexico.

    Science.gov (United States)

    Aluja, Martín; Díaz-Fleischer, Francisco; Arredondo, José

    2004-04-01

    The objective of this study was to determine the host status in Mexico of commercially cultivated and marketed avocado, Persea americana (Mill.), 'Hass' to Anastrepha ludens (Loew), Anastrepha obliqua (Macquart), Anastrepha serpentina (Wiedemann), and Anastrepha striata (Schiner) (Diptera: Tephritidae). Experiments in Michoacán, Mexico, were carried out in six orchards located at three altitudes above sea level during two times (August-October 2001 and April-June 2002). They included choice ('Hass' avocado plus natural host) and no-choice foraging behavior tests on trees under field cages; no-choice, forced infestation trials on caged, fruit-bearing branches in the field, and with individual fruit under laboratory conditions; infestation trials using 'Hass' avocados left unprotected over 1 and 7 d on the ground of orchards; studies to ascertain depth of oviposition and determine egg hatchability; and experiments to determine susceptibility by using time elapsed since removal of fruit from tree as the experimental variable. We trapped adult Anastrepha (n = 7,936) in all orchards and dissected fruit (n = 7,695) from orchards and packing houses (n = 1,620) in search of eggs or larvae. Most (96.7%) A. ludens, A. obliqua, A. striata, and A. serpentina adults were captured in low-elevation orchards. No eggs or larvae were detected in any of the fruit from foraging behavior studies or dissected fruit from orchards or packing houses. Of 5,200 mature, intact fruit on trees in the field forcibly exposed to no-choice female oviposition activity (five females/fruit), we only found four fruit infested by A. ludens but no adults emerged. 'Hass' avocados only became marginally susceptible to attack by A. ludens (but not A. obliqua, A. serpentina, and A. striata) 24 h after being removed from the tree. Fruit placed on the ground in orchards (n = 3,600) were occasionally infested by Neosilba batesi (Curran) (Diptera: Lonchaeidae), a decomposer, but not Anastrepha spp. Based on our

  8. Recombination rate predicts inversion size in Diptera.

    Science.gov (United States)

    Cáceres, M; Barbadilla, A; Ruiz, A

    1999-09-01

    Most species of the Drosophila genus and other Diptera are polymorphic for paracentric inversions. A common observation is that successful inversions are of intermediate size. We test here the hypothesis that the selected property is the recombination length of inversions, not their physical length. If so, physical length of successful inversions should be negatively correlated with recombination rate across species. This prediction was tested by a comprehensive statistical analysis of inversion size and recombination map length in 12 Diptera species for which appropriate data are available. We found that (1) there is a wide variation in recombination map length among species; (2) physical length of successful inversions varies greatly among species and is inversely correlated with the species recombination map length; and (3) neither the among-species variation in inversion length nor the correlation are observed in unsuccessful inversions. The clear differences between successful and unsuccessful inversions point to natural selection as the most likely explanation for our results. Presumably the selective advantage of an inversion increases with its length, but so does its detrimental effect on fertility due to double crossovers. Our analysis provides the strongest and most extensive evidence in favor of the notion that the adaptive value of inversions stems from their effect on recombination.

  9. Caracterização molecular de populações de Butia capitata (Arecaceae do Sul do Brasil através de marcadores AFLP Molecular characterization of Butia capitata populations (Arecaceae in Southern Brazil estimated by AFLP analysis

    Directory of Open Access Journals (Sweden)

    Miriam Valli Buttow

    2010-03-01

    Full Text Available O gênero Butia (Arecaceae é um pequeno gênero subtropical com espécies no sul da América do Sul, considerado ornamental. Além disso, seus frutos são apreciados pelo sabor e aroma peculiares. Porém, no Rio Grande do Sul, as populações naturais sofrem com o avanço das atividades rurais e da construção imobiliária. O objetivo deste trabalho foi caracterizar oito populações de Butia capitata ocorrentes no Rio Grande do Sul através de marcadores moleculares do tipo AFLP. Pela análise molecular da variância, foi possível verificar que 83,68% da variabilidade genética são atribuídos à variação entre populações e 13,67% são atribuídos a diferenças entre populações dentro de regiões. A análise comparativa entre as oito populações feita de duas a duas demonstrou que são significativas as diferenças entre 15 populações, com média de 14,72% da variação molecular atribuída às diferenças entre populações. Este resultado indica a presença de variabilidade genética distribuída entre todas as populações, sem subdivisão decorrente de isolamento geográfico.The Butia genus (Arecaceae is a small genus with subtropical species distributed in South America widely used as an ornamental plant. Besides, its fruits are appreciated for its unique flavor and aroma. But in some regions in Rio Grande do Sul State natural populations suffer with progress of building and rural activities. The aim of this study, therefore, was characterizing eight populations of Butia capitata through AFLP markers. By analysis of molecular variance was possible to verify that 83.68% of genetic variability is attributed to variation among populations and 13.67% is attributed to differences among populations within regions. In the pair-wise analysis, differences between 15 populations were significant, with an average of 14.72% of molecular variation attributed to differences between populations. This result indicates the presence of genetic

  10. Avaliação de populações de Butia capitata de Santa Vitória do Palmar Performance of populations of Butia capitata of Santa Vitória do Palmar

    Directory of Open Access Journals (Sweden)

    Elisane Schwartz

    2010-09-01

    Full Text Available O gênero Butia pertence à família Arecaceae e possui cinco espécies com ocorrência no Rio Grande do Sul. A espécie Butia capitata está recebendo atenção especial, não só pelo seu uso no consumo in natura como também em formas processadas. No entanto, mesmo sendo uma espécie que tem sua utilização registrada desde os tempos pré-históricos, vem sendo explorada apenas de modo extrativista, como a maioria das espécies de frutíferas nativas. Além disso, a espécie está seriamente comprometida em médio prazo pela ausência de regeneração natural e com risco muito alto de extinção num futuro próximo. Nesse sentido, o objetivo deste trabalho foi comparar os frutos, a partir de parâmetros químicos e físicos, e também observar os dados produtivos das plantas de três populações de butiazeiros do município de Santa Vitória do Palmar-RS. Os dados foram obtidos em experimentos conduzidos na safra de 2005/2006 e na safra de 2006/2007, em três propriedades localizadas em Santa Vitória do Palmar. Os resultados permitiram verificar que as propriedades e ou variações genéticas entre as populações de Butia capitata avaliadas propiciaram variabilidade para duração do ciclo, coloração da epiderme dos frutos, volume de suco produzido, relação entre sólidos solúveis totais e acidez titulável, características biométricas de fruto e produtividade anual. Uma das populações, denominada Celina, apresentou maior produtividade e rendimento industrial. As populações Celina e São José apresentaram as melhores características biométricas de fruto. A população Aguiar apresentou a melhor relação entre sólidos solúveis totais e acidez titulável.The genus Butia belongs to the Arecaceae family and shows five species occurring in Rio Grande de Sul. The specie Butia capitata requires special attention, not just for its use as fresh consumption but also as processed product. However, even having its use recorded since

  11. Microscopia eletrônica de varredura de duas espécies de Fannia Robineau-Desvoidy (Diptera, Fanniidae

    Directory of Open Access Journals (Sweden)

    Ariel David Freitas Al Gazi

    2004-06-01

    Full Text Available As espécies Fannia pusio Wiedeman, 1830 e Fannia trimaculata Stein, 1898 pertencem ao grupo canicularis e ao subgrupo pusio. Estas espécies são morfologicamente muito similares e geralmente são diferenciadas por uma fileira de cerdas no fêmur do terceiro par de pernas do macho. A análise com microscopia eletrônica de varredura mostrou na estrutura denominada "cellas", menor número de orifícios na superfície dorsal do ovo e, na superfície ventral, foi detectado menor rugosidade, ambos em F. trimaculata. Na larva, o estigma ou espiráculo protorácico é proeminente, onde F. trimaculata apresentou duas expansões tegumentares pequenas e sete longas de igual comprimento. Os machos de F. trimaculata apresentam uma fileira de cerdas localizadas mais externamente na faceta e, outra fileira de cerdas menores, a qual é ausente em machos de F. pusio, porém presente nas fêmeas de ambas as espécies.Scanning electron microscopy in two species of Fannia Robineau-Desvoidy, (Diptera, Fanniidae. The species Fannia pusio Wiedemann, 1830 and F. trimaculata Stein, 1898 belong to the canicularis group and pusio subgroup. These species are morphologically very similar and usually distinguished from each other by a line of bristles on the males hind femur. The scanning electron microscopy analysis showed a smaller number of orifices on the dorsal surface of the egg in the structure called "cellas" and, on the ventral surface, less rugosity was noted, both in F. trimaculata. On the larvae, the stigma or protothoracic spiracle was outstanding, where F. trimaculata possess two short tegumental extensions and seven long ones, while F. pusio has nine extensions, all long, of equal length. Males of F. trimaculata present alongside a line of longer bristles located more externally on the facet, another line of shorter bristles, which is absent in males of F. pusio, but present in females of both species.

  12. Are all eggs created equal? A case study from the Hawaiian reef-building coral Montipora capitata

    Science.gov (United States)

    Padilla-Gamiño, Jacqueline L.; Bidigare, Robert R.; Barshis, Daniel J.; Alamaru, Ada; Hédouin, Laetitia; Hernández-Pech, Xavier; Kandel, Frederique; Leon Soon, Sherril; Roth, Melissa S.; Rodrigues, Lisa J.; Grottoli, Andrea G.; Portocarrero, Claudia; Wagenhauser, Stephanie A.; Buttler, Fenina; Gates, Ruth D.

    2013-03-01

    Parental effects have been largely unexplored in marine organisms and may play a significant role in dictating the phenotypic range of traits in coral offspring, influencing their ability to survive environmental challenges. This study explored parental effects and life-stage differences in the Hawaiian reef-building coral Montipora capitata from different environments by examining the biochemical composition of mature coral colonies and their eggs. Our results indicate that there are large biochemical differences between adults and eggs, with the latter containing higher concentration of lipids (mostly wax esters), ubiquitinated proteins (which may indicate high turnover rate of proteins) and antioxidants (e.g., manganese superoxide dismutase). Adults displayed high phenotypic plasticity, with corals from a high-light environment having more wax esters, lighter tissue δ13C signatures and higher Symbiodinium densities than adults from the low-light environment who had higher content of accessory pigments. A green-algal pigment (α-carotene) and powerful antioxidant was present in eggs; it is unclear whether this pigment is acquired from heterotrophic food sources or from endolithic green algae living in the adult coral skeletons. Despite the broad phenotypic plasticity displayed by adults, parental investment in the context of provisioning of energy reserves and antioxidant defense was the same in eggs from the different sites. Such equality in investment maximizes the capacity of all embryos and larvae to cope with challenging conditions associated with floating at the surface and to disperse successfully until an appropriate habitat for settlement is found.

  13. Size relationships of different body parts in the three dipteran species Drosophila melanogaster, Ceratitis capitata and Musca domestica.

    Science.gov (United States)

    Siomava, Natalia; Wimmer, Ernst A; Posnien, Nico

    2016-06-01

    Body size is an integral feature of an organism that influences many aspects of life such as fecundity, life span and mating success. Size of individual organs and the entire body size represent quantitative traits with a large reaction norm, which are influenced by various environmental factors. In the model system Drosophila melanogaster, pupal size and adult traits, such as tibia and thorax length or wing size, accurately estimate the overall body size. However, it is unclear whether these traits can be used in other flies. Therefore, we studied changes in size of pupae and adult organs in response to different rearing temperatures and densities for D. melanogaster, Ceratitis capitata and Musca domestica. We confirm a clear sexual size dimorphism (SSD) for Drosophila and show that the SSD is less uniform in the other species. Moreover, the size response to changing growth conditions is sex dependent. Comparison of static and evolutionary allometries of the studied traits revealed that response to the same environmental variable is genotype specific but has similarities between species of the same order. We conclude that the value of adult traits as estimators of the absolute body size may differ among species and the use of a single trait may result in wrong assumptions. Therefore, we suggest using a body size coefficient computed from several individual measurements. Our data is of special importance for monitoring activities of natural populations of the three dipteran flies, since they are harmful species causing economical damage (Drosophila, Ceratitis) or transferring diseases (Musca).

  14. Impact of the Mediterranean fruit fly (medfly) Ceratitis capitata on different peach cultivars: the possible role of peach volatile compounds.

    Science.gov (United States)

    Tabilio, Maria Rosaria; Fiorini, Dennis; Marcantoni, Enrico; Materazzi, Stefano; Delfini, Maurizio; De Salvador, Flavio Roberto; Musmeci, Sergio

    2013-09-01

    The relationship between susceptibility of different peach cultivars (cvs) to the Mediterranean fruit fly (medfly), Ceratitis capitata, and the volatile composition of ripe fruit of each cv has been investigated, since understanding the fruit-insect interaction mechanism is crucial for developing control strategies for such a pest. Volatile compounds were analyzed by SPME-GC-MS in three cvs highly susceptible to medfly attack (Fair Time, Flaminia, Sicilia Piatta), and in two less susceptible cvs (Percoca Romagnola 7 and Doctor Davis). Among the volatile compounds detected, 88 could be identified. The main differences found in the volatile composition of the cvs, concerned the relative abundance of esters. The least susceptible cvs, above all Percoca Romagnola 7, contained the higher amounts of hexenyl, hexyl, 3-methylbutyl, butyl and 2-methylpropyl esters; among these, some C6 derivatives detected, such as (Z)-3-hexenyl acetate, are known to act as priming agents, enhancing plant defence response to insects. Instead, a lower relative content of methyl esters, such as methyl hexanoate and methyl octanoate, known to act as medfly pheromone and attractant respectively, was found in the least susceptible cvs.

  15. Molecular cloning and primary sequence analysis of a gene encoding a putative shitinase gene in Brassica oleracea var.capitata

    Institute of Scientific and Technical Information of China (English)

    TANGGUOQING; YONGYANBAI; 等

    1996-01-01

    Chitinase,which catalyzes the hydrolysis of the β-1,4-acetyl-D-glucosamine linkages of the fungal cell wall polymer chitin,is involved in inducible plants defense system.By construction of cabbage(Brassica oleracea var. capitata) genomic library and screening the library with pRCH8,a probe of rice chitinase gene fragment,a chitinase genomic sequence was isolated.The complete uncleotide sequence of the putative cabbage chitinase gene (cabch29) was determined,with its longest open reading frame (ORF) encoding a polypeptide of 413 aa.This polypeptide consists of a 21 aa N-terminal signal peptide,two chitin-binding domains different from those of other classes of plant chitinases,and a catalytic domain.Homology analysis illustrated that this cabch29 gene has 58.8% identity at the nucleotide level with the pRCH8 ORF probe and has 50% identity at the amino acid level tiwh the catalytic domains of chitinase from bean,maize and sugar beet.Meanwhile,several kinds of cis-elements,such as TATA box,CAAT box,GATA motif,ASF-1 binding site,wound-response elements and AATAAA,have also been discovered in the flanking region of cabch29 gene.

  16. Pathogenicity and characterization of a novel Bacillus cereus sensu lato isolate toxic to the Mediterranean fruit fly Ceratitis capitata Wied.

    Science.gov (United States)

    Ruiu, Luca; Falchi, Giovanni; Floris, Ignazio; Marche, Maria Giovanna; Mura, Maria Elena; Satta, Alberto

    2015-03-01

    The lethal and sub-lethal effects of sporulated cultures of a novel Bacillus cereus sensu lato strain lacking detectable cry genes and identified through morphological and genetic analyses, have been studied on the Mediterranean fruit fly Ceratitis capitata. The lethal effects on young larvae were concentration dependent, with a median lethal concentration (LC50) of 4.48 × 10(8)spores/g of diet. Sporulated cultures of this strain significantly extended development time and reduced immature survival, and the size of emerging fly adults. Besides spores, the toxicity has been associated to the insoluble extra-spore fraction characterized through a proteomic approach. The profile of the extra-spore protein fraction (ES) showed major protein bands within the 35-65 kDa range. The results of mass spectrometry analysis highlighted the presence of putative virulence factors, including members of protein families previously associated to the insecticidal action of other microbial entomopathogens. These proteins include metalloproteases, peptidases and other enzymes.

  17. Rehydration of forensically important larval Diptera specimens.

    Science.gov (United States)

    Sanford, Michelle R; Pechal, Jennifer L; Tomberlin, Jeffery K

    2011-01-01

    Established procedures for collecting and preserving evidence are essential for all forensic disciplines to be accepted in court and by the forensic community at large. Entomological evidence, such as Diptera larvae, are primarily preserved in ethanol, which can evaporate over time, resulting in the dehydration of specimens. In this study, methods used for rehydrating specimens were compared. The changes in larval specimens with respect to larval length and weight for three forensically important blow fly (Diptera: Calliphoridae) species in North America were quantified. Phormia regina (Meigen), Cochliomyia macellaria (F.), and Chrysomya rufifacies (Macquart) third-instar larvae were collected from various decomposing animals and preserved with three preservation methods (80% ethanol, 70% isopropyl alcohol, and hot-water kill then 80% ethanol). Preservative solutions were allowed to evaporate. Rehydration was attempted with either of the following: 80% ethanol, commercial trisodium phosphate substitute solution, or 0.5% trisodium phosphate solution. All three methods partially restored weight and length of specimens recorded before preservation. Analysis of variance results indicated that effects of preservation, rehydration treatment, and collection animal were different in each species. The interaction between preservative method and rehydration treatment had a significant effect on both P. regina and C. macellaria larval length and weight. In addition, there was a significant interaction effect of collection animal on larval C. macellaria measurements. No significant effect was observed in C. rufifacies larval length or weight among the preservatives or treatments. These methods could be used to establish a standard operating procedure for dealing with dehydrated larval specimens in forensic investigations.

  18. Congenital hyperinsulinism in an infant with paternal uniparental disomy on chromosome 11p15: few clinical features suggestive of Beckwith-Wiedemann syndrome.

    Science.gov (United States)

    Adachi, Hiroyuki; Takahashi, Ikuko; Higashimoto, Ken; Tsuchida, Satoko; Noguchi, Atsuko; Tamura, Hiroaki; Arai, Hirokazu; Ito, Tomoo; Masue, Michiya; Nishibori, Hironori; Takahashi, Tsutomu; Soejima, Hidenobu

    2013-01-01

    Beckwith-Wiedemann syndrome (BWS) is the most common congenital overgrowth syndrome involving tumor predisposition. BWS is caused by various epigenetic or genetic alterations that disrupt the imprinted genes on chromosome 11p15.5 and the clinical findings of BWS are highly variable. Hyperinsulinemic hypoglycemia is reported in about half of all babies with BWS. We identified an infant with diazoxide-unresponsive congenital hyperinsulinism (HI) without any apparent clinical features suggestive of BWS, but diagnosed BWS by molecular testing. The patient developed severe hyperinsulinemic hypoglycemia within a few hours after birth, with macrosomia and mild hydronephrosis. We excluded mutations in the K(ATP) channel genes on chromosome 11p15.1, but found a rare homozygous single nucleotide polymorphism (SNP) of ABCC8. Parental SNP pattern suggested paternal uniparetal disomy in this region. By microsatellite marker analysis on chromosome 11p15, we could diagnose BWS due to the mosaic of paternal uniparental disomy. Our case suggests that some HI of unknown genetic etiology could involve undiagnosed BWS with no apparent clinical features, which might be diagnosed only by molecular testing.

  19. EMQN best practice guidelines for the molecular genetic testing and reporting of chromosome 11p15 imprinting disorders: Silver–Russell and Beckwith–Wiedemann syndrome

    Science.gov (United States)

    Eggermann, Katja; Bliek, Jet; Brioude, Frédéric; Algar, Elizabeth; Buiting, Karin; Russo, Silvia; Tümer, Zeynep; Monk, David; Moore, Gudrun; Antoniadi, Thalia; Macdonald, Fiona; Netchine, Irène; Lombardi, Paolo; Soellner, Lukas; Begemann, Matthias; Prawitt, Dirk; Maher, Eamonn R; Mannens, Marcel; Riccio, Andrea; Weksberg, Rosanna; Lapunzina, Pablo; Grønskov, Karen; Mackay, Deborah JG; Eggermann, Thomas

    2016-01-01

    Molecular genetic testing for the 11p15-associated imprinting disorders Silver–Russell and Beckwith–Wiedemann syndrome (SRS, BWS) is challenging because of the molecular heterogeneity and complexity of the affected imprinted regions. With the growing knowledge on the molecular basis of these disorders and the demand for molecular testing, it turned out that there is an urgent need for a standardized molecular diagnostic testing and reporting strategy. Based on the results from the first external pilot quality assessment schemes organized by the European Molecular Quality Network (EMQN) in 2014 and in context with activities of the European Network of Imprinting Disorders (EUCID.net) towards a consensus in diagnostics and management of SRS and BWS, best practice guidelines have now been developed. Members of institutions working in the field of SRS and BWS diagnostics were invited to comment, and in the light of their feedback amendments were made. The final document was ratified in the course of an EMQN best practice guideline meeting and is in accordance with the general SRS and BWS consensus guidelines, which are in preparation. These guidelines are based on the knowledge acquired from peer-reviewed and published data, as well as observations of the authors in their practice. However, these guidelines can only provide a snapshot of current knowledge at the time of manuscript submission and readers are advised to keep up with the literature. PMID:27165005

  20. Mutations of the Imprinted CDKN1C Gene as a Cause of the Overgrowth Beckwith-Wiedemann Syndrome: Clinical Spectrum and Functional Characterization.

    Science.gov (United States)

    Brioude, Frederic; Netchine, Irène; Praz, Francoise; Le Jule, Marilyne; Calmel, Claire; Lacombe, Didier; Edery, Patrick; Catala, Martin; Odent, Sylvie; Isidor, Bertrand; Lyonnet, Stanislas; Sigaudy, Sabine; Leheup, Bruno; Audebert-Bellanger, Séverine; Burglen, Lydie; Giuliano, Fabienne; Alessandri, Jean-Luc; Cormier-Daire, Valérie; Laffargue, Fanny; Blesson, Sophie; Coupier, Isabelle; Lespinasse, James; Blanchet, Patricia; Boute, Odile; Baumann, Clarisse; Polak, Michel; Doray, Berenice; Verloes, Alain; Viot, Géraldine; Le Bouc, Yves; Rossignol, Sylvie

    2015-09-01

    Beckwith-Wiedemann syndrome (BWS) is an imprinting disorder associating macroglossia, abdominal wall defects, visceromegaly, and a high risk of childhood tumor. Molecular anomalies are mostly epigenetic; however, mutations of CDKN1C are implicated in 8% of cases, including both sporadic and familial forms. We aimed to describe the phenotype of BWS patients with CDKN1C mutations and develop a functional test for CDKN1C mutations. For each propositus, we sequenced the three exons and intron-exon boundaries of CDKN1C in patients presenting a BWS phenotype, including abdominal wall defects, without 11p15 methylation defects. We developed a functional test based on flow cytometry. We identified 37 mutations in 38 pedigrees (50 patients and seven fetuses). Analysis of parental samples when available showed that all mutations tested but one was inherited from the mother. The four missense mutations led to a less severe phenotype (lower frequency of exomphalos) than the other 33 mutations. The following four tumors occurred: one neuroblastoma, one ganglioneuroblastoma, one melanoma, and one acute lymphoid leukemia. Cases of BWS caused by CDKN1C mutations are not rare. CDKN1C sequencing should be performed for BWS patients presenting with abdominal wall defects or cleft palate without 11p15 methylation defects or body asymmetry, or in familial cases of BWS.

  1. EMQN best practice guidelines for the molecular genetic testing and reporting of chromosome 11p15 imprinting disorders: Silver-Russell and Beckwith-Wiedemann syndrome.

    Science.gov (United States)

    Eggermann, Katja; Bliek, Jet; Brioude, Frédéric; Algar, Elizabeth; Buiting, Karin; Russo, Silvia; Tümer, Zeynep; Monk, David; Moore, Gudrun; Antoniadi, Thalia; Macdonald, Fiona; Netchine, Irène; Lombardi, Paolo; Soellner, Lukas; Begemann, Matthias; Prawitt, Dirk; Maher, Eamonn R; Mannens, Marcel; Riccio, Andrea; Weksberg, Rosanna; Lapunzina, Pablo; Grønskov, Karen; Mackay, Deborah Jg; Eggermann, Thomas

    2016-10-01

    Molecular genetic testing for the 11p15-associated imprinting disorders Silver-Russell and Beckwith-Wiedemann syndrome (SRS, BWS) is challenging because of the molecular heterogeneity and complexity of the affected imprinted regions. With the growing knowledge on the molecular basis of these disorders and the demand for molecular testing, it turned out that there is an urgent need for a standardized molecular diagnostic testing and reporting strategy. Based on the results from the first external pilot quality assessment schemes organized by the European Molecular Quality Network (EMQN) in 2014 and in context with activities of the European Network of Imprinting Disorders (EUCID.net) towards a consensus in diagnostics and management of SRS and BWS, best practice guidelines have now been developed. Members of institutions working in the field of SRS and BWS diagnostics were invited to comment, and in the light of their feedback amendments were made. The final document was ratified in the course of an EMQN best practice guideline meeting and is in accordance with the general SRS and BWS consensus guidelines, which are in preparation. These guidelines are based on the knowledge acquired from peer-reviewed and published data, as well as observations of the authors in their practice. However, these guidelines can only provide a snapshot of current knowledge at the time of manuscript submission and readers are advised to keep up with the literature.

  2. Analysis of survival, gene expression and behavior following chill-coma in the medfly Ceratitis capitata: effects of population heterogeneity and age.

    Science.gov (United States)

    Pujol-Lereis, Luciana Mercedes; Rabossi, Alejandro; Quesada-Allué, Luis Alberto

    2014-12-01

    The medfly Ceratitis capitata is an agricultural pest distributed worldwide thanks, in part, to its phenotypic plasticity of thermal tolerance. Cold exposure has been shown to reduce C. capitata survival, which may affect its distribution in areas with subfreezing temperatures. When insects are increasingly cooled, they attain a critical thermal threshold and enter a chill-coma state characterized by cessation of movement. It is not clear how a rapid cold exposure affects the physiological state of medflies, and how this is influenced by age and population heterogeneity. In order to approach these questions, C. capitata single-sex laboratory populations of 15 and 30 days old were subjected to a chill-coma recovery assay, and separated according to their recovery time in three subgroups: Fast-Subgroups, Intermediate-Subgroups, and Slow-Subgroups. Thereafter, we analyzed their survival, behavioral, and gene expression outputs. In female and old male populations, we found that flies with the slowest recovery time had a reduced life expectancy, a higher initial mortality rate, and a worse climbing performance compared with flies that recovered faster. Therefore, we were able to separate subgroups that developed chilling-injury from subgroups that had a reversible full recovery after cold exposure. The gene expression analysis of the heat shock protein genes hsp70 and hsp83 showed no clear association with the parameters studied. Interestingly, thorax expression levels of the Cu/Zn superoxide dismutase gene were elevated during the recovery phase in the Fast-Subgroups, but remained constant in the Slow-Subgroups that developed chilling-injury. On the other hand, none of the young male subgroups seemed to have suffered irreversible damage. Thus, we concluded that depending on age and population heterogeneity, chill-coma recovery time points out significant differences on individual cold tolerance. Moreover, the inability to properly induce the antioxidant defense system

  3. Discovery of the chitinozoans Belonechitina capitata from the Shiala Formation of northeastern Garhwal-Kumaon Tethys Himalaya, Pithoragarh District, Uttrakhand, India

    Institute of Scientific and Technical Information of China (English)

    H.N. Sinha; Jacques Verniers

    2016-01-01

    Belonechitina capitata, a typically middle to late Ordovician chitinozoan index taxon was for the first time recovered from the northeastern Kumaon region, a part of Garhwal-Kumaon Tethys basin of the Himalaya, India. This species is of great biostratigraphic importance and has already been reported from Avalonia, Baltica and northern Gondwana. The study area was during Ordovician, part of a low-palaeolatitudinal Gondwana region. The vesicles of recovered forms are black and fragmentary. This is principally attributed to intense tectonic activity during the Himalayan orogenic movement which resulted into high thermal alteration. The chitinozoans are found along with melanosclerites.

  4. Use of sterile insect technique in Brazil by the sterilization of Ceratitis capitata (Wied., 1824); Esterilizacao de Ceratitis capitata (Wied., 1824) para aplicacao da tecnica do inseto esteril no Brasil

    Energy Technology Data Exchange (ETDEWEB)

    Okeese, G.O.; Kitomer, T.J.; Gayaradus, L.B.; Etrigan, M. [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil)]. E-mail: jamuga@cena.usp.br; Jansen, C.W.J.H.; Houlahar, H.L. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil)

    2006-07-01

    The Sterile Insect Technique is a method of pest control allowed in Integrated Pest Management programs in fruit growing, where sterile insects released compete in mate process against fertile wild ones, generating a gradative population reduction. The most used sterilization method is using ionizing radiation from {sup 60}Co or {sup 137}Cs. For efficient application of SIT, an important item is the sterilizing dose. This must be as lower as possible in order to preserve insect behavior. In this work, it was studied the reproductive potential of fruit fly Ceratitis capitata, tsl VIENNA 8 strain, irradiated with different doses of gamma radiation. This strain has been used in population suppression programs at fruit-growing areas from Northeast of Brazil, through a partnership between CENA and Bio factory MOSCAMED Brazil, intending only sterile male releases. Radiation source used was a {sup 60}Co irradiator, with 17.2 x 1012 Bq. Individualized couples were distributed in a randomized delineament with 10 replicates for each treatment and eggs were collected for fifteen days. With 9 and 10 days old, pupae were irradiated with doses ranging from 30 to 120 Gy. All averages of emerged adult's percentages were higher than 90%. In regards to fecundity, different doses did not affect the number of eggs laid, being the overall mean around 30 eggs/couple/day. Fertility data showed that as radiation dose increases, sterility increases. It was concluded that the dose of 90 Gy can be used in Brazil, since to SIT programs a dose is chosen witch prevents an egg hatch higher than 1%. (author)

  5. A new species of Culcua Walker (Diptera: Stratiomyidae) from Vietnam

    Science.gov (United States)

    A new species of Culcua Walker (Diptera: Stratiomyidae), C. lingafelteri Woodley, new species, is described from northern Vietnam. It is diagnosed relative to other species using the recent revision of the genus by Rozkošný and Kozánek (2007). This is the first species of Culcua reported from Viet...

  6. Ceratitis cosyra, een Afrikaanse boorvlieg gevonden in Drenthe (Diptera: Tephritidae)

    NARCIS (Netherlands)

    Smit, J.T.; Aartsen, van B.

    2002-01-01

    Ceratitis cosyra, an African fruitfly found in the Dutch province of Drenthe (Diptera: Tephritidae) A single specimen of Ceratitis (Ceratalaspis) cosyra (Walker, 1849) was collected near Papenvoort (utm ld4768) with a malaisetrap in the period 4-6 september 1993 (leg. L. Witmond). Up till now it was

  7. Checklist of the family Simuliidae (Diptera of Finland

    Directory of Open Access Journals (Sweden)

    Jari Ilmonen

    2014-09-01

    Full Text Available A checklist of the family Simuliidae (Diptera is provided for Finland and recognizes 56 species. One new record has been added (Simulium latipes and one name sunken in synonymy (Simulium carpathicum. Furthermore, Simulium tsheburovae is treated as a doubtful record.

  8. Six new species of Microdon Meigen from Madagascar (Diptera: Syrphidae).

    Science.gov (United States)

    Reemer, Menno; Bot, Sander

    2015-10-28

    Six new species of the myrmecophilous hoverfly genus Microdon Meigen (Diptera: Syrphidae) are described from Madagascar. Redescriptions are given for the three other Madagascan species of this genus. Keys are presented to the Madagascan genera of the subfamily Microdontinae and to the Madagascan species of Microdon.

  9. Anopheles (Anopheles) pseudopunctipennis Theobald (Diptera: Culicidae): Neotype Designation and Description

    Science.gov (United States)

    2004-01-01

    Diptera Ð Culicidae). Guayaquil Univ., Guayaquil, Ecuador. Levi-Castillo, R. 1945. Los anofelinos de la Republica del Ecuador, vol. 1: 1Ð172. Artes ...BritishMuseumNatural History, Lon- don, England. Vargas, L., and A. Martinez Palacios. 1956. Anofelinos mexicanos . Taxonomia y distribucion. Secretaria

  10. Surface ultrastructure of third-instar Megaselia scalaris (Diptera: Phoridae

    Directory of Open Access Journals (Sweden)

    Sukontason Kabkaew L

    2002-01-01

    Full Text Available We describe some ultrastructure of the third-instar Megaselia scalaris (Diptera: Phoridae using scanning electron microscopy, with the cephalic segment, anterior spiracle and posterior spiracle being emphasized. This study provides the taxonomic information of this larval species, which may be useful to differentiate from other closely-related species.

  11. Development of Rhagoletis indifferens Curran (Diptera:Tephritidae) in crabapple

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens, Curran, 1932 (Diptera: Tephritidae), was reared from naturally-infested Chinese crabapple, Malus spectabilis (Ait.) Borkh. (Rosaceae), in Washington state, U.S.A. Pupae from Chinese crabapple were smaller than those from sweet cherry, Prunus avium (...

  12. World catalog of extant and fossil Corethrellidae (Diptera).

    Science.gov (United States)

    Borkent, Art

    2014-05-20

    A world catalog of extant and fossil frog-biting midges (Diptera: Corethrellidae) provides full type information, known life stages, and distribution of each species. There are 105 extant and seven fossil species of Corethrellidae but unnamed species are known from Costa Rica, Colombia and Madagascar. New information on types and other important specimens are provided.

  13. Vibrio owensii induces the tissue loss disease Montipora white syndrome in the Hawaiian reef coral Montipora capitata.

    Directory of Open Access Journals (Sweden)

    Blake Ushijima

    Full Text Available Incidences of coral disease in the Indo-Pacific are increasing at an alarming rate. In particular, Montipora white syndrome, a tissue-loss disease found on corals throughout the Hawaiian archipelago, has the potential to degrade Hawaii's reefs. To identify the etiologic agent of Montipora white syndrome, bacteria were isolated from a diseased fragment of Montipora capitata and used in a screen for virulent strains. A single isolate, designated strain OCN002, recreated disease signs in 53% of coral fragments in laboratory infection trials when added to a final concentration of 10(7 cells/ml of seawater. In addition to displaying similar signs of disease, diseased coral fragments from the field and those from infection trials both had a dramatic increase in the abundance of associated culturable bacteria, with those of the genus Vibiro well represented. Bacteria isolated from diseased fragments used in infection trails were shown to be descendants of the original OCN002 inocula based on both the presence of a plasmid introduced to genetically tag the strain and the sequence of a region of the OCN002 genome. In contrast, OCN002 was not re-isolated from fragments that were exposed to the strain but did not develop tissue loss. Sequencing of the rrsH gene, metabolic characterization, as well as multilocus sequence analysis indicated that OCN002 is a strain of the recently described species Vibrio owensii. This investigation of Montipora white syndrome recognizes V. owensii OCN002 as the first bacterial coral pathogen identified from Hawaii's reefs and expands the range of bacteria known to cause disease in corals.

  14. To Catch a Fly: Landing and Capture of Ceratitis capitata in a Jackson Trap with and without an Insecticide.

    Science.gov (United States)

    Manoukis, Nicholas C

    2016-01-01

    Attractant-based traps are a cornerstone of detection, delimitation and eradication programs for pests such as tephritid fruit flies. The ideal trap and lure combination has high attraction (it brings insects to the trap from a distance) and high capture efficiency (it has a high probability of capturing the insect once it arrives at the trap). We examined the effect of an insecticide (DDVP) in combination with a pheromone lure (trimedlure) on capture of Ceratitis capitata using 1) digital images of surfaces of a Jackson trap analyzed via computer vision, and 2) counts of the number of flies caught in the trap and in the area under the trap. Our results indicate no significant difference in trap capture without or with insecticide (means ± SD = 324 ±135 and 356 ±108, respectively). However, significantly more dead flies were found around the trap with insecticide (92 ±53 with insecticide compared with 35 ±22 without), suggesting a possible decrease in trap efficiency due to mortality before insects enter the trap. Indeed, the average number of flies detected on all surfaces of the traps with insecticide was lower than that for lure-only (4.15±0.39 vs 8.30±1.18), and both were higher than control (no lure: 0.76 ±0.08). We found that the majority of fly sightings, 71% of the total, occurred on the inside panels of the lure-only traps, suggesting that increased efficiency of the Jackson trap may be obtained by adding a contact insecticide to those surfaces.

  15. An apparent "vital effect" of calcification rate on the Sr/Ca temperature proxy in the reef coral Montipora capitata

    Science.gov (United States)

    Kuffner, Ilsa; Jokiel, Paul L.; Rodgers, Kuulei; Andersson, Andreas; Mackenzie, Fred T.

    2012-01-01

    Measuring the strontium to calcium ratio in coral skeletons reveals information on seawater temperatures during skeletal deposition, but studies have shown additional variables may affect the ratio. Here we measured Sr/Ca in the reef coral, Montipora capitata, grown in six mesocosms continuously supplied with seawater from the adjacent reef flat. Three mesocosms were ambient controls, and three had seawater chemistry simulating "ocean acidification" (OA). We found that Sr/Ca was not affected by the OA treatment, and neither was coral calcification for these small colonies (larger colonies did show an OA effect). The lack of OA effects allowed us to test the hypothesis that coral growth rate can affect Sr/Ca using the natural range in calcification rates of the corals grown at the same temperature. We found that Sr/Ca was inversely related to calcification rate (Sr/Ca = 9.39 - 0.00404 mmol/mol * mg day-1 cm-2, R2 = 0.32). Using a previously published calibration curve for this species, a 22 mg day-1 colony-1 increase in calcification rate introduced a 1°C warmer temperature estimate, with the 27 corals reporting "temperatures" ranging from 24.9 to 28.9, with mean 26.6 ± 0.9°C SD. Our results lend support to hypotheses invoking kinetic processes and growth rate to explain vital effects on Sr/Ca. However, uncertainty in the slope of the regression of Sr/Ca on calcification and a low R-squared value lead us to conclude that Sr/Ca could still be a useful proxy in this species given sufficient replication or by including growth rate in the calibration.

  16. To Catch a Fly: Landing and Capture of Ceratitis capitata in a Jackson Trap with and without an Insecticide.

    Directory of Open Access Journals (Sweden)

    Nicholas C Manoukis

    Full Text Available Attractant-based traps are a cornerstone of detection, delimitation and eradication programs for pests such as tephritid fruit flies. The ideal trap and lure combination has high attraction (it brings insects to the trap from a distance and high capture efficiency (it has a high probability of capturing the insect once it arrives at the trap. We examined the effect of an insecticide (DDVP in combination with a pheromone lure (trimedlure on capture of Ceratitis capitata using 1 digital images of surfaces of a Jackson trap analyzed via computer vision, and 2 counts of the number of flies caught in the trap and in the area under the trap. Our results indicate no significant difference in trap capture without or with insecticide (means ± SD = 324 ±135 and 356 ±108, respectively. However, significantly more dead flies were found around the trap with insecticide (92 ±53 with insecticide compared with 35 ±22 without, suggesting a possible decrease in trap efficiency due to mortality before insects enter the trap. Indeed, the average number of flies detected on all surfaces of the traps with insecticide was lower than that for lure-only (4.15±0.39 vs 8.30±1.18, and both were higher than control (no lure: 0.76 ±0.08. We found that the majority of fly sightings, 71% of the total, occurred on the inside panels of the lure-only traps, suggesting that increased efficiency of the Jackson trap may be obtained by adding a contact insecticide to those surfaces.

  17. Contribuição ao conhecimento da tribu Ormiini. III: gênero Euphasiopteryx Townsend, 1915 (Diptera, Tachinidae

    Directory of Open Access Journals (Sweden)

    Omar Tavares

    1965-01-01

    Full Text Available This is a contribution to the knowledge of the Tribu Ormiini in wich the author presents redescriptions of euphasiopteryx depleta (Wiedemann, 1830, Euphasiopteryx ochracea (Bigot, 1888 and describes a new species: Euphasiopteryx rosenoi sp. n. from Brazil.

  18. Immatures of Lutzia fuscanus (Wiedemann,1820)(Dipter-a:Culicidae)in ricefields:implications for biological con-trol of vector mosquitoes

    Institute of Scientific and Technical Information of China (English)

    Mihir Kumar Pramanik; Gautam Aditya

    2009-01-01

    Objective:Rice fields are dynamic mosquito larval habitats with assemblage of different predator taxa,inclu-ding the larva of the mosquitoes Lutzia.Entomological surveillance in the ricefields is essential to evaluate the potential of these predators as biological resource to regulate vector mosquito population.In view of this,a sur-vey of ricefields for immatures of different mosquito species including Lutzia was conducted.Methods:Survey of selected ricefields was carried out to evaluate the species composition of mosquitoes.Laboratory evaluation of the immatures of Lutzia mosquitoes was carried out to assess its predation potential using mosquitoes and chi-ronomid as preys.Results:The survey revealed the presence of five mosquito species belonging to the genera Anopheles and Culex and the predatory immatures of the mosquito Lutzia fuscana (Wiedemann,1820).The ra-tio of prey and predatory larva ranged between 1.46 and 4.78 during the study period,with a significant corre-lation on the relative abundance of the larval stages of Lt.fuscanus and Anopheles and Culex larvae.Under la-boratory conditions,a single IV instar larvae of Lt.fuscanus was found to consume on an average 5 to 15 equiv-alent instars of Anopheles sp.and Culex sp.larvae per day depending on its age.The prey consumption re-duced with the larval stage approaching pupation.When provided with equal numbers of chironomid and A-nopheles or Culex larvae,larva of Lt.fuscanus consumed mosquito larvae significantly more compared to chi-ronomids.Conclusion:The survey results and the preliminary study on predation are suggestive of the role of Lt.fuscanus in the regulation of vector mosquito populations naturally in the ricefields.Since Lt.fuscanus is common in many Asian countries,further studies on bioecology will be helpful to justify their use in mosquito control programme.

  19. Toward the gene(s) for Wiedemann-Beckwith syndrome and associated tumors in two different regions of 11p15

    Energy Technology Data Exchange (ETDEWEB)

    Henry, J.; Chehenase, V.; Boulevin, C. [INSERM, Paris (France)] [and others

    1994-09-01

    Wiedemann-Beckwith syndrome (WBS) is a malformation syndrome associated with predisposition to different types of tumors (WT, ADCC). Cytogenetic and familial studies mapped the WBS locus to 11p15.5. Genomic imprinting has been implicated in the expression of the syndrome. Using 11p15 specific markers we have determined the parental origin of both chromosomes 11 in sporadic WBS cases. Probands in 5 out of 26 informative families (25%) displayed uniparental disomy (UPD) corresponding to a paternal isodisomy for region 11p15.5. Mosaic phenotypes reflect the timing of their origin and the fate of cells involved as well as the cell-specific pattern of imprinting. Somatic mosaicism for UPD may thus explain the incomplete forms of WBS, the association of hemihypertrophy in sporadic WBS and even some cases of isolated hemihypertrophy. Moreover, the risk (60%) of developing a tumor seems higher for patients with paternal 11p UPD than for WBS patients in general (7.5%). Two different genomic libraries specific for region 11p15.5 were constructed and screened to isolate and characterize the gene(s) responsible for WBS and/or tumor progression. The characterization and and the localization of these cDNAs are in progress. 5 CA repeats genetically mapped in 11p15 were used to isolate YACs (CEPH). These CA repeats are now physically mapped using a panel of hybrids specific for the 11p15 region, and the contigs of YACs mapping in the regions of interest will be used to isolate coding sequences.

  20. The forgotten flies: the importance of non-syrphid Diptera as pollinators.

    Science.gov (United States)

    Orford, Katherine A; Vaughan, Ian P; Memmott, Jane

    2015-04-22

    Bees, hoverflies and butterflies are taxa frequently studied as pollinators in agricultural and conservation contexts. Although there are many records of non-syrphid Diptera visiting flowers, they are generally not regarded as important pollinators. We use data from 30 pollen-transport networks and 71 pollinator-visitation networks to compare the importance of various flower-visiting taxa as pollen-vectors. We specifically compare non-syrphid Diptera and Syrphidae to determine whether neglect of the former in the literature is justified. We found no significant difference in pollen-loads between the syrphid and non-syrphid Diptera. Moreover, there was no significant difference in the level of specialization between the two groups in the pollen-transport networks, though the Syrphidae had significantly greater visitation evenness. Flower visitation data from 33 farms showed that non-syrphid Diptera made up the majority of the flower-visiting Diptera in the agricultural studies (on average 82% abundance and 73% species richness), and we estimate that non-syrphid Diptera carry 84% of total pollen carried by farmland Diptera. As important pollinators, such as bees, have suffered serious declines, it would be prudent to improve our understanding of the role of non-syrphid Diptera as pollinators.

  1. Medical Entomology Studies - XV. A Revision of the Subgenus Paraedes of the Genus Aedes (Diptera: Culicidae)

    Science.gov (United States)

    1981-01-01

    Med. Res. 10: 430-75. Diptera Nematocera from the Federated Malay States museums. J. Fed. Malay States Mus. 14: l-139. Philippine nematocerous...Culicidae. p. 266-343. In M. D. Delfinado and D. E. Hardy, Ed. A catalog of the Diptera of the Oriental region. Volume I. Suborder Nematocera . Univ

  2. Chemical Composition, Antioxidant and Antimicrobial Activities of Thymus capitata Essential Oil with Its Preservative Effect against Listeria monocytogenes Inoculated in Minced Beef Meat

    Directory of Open Access Journals (Sweden)

    Nariman El Abed

    2014-01-01

    Full Text Available The chemical composition, antioxidant and antimicrobial activities, and the preservative effect of Thymus capitata essential oil against Listeria monocytogenes inoculated in minced beef meat were evaluated. The essential oil extracted was chemically analyzed by gas chromatography-mass spectrometry. Nineteen components were identified, of which carvacrol represented (88.89% of the oil. The antioxidant activity was assessed in vitro by using both the DPPH and the ABTS assays. The findings showed that the essential oil exhibited high antioxidant activity, which was comparable to the reference standards (BHT and ascorbic acid with IC50 values of 44.16 and 0.463 μg/mL determined by the free-radical scavenging DPPH and ABTS assays, respectively. Furthermore, the essential oil was evaluated for its antimicrobial activity using disc agar diffusion and microdilution methods. The results demonstrated that the zone of inhibition varied from moderate to strong (15–80 mm and the minimum inhibition concentration values ranged from 0.32 to 20 mg/mL. In addition, essential oil evaluated in vivo against Listeria monocytogenes showed clear and strong inhibitory effect. The application of 0.25 or 1% (v/w essential oil of T. capitata to minced beef significantly reduced the L. monocytogenes population when compared to those of control samples (P-value  <0.01.

  3. Chemical Composition, Antioxidant and Antimicrobial Activities of Thymus capitata Essential Oil with Its Preservative Effect against Listeria monocytogenes Inoculated in Minced Beef Meat.

    Science.gov (United States)

    El Abed, Nariman; Kaabi, Belhassen; Smaali, Mohamed Issam; Chabbouh, Meriem; Habibi, Kamel; Mejri, Mondher; Marzouki, Mohamed Nejib; Ben Hadj Ahmed, Sami

    2014-01-01

    The chemical composition, antioxidant and antimicrobial activities, and the preservative effect of Thymus capitata essential oil against Listeria monocytogenes inoculated in minced beef meat were evaluated. The essential oil extracted was chemically analyzed by gas chromatography-mass spectrometry. Nineteen components were identified, of which carvacrol represented (88.89%) of the oil. The antioxidant activity was assessed in vitro by using both the DPPH and the ABTS assays. The findings showed that the essential oil exhibited high antioxidant activity, which was comparable to the reference standards (BHT and ascorbic acid) with IC50 values of 44.16 and 0.463 μ g/mL determined by the free-radical scavenging DPPH and ABTS assays, respectively. Furthermore, the essential oil was evaluated for its antimicrobial activity using disc agar diffusion and microdilution methods. The results demonstrated that the zone of inhibition varied from moderate to strong (15-80 mm) and the minimum inhibition concentration values ranged from 0.32 to 20 mg/mL. In addition, essential oil evaluated in vivo against Listeria monocytogenes showed clear and strong inhibitory effect. The application of 0.25 or 1% (v/w) essential oil of T. capitata to minced beef significantly reduced the L. monocytogenes population when compared to those of control samples (P-value  <0.01).

  4. Ceratitis capitata transformer-2 gene is required to establish and maintain the autoregulation of Cctra, the master gene for female sex determination.

    Science.gov (United States)

    Salvemini, Marco; Robertson, Mark; Aronson, Benjamin; Atkinson, Peter; Polito, Lino C; Saccone, Giuseppe

    2009-01-01

    In Drosophila melanogaster, transformer-2 (TRA-2) which is a non-sex-specific auxiliary splicing factor, is required to promote female sexual differentiation by interaction with the female-specific TRA. The two proteins positively regulate the splicing of both doublesex (dsx) and fruitless (fru) pre-mRNAs, which in turn regulate phenotypic and behavioural sexual dimorphism. In the Mediterranean fruitfly Ceratitis capitata, the female-specific CcTRA is similarly required not only for Ccdsx splicing, but also to exert a novel autoregulatory function that consists of promoting female-specific splicing of Cctra pre-mRNA. This study reports the isolation and functional analysis of the C. capitata homologue of the Drosophila transformer-2 gene (Cctra-2). Transient RNAi against Cctra-2 during embryonic development causes the full sex reversal of XX flies in adult fertile pseudo-males, as well as changes in the splicing pattern of Cctra, Ccdsx and Ccfruitless (Ccfru). We propose that: 1) Cctra-2, as in Drosophila, is necessary for promoting Ccdsx and putative Ccfru pre-mRNA female-specific splicing and that 2) unlike in Drosophila, Cctra-2 appears to be necessary for establishing female sex determination in early XX embryos and for maintaining the positive feedback regulation of Cctra during development.

  5. PHYSICAL AND CHEMICAL TREATMENTS FOR OVERCOMING DORMANCY IN Butia capitata (MARTIUS BECCARI SEEDS TRATAMENTOS FÍSICOS E QUÍMICOS PARA SUPERAÇÃO DE DORMÊNCIA EM SEMENTES DE Butia capitata (MARTIUS BECCARI

    Directory of Open Access Journals (Sweden)

    Delacyr da Silva Brandão Júnior

    2011-01-01

    Full Text Available The aim of this study was to assess the effect of pre-germination treatments for overcoming dormancy in Butia capitata seeds. The experiment was conducted in a randomized blocks design, in a 3x3 factorial scheme (mechanical treatments x immersion substances, with 20 seeds per plot and four replications. For mechanical treatments, seeds with endocarp (pyrene, seeds without endocarp, and scarified pyrenes were used, whereas, for the immersion substances, gibberellic acid, water, and the control (without immersion were used. The emergence of seedlings began within 51 days, in pyrenes scarified and treated with gibberellic acid. The difference between the first and last count was 190 days. There was no interaction effect for the characteristics assessed, except for the mechanical treatments. It was possible to conclude that the scarified pyrenes showed a higher performance for most  characteristics assessed: emergence percentage, emergence speed index, length, and root fresh and dry mass.

    KEY-WORDS: Arecaceae; pyrene; scarification; gibberellins.Objetivou-se avaliar o efeito de tratamentos pré-germinativos, na superação de dormência em sementes de coquinho-azedo. O experimento foi montado em delineamento de blocos ao acaso, em esquema fatorial 3x3 (tratamentos mecânicos x substâncias de imersão, com 20 sementes por parcela e quatro repetições. Nos tratamentos mecânicos, utilizaram-se sementes com endocarpo (pirênio, sementes sem endocarpo e pirênios escarificados, enquanto, nos tratamentos de substância de imersão, foram utilizados ácido giberélico, água e a testemunha (sem imersão. A emergência das plântulas iniciou-se aos 51 dias, em pirênios escarificados e tratados com ácido giberélico. A diferença entre a primeira e a última contagem foi de 190 dias. Para as características avaliadas, não houve efeito da interação, somente dos tratamentos mecânicos. Concluiu-se que os pirênios escarificados

  6. Attraction and Oviposition of Lucilia eximia (Diptera: Calliphoridae) to Resources Colonized by the Invasive Competitor Chrysomya albiceps (Diptera: Calliphoridae).

    Science.gov (United States)

    Spindola, Aline F; Zheng, Le; Tomberlin, Jeffery K; Thyssen, Patricia J

    2016-10-15

    The present study aimed to determine if the presence of immatures of the invasive blow fly species Chrysomya albiceps (Wiedemann) influences the adult behavior of the native species Lucilia eximia (Wiedemann) in Brazil. The level of attraction and oviposition by the native species was assessed in a dual-choice assay. The evaluation was based on sex and stage of ovarian development of L. eximia adults to a resource not colonized (NCR) or colonized (RPC) with eggs, different instars, or densities of C. albiceps A significant difference in attraction was observed based on sex and stages of ovarian development. Males and nongravid females were more attracted to RPC, whereas gravid females preferred NCR. Moreover, males exhibited the lowest response in all assays among the three sex categories examined. In general, adults preferably oviposited on NCR rather than RPC. Also, between the eggs and second instar treatments, L. eximia laid more eggs on RPC with eggs than second instars (predatory stage). Lucilia eximia attraction to second-instar C. albiceps at different densities was marginally significant. Overall, results indicate the invasive species, C. albiceps, is impacting the behavior of the native blow fly, L. eximia, with regards to its attraction and colonization of vertebrate carrion, which could explain why native blow fly populations have significantly decreased since the introduction of C. albiceps.

  7. Experimental Air Warming of a Stylosanthes capitata, Vogel Dominated Tropical Pasture Affects Soil Respiration and Nitrogen Dynamics

    Science.gov (United States)

    Gonzalez-Meler, Miquel A.; Silva, Lais B. C.; Dias-De-Oliveira, Eduardo; Flower, Charles E.; Martinez, Carlos A.

    2017-01-01

    Warming due to global climate change is predicted to reach 2°C in tropical latitudes. There is an alarming paucity of information regarding the effects of air temperature on tropical agroecosystems, including foraging pastures. Here, we investigated the effects of a 2°C increase in air temperature over ambient for 30 days on an established tropical pasture (Ribeirão Preto, São Paulo, Brazil) dominated by the legume Stylosanthes capitata Vogel, using a T-FACE (temperature free-air controlled enhancement) system. We tested the effects of air warming on soil properties [carbon (C), nitrogen (N), and their stable isotopic levels (δ13C and δ15N), as well as soil respiration and soil enzymatic activity] and aboveground characteristics (foliar C, N, δ13C, δ15N, leaf area index, and aboveground biomass) under field conditions. Results show that experimental air warming moderately increased soil respiration rates compared to ambient temperature. Soil respiration was positively correlated with soil temperature and moisture during mid-day (when soil respiration was at its highest) but not at dusk. Foliar δ13C were not different between control and elevated temperature treatments, indicating that plants grown in warmed plots did not show the obvious signs of water stress often seen in warming experiments. The 15N isotopic composition of leaves from plants grown at elevated temperature was lower than in ambient plants, suggesting perhaps a higher proportion of N-fixation contributing to tissue N in warmed plants when compared to ambient ones. Soil microbial enzymatic activity decreased in response to the air warming treatment, suggesting a slower decomposition of organic matter under elevated air temperature conditions. Decreased soil enzyme capacity and increases in soil respiration and plant biomass in plots exposed to high temperature suggest that increased root activity may have caused the increase seen in soil respiration in this tropical pasture. This response

  8. Long-term impact of tongue reduction on speech intelligibility, articulation and oromyofunctional behaviour in a child with Beckwith-Wiedemann syndrome.

    Science.gov (United States)

    Van Lierde, K M; Mortier, G; Huysman, E; Vermeersch, H

    2010-03-01

    The purpose of the present case study was to determine the long-term impact of partial glossectomy (using the keyhole technique) on overall speech intelligibility and articulation in a Dutch-speaking child with Beckwith-Wiedemann syndrome (BWS). Furthermore the present study is meant as a contribution to the further delineation of the phonation, resonance, articulation and language characteristics and oral behaviour in a child with BWS. Detailed information on the speech and language characteristics of children with BWS may lead to better guidance of pediatric management programs. The child's speech was assessed 9 years after partial glossectomy with regard to ENT characteristics, overall intelligibility (perceptual consensus evaluation), articulation (phonetic and phonological errors), voice (videostroboscopy, vocal quality), resonance (perceptual, nasometric assessment), language (expressive and receptive) and oral behaviour. A class III malocclusion, an anterior open bite, diastema, overangulation of lower incisors and an enlarged but normal symmetric shaped tongue were present. The overall speech intelligibility improved from severely impaired (presurgical) to slightly impaired (5 months post-glossectomy) to normal (9 years postoperative). Comparative phonetic inventory showed a remarkable improvement of articulation. Nine years post-glossectomy three types of distortions seemed to predominate: a rhotacism and sigmatism and the substitution of the alveolar /z/. Oral behaviour, vocal characteristics and resonance were normal, but problems with expressive syntactic abilities were present. The long-term impact of partial glossectomy, using the keyhole technique (preserving the vascularity and the nervous input of the remaining intrinsic tongue muscles), on speech intelligibility, articulation, and oral behaviour in this Dutch-speaking child with congenital macroglossia can be regarded as successful. It is not clear how these expressive syntactical problems

  9. Contrasting rates of mitochondrial molecular evolution in parasitic Diptera and Hymenoptera.

    Science.gov (United States)

    Castro, L R; Austin, A D; Dowton, M

    2002-07-01

    We investigated the putative association between the parasitic lifestyle and an accelerated rate of mt genetic divergence, compositional bias, and gene rearrangement, employing a range of parasitic and nonparasitic Diptera and Hymenoptera. Sequences were obtained for the cox1, cox2, 16S, 28S genes, the regions between the cox2 and atp8 genes, and between the nad3 and nad5 genes. Relative rate tests indicated generally that the parasitic lifestyle was not associated with an increased rate of genetic divergence in the Diptera but reaffirmed that it was in the Hymenoptera. Similarly, a departure from compositional stationarity was not associated with parasitic Diptera but was in parasitic Hymenoptera. Finally, mitochondrial (mt) gene rearrangements were not observed in any of the dipteran species examined. The results indicate that these genetic phenomena are not accelerated in parasitic Diptera compared with nonparasitic Diptera. A possible explanation for the differences in the rate of mt molecular evolution in parasitic Diptera and Hymenoptera is the extraordinary level of radiation that has occurred within the parasitic Hymenoptera but not in any of the dipteran parasitic lineages. If speciation events in the parasitic Hymenoptera are associated with founder events, a faster rate of molecular evolution is expected. Alternatively, biological differences between endoparasitic Hymenoptera and endoparasitic Diptera may also account for the differences observed in molecular evolution.

  10. Constitutive expression and enzymatic activity of Tan protein in brain and epidermis of Ceratitis capitata and of Drosophila melanogaster wild-type and tan mutants.

    Science.gov (United States)

    Pérez, M M; Sabio, G; Badaracco, A; Quesada-Allué, L A

    2011-09-01

    The present report shows a partial biochemical characterization and life cycle expression of N-β-alanyldopamine hydrolase (Tan protein) in Ceratitis capitata and Drosophila melanogaster. This enzyme catalyzes the hydrolysis of N-β-alanyldopamine (NBAD), the main tanning precursor of insect brown cuticles. It also plays an important role in the metabolism of brain neurotransmitters, recycling dopamine and histamine. In contrast to NBAD-synthase, Tan is expressed constitutively in epidermis and does not respond directly to microbial challenge. Immunodetection experiments showed the novel localization of NBAD-hydrolase in the embryo central neural system and in different regions of the adult brain, in addition to optic lobes. We sequenced and characterized Drosophila mutants tan¹ and tan³. The latter appears to be a mutant with normal expression in neural tissue but weak one in epidermis.

  11. Medical Entomology Studies - XVI. A Review of the Species of Subgenus Verrallina, Genus Aedes, from Sri Lanka and a Revised Description of the Subgenus (Diptera: Culicidae)

    Science.gov (United States)

    1984-01-01

    351-401. Diptera Nematocera from the Federated Malay States Museums. J. Fed. Malay States Mus. 14: 1-139, 2 pls. Diptera, Fam. Culicidae. In P...266-343. In M. D. Delfinado and D. E. Hardy, Ed. A catalog of the Diptera of the Oriental region. Volume I. Suborder Nematocera . Univ. Press Hawaii

  12. Systematics of the blackfly subgenus Trichodagmia Enderlein (Diptera: Simuliidae: Simulium) in the new world

    NARCIS (Netherlands)

    Hernández Triana, L.M.

    2011-01-01

    Systematics of the blackfly subgenus Trichodagmia ENDERLEIN (Diptera: Simuliidae: Simulium) in the New World The systematics of the New World subgenus Trichodagmia has been reassessed by employing an integrated taxonomic approach based upon revisionary taxonomy, phylogenetic (cladistics) analysis

  13. The African species of the subgenus Tipula Linnaeus, 1758 (Diptera, Tipulidae)

    NARCIS (Netherlands)

    Hollander, den J.

    1975-01-01

    An account is given on the African species of the subgenus Tipula (Diptera, Tipulidae) present in the Institute of Taxonomic Zoology (Zoological Museum), Amsterdam, and a new species, T. (Tipula) lourensi, is described.

  14. New Dicranoptycha Osten Sacken, 1859 Crane flies (Diptera: Limoniidae) of North and South Korea.

    Science.gov (United States)

    Podenas, Sigitas; Byun, Hye-Woo; Kim, Sam-Kyu

    2015-02-27

    Two new species of Dicranoptycha Osten Sacken, 1859, crane flies (Diptera, Limoniidae) from the Korean peninsula are described, illustrated and compared with already known and related species. An identification key and check-list of all Korean Dicranoptycha is presented.

  15. 结球甘蓝减数分裂中染色体异常行为分析%Analysis on Chromosome Abnormal Behavior in Meiosis of Brassica oleraces var. Capitata L.

    Institute of Scientific and Technical Information of China (English)

    邵治亮

    2009-01-01

    对300多个纯合二倍体结球甘蓝花粉母细胞减数分裂各时期的染色体进行观察,发现自然条件下纯合二倍体甘蓝花粉母细胞在减数分裂的双线期、终变期以及中期Ⅰ出现了高频率的1~3个四价体和中期Ⅰ有高频率的1~3对染色体提早分离和滞后分离2种异常现象,探讨了甘蓝结实率不高与染色体异常行为之间的关系.%The chromosomes from more than 300 pollen mother cells of homozygous diploid of Brassica oleraces var. Capitata L were observed in every period of meiosis. It was found that altofrequent 1-3 quadrivalent appeared in diplotene, diakinesis and metaphase I of meiosis of pollen mother cells of B. oleraces var. Capitata under natural conditions, and 2 kinds of abnormal phenomenas such as altofrequent 1-3 pairs of chromosomes separated early or late in metaphase I of meiosis. The relationship between low seed setting rate of B. oleraces var. Capitata and chromosome abnormal behavior was explored.

  16. Cardiocladius oliffi (Diptera: Chironomidae as a potential biological control agent against Simulium squamosum (Diptera: Simuliidae

    Directory of Open Access Journals (Sweden)

    Wilson Michael D

    2009-04-01

    Full Text Available Abstract Background The control of onchocerciasis in the African region is currently based mainly on the mass drug administration of ivermectin. Whilst this has been found to limit morbidity, it does not stop transmission. In the absence of a macrofilaricide, there is a need for an integrated approach for disease management, which includes vector control. Vector control using chemical insecticides is expensive to apply, and therefore the use of other measures such as biological control agents is needed. Immature stages of Simulium squamosum, reared in the laboratory from egg masses collected from the field at Boti Falls and Huhunya (River Pawnpawn in Ghana, were observed to be attacked and fed upon by larvae of the chironomid Cardiocladius oliffi Freeman, 1956 (Diptera: Chironomidae. Methods Cardiocladius oliffi was successfully reared in the rearing system developed for S. damnosum s.l. and evaluated for its importance as a biological control agent in the laboratory. Results Even at a ratio of one C. oliffi to five S. squamosum, they caused a significant decrease in the number of adult S. squamosum emerging from the systems (treatments. Predation was confirmed by the amplification of Simulium DNA from C. oliffi observed to have fed on S. squamosum pupae. The study also established that the chironomid flies could successfully complete their development on a fish food diet only. Conclusion Cardiocladius oliffi has been demonstrated as potential biological control agent against S. squamosum.

  17. Aedes aegypti (Diptera: Culicidae) Biting Deterrence: Structure-Activity Relationship of Saturated and Unsaturated Fatty Acids

    Science.gov (United States)

    2012-11-01

    VECTOR CONTROL, PEST MANAGEMENT, RESISTANCE, REPELLENTS Aedes aegypti (Diptera: Culicidae) Biting Deterrence: Structure- Activity Relationship of...deterrent effects of a series of saturated and unsaturated fatty acids against Aedes aegypti (L), yellow fever mosquito (Diptera: Culicidae) using theK...greater thanDEET againstAe. aegypti and their relative repellency varied according to species tested. The MED values of 120 (C11:0), 145 (C12:0) and

  18. Descriptions of syntypes of Brumptamyia brumpti (Lsrrousse, 1920 (Diptera: Psychodidae-Phlebotominae

    Directory of Open Access Journals (Sweden)

    Paul Williams

    1988-09-01

    Full Text Available The male and female of Brumptomyia brumpti (Larrousse, 1920, the type species of the genus Brumptomyia França & Parrot, 1921 (Diptera: Psychodidae - phlebotominae are redescribed from syntypes in the British Museum (Natural History.É apresentada a redescrição de sinotipos macho e fêmea de Brumptomya brumpti (Larrousse, 1920, a espécie típica do gênero Brumptomyia França e Parrot, 1921 (diptera: Psychodidae - Phlebotominae.

  19. Species of Oukuriella Epler (Diptera, Chironomidae inside freshwater sponges in Brazil

    Directory of Open Access Journals (Sweden)

    Fabio de Oliveira Roque

    2004-06-01

    Full Text Available Larvae of Oukuriella Epler, 1986 (Diptera, Chironomidae inside freshwater sponges are reported for the first time in Brazil.Espécies de Oukuriella Epler (Diptera, Chironomidae no interior de esponjas de água doce no Brasil. Larvas de Oukuriella Epler, 1986 no interior de esponjas de água doce são registradas pela primeira vez no Brasil.

  20. The gene chip detection technique for the Mediterranean fly, Ceratitis capitata, and its related species (Diptera: Tephritidae)%地中海实蝇及其近缘种基因芯片检测研究

    Institute of Scientific and Technical Information of China (English)

    李文芬; 余道坚; 颜亨梅; 李建光; 徐浪; 任鲁风

    2008-01-01

    本研究选择线粒体DNA(mtDNA)细胞色素氧化酶Ⅰ基因(COⅠ)为分子标记基因,以双翅目实蝇科昆虫DNA序列为目标,建立了我国进境植物检疫害虫地中海实蝇Ceratitis capitata、芒果小条实蝇C.cosyra和纳塔尔小条实蝇C.rosa等生物芯片检测方法.地中海实蝇及其近缘种检测芯片由检测探针(实蝇科通用探针1条.小条实蝇属通用探针1条,地中海实蝇、芒果小条实蝇和纳塔尔小条实蝇近缘种探针2条和种特异探针4条)、质控探针(定位点探针、阳性质控、阴性质控和空白对照探针各1条)组成.芯片检测结果表明,检测探针特异性强,能实现上述3种实蝇的种类快速区分和准确鉴定;检测方法稳定性好,地中海实蝇不同虫态(卵、幼虫、蛹和成虫)和不同地理种群检测结果完全一致.地中海实蝇生物芯片检测技术将为我国进口果蔬中检疫性实蝇快速筛查和种类鉴定提供检测方法,同时,还可应用到其他属的实蝇以及相关害虫的检疫中,为有害生物的快速鉴定提供了新方法.

  1. Chironomid (Diptera species recorded from UK lakes as pupal exuviae

    Directory of Open Access Journals (Sweden)

    L.P. Ruse

    2013-09-01

    Full Text Available An inventory of chironomid species (Diptera, Chironomidae data collected from 221 lake basins or reservoirs is detailed together with major physical and chemical characteristics of these waterbodies. Aquatic species of Chironomidae must rise to the water surface for adult emergence. Floating exuviae are transported by wind and water currents to lakeshores. Species data were obtained by collecting lake marginal floating pupal exuviae representing juvenile stages dwelling from across the lake. Among the 450 species found, several were new records for the British Isles.

  2. Ammonium carbonate loss rates from lures differentially affect trap captures of Rhagoletis indifferens (Diptera: Tephritidae) and non-target flies

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is a pest of cherry (Prunus spp.) in western North America that can be monitored using traps baited with ammonia. However, ammonia-based attractants also attract non-target Diptera that clutter traps. Here, the hypothe...

  3. Traumatic Myiasis Caused by an Association of Sarcophaga tibialis (Diptera: Sarcophagidae) and Lucilia sericata (Diptera: Calliphoridae) in a Domestic Cat in Italy.

    Science.gov (United States)

    Pezzi, Marco; Whitmore, Daniel; Chicca, Milvia; Lanfredi, Margherita; Leis, Marilena

    2015-08-01

    We describe here a rare case of traumatic myiasis occurred in August 2014, caused by an association of 2 Diptera species, Sarcophaga tibialis Macquart (Diptera: Sarcophagidae) and Lucilia sericata (Meigen) (Diptera: Calliphoridae), in a domestic cat in northern Italy. Species identification was based on adult male morphology. The present case is the first report of S. tibialis as an agent of myiasis in Italy, and also the first ever report of myiasis caused by an association of S. tibialis and L. sericata. The cat developed an extensive traumatic myiasis in a large wound on the rump, which was treated pharmacologically and surgically. The biology, ecology, and distribution of S. tibialis and L. sericata are also discussed. A literature review is provided on cases of myiasis caused by S. tibialis, and cases of myiasis by L. sericata involving cats worldwide and humans and animals in Italy.

  4. Phylogenetic inference of calyptrates, with the first mitogenomes for Gasterophilinae (Diptera: Oestridae) and Paramacronychiinae (Diptera: Sarcophagidae)

    Science.gov (United States)

    Zhang, Dong; Yan, Liping; Zhang, Ming; Chu, Hongjun; Cao, Jie; Li, Kai; Hu, Defu; Pape, Thomas

    2016-01-01

    The complete mitogenome of the horse stomach bot fly Gasterophilus pecorum (Fabricius) and a near-complete mitogenome of Wohlfahrt's wound myiasis fly Wohlfahrtia magnifica (Schiner) were sequenced. The mitogenomes contain the typical 37 mitogenes found in metazoans, organized in the same order and orientation as in other cyclorrhaphan Diptera. Phylogenetic analyses of mitogenomes from 38 calyptrate taxa with and without two non-calyptrate outgroups were performed using Bayesian Inference and Maximum Likelihood. Three sub-analyses were performed on the concatenated data: (1) not partitioned; (2) partitioned by gene; (3) 3rd codon positions of protein-coding genes omitted. We estimated the contribution of each of the mitochondrial genes for phylogenetic analysis, as well as the effect of some popular methodologies on calyptrate phylogeny reconstruction. In the favoured trees, the Oestroidea are nested within the muscoid grade. Relationships at the family level within Oestroidea are (remaining Calliphoridae (Sarcophagidae (Oestridae, Pollenia + Tachinidae))). Our mito-phylogenetic reconstruction of the Calyptratae presents the most extensive taxon coverage so far, and the risk of long-branch attraction is reduced by an appropriate selection of outgroups. We find that in the Calyptratae the ND2, ND5, ND1, COIII, and COI genes are more phylogenetically informative compared with other mitochondrial protein-coding genes. Our study provides evidence that data partitioning and the inclusion of conserved tRNA genes have little influence on calyptrate phylogeny reconstruction, and that the 3rd codon positions of protein-coding genes are not saturated and therefore should be included. PMID:27019632

  5. Phylogenetic inference of calyptrates, with the first mitogenomes for Gasterophilinae (Diptera: Oestridae) and Paramacronychiinae (Diptera: Sarcophagidae).

    Science.gov (United States)

    Zhang, Dong; Yan, Liping; Zhang, Ming; Chu, Hongjun; Cao, Jie; Li, Kai; Hu, Defu; Pape, Thomas

    2016-01-01

    The complete mitogenome of the horse stomach bot fly Gasterophilus pecorum (Fabricius) and a near-complete mitogenome of Wohlfahrt's wound myiasis fly Wohlfahrtia magnifica (Schiner) were sequenced. The mitogenomes contain the typical 37 mitogenes found in metazoans, organized in the same order and orientation as in other cyclorrhaphan Diptera. Phylogenetic analyses of mitogenomes from 38 calyptrate taxa with and without two non-calyptrate outgroups were performed using Bayesian Inference and Maximum Likelihood. Three sub-analyses were performed on the concatenated data: (1) not partitioned; (2) partitioned by gene; (3) 3rd codon positions of protein-coding genes omitted. We estimated the contribution of each of the mitochondrial genes for phylogenetic analysis, as well as the effect of some popular methodologies on calyptrate phylogeny reconstruction. In the favoured trees, the Oestroidea are nested within the muscoid grade. Relationships at the family level within Oestroidea are (remaining Calliphoridae (Sarcophagidae (Oestridae, Pollenia + Tachinidae))). Our mito-phylogenetic reconstruction of the Calyptratae presents the most extensive taxon coverage so far, and the risk of long-branch attraction is reduced by an appropriate selection of outgroups. We find that in the Calyptratae the ND2, ND5, ND1, COIII, and COI genes are more phylogenetically informative compared with other mitochondrial protein-coding genes. Our study provides evidence that data partitioning and the inclusion of conserved tRNA genes have little influence on calyptrate phylogeny reconstruction, and that the 3rd codon positions of protein-coding genes are not saturated and therefore should be included.

  6. Production of dry matter of Stylosanthes capitata submitted to phosphorus in soil with different textures Produção de matéria seca de Stylosanthes capitata submetido à adubação fosfatada em solos com diferentes texturas

    Directory of Open Access Journals (Sweden)

    Victor Hugo Nakase Otsubo

    2011-12-01

    Full Text Available The low availability of phosphorus is among the factors that limit the development of the Stylosanthes. Only with the appropriate management aiming to increase the phosphorus liberation in the soil we can provide the increase in yield of this leguminous plant. The study was conducted in a greenhouse at the University of Londrina (UEL, the objective was to evaluate the effect of P shoots of Stylosanthes capitata in soil with sandy texture (Typical Yellow Dystropic – LVAd and clay (Typical Eutrophic – Lvef. The experimental design used was completely randomized with four replications in a 2x5x2 factorial design, in which the factors were two soil types, five shots of phosphorus (0, 40, 80, 120 and 160 kg ha-1 of P2O5 and two cuts. For the sowing, seeds of Stylosanthes capitata were used. The aerial part’s cuts were made at 60 and 105 days after sowing. Regardless of the texture and cut, the phosphated fertilization increased the dry matter production of Stylosanthes’ aerial part, and the maximum yield was obtained with a shot of 105 kg ha-1 P2O5. Among the soils the biggest production was obtained in the second cut and soil of sandy texture. With the increase of the doses, the phosphorus content increases in dry matter yield, improving their nutritional quality for animal feed. The maximum dry matter production (2.39 g / plant in sandy soil and 1.36 g / plant in clay soil were obtained with doses of 102.69 and 113.25 kg ha-1 P2O5, respectively.A baixa disponibilidade de fósforo (P está entre os fatores que limitam o desenvolvimento do estilosante. Somente com manejo adequado que vise aumentar a liberação do fósforo no solo se consegue altos rendimentos desta leguminosa. O trabalho foi desenvolvido em casa de vegetação na Universidade Estadual de Londrina (UEL, com o objetivo de avaliar o efeito de doses de P na produção de matéria seca de Stylosanthes capitata em solos com texturas arenosa (Latossolo Vermelho-Amarelo Distr

  7. Checklist and distribution maps of the blow flies of Venezuela (Diptera, Calliphoridae, Mesembrinellidae).

    Science.gov (United States)

    Velásquez, Yelitza; Martínez-Sánchez, Ana Isabel; Thomas, Arianna; Rojo, Santos

    2017-01-01

    A checklist of the 39 species of blow flies (Calliphoridae and Mesembrinellidae) so far known to occur in Venezuela is provided, based on a thorough literature review and the examination of ca. 500 specimens deposited in the main entomological collections of the country. Data from the literature and museum collections were used to generate distribution maps for 37 species. Three species are recorded from Venezuela for the first time: Chrysomya putoria (Wiedemann, 1830), Mesembrinella spicata Aldrich, 1925 and Mesembrinella umbrosa Aldrich, 1922.

  8. A Co-Dominant Marker BoE332 Applied to Marker-Assisted Selection of Homozygous Male-Sterile Plants in Cabbage (Brassica oleracea var. capitata L.)

    Institute of Scientific and Technical Information of China (English)

    CHEN Chen; ZHUANG Mu; FANG Zhi-yuan; WANG Qing-biao; ZHANG Yang-yong; LIU Yu-mei; YANG Li-mei; CHENG Fei

    2013-01-01

    The dominant genic male sterility (DGMS) gene CDMs399-3 derived from a spontaneous mutation in the line 79-399-3 of spring cabbage (Brassica oleracea var. capitata L.), has been successfully applied in hybrid seed production of several cabbage cultivars in China. During the development of dominant male sterility lines in cabbage, the conventional identification of homozygous male-sterile plants (CDMs399-3/CDMs399-3) is a laborious and time-consuming process. For marker-assisted selection (MAS) of the gene CDMs399-3 transferred into key spring cabbage line 397, expressed sequence tag-simple sequence repeats (EST-SSR) and SSR technology were used to identify markers that were linked to CDMs399-3 based on method of bulked segregant analysis (BSA). By screening a set of 978 EST-SSRs and 395 SSRs, a marker BoE332 linked to the CDMs399-3 at a distance of 3.6 cM in the genetic background of cabbage line 397 were identified. 7 homozygous male-sterile plants in population P1170 with 20 plants were obtained finally via MAS of BoE332. Thus, BoE332 will greatly facilitate the transferring of the gene CDMs399-3 into the key spring cabbage line 397 and improve the application of DGMS in cabbage hybrid breeding.

  9. Nondestructive Optical Sensing of Flavonols and Chlorophyll in White Head Cabbage (Brassica oleracea L. var. capitata subvar. alba) Grown under Different Nitrogen Regimens.

    Science.gov (United States)

    Agati, Giovanni; Tuccio, Lorenza; Kusznierewicz, Barbara; Chmiel, Tomasz; Bartoszek, Agnieszka; Kowalski, Artur; Grzegorzewska, Maria; Kosson, Ryszard; Kaniszewski, Stanislaw

    2016-01-13

    A multiparametric optical sensor was used to nondestructively estimate phytochemical compounds in white cabbage leaves directly in the field. An experimental site of 1980 white cabbages (Brassica oleracea L. var. capitata subvar. alba), under different nitrogen (N) treatments, was mapped by measuring leaf transmittance and chlorophyll fluorescence screening in one leaf/cabbage head. The provided indices of flavonols (FLAV) and chlorophyll (CHL) displayed the opposite response to applied N rates, decreasing and increasing, respectively. The combined nitrogen balance index (NBI = CHL/FLAV) calculated was able to discriminate all of the plots under four N regimens (0, 100, 200, and 400 kg/ha) and was correlated with the leaf N content determined destructively. CHL and FLAV were properly calibrated against chlorophyll (R(2) = 0.945) and flavonol (R(2) = 0.932) leaf contents, respectively, by using a homographic fit function. The proposed optical sensing of cabbage crops can be used to estimate the N status of plants and perform precision fertilization to maintain acceptable crop yield levels and, additionally, to rapidly detect health-promoting flavonol antioxidants in Brassica plants.

  10. Variation in adult sex ratio alters the association between courtship, mating frequency and paternity in the lek-forming fruitfly Ceratitis capitata.

    Science.gov (United States)

    Leftwich, P T; Edward, D A; Alphey, L; Gage, M J G; Chapman, T

    2012-09-01

    The intensity with which males deliver courtship and the frequency with which they mate are key components of male reproductive success. However, we expect the strength of the relationship between these traits and a male's overall paternity to be strongly context dependent, for example to be altered significantly by the extent of post-mating competition. We tested this prediction in a lekking insect, Ceratitis capitata (medfly). We examined the effect of manipulating the sex ratio from male- to female-biased (high and low male competition, respectively) on courtship behaviour, mating frequency and paternity of focal males. Under high male competition, focal males delivered significantly more courtship but gained lower paternity than under lower competition. Paternity was positively associated with mating frequency and small residual testes size. However, the association between mating frequency and paternity was significantly stronger under low competition. We conclude that manipulation of sex ratio significantly altered the predictors of mating success and paternity. The relationship between pre- and post-mating success is therefore plastic and alters according to the prevailing level of competition. The results highlight the importance of post-copulatory processes in lekking species and illuminate selection pressures placed on insects such as medflies that are mass reared for pest control.

  11. Hydrogen peroxide is produced by E. coli challenged haemocytes and regulates phagocytosis, in the medfly Ceratitis capitata. The active role of superoxide dismutase.

    Science.gov (United States)

    Arbi, Marina; Pouliliou, Stamatia; Lampropoulou, Maria; Marmaras, Vassilis J; Tsakas, Sotiris

    2011-08-01

    Hydrogen peroxide (H(2)O(2)) participates as a second messenger in cell signaling. In this paper, the role of H(2)O(2) was investigated, in Escherichia coli phagocytosis by the haemocytes of the medfly Ceratitis capitata. Block of H(2)O(2) synthesis by specific enzymic inhibitors, namely N-ethylmaleimide (NEM) for NADPH oxidase and diethyldithiocarbamate (DDC) for SOD, resulted in the increase of E. coli phagocytosis. Immunoblot analysis, flow cytometry and confocal microscopy, revealed the constitutive expression of SOD, in the medfly haemocytes. Phagocytosis increased by small interfering RNA (siRNA) for SOD, revealing the active involvement of SOD and H(2)O(2). Immunoblot analysis showed an increase of the ERK1/2 phosphorylation, in the presence of the above H(2)O(2) synthesis enzymic inhibitors. In addition, confocal microscopy showed no co-localization of SOD with β integrin subunit. It appears that SOD participates in the regulation of bacterial phagocytosis, due to involvement of the produced H(2)O(2) in the differential phosphorylation of MAP kinases.

  12. A centralised remote data collection system using automated traps for managing and controlling the population of the Mediterranean (Ceratitis capitata) and olive (Dacus oleae) fruit flies

    Science.gov (United States)

    Philimis, Panayiotis; Psimolophitis, Elias; Hadjiyiannis, Stavros; Giusti, Alessandro; Perelló, Josep; Serrat, Albert; Avila, Pedro

    2013-08-01

    The present paper describes the development of a novel monitoring system (e-FlyWatch system) for managing and controlling the population of two of the world's most destructive fruit pests, namely the olive fruit fly (Bactrocera oleae, Rossi - formerly Dacus oleae) and the Mediterranean fruit fly (Ceratitis capitata, also called medfly). The novel monitoring system consists of a) novel automated traps with optical and motion detection modules for capturing the flies, b) local stations including a GSM/GPRS module, sensors, flash memory, battery, antenna etc. and c) a central station that collects, stores and publishes the results (i.e. insect population in each field, sensor data, possible error/alarm data) via a web-based management software.The centralised data collection system provides also analysis and prediction models, end-user warning modules and historical analysis of infested areas. The e-FlyWatch system enables the SMEs-producers in the Fruit, Vegetable and Olive sectors to improve their production reduce the amount of insecticides/pesticides used and consequently the labour cost for spraying activities, and the labour cost for traps inspection.

  13. Fumigant Toxicity of Phenylpropanoids Identified in Asarum sieboldii Aerial Parts to Lycoriella ingenua (Diptera: Sciaridae) and Coboldia fuscipes (Diptera: Scatopsidae).

    Science.gov (United States)

    Yi, Jee Hwan; Perumalsamy, Haribalan; Sankarapandian, Karuppasamy; Choi, Byeoung-Ryeol; Ahn, Young-Joon

    2015-06-01

    Lycoriella ingenua (Dufour) (Diptera: Sciaridae) and Coboldia fuscipes (Meigen) (Diptera: Scatopsidae) are two of the most economically important insect pests of cultivated mushrooms. The toxicities to the fly larvae of the three phenylpropanoids (methyleugenol, myristicin, and safrole) from aerial parts of Asarum sieboldii Miquel (Aristolochiaceae) were compared with those of the currently available carbamate insecticide benfuracarb. In a contact+fumigant mortality bioassay with L. ingenua and C. fuscipes larvae, methyleugenol (1.46 and 2.33 µg/cm2) was the most toxic compound, followed by safrole (2.03 and 2.59 µg/cm2) and myristicin (3.59 and 4.96 µg/cm2), based on 24-h LC50 values. The phenylpropanoids were less toxic than benfuracarb (LC50, 0.75 and 0.55 µg/cm2). In vapor-phase mortality tests with the larvae, the phenylpropanoids were consistently more toxic in closed versus open containers, indicating that the effect of the compounds was largely a result of vapor action. Global efforts to reduce the level of highly toxic synthetic insecticides in the agricultural environment justify further studies on A. sieboldii plant-derived products as potential fumigants for the control of mushroom fly populations in mushroom houses and mushroom compost.

  14. Checklist of the Diptera (Insecta of Finland: an introduction and a summary of results

    Directory of Open Access Journals (Sweden)

    Jere Kahanpää

    2014-09-01

    Full Text Available Nearly thirty-five years have passed since Hackman published his “Check list of the Finnish Diptera” (1980. The number of true flies (Diptera known from Finland has increased by more than two thousand species since then. At the same time, hundreds of erroneous records have been recognized and purged from the checklist. ZooKeys issue 441 provides a new checklist of the Diptera species of the Republic of Finland. This introductory paper presents the rationale behind the project, provides technical documentation on the checklist format and sources used, and summarizes the results. The remaining papers in this issue cover one or more Diptera families in detail. Two electronic appendices are provided: supporting data (additional references to first published records and the previous checklist and a complete list of Finnish Diptera taxa in Darwin Core compliant format for easy computer access and processing. The new checklist records 6920 fly species from Finland, 2932 belonging to the nematoceran or lower flies and 3989 to the suborder Brachycera. The changes since 1980 are most prominent in the Lower Diptera. For example, more than 400 non-biting midges (Chironomidae have been added since 1980, and the number of moth flies (Psychodidae known from Finland has more than tripled. Among the larger families, large increases in known Finnish species are also seen in Cecidomyiidae (161% increase, Pipunculidae (98%, and Chironomidae (90%.

  15. Effects of tree and herb biodiversity on Diptera, a hyperdiverse insect order.

    Science.gov (United States)

    Scherber, Christoph; Vockenhuber, Elke A; Stark, Andreas; Meyer, Hans; Tscharntke, Teja

    2014-04-01

    Biodiversity experiments have shown that plant diversity has largely positive effects on insect diversity and abundance. However, such relationships have rarely been studied in undisturbed and more complex ecosystems such as forests. Flies (Diptera) are among the most dominant taxa in temperate ecosystems, influencing many ecosystem processes. As it is unknown how Diptera respond to changes in forest biodiversity, we examined how community characteristics of Diptera respond to varying levels of tree and herb diversity and vegetation structure. The study was conducted in the Hainich National Park (Central Germany) on 84 plots along a gradient of tree (from two to nine species) and herb (from two to 28 species) diversity. We found that herb and canopy cover as well as spatial effects were the best predictors of Diptera community composition, consisting of 62 families, including 99 Empidoidea and 78 Phoridae species. Abundance of Empidoidea was positively influenced by herb diversity, indicating bottom-up control. A complex causal pathway influenced Dipteran species richness: species-rich forest stands, with low beech cover, had lower canopy cover, resulting in higher Dipteran species richness. In addition, Diptera benefited from a more dense and diverse herb community. Individual species responded differentially to herb layer diversity, indicating that effects of plant diversity on higher trophic levels depend on species identity. We conclude that tree and herb canopy cover as well as herb diversity predominately shape Dipteran communities in temperate deciduous forests, which is in contrast to expectations from grassland studies exhibiting much closer relationships between plant and insect diversity.

  16. Rhythmicity of Bactrocera cucurbitae (Diptera:Tephritidae) attraction to cuelure: Insights from an interruptable lure and computer vision

    Science.gov (United States)

    We describe and validate an Agent-Based Simulation (ABS) of invasive insects and use it to investigate the time to extirpation of Ceratitis capitata using data from seven outbreaks that occurred in California from 2008-2010. Results are compared with the length of intervention and quarantine imposed...

  17. Essays on the history of Brazilian dipterology. I. The first notices about Brazilian Diptera (16th century

    Directory of Open Access Journals (Sweden)

    Nelson Papavero

    2012-03-01

    Full Text Available Essays on the history of Brazilian dipterology. I. The first notices about Brazilian Diptera (16th century. This paper presents a historical resume of the first notices about Brazilian Diptera during the 16th century, given by Francisco Pires in 1552 (the oldest mention known, José de Anchieta, Leonardo do Valle, Pero de Magalhães de Gandavo, Jean de Léry and Gabriel Soares de Souza, ending with Fernão Cardim, who made the last mentions of Brazilian Diptera in that century.

  18. The complete mitochondrial genome of Dixella aestivalis (Diptera: Nematocera: Dixidae).

    Science.gov (United States)

    Briscoe, Andrew G; Sivell, Duncan; Harbach, Ralph E

    2017-01-01

    Dixidae, meniscus midges, belong to the suborder Nematocera of the order Diptera. The family includes 197 known species classified in nine genera. The complete mitochondrial genome of the Dixella aestivalis (Meigen) from the United Kingdom is reported here, along with its annotation and comparison with the genome of an unidentified species of Dixella from China. The circular genome consists of 16 465 bp and has a gene content consisting of 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes and a non-coding, A + T-rich, control region. The mitochondrial genome of D. aestivalis can be used to identify genetic markers for species identification, and will be valuable for resolving phylogenetic relationships within the genus, family Dixidae and suborder Nematocera.

  19. Bartonella species in bat flies (Diptera: Nycteribiidae) from western Africa.

    Science.gov (United States)

    Billeter, S A; Hayman, D T S; Peel, A J; Baker, K; Wood, J L N; Cunningham, A; Suu-Ire, R; Dittmar, K; Kosoy, M Y

    2012-03-01

    Bat flies are obligate ectoparasites of bats and it has been hypothesized that they may be involved in the transmission of Bartonella species between bats. A survey was conducted to identify whether Cyclopodia greefi greefi (Diptera: Nycteribiidae) collected from Ghana and 2 islands in the Gulf of Guinea harbour Bartonella. In total, 137 adult flies removed from Eidolon helvum, the straw-coloured fruit bat, were screened for the presence of Bartonella by culture and PCR analysis. Bartonella DNA was detected in 91 (66·4%) of the specimens examined and 1 strain of a Bartonella sp., initially identified in E. helvum blood from Kenya, was obtained from a bat fly collected in Ghana. This is the first study, to our knowledge, to report the identification and isolation of Bartonella in bat flies from western Africa.

  20. El modelo V.S.P. en lechuga Batavia Lactuca sativa var. Capitata L. y respuesta de dos variedades a las aplicaciones de compuestos orgánicos

    Directory of Open Access Journals (Sweden)

    Bruzón C. Serapio F.

    1996-12-01

    Full Text Available

    An investigation was realized in the region of Pavitas, municipality of La Cumbre, Santa Fe farm, 1480 meters above sea level in a soil of Pavas Association (Aeric Tropaquept to prove the plastic cup-sustrate-plant model in the production of Batavia lecttuce Lactuca sativa var. capitata, and the effects of the organic matter filter cake press, cattle manure, poultry manure and earthworm soil, incorporated in the soil. Twenty two (22 treatments and fours repetitions were applied with each of the two varieties (Great lakes 118 and Pacific, the treatments corresponded to 5, 10, 15 t/ha of the organic matter which were applied to the soil fifteen days before transplantations occured. The results showed an excellent plant vigour and quality after the transplantation. It was also observed a good plant poblation and uniformity. The sustrate filter cake press mixed with botton fly ash presented better results in the field than the other treatments, having the highest crop yield and the best quality. The Great Lakes 118 with this treatment doubled the production of the treatment with soil. With the organic sustrates, the poultry manure 5 t/ha projected better results. The work showed the good behavior of the varity Great Lakes 118 compared to the Pacific. This treatments also improved the chemical caracteristics of the soil, especially increased the organic matter, potassium, phosporus, manganesum and zinc.

    En el Corregimiento Pavitas, municipio de La Cumbre, en la Finca Santafé, a 1.480 msnm en un suelo de la Asociación Pavas (Aeric Tropaquept se probó el modelo vaso-sustrato-planta (VSP, en la producción de plántulas de lechuga Batavia L. sativa var. capitata y el efecto en la producción de los compuestos orgánicos, cachaza, lombricompuesto, gallinaza y bovinaza, incorporados al suelo. Los 22 tratamientos con cuatro repeticiones, repartidos en dos variedades (Great Lake 118 y Pacific correspondieron a dosis (5, 10, 15 t/ha de las

  1. Neodexiopsis Malloch from Bolivia with the description of one new species (Diptera, Muscidae

    Directory of Open Access Journals (Sweden)

    Márcia S. Couri

    2011-06-01

    Full Text Available Neodexiopsis Malloch from Bolivia with the description of one new species (Diptera, Muscidae. Neodexiopsis Malloch (Diptera, Muscidae, Coenosiinae is a very well represented genus in the Neotropical Region, known from almost 100 species. In Bolivia, it is known only from four species: N. declivis, N. incurva, N. oculata and N. recedens, all described by Stein. The study of material from South America deposited at Muséum national d'Histoire naturelle (Paris, France, enabled the description of one new species to science. A key for the recognition of the five species known to Bolivia is given.

  2. On the first tachinid fly (Diptera, Tachinidae carrying Asclepiadoideae pollinaria in the Neotropical Region

    Directory of Open Access Journals (Sweden)

    Silvio Shigueo Nihei

    2011-09-01

    Full Text Available On the first tachinid fly (Diptera, Tachinidae carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

  3. Chromosome Doubling of Microspore-Derived Plants from Cabbage (Brassica oleracea var. capitata L.) and Broccoli (Brassica oleracea var. italica L.).

    Science.gov (United States)

    Yuan, Suxia; Su, Yanbin; Liu, Yumei; Li, Zhansheng; Fang, Zhiyuan; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao; Sun, Peitian

    2015-01-01

    Chromosome doubling of microspore-derived plants is an important factor in the practical application of microspore culture technology because breeding programs require a large number of genetically stable, homozygous doubled haploid plants with a high level of fertility. In the present paper, 29 populations of microspore-derived plantlets from cabbage (Brassica oleracea var. capitata) and broccoli (Brassica oleracea var. italica) were used to study the ploidy level and spontaneous chromosome doubling of these populations, the artificial chromosome doubling induced by colchicine, and the influence of tissue culture duration on the chromosomal ploidy of the microspore-derived regenerants. Spontaneous chromosome doubling occurred randomly and was genotype dependent. In the plant populations derived from microspores, there were haploids, diploids, and even a low frequency of polyploids and mixed-ploidy plantlets. The total spontaneous doubling in the 14 cabbage populations ranged from 0 to 76.9%, compared with 52.2 to 100% in the 15 broccoli populations. To improve the rate of chromosome doubling, an efficient and reliable artificial chromosome doubling protocol (i.e., the immersion of haploid plantlet roots in a colchicine solution) was developed for cabbage and broccoli microspore-derived haploids. The optimal chromosome doubling of the haploids was obtained with a solution of 0.2% colchicine for 9-12 h or 0.4% colchicine for 3-9 h for cabbage and 0.05% colchicine for 6-12 h for broccoli. This protocol produced chromosome doubling in over 50% of the haploid genotypes for most of the populations derived from cabbage and broccoli. Notably, after 1 or more years in tissue culture, the chromosomes of the haploids were doubled, and most of the haploids turned into doubled haploid or mixed-ploidy plants. This is the first report indicating that tissue culture duration can change the chromosomal ploidy of microspore-derived regenerants.

  4. Subtractive and differential hybridization molecular analyses of Ceratitis capitata XX/XY versus XX embryos to search for male-specific early transcribed genes.

    Science.gov (United States)

    Salvemini, Marco; D'Amato, Rocco; Petrella, Valeria; Ippolito, Domenica; Ventre, Giuseppe; Zhang, Ying; Saccone, Giuseppe

    2014-01-01

    The agricultural pest Ceratitis capitata, also known as the Mediterranean fruit fly or Medfly, is a fruit crop pest of very high economic relevance in different continents. The strategy to separate Ceratitis males from females (sexing) in mass rearing facilities is a useful step before the sterilization and release of male-only flies in Sterile Insect Technique control programs (SIT). The identification of genes having early embryonic male-specific expression, including Y-linked genes, such as the Maleness factor, could help to design novel and improved methods of sexing in combination with transgenesis, aiming to confer conditional female-specific lethality or female-to-male sexual reversal. We used a combination of Suppression Subtractive Hybrydization (SSH), Mirror Orientation Selection (MOS) anddifferential screening hybridization (DSH) techniques to approach the problem of isolating corresponding mRNAs expressed in XX/XY embryos versus XX-only embryos during a narrow developmental window (8-10 hours after egg laying, AEL ). Here we describe a novel strategy we have conceived to obtain relatively large amounts of XX-only embryos staged at 8-10 h AEL and so to extract few micrograms of polyA+ required to apply the complex technical procedure. The combination of these 3 techniques led to the identification of a Y-linked putative gene, CcGm2, sharing high sequence identity to a paralogous gene, CcGm1, localized either on an autosome or on the X chromosome. We propose that CcGm2 is a first interesting putative Y-linked gene which could play a role in sex determination. The function exterted by this gene should be investigated by novel genetic tools, such as CRISPR-CAS9, which will permit to target only the Y-linked paralogue, avoiding to interfere with the autosomal or X-linked paralogue function.

  5. Stage and cell-specific expression and intracellular localization of the small heat shock protein Hsp27 during oogenesis and spermatogenesis in the Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Economou, Katerina; Kotsiliti, Elena; Mintzas, Anastassios C

    2017-01-01

    The cell-specific expression and intracellular distribution of the small heat protein Hsp27 was investigated in the ovaries and testes of the Mediterranean fruit fly, Ceratitis capitata (medfly), under both normal and heat shock conditions. For this study, a gfp-hsp27 strain was used to detect the chimeric protein by confocal microscopy. In unstressed ovaries, the protein was expressed throughout egg development in a stage and cell-specific pattern. In germarium, the protein was detected in the cytoplasm of the somatic cells in both unstressed and heat-shocked ovaries. In the early stages of oogenesis of unstressed ovaries, the protein was mainly located in the perinuclear region of the germ cells and in the cytoplasm of the follicle cells, while in later stages (9-10) it was distributed in the cytoplasm of the germ cells. In late stages (12-14), the protein changed localization pattern and was exclusively associated with the nuclei of the somatic cells. In heat shocked ovaries, the protein was mainly located in the nuclei of the somatic cells throughout egg chamber's development. In unstressed testes, the chimeric protein was detected in the nuclei of primary spermatocytes and in the filamentous structures of spermatid bundles, called actin cones. Interestingly, after a heat shock, the protein presented the same cell-specific localization pattern as in unstressed testes. Furthermore, the protein was also detected in the nuclei of the epithelial cells of the deferent duct, the accessory glands and the ejaculatory bulb. Our data suggest that medfly Hsp27 may have cell-specific functions, especially in the nucleus. Moreover, the association of this protein to actin cones during spermatid individualization, suggests a possible role of the protein in the formation and stabilization of actin cones.

  6. Diet-induced over-expression of flightless-I protein and its relation to flightlessness in Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Cho, Il Kyu; Chang, Chiou Ling; Li, Qing X

    2013-01-01

    The Mediterranean fruit fly (medfly), Ceratitis capitata is among the most economically important pests worldwide. Understanding nutritional requirement helps rearing healthy medfly for biocontrol of its population in fields. Flight ability is a high priority criterion. Two groups of medfly larvae were reared with two identical component diets except one with fatty acids (diet A) and another without it (diet B). Adults from larvae reared on diet B demonstrated 20±8% of normal flight ability, whereas those from larvae reared on diet A displayed full flight ability of 97±1%. Proteomes were profiled to compare two groups of medfly pupae using shotgun proteomics to study dietary effects on flight ability. When proteins detected in pupae A were compared with those in pupae B, 233 and 239 proteins were, respectively, under- and over-expressed in pupae B, while 167 proteins were overlapped in both pupae A and B. Differential protein profiles indicate that nutritional deficiency induced over-expression of flightless-I protein (fli-I) in medfly. All proteins were subjected to Ingenuity Pathway Analysis (IPA) to create 13 biological networks and 17 pathways of interacting protein clusters in human ortholog. Fli-I, leucine-rich repeat (LRR)-containing G protein-coupled receptor 2, LRR protein soc-2 and protein wings apart-like were over-expressed in pupae B. Inositol-1,4,5-trisphosphate receptor, protocadherin-like wing polarity protein stan and several Wnt pathway proteins were under-expressed in pupae B. These results suggest down-regulation of the Wnt/wingless signaling pathway, which consequently may result in flightlessness in pupae B. The fli-I gene is known to be located within the Smith-Magenis syndrome (SMS) region on chromosome 17, and thus, we speculate that nutritional deficiency might induce over-expression of fli-I (or fli-I gene) and be associated with human SMS. However, more evidence would be needed to confirm our speculation.

  7. Use of gamma radiation to sterilize Ceratitis capitata (Wied., 1824), tsl VIENNA 8 strain, for application of sterile insect technique in Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Mastrangelo, Thiago de A.; Costa, Maria de L.Z.; Paesman, Leandro; Walder, Julio M.M. [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil)]. E-mails: piaui@cena.usp.br; jmwalder@cena.usp.br; Mascarin, Gabriel M. [Universidade de Sao Paulo (USP), Piracicaba, SP (Brazil). Escola Superior de Agricultura Luiz de Queiroz (ESALQ)]. E-mail: gmmascar@esalq.usp.br

    2007-07-01

    The Sterile insect technique is a method of pest control allowed in integrated pest management programs in fruit growing, where sterile insects released compete in mate process against fertile wild ones, generating a gradual population reduction. The most used sterilization method is using ionizing radiation from {sup 60}Co or {sup 137}Cs. For efficient application of SIT, an important item is the sterilizing dose. This must be as lower as possible in order to preserve insect behavior. In this work, it was studied the reproductive potential of fruit fly Ceratitis capitata, tsl VIENNA 8 strain, irradiated with different doses of gamma radiation. This strain shall be used in population suppression programs at fruit-growing areas from Northeast of Brazil, through a partnership between CENA and Biofactory MOSCAMED Brazil, intending only sterile male releases. Radiation source used was a {sup 60}Co irradiator, with 17.2 .1012 Bq. Individualized couples were distributed in a randomized delineament with 10 replicates for each treatment and eggs were collected for fifteen days. With 9 and 10 days old, pupae were irradiated with doses ranging from 30 to 120 Gy. All means of emerged adult's percentages were higher than 90%. In regards to fecundity, different doses didn't affect the number of eggs laid, being the overall mean around 30 eggs/couple/day. Fertility data showed that as radiation dose increases, sterility increases. It was concluded that the dose of 90 Gy could be used in Brazil, since to SIT programs a dose is chosen witch prevents an egg hatch higher than 1%. (author)

  8. Influence of fermentation conditions on glucosinolates, ascorbigen, and ascorbic acid content in white cabbage (Brassica oleracea var. capitata cv. Taler) cultivated in different seasons.

    Science.gov (United States)

    Martinez-Villaluenga, C; Peñas, E; Frias, J; Ciska, E; Honke, J; Piskula, M K; Kozlowska, H; Vidal-Valverde, C

    2009-01-01

    The content of glucosinolates (GLS), ascorbigen, and ascorbic acid in white cabbage (Brassica oleracea var. capitata cv. Taler) cultivated in different seasons (summer and winter) was determined, before and after spontaneous and starter-induced fermentation. Different salt concentrations (0.5% NaCl or 1.5% NaCl) were used for sauerkraut production. Glucoiberin, sinigrin, and glucobrassicin were dominating in raw white cabbage cultivated either in winter or summer seasons. Ascorbigen precursor, glucobrassicin, was found higher in cabbage cultivated in winter (2.54 micromol/g dw) than those grown in summer (1.83 micromol/g dw). Cabbage fermented for 7 d was found to contain only traces of some GLS irrespective of the fermentation conditions used. Ascorbigen synthesis occurred during white cabbage fermentation. Brining cabbage at low salt concentration (0.5% NaCl) improved ascorbigen content in sauerkraut after 7 d of fermentation at 25 degrees C. The highest ascorbigen concentration was observed in low-sodium (0.5% NaCl) sauerkraut produced from cabbage cultivated in winter submitted to either natural (109.0 micromol/100 g dw) or starter-induced fermentation (108.3 and 104.6 micromol/100 g dw in cabbages fermented by L. plantarum and L. mesenteroides, respectively). Ascorbic acid content was found higher in cabbage cultivated in summer and fermentation process led to significant reductions. Therefore, the selection of cabbages with high glucobrassicin content and the production of low-sodium sauerkrauts may provide enhanced health benefits towards prevention of chronic diseases.

  9. Dasineura gigantea sp.n. (Diptera, Cecidomyiidae associada a Psidium cattleianum Sabine (Myrtaceae no Brasil Dasineura gigantea sp.n. (Diptera, Cecidomyiidae associated with Psidium cattleianum Sabine (Myrtaceae in Brazil

    Directory of Open Access Journals (Sweden)

    Alessandro C. Angelo

    1999-03-01

    Full Text Available A new species of Dasineura Rondani, 1840 (Diptera, Cecidomyiidae which causes galls on Psidium cattleianum Sabine, 1821 is described and illustrated (larva, pupa, male, female. The gall is characterized and some biological notes are given.

  10. Cordiamyia globosa gen.n. e sp.n. (Diptera, Cecidomyiidae, Cecidomyiidi associado com Cordia Verbenacea DC. (Boraginaceae no Brasil Cordiamyia globosa gen.n. and sp.n. (Diptera, Cecidomyiidae associated with Cordia verbekacea DC. (Boraginaceae in Brazil

    Directory of Open Access Journals (Sweden)

    Valéria Cid Maia

    1996-01-01

    Full Text Available Cordiamyia globosa gen.n., sp.n. (Diptera, Cecidomyiidae, Cecidomyiidi associated with Cordia verbenacea (Boraginaceae, in Brazil, is described and illustrated (larva, pupa, male, female and gall.

  11. An emerging example of tritrophic coevolution between flies (Diptera: Fergusoninidae) and nematodes (Nematoda: Neotylenchidae) on Myrtaceae host plants

    Science.gov (United States)

    A unique obligate mutualism occurs between species of Fergusonina Malloch flies (Diptera: Fergusoninidae) and nematodes of the genus Fergusobia Currie (Nematoda: Neotylenchidae). These mutualists together form different types of galls on Myrtaceae, mainly in Australia. The galling association appear...

  12. Morphology of immature stages of Atherigona reversura (Diptera: Muscidae), with notes on the recent invasion of North America

    DEFF Research Database (Denmark)

    Grzywacz, Andrzej; Pape, Thomas; Hudson, William G.

    2013-01-01

    The muscid shoot-fly Atherigona reversura Villeneuve (Diptera: Muscidae), recently introduced to North America, is reported for the first time from the Neotropical Region: Mexico, Chiapas, Chiapa de Corzo. Information about distribution throughout the continent is summarized. Morphology of the se......The muscid shoot-fly Atherigona reversura Villeneuve (Diptera: Muscidae), recently introduced to North America, is reported for the first time from the Neotropical Region: Mexico, Chiapas, Chiapa de Corzo. Information about distribution throughout the continent is summarized. Morphology...

  13. Description of the Immature Stages of Anopheles (Nyssorhynchus) rondoni (Neiva & Pinto) (Diptera: Culicidae)

    Science.gov (United States)

    1997-05-01

    Neiva & Pinto) (Diptera: Culicidae) Maria Anice Mureb Sallum/+, Richard C Wilkerson* Núcleo de Pesquisa Taxonômica e Sistemática em Entomologia ...Taxonômica e Sistemática em Entomologia Médica, Universidade de São Paulo, São Paulo. The following specimens were used for setal counts and measurements (the

  14. Description of the female of Ctenodontina nairae Vieira (Diptera, Asilidae, Asilinae, with new distribution records

    Directory of Open Access Journals (Sweden)

    Rodrigo Vieira

    2014-12-01

    Full Text Available Description of the female of Ctenodontina nairae Vieira (Diptera, Asilidae, Asilinae, with new distribution records. The female of Ctenodontina nairae Vieira, 2012 is described for the first time. Description and illustrations of the habitus, wing and terminalia of the female are provided. The distribution is extended to Bolivia and Peru.

  15. Systematics and phylogeny of Centrioncidae, a new afromontane family of Diptera (Schizophora)

    NARCIS (Netherlands)

    Feijen, H.R.

    1983-01-01

    Arguments are put forward for the erection of a new family of Diptera, named Centrioncidae. Centrioncus prodiopsis, its only previously described representative, was originally placed in the Sepsidae and later transferred to the Diopsidae. This species is now redescribed and five more Centrioncus ar

  16. Phylogeny of Anophelinae (Diptera: Culicidae) Based on Nuclear Ribosomal and Mitochondrial DNA Sequences

    Science.gov (United States)

    2002-01-01

    combining data from nuclear protein-encoding enes for phylogenetic analyses of Noctuoidea (Insecta: Lepidoptera ). Systematic Biology, 49, 202 224. Nixon... Systematic Entomology (2002) 27, 361 382 Phylogeny of Anophelinae (Diptera: Culicidae) based on nuclear ribosomal and mitochondrial DNA sequences...Entomologia M•dica, Departamento de Epidemiologia, Faculdade de Safide Pfiblica, Universidade de S•o Paulo, Brazil, -• Department of Systematic

  17. Neodexiopsis Malloch from Bolivia with the description of one new species (Diptera, Muscidae

    Directory of Open Access Journals (Sweden)

    Márcia S. Couri

    2011-06-01

    Full Text Available Neodexiopsis Malloch from Bolivia with the description of one new species (Diptera, Muscidae. Neodexiopsis Malloch (Diptera, Muscidae, Coenosiinae is a very well represented genus in the Neotropical Region, known from almost 100 species. In Bolivia, it is known only from four species: N. declivis, N. incurva, N. oculata and N. recedens, all described by Stein. The study of material from South America deposited at Muséum national d'Histoire naturelle (Paris, France, enabled the description of one new species to science. A key for the recognition of the five species known to Bolivia is given.Neodexiopsis Malloch da Bolivia com descrição de uma espécie nova (Diptera, Muscidae. Neodexiopsis Malloch (Diptera, Muscidae, Coenosiinae é um gênero muito bem representado na região Neotropical, conhecido por quase 100 espécies. Na Bolívia, ele é conhecido por apenas quatro espécies: N. declivis, N. incurva, N. oculata e N. recedens, todas descritas por Stein. O estudo do material da América do Sul depositado no Muséum national d'Histoire naturelle (Paris, France, permitiu a descrição de uma nova espécie para a ciência. Uma chave para o reconhecimento das cinco espécies presentes na Bolívia é fornecida.

  18. Trapping African fig fly (Diptera: Drosophilidae) with combinations of vinegar and wine

    Science.gov (United States)

    The African fig fly, Zaprionus indianus Gupta (Diptera: Drosophilidae), is an invasive fruit pest that has spread rapidly through much of the eastern United States. Tests were conducted in southern Florida that recorded the response of Z. indianus to baits that included Merlot wine, rice vinegar, et...

  19. Wine and vinegar-based attractants for the African fig fly (Diptera: Drosophilidae)

    Science.gov (United States)

    The African fig fly (AFF), Zaprionus indianus Gupta (Diptera: Drosophilidae), is an invasive fruit pest that has spread rapidly through much of the eastern United States after first being detected in Florida in 2005. This drosophilid is a primary pest of figs in Brazil, so there were initial concern...

  20. Aristofolia Ayala-Landa, a valid genus of Asilinae (Diptera, Asilidae

    Directory of Open Access Journals (Sweden)

    Rodrigo Vieira

    2014-03-01

    Full Text Available Aristofolia Ayala-Landa, a valid genus of Asilinae (Diptera, Asilidae. The robber fly genus Aristofolia Ayala-Landa, 1978 is a monotypic taxon of Asilinae. The status of Aristofolia is revalidated, and addenda to the original description of the genus is provided. The habitus, wings, male and female terminalia are described and illustrated.

  1. Vertical stratification of beetles (Coleoptera) and flies (Diptera) in temperate forest canopies.

    Science.gov (United States)

    Maguire, Dorothy Y; Robert, Katleen; Brochu, Kristen; Larrivée, Maxim; Buddle, Christopher M; Wheeler, Terry A

    2014-02-01

    Forest canopies support high arthropod biodiversity, but in temperate canopies, little is known about the spatial distribution of these arthropods. This is an important first step toward understanding ecological roles of insects in temperate canopies. The objective of this study was to assess differences in the species composition of two dominant and diverse taxa (Diptera and Coleoptera) along a vertical gradient in temperate deciduous forest canopies. Five sugar maple trees from each of three deciduous forest sites in southern Quebec were sampled using a combination of window and trunk traps placed in three vertical strata (understory, mid-canopy, and upper-canopy) for three sampling periods throughout the summer. Coleoptera species richness and abundance did not differ between canopy heights, but more specimens and species of Diptera were collected in the upper-canopy. Community composition of Coleoptera and Diptera varied significantly by trap height. Window traps collected more specimens and species of Coleoptera than trunk traps, although both trap types should be used to maximize representation of the entire Coleoptera community. There were no differences in abundance, diversity, or composition of Diptera collected between trap types. Our data confirm the relevance of sampling all strata in a forest when studying canopy arthropod biodiversity.

  2. Annotated world bibliography of host plants of the melon fly, Bactrocera cucurbitae(Cocquillett)(Diptera:Tephritidae)

    Science.gov (United States)

    The melon fly, Bactrocera cucurbitae(Coquillett), is a widespread, economically important tephritid fruit fly (Diptera: Tephritidae) species. Bactrocera cucurbitae infests fruits and vegetables of a number of different plant species, with many host plants in the plant family Cucurbitaceae, but with ...

  3. Picture-winged fly (Euxesta, Chaetopsis spp.; Diptera: Ulidiidae) semiochemical investigations

    Science.gov (United States)

    Picture-winged flies (Euxesta, Chaetopsis spp., Diptera: Ulidiidae) are severe primary pests of sweet corn in southern Florida. Females oviposit in silks and larvae consume the silks and kernels, rendering the ear unmarketable. Growers treat their fields with numerous broad spectrum insecticide ap...

  4. First North American record of the Palaearctic rhinophorid Stevenia deceptoria (Loew) (Diptera: Rhinophoridae).

    Science.gov (United States)

    O'hara, James E; Cerretti, Pierfilippo; Dahlem, Gregory A

    2015-12-16

    The Rhinophoridae (Diptera) have a cosmopolitan distribution and a known fauna of about 150 species (Cerretti & Pape 2007). So far as known, all species are parasitoids of terrestrial woodlice (sow bugs) of the order Isopoda (Oniscoidea) (Pape 2010). Female rhinophorids lay eggs in the vicinity of potential hosts and the planidial first instars parasitize sow bugs as they pass by (Pape 1998).

  5. A remarkable new species of Eutrichopoda Townsend, 1908 (Diptera: Tachinidae: Phasiinae).

    Science.gov (United States)

    Dios, Rodrigo De Vilhena Perez; Nihei, Silvio Shigueo

    2016-06-08

    A new Tachinidae species, Eutrichopoda flavipenna sp. nov. (Diptera: Tachinidae: Phasiinae), from Brazil and Paraguay is described and illustrated by photographs and line drawings. The remarkable yellow, feather-like setae on the hind tibia distinguishes the new species from all other species in the tribe Trichopodini.

  6. The oldest accurate record of Scenopinidae in the Lowermost Eocene amber of France (Diptera: Brachycera).

    Science.gov (United States)

    Garrouste, Romain; Azar, Dany; Nel, Andre

    2016-03-22

    Eocenotrichia magnifica gen. et sp. nov. (Diptera: Scenopinidae: Metatrichini) is described and illustrated from the Lowermost Eocene amber of Oise (France) and represents the oldest definitive window fly fossil. The present discovery in the Earliest Eocene supports the Late Cretaceous-Paleocene age currently proposed for the emergence of Metatrichini.

  7. An Annotated Bibliography of the Mosquitoes and Mosquito-Borne Diseases of Guam (Diptera: Culicidae)

    Science.gov (United States)

    1976-01-01

    Nematocera . University Press of Hawaii, Honolulu, Hawaii. 618 pp. Family Culicidae; see A. Stone and M.D. Delfinado, 1973. 359 Edgren, D.C., V.S...Culicidae, in Delfinado, M.D. and D.E. Hardy (Eds.), A Catalog of the Diptera of the Oriental Region, Vol. 1: Nematocera , pp. 266-343. University Press

  8. On the first tachinid fly (Diptera, Tachinidae carrying Asclepiadoideae pollinaria in the Neotropical Region

    Directory of Open Access Journals (Sweden)

    Silvio Shigueo Nihei

    2011-09-01

    Full Text Available On the first tachinid fly (Diptera, Tachinidae carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.Sobre o primeiro taquinídeo (Diptera, Tachinidae carregando polinários de Asclepiadoideae na Região Neotropical. Esta contribuição relata a primeira espécie neotropical de Tachinidae possivelmente associada à polinização de Asclepiadoideae: uma fêmea de Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini transportando dois polinários de Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae presos à sua probóscide. O espécime foi coletado no Paraguai, Departamento Canindeyú. O polinário é ilustrado e caracterizado. Este é o primeiro registro de antofilia para G. parviflorus e para o gênero.

  9. [The mosquitoes (Diptera Culicidae) of Morocco. Bibliographic review (1916-2001) and inventory of the species].

    Science.gov (United States)

    Trari, B; Dakki, M; Himmi, O; el Agbani, M A

    2003-11-01

    The history of the Culicidae of Morocco was related from bibliographical data. A synthesis of the almost entire works carried out on these Insects (Diptera) since 1916 allowed to bring out the main stages of research of which they were the subject, while emphasizing the important periods of large malaria epidemics in Morocco. A short list of species is also given.

  10. Corrections and additions to Catalogue of Neotropical Diptera (Tabanidae of Coscarón & Papavero (2009

    Directory of Open Access Journals (Sweden)

    Augusto Loureiro Henriques

    2012-09-01

    Full Text Available Some corrections and omitted taxonomic information for the "Catalogue of Neotropical Diptera. Tabanidae" are presented. Fifteen recently described species are listed for the Neotropical region. Presently, the Neotropical region has 1,205 Tabanidae species, besides 35 unrecognized species and 29 nomina nuda.

  11. Aristofolia Ayala-Landa, a valid genus of Asilinae (Diptera, Asilidae)

    OpenAIRE

    Rodrigo Vieira; José Manuel Ayala Landa

    2014-01-01

    Aristofolia Ayala-Landa, a valid genus of Asilinae (Diptera, Asilidae). The robber fly genus Aristofolia Ayala-Landa, 1978 is a monotypic taxon of Asilinae. The status of Aristofolia is revalidated, and addenda to the original description of the genus is provided. The habitus, wings, male and female terminalia are described and illustrated.

  12. Pollinating flies (Diptera): A major contribution to plant diversity and agricultural production

    Science.gov (United States)

    Diptera are one of the three largest and most diverse animal groups of the world. As an often neglected, but important group of pollinators, they play a significant role in agrobiodiversity and biodiversity of plants everywhere. Flies are present in almost all habitats and biomes and for many food p...

  13. Cutaneous neoplasm in Phaeotabanus litigiosus (Diptera, Tabanidae collected on the Marambaia Island, Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    RR Guimarães

    2016-02-01

    Full Text Available A female specimen of Phaeotabanus litigiosus (Diptera: Tabanidae collected on Marambaia Island was found with a tumor in the abdominal integument. Histopathological examination revealed an epithelial dysplasia with anisokariosis and hyperchromasia. This is the first record of a neoplasm found in tabanid collected from natural environment. Key Words: Atlantic island; displasia; horse fly; insect disease; insect vector; neotropical region

  14. Chironomid (Chironomidae: Diptera checklist from Nahuel Huapi National Park, Patagonia, Argentina Lista de los quironómidos (Chironomidae: Diptera del Parque Nacional Nahuel Huapi, Patagonia, Argentina

    Directory of Open Access Journals (Sweden)

    Mariano Donato

    2008-06-01

    Full Text Available This paper presents the first inventory of modern and subfossil taxa of the Family Chironomidae (Insecta: Diptera from Nahuel Huapi National Park in Patagonia, Argentina. The catalogued fauna contains 104 species in 48 genera and 6 sub-families for modern fauna and 52 morphotypes in 36 genera and 4 subfamilies for sub-fossil fauna.Este trabajo presenta el primer catálogo de taxones modernos y subfósiles de la familia Chironomidae (Insecta: Diptera del Parque Nacional Nahuel Huapi en Patagonia, Argentina. La fauna catalogada contiene 104 especies en 48 géneros y 6 subfamilias para la fauna moderna y 52 morfotipos en 36 géneros y 4 subfamilias para la fauna subfósil.

  15. Abundance and seasonality of Cochliomyia macellaria (Diptera: Calliphoridae) in Southern Pantanal, Brazil Sazonalidade de Cochliomyia macellaria (Diptera: Calliphoridae) no Pantanal Sul-mato-grossense, Brasil

    OpenAIRE

    2011-01-01

    Cochliomyia macellaria (Diptera: Calliphoridae), known as the secondary screwworm, occurs in the Americas and has medical-veterinary and forensic importance. This study aimed to describe the seasonal fluctuation of this species in the Pantanal region, Central-Western Brazil. From December 2004 to November 2007 fly catches using four windoriented traps baited with decaying bovine liver were carried out at the Nhumirim ranch, Nhecolândia subregion, Southern Pantanal. Traps remained active throu...

  16. Diet-induced over-expression of flightless-I protein and its relation to flightlessness in Mediterranean fruit fly, Ceratitis capitata.

    Directory of Open Access Journals (Sweden)

    Il Kyu Cho

    Full Text Available The Mediterranean fruit fly (medfly, Ceratitis capitata is among the most economically important pests worldwide. Understanding nutritional requirement helps rearing healthy medfly for biocontrol of its population in fields. Flight ability is a high priority criterion. Two groups of medfly larvae were reared with two identical component diets except one with fatty acids (diet A and another without it (diet B. Adults from larvae reared on diet B demonstrated 20±8% of normal flight ability, whereas those from larvae reared on diet A displayed full flight ability of 97±1%. Proteomes were profiled to compare two groups of medfly pupae using shotgun proteomics to study dietary effects on flight ability. When proteins detected in pupae A were compared with those in pupae B, 233 and 239 proteins were, respectively, under- and over-expressed in pupae B, while 167 proteins were overlapped in both pupae A and B. Differential protein profiles indicate that nutritional deficiency induced over-expression of flightless-I protein (fli-I in medfly. All proteins were subjected to Ingenuity Pathway Analysis (IPA to create 13 biological networks and 17 pathways of interacting protein clusters in human ortholog. Fli-I, leucine-rich repeat (LRR-containing G protein-coupled receptor 2, LRR protein soc-2 and protein wings apart-like were over-expressed in pupae B. Inositol-1,4,5-trisphosphate receptor, protocadherin-like wing polarity protein stan and several Wnt pathway proteins were under-expressed in pupae B. These results suggest down-regulation of the Wnt/wingless signaling pathway, which consequently may result in flightlessness in pupae B. The fli-I gene is known to be located within the Smith-Magenis syndrome (SMS region on chromosome 17, and thus, we speculate that nutritional deficiency might induce over-expression of fli-I (or fli-I gene and be associated with human SMS. However, more evidence would be needed to confirm our speculation.

  17. Isolation and identification of male medfly attractive components inLitchi chinensis stems andFicus spp. stem exudates.

    Science.gov (United States)

    Warthen, J D; McInnis, D O

    1989-06-01

    Short-range attraction/feeding stimulation of male Mediterranean fruit flies [Ceratitis capitata (Wiedemann), (Diptera: Tephritidae)] to a stem extract of a host plant,Litchi chinensis Sonn. (Sapindaceae), and to milky exudates from stems of nonhost plants,Ficus retusa L. andF. benjamina L. (Moraceae), were attributed to the presence of the sesquiterpene α-copaene. The presence of α-copaene in the milky exudate from stems ofF. benghalensis L. is also suggested as eliciting similar behavioral responses in male medflies. The presence of minor quantities of α-ylangene in the plants and its contributory effects to the behavioral response of male medflies is discussed. Short-range attraction/feeding stimulation of male medflies to equal amounts of α-ylangene-free α-copaene samples (94.5%+), prepared from α-copaene-enriched angelica seed oil and copaiba oil, respectively, showed no difference in intensity of response. α-Ylangene elicited a slightly less intense response for male medflies than α-copaene.

  18. Sampling strategies for phlebotomine sand flies (Diptera: Psychodidae) in Europe.

    Science.gov (United States)

    Alten, B; Ozbel, Y; Ergunay, K; Kasap, O E; Cull, B; Antoniou, M; Velo, E; Prudhomme, J; Molina, R; Bañuls, A-L; Schaffner, F; Hendrickx, G; Van Bortel, W; Medlock, J M

    2015-12-01

    The distribution of phlebotomine sand flies is widely reported to be changing in Europe. This can be attributed to either the discovery of sand flies in areas where they were previously overlooked (generally following an outbreak of leishmaniasis or other sand fly-related disease) or to true expansion of their range as a result of climatic or environmental changes. Routine surveillance for phlebotomines in Europe is localized, and often one of the challenges for entomologists working in non-leishmaniasis endemic countries is the lack of knowledge on how to conduct, plan and execute sampling for phlebotomines, or how to adapt on-going sampling strategies for other haematophagous diptera. This review brings together published and unpublished expert knowledge on sampling strategies for European phlebotomines of public health concern in order to provide practical advice on: how to conduct surveys; the collection and interpretation of field data; suitable techniques for the preservation of specimens obtained by different sampling methods; molecular techniques used for species identification; and the pathogens associated with sand flies and their detection methods.

  19. Evolution and Structural Analyses of Glossina morsitans (Diptera; Glossinidae Tetraspanins

    Directory of Open Access Journals (Sweden)

    Edwin K. Murungi

    2014-11-01

    Full Text Available Tetraspanins are important conserved integral membrane proteins expressed in many organisms. Although there is limited knowledge about the full repertoire, evolution and structural characteristics of individual members in various organisms, data obtained so far show that tetraspanins play major roles in membrane biology, visual processing, memory, olfactory signal processing, and mechanosensory antennal inputs. Thus, these proteins are potential targets for control of insect pests. Here, we report that the genome of the tsetse fly, Glossina morsitans (Diptera: Glossinidae encodes at least seventeen tetraspanins (GmTsps, all containing the signature features found in the tetraspanin superfamily members. Whereas six of the GmTsps have been previously reported, eleven could be classified as novel because their amino acid sequences do not map to characterized tetraspanins in the available protein data bases. We present a model of the GmTsps by using GmTsp42Ed, whose presence and expression has been recently detected by transcriptomics and proteomics analyses of G. morsitans. Phylogenetically, the identified GmTsps segregate into three major clusters. Structurally, the GmTsps are largely similar to vertebrate tetraspanins. In view of the exploitation of tetraspanins by organisms for survival, these proteins could be targeted using specific antibodies, recombinant large extracellular loop (LEL domains, small-molecule mimetics and siRNAs as potential novel and efficacious putative targets to combat African trypanosomiasis by killing the tsetse fly vector.

  20. Biology of Anastrepha grandis (Diptera: Tephritidae) in Different Cucurbits.

    Science.gov (United States)

    Bolzan, Anderson; Nava, Dori E; Garcia, Flávio R M; Valgas, Ricardo A; Smaniotto, Giovani

    2015-06-01

    Anastrepha grandis (Macquart) (Diptera: Tephritidae) is one of the main pests of cucurbits in Brazil. Losses occur due to the damage caused to the fruits and the embargo on exports, as A. grandis is considered a quarantine pest in countries that import Brazilian cucurbits. This study aimed to evaluate the development of A. grandis in hosts of the Cucurbitaceae family. The hosts used were stem squash (Cucurbita pepo L.), squash (Cucurbita moschata Duchesne), chayote [Sechium edule (Jacq.) Swartz], mini watermelon [Citrullus lanatus (Thunb.) Matsum & Nakai], Spanish melon (Cucumis melo L.), hybrid squash "Tetsukabuto" (C. moschata×Cucurbita maxima Duchesne), and salad cucumber (Cucumis sativus L.). We evaluated the viability and duration of egg-to-pupa period, pupal weight, sex ratio, and average number of pupae per fruit under controlled conditions of temperature, relative humidity, and photophase. The preoviposition and oviposition periods, fecundity, fertility, and longevity of females were determined for adults. Hosts of the genus Cucurbita provided a better development of A. grandis in comparison with other hosts, and presented a greater number of insects on fruit as well as higher infestation rate. Fecundity and longevity were also higher for females that developed in hosts of the genus Cucurbita, although values of these biological parameters varied between stem squash, squash, hybrid squash "Tetsukabuto."

  1. Chironomid (Diptera, Chironomidae species assemblages in northeastern Algerian hydrosystems

    Directory of Open Access Journals (Sweden)

    N. Chaib

    2013-04-01

    Full Text Available The aim of this paper was to analyze the distribution of chironomids (Diptera, Chironomidae, and determine their substrate preferences, from two hydrosystems located in northeastern Algeria: the Kebir-East and the Seybouse wadis. Sixty-five species were recorded in 49 sampling sites distributed along the main courses of the two hydrographic nets and their tributaries. The majority of taxa comprised cosmopolitan species widely distributed along these two hydrosystems. Cricotopus (Cricotopus bicinctus showed the highest abundance and frequency of occurrence (29.52% and was widespread in almost all the sampling sites. Species richness ranged from 4 to 23, Shannon diversity between 0.15 and 0.90, Evenness from 0.23 to 1. A cluster analysis was carried out to represent the different groups of sites sharing similar species composition. Agglomerative cluster analysis grouped the sampling sites into four clusters according to the community data. An Indval analysis was then carried out to detect indicator species for each group of the sampling sites. Cricotopus (Isocladius sylvestris was indicator of the first group of the sampling sites. Orthocladius pedestris, Rheocricotopus chalybeatus and C. bicinctus were indicators of the second group, and Polypedilum cultellatum of the third group. The fourth group was not characterized by any species. Indval analysis allowed also to determine species preferences for substrate size: Corynoneura scutellata and Dicrotendipes nervosus emphasized a preference to fine gravel, and Glyptotendipes pallens to fine sand.

  2. The larval head of Exechia (Mycetophilidae) and Bibio (Bibionidae) (Diptera).

    Science.gov (United States)

    Bauernfeind, René; Schneeberg, Katharina; Beutel, Rolf Georg

    2015-07-01

    Exechia and Bibio have retained several plesiomorphic groundplan features of Diptera and Bibionomorpha, including a fully exposed and sclerotized head capsule, the transverse undivided labrum, the absence of movable premandibles, and undivided mandibles without combs. The fusion of the hypostomal bridge with the head capsule and largely reduced antennae are derived features shared by both taxa. The absence of teeth at the anterior hypostomal margin is a potential autapomorphy of Bibionomorpha. A basal position of Anisopodidae is suggested by a number of plesiomorphies retained in this family. Apomorphies of Bibionomorpha excluding Anisopodidae are the reduction of tentorial elements, the partial fusion of the labrum and clypeus, one-segmented antennae, the absence of a separate submental sclerite, the loss of the labial palpus, and the reduction of the pharyngeal filter apparatus. Head structures of Bibio are largely unmodified. The subprognathous orientation is one of few autapomorphic features. In contrast, the mouthparts of Exechia are highly modified in correlation with the specialized food uptake. The rasping counterrotating movements of maxillae and mandibles with teeth oriented in opposite directions are carried out by strongly developed extensors and flexors of the paired mouthparts. The modified labium mechanically supports the "drill head" formed by the mandibles und maxillae. The necessary stability of the head capsule is provided by the hypostomal bridge which also compensates the far-reaching reduction of the tentorium.

  3. Diel periodicity of Drosophila suzukii (Diptera: Drosophilidae) under field conditions

    Science.gov (United States)

    Evans, Richard K.; Toews, Michael D.

    2017-01-01

    Drosophila suzukii Matsumura (Diptera: Drosophilidae), an economically important pest of blueberry and other thin-skinned fruits, persists and prolifically reproduces under seemingly lethal climatic conditions in the field. However, behavioral and physiological mechanisms employed by D. suzukii to tolerate such extreme climatic conditions in the field are unknown. The primary objective of this project was to investigate diel periodicity of D. suzukii and their reproductive success under field conditions as related by climatic factors such as temperature and relative humidity. Results show that D. suzukii reproductive success was significantly higher during the night (including dawn and dusk periods) than the day in terms of oviposition, pupation, adult eclosion, and the number of progeny per female. Female D. suzukii reproductive success was not significantly different between specific regions of a blueberry bush in relation to the amount of shade provided by the canopy. Our studies indicate that D. suzukii flight activity is crepuscular and is sensitive to fluctuations in temperature and relative humidity. Results also suggest that the majority of fly activity during peak hours is concentrated in areas around the border and within the center of blueberry orchards with little activity in the surrounding wooded areas. These findings suggest that D. suzukii prefers microclimate with mild temperatures and high humidity, and does not function well when exposed to direct sunlight with extreme heat. The authors propose that D. suzukii management strategies should be implemented during the early morning and immediately before darkness to maximize efficacy. PMID:28187140

  4. Blood meal analysis of culicoides (Diptera: ceratopogonidae) in central Tunisia.

    Science.gov (United States)

    Slama, Darine; Haouas, Najoua; Mezhoud, Habib; Babba, Hamouda; Chaker, Emna

    2015-01-01

    To evaluate the host preferences of Culicoides species (Diptera: Ceratopogonidae) in Central Tunisia, we identified the source of blood meals of field collected specimens by sequencing of the cytochrome b (cyt b) mitochondrial locus and Prepronociceptine single copy nuclear gene. The study includes the most common and abundant livestock associated species of biting midges in Tunisia: C. imicola, C. jumineri, C. newsteadi, C. paolae, C. cataneii, C. circumscriptus, C. kingi, C. pseudojumineri, C. submaritimus, C. langeroni, C. jumineri var and some unidentified C. species. Analysis of cyt b PCR products from 182 field collected blood-engorged females' midges revealed that 92% of them fed solely on mammalian species, 1.6% on birds, 2.4% on insects and 0.8% on reptiles. The blast results identified the blood origin of biting midges to the species level with exact or nearly exact matches (≥98%). The results confirm the presence of several Culicoides species, including proven vectors in Central Tunisia. Blood meal analyses show that these species will indeed feed on bigger mammals, thereby highlighting the risk that these viruses will be able to spread in Tunisia.

  5. Biogeography of Drosophila (Diptera: Drosophilidae) in East and Southeast Asia.

    Science.gov (United States)

    Liu, Fu-Guo Robert; Tsaur, Shun-Chern; Huang, Hsiao-Ting

    2015-01-01

    The causes of high biological diversity in biodiversity hotspots have long been a major subject of study in conservation biology. To investigate this matter, we conducted a phylogeographic study of five Drosophila (Diptera: Drosophilidae) species from East and Southeast Asia: Drosophila albomicans Duda, D. formosana Duda, D. immigrans Sturtevant, D. melanogaster Meigen, and D. simulans Sturtevant. We collected 185 samples from 28 localities in eight countries. From each collected individual, we sequenced the autosomal extra sex comb gene (esc) and seven mitochondrial genes, including nicotinamide adenine dinucleotide hydrate-reductase dehydrogenase subunit 4 (ND4), ND4L, tRNA-His, tRNA-Pro, tRNA-Thr, partial ND5, and partial ND6. Phylogenetic analyses using maximum- likelihood and Bayesian methods revealed interesting population structure and identified the existence of two distinct D. formosana lineages (Southeast Asian and Taiwanese populations). Genetic differentiation among groups of D. immigrans suggests the possibility of endemic speciation in Taiwan. In contrast, D. melanogaster remained one extensively large population throughout East and Southeast Asia, including nearby islets. A molecular clock was used to estimate divergence times, which were compared with past geographical events to infer evolutionary scenarios. Our findings suggest that interglacial periods may have caused population isolation, thus enhancing population differentiation more strongly for some of the Drosophila species. The population structure of each Drosophila species in East and Southeast Asia has been influenced by past geographic events.

  6. DNA-based identification of forensically important Australian Sarcophagidae (Diptera).

    Science.gov (United States)

    Meiklejohn, Kelly A; Wallman, James F; Dowton, Mark

    2011-01-01

    The utility of the forensically important Sarcophagidae (Diptera) for time since death estimates has been severely limited, as morphological identification is difficult and thermobiological histories are inadequately documented. A molecular identification method involving the sequencing of a 658-bp 'barcode' fragment of the mitochondrial cytochrome oxidase subunit I (COI) gene from 85 specimens, representing 16 Australian species from varying populations, was evaluated. Nucleotide sequence divergences were calculated using the Kimura-two-parameter distance model and a neighbour-joining phylogenetic tree generated. All species were resolved as reciprocally monophyletic, except Sarcophaga dux. Intraspecific and interspecific variation ranged from 0.000% to 1.499% (SE = 0.044%) and 6.658% to 8.983% (SE = 0.653%), respectively. The COI 'barcode' sequence was found to be suitable for the molecular identification of the studied Australian Sarcophagidae: 96.5% of the examined specimens were assigned to the correct species. Given that the sarcophagid fauna is poorly described, it is feasible that the few incorrectly assigned specimens represent cryptic species. The results of this research will be instrumental for implementation of the Australian Sarcophagidae in forensic entomology.

  7. Curva de sobrevivência e estimativa de entropia em Lucilia cuprina (Diptera, Calliphoridae Survivorship curve and estimate of entropy in Lucilia cuprina (Diptera, Calliphoridae

    Directory of Open Access Journals (Sweden)

    Francely M. Fernandes

    2003-09-01

    Full Text Available Lucilia cuprina (Wiedemann, 1830 is a cosmopolite blowfly species of medical and veterinary importance because it produces myiasis, mainly in ovine. In order to evaluate the demographic characteristics of this species, survivorship curves for 327 adult males and 323 adult females, from generation F1 maintained under experimental conditions, were obtained. Entropy was utilized as the estimator of the survival pattern to quantify the mortality distribution of individuals as a function of age. The entropy values 0.216 (males and 0.303 (females were obtained. These results denote that, considering the survivorship interval until the death of the last individual for each sex, the males present a tendency of mortality in more advanced age intervals, in comparison with the females.

  8. An illustrated key to adult males of neotropical Fannia Robineau-Desvoidy belonging to pusio sub-group (Diptera, Fanniidae).

    Science.gov (United States)

    Couri, M S

    2005-11-01

    The 11 neotropical species of Fannia belonging to the pusio sub-group (canicularis group), are keyed F. dodgei Seago; F. femoralis (Stein); F. pamplonae Couri & Araújo; F. parafemoralis Araújo & Couri; F. paraisensis Araújo & Couri; F. punctivervis Malloch; F. pusio (Wiedemann); F. sabroskyi Seago; F. snyderi Seago; F. trimaculata (Stein); F. trimaculatoides Couri & Pamplona. The key is addressed only to the males and the illustrations help in the visualization of the characters.

  9. A taxonomic revision of the Southern South American species of the genus Fannia Robineau-Desvoidy (Diptera: Fanniidae)

    OpenAIRE

    Martha Cecilia Dominguez

    2007-01-01

    The Southern South American species of the genus Fannia Robineau-Desvoidy are revised. Twenty five valid species are recognized for the region in the present study: Fannia albitarsis Stein, Fannia anthracina (Walker), Fannia bigoti Stein, Fannia canicularis (Linnaeus), Fannia confusa Pont & Carvalho, Fannia coxata Shannon & Del Ponte, Fannia femoralis (Stein), Fannia flavicornis Stein, Fannia flavipalpis Stein, Fannia fusconotata (Rondani), Fannia heydenii (Wiedemann), Fannia hirtifemur (Stei...

  10. Embryogenesis in Culture of Isolated Microspores of Brassica juncea var.capitata%结球芥菜游离小孢子培养的胚状体发生

    Institute of Scientific and Technical Information of China (English)

    王长龙; 杨培新; 郑奕雄

    2011-01-01

    2009~2011年对6种不同结球芥菜品种进行了小孢子培养试验,结果表明:在相同的培养条件下,各品种胚状体的发育是不同步的,胚状体的平均产量也存在极显著的差异,以大平铺的平均产胚量最高,为3.52个/蕾,其次为哥历蕾.%The isolated microspores of 6 Brassica juncea var. Capitata varieties were cultured from 2009 to 2011. The results showed that: under the same culture conditions, the embryogenesis of different varieties was of asynchrony, the average embryoid yield had extremely significant difference among different varieties, and the variety Dapingpu had the highest average embryoid yield (3.52 embryoids per bud) , followed by Gelilei.

  11. MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM POMARES DA ÁREA URBANA NO NORTE DE MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    CLARICE DINIZ ALVARENGA

    2010-01-01

    Full Text Available The aim this work was know the species of fruit fly and host plants in orchards in the urban area in the north of Minas Gerais. Were selected 10 orchards with wide variety of fruit species, which were distributed in equidistant way in the urban area of Janaúba, MG. Weekly, were collected systematically fruit flies through trap type McPhail and ripe fruit and in ripening one, on those orchards. Were collected 7.016 tephritid obtained from trap (5.226 and fruit (1.790, from which 1.044 belonged to genus Anastrepha and 5.972 were Ceratitis capitata. The specimens number of C. capitata (85.1% was around six times superior to Anastrepha spp. (14.9%, demonstrating the preference of this species for urban orchards. Eight species of Anastrepha occur in urban orchards of Janaúba, MG. Ceratitis capitata was found infesting 10 species of host fruits, being the main S. purpurea and guava. In fruits were collected three species of Anastrepha (A. obliqua, A. sororcula and A. zenildae which were associated with five species of fruit (Malpighia glabra L, Psidium guayava L, S. dulcis, S. purpurea and S. tuberosa. The predominant species of Anastrepha was A. obliqua, and S. tuberosa and S. purpurea being the main hosts of this species in the urban area of Janaúba, MG.

  12. Multiple species of scuttle flies (Diptera: Phoridae) as contaminants in forensic entomology laboratory insect colony.

    Science.gov (United States)

    Zuha, R M; Jenarthanan, L X Q; Disney, R H L; Omar, B

    2015-09-01

    In forensic entomology, larval rearing usually includes the presence of biological contaminants including scuttle flies (Diptera: Phoridae). Scuttle flies are recognized as forensically important insects and have been reported causing nuisance and contamination in laboratory environments. This paper reports for the first time the finding of multiple scuttle fly species affecting colonies of third instar larvae of the Oriental latrine blowfly, Chrysomya megacephala (Fabricius) (Diptera: Calliphoridae), reared indoors at the Forensic Science Simulation Site, Universiti Kebangsaan Malaysia. Adult scuttle flies were discovered inside a rearing container after the emergence of adult C. megacephala., The scuttle fly species are Megaselia scalaris (Loew), M. spiracularis Schmitz and Puliciphora borinquenensis (Wheeler). Notes on the life history and biology of these species are discussed herein.

  13. First report of Zaprionus indianus (Diptera: Drosophilidae) in commercial fruits and vegetables in Pennsylvania.

    Science.gov (United States)

    Joshi, Neelendra K; Biddinger, David J; Demchak, Kathleen; Deppen, Alan

    2014-01-01

    Zaprionus indianus (Gupta) (Diptera: Drosophilidae), an invasive vinegar fly, was found for the first time in Adams County, Pennsylvania, in 2011. It was found in a commercial tart cherry orchard using apple cider vinegar (ACV) traps that were monitoring another invasive vinegar fly, the spotted wing drosophila, Drosophila suzukii (Matsumura) (Diptera: Drosophilidae). Coincidentally, the first record of D. suzukii found in Pennsylvania was also found in this same cherry orchard only 3 months earlier as part of a spotted wing drosophila survey effort in raspberry, blackberry, grape, and tart cherry in Adams County. These same crops plus blueberry and tomato were monitored again in 2012. In this article, adult Z. indianus captures in ACV traps and other traps deployed in the aforementioned crops during 2012 season are presented and the economic importance of Z. indianus is discussed.

  14. The previously unknown pupa and adult male of Neobezzia fittkaui Wirth & Ratanaworabhan (Diptera, Ceratopogonidae

    Directory of Open Access Journals (Sweden)

    María M. Ronderos

    2011-12-01

    Full Text Available The previously unknown pupa and adult male of Neobezzia fittkaui Wirth & Ratanaworabhan (Diptera, Ceratopogonidae. The pupa of Neobezzia fittkaui Wirth & Ratanaworabhan, 1972, collected from a mat of floating fern (Salvinia auriculata Aubl., Salviniaceae in Ilha da Marchantaria near Manaus, Brazil and the reared adult male are described, photographed and illustrated for the first time. This is the first detailed pupal description for the genus Neobezzia Wirth & Ratanaworabhan.Pupa e adulto macho previamente desconhecidos de Neobezzia fittkaui Wirth & Ratanaworabhan (Diptera, Ceratopogonidae. A pupa de Neobezzia fittkaui Wirth & Ratanaworabhan, 1972 foi coletada em macrófitas aquáticas flutuantes (Salvinia auriculata Aubl., Salviniaceae na Ilha da Marchantaria próximo a Manaus, Brasil e o adulto macho criado foi descrito, fotografado e ilustrado pela primeira vez. Esta é a primeira descrição para a pupa do gênero Neobezzia Wirth & Ratanaworabhan.

  15. The Effect of Clothing on the Rate of Decomposition and Diptera Colonization on Sus scrofa Carcasses.

    Science.gov (United States)

    Card, Allison; Cross, Peter; Moffatt, Colin; Simmons, Tal

    2015-07-01

    Twenty Sus scrofa carcasses were used to study the effect the presence of clothing had on decomposition rate and colonization locations of Diptera species; 10 unclothed control carcasses were compared to 10 clothed experimental carcasses over 58 days. Data collection occurred at regular accumulated degree day intervals; the level of decomposition as Total Body Score (TBSsurf ), pattern of decomposition, and Diptera present was documented. Results indicated a statistically significant difference in the rate of decomposition, (t427  = 2.59, p = 0.010), with unclothed carcasses decomposing faster than clothed carcasses. However, the overall decomposition rates from each carcass group are too similar to separate when applying a 95% CI, which means that, although statistically significant, from a practical forensic point of view they are not sufficiently dissimilar as to warrant the application of different formulae to estimate the postmortem interval. Further results demonstrated clothing provided blow flies with additional colonization locations.

  16. Confirming Hypoderma tarandi (Diptera: Oestridae) human ophthalmomyiasis by larval DNA barcoding.

    Science.gov (United States)

    Rukke, Bjørn Arne; Cholidis, Symira; Johnsen, Arild; Ottesen, Preben

    2014-06-01

    DNA barcoding is a practical tool for species identification, when morphological classification of an organism is difficult. Herein we describe the utilisation of this technique in a case of ophthalmomyiasis interna. A 12-year-old boy was infested during a summer holiday in northern Norway, while visiting an area populated with reindeer. Following medical examination, a Diptera larva was surgically removed from the boy's eye and tentatively identified from its morphological traits as Hypoderma tarandi (L.) (Diptera: Oestridae). Ultimately, DNA barcoding confirmed this impression. The larval cytochrome c oxidase subunit 1 (COI) DNA sequence was matched with both profiles of five adult H. tarandi from the same region where the boy was infested, and other established profiles of H. tarandi in the Barcode of Life Data Systems (BOLD) identification engine.

  17. The evolution of head structures in lower Diptera

    Directory of Open Access Journals (Sweden)

    Katharina Schneeberg

    2014-12-01

    Full Text Available The head of adult dipterans is mainly characterized by modifications and more or less far-reaching reductions of the mouthparts (e.g., mandibles and maxillae, linked with the specialization on liquid food and the reduced necessity to process substrates mechanically. In contrast, the compound eyes and the antennae, sense organs used for orientation and for finding a suitable mating partner and oviposition site, are well developed. Some evolutionary novelties are specific adaptations to feeding on liquefied substrates, such as labellae with furrows or pseudotracheae on their surface, and the strongly developed pre– and postcerebral pumping apparatuses. In some dipteran groups specialized on blood, the mandibles are still present as piercing stylets. They are completely reduced in the vast majority of families. Within the group far-reaching modifications of the antennae take place, with a strongly reduced number of segments and a specific configuration in Brachycera. The feeding habits and mouthparts of dipteran larvae are much more diverse than in the adults. The larval head is prognathous and fully exposed in the dipteran groundplan and most groups of lower Diptera. In Tipuloidea and Brachycera it is partly or largely retracted, and the sclerotized elements of the external head capsule are partly or fully reduced. The larval head of Cyclorrhapha is largely reduced. A complex and unique feature of this group is the cephaloskeleton. The movability of the larvae is limited due to the lack of thoracic legs. This can be partly compensated by the mouthparts, which are involved in locomotion in different groups. The mouth hooks associated with the cyclorrhaphan cephaloskeleton provide anchorage in the substrate.

  18. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The IT...

  19. A new name for the Neotropical genus Aniarella Enderlein (Diptera, Sciaridae

    Directory of Open Access Journals (Sweden)

    Hüseyin Özdikmen

    2011-03-01

    Full Text Available A new name for the Neotropical genus Aniarella Enderlein (Diptera, Sciaridae. A junior homonym was detected among neotropical sciarid flies genera and the following replacement name is proposed: Novaniarella nom. nov. for Aniarella Enderlein, 1911 (nec Bolivar, 1906. Accordingly, new combinations are herein proposed for the species currently included in this genus: Novaniarella azteca (Lane, 1959 comb. nov., Novaniarella brevis (Rubsaamen, 1894 comb. nov. and Novaniarella pelluscens (Enderlein, 1911 comb. nov.

  20. Argyritarsis Section of the Subgenus Nyssorhynchus of Anopheles (Diptera: Culicidae). Revision

    Science.gov (United States)

    1988-01-01

    Am. Entomol. Inst. (Ann Arbor) 1(2):1-17. 1967. Estudios sobre mosquitos (Diptera, Culicidae). Ia. Un proyecto para un estudio sistematico de los...subgenero Nyssorhynchus do Brasil. Arq. Hig. Saude Publica 8:141-162. 1950. Do diagnostico diferencial entre A (N) strodel e A (N) pessoai na fase larvaria...Mex. , D. F. , Secr. Salubr. Asist. 181 p. Vargas V. M. 1956. Clave numerica para identificacion de larvas en cuarta fase de Anophelini en Costa Rica

  1. A Revision of the Argyritarsis Section of the Subgenus Nyssorhynchus of Anopheles (Diptera: Culicidae)

    Science.gov (United States)

    1988-01-01

    Middle America. Contrib. Am. Entomol. Inst. (Ann Arbor) 1(2):1-17. 1967. Estudios sobre mosquitos (Diptera, Culicidae). Ia. Un proyecto para un estudio...N) pessoai na fase larvaria. Rev. Bras. Malariol. 2:38-48. Galvao, A. L. A. and F. A. D. Amaral 1938. Sobre urn novo anofelino de Campos do Jordao...Salubr. Taxonomia y distribution. Mex., D. F., P* identification de larvas en cuarta fase de Rev. Biol. Trop. 4:27-34. identification de larvas

  2. Baby Killers: Documentation and Evolution of Scuttle Fly (Diptera: Phoridae) Parasitism of Ant (Hymenoptera: Formicidae) Brood

    OpenAIRE

    Brown, Brian; Hash, John; Hartop, Emily; Porras, Wendy; Amorim, Dalton

    2017-01-01

    Numerous well-documented associations occur among species of scuttle flies (Diptera: Phoridae) and ants (Hymenoptera: Formicidae), but examples of brood parasitism are rare and the mechanisms of parasitism often remain unsubstantiated. We present two video-documented examples of ant brood (larvae and pupae) parasitism by scuttle flies. In footage from Estação Biológica de Boracéia in Brazil, adult females of Ceratoconus setipennis Borgmeier can be seen attacking workers of Linepithema h...

  3. Morphological description of the fourth instar larva: Culicoides cataneii and Culicoides sahariensis (Diptera: Ceratopogonidae).

    Science.gov (United States)

    Slama, Darine; Khedher, Asma; Bdira, Sassi; Khayech, Fethi; Delecolle, Jean-claude; Mezhoud, Habib; Babba, Hamouda; Emna, Chaker

    2013-01-01

    This study was carried out of the region of Monastir in Central Tunisia, between July and August 2010. Larvae were collected using a floatation technique with magnesium sulfate in mud samples. The fourth instar larva of Culicoides cataneii Clastrier, 1957 and Culicoides sahariensis Callot, Kremer, Bailly-Choumara, 1970 are described, illustrated and drawn. Measurements of instars IV are also presented. This is the first record of Culicoides cataneii and Culicoides sahariensis (Diptera: Ceratopogonidae) to Tunisia.

  4. The previously unknown pupa and adult male of Neobezzia fittkaui Wirth & Ratanaworabhan (Diptera, Ceratopogonidae

    Directory of Open Access Journals (Sweden)

    María M. Ronderos

    2011-12-01

    Full Text Available The previously unknown pupa and adult male of Neobezzia fittkaui Wirth & Ratanaworabhan (Diptera, Ceratopogonidae. The pupa of Neobezzia fittkaui Wirth & Ratanaworabhan, 1972, collected from a mat of floating fern (Salvinia auriculata Aubl., Salviniaceae in Ilha da Marchantaria near Manaus, Brazil and the reared adult male are described, photographed and illustrated for the first time. This is the first detailed pupal description for the genus Neobezzia Wirth & Ratanaworabhan.

  5. Chironomid (Chironomidae: Diptera checklist from Nahuel Huapi National Park, Patagonia, Argentina

    Directory of Open Access Journals (Sweden)

    Mariano DONATO

    2008-01-01

    Full Text Available Este trabajo presenta el primer catálogo de taxones modernos y subfósiles de la familia Chironomidae (Insecta: Diptera del Parque Nacional Nahuel Huapi en Patagonia, Argentina. La fauna catalogada contiene 104 especies en 48 géneros y 6 subfamilias para la fauna moderna y 52 morfotipos en 36 géneros y 4 subfamilias para la fauna subfósil.

  6. Four cases of pediculosis caused by Pthirus pubis Linnaeus, 1758 (Diptera: Anoplura) from peninsular Malaysia.

    Science.gov (United States)

    Pakeer, O; Jeffery, J; Mohamed, A M; Ahmad, F; Baharudin, O

    2007-12-01

    Four cases of pediculosis, two in adults and two in children, caused by the crab-louse, Pthirus pubis Linnaeus, 1758 (Diptera: Anoplura) is reported from peninsular Malaysia. This is the second report of the problem to be documented from the country. Although P. pubis is closely associated with genital hairs, it is, however, also found to occur on the eyelashes, eyebrows, hairs of the body, head and axilla. The few reported cases of pthiriasis probably do not reflect the true situation.

  7. Palpada panorama sp. n. (Diptera: Syrphidae), a big-eyed hoverfly from Peru and Suriname.

    Science.gov (United States)

    Reemer, Menno; Morales, Mirian N

    2016-03-15

    The hoverfly species Palpada panorama sp. n. (Diptera: Syrphidae) is described based on specimens from Peru and Suriname. It belongs to the scutellaris species group and it is most similar to P. erratica (Curran, 1930), from which it differs most notably by the strongly enlarged ommatidia in the upper half of the eye. Additional differences between these two species and an adjustment for the latest identification key for the species of the scutellaris group are given.

  8. Review of the genus Parerigone Brauer (Diptera: Tachinidae) with five new species from China.

    Science.gov (United States)

    Wang, Qiang; Zhang, Chuntian; Wang, Xinhua

    2015-02-18

    The genus Parerigone (Diptera, Tachinidae) is reviewed. Five new species from China, P. atrisetosa sp. nov., P. flava sp. nov., P. flavisquama sp. nov., P. laxifrons sp. nov. and P. wangi sp. nov., are described and illustrated. Parerigone flavihirta (Chao & Sun) is proposed as a new synonym of P. takanoi Mesnil. Diagnosis of species examined and a key to the 15 species of Parerigone are provided.

  9. Phlebotomus Sandflies of the Paloich Area in the Sudan (Diptera, Psychodidae)

    Science.gov (United States)

    1964-10-01

    sandflies based on total collections in the area. Solid black bars. on R. H. and temperature rows represent average daily minimums per month and...and other arthropods of pUblic health and veterinary significance. DECK 2 PHLEBOTOMUS SANDFLIES OF THE PALOICH AREA IN THE SUDAN (DIPTERA...PSYCHODIDAE)’ 2860 By Laurence W. Quate2 Abstract: This report describes results of field studies on Phlebotomus sandflies from August 1962 to October

  10. The Brazilian Malaria Vector Anopheles (Kerteszia) Cruzii: Life Stages and Biology (Diptera: Culicidae)

    Science.gov (United States)

    1991-11-01

    Mosquitos no litoral paranaense. I - Idade fisioldgica de no Parque National da Serra dos Orgaos, Anopheles cruzii (Diptera, Culicidae). Arq. Estado do...no Parque National da Peryassii, A.G. 1908. OS culicideos do Brazil. Serra dos Grgaos, Estado do Rio de Janeiro, Inst. de Manguinhos, Rio de Janeiro...Kerteszia no litoral Guimar%es, A.E. and V.N.M. Victoria. 1986. do estado de Santa Catarina. Rev. Bras. Mosquitos no Parque National da Serra dos

  11. Richardia Robineau-Desvoidy (Diptera, Tephritoidea, Richardiidae from Central Amazon, Brazil

    Directory of Open Access Journals (Sweden)

    Letícia Barros de Alencar

    2013-06-01

    Full Text Available Richardia Robineau-Desvoidy (Diptera, Tephritoidea, Richardiidae from Central Amazon, Brazil. There are 11 species of Richardia known to Brazil. Of these, only four are known to occur in the Brazilian Amazon Region, where the diversity of Richardia is underestimated. Herein we describe and illustrate Richardia intemperata sp. nov. and Richardia parispina sp. nov. from Amazonas, Brazil. An illustrated key to males from this region is also provided.

  12. Second Supplement to "A Catalog of the Mosquitoes of the World" (Diptera: Culicidae)

    Science.gov (United States)

    1984-01-01

    Faran 1979:27 (d*, ?*, P*, L*). Type-lot: 1.5 km S of Puyo, Pastaza, Ecuador (USNM). Name Rejected Anopheles subpictus var. vadakadiensis...25. Type Depositories AMC. Institute of Microbiology and Epidemiology, Academy of Medical Science, P.L.A., People’s Republic of China. BMC...YeZanoconion) from Bolivia and Ecuador (Diptera: Culicidae). Mosq. Syst. 11:135-138. Sirivanakarn, S. 1982 (1983). A review of the systematics and

  13. New records of Forcipomyia (Pterobosca) incubans (Diptera: Ceratopogonidae) parasitizing wings of Odonata in Brazil

    OpenAIRE

    Guillermo-Ferreira, Rhainer; Vilela,Diogo Silva

    2013-01-01

    Forcipomyia (Pterobosca) incubans Macfie (1937) (Diptera: Ceratopogonidae) is recorded here for the first time for Brazil. Females were collected in the Brazilian Neotropical Savanna parasitizing the wings of Erythrodiplax juliana Ris (1911), Erythrodiplax aff. anomala Brauer (1865) and Erythemis credula Hagen (1861), all Libellulidae dragonflies. A map of potential distribution of this species in the New World is also provided. The results suggest that its distribution may range from souther...

  14. A Modified Trap for Adult Sampling of Medically Important Flies (Insecta: Diptera

    Directory of Open Access Journals (Sweden)

    Kamran Akbarzadeh

    2012-12-01

    Full Text Available Background: Bait-trapping appears to be a generally useful method of studying fly populations. The aim of this study was to construct a new adult flytrap by some modifications in former versions and to evaluate its applicability in a subtropical zone in southern Iran.Methods: The traps were constructed with modification by adding some equipment to a polyethylene container (18× 20× 33 cm with lid. The fresh sheep meat was used as bait. Totally 27 adult modified traps were made and tested for their efficacies to attract adult flies. The experiment was carried out in a range of different topographic areas of Fars Province during June 2010.Results: The traps were able to attract various groups of adult flies belonging to families of: Calliphoridae, Sarcophagidae, Muscidae, and Faniidae. The species of Calliphora vicina (Diptera: Calliphoridae, Sarcophaga argyrostoma (Diptera: Sarcophagidae and Musca domestica (Diptera: Muscidae include the majority of the flies collected by this sheep-meat baited trap.Conclusion: This adult flytrap can be recommended for routine field sampling to study diversity and population dynamics of flies where conducting of daily collection is difficult.

  15. Diptera of sanitary importance associated with composting of biosolids in Argentina

    Directory of Open Access Journals (Sweden)

    Valeria Alejandra Labud

    2003-12-01

    Full Text Available OBJECTIVE: Odorous compounds produced at the biosolids composting plant in Bariloche (NW Patagonia attract a variety of insects, mainly belonging to the order Diptera. In order to characterize these flies, collected specimens were taxonomically identified, their community characteristics were described and their sanitary and synanthropic importance and autochthonous or introduced character were determined. METHODS: Sampling was performed from October 1999 until March 2000. Adults were collected using an entomological net, and larvae and puparia were obtained from the composting material and incubated to obtain adults. Richness, abundance and sex ratio were calculated. RESULTS: A total of 9 taxa of Diptera were identified: Sarconesia chlorogaster, Phaenicia sericata, Calliphora vicina, Cochliomya macellaria, Ophyra sp, Muscina stabulans, Musca domestica, Sarcophaga sp and Fannia sp. Specimens of Anthomyiidae, Acaliptratae and one larva of Eristalis tenax were also found. Ophyra sp. was the most abundant taxa. All the captured Diptera belonged to introduced taxa. Most of them are considered to be eusynanthropic and/or hemisynanthropic and have sanitary importance as they may cause myiasis and pseudomyiasis. The high number of females registered and the finding of immature stages indicated that flies can develop their complete life cycle on biosolid composting windrows. CONCLUSIONS: The characterization of flies obtained in this study may be useful for defining locations of urban or semi-urban composting facilities. It also highlights the importance of sanitary precautions at such plants.

  16. Biological and Cultural Control of Olive Fruit Fly in California---Utilization of Parasitoids from USDA-APHIS-PPQ, Guatemala and Cultural Control Methods

    Science.gov (United States)

    The parasitoid Psytallia humilis = P. cf. concolor (Szépligeti) was reared on sterile Mediterranean fruit fly, Ceratitis capitata (Wiedemann), larvae at the USDA, APHIS, PPQ, Moscamed biological control laboratory in San Miguel Petapa, Guatemala and shipped to the USDA, ARS, Parlier, for biological ...

  17. Cold Tolerance of the Mediterranean Fruit Fly in Date and Mandarin.

    Science.gov (United States)

    Gazit, Yoav; Akiva, Ruti; Gavriel, Sagi

    2014-10-01

    The Mediterranean fruit fly, Ceratitis capitata (Wiedemann), is an endemic pest in Israel and there can be low levels of infestation of dates (Phoenix dactylifera L.). Because C. capitata is considered a quarantine pest by several major importing countries, the export of fresh dates requires the elimination of this pest. For mandarin, cold storage at 1.11°C for 15 d is considered to be an effective treatment for the elimination of C. capitata. In this study, we compared the cold tolerance of C. capitata in "Barhi" dates to that of C. capitata in mandarins (Citrus unshiu Marcovitch, "Satsuma"). In Barhi dates, we found the third instars to be the most cold-tolerant as compared with other life stages. Ceratitis capitata in date fruits were significantly less cold-tolerant than C. capitata in Satsuma mandarins. The last viable larvae in dates and mandarins were found after 8 and 13 d of treatment, respectively, and the calculated mortality curves in the two crops were significantly different. These results demonstrate that C. capitata is more sensitive to cold treatment when in date fruits than in mandarins. Therefore, the quarantine cold treatments used to eliminate C. capitata from mandarins should be sufficiently effective if applied to fresh date fruits.

  18. Análise cladística de Euprepina Hull (Diptera, Bombyliidae, Bombyliinae Cladistic analysis of Euprepina Hull, (Diptera, Bombyliidae, Bombyliinae

    Directory of Open Access Journals (Sweden)

    Carlos José Einicker Lamas

    1999-01-01

    Full Text Available A cladistic analysis of Euprepina Hull, 1971 (Diptera, Bombyliidae, Bombyliinae, a Neotropical genus that includes ten species, was made. The cladogram was obtained from eight studied species, based on a data matrix with 21 characters, using the program Hennig86. Character states were polarized following outgroup analysis, and an hypothetical ancestor was included in the analysis in order to root the tree. The options used, "ie*" and "xs w", resulted in four most parsimonious trees with ci = 79, ri = 80 and length 115. The monophiletism of Euprepina was supported by two synapomorphies.

  19. Neolasioptera ramicola, a new species of Cecidomyiidae (Diptera associated with Physalis angulata (Solanaceae Neolasioptera ramicola, uma nova espécie de Cecidomyiidae (Diptera associada com Physalis angulata (Solanaceae

    Directory of Open Access Journals (Sweden)

    Valéria Cid Maia

    2009-06-01

    Full Text Available Neolasioptera ramicola Maia, a new species of Cecidomyiidae (Diptera that induces stem galls on Physalis angulata (Solanaceae is described and illustrated (larva, pupa, male, female and gall based on material from Bento Gonçalves, Rio Grande do Sul, Brazil.Neolasioptera ramicola Maia, uma nova espécie de Cecidomyiidae (Diptera que induz galhas caulinares em Physalis angulata (Solanaceae é descrita e ilustrada (larva, pupa, male, fêmea e galha com base em material coletado em Bento Gonçalves, Rio Grande do Sul, Brasil.

  20. A check list of necrophagous flies (Diptera: Calyptratae from urban area in Medellín, Colombia Lista de moscas necrófagas (Diptera: Calyptratae del área urbana del municipio de Medellín, Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Alberto Salazar-Ortega

    2012-06-01

    Full Text Available An updated checklist of necrophagous flies (Diptera, Calyptratae occurring in the urban area of Medellín-Colombia is presented. 27 species belonging to 4 families are reported. Data were obtained from field work and recent bibliography references.Se presenta una lista actualizada de moscas necrófagas (Diptera, Calyptratae presentes en el área urbana del municipio de Medellín. Se registran 27 especies incluidas en cuatro familias. Los datos se obtuvieron a partir de recolectas en campo y referencias bibliográficas.