Characterization of the canine urinary proteome.

Science.gov (United States)

Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E

2014-06-01

Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.

Duration of serological response to canine parvovirus-type 2, canine distemper virus, canine adenovirus type 1 and canine parainfluenza virus in client-owned dogs in Australia.

Science.gov (United States)

Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J

2012-12-01

To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.

Antibody titers for canine parvovirus type-2, canine distemper virus, and canine adenovirus type-1 in adult household dogs.

Science.gov (United States)

Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki

2011-09-01

Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.

New and emerging pathogens in canine infectious respiratory disease.

Science.gov (United States)

Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J

2014-03-01

Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.

Genetics of Human and Canine Dilated Cardiomyopathy.

Science.gov (United States)

Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S

2015-01-01

Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...

Clinical and serological response of wild dogs (Lycaon pictus to vaccination against canine distemper, canine parvovirus infection and rabies

Directory of Open Access Journals (Sweden)

J. Van Heerden

2002-07-01

Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies.

Science.gov (United States)

van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E

2002-03-01

Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

9 CFR 113.317 - Parvovirus Vaccine (Canine).

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...

Application of xenogeneic anti-canine distemper virus antibodies in treatment of canine distemper puppies.

Science.gov (United States)

Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L

2016-11-01

The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.

Genetics of Human and Canine Dilated Cardiomyopathy

Directory of Open Access Journals (Sweden)

Siobhan Simpson

2015-01-01

Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

Kinetics of canine dental calculus crystallization: an in vitro study on the influence of inorganic components of canine saliva.

Science.gov (United States)

Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H

2014-07-01

This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.

Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.

Science.gov (United States)

Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S

2017-06-03

Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.

Reliability of mandibular canines as indicators for sexual dichotomy.

Science.gov (United States)

Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa

2013-02-01

Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.

Approaches to canine health surveillance.

Science.gov (United States)

O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C

2014-01-01

Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.

The Effect of Using a Modified Dentoalveolar Distractor on Canine Angulation following Rapid Canine Retraction: A Split-mouth Design Randomized Controlled Trial.

Science.gov (United States)

Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y

2016-01-01

New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.

Platelets Inhibit Migration of Canine Osteosarcoma Cells.

Science.gov (United States)

Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C

2017-01-01

The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.

9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...

Recombinant canine distemper virus serves as bivalent live vaccine against rabies and canine distemper.

Science.gov (United States)

Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao

2012-07-20

Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.

Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War

Science.gov (United States)

1981-06-05

anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges

Concomitant canine distemper, infectious canine hepatitis, canine parvoviral enteritis, canine infectious tracheobronchitis, and toxoplasmosis in a puppy.

Science.gov (United States)

Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes

2013-01-01

The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.

Canine Visceral Leishmaniasis in Wild Canines (Fox, Jackal, and Wolf in Northeastern Iran Using Parasitological, Serological, and Molecular Methods

Directory of Open Access Journals (Sweden)

Mehdi Mohebali

2016-10-01

Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.

Clinical and Statistical Study on Canine Impaction

Directory of Open Access Journals (Sweden)

Adina-Simona Coșarcă

2013-08-01

Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic

Podoplanin Expression in Canine Melanoma.

Science.gov (United States)

Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

2016-12-01

A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.

European canine lymphoma network consensus recommendations for reporting flow cytometry in canine hematopoietic neoplasms.

Science.gov (United States)

Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W

2017-09-01

Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.

Vaccines for canine leishmaniasis

Directory of Open Access Journals (Sweden)

Clarisa B. Palatnik-De-Sousa

2012-04-01

Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans

Canine adenovirus type 1 in a fennec fox (Vulpes zerda).

Science.gov (United States)

Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku

2014-12-01

A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.

MicroRNAs as tumour suppressors in canine and human melanoma cells and as a prognostic factor in canine melanomas.

Science.gov (United States)

Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y

2013-06-01

Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.

Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review

Directory of Open Access Journals (Sweden)

Parviz Torkzaban

2016-09-01

Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.

9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).

Science.gov (United States)

2010-01-01

... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...

Orthodontic Traction of Impacted Canine Using Cantilever

Directory of Open Access Journals (Sweden)

Cláudia Nakandakari

2016-01-01

Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.

Transmigration of mandibular canine – case report

International Nuclear Information System (INIS)

Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia

2014-01-01

Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation

Canine Parvovirus: Current Perspective

OpenAIRE

Nandi, S.; Kumar, Manoj

2010-01-01

Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...

Evaluation of P16 expression in canine appendicular osteosarcoma.

Science.gov (United States)

Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K

2017-06-20

Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.

Cone beam computed tomography findings of impacted upper canines

Energy Technology Data Exchange (ETDEWEB)

Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)

2014-12-15

To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

Cone beam computed tomography findings of impacted upper canines

International Nuclear Information System (INIS)

Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio

2014-01-01

To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

The Effects of Orthodontic Forces during Canine Retraction Using Self-ligating Brackets on Gingival Crevicular Fluid Enzyme Activity, Canine Movement and Root Resorption

International Nuclear Information System (INIS)

Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin

2015-01-01

Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)

Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.

Science.gov (United States)

Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano

2004-10-01

This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.

Skeletal maturity assessment using mandibular canine calcification stages

Directory of Open Access Journals (Sweden)

Vildana Džemidžić

2016-11-01

Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.

A new method for rapid Canine retraction

Directory of Open Access Journals (Sweden)

"Khavari A

2001-06-01

Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.

Simultaneous canine distemper encephalitis and canine parvovirus infection with distemper-associated cardiac necrosis in a pup

OpenAIRE

Headley,Selwyn Arlington; Saito,Taís Berelli

2003-01-01

Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...

Novel canine circovirus strains from Thailand: Evidence for genetic recombination.

Science.gov (United States)

Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E

2018-05-14

Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.

Podoplanin Expression in Canine Melanoma

OpenAIRE

Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

2016-01-01

A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...

Finite element analysis of rapid canine retraction through reducing resistance and distraction

Directory of Open Access Journals (Sweden)

Junjie XUE

2014-01-01

Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.

Canine scent detection of canine cancer: a feasibility study

Directory of Open Access Journals (Sweden)

Dorman DC

2017-10-01

Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of

Comparative trial of the canine parvovirus, canine distemper virus and canine adenovirus type 2 fractions of two commercially available modified live vaccines.

Science.gov (United States)

Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G

2006-11-25

The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.

Evaluation of the efficacy and duration of immunity of a canine combination vaccine against virulent parvovirus, infectious canine hepatitis virus, and distemper virus experimental challenges.

Science.gov (United States)

Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald

2004-01-01

The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.

A rare case of canine anomaly - a possible algorithm for treating it.

Science.gov (United States)

Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore

2014-01-01

Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.

Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.

Science.gov (United States)

Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong

2017-06-01

Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.

Surgical considerations and management of bilateral labially impacted canines

Directory of Open Access Journals (Sweden)

Yu-Shan Huang

2016-06-01

Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.

Immunohistochemical Characterization of Canine Lymphomas

Directory of Open Access Journals (Sweden)

Roxana CORA

2017-11-01

Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.

Stem Cell-Associated Marker Expression in Canine Hair Follicles.

Science.gov (United States)

Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J

2016-03-01

Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.

Chlamydia in canine or feline coronary arteriosclerotic lesions

Directory of Open Access Journals (Sweden)

Grabarevic Zeljko

2011-09-01

Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.

Chlamydia in canine or feline coronary arteriosclerotic lesions.

Science.gov (United States)

Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas

2011-09-09

There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.

A novel bocavirus in canine liver

Directory of Open Access Journals (Sweden)

Li Linlin

2013-02-01

Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.

A compendium of canine normal tissue gene expression.

Directory of Open Access Journals (Sweden)

Joseph Briggs

Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.

Genomic instability and telomere fusion of canine osteosarcoma cells.

Directory of Open Access Journals (Sweden)

Junko Maeda

Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.

Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.

Science.gov (United States)

Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H

2016-06-01

Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.

Canine index – A tool for sex determination

Directory of Open Access Journals (Sweden)

Shankar M. Bakkannavar

2015-12-01

Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.

Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.

Science.gov (United States)

Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara

2018-04-01

Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.

Rate of retraction of anterior teeth after canine distraction

Directory of Open Access Journals (Sweden)

Litesh Singla

2017-01-01

Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.

Canine tooth size and fitness in male mandrills (Mandrillus sphinx).

Science.gov (United States)

Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean

2008-07-01

Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.

Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature

Directory of Open Access Journals (Sweden)

Gaurav Sharma

2011-01-01

Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.

Asymmetry in development (mineralisation of permanent mandibular canine roots

Directory of Open Access Journals (Sweden)

Burić Mirjana V.

2012-01-01

Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.

Orthodontic management of buccally erupted ectopic canine with two case reports

Directory of Open Access Journals (Sweden)

Avesh Sachan

2012-01-01

Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.

Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel

International Nuclear Information System (INIS)

Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.

2005-01-01

Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old

Canine parvovirus: current perspective.

Science.gov (United States)

Nandi, S; Kumar, Manoj

2010-06-01

Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.

Consequences of crown shortening canine teeth in Greenland sled dogs

DEFF Research Database (Denmark)

Kortegaard, H E; Anthony Knudsen, T; Dahl, S

2015-01-01

OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...

Dental anomalies associated with buccally- and palatally-impacted maxillary canines.

Science.gov (United States)

Sajnani, Anand K; King, Nigel M

2014-08-01

The aim of the present study was to determine the association of both buccally- and palatally-impacted canines with other dental anomalies. This retrospective study was conducted on a population of 533 southern Chinese children and adolescents who had impacted maxillary canines that had been treated in the Paediatric Dentistry and Orthodontics Clinic, Prince Philip Dental Hospital, The University of Hong Kong, Hong Kong. Descriptions of the impacted canine and other associated anomalies were obtained from the case notes and radiographs. Clinical photographs and study casts were used, where available. A total of 253 (47.5%) patients with impacted maxillary canines were diagnosed with other dental anomalies. Microdontia was the most frequently-occurring anomaly reported in these patients, with the maxillary lateral incisor the most commonly affected tooth. Other odontogenic anomalies that were associated with both buccally- and palatally-impacted canines included hypodontia, supernumerary teeth, transposition of other teeth, enamel hypoplasia, other impacted teeth, and dens invaginatus. Both buccally- and palatally-impacted canines were found to be associated with other odontogenic anomalies. © 2013 Wiley Publishing Asia Pty Ltd.

SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.

Science.gov (United States)

Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi

2017-10-01

Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.

Overexpression of vimentin in canine prostatic carcinoma

DEFF Research Database (Denmark)

Rodrigues, M M P; Rema, A; Gärtner, F

2011-01-01

Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....

Vaccines for Canine Leishmaniasis

Directory of Open Access Journals (Sweden)

Faeze Foroughi-Parvar

2014-01-01

Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

Upper canine inclination influences the aesthetics of a smile.

Science.gov (United States)

Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S

2015-02-01

This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.

Treatment modalities of palatal impacted canines

OpenAIRE

Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona

2012-01-01

Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...

Health of periodontal tissues and resorption status after orthodontic treatment of impacted maxillary canines.

Science.gov (United States)

Oz, A Z; Ciger, S

2018-03-01

The aim of the present study was to evaluate the changes of incisor root resorption associated with impacted maxillary canines and health of periodontal tissues around maxillary canines erupted with orthodontic treatment. Twenty patients with a unilateral palatally impacted maxillary canine were included in the study. Cone-beam computed tomography images taken before and after orthodontic treatment were compared with the contralateral canines serving as control teeth. Root resorption was present in 10% of central and 40% of lateral incisors before treatment. After treatment, the incidence of resorption decreased. The thickness of the buccal bone surrounding the impacted canines was similar to that surrounding the contralateral canines, except in the apical area. Periodontal pocket depth and alveolar bone loss were greater for the impacted canine teeth than for the contralateral canines. Incisor root resorption associated with impacted canine teeth showed signs of repair after orthodontic treatment. Slight differences related to periodontal health were found between the previously impacted teeth and contralateral canine teeth.

Comprehensive characterization of commercially available canine training aids.

Science.gov (United States)

Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A

2014-09-01

Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine

The relationship between the Southern Oscillation Index, rainfall and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia.

Science.gov (United States)

Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P

2015-07-01

The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

Development of a Vaccine Incorporating Killed Virus of Canine Origin for the Prevention of Canine Parvovirus Infection

OpenAIRE

Povey, C.

1982-01-01

A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...

Evaluation of post-vaccination immunity to canine distemper and ...

African Journals Online (AJOL)

SERVER

2007-08-20

Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...

Canine as a biomedical research model: immunological, hematological, and oncological aspects

International Nuclear Information System (INIS)

Shifrine, M.; Wilson, F.D.

1980-01-01

The canine has been used as a biomedical research model in radiation studies by a number of laboratories supported primarily by the US Department of Energy and its predecessors. These studies were unique in that they covered the life spans of the canines and permitted the collection of data from birth to death under controlled conditions. Since these were multiparametric studies, an extensive data base has been established, not the least of which are normative values covering all biologic systems, including immunohematology. The canine model has also been extensively used by other groups, such as transplantation biologists. The virtues of the canine as a model in these and many other endeavors are becoming increasingly more apparent with the passing of time. One of the primary goals of this volume was to compile the knowledge and experience of researchers using the canine model and to focus their expertise on furthering the use of the canine for studies in immunology, hematology, and oncology. We have attempted to present some of the contemporary, diverse uses of the canine in biomedical research, emphasizing immunologic endpoints, and also to present in detail some of the latest technology used in such studies

Molecular detection of canine parvovirus in flies (Diptera) at open and closed canine facilities in the eastern United States.

Science.gov (United States)

Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan

2014-06-01

More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year

Identification of quantitative trait loci (QTL for canine hip dysplasia and canine elbow dysplasia in Bernese mountain dogs.

Directory of Open Access Journals (Sweden)

Sophia Pfahler

Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.

Feeding ecology and morphology of the upper canines in bears (carnivora: Ursidae).

Science.gov (United States)

Christiansen, Per

2008-07-01

The morphology and mechanical strength of the upper canines in all eight extant species of ursids is analyzed, and the findings are discussed in relation to feeding ecology. Ursids have proportionally smaller canines than other large carnivores with a specialized feeding ecology, such as large felids, and the upper canine morphology is both canid-like and felid-like. The giant panda is the most divergent species, and its short, blunt, and cone-like canines appear well adapted for tearing into bamboo. The almost equally herbivorous spectacled bear has a less derived canine morphology. The large canines of the sun bear are divergent from other ursine ursids, and may be an adaptation for tearing open tree trunks in search of insects. Discriminant Analysis is successful in separating ursid species on the basis of canine morphology, but the canines of ursine ursids, and also of the spectacled bear, show greater resemblance among the species than the marked differences in feeding ecology would suggest. This could be in part due to a short evolutionary history, and in part due to canines not having been subjected to much evolutionary selection as has been the case among other large carnivores, such as large felids. Ursids are probably evolutionarily and ecologically successful due to physical size and strength rather than a derived craniodental anatomy. Copyright 2008 Wiley-Liss, Inc.

Canine length in wild male baboons: maturation, aging and social dominance rank.

Directory of Open Access Journals (Sweden)

Jordi Galbany

Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.

Effects of body weight on antibody titers against canine parvovirus type 2, canine distemper virus, and canine adenovirus type 1 in vaccinated domestic adult dogs.

Science.gov (United States)

Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki

2012-10-01

The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.

IQGAP1 is an oncogenic target in canine melanoma.

Directory of Open Access Journals (Sweden)

Becky H Lee

Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.

Expression and function of survivin in canine osteosarcoma.

Science.gov (United States)

Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H

2012-01-01

Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.

American Canine Hepatozoonosis

Science.gov (United States)

Ewing, S. A.; Panciera, R. J.

2003-01-01

American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294

National clinical guidelines for management of the palatally ectopic maxillary canine.

Science.gov (United States)

Husain, J; Burden, D; McSherry, P; Morris, D; Allen, M

2012-08-01

This review summarises updated clinical guidelines produced by the Clinical Standards Committee of the Faculty of Dental Surgery, Royal College of Surgeons of England (FDSRCS). This guideline on the management of the palatally ectopic maxillary canine illustrates the information contained in the recently updated online version. The timely recognition of ectopic canines is important for the overall management of the dentition. This review illustrates five management strategies for ectopic permanent canines: interceptive treatment by extraction of the deciduous canine, surgical exposure and orthodontic alignment, surgical removal of the palatally ectopic permanent canine, auto-transplantation and no active treatment/leave and observe. The current available evidence for each of these management options has been evaluated and awarded a grade used by the Scottish Intercollegiate Guidelines Network.

Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report.

Science.gov (United States)

Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka

2016-07-01

Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.

Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.

Directory of Open Access Journals (Sweden)

Emily J Shields

Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.

Severe canine distemper outbreak in unvaccinated dogs in Mozambique

Directory of Open Access Journals (Sweden)

Julieta Zacarias

2016-07-01

Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

Management of an Unusual Ectopic Eruption of Maxillary Canine.

Science.gov (United States)

Aileni, Kaladhar Reddy; Rachala, Madhukar Reddy; Prathima, Chintakunta Reddy; Naveen, Pitalla Kumar; Soujanya, Donthula

2017-05-01

Transposition of teeth is a rare condition, with a prevalence of 0.3-0.4% in general population. They are more commonly observed in females, and may occur unilaterally/bilaterally with greater frequency of left side occurrence in unilateral transposition cases. A 17-year-old female patient reported with the chief complaint of unaesthetic smile. On clinical examination the patient was diagnosed with Angle's class I malocclusion with an ectopically erupted maxillary left canine labial to the left central incisor with retained deciduous canine. The treatment plan decided was to extract the retained deciduous canine, level and align the ectopic canine using an R-loop. The treatment for the patient was finished in 14 months and was retained using a fixed lingual retainer in the upper and lower arches.

Cardiac involvement in canine babesiosis : review article

Directory of Open Access Journals (Sweden)

R.G. Lobetti

2005-06-01

Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.

The Ondersteport Canine distemper virus strain and measles ...

African Journals Online (AJOL)

Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...

Management of an impacted and transposed maxillary canine

Directory of Open Access Journals (Sweden)

Deepti A

2010-03-01

Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.

Aspects and clinical procedures of eruptive changes of permanent upper canines

Directory of Open Access Journals (Sweden)

Sheila Marcia Francisco

2012-04-01

Full Text Available INTRODUCTION: Even though the upper canine is the tooth that presents most eruption anomalies, after the third molars, canine retention prevalence in the population is quite low. Local, physiologic and pathologic factors can provide difficulties for the tooth eruptive process. The correct diagnosis in trying to prevent upper canine retention with ectopic eruption is fundamental to choose the ideal treatment, which can be performed by various methods. OBJECTIVE: The present paper has the purpose of approaching aspects related to impacted upper permanent canines by a literature review, including localization and treatment conducts.

A randomized clinical study of two interceptive approaches to palatally displaced canines.

Science.gov (United States)

Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela

2008-08-01

This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.

Binding of 125I-labeled endotoxin to bovine, canine, and equine platelets and endotoxin-induced agglutination of canine platelets

International Nuclear Information System (INIS)

Meyers, K.M.; Boehme, M.; Inbar, O.

1982-01-01

Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using 125 I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed

Morphology of palatally impacted canines: A case-controlled cone-beam volumetric tomography study.

Science.gov (United States)

Hettiarachchi, Pilana Vithanage Kalani Shihanika; Olive, Richard John; Monsour, Paul

2017-02-01

The aim of this study was to investigate the relationships between an apical curvature or a hook and the crown/root ratio in subjects with and without palatally impacted maxillary canines. An experimental group of 44 patients (17 boys, 27 girls; mean age, 13.6 years) with 59 palatally impacted maxillary canines was selected from the records of patients referred to a radiology practice for cone-beam imaging. If a patient had bilateral palatally impacted canines, 1 canine was randomly selected for analysis. The palatally impacted canine group was matched for age and sex with 49 normal subjects (25 boys, 24 girls; mean age, 13.2 years) with 98 canines. Cone-beam DICOM files were imported into In Vivo imaging software (version 5.3; Anatomage, San Jose, Calif) for analysis. The angulations and linear variables of the maxillary canines were measured by using the software measurement tools. Chi-square and independent t tests were used to test for differences between the groups. The presence of a hook at the apical third and other root curvature were significantly different between the 2 groups (P <0.001 and P <0.05, respectively). Of the 44 palatally impacted canines, 16 (36.4%) had an apical hook and only 1 canine in the control group had an apical hook (1.0%). The mean root length of the palatally impacted canines was 2.66 mm shorter (P <0.001), and the mean crown/root ratio was significantly greater for the palatally impacted canines compared with the nonimpacted group (P <0.001). Palatally impacted canines have a greater tendency to develop apical hooks and are less likely to develop other root curvatures than are nonimpacted canines. Also, they have shorter roots resulting in larger crown/root ratios compared with the control group. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

Canine detection of free-ranging brown treesnakes on Guam

Science.gov (United States)

Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.

2011-01-01

We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.

Cryopreservation of microencapsulated canine sperm.

Science.gov (United States)

Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu

2011-03-01

The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.

Three-year rabies duration of immunity in dogs following vaccination with a core combination vaccine against canine distemper virus, canine adenovirus type-1, canine parvovirus, and rabies virus.

Science.gov (United States)

Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

2006-01-01

Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.

Management of impacted all canines with surgical exposure and alignment by orthodontic treatment

Directory of Open Access Journals (Sweden)

Radha Katiyar

2013-01-01

Full Text Available Canine impaction is a dental problem very often encountered in orthodontic practice. After the third molar, the canine is the most frequently impacted tooth. Bringing the impacted canine into a normal position is important for functional occlusion and the final esthetics of the orthodontic treatment. This article illustrates a peculiar case, in which all four permanent canines maintained their unerupted status at age of 16 years. All four impacted canines were surgically exposed, attachment bonded, traction given with K-9 spring and ideally positioned with fixed orthodontic mechanotherapy.

FLT3 mutations in canine acute lymphocytic leukemia

International Nuclear Information System (INIS)

Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L

2011-01-01

FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias

Vaccine-induced canine distemper in a lesser panda.

Science.gov (United States)

Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J

1976-11-01

A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.

Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

International Nuclear Information System (INIS)

Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.

1974-01-01

Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

Canine hip dysplasia: significance of early bony spurring

International Nuclear Information System (INIS)

Morgan, J.P.

1987-01-01

It is the purpose of this study to call attention to new bone production that often occurs early in the sequence of pathological changes associated with canine hip dysplasia. New bone production extending to bony remodeling, as well as femoral head subluxation, both occur in the sequence of pathologic changes associated with canine hip dysplasia. Subluxation is considered primary, while osteoarthrosis is a secondary feature, and both are used in the diagnosis of canine hip dysplasia. This report concerns the significance of the presence of a solitary bony osteophyte, or spur, that is frequently evident on the caudal aspect of the femoral neck as viewed on the conventional ventrodorsal projection. This report utilizes findings from pelvic radiographs of 605 dogs (five breeds). There was a greater frequency (54%)of this bony change in cases diagnosed radiographically as dysplastic than in cases diagnosed as normal(15%).Thus, it is suggested that this minimal radiographic change can be used as an indicator of early canine hip dysplasia, especially in the absence of subluxation of the femoral head

Radiographic assessment of dental anomalies in patients with ectopic maxillary canines

DEFF Research Database (Denmark)

Sørensen, Helle Budtz; Artmann, Lone; Larsen, Helle Juul

2008-01-01

dental deviations in cases with either palatal or labial ectopic canines. Design. Panoramic and intra-oral radiographs from 50 patients with palatally located (38 females and 12 males) and 19 patients with labially located ectopic canines (11 females and 8 males), aged 10 years, 2 months-18 years, 1...... month, were analysed. Dental deviations registered were crown and root malformations, agenesis, and eruption deviations. Registrations were performed in the maxillary incisor field and in the dentition in general. Results. The study documented that palatally as well as labially located ectopic canines...... can occur in dentitions without other dental deviations. Dental deviations occurred in approximately two-thirds of all cases, more often in females and in cases with palatally located canines. More than half of the females with palatally located canines had deviations in the maxillary incisors...

Canine Babesiosis in China Caused by Babesia gibsoni: A Molecular Approach.

Directory of Open Access Journals (Sweden)

Da-Wei Yao

2014-06-01

Full Text Available To provide a point of reference to study the epidemiology and clinical expression of canine babesiosis in China.A total of 30 dogs infected with canine babesiosis were evaluated by mean of clinical history, physical examination, hematological, restriction fragment length polymorphism of PCR products (PCR-RFLP and sequencing analysis.The most prevalent clinical abnormalities were lethargy (100%, anorexia (100%, pale or icteric mucous membranes (80%, fever (70% and dark urine (70%. Hematology parameters revealed that anemia and thrombocytopenia were the major abnormalities in blood of dogs infected with canine babesia. The results of PCR-RFLP and sequencing analysis indicated that B. gibsoni was the main species responsible for canine babesiosis cases at the time of the study in Nanjing, China.The results provide valuable information for better understanding of the epidemiology of canine babesiosis in China.

The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D

Directory of Open Access Journals (Sweden)

MarkéŽta Vaňkov‡á

2016-01-01

Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.

Orthodontic-surgical treatment of bilateral maxillary canine impaction

Directory of Open Access Journals (Sweden)

Sumitra

2012-01-01

Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.

Prostate histotripsy for BPH: initial canine results

Science.gov (United States)

Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.

2009-02-01

Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.

Difficulties in estimating the human burden of canine rabies.

Science.gov (United States)

Taylor, Louise H; Hampson, Katie; Fahrion, Anna; Abela-Ridder, Bernadette; Nel, Louis H

2017-01-01

Current passive surveillance data for canine rabies, particularly for the regions where the burden is highest, are inadequate for appropriate decision making on control efforts. Poor enforcement of existing legislation and poor implementation of international guidance reduce the effectiveness of surveillance systems, but another set of problems relates to the fact that canine rabies is an untreatable condition which affects very poor sectors of society. This results in an unknown, but potentially large proportion of rabies victims dying outside the health system, deaths that are unlikely to be recorded by surveillance systems based on health center records. This article critically evaluates the potential sources of information on the number of human deaths attributable to canine rabies, and how we might improve the estimates required to move towards the goal of global canine rabies elimination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Binding of /sup 125/I-labeled endotoxin to bovine, canine, and equine platelets and endotoxin-induced agglutination of canine platelets

Energy Technology Data Exchange (ETDEWEB)

Meyers, K.M.; Boehme, M.; Inbar, O.

1982-10-01

Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.

Headspace concentrations of explosive vapors in containers designed for canine testing and training: theory, experiment, and canine trials.

Science.gov (United States)

Lotspeich, Erica; Kitts, Kelley; Goodpaster, John

2012-07-10

It is a common misconception that the amount of explosive is the chief contributor to the quantity of vapor that is available to trained canines. In fact, this quantity (known as odor availability) depends not only on the amount of explosive material, but also the container volume, explosive vapor pressure and temperature. In order to better understand odor availability, headspace experiments were conducted and the results were compared to theory. The vapor-phase concentrations of three liquid explosives (nitromethane, nitroethane and nitropropane) were predicted using the Ideal Gas Law for containers of various volumes that are in use for canine testing. These predictions were verified through experiments that varied the amount of sample, the container size, and the temperature. These results demonstrated that the amount of sample that is needed to saturate different sized containers is small, predictable and agrees well with theory. In general, and as expected, once the headspace of a container is saturated, any subsequent increase in sample volume will not result in the release of more vapors. The ability of canines to recognize and alert to differing amounts of nitromethane has also been studied. In particular, it was found that the response of trained canines is independent of the amount of nitromethane present, provided it is a sufficient quantity to saturate the container in which it is held. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Display of neutralizing epitopes of Canine parvovirus and a T-cell epitope of the fusion protein of Canine distemper virus on chimeric tymovirus-like particles and its use as a vaccine candidate both against Canine parvo and Canine distemper.

Science.gov (United States)

Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar

2009-12-10

Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.

Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough).

Science.gov (United States)

Glickman, L T; Appel, M J

1981-08-01

Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.

Current practices and research updates on diabetes mellitus in canine

Directory of Open Access Journals (Sweden)

Pankaj Kumar

2014-11-01

Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.

Eruption of the maxillary canines in relation to skeletal maturity.

Science.gov (United States)

Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica

2008-05-01

Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.

Citizen science: a new direction in canine behavior research.

Science.gov (United States)

Hecht, Julie; Spicer Rice, Eleanor

2015-01-01

Researchers increasingly rely on members of the public to contribute to scientific projects-from collecting or identifying, to analyzing and disseminating data. The "citizen science" model proves useful to many thematically distinctive fields, like ornithology, astronomy, and phenology. The recent formalization of citizen science projects addresses technical issues related to volunteer participation--like data quality--so that citizen scientists can make longstanding, meaningful contributions to scientific projects. Since the late 1990s, canine science research has relied with greater frequency on the participation of the general public, particularly dog owners. These researchers do not typically consider the methods and technical issues that those conducting citizen science projects embrace and continue to investigate. As more canine science studies rely on public input, an in-depth knowledge of the benefits and challenges of citizen science can help produce relevant, high-quality data while increasing the general public's understanding of canine behavior and cognition as well as the scientific process. We examine the benefits and challenges of current citizen science models in an effort to enhance canine citizen science project preparation, execution, and dissemination. This article is part of a Special Issue entitled: Canine Behavior. Copyright © 2014 Elsevier B.V. All rights reserved.

Antiviral effect of lithium chloride on infection of cells by canine parvovirus.

Science.gov (United States)

Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun

2015-11-01

Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.

Age estimation by canines' pulp/tooth ratio in an Iranian population using digital panoramic radiography.

Science.gov (United States)

Dehghani, Mahdieh; Shadkam, Elaheh; Ahrari, Farzaneh; Dehghani, Mahboobe

2018-04-01

Age estimation in adults is an important issue in forensic science. This study aimed to estimate the chronological age of Iranians by means of pulp/tooth area ratio (AR) of canines in digital panoramic radiographs. The sample consisted of panoramic radiographs of 271 male and female subjects aged 16-64 years. The pulp/tooth area ratio (AR) of upper and lower canines was calculated by AutoCAD software. Data were subjected to correlation and regression analysis. There was a significant and inverse correlation between age and pulp/tooth area ratio of upper and lower canines (r=-0.794 for upper canine and r=-0.282 for lower canine; p-value<0.001). Linear regression equations were derived separately for upper, lower and both canines. The mean difference between actual and estimated age using upper canine was 6.07±1.7. The results showed that the pulp/tooth area ratios of canines are a reliable method for age estimation in Iranians. The pulp/tooth area ratio of upper canine was better correlated with chronological age than that of lower canine. Copyright © 2018 Elsevier B.V. All rights reserved.

Ultrasonographic evaluation of the canine shoulder.

Science.gov (United States)

Long, C D; Nyland, T G

1999-01-01

The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.

The Comparative Diagnostic Features of Canine and Human Lymphoma

Directory of Open Access Journals (Sweden)

Davis M. Seelig

2016-06-01

Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

The Comparative Diagnostic Features of Canine and Human Lymphoma.

Science.gov (United States)

Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A

2016-06-01

The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

Establishment of sexual dimorphism in north indian population by odontometric study of permanent maxillary canine teeth

Directory of Open Access Journals (Sweden)

Shalini Gupta

2014-01-01

Full Text Available Aim: To investigate whether sexual dimorphism can be established by odontometric study of permanent maxillary canine teeth as well as inter-canine width in north Indian population. Study Design: The study was carried out at department of oral and maxillofacial pathology, King George′s Medical University, Lucknow, India on students and patients reporting at OPD. Out of total 180 subjects examined 90 subjects were female and 90 were male. Impressions of the upper arch were made using alginate and casts poured in dental stone. The mesiodistal diameter (MD of the crown of permanent maxillary canine both on right and left sides and inter-canine width were measured. From these measurements, maxillary canine index was calculated. The percentage of sexual dimorphism (SD was assessed for all the parameters. Results: In the present study, the MD of maxillary canine for both right (P = 0.001 and left side (P = 0.005 was significantly higher among male subjects than females, Similar observation was found for inter-canine width too (P = 0.0001. However, the maxillary canine index for right and left was almost similar (P > 0.05 for both male and female subjects. The SD in right and left MDs of maxillary canine was 4.2% and 3.6% respectively. For, inter-canine width it was maximum (13.7%. However, SD in right and left canine index showed negative values (−2.1% and -0.9% respectively. Conclusion: There was SD in MD and inter-canine width of permanent maxillary canine teeth. SD was more on right permanent maxillary canine teeth than left permanent maxillary canine.

[Nonsurgical endodontic treatment of an invaginated canine].

Science.gov (United States)

Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P

1989-01-01

We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.

Canine babesiosis: from molecular taxonomy to control

Directory of Open Access Journals (Sweden)

Irwin Peter J

2009-03-01

Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

Genetic characterization of canine influenza A virus (H3N2) in Thailand.

Science.gov (United States)

Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn

2014-02-01

In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.

Glucosamine and chondroitin use in canines for osteoarthritis: A ...

African Journals Online (AJOL)

Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...

A case of unusual root morphology: Maxillary canine with two roots

Directory of Open Access Journals (Sweden)

Nagesh Bolla

2009-01-01

Full Text Available The case describes a 3 months follow-up of the treatment of a maxillary canine with two roots. Clinical examination revealed a maxillary canine with a large carious lesion and an exaggerated response to cold thermal tests. Radiographic examination revealed a large distal carious lesion that appeared to invade the pulp chamber. The radiograph also revealed what appeared to be an extra root in this permanent maxillary canine.

Purification and partial characterization of canine S100A12.

Science.gov (United States)

Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M

2010-12-01

Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the

Impacted maxillary canines and root resorption of adjacent teeth: A retrospective observational study.

Science.gov (United States)

Guarnieri, R; Cavallini, C; Vernucci, R; Vichi, M; Leonardi, R; Barbato, E

2016-11-01

The prevalence of impacted maxillary canine is reported to be between 1% and 3%. The lack of monitoring and the delay in the treatment of the impacted canine can cause different complications such as: displacement of adjacent teeth, loss of vitality of neighbouring teeth, shortening of the dental arch, follicular cysts, canine ankylosis, recurrent infections, recurrent pain, internal resorption of the canine and the adjacent teeth, external resorption of the canine and the adjacent teeth, combination of these factors. An appropriate diagnosis, accurate predictive analysis and early intervention are likely to prevent such undesirable effects. The objective is to evaluate, by means of a retrospective observational study, the possibility of carrying out a predictive analysis of root resorption adjacent to the impacted canines by means of orthopantomographs, so as to limit the prescription of additional 3D radiography. 120 subjects with unilateral or bilateral maxillary impacted canine were examined and 50 patients with 69 impacted maxillary canine (22 male, 28 female; mean age: 11.7 years) satisfied the inclusion criteria of the study. These patients were subjected to a basic clinical and radiographic investigation (orthopantomographs and computerized tomography). All panoramic films were viewed under standardized conditions for the evaluation of two main variables: maxillary canine angulations (a, b, g angles) and the overlapping between the impacted teeth and the lateral incisor (Analysis of Lindauer). Binary logistic regression was used to estimate the likelihood of resorbed lateral incisors depending on sector location and angle measurements. Results indicated that b angle has the greatest influence on the prediction of root resorption (predictive value of b angle = 76%). If β angle <18° and Lindauer = I, the probability of resorption is 0.06. Evaluation of b angle and superimposition lateral incisor/impacted canine analysed on orthopantomographs could be one of

Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.

Science.gov (United States)

von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H

2008-05-01

Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.

Orthodontic Traction of Impacted Canine Using Cantilever

OpenAIRE

Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé

2016-01-01

The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...

Comparison of the dental anomalies found in maxillary canine-first premolar transposition cases with those in palatally displaced canine cases.

Science.gov (United States)

Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon

2016-02-01

To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Detection of canine pneumovirus in dogs with canine infectious respiratory disease.

Science.gov (United States)

Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe

2013-12-01

Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.

Oncolytic virotherapy in veterinary medicine: current status and future prospects for canine patients

Directory of Open Access Journals (Sweden)

Patil Sandeep S

2012-01-01

Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.

Vertical periodontal ligament distraction--a new method for aligning ankylosed and displaced canines.

Science.gov (United States)

Wilmes, Benedict; Drescher, Dieter

2009-05-01

In the course of a clinical pilot study we tested the vertical periodontal ligament (V-PDL) distraction as a means of aligning ankylosed upper canines. The objective of this study was to analyze the appropriateness und effectiveness of this method. The ankylosed upper canines of five female patients aged between 16 und 19 years were surgically exposed, luxated, and after a latency period of 5 to 7 days, distracted at a rate of 0.5 mm per day. The installed distractors were borne by the periodontal-mucosa, the periodontal-mucosa and the bone, or by the bone exclusively. We evaluated the distraction distance and time and degree of hard and soft tissue generation present in the region surrounding the distracted teeth. All canines were aligned after a mean distraction period of 43.2 days (+/- 3.6 days). The mean distraction distance was 10.8 mm. Three canines had defects at the cemento-enamel junction, and one canine had to be extracted due to a large defect at the root. Vertical PDL distraction is a minimally-invasive therapy to align ankylosed impacted canines. Even if the long-term prognosis of distracted canines with defects is uncertain, the patient benefits from the vertical PDL distraction because both hard and soft tissues are generated in the vicinity of the distracted canine.

Genetics of Human and Canine Dilated Cardiomyopathy

OpenAIRE

Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland

2015-01-01

Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...

Orthodontic treatment of a complete transposed impacted maxillary canine

Directory of Open Access Journals (Sweden)

Pi-Huei Liu

2015-03-01

Full Text Available Tooth transposition is a positional interchange of two adjacent teeth. Transposition most often occurs at maxillary canine. Moving transposed teeth to their normal positions is challenging because this requires bodily movement and translation of one tooth to pass another. This procedure may cause damage to the teeth or supporting structures. We report a case of complete transposition of maxillary canine and lateral incisor. Transposed teeth were successfully moved orthodontically to their normal positions. Multiple mechanics were meticulously applied to achieve complete correction of the tooth positions and to minimize root resorption and/or periodontal defects of canine and lateral incisors. Factors concerning treatment planning for transposed teeth are discussed.

Tooth fractures in canine clinical practice

International Nuclear Information System (INIS)

Capik, I.; Ledecky, V.; Sevcik, A.

2001-01-01

Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients

Canine faecal contamination and parasitic risk in the city of Naples (southern Italy

Directory of Open Access Journals (Sweden)

Veneziano Vincenzo

2006-09-01

Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between

Current state of knowledge: the canine gastrointestinal microbiome.

Science.gov (United States)

Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S

2012-06-01

Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.

Molecular and serological surveillance of canine enteric viruses in stray dogs from Vila do Maio, Cape Verde.

Science.gov (United States)

Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis

2014-04-23

Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from

Molecular surveillance of traditional and emerging pathogens associated with canine infectious respiratory disease.

Science.gov (United States)

Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio

2016-08-30

A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.

Comparison of canine retraction using single and Siamese edgewise brackets: An in vivo study

Directory of Open Access Journals (Sweden)

Zeeshan Iqbal Bhat

2013-01-01

Full Text Available Objectives: The purpose of this study was to check the rate of canine retraction with bodily mechanics using two different pre-adjusted edgewise bracket Systems. Materials and Methods: A split mouth study with twenty patients who were randomly selected and allotted to a single operator. Duration of canine retraction, angulation of canine during its retraction, degree of Rotation, anchorage Loss, distance between canine and premolar at different time intervals were then evaluated, pre- (To, 3 months- (T1 and canine tip touches the second premolar- (T2. Descriptive statistics including mean values and standard deviations were calculated. Paired and unpaired t-test was performed to evaluate the differences between the groups. Results: Rotation and angulation of the canines did not show significant difference in both the systems. There was statistically significant difference (P<0.01 in anchorage loss between single wing and Siamese bracket being 2.65 ±1.41 mm and 1.31 ± 0.93 respectively. There was statistically significant intergroup difference (P<0.01 in canine movement i.e distance between canine and premolar was recorded as 4.72mm (15.06 ± 1.69 to 10.34 ± 1.68mm in single wing bracket and 6.25mm in Siamese (15.52 ± 1.41 to 9.27 ± 1.94. Conclusion: In cases where high anchorage is required and the rate of canine retraction is a concern, Siamese brackets pose a definite advantage over Single wing brackets.

Validation of anti-FXR1 antibodies in the canine species and application to an immunohistochemical study of canine oral melanomas

Directory of Open Access Journals (Sweden)

Laura Nordio

2017-05-01

Full Text Available FXR1 (Fragile X mental retardation-related protein 1 is a cytoplasmic RNA binding protein, which genetic expression has been related to metastatic potential in human melanoma. The aims of the present study were: the validation of two commercially available clones of polyclonal anti-human FXR1 antibody in dogs; their application to investigate FXR1 expression in a group of canine oral melanomas. Anti-FXR1 antibody was not previously validated in the canine species. Two different commercially available polyclonal anti-FXR1 antibodies (respectively made in goat and in rabbit were used. FXR1 protein in canine serum was identified by western blot after SDS-PAGE, using human serum as control. FXR1 immunohistochemical expression was tested in a series of normal tissues, that are expected to express FXR1, and in 31 cases of oral melanomas. The final immunohistochemical protocol used heat-induced unmasking and overnight incubation. FXR1 protein bands in canine serum were detected by tested antibodies, in a more specific way by the rabbit antibody. FXR1 immunohistochemical staining was positive in all tested organs, with different levels of expression. FXR1 was also expressed in 31/31 tested melanomas, with variable intensity and percentage of positive cells (Figure 1. Equal results were achieved with the two antibodies in 8 cases of melanoma, whereas there were variable differences in 22, and one case stained only with goat antibody. The rabbit antibody gave less background staining. This study validated anti-FXR1 antibodies for use in the canine species. This protein was expressed in various normal tissues, as well as in the tested neoplasms. Significance of different level of expression is undergoing evaluation with further studies.

Models of experimental saccular aneurysms of carotid arteries in canine

International Nuclear Information System (INIS)

Zhang Haixia; Cheng Yingsheng; Li Minghua

2006-01-01

Objective: To study the availability by making experimental saccular aneurysm models of carotid arteries in canine similar to human intracranial aneurysms. Methods: Twenty healthy canines with experimental saccular side-wall aneurysms of carotid arteries were created successfully by surgery. Results: Forty experimental saccular side-wall aneurysms of carotid arteries were created successfully with 36 aneurysms and parent arteries maintaining patency with each other and four spontaneously occluded confirmed by angiography. Model successful rate reached 90%. Conclusions: Experimental saccular side-wall aneurysms of carotid arteries in canines were one of best models created for simulating human intracranial aneurysms. (authors)

Testosterone biotransformation by the isolated perfused canine pancreas

International Nuclear Information System (INIS)

Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G.

1991-01-01

There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis

Testosterone biotransformation by the isolated perfused canine pancreas

Energy Technology Data Exchange (ETDEWEB)

Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))

1991-01-01

There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.

Influence of feeding on serum canine pancreatic lipase immunoreactivity concentrations

Directory of Open Access Journals (Sweden)

Steiner JM

2014-10-01

Full Text Available Jörg M Steiner, Craig G Ruaux, David A Williams Gastrointestinal Laboratory, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, USA Abstract: Measurement of serum concentration of pancreatic lipase immunoreactivity (PLI has been shown to be highly specific for exocrine pancreatic function and sensitive for the diagnosis of canine pancreatitis. Currently, it is recommended that food be withheld for at least 12 hours before collecting a blood sample for analysis from dogs. However, it is unknown whether feeding has any influence on serum canine PLI concentration. Thus, the goal of this study was to evaluate the influence of feeding on serum canine PLI concentrations in healthy dogs. Food was withheld from eight healthy adult Beagle dogs for at least 17 hours and a baseline serum sample (0 minutes was collected. Dogs were fed and serum samples were collected at 15, 30, 45, 60, 75, 90, 105, 150, 180, 210, 240, 300, 360, 420, and 480 minutes. There was no significant difference in serum canine PLI concentrations at any time after feeding (P=0.131. We conclude that feeding has no significant influence on serum canine PLI concentrations. Keywords: dog, pancreatic function, pancreatitis, biomarker, diagnostic test

Alkaline phosphatase activity in gingival crevicular fluid during canine retraction.

Science.gov (United States)

Batra, P; Kharbanda, Op; Duggal, R; Singh, N; Parkash, H

2006-02-01

The aim of the study was to investigate alkaline phosphatase activity in the gingival crevicular fluid (GCF) during orthodontic tooth movement in humans. Postgraduate orthodontic clinic. Ten female patients requiring all first premolar extractions were selected and treated with standard edgewise mechanotherapy. Canine retraction was done using 100 g sentalloy springs. Maxillary canine on one side acted as experimental site while the contralateral canine acted as control. Gingival crevicular fluid was collected from mesial and distal of canines before initiation of canine retraction (baseline), immediately after initiation of retraction, and on 1st, 7th, 14th and 21st day and the alkaline phosphatase activity was estimated. The results show significant (p < 0.05) changes in alkaline phosphatase activity on the 7th, 14th and 21st day on both mesial and distal aspects of the compared experimental and control sides. The peak in enzyme activity occurred on the 14th day of initiation of retraction followed by a significant fall in activity especially on the mesial aspect. The study showed that alkaline phosphatase activity could be successfully estimated in the GCF using calorimetric estimation assay kits. The enzyme activity showed variation according to the amount of tooth movement.

Orthodontic-surgical treatment of bilateral maxillary canine impaction

OpenAIRE

Sumitra

2012-01-01

A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle's Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth an...

Development of a Vaccine Incorporating Killed Virus of Canine Origin for the Prevention of Canine Parvovirus Infection

Science.gov (United States)

Povey, C.

1982-01-01

A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted form was immunogenic in 20 of 20 vaccinated dogs. The double adjuvanted vaccine is selected as the one of choice on the basis of best and most persistent seriological response. PMID:7039811

MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.

Science.gov (United States)

Lopez, Cecilia M; Yu, Peter Y; Zhang, Xiaoli; Yilmaz, Ayse Selen; London, Cheryl A; Fenger, Joelle M

2018-01-01

Osteosarcoma (OSA) is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease. RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes. These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.

MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.

Directory of Open Access Journals (Sweden)

Cecilia M Lopez

Full Text Available Osteosarcoma (OSA is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease.RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes.These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.

Homologous radioimmunoassay for canine prolactin and its application in various physiological states

International Nuclear Information System (INIS)

Graef, K.-J.; Friedreich, E.; Matthes, S.; Hasan, S.H.

1977-01-01

The purification of canine prolactin and the development of an homologous radioimmunoassay including several physiological studies in the Beagle dog are described. The assay measured immunoreactive canine prolactin with a sensitivity limit of 0.6 ng/ml. Purified canine luteinizing hormone gave no significant inhibition in the assay whereas purified canine growth hormone inhibited the binding of 125 I-labelled canine prolactin to antiserum only at very high dose levels. In Beagle dogs, basal serum prolactin concentrations were in the range 1 to 2 ng/ml in normal male, normal female (metoestrus and anoestrus) and oophorectomized-hysterectomized female dogs. The prolactin concentration in one sample of amniotic fluid was in the same range, while in hypophysectomized make dogs no serum prolactin could be detected by the assay system. Serum prolactin concentrations tended to increase during late pregnancy and parturition, remaining high during the first 9 days of lactation. In consequence, a negative correlation was suggested between serum prolactin and serum progesterone concentrations. (author)

Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus

Directory of Open Access Journals (Sweden)

Lourdes M. B. Pessoa

2016-01-01

Full Text Available The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.

Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus)

OpenAIRE

Pessoa, Lourdes M. B.; Roza, Marcello; Farias, Anderson; Jesus, Pedro Henrique de; Campbell, Rita de Cassia; Pinho, Mariângela Pereira de

2016-01-01

The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.

PMab-38 Recognizes Canine Podoplanin of Squamous Cell Carcinomas.

Science.gov (United States)

Kaneko, Mika K; Honma, Ryusuke; Ogasawara, Satoshi; Fujii, Yuki; Nakamura, Takuro; Saidoh, Noriko; Takagi, Michiaki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

2016-10-01

Podoplanin, a type I transmembrane protein, is expressed in lymphatic endothelial cells. Although we previously developed an anticanine podoplanin monoclonal antibody (mAb), PMab-38, immunohistochemistry (IHC) showed that it did not react with canine lymphatic endothelial cells. Here, we determined whether PMab-38 recognizes canine podoplanin of squamous cell carcinomas (SCCs) and clarified its epitope. In IHC, PMab-38 reacted with 83% of SCCs (15/18 cases). Flow cytometry showed that the epitope of PMab-38 was different from that of the platelet aggregation-stimulating domain of the N-terminus, which was detected by almost all antipodoplanin mAbs such as D2-40 or NZ-1. PMab-38 is expected to be useful for investigating the function of podoplanin in canine tumors.

Severe canine distemper outbreak in unvaccinated dogs in Mozambique.

Science.gov (United States)

Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G

2016-07-15

Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.

[Biological characteristics of a chimeric rabies virus expressing canine parvovirus VP2 protein].

Science.gov (United States)

Niu, Xue-Feng; Liu, Xiao-Hui; Sun, Zhao-Jin; Shi, He-He; Chen, Jing; Jiang, Bido; Sun, Jing-Chen; Guo, Xiao-Feng

2009-09-01

To obtain a bivalence vaccine against canine rabies virus and canine parvovirus, a chimeric rabies virus expressing canine parvovirus VP2 protein was generated by the technique of reverse genetics. It was shown that the chimeric virus designated as HEP-Flury (VP2) grew well on BHK-21 cells and the VP2 gene could still be stably expressed after ten passages on BHK-21 cells. Experiments on the mice immunized with the chimeric virus HEP-Flury (VP2) demonstrated that specific antibodies against rabies virus and canine parvovirus were induced in immunized mice after vaccination with the live chimeric virus.

Cellular endocytic compartment localization of expressed canine CD1 molecules

DEFF Research Database (Denmark)

Schjærff, Mette; Keller, Stefan M.; Affolter, Verena K.

2016-01-01

CD1 molecules are glycoproteins present primarily on dendritic cells (DCs), which recognize and presenta variety of foreign- and self-lipid antigens to T-cells. Humans have five different CD1 isoforms that sur-vey distinct cellular compartments allowing for recognition of a large repertoire...... onlya diminished GFP expression. In conclusion, canine CD1 transfectants show distinct localization patternsthat are similar to human CD1 proteins with the exception of the canine CD1d isoform, which most likelyis non-functional. These findings imply that canine CD1 localization overall resembles human...... CD1 traf-ficking patterns. This knowledge is important for the understanding of lipid antigen-receptor immunityin the dog....

Canine Gouging: A Taboo Resurfacing in Migrant Urban Population.

Science.gov (United States)

Noman, Anila Virani; Wong, Ferranti; Pawar, Ravikiran Ramakrishna

2015-01-01

Cosmopolitan cities have become a pool of migrants from different parts of the world, who carry their cultural beliefs and superstitions with them around the globe. Canine gouging is a kind of infant oral mutilation (IOM) which is widely practiced among rural population of Africa where the primary tooth bud of the deciduous canine is enucleated. The belief is that the life threatening illnesses in children like vomiting, diarrhoea, and fevers are caused by worms which infest on tooth buds. This case report is of a 15-year-old Somalian born boy, who presented at the dental institute with intermittent pain in his lower right permanent canine which was associated with a discharging intra oral buccal sinus. The tooth was endodontically treated and then restored with composite. General dental practitioners need to be vigilant when encountered with tooth presenting unusual morphology, unilateral missing tooth, and shift in the midline due to early loss of deciduous/permanent canines. Identification of any such dental mutilation practice will need further counselling of the individual and family members. It is the duty of every dental professional to educate and safeguard the oral and dental health of general public.

Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines

Directory of Open Access Journals (Sweden)

Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman

2011-01-01

Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.

Orthodontic management of bilaterally impacted mandibular canines in a growing patient

Directory of Open Access Journals (Sweden)

Rajaganesh J Gautam

2016-01-01

Full Text Available KK, an 11.9-year-old male patient, presented with the chief complaint of forwardly placed upper front teeth. Diagnosis revealed a Class II subdivision right malocclusion on an underlying Class I skeletal base with a horizontal growth pattern, bimaxillary proclination, crowding in the lower arch, over retained deciduous canines in the upper right and lower quadrants, an unerupted maxillary right permanent canine, and bilaterally impacted mandibular permanent canines, an increased overjet, and a deep overbite. He had a mild convex profile, a toothy smile with a nonconsonant smile arc and mildly protrusive lips. Treatment with a nonextraction treatment plan, which included surgical uncovering and orthodontic eruptive guidance of the impacted mandibular canines, with multibracket metallic fixed appliances, solved the patient′s complaints and achieved an esthetically pleasing and functionally adequate occlusal result.

Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.

OpenAIRE

McMaster, G K; Tratschin, J D; Siegl, G

1981-01-01

The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.

Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus

Directory of Open Access Journals (Sweden)

Sudarisman

2006-03-01

Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.

Comparative photoelastic study of dental and skeletal anchorages in the canine retraction

Directory of Open Access Journals (Sweden)

Cristiane Aparecida de Assis Claro

2014-01-01

Full Text Available OBJECTIVE: To compare dental and skeletal anchorages in mandibular canine retraction by means of a stress distribution analysis. METHODS: A photoelastic model was produced from second molar to canine, without the first premolar, and mandibular canine retraction was simulated by a rubber band tied to two types of anchorage: dental anchorage, in the first molar attached to adjacent teeth, and skeletal anchorage with a hook simulating the mini-implant. The forces were applied 10 times and observed in a circular polariscope. The stresses located in the mandibular canine were recorded in 7 regions. The Mann-Whitney test was employed to compare the stress in each region and between both anchorage systems. The stresses in the mandibular canine periradicular regions were compared by the Kruskal-Wallis test. RESULTS: Stresses were similar in the cervical region and the middle third. In the apical third, the stresses associated with skeletal anchorage were higher than the stresses associated with dental anchorage. The results of the Kruskal-Wallis test showed that the highest stresses were identified in the cervical-distal, apical-distal, and apex regions with the use of dental anchorage, and in the apical-distal, apical-mesial, cervical-distal, and apex regions with the use of skeletal anchorage. CONCLUSIONS: The use of skeletal anchorage in canine retraction caused greater stress in the apical third than the use of dental anchorage, which indicates an intrusive component resulting from the direction of the force due to the position of the mini-implant and the bracket hook of the canine.

Permanent maxillary canines - review of eruption pattern and local etiological factors leading to impaction.

Science.gov (United States)

Sajnani, Anand K

2015-02-01

The position of the permanent maxillary canine at the angle of the mouth is strategically significant in maintaining the harmony and symmetry of the occlusal relationship. However, the maxillary canine is the second most frequently impacted tooth, with prevalence reported to be between 1% and 2%. Moreover, treatment of this condition is often complex and involves substantial time and financial cost. Hence, it is only prudent to monitor the eruption and identify the etiological factors that lead to impaction of the maxillary canine. Numerous researchers have tried to identify specific and nonspecific etiological factors responsible for displacement of canines. The purpose of this review was to track the development processes of maxillary canines and determine the hindrances that affect the eruption at different ages. Awareness of the eruption process and etiology of noneruption will help to reduce the incidence of impacted canines by allowing for early recognition and interceptive treatment. © 2013 Wiley Publishing Asia Pty Ltd.

Tumor microvessel density–associated mast cells in canine nodal lymphoma

Science.gov (United States)

Mann, Elizabeth; Whittington, Lisa

2014-01-01

Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4) was significantly higher (p < 0.05) than that in the control (0.83 ± 0.3) and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009). Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended. PMID:26770752

Tumor microvessel density–associated mast cells in canine nodal lymphoma

Directory of Open Access Journals (Sweden)

Moges Woldemeskel

2014-11-01

Full Text Available Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4 was significantly higher (p < 0.05 than that in the control (0.83 ± 0.3 and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009. Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended.

How far is the root apex of a unilateral impacted canine from the root apices' arch form?

Science.gov (United States)

Kim, Sung-Hun; Kim, You-Min; Oh, Sewoong; Kim, Seong-Sik; Park, Soo-Byung; Son, Woo-Sung; Kim, Yong-Il

2017-02-01

The purpose of this study was to determine the arch form of the root apices of normally erupting teeth and then determine the differences in the location of the apex of impacted canines relative to normally erupting canines. In addition, we sought to determine whether the labiopalatal position of the impacted canines influences the position of the apices. The study included 21 patients with unerupted canines that subsequently had a normal eruption, 21 patients with palatally impacted canines, 27 patients with labially impacted canines, and 17 patients with midalveolus impacted canines. Images were obtained using cone beam computed tomography, and the x, y, and z coordinates of the root apices were determined using Ondemand3D software (Cybermed Co., Seoul, Korea). Two-dimensional coordinates were converted from acquired 3-dimensional coordinates via projection on a palatal plane, and the Procrustes method was used to process the converted 2-dimensional coordinates and to draw the arch forms of the root apices. Finally, we measured the extent of root apex deviation from the arch forms of the root apices. Normally erupting canines showed that even though calcifications may be immature, their positions were aligned with a normal arch form. The root apices of the impacted canines were an average of 6.572 mm away from the root apices' arch form, whereas those of the contralateral nonimpacted canines were an average distance of 2.221 mm away, a statistically significant difference. The palatally impacted canines' root apices distribution tended toward the first premolar root apices. Incompletely calcified, unerupted teeth with a subsequent normal eruption showed a normal arch form of the root apices. The root apices of impacted canines were farther from the arch forms than were the nonimpacted canines. Also, the root apices of impacted canines in the palatal area showed distributions different from those of the other impacted canine groups. Copyright © 2017 American

The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.

Science.gov (United States)

Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki

2015-04-17

Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

Automated tru-cut imaging-guided core needle biopsy of canine ...

African Journals Online (AJOL)

The purpose of this study was to evaluate the diagnostic value of imaging-guided core needle biopsy for canine orbital mass diagnosis. A second excisional biopsy obtained during surgery or necropsy was used as the reference standard. A prospective feasibility study was conducted in 23 canine orbital masses at a single ...

Biochemical characterization of prostate-specific membrane antigen from canine prostate carcinoma cells.

Science.gov (United States)

Wu, Lisa Y; Johnson, Jacqueline M; Simmons, Jessica K; Mendes, Desiree E; Geruntho, Jonathan J; Liu, Tiancheng; Dirksen, Wessel P; Rosol, Thomas J; Davis, William C; Berkman, Clifford E

2014-05-01

Prostate-specific membrane antigen (PSMA) remains an important target for diagnostic and therapeutic application for human prostate cancer. Model cell lines have been recently developed to study canine prostate cancer but their PSMA expression and enzymatic activity have not been elucidated. The present study was focused on determining PSMA expression in these model canine cell lines and the use of fluorescent small-molecule enzyme inhibitors to detect canine PSMA expression by flow cytometry. Western blot and RT-PCR were used to determine the transcriptional and translational expression of PSMA on the canine cell lines Leo and Ace-1. An endpoint HPLC-based assay was used to monitor the enzymatic activity of canine PSMA and the potency of enzyme inhibitors. Flow cytometry was used to detect the PSMA expressed on Leo and Ace-1 cells using a fluorescently tagged PSMA enzyme inhibitor. Canine PSMA expression on the Leo cell line was confirmed by Western blot and RT-PCR, the enzyme activity, and flow cytometry. Kinetic parameters Km and Vmax of PSMA enzymatic activity for the synthetic substrate (PABGγG) were determined to be 393 nM and 220 pmol min(-1)  mg protein(-1) , respectively. The inhibitor core 1 and fluorescent inhibitor 2 were found to be potent reversible inhibitors (IC50  = 13.2 and 1.6 nM, respectively) of PSMA expressed on the Leo cell line. Fluorescent labeling of Leo cells demonstrated that the fluorescent PSMA inhibitor 2 can be used for the detection of PSMA-positive canine prostate tumor cells. Expression of PSMA on Ace-1 was low and not detectable by flow cytometry. The results described herein have demonstrated that PSMA is expressed on canine prostate tumor cells and exhibits similar enzymatic characteristics as human PSMA. The findings show that the small molecule enzyme inhibitors currently being studied for use in diagnosis and therapy of human prostate cancer can also be extended to include canine prostate cancer. Importantly

Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

International Nuclear Information System (INIS)

Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma

2006-01-01

Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs

Feline and canine coronaviruses: common genetic and pathobiological features.

Science.gov (United States)

Le Poder, Sophie

2011-01-01

A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP) and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV) will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma.

Science.gov (United States)

Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid

2016-01-01

Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma.

Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

1999-08-02

Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

Directory of Open Access Journals (Sweden)

Otávio Valério Carvalho

2012-01-01

Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.

Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

Science.gov (United States)

Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo

2012-01-01

Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403

Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia

Directory of Open Access Journals (Sweden)

Víctor Acero P

2015-09-01

Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.

Compensatory canine angulation in angle Class II and III patients

Directory of Open Access Journals (Sweden)

Mauro Carlos Agner Busato

2009-09-01

Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.

European surveillance of emerging pathogens associated with canine infectious respiratory disease.

Science.gov (United States)

Mitchell, Judy A; Cardwell, Jacqueline M; Leach, Heather; Walker, Caray A; Le Poder, Sophie; Decaro, Nicola; Rusvai, Miklos; Egberink, Herman; Rottier, Peter; Fernandez, Mireia; Fragkiadaki, Eirini; Shields, Shelly; Brownlie, Joe

2017-12-01

Canine infectious respiratory disease (CIRD) is a major cause of morbidity in dogs worldwide, and is associated with a number of new and emerging pathogens. In a large multi-centre European study the prevalences of four key emerging CIRD pathogens; canine respiratory coronavirus (CRCoV), canine pneumovirus (CnPnV), influenza A, and Mycoplasma cynos (M. cynos); were estimated, and risk factors for exposure, infection and clinical disease were investigated. CIRD affected 66% (381/572) of the dogs studied, including both pet and kennelled dogs. Disease occurrence and severity were significantly reduced in dogs vaccinated against classic CIRD agents, canine distemper virus (CDV), canine adenovirus 2 (CAV-2) and canine parainfluenza virus (CPIV), but substantial proportions (65.7%; 201/306) of vaccinated dogs remained affected. CRCoV and CnPnV were highly prevalent across the different dog populations, with overall seropositivity and detection rates of 47% and 7.7% for CRCoV, and 41.7% and 23.4% for CnPnV, respectively, and their presence was associated with increased occurrence and severity of clinical disease. Antibodies to CRCoV had a protective effect against CRCoV infection and more severe clinical signs of CIRD but antibodies to CnPnV did not. Involvement of M. cynos and influenza A in CIRD was less apparent. Despite 45% of dogs being seropositive for M. cynos, only 0.9% were PCR positive for M. cynos. Only 2.7% of dogs were seropositive for Influenza A, and none were positive by PCR. Copyright © 2017 Elsevier B.V. All rights reserved.

Canine obesity: an overview.

Science.gov (United States)

Gossellin, J; Wren, J A; Sunderland, S J

2007-08-01

Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.

Peracute Infectious Canine Hepatitis

Directory of Open Access Journals (Sweden)

A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam

2012-05-01

Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.

Radioresistant canine hematopoietic cells

International Nuclear Information System (INIS)

Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.

1987-01-01

Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells

Surgical innovations in canine gonadectomy

NARCIS (Netherlands)

Van Goethem, Bart

2016-01-01

In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated

Maxillary canine displacement and genetically determined predisposition to disturbed development of the dentition.

Science.gov (United States)

Stahl, Franka; Grabowski, Rosemarie

2003-05-01

The relationship between maxillary canine displacement and the simultaneous occurrence of "genetically determined predisposition to disturbed development of the dentition" as defined by Hoffmeister was investigated in 675 patients. Panoramic radiographs taken of each patient during the first and the second mixed dentition periods were evaluated. Canine inclination and the distance between the tip of the canine and a line connecting the cusps of the molars were computed in five different age groups according to Dausch-Neumann. Statistical analysis revealed 34 patients with "potential canine displacement", who exhibited further symptoms of "genetically determined predisposition to disturbed development of the dentition" significantly more frequently than the total group. The symptoms concerned were agenesia, displaced tooth buds, rotated or tilted incisors, aplasia and microdontia of lateral incisors. Careful follow-ups in patients with a predisposition to disturbed dental development enables risks to be anticipated and canine displacement to be detected at an early stage.

Expression of nociceptive ligands in canine osteosarcoma.

Science.gov (United States)

Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M

2015-01-01

Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.

Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features

Directory of Open Access Journals (Sweden)

Sophie Le Poder

2011-01-01

Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

THE REDUCED CANINE PANCREAS TO STUDY THE EFFECTS OF INTRAOPERATIVE RADIOTHERAPY

NARCIS (Netherlands)

HEIJMANS, HJ; MEHTA, D; KLEIBEUKER, JH; SLUITER, WJ; HOEKSTRA, HJ

1993-01-01

A canine model is described to study the tolerance of the pancreas to intra-operative radiotherapy (IORT). The canine pancreas is a horseshoe-shaped organ. To create a homogeneous delivery of IORT to the whole pancreas surgical manipulation is necessary which may induce pancreatitis. A resection of

Laparoscopic radical prostatectomy in the canine model.

Science.gov (United States)

Price, D T; Chari, R S; Neighbors, J D; Eubanks, S; Schuessler, W W; Preminger, G M

1996-12-01

The purpose of this study was to determine the feasibility of performing laparoscopic radical prostatectomy in a canine model. Laparoscopic radical prostatectomy was performed on six adult male canines. A new endoscopic needle driver was used to construct a secure vesicourethral anastomosis. Average operative time required to complete the procedure was 304 min (range 270-345 min). Dissection of the prostate gland took an average of 67 min (range 35-90 min), and construction of the vesicourethral anastomosis took 154 min (rage 80-240 min). There were no intraoperative complications and only one postoperative complication (anastomotic leak). Five of the six animals recovered uneventfully from the procedure, and their foley catheters were removed 10-14 days postoperatively after a retrograde cystourethrogram demonstrated an intact vesicourethral anastomosis. Four (80%) of the surviving animals were clinically continent within 10 days after catheter removal. Post mortem examination confirmed that the vesicourethral anastomosis was intact with no evidence of urine extravasation. These data demonstrate the feasibility of laparoscopic radical prostatectomy in a canine model, and suggest that additional work with this technique should be continued to develop its potential clinical application.

Characterization of canine osteosarcoma by array comparative genomic hybridization and RT-qPCR: signatures of genomic imbalance in canine osteosarcoma parallel the human counterpart.

Science.gov (United States)

Angstadt, Andrea Y; Motsinger-Reif, Alison; Thomas, Rachael; Kisseberth, William C; Guillermo Couto, C; Duval, Dawn L; Nielsen, Dahlia M; Modiano, Jaime F; Breen, Matthew

2011-11-01

Osteosarcoma (OS) is the most commonly diagnosed malignant bone tumor in humans and dogs, characterized in both species by extremely complex karyotypes exhibiting high frequencies of genomic imbalance. Evaluation of genomic signatures in human OS using array comparative genomic hybridization (aCGH) has assisted in uncovering genetic mechanisms that result in disease phenotype. Previous low-resolution (10-20 Mb) aCGH analysis of canine OS identified a wide range of recurrent DNA copy number aberrations, indicating extensive genomic instability. In this study, we profiled 123 canine OS tumors by 1 Mb-resolution aCGH to generate a dataset for direct comparison with current data for human OS, concluding that several high frequency aberrations in canine and human OS are orthologous. To ensure complete coverage of gene annotation, we identified the human refseq genes that map to these orthologous aberrant dog regions and found several candidate genes warranting evaluation for OS involvement. Specifically, subsequenct FISH and qRT-PCR analysis of RUNX2, TUSC3, and PTEN indicated that expression levels correlated with genomic copy number status, showcasing RUNX2 as an OS associated gene and TUSC3 as a possible tumor suppressor candidate. Together these data demonstrate the ability of genomic comparative oncology to identify genetic abberations which may be important for OS progression. Large scale screening of genomic imbalance in canine OS further validates the use of the dog as a suitable model for human cancers, supporting the idea that dysregulation discovered in canine cancers will provide an avenue for complementary study in human counterparts. Copyright © 2011 Wiley-Liss, Inc.

Detection and genetic characterization of Canine parvovirus and Canine coronavirus strains circulating in district of Tirana in Albania.

Science.gov (United States)

Cavalli, Alessandra; Desario, Costantina; Kusi, Ilir; Mari, Viviana; Lorusso, Eleonora; Cirone, Francesco; Kumbe, Ilirjan; Colaianni, Maria Loredana; Buonavoglia, Domenico; Decaro, Nicola

2014-07-01

An epidemiological survey for Canine parvovirus 2 (CPV-2) and Canine coronavirus (CCoV) was conducted in Albania. A total of 57 fecal samples were collected from diarrheic dogs in the District of Tirana during 2011-2013. The molecular assays detected 53 and 31 CPV- and CCoV-positive specimens, respectively, with mixed CPV-CCoV infections diagnosed in 28 dogs. The most frequently detected CPV type was 2a, whereas IIa was the predominant CCoV subtype. A better comprehension of the CPV-CCoV epidemiology in eastern European countries will help to assess the most appropriate vaccination strategies to prevent disease due to infections with these widespread agents of acute gastroenteritis in the dog.

Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.

Science.gov (United States)

Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J

2014-03-01

Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (Posteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.

Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.

Science.gov (United States)

Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L

2016-02-19

Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.

Functional Characterization of Canine Interferon-Lambda

Science.gov (United States)

Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun

2014-01-01

In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142

Maxillary canine impactions related to impacted central incisors: two case reports.

Science.gov (United States)

Bayram, Mehmet; Ozer, Mete; Sener, Ismail

2007-09-01

The purpose of this case report is to describe the combined surgical and orthodontic treatment of two cases with an impacted maxillary central incisor and canine in the same quadrant and to discuss the causal relationship between them. The most common causes of canine impactions are usually the result of one or more factors such as a long path of eruption, tooth size-arch length discrepancies, abnormal position of the tooth bud, prolonged retention or early loss of the deciduous canine, trauma, the presence of an alveolar cleft, ankylosis, cystic or neoplastic formation, dilaceration of the root, supernumerary teeth, and odontomas. Although impaction of the maxillary central incisor is almost as prevalent as impacted canines its etiology is different. The principal factors involved in causing the anomaly are supernumerary teeth, odontomas, and trauma. Case #1: A 10.5-year-old girl in the early mixed dentition stage presented with a chief complaint of the appearance of her anterior teeth. She had a Class I skeletal pattern and a history of trauma to the maxillary central incisors at age five with premature exfoliation. Radiographs revealed an impacted upper right central incisor in the region of the nasal floor, delayed eruption of the maxillary permanent central incisor, and the adjacent lateral incisor was inclined toward the edentulous space. Treatment was done in two stages consisting of surgical exposure and traction of the impacted central incisor and fixed orthodontic treatment. Case #2: An 11.5-year-old girl presented for orthodontic treatment with the chief complaint of an unerupted tooth and the appearance of her upper anterior teeth. She was in the late mixed dentition period with a Class III skeletal pattern along with an anterior cross-bite with some maxillary transverse deficiency. The maxillary right canine and central incisor were absent, but the maxillary right deciduous canine was still present. Treatment included arch expansion followed by

Orthodontic treatment of a stubborn palatally ectopic canine: a case report.

Science.gov (United States)

Al-Musfir, Tumadher M; Morris, David O

2014-03-01

This is a case report that highlights a different treatment approach in dealing with palatally ectopic canines. The modified transpalatal arch with an 'active' arm was used to align a palatally ectopic canine with 'push' mechanics after the initial use of more conventional 'pull' mechanics (piggy-back archwire technique) had failed.

Successful experimental challenge of dogs with canine parvovirus-2.

OpenAIRE

Carman, S; Povey, C

1982-01-01

Withholding food from dogs for 24 hours prior to, and for 48 hours following oral challenge with a gut mucosal homogenate of canine parvovirus-2, was a successful means of reproducing gastroenteric signs of canine parvovirus-2 infection. Twenty-one of 24 dogs, which had previously received various vaccine preparations of mink enteritis virus or were unvaccinated, and which were starved at challenge, developed soft or liquid feces with large or without large clots of mucus. Altered feces were ...

Assessment of Periodontal Status of Surgically Exposed and Orthodontically Aligned Impacted Maxillary Canines

OpenAIRE

Adina Coșarcă; Mariana Păcurar; Cecilia Petrovan; Alina Ormenișan

2014-01-01

Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of t...

Bilateral Second Premolars Agenesia Together with a Unilateral Canine Radiculomegaly.

Science.gov (United States)

Kemoli, Arthur Musakulu; Junior, Thomas Munyao

2017-01-01

Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.

Recent advances in canine leptospirosis: focus on vaccine development

Directory of Open Access Journals (Sweden)

Klaasen HLBM

2015-06-01

Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis

Efficacy of feline anti-parvovirus antibodies in the treatment of canine parvovirus infection.

Science.gov (United States)

Gerlach, M; Proksch, A L; Unterer, S; Speck, S; Truyen, U; Hartmann, K

2017-07-01

This prospective, randomised, placebo-controlled, double-blinded study aimed to evaluate efficacy of commercially available feline anti-parvovirus antibodies in dogs with canine parvovirus infection. First, cross-protection of feline panleukopenia virus antibodies against canine parvovirus was evaluated in vitro. In the subsequent prospective clinical trial, 31 dogs with clinical signs of canine parvovirus infection and a positive faecal canine parvovirus polymerase chain reaction were randomly assigned to a group receiving feline panleukopenia virus antibodies (n=15) or placebo (n=16). All dogs received additional routine treatment. Clinical signs, blood parameters, time to clinical recovery and mortality were compared between the groups. Serum antibody titres and quantitative faecal polymerase chain reaction were compared on days 0, 3, 7, and 14. In vitro, canine parvovirus was fully neutralised by feline panleukopenia virus antibodies. There were no detected significant differences in clinical signs, time to clinical recovery, blood parameters, mortality, faecal virus load, or viral shedding between groups. Dogs in the placebo group showed a significant increase of serum antibody titres and a significant decrease of faecal virus load between day 14 and day 0, which was not detectable in dogs treated with feline panleukopenia virus antibodies. No significant beneficial effect of passively transferred feline anti-parvovirus antibodies in the used dosage regimen on the treatment of canine parvovirus infection was demonstrated. © 2017 British Small Animal Veterinary Association.

Impacted canines: Etiology, diagnosis, and orthodontic management

Directory of Open Access Journals (Sweden)

Ranjit Manne

2012-01-01

Full Text Available Impaction of maxillary and mandibular canines is a frequently encountered clinical problem, the treatment of which usually requires an interdisciplinary approach. Surgical exposure of the impacted tooth and the complex orthodontic mechanisms that are applied to align the tooth into the arch may lead to varying amounts of damage to the supporting structures of the tooth, not to mention the long treatment duration and the financial burden to the patient. Hence, it seems worthwhile to focus on the means of early diagnosis and interception of this clinical situation. In the present article, an overview of the incidence and sequelae, as well as the surgical, periodontal, and orthodontic considerations in the management of impacted canines is presented.

A re-evaluation of subspecific variation and canine dimorphism in woolly spider monkeys (Brachyteles arachnoides).

Science.gov (United States)

Leigh, S R; Jungers, W L

1994-12-01

A recent study suggests that differing populations of woolly spider monkeys exhibit a substantial degree of morphological, cytogenetic, and behavioral variation. We re-evaluate the differences between populations in the degree of canine tooth height sexual dimorphism and in the frequency of thumbs. Statistical analysis of variation in the degree of canine sexual dimorphism between these populations fails to provide strong evidence for subspecific variation: differences in the degree of canine dimorphism cannot be considered statistically significant. Differences between populations in the frequency of thumbs are, however, statistically significant. The lack of clear distinctions between populations in the degree of canine dimorphism complicates assessments of behavioral variation between these populations. We suggest that the level of geographic variation in woolly spider monkey canine dimorphism is not consistent with subspecific status.

Cost-effectiveness of canine vaccination to prevent human rabies in rural Tanzania.

Science.gov (United States)

Fitzpatrick, Meagan C; Hampson, Katie; Cleaveland, Sarah; Mzimbiri, Imam; Lankester, Felix; Lembo, Tiziana; Meyers, Lauren A; Paltiel, A David; Galvani, Alison P

2014-01-21

The annual mortality rate of human rabies in rural Africa is 3.6 deaths per 100 000 persons. Rabies can be prevented with prompt postexposure prophylaxis, but this is costly and often inaccessible in rural Africa. Because 99% of human exposures occur through rabid dogs, canine vaccination also prevents transmission of rabies to humans. To evaluate the cost-effectiveness of rabies control through annual canine vaccination campaigns in rural sub-Saharan Africa. We model transmission dynamics in dogs and wildlife and assess empirical uncertainty in the biological variables to make probability-based evaluations of cost-effectiveness. Epidemiologic variables from a contact-tracing study and literature and cost data from ongoing vaccination campaigns. Two districts of rural Tanzania: Ngorongoro and Serengeti. 10 years. Health policymaker. Vaccination coverage ranging from 0% to 95% in increments of 5%. Life-years for health outcomes and 2010 U.S. dollars for economic outcomes. Annual canine vaccination campaigns were very cost-effective in both districts compared with no canine vaccination. In Serengeti, annual campaigns with as much as 70% coverage were cost-saving. Across a wide range of variable assumptions and levels of societal willingness to pay for life-years, the optimal vaccination coverage for Serengeti was 70%. In Ngorongoro, although optimal coverage depended on willingness to pay, vaccination campaigns were always cost-effective and lifesaving and therefore preferred. Canine vaccination was very cost-effective in both districts, but there was greater uncertainty about the optimal coverage in Ngorongoro. Annual canine rabies vaccination campaigns conferred extraordinary value and dramatically reduced the health burden of rabies. National Institutes of Health.

Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

Science.gov (United States)

Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2014-09-09

Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

Identification and function analysis of canine stimulator of interferon gene (STING).

Science.gov (United States)

Zhang, Yuxiang; Zhu, Mengyan; Li, Gairu; Liu, Jie; Zhai, Xiaofeng; Wang, Ruyi; Zhang, Junyan; Xing, Gang; Gu, Jinyan; Yan, Liping; Lei, Jing; Sun, Haifeng; Shi, Zhiyu; Liu, Fei; Hu, Boli; Su, Shuo; Zhou, Jiyong

2017-12-01

Stimulator of interferon gene (STING) plays an important role in the cyclic GMP-AMP synthase (cGAS)-mediated activation of type I IFN responses. In this study, we identified and cloned canine STING gene. Full-length STING encodes a 375 amino acid product that shares the highest similarity with feline STING. Highest levels of mRNA of canine STING were detected in the spleen and lungs while the lowest levels in the heart and muscle. Analysis of its cellular localization showed that STING is localizes to the endoplasmic reticulum. STING overexpression induced the IFN response via the IRF3 and NF-κB pathways and up-regulated the expression of ISG15 and viperin. However, knockdown of STING did not inhibit the IFN-β response triggered by poly(dA:dT), poly(I:C), or SeV. Finally, overexpression of STING significantly inhibited the replication of canine influenza virus H3N2. Collectively, our findings indicate that STING is involved in the regulation of the IFN-β pathway in canine. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mandibular Canine Dimorphism in Establishing Sex Identity in the Lebanese Population

Directory of Open Access Journals (Sweden)

Fouad Ayoub

2014-01-01

Full Text Available Background and Objective. In forensic investigations, mandibular canines provide excellent materials to identify gender since they are more likely to survive disasters. The objective of this study was to investigate gender dimorphism by comparing the mesiodistal width of mandibular permanent canines and intercanine distance in a group of Lebanese population. Methods. Participants consisted of undergraduate students from the School of Dentistry, Lebanese University, for two academic years who fulfilled the inclusion criteria. Canine widths and intercanine distance were measured by one operator directly on dental casts using a digital caliper. Results. One hundred thirty-three Lebanese dental students (54 males and 69 females aged 18–25 were included in the study. The intercanine distance was significantly greater in males (P value 0.05 and females (P value > 0.05. The mean width of canine was greater than 7.188 mm for males. Conclusion. The parameters measured in the present study are of great help in sex identification in forensic investigations in the Lebanese adult population.

Increasing Incidence of Canine Leptospirosis in Switzerland

Directory of Open Access Journals (Sweden)

Andrea Major

2014-07-01

Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.

NCR1 Expression Identifies Canine Natural Killer Cell Subsets with Phenotypic Similarity to Human Natural Killer Cells

Directory of Open Access Journals (Sweden)

Jennifer Ann Foltz

2016-11-01

Full Text Available Canines spontaneously develop many cancers similar to humans - including osteosarcoma, leukemia, and lymphoma - offering the opportunity to study immune therapies in a genetically heterogeneous and immunocompetent environment. However, a lack of antibodies recognizing canine NK cell markers has resulted in suboptimal characterization and unknown purity of NK cell products, hindering the development of canine models of NK cell adoptive immunotherapy. To this end, we generated a novel antibody to canine NCR1 (NKp46, the putative species-wide marker of NK cells, enabling purification of NK cells for further characterization. We demonstrate that CD3-/NKp46+ cells in healthy and osteosarcoma-bearing canines have phenotypic similarity to human CD3-/NKp46+ NK cells, expressing mRNA for CD16 and the natural cytotoxicity receptors NKp30, NKp44, and NKp80. Functionally, we demonstrate with the calcein release assay that canine CD3-/NKp46+ cells kill canine tumor cell lines without prior sensitization and secrete IFN-γ, TNF-α, IL-8, IL-10, and GM-CSF as measured by Luminex. Like human NK cells, CD3-/NKp46+ cells expand rapidly on feeder cells expressing 4-1BBL and membrane-bound IL-21 (median= 20,283-fold in 21 days. Further, we identify a minor Null population (CD3-/CD21-/CD14-/NKp46- with reduced cytotoxicity against osteosarcoma cells, but similar cytokine secretion as CD3-/NKp46+ cells. Null cells in canines and humans have reduced expression of NKG2D, NKp44, and CD16 compared to NKp46+ NK cells, and can be induced to express NKp46 with further expansion on feeder cells. In conclusion, we have identified and characterized canine NK cells, including an NKp46- subset of canine and human NK cells, using a novel anti-canine NKp46 antibody, and report robust ex vivo expansion of canine NK cells sufficient for adoptive immunotherapy.

Sequence-independent VIDISCA-454 technique to discover new viruses in canine livers

NARCIS (Netherlands)

van der Heijden, Mitzi; de Vries, Michel; van Steenbeek, Frank G.; Favier, Robert P.; Deijs, Martin; Brinkhof, Bas; Rothuizen, Jan; van der Hoek, Lia; Penning, Louis C.

2012-01-01

In many mammals, viruses cause hepatitis. Despite many efforts a specific virus responsible for canine idiopathic hepatitis has not been identified. The discovery of a viral etiology in canine hepatitis will promote the development of specific drugs and vaccines for the treatment of idiopathic

78 FR 29698 - Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA

Science.gov (United States)

2013-05-21

...] Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA AGENCY: Animal and... Canine Lymphoma Vaccine, DNA. The environmental assessment, which is based on a risk analysis prepared to... biological product: Requester: Merial, Inc. Product: Canine Lymphoma Vaccine, DNA. Possible Field Test...

Functional Characterization of the Canine Heme-Regulated eIF2α Kinase: Regulation of Protein Synthesis

Directory of Open Access Journals (Sweden)

Kimon C. Kanelakis

2009-01-01

Full Text Available The heme-regulated inhibitor (HRI negatively regulates protein synthesis by phosphorylating eukaryotic initiation factor-2α (eIF2α thereby inhibiting protein translation. The importance of HRI in regulating hemoglobin synthesis in erythroid cells makes it an attractive molecular target in need of further characterization. In this work, we have cloned and expressed the canine form of the HRI kinase. The canine nucleotide sequence has 86%, 82%, and 81% identity to the human, mouse, and rat HRI, respectively. It was noted that an isoleucine residue in the ATP binding site of human, rat, and mouse HRI is replaced by a valine in the canine kinase. The expression of canine HRI protein by in vitro translation using wheat germ lysate or in Sf9 cells using a baculovirus expression system was increased by the addition of hemin. Following purification, the canine protein was found to be 72 kD and showed kinase activity determined by its ability to phosphorylate a synthetic peptide substrate. Quercetin, a kinase inhibitor known to inhibit mouse and human HRI, inhibits canine HRI in a concentration-dependent manner. Additionally, quercetin is able to increase de novo protein synthesis in canine reticulocytes. We conclude that the canine is a suitable model species for studying the role of HRI in erythropoiesis.

The Effect of Using Self-ligating Brackets on Maxillary Canine Retraction: A Split-mouth Design Randomized Controlled Trial.

Science.gov (United States)

Hassan, Siba E; Hajeer, Mohammad Y; Alali, Osama H; Kaddah, Ayham S

2016-06-01

The results of previous studies about the efficacy of using self-ligating brackets (SLBs) in controlling canine movement during retraction are not in harmony. Therefore, the current study aimed to compare the effects of using new passive SLBs on maxillary canine retraction with sliding mechanics vs conventional ligating brackets (CLBs) tied with metal ligatures. The sample comprised 15 adult patients (4 males, 11 females; 18-24 years) requiring bilateral extraction of maxillary first premolars. Units of randomization are the left or right maxillary canines within the same patient. The two maxillary canines in each patient were randomly assigned to one of the two groups in a simple split-mouth design. The canines in the SLBs group (n = 15) were bracketed with SLBs (Damon Q™), while the canines in the CLBs group (n = 15) were bracketed with conventional brackets (Mini Master Series). Transpalatal bars were used for anchorage. After leveling and alignment, 0.019 × 0.025" stainless steel working archwires were placed. Canines were retracted using a nickel-titanium close-coil springs with a 150 gm force. The amount and rate of maxillary canine retraction, canine rotation, and loss of anchorage were measured on study models collected at the beginning of canine retraction (T0) and 12 weeks later (T1). Differences were analyzed using paired-samples t-tests. The effect differences were statistically significant (p brackets gave better results compared to the CLBs in terms of rate of movement, amount of canine rotation following extraction, and anchorage loss.

Canine osteosarcoma cells exhibit resistance to aurora kinase inhibitors.

Science.gov (United States)

Cannon, C M; Pozniak, J; Scott, M C; Ito, D; Gorden, B H; Graef, A J; Modiano, J F

2015-03-01

We evaluated the effect of Aurora kinase inhibitors AZD1152 and VX680 on canine osteosarcoma cells. Cytotoxicity was seen in all four cell lines; however, half-maximal inhibitory concentrations were significantly higher than in human leukaemia and canine lymphoma cells. AZD1152 reduced Aurora kinase B phosphorylation, indicating resistance was not because of failure of target recognition. Efflux mediated by ABCB1 and ABCG2 transporters is one known mechanism of resistance against these drugs and verapamil enhanced AZD1152-induced apoptosis; however, these transporters were only expressed by a small percentage of cells in each line and the effects of verapamil were modest, suggesting other mechanisms contribute to resistance. Our results indicate that canine osteosarcoma cells are resistant to Aurora kinase inhibitors and suggest that these compounds are unlikely to be useful as single agents for this disease. Further investigation of these resistance mechanisms and the potential utility of Aurora kinase inhibitors in multi-agent protocols is warranted. © 2013 Blackwell Publishing Ltd.

An RCT on treatment of palatally displaced canines with RME and/or a transpalatal arch.

Science.gov (United States)

Baccetti, Tiziano; Sigler, Lauren M; McNamara, James A

2011-12-01

To investigate the effect of rapid maxillary expansion (RME) and/or transpalatal arch (TPA) therapy in combination with deciduous canine extraction on the eruption of palatally displaced canines (PDCs). Hundred and twenty subjects were enrolled in an RCT based on PDCs diagnosed on panoramic radiographs and they were randomly assigned to one of four study groups. Three treatment groups (TGs) (RME followed by TPA therapy plus extraction of deciduous canines, RME/TPA/EC group, 40 subjects; TPA therapy plus extraction of deciduous canines, TPA/EC group, 25 subjects; extraction of deciduous canines, EC group, 25 subjects) were analyzed. A control group (CG, 30 subjects) received no orthodontic treatment. Prevalence rates of eruption of PDCs in the three TGs were compared with the CG at T2. Predictive features at T1 for successful canine eruption were tested in the three TGs. The prevalence of canine eruption was 80 per cent for the RME/TPA/EC group, 79 per cent for the TPA/EC group, 62.5 per cent for the EC group, versus 28 per cent in the CG, with statistically significant differences between all the groups, with the exception of the comparison between RME/TPA/EC and TPA/EC. Predictive pretreatment variables for the success of treatment were less severe sectors of canine displacement, prepubertal stages of skeletal maturity, and an open root apex of PDCs. The use of a TPA in absence of RME can be equally effective than the RME/TPA combination in PDC cases not requiring maxillary expansion, thus reducing the burden of treatment for the patient.

Bilateral second premolars agenesia together with a unilateral canine radiculomegaly

Directory of Open Access Journals (Sweden)

Arthur Musakulu Kemoli

2017-01-01

Full Text Available Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.

In vitro development of canine somatic cell nuclear transfer embryos in different culture media.

Science.gov (United States)

Kim, Dong-Hoon; No, Jin-Gu; Choi, Mi-Kyung; Yeom, Dong-Hyeon; Kim, Dong-Kyo; Yang, Byoung-Chul; Yoo, Jae Gyu; Kim, Min Kyu; Kim, Hong-Tea

2015-01-01

The objective of the present study was to investigate the effects of three different culture media on the development of canine somatic cell nuclear transfer (SCNT) embryos. Canine cloned embryos were cultured in modified synthetic oviductal fluid (mSOF), porcine zygote medium-3 (PZM-3), or G1/G2 sequential media. Our results showed that the G1/G2 media yielded significantly higher morula and blastocyst development in canine SCNT embryos (26.1% and 7.8%, respectively) compared to PZM-3 (8.5% and 0%or mSOF (2.3% and 0%) media. In conclusion, this study suggests that blastocysts can be produced more efficiently using G1/G2 media to culture canine SCNT embryos.

Canine spontaneous head and neck squamous cell carcinomas represent their human counterparts at the molecular level.

Directory of Open Access Journals (Sweden)

Deli Liu

2015-06-01

Full Text Available Spontaneous canine head and neck squamous cell carcinoma (HNSCC represents an excellent model of human HNSCC but is greatly understudied. To better understand and utilize this valuable resource, we performed a pilot study that represents its first genome-wide characterization by investigating 12 canine HNSCC cases, of which 9 are oral, via high density array comparative genomic hybridization and RNA-seq. The analyses reveal that these canine cancers recapitulate many molecular features of human HNSCC. These include analogous genomic copy number abnormality landscapes and sequence mutation patterns, recurrent alteration of known HNSCC genes and pathways (e.g., cell cycle, PI3K/AKT signaling, and comparably extensive heterogeneity. Amplification or overexpression of protein kinase genes, matrix metalloproteinase genes, and epithelial-mesenchymal transition genes TWIST1 and SNAI1 are also prominent in these canine tumors. This pilot study, along with a rapidly growing body of literature on canine cancer, reemphasizes the potential value of spontaneous canine cancers in HNSCC basic and translational research.

Surgical Removal of a Canine Aortic Thromboembolism Secondary to Pancreatitis

Directory of Open Access Journals (Sweden)

Jill Narak

2015-01-01

Full Text Available A 7-year-old castrated male Pomeranian was evaluated on emergency for diagnostic work-up and treatment for acute nonpainful paraparesis. The neurologic examination suggested a L4-S3 myelopathy, but physical examination revealed lack of femoral pulses and rectal hypothermia, as well as a grade II/VI systolic heart murmur, so ischemic neuromyopathy was suspected. Clinicopathologic analysis revealed increased muscle enzymes and proteinuria. Abdominal ultrasonography confirmed aortic thromboembolism (ATE, and surgical histopathology diagnosed necrotizing pancreatitis. Surgical aortic thrombectomy was performed, and antithrombotic therapy was instituted. Pancreatitis was treated supportively. The dog was discharged to the owners after 10 days of hospitalization. Recheck examination 6 weeks after initial presentation revealed a normal neurologic examination and normal femoral pulses. The patient has had no further bouts of pancreatitis and remains neurologically normal 5 years after initial presentation. Canine ATE is relatively rare compared to the feline counterpart. Directed therapy for feline ATE is often not recommended, as underlying conditions are oftentimes ultimately fatal. Underlying etiologies for canine ATE include cardiovascular disease and endocrinopathies, but canine ATE secondary to pancreatitis has not yet been reported. Surgical removal of aortic thromboembolus should be considered as curative for pelvic limb dysfunction in the canine patient without a terminal underlying disease.

Molecular biological and immunohistological characterization of canine dermal papilla cells and the evaluation of culture conditions.

Science.gov (United States)

Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu

2011-10-01

The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.

Orthodontic tooth movement after extraction of previously autotransplanted maxillary canines and ridge augmentation.

Science.gov (United States)

Collett, A R; Fletcher, B

2000-12-01

A case report is detailed in which autotransplanted maxillary canines were removed and the spaces closed. Substantial surrounding bone loss was associated with the upper right canine, and a bone graft was needed to reestablish normal dentoalveolar ridge morphology. Bone was taken from the maxillary tuberosity and placed in the canine extraction site, fixed with a bone screw, and covered with GoreTex. Seven months after placement of the bone graft, the GoreTex and stabilizing screw were removed to allow for consolidation of the bone. The upper left canine and lower second premolars were extracted, and fixed appliances were placed in both arches to align the teeth and close the spaces. Protraction of the upper right first premolar and retraction of the lateral incisor into the graft site were kept slow and constant with continued periodontal assessment. During the space closure, there was some concern that the bone in the graft site might resorb, leaving the teeth with compromised periodontal support. However, no significant periodontal attachment loss occurred despite ongoing concern about the amount of keratinized tissue. Perhaps the relatively slow rate of tooth movement provided for bone to be maintained and recreated ahead of the tooth. Almost complete closure of the upper canine extraction spaces was achieved. The upper premolars were substituted for the maxillary canines, and unfavorable prosthetic options were thus avoided. The lower arch was aligned, and the extraction spaces completely closed.

"Fooling fido"--chemical and behavioral studies of pseudo-explosive canine training aids.

Science.gov (United States)

Kranz, William D; Strange, Nicholas A; Goodpaster, John V

2014-12-01

Genuine explosive materials are traditionally employed in the training and testing of explosive-detecting canines so that they will respond reliably to these substances. However, challenges arising from the acquisition, storage, handling, and transportation of explosives have given rise to the development of "pseudo-explosive" training aids. These products attempt to emulate the odor of real explosives while remaining inert. Therefore, a canine trained on a pseudo-explosive should respond to its real-life analog. Similarly, a canine trained on an actual explosive should respond to the pseudo-explosive as if it was real. This research tested those assumptions with a focus on three explosives: single-base smokeless powder, 2,4,6-trinitrotoluene (TNT), and a RDX-based plastic explosive (Composition C-4). Using gas chromatography-mass spectrometry with solid phase microextraction as a pre-concentration technique, we determined that the volatile compounds given off by pseudo-explosive products consisted of various solvents, known additives from explosive formulations, and common impurities present in authentic explosives. For example, simulated smokeless powders emitted terpenes, 2,4-dinitrotoluene, diphenylamine, and ethyl centralite. Simulated TNT products emitted 2,4- and 2,6-dinitrotoluene. Simulated C-4 products emitted cyclohexanone, 2-ethyl-1-hexanol, and dimethyldinitrobutane. We also conducted tests to determine whether canines trained on pseudo-explosives are capable of alerting to genuine explosives and vice versa. The results show that canines trained on pseudo-explosives performed poorly at detecting all but the pseudo-explosives they are trained on. Similarly, canines trained on actual explosives performed poorly at detecting all but the actual explosives on which they were trained.

Morphological study of maxillary canine region based on CT

International Nuclear Information System (INIS)

Yamada, Maiko; Takamori, Hitoshi; Ide, Yoshiaki; Yosue, Takashi

2010-01-01

The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)

Pathophysiology, diagnosis, and treatment of canine hip dysplasia

International Nuclear Information System (INIS)

Cook, J.L.; Tomlinson, J.L.; Constantinescu, G.M.

1996-01-01

Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education

Does contemporary canine diet cause cancer? ; A review

Directory of Open Access Journals (Sweden)

Joseph B Gentzel

2013-07-01

Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer

Three-dimensional localization of impacted canines and root resorption assessment using cone beam computed tomography.

Science.gov (United States)

Almuhtaseb, Eyad; Mao, Jing; Mahony, Derek; Bader, Rawan; Zhang, Zhi-xing

2014-06-01

The purpose of this study was to develop a new way to localize the impacted canines from three dimensions and to investigate the root resorption of the adjacent teeth by using cone beam computed tomography (CBCT). Forty-six patients undergoing orthodontic treatments and having impacted canines in Tongji Hospital were examined. The images of CBCT scans were obtained from KaVo 3D exam vision. Angular and linear measurements of the cusp tip and root apex according to the three planes (mid-sagittal, occlusal and frontal) have been taken using the cephalometric tool of the InVivo Dental Anatomage Version 5.1.10. The measurements of the angular and linear coordinates of the maxillary and mandibular canines were obtained. Using this technique the operators could envision the location of the impacted canine according to the three clinical planes. Adjacent teeth root resorption of 28.26 % was in the upper lateral incisors while 17.39% in upper central incisors, but no lower root resorption was found in our samples. Accurate and reliable localization of the impacted canines could be obtained from the novel analysis system, which offers a better surgical and orthodontic treatment for the patients with impacted canines.

Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.

Science.gov (United States)

Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D

2014-12-01

Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis.

Canine parvovirus in asymptomatic feline carriers.

Science.gov (United States)

Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D

2012-05-25

Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog

Electroencephalography as a diagnostic technique for canine neurological diseases

Directory of Open Access Journals (Sweden)

Wrzosek Marcin

2016-06-01

Full Text Available Electroencephalography (EEG is a non-invasive examination method for the assessment of functional central nervous system (CNS disturbances. In human medicine it has a special importance as a diagnostic tool for epilepsy. Although many studies were done on the use of EEG for diagnostics of canine central nervous system disorders, the technique is still not applied routinely. The purpose of this paper was to review the use of the electroencephalography in canine neurological disorders of central nervous system diagnosis and assess the future perspectives of this technique in veterinary medicine.

Canine distemper virus detection in asymptomatic and non vaccinated dogs

Directory of Open Access Journals (Sweden)

Helen L. Del Puerto

2010-02-01

Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

Experimental study of pulmonary thromboembolism ischemia-reperfusion injury in canine model

International Nuclear Information System (INIS)

Li Jianjun; Zhai Renyou; Zhang Dongpo; Huang Qiang; Yu Ping; Dai Dingke; Bao Na

2009-01-01

Objective: To establish a canine model of pulmonary thromboembolism ischemia- reperfusion injury (PTE IRI) that may be used for imaging study. Methods: Ten male and 10 female healthy mongrel canines with (18.6±0.8) kg/body weight, were used. A Swan-Ganz catheter was introduced into the right internal jugular vein via a preset percutaneous sheath using the Seldinger technique, and then was with further insertion the pulmonary artery. Balloon occlusion of the right inferior lobe pulmonary artery for 4 hours was followed by removing the catheter and ending with 4 hours of reperfusion. CT was performed before ischemia, 4 h after ischemia and 4 h after reperfusion. At last, dogs were killed and the bilateral inferior lung tissues were prepared for the examination by light and electronic microscopy. Results: All canine models were successfully developed pulmonary thromboembolism ischemia-reperfusion injury. The examination of CT, light and electron microscopy consistently indicated the presence of permeability pulmonary edema after reperfusion. Conclusions: A closed-chest canine model in vivo of pulmonary thromboembolism ischemia-reperfusion injury can be established with virtual pathophysiological process in human and be as well as for imaging experimental study. (authors)

A survey of canine tick-borne diseases in India

Directory of Open Access Journals (Sweden)

Coleman Glen T

2011-07-01

Full Text Available Abstract Background There are few published reports on canine Babesia, Ehrlichia, Anaplasma, Hepatozoon and haemotropic Mycoplasma infections in India and most describe clinical disease in individual dogs, diagnosed by morphological observation of the microorganisms in stained blood smears. This study investigated the occurrence and distribution of canine tick-borne disease (TBD pathogens using a combination of conventional and molecular diagnostic techniques in four cities in India. Results On microscopy examination, only Hepatozoon gamonts were observed in twelve out of 525 (2.3%; 95% CI: 1.2, 4 blood smears. Using polymerase chain reaction (PCR, a total of 261 from 525 dogs (49.7%; 95% CI: 45.4, 54.1 in this study were infected with one or more canine tick-borne pathogen. Hepatozoon canis (30%; 95% CI: 26.0, 34.0 was the most common TBD pathogen found infecting dogs in India followed by Ehrlichia canis (20.6%; 95% CI: 17.2, 24.3, Mycoplasma haemocanis (12.2%; 95% CI: 9.5, 15.3, Anaplasma platys (6.5%; 95% CI: 4.5, 8.9, Babesia vogeli (5.5%, 95% CI: 3.7, 7.8 and Babesia gibsoni (0.2%, 95% CI: 0.01, 1.06. Concurrent infection with more than one TBD pathogen occurred in 39% of cases. Potential tick vectors, Rhipicephalus (most commonly and/or Haemaphysalis ticks were found on 278 (53% of dogs examined. Conclusions At least 6 species of canine tick-borne pathogens are present in India. Hepatozoon canis was the most common pathogen and ticks belonging to the genus Rhipicephalus were encountered most frequently. Polymerase chain reaction was more sensitive in detecting circulating pathogens compared with peripheral blood smear examination. As co-infections with canine TBD pathogens were common, Indian veterinary practitioners should be cognisant that the discovery of one such pathogen raises the potential for multiple infections which may warrant different clinical management strategies.

New hominin fossils from Kanapoi, Kenya, and the mosaic evolution of canine teeth in early hominins

Directory of Open Access Journals (Sweden)

J. Michael Plavcan

2012-03-01

Full Text Available Whilst reduced size, altered shape and diminished sexual dimorphism of the canine–premolar complex are diagnostic features of the hominin clade, little is known about the rate and timing of changes in canine size and shape in early hominins. The earliest Australopithecus, Australopithecus anamensis, had canine crowns similar in size to those of its descendant Australopithecus afarensis, but a single large root alveolus has suggested that this species may have had larger and more dimorphic canines than previously recognised. Here we present three new associated dentitions attributed to A. anamensis, recently recovered from the type site of Kanapoi, Kenya, that provide evidence of canine evolution in early Australopithecus. These fossils include the largest mandibular canine root in the hominin fossil record. We demonstrate that, although canine crown height did not differ between these species, A. anamensis had larger and more dimorphic roots, more like those of extant great apes and Ardipithecus ramidus, than those of A. afarensis. The canine and premolar occlusal shapes of A. anamensis also resemble those of Ar. ramidus, and are intermediary between extant great apes and A. afarensis. A. afarensis achieved Homo-like maxillary crown basal proportions without a reduction in crown height. Thus, canine crown size and dimorphism remained stable during the early evolution of Australopithecus, but mandibular root dimensions changed only later within the A. anamensis–afarensis lineage, coincident with morphological changes in the canine–premolar complex. These observations suggest that selection on canine tooth crown height, shape and root dimensions was not coupled in early hominin evolution, and was not part of an integrated adaptive package.

Molecular characterization of the canine HMGB1.

Science.gov (United States)

Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I

2003-01-01

Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel

Comparative analysis of the surface exposed proteome of two canine osteosarcoma cell lines and normal canine osteoblasts.

Science.gov (United States)

Milovancev, Milan; Hilgart-Martiszus, Ian; McNamara, Michael J; Goodall, Cheri P; Seguin, Bernard; Bracha, Shay; Wickramasekara, Samanthi I

2013-06-13

Osteosarcoma (OSA) is the most common primary bone tumor of dogs and carries a poor prognosis despite aggressive treatment. An improved understanding of the biology of OSA is critically needed to allow for development of novel diagnostic, prognostic, and therapeutic tools. The surface-exposed proteome (SEP) of a cancerous cell includes a multifarious array of proteins critical to cellular processes such as proliferation, migration, adhesion, and inter-cellular communication. The specific aim of this study was to define a SEP profile of two validated canine OSA cell lines and a normal canine osteoblast cell line utilizing a biotinylation/streptavidin system to selectively label, purify, and identify surface-exposed proteins by mass spectrometry (MS) analysis. Additionally, we sought to validate a subset of our MS-based observations via quantitative real-time PCR, Western blot and semi-quantitative immunocytochemistry. Our hypothesis was that MS would detect differences in the SEP composition between the OSA and the normal osteoblast cells. Shotgun MS identified 133 putative surface proteins when output from all samples were combined, with good consistency between biological replicates. Eleven of the MS-detected proteins underwent analysis of gene expression by PCR, all of which were actively transcribed, but varied in expression level. Western blot of whole cell lysates from all three cell lines was effective for Thrombospondin-1, CYR61 and CD44, and indicated that all three proteins were present in each cell line. Semi-quantitative immunofluorescence indicated that CD44 was expressed at much higher levels on the surface of the OSA than the normal osteoblast cell lines. The results of the present study identified numerous differences, and similarities, in the SEP of canine OSA cell lines and normal canine osteoblasts. The PCR, Western blot, and immunocytochemistry results, for the subset of proteins evaluated, were generally supportive of the mass spectrometry data

Soluble Form of Canine Transferrin Receptor Inhibits Canine Parvovirus Infection In Vitro and In Vivo

Science.gov (United States)

Wen, Jiexia; Pan, Sumin; Liang, Shuang; Zhong, Zhenyu; He, Ying; Lin, Hongyu; Li, Wenyan; Wang, Liyue; Li, Xiujin; Zhong, Fei

2013-01-01

Canine parvovirus (CPV) disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR) was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR)) possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo. PMID:24089666

Soluble Form of Canine Transferrin Receptor Inhibits Canine Parvovirus Infection In Vitro and In Vivo

Directory of Open Access Journals (Sweden)

Jiexia Wen

2013-01-01

Full Text Available Canine parvovirus (CPV disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo.

3D enamel thickness in Neandertal and modern human permanent canines.

Science.gov (United States)

Buti, Laura; Le Cabec, Adeline; Panetta, Daniele; Tripodi, Maria; Salvadori, Piero A; Hublin, Jean-Jacques; Feeney, Robin N M; Benazzi, Stefano

2017-12-01

Enamel thickness figures prominently in studies of human evolution, particularly for taxonomy, phylogeny, and paleodietary reconstruction. Attention has focused on molar teeth, through the use of advanced imaging technologies and novel protocols. Despite the important results achieved thus far, further work is needed to investigate all tooth classes. We apply a recent approach developed for anterior teeth to investigate the 3D enamel thickness of Neandertal and modern human (MH) canines. In terms of crown size, the values obtained for both upper and lower unworn/slightly worn canines are significantly greater in Neandertals than in Upper Paleolithic and recent MH. The 3D relative enamel thickness (RET) is significantly lower in Neandertals than in MH. Moreover, differences in 3D RET values between the two groups appear to decrease in worn canines beginning from wear stage 3, suggesting that both the pattern and the stage of wear may have important effects on the 3D RET value. Nevertheless, the 3D average enamel thickness (AET) does not differ between the two groups. In both groups, 3D AET and 3D RET indices are greater in upper canines than in lower canines, and overall the enamel is thicker on the occlusal half of the labial aspect of the crown, particularly in MH. By contrast, the few early modern humans investigated show the highest volumes of enamel while for all other components of 3D enamel, thickness this group holds an intermediate position between Neandertals and recent MH. Overall, our study supports the general findings that Neandertals have relatively thinner enamel than MH (as also observed in molars), indicating that unworn/slightly worn canines can be successfully used to discriminate between the two groups. Further studies, however, are needed to understand whether these differences are functionally related or are the result of pleiotropic or genetic drift effects. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Phylogenetic analysis of Austrian canine distemper virus strains from clinical samples from dogs and wild carnivores.

Science.gov (United States)

Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K

2011-04-09

Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.

Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma

OpenAIRE

Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid

2016-01-01

Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA.

Science.gov (United States)

Folitse, R D; Kodie, D O; Amemor, E; Dei, D; Tasiame, W; Burimuah, V; Emikpe, B O

2018-01-01

Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT ® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α 0.05 . We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection.

DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA

Science.gov (United States)

Folitse, R. D; Kodie, D.O; Amemor, E.; Dei, D.; Tasiame, W.; Burimuah, V.; Emikpe, B.O

2018-01-01

Background: Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Materials and Methods: Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α0.05 Results: We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. Conclusion: The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection. PMID:29302647

Canine Detection of Illict Drugs: Sensory Apparatus Technology

National Research Council Canada - National Science Library

Morrison, Edward

2000-01-01

This report describes basic anatomical and physiological observations of the peripheral canine olfactory system, provided by means of investigations into its structural and molecular characteristics...

Coryneform bacteria associated with canine otitis externa

DEFF Research Database (Denmark)

Aalbæk, Bent; Bemis, David A.; Schjærff, Mette

2010-01-01

This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...

Antigenic typing Polish isolates of canine parvovirus

Energy Technology Data Exchange (ETDEWEB)

Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)

1995-12-31

Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.

Antigenic typing Polish isolates of canine parvovirus

International Nuclear Information System (INIS)

Mizak, B.; Plucienniczak, A.

1995-01-01

Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs

Assessment of periodontal status following the alignment of impacted permanent maxillary canine teeth.

Science.gov (United States)

Szarmach, I J; Szarmach, J; Waszkiel, D; Paniczko, A

2006-01-01

The aim of the study was to assess the effect of orthodontic movement of the impacted canines after surgical exposure and alignment on the periodontal status of the transpositioned and adjacent teeth as well as to compare certain parameters with those of spontaneously erupted teeth. Twenty-four patients (mean age 18.4 +/- 3.66) with unilaterally impacted 24 canines were enrolled in the study. The following parameters were assessed: pocket depth (PD), clinical attachment level (CAL), platelet index (PI) of Silness and Löe, and modified sulcus bleeding index (SBI). Optic density of the alveolar bone along the root surface of the aligned canine was analysed based on digital radiological images made with the right angle technique. Control group consisted of spontaneously erupted teeth. In comparison to the control group, in the orthodonticaly treated group PD was found to increase on the mesial buccal and palatal surfaces of the first premolar (p aligned canine (p aligned tooth were statistically significant (p alignment zone and the control, and there was no link between the method of treatment and periodontal status, either. The alignment of the impacted permanent maxillary canines poses a risk of periodontal deterioration. Patients subjected to surgical-orthodontic treatment require periodic periodontal follow-ups.

An assessment of the relationship between cervical vertebrae maturation index and eruption of permanent maxillary canines

Directory of Open Access Journals (Sweden)

D S Kothavade

2012-01-01

Full Text Available Aim : The purpose of the present study was to establish the relationship between the eruption of permanent maxillary canines and cervical vertebral maturation stages (CVMs to assess an alternative method for determining time of canine eruption in the late mixed dentition. Materials and Methods : One hundred and twenty subjects with erupting permanent maxillary canines were observed both intraorally and radiographically with orthopantamograms. Lateral cephalograms were recorded to divide subjects according to CVM stage into prepeak (CS1 and CS2, peak (CS3 and CS4 and postpeak (CS5 and CS6 groups of puberty. Statistical Analysis : The differences between the prevalence rates of canine eruption in different groups of puberty were estimated using ′z test′. Results : Prepeak group comprised of forty six subjects, peak group sixty eight subjects and postpeak group six subjects. The differences in prevalence rates between peak and prepeak and between peak and postpeak groups were noticed highly significant (p<0.001, while prevalence rates between peak and postpeak was found less significant ( p0 <0.01. Conclusion : Eruption of the permanent maxillary canine can occur at any CVM stage till end of the puberty or after puberty (CS1-CS6. Thus, an absence of maxillary canine during or after postpeak stage of puberty (CS5 or CS6 suggests delayed eruption and canine impaction.

Cathepsin K expression and activity in canine osteosarcoma.

Science.gov (United States)

Schmit, J M; Pondenis, H C; Barger, A M; Borst, L B; Garrett, L D; Wypij, J M; Neumann, Z L; Fan, T M

2012-01-01

Cathepsin K (CatK) is a lysosomal protease with collagenolytic activity, and its secretion by osteoclasts is responsible for degrading organic bone matrix. People with pathologic bone resorption have higher circulating CatK concentrations. Canine osteosarcoma (OS) cells will possess CatK, and its secretion will be cytokine inducible. Circulating CatK concentrations will be increased in dogs with OS, and will be a surrogate marker of bone resorption. Fifty-one dogs with appendicular OS and 18 age- and weight-matched healthy control dogs. In a prospective study, expressions of CatK mRNA and protein were investigated in OS cells. The inducible secretion and proteolytic activity of CatK from OS cells was assessed in vitro. Serum CatK concentrations were quantified in normal dogs and dogs with OS and its utility as a bone resorption marker was evaluated in dogs with OS treated with palliative radiation and antiresorptive agents. Canine OS cells contain preformed CatK within cytoplasmic vesicles. In OS cells, TGFβ1 induced the secretion of CatK, which degraded bone-derived type I collagen in vitro. CatK concentrations were higher in dogs with OS than healthy dogs (11.3 ± 5.2 pmol/L versus 8.1 ± 5.0 pmol/L, P = .03). In a subset of dogs with OS, pretreatment CatK concentrations gradually decreased after palliative radiation and antiresorptive treatment, from 9.3 ± 3.2 pmol/L to 5.0 ± 3.1 pmol/L, P = .03. Canine OS is associated with pathologic bone resorption, and CatK inhibitors might aid in the management of canine OS-related malignant osteolysis. Copyright © 2011 by the American College of Veterinary Internal Medicine.

Epidemiology of canine gastrointestinal helminths in sub-Saharan Africa

Directory of Open Access Journals (Sweden)

Nozyechi Ngulube Chidumayo

2018-02-01

Full Text Available Abstract Background Dogs have a close association with humans providing companionship, security and a source of dietary protein. However, dogs are also potential carriers of zoonotic pathogens. Dogs, therefore, pose a public health risk and a good understanding of canine diseases is important for planning and implementing control measures. The aim of this study was to characterise canine helminthiasis in sub-Saharan Africa using a systematic approach. Methods Pubmed and Google Scholar were searched for relevant primary studies published from 2000. Forty-one eligible studies were included in the meta-analysis. Pooled prevalences were estimated using the quality effects model. Results and conclusions Twenty-six genera of enteric helminths were reported and the pooled estimate of canine helminthiasis was 71% (95% CI: 63–79%. Species of Ancylostoma and Toxocara, causative agents of larva migrans in humans, were the most frequently reported helminths with pooled estimated prevalences of 41% (95% CI: 32–50% and 22% (95% CI: 16–29%, respectively. Dipylidium caninum and Taenia spp. were the most frequently reported cestodes with pooled estimated prevalences of 20% (95% CI: 12–29% and 9% (95% CI: 5–15%, respectively. Trematodes were rarely reported. There was a high level of heterogeneity in most pooled estimates (I2 ˃ 80%. The results of this study show that canine helminthiasis is highly prevalent in sub-Saharan Africa and there is need for regular deworming programmes to improve the health status of the dogs and minimise the potential health risk to humans.

Canine trypanosomosis: Clinical observations and morphological ...

African Journals Online (AJOL)

Clinical and pathological aspects of canine trypanosomosis were determined in naturally infected dogs presented to the Veterinary Teaching Hospital, Federal University of Agriculture, Abeokuta, at different times between 2012 and 2013. The breeds, sexes, ages and body weights of the dogs were recorded. Clinical signs ...

The unerupted maxillary canine - a post-surgical review.

LENUS (Irish Health Repository)

O'Dowling, Ian

2009-10-01

The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.

The unerupted maxillary canine--a post-surgical review.

Science.gov (United States)

O'Dowling, Ian

2009-01-01

The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.

Canine distemper spillover in domestic dogs from urban wildlife.

Science.gov (United States)

Kapil, Sanjay; Yeary, Teresa J

2011-11-01

Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.

Relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction

Directory of Open Access Journals (Sweden)

Anísio Bueno de Carvalho

2012-12-01

Full Text Available OBJECTIVE: The purpose was to obtain information about the relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction. METHODS: Seventy-three patients with canine impaction and 73 control patients, without canine impaction, were evaluated. The mesiodistal distances of the maxillary lateral incisors adjacent to the impacted canines and the correspondent mandibular lateral incisors were measured. The adjacent lateral incisors were classified in: 1 - absent, 2 - small, 3 - peg-shaped, 4 - standard. RESULTS: The results showed that among the patients with impacted canines, there were 21 anomalous teeth (small and peg-shaped and among the control patients there were only three small and peg-shaped teeth, with a statistically significant difference (p = 0.001. No patients were found with impacted canines and absent lateral incisors. CONCLUSION: It was concluded that in patients with anomalous lateral incisors (small and peg-shaped there is a probability to present impacted canines and this must be considered.OBJETIVO: o objetivo foi obter informação sobre a relação existente entre a agenesia e/ou anomalia de forma de incisivos laterais superiores e impacção de caninos. MÉTODOS: foram avaliados 73 pacientes com impacção de caninos e 73 pacientes controle, sem impacção de caninos. Foram medidas as distâncias mesiodistais dos incisivos laterais superiores adjacentes aos caninos impactados e os incisivos laterais correspondentes inferiores. Os incisivos laterais adjacentes foram classificados em: 1 - ausentes; 2 - pequenos; 3 - conoides; 4 - normais. RESULTADOS: os resultados mostraram que no grupo de pacientes com caninos impactados foram encontrados 22 dentes anômalos (pequenos e conoides, e no grupo controle apenas três dentes pequenos e conoides, sendo uma diferença estatisticamente significativa (p=0,001. Não foram encontrados pacientes com canino impactado e incisivo lateral ausente. CONCLUS�

Vulnerability of cultured canine lung tumor cells to NK cell-mediated cytolysis

International Nuclear Information System (INIS)

Haley, P.J.; Kohr, J.M.; Kelly, G.; Muggenburg, B.A.; Guilmette, B.A.

1988-01-01

Five cell lines, designated as canine lung epithelial cell (CLEP), derived from radiation induced canine lung tumors and canine thyroid adeno-carcinoma (CTAC) cells were compared for their susceptibility to NK cell-mediated cytolysis using peripheral blood lymphocytes from normal, healthy Beagle dogs as effector cells. Effector cells and chromium 51 radiolabeled target cells were incubated for 16 h at ratios of 12.5:1, 25:1, 50:1, and 100:1. Increasing cytolysis was observed for all cell lines as the effector-to-target-cell ratios increased from 12.5:1 to 100:1. The percent cytotoxicity was significantly less for all lung tumor cell lines as compared to CTAC at the 100:1 ratio. One lung tumor cell line, CLEP-9, had 85% of the lytic vulnerability of the CTAC cell line and significantly greater susceptibility to NK cell-mediated lysis than all of the other lung tumor cell lines. Susceptibility to NK cell cytolysis did not correlate with in vivo malignant behavior of the original tumor. These data suggest that cultured canine lung tumor cells are susceptible to NK cell cytolytic activity in vitro and that at least one of these cell lines (CLEP-9) is a candidate for substitution of the standard canine NK cell target, CTAC, in NK cell assays. The use of lung tumor cells in NK cell assays may provide greater insight into the control of lung tumors by immune mechanisms. (author)

Panoramic radiological study to identify locally displaced maxillary canines in Bangladeshi population

International Nuclear Information System (INIS)

Alif, Sheikh Mohammad; Haque, Sejuty; Nimmi, Naima; Ashraf, Ali; Khan, Saeed Hossain; Khan, Mahfujul Haq

2011-01-01

This study was performed to determine the prevalence of maxillary canine impaction on a basis of a single panoramic radiograph in Bangladeshi population. A random sample of seven hundred panoramic radiographs was collected from the patient record of a dental clinic. All the selected panoramic radiographs were taken from January 2009 to August 2010 by a single panoramic radiograph machine with the same exposure time (19 seconds) for all radiographs. One hundred and twenty panoramic radiographs were excluded to minimize the selection bias. In a dim lit room, an observer assessed the radiographs on a standard radiographic light box. The position of the impacted maxillary canine was recorded in line with the longitudinal axis of a tooth using the edge of a metal ruler. Data were subsequently put on SPSS 11.5 software and chi-square (x 2 ) tests were applied to find out the association. Among 580 panoramic radiographs it was found that impacted maxillary canines were present in only 7 (1.2%) radiographs. A statistical significant difference was found between the age of the patients and the vertical position of the impacted canines (p=0.000) and between the age of the patients and the horizontal position of the impacted canines (p=0.003). The prevalence was found to be low compared with the present study from the limitation of panoramic image. Further study needs to include three-dimensional imaging modality.

A comparative study between mixed-type tumours from human salivary and canine mammary glands

International Nuclear Information System (INIS)

Genelhu, Marisa CLS; Cardoso, Sérgio V; Gobbi, Helenice; Cassali, Geovanni D

2007-01-01

In comparative pathology, canine mammary tumours have special interest because of their similarities with human breast cancer. Mixed tumours are uncommon lesions in the human breast, but they are found most frequently in the mammary gland of the female dogs and in the human salivary glands. The aim of the study was to compare clinical, morphological and immunohistochemical features of human salivary and canine mammary gland mixed tumours, in order to evaluate the latter as an experimental model for salivary gland tumours. Ten examples of each mixed tumour type (human pleomorphic adenoma and carcinomas ex-pleomorphic adenomas and canine mixed tumour and metaplastic carcinoma) were evaluated. First, clinical and morphologic aspects of benign and malignant variants were compared between the species. Then, streptavidin-biotin-peroxidase immunohistochemistry was performed to detect the expression of cytokeratins, vimentin, p63 protein, estrogen receptor, β-catenin, and E-cadherin. After standardization, similar age and site distributions were observed in human and canine tumours. Histological similarities were identified in the comparison of the benign lesions as well. Metaplastic carcinomas also resembled general aspects of carcinomas ex-pleomorphic adenomas in morphological evaluation. Additionally, immunohistochemical staining further presented similar antigenic expression between lesions. There are many similar features between human salivary and canine mammary gland mixed tumours. This observation is of great relevance for those interested in the study and management of salivary gland tumours, since canine lesions may constitute useful comparative models for their investigations

Immunohistochemical expression study of proapoptotic BH3-only protein bad in canine nonneoplastic tissues and canine lymphomas.

Science.gov (United States)

Dettwiler, M; Croci, M; Vaughan, L; Guscetti, F

2013-09-01

The BH3-only protein Bad is a proapoptotic Bcl-2 family member that acts as a sensitizer in intrinsic apoptosis by inactivating antiapoptotic members through heterodimer formation. Bad has been shown to contribute to tumorigenesis, including lymphoma formation in humans and mice, through alteration in expression or functional status. Here, its immunohistochemical expression was analyzed in canine nonneoplastic and lymphoma tissues using tissue microarrays. Bad was expressed in the cytoplasm of a wide range of nonneoplastic tissues, especially epithelial cells. Nonneoplastic lymph nodes displayed weak immunostaining in the follicular germinal centers only. Immunoblotting supported these observations but also revealed presence of nonspecific labeling in some organs. Of 81 lymphomas, 29 (35.8%) displayed moderate to strong immunohistochemical Bad labeling, and a significant expression increase was found in lymphomas (especially B cell and double negative) compared to nonneoplastic lymph nodes. These findings warrant further investigations of the functional status, the involvement of partner proteins, and a possible impact of Bad on prognosis in canine lymphoma.

Detection of canine distemper virus nucleocapsid protein gene in canine peripheral blood mononuclear cells by RT-PCR.

Science.gov (United States)

Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T

1995-06-01

For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.

Cytotoxic action of Brazilian propolis in vitro on canine osteosarcoma cells.

Science.gov (United States)

Cinegaglia, N C; Bersano, P R O; Búfalo, M C; Sforcin, J M

2013-09-01

Osteosarcoma (OSA) is a primary bone neoplasm frequently diagnosed in dogs. The biology of OSA in pet dogs is identical to that of pediatric patients, and it has been considered an excellent model in vivo to study human OSA. Since the individual response to chemotherapy is unpredictable and considering that propolis is a natural product with several biological properties, this work evaluated the cytotoxic action of propolis on canine OSA cells. The primary cell culture of canine OSA was obtained from the tumor of a dog with OSA. Cell viability was assessed after incubation with propolis, 70% ethanol (propolis solvent), and carboplatin after 6, 24, 48, and 72 h. Cell viability was analyzed by the crystal violet method. Data showed that canine OSA cells were sensitive to propolis in a dose- and time-dependent manner and had a distinct morphology compared to control. Its solvent (70% ethanol) had no effect on cell viability, suggesting that the cytotoxic action was exclusively due to propolis. Our propolis sample exerted a cytotoxic effect on canine OSA cells, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment. Copyright © 2012 John Wiley & Sons, Ltd.

Mechanical properties of canine osteosarcoma-affected antebrachia.

Science.gov (United States)

Steffey, Michele A; Garcia, Tanya C; Daniel, Leticia; Zwingenberger, Allison L; Stover, Susan M

2017-05-01

To determine the influence of neoplasia on the biomechanical properties of canine antebrachia. Ex vivo biomechanical study. Osteosarcoma (OSA)-affected canine antebrachia (n = 12) and unaffected canine antebrachia (n = 9). Antebrachia were compressed in axial loading until failure. A load-deformation curve was used to acquire the structural mechanical properties of neoplastic and unaffected specimens. Structural properties and properties normalized by body weight (BW) and radius length were compared using analysis of variance (ANOVA). Modes of failure were compared descriptively. Neoplastic antebrachia fractured at, or adjacent to, the OSA in the distal radial diaphysis. Unaffected antebrachia failed via mid-diaphyseal radial fractures with a transverse cranial component and an oblique caudal component. Structural mechanical properties were more variable in neoplastic antebrachia than unaffected antebrachia, which was partially attributable to differences in bone geometry related to dog size. When normalized by dog BW and radial length, strength, stiffness, and energy to yield and failure, were lower in neoplastic antebrachia than in unaffected antebrachia. OSA of the distal radial metaphysis in dogs presented for limb amputation markedly compromises the structural integrity of affected antebrachia. However, biomechanical properties of affected bones was sufficient for weight-bearing, as none of the neoplastic antebrachia fractured before amputation. The behavior of tumor invaded bone under cyclic loading warrants further investigations to evaluate the viability of in situ therapies for bone tumors in dogs. © 2017 The American College of Veterinary Surgeons.

Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro

Directory of Open Access Journals (Sweden)

Cintia Xavier de Mello

2014-12-01

Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.

Assessment of Periodontal Status of Surgically Exposed and Orthodontically Aligned Impacted Maxillary Canines

Directory of Open Access Journals (Sweden)

Adina Coșarcă

2014-02-01

Full Text Available Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of teeth. Conclusions: The assessed periodontal indices may signal the appearance of a periodontal disease around the teeth that were surgically and orthodontically treated

Canine Distemper Viral Inclusions in Blood Cells of Four Vaccinated Dogs

OpenAIRE

McLaughlin, Bruce G.; Adams, Pamela S.; Cornell, William D.; Elkins, A. Darrel

1985-01-01

Four cases of canine distemper were detected by the presence of numerous cytoplasmic inclusions in various circulating blood cells. Fluorescent antibody techniques and electron microscopy confirmed the identity of the viral inclusions. The cases occurred in the same geographic area and within a short time span. All four dogs had been vaccinated against canine distemper, but stress or other factors may have compromised their immune status. The possibility of an unusually virulent virus strain ...

BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

Science.gov (United States)

Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B

2015-01-01

BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

Nd : YAG surgical laser effects in canine prostate tissue: temperature and damage distribution

NARCIS (Netherlands)

van Nimwegen, S. A.; L'Eplattenier, H. F.; Rem, A. I.; van der Lugt, J. J.; Kirpensteijn, J.

2009-01-01

An in vitro model was used to predict short-term, laser-induced, thermal damage in canine prostate tissue. Canine prostate tissue samples were equipped with thermocouple probes to measure tissue temperature at 3, 6, 9 and 12 mm depths. The tissue surface was irradiated with a Nd:YAG laser in contact

Assessment of Growth Using Mandibular Canine Calcification Stages and Its Correlation with Modified MP3 Stages.

Science.gov (United States)

Nayak, Reshma; Nayak, Us Krishna; Hegde, Gautam

2010-01-01

Orthodontic diagnosis and treatment planning for growing children must involve growth prediction, especially in the treatment of skeletal problems. Studies have shown that a strong association exists between skeletal maturity and dental calcification stages. The present study was therefore taken up to provide a simple and practical method for assessing skeletal maturity using a dental periapical film and standard dental X-ray machine, to compare the developmental stages of the mandibular canine with that of developmental stages of modified MP3 and to find out if any correlation exists, to determine if the developmental stages of the mandibular canine alone can be used as a reliable indicator for assessment of skeletal maturity. A total of 160 periapical radiographs (80 males and 80 females), of the mandibular right canine and the MP3 region was taken and assessed according to the Dermirjian's stages of dental calcification and the modified MP3 stages. The correlation between the developmental stages of MP3 and the mandibular right canine in male and female groups, is of high statistical significance (p = 0.001). The correlation coefficient between MP3 stages and developmental stages of mandibular canine and chronological age in male and females was found to be not significant. The correlation between the mandibular canine calcification stages and MP3 stages was found to be significant. The developmental stages of the mandibular canine could be used very reliably as a sole indicator for assessment of skeletal maturity.

A CBCT Investigation of the Association between Sella-Turcica Bridging and Maxillary Palatal Canine Impaction

Directory of Open Access Journals (Sweden)

Pamela M. Ortiz

2018-01-01

Full Text Available Objectives. To investigate the association between unilateral/bilateral maxillary canine impaction and sella-turcica bridging using CBCT imaging. Methods. This retrospective comparative study analyzed 76 CBCT images of the craniofacial complex including sella-turcica. The impacted cuspid group consisted of thirty-eight subjects (7 males, 31 females; mean age, 14.6 ± 3.2 years diagnosed with unilateral (left n=14, right n=11 or bilateral (n=13 palatal canine impaction. The control group included thirty-eight subjects matched by sex (7 males, 31 females; mean age, 19.5 ± 3.6 years with no impaction. Multinomial logistic regression analysis was used to determine the association between unilateral/bilateral canine impaction and right and left sella-turcica bridging. Results. The prevalence of sella-turcica bridging was 59.3% and 50% in the impacted canine and control groups, respectively. Although the odds for unilateral canine impaction were increased in the right and left sella-turcica bridging groups compared to the controls, the difference was not statistically significant. The risk of bilateral impaction was different between the two sides of sella-turcica bridging, but, again, the findings were not statistically significant. Conclusion. Contrary to previous 2D studies, there is no statistically significant association between unilateral/bilateral palatal canine impaction and sella-turcica bridging when using 3D CBCT.

Stimulation with Concanavalin-A Induces IL-17 Production by Canine Peripheral T Cells

Directory of Open Access Journals (Sweden)

Michelle G. Ritt

2015-04-01

Full Text Available The characteristics of canine IL-17-producing cells are incompletely understood. Expression of mRNA encoding orthologs of IL-17 and the IL-17 receptor has been documented in tissues from dogs with arthritis, inflammatory bowel disease, and lymphoma; however, no associations have been found between IL-17 gene expression and disease phenotype in these conditions. Robust assessment of the role of IL-17-producing cells in dogs will require measuring the frequency of these cells in health and disease in balance with other lymphocyte subsets. The aim of this study was to confirm that the T-cell IL-17 response in dogs is evolutionarily conserved. Canine peripheral blood mononuclear cells were stimulated with Concanavalin A with or without polarizing cytokines. We used a canine specific IL-17 ELISA and flow cytometry to identify IL-17-producing T cells. Accumulation of intracellular IL-17 was observed in stimulated CD4 and CD8 T cells. The addition of pro-inflammatory cytokines appeared to enhance polarization of canine CD4 T cells to the Th17 phenotype. Conversely, the addition of IL-2 in the presence of TGF-β resulted in expansion of Treg cells. We conclude that canine IL-17-producing cells behave similarly to those from humans and mice when stimulated with mitogens and polarized with pro-inflammatory or immune regulatory cytokines.

Automation of gender determination in human canines using artificial intelligence

Directory of Open Access Journals (Sweden)

F. Fidya

2017-09-01

Full Text Available Background: Gender determination is an important aspect of the identification process. The tooth represents a part of the human body that indicates the nature of sexual dimorphism. Artificial intelligence enables computers to perform to the same standard the same tasks as those carried out by humans. Several methods of classification exist within an artificial intelligence approach to identifying sexual dimorphism in canines. Purpose: This study aimed to quantify the respective accuracy of the Naive Bayes, decision tree, and multi-layer perceptron (MLP methods in identifying sexual dimorphism in canines. Methods: A sample of results derived from 100 measurements of the diameter of mesiodistal, buccolingual, and diagonal upper and lower canine jaw models of both genders were entered into an application computer program that implements the algorithm (MLP. The analytical process was conducted by the program to obtain a classification model with testing being subsequently carried out in order to obtain 50 new measurement results, 25 each for males and females. A comparative analysis was conducted on the program-generated information. Results: The accuracy rate of the Naive Bayes method was 82%, while that of the decision tree and MLP amounted to 84%. The MLP method had an absolute error value lower than that of its decision tree counterpart. Conclusion: The use of artificial intelligence methods produced a highly accurate identification process relating to the gender determination of canine teeth. The most appropriate method was the MLP with an accuracy rate of 84%.

Experimental research of covered stent implanted in canine hepatic artery

International Nuclear Information System (INIS)

Zhou Bing; Liu Linxiang; Li Minghua; Wang Yongli; Cheng Yongde

2007-01-01

Objective: To evaluate the feasibility of success rate of implantation, post-procedure stenosis rate, apposition ability and endothelialization level, etc. for implantation with balloon-expandable covered stent in canine hepatic artery. Methods: 8 adult canines were implanted with balloon-expendable stents covered by expandable poly Teflon ester membrane (e-PTFEM). Follow-up DSA was performed immediately, 2, 4 and 12 wk after the procedure. The canines were sacrificed for histopathologic examination and statistical analysis with correlation of implantation manenvor and angiographic manifestations. Results: 8 cases were all implanted with the covered stents in proper hepatic artery/right hepatic artery successfully; showing good apposition ability and non-opacification of the separated branches. 2 cases showed intraluminal obvious stenosis( > 50%)of the stent at 2 weeks follow-up, so did 3 cases at 12 weeks follow-up, and the total stenosis rate was 37.5% and 5 cases manifested full endothelialization (3 different locations of the sample all manifested full endothelialization), 3 cased manifested partial endothelialization (at least 1 location of the sample didn't show full endothelialization), and the two terminal parts were easier to get endothelialization than the central part. Before and after the stent implantation, hepatic function of all cases didn't demonstrate any obvious changes. Conclusions: Balloon-expandable covered stent can be implanted in canine hepatic artery. successfully, with good apposition ability, full endothelialization, and no influence on hepatic function. (authors)

Extrusion processing : effects on dry canine diets

NARCIS (Netherlands)

Tran, Q.D.

2008-01-01

Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying.

Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the

Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

International Nuclear Information System (INIS)

Pang, Lisa Y.; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J.

2011-01-01

Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology

Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

Energy Technology Data Exchange (ETDEWEB)

Pang, Lisa Y., E-mail: lisa.pang@ed.ac.uk; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J. [Royal (Dick) School of Veterinary Studies and Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG (United Kingdom)

2011-03-30

Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology.

Effect of rapid maxillary expansion and transpalatal arch treatment associated with deciduous canine extraction on the eruption of palatally displaced canines: A 2-center prospective study.

Science.gov (United States)

Sigler, Lauren M; Baccetti, Tiziano; McNamara, James A

2011-03-01

Our aim was to investigate the effect of rapid maxillary expansion and transpalatal arch therapy combined with deciduous canine extraction on the eruption rate of palatally displaced canines (PDCs) in patients in the late mixed dentition in a 2-center prospective study. Seventy subjects were enrolled based on PDCs diagnosed on panoramic radiographs. The treatment group (TG, 40 subjects) underwent RME followed by TPA therapy and extraction of the deciduous canines. The control group (CG, 30 subjects) received no orthodontic treatment. At the start of the trial, panoramic radiographs and dental casts were compared between the TG and the CG with the Mann-Whitney U test (P anomalies was reported. No statistically significant difference was found for any measurement at the start of the trial between the 2 groups. The prevalence rates of eruption of the maxillary canines were 80% for the TG and 28% in the CG, a statistically significant difference (chi-square =16.26, P mixed dentition with PDCs. Pretreatment variables indicating success of treatment on the eruption of PDCs were less severe sectors of displacement, prepubertal stages of skeletal maturity, and open root apices of PDCs. Several dental anomalies were associated significantly with PDCs, thus confirming the genetic etiology of this eruption disturbance. Copyright © 2011 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

Comparative Analysis of Human and Canine Campylobacter upsaliensis Isolates by Amplified Fragment Length Polymorphism

DEFF Research Database (Denmark)

Damborg, Peter; Guardabassi, Luca; Pedersen, Karl

2008-01-01

Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...

To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age.

Science.gov (United States)

Malik, Pooja; Rana, Vivek; Rehani, Usha

2012-01-01

The purpose of this study was to assess skeletal age and establish relationship between mandibular canine calcification and skeletal age. The study included 147 females aged 10 to 13 years. The subjects were divided into three groups: Group I-comprising of 10 to 11 years old female; Group II-comprising of 11 to 12 years old female; Group III-12 to 13 years female. OPG and hand and wrist radiographs of left side for each subject were taken with prior consent of their parents. The calcification status of canine was evaluated from orthopantomograms according to scores given in Demirjian's method. The stages of ossification of various carpal bones were evaluated using radiographic atlas of Greulich-Pyle and skeletal age was calculated. Data collected was statistically analyzed. The results drawn from this study showed that a strong correlation was observed for canine calcification stage F for 10 to 11 years and for stage G in 11 to 12 years and 12 to 13 years respectively. How to cite this article: Malik P, Rana V, Rehani U. To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age. Int J Clin Pediatr Dent 2012;5(1): 14-19.

Identification of a new genotype of canine distemper virus circulating in America.

Science.gov (United States)

Gámiz, César; Martella, Vito; Ulloa, Raúl; Fajardo, Raúl; Quijano-Hernandéz, Israel; Martínez, Simón

2011-08-01

Canine Distemper is a highly contagious viral systemic disease that affects a wide variety of terrestrial carnivores. Canine Distemper virus (CDV) appears genetically heterogeneous, markedly in the hemagglutinin protein (H), showing geographic patterns of diversification that are useful to monitor CDV molecular epidemiology. In Mexico the activity of canine distemper remains high in dogs, likely because vaccine prophylaxis coverage in canine population is under the levels required to control effectively the disease. By phylogenetic analysis based on the nucleoprotein (N) and on the H genes, Mexican CDV strains collected between 2007 and 2010 were distinguished into several genovariants, all which constituted a unique group, clearly distinct from field and vaccine strains circulating worldwide, but resembling a CDV strain, 19876, identified in Missouri, USA, 2004, that was genetically unrelated to other North-American CDV strains. Gathering information on the genetic heterogeneity of CDV on a global scale appears pivotal in order to investigate the origin and modalities of introduction of unusual/novel CDV strains, as well as to understand if vaccine breakthroughs or disease epidemics may be somewhat related to genetic/antigenic or biological differences between field and vaccine strains.

Histologic prognosticators in feline osteosarcoma: a comparison with phenotypically similar canine osteosarcoma.

Science.gov (United States)

Dimopoulou, Maria; Kirpensteijn, Jolle; Moens, Hester; Kik, Marja

2008-07-01

To investigate the histologic characteristics of feline osteosarcoma (OS) and compare the histologic data with phenotypically comparable canine OS. The effects of histologic and clinical variables on survival statistics were evaluated. Retrospective study. Cats (n=62) and dogs (22). Medical records of 62 cats with OS were reviewed for clinically relevant data. Clinical outcome was obtained by telephone interview. Histologic characteristics of OS were classified using a standardized grading system. Histologic characteristics in 22 feline skeletal OS were compared with 22 canine skeletal OS of identical location and subtype. Prognostic variables for clinical outcome were determined using multivariate analysis. Feline OS was characterized by moderate to abundant cellular pleomorphism, low mitotic index, small to moderate amounts of matrix, high cellularity, and a moderate amount of necrosis. There was no significant difference between histologic variables in feline and canine OS. Histologic grade, surgery, and mitotic index significantly influenced clinical outcome as determined by multivariate analysis. Tumor invasion into vessels was not identified as a significant prognosticator. Feline and canine skeletal OS have similar histologic but different prognostic characteristics. Prognosis for cats with OS is related to histologic grade and mitotic index of the tumor.

Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012-2013.

Science.gov (United States)

Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted; Andresen, Lars; Chrièl, Mariann; Hagberg, Emma; Jensen, Mette Kragh; Hansen, Mette Sif; Hjulsager, Charlotte Kristiane; Struve, Tina

2015-09-30

During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit in biosecurity on the mink farms. The aim of this study was to investigate the extent and association of specific biosecurity measures with the outbreak. The study was carried out in an epidemiological case-control design. The case group consisted of the 61 farms, which had a confirmed outbreak of canine distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case farms, indicating that the control farms had a better biosecurity or were not equally exposed to canine distemper virus. Generally, all farms had very few specific precautions at the gate entrance in respect to human visitors as well as animals. The use of biosecurity measures was very variable in both case and control farms. Not using plastic boot covers, presence of dogs and cats, presence of demarcated area for changing clothes when entering and leaving the farm area and presence of hand washing facilities significantly lowered the odds of the farm having a canine distemper virus outbreak. The results of the study indicate that consistent use of correct vaccination strategies, implementation of biosecurity measures and limiting human and animal access to the mink farm can be

A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article

Directory of Open Access Journals (Sweden)

S. Gur

2009-05-01

Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.

The effects of sulforaphane on canine osteosarcoma proliferation and invasion.

Science.gov (United States)

Rizzo, V L; Levine, C B; Wakshlag, J J

2017-09-01

Recent evidence in in vitro and in vivo models suggests that sulforaphane (SFN), found in raw cruciferous vegetables, may have utility in chemoprevention, as an antineoplastic agent and as a free radical scavenger. The effects of SFN alone or with doxorubicin on cell viability were examined, as well as cell cycle kinetics, invasion capabilities and apoptosis in three canine osteosarcoma cell line (D17, OS 2.4 and HMPOS). Results showed that SFN could not induce cell death at potentially physiological concentrations (canine osteosarcoma. © 2016 John Wiley & Sons Ltd.

Construct canine intracranial aneurysm model by endovascular technique

International Nuclear Information System (INIS)

Liang Xiaodong; Liu Yizhi; Ni Caifang; Ding Yi

2004-01-01

Objective: To construct canine bifurcation aneurysms suitable for evaluating the exploration of endovascular devices for interventional therapy by endovascular technique. Methods: The right common carotid artery of six dogs was expanded with a pliable balloon by means of endovascular technique, then embolization with detached balloon was taken at their originations DAS examination were performed on 1, 2, 3 d after the procedurse. Results: 6 aneurysm models were created in six dogs successfully with the mean width and height of the aneurysms decreasing in 3 days. Conclusions: This canine aneurysm model presents the virtue in the size and shape of human cerebral bifurcation saccular aneurysms on DSA image, suitable for developing the exploration of endovascular devices for aneurismal therapy. The procedure is quick, reliable and reproducible. (authors)

Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

Energy Technology Data Exchange (ETDEWEB)

Kim, Jong-Hyuk, E-mail: jhkim@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Robinson, Sally [Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Sharkey, Leslie C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); O' Brien, Timothy D. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Dickerson, Erin B. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Modiano, Jaime F., E-mail: modiano@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States)

2014-04-15

Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

International Nuclear Information System (INIS)

Kim, Jong-Hyuk; Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C.; Robinson, Sally; Sharkey, Leslie C.; O'Brien, Timothy D.; Dickerson, Erin B.; Modiano, Jaime F.

2014-01-01

Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

Distinct fermentation and antibiotic sensitivity profiles exist in salmonellae of canine and human origin.

Science.gov (United States)

Wallis, Corrin V; Lowden, Preena; Marshall-Jones, Zoe V; Hilton, Anthony C

2018-02-26

Salmonella enterica is a recognised cause of diarrhoea in dogs and humans, yet the potential for transfer of salmonellosis between dogs and their owners is unclear, with reported evidence both for and against Salmonella as a zoonotic pathogen. A collection of 174 S. enterica isolates from clinical infections in humans and dogs were analysed for serotype distribution, carbon source utilisation, chemical and antimicrobial sensitivity profiles. The aim of the study was to understand the degree of conservation in phenotypic characteristics of isolates across host species. Serovar distribution across human and canine isolates demonstrated nine serovars common to both host species, 24 serovars present in only the canine collection and 39 solely represented within the human collection. Significant differences in carbon source utilisation profiles and ampicillin, amoxicillin and chloramphenicol sensitivity profiles were detected in isolates of human and canine origin. Differences between the human and canine Salmonella collections were suggestive of evolutionary separation, with canine isolates better able to utilise several simple sugars than their human counterparts. Generally higher minimum inhibitory concentrations of three broad-spectrum antimicrobials, commonly used in veterinary medicine, were also observed in canine S. enterica isolates. Differential carbon source utilisation and antimicrobial sensitivity profiles in pathogenic Salmonella isolated from humans and dogs are suggestive of distinct reservoirs of infection for these hosts. Although these findings do not preclude zoonotic or anthroponotic potential in salmonellae, the separation of carbon utilisation and antibiotic profiles with isolate source is indicative that infectious isolates are not part of a common reservoir shared frequently between these host species.

Canine and incisor microwear in pitheciids and Ateles reflects documented patterns of tooth use.

Science.gov (United States)

Delezene, Lucas K; Teaford, Mark F; Ungar, Peter S

2016-09-01

Platyrrhine species differ in the extent to and the manner in which they use their incisors and canines during food ingestion. For example, Ateles uses its anterior teeth to process mechanically nondemanding soft fruits, while the sclerocarp-harvesting pitheciids rely extensively on these teeth to acquire and process more demanding foods. Pitheciids themselves vary in anterior tooth use, with the pitheciines (Cacajao, Chiropotes, and Pithecia) noted to use their robust canines in a variety of ways to predate seeds, while Callicebus, which rarely predates seeds, uses its incisors and exceptionally short canines to scrape tough mesocarp from fruits. To investigate the relationship between tooth use and dental wear, microwear textures were investigated for the anterior teeth of these five genera of platyrrhine primates. Using a white light confocal microscope, 12 microwear texture attributes that reflect feature size, anisotropy, density, and complexity were recorded from high-resolution epoxy casts of the incisors and canines of adult wild-collected Brazilian specimens of Ateles, Callicebus, Cacajao, Chiropotes, and Pithecia. Pitheciine canines tend to have deep microwear features and complex, anisotropic microwear textures, while Ateles anterior teeth tend to have very small features, low feature density, and less complex and anisotropic surfaces. Callicebus incisor and canine microwear is generally intermediate in size and complexity between those extremes. These findings align with expectations from reported field observations of tooth use and illustrate the potential for using microwear texture analysis to infer patterns of anterior tooth use in extinct primates. Am J Phys Anthropol 161:6-25, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Development of an Arthroscopic Joint Capsule Injury Model in the Canine Shoulder.

Directory of Open Access Journals (Sweden)

David Kovacevic

Full Text Available The natural history of rotator cuff tears can be unfavorable as patients develop fatty infiltration and muscle atrophy that is often associated with a loss of muscle strength and shoulder function. To facilitate study of possible biologic mechanisms involved in early degenerative changes to rotator cuff muscle and tendon tissues, the objective of this study was to develop a joint capsule injury model in the canine shoulder using arthroscopy.Arthroscopic surgical methods for performing a posterior joint capsulectomy in the canine shoulder were first defined in cadavers. Subsequently, one canine subject underwent bilateral shoulder joint capsulectomy using arthroscopy, arthroscopic surveillance at 2, 4 and 8 weeks, and gross and histologic examination of the joint at 10 weeks.The canine subject was weight-bearing within eight hours after index and follow-up surgeries and had no significant soft tissue swelling of the shoulder girdle or gross lameness. Chronic synovitis and macroscopic and microscopic evidence of pathologic changes to the rotator cuff bony insertions, tendons, myotendinous junctions and muscles were observed.This study demonstrates feasibility and proof-of-concept for a joint capsule injury model in the canine shoulder. Future work is needed to define the observed pathologic changes and their role in the progression of rotator cuff disease. Ultimately, better understanding of the biologic mechanisms of early progression of rotator cuff disease may lead to clinical interventions to halt or slow this process and avoid the more advanced and often irreversible conditions of large tendon tears with muscle fatty atrophy.

Expression of monocarboxylate transporter 1 in oral and ocular canine melanocytic tumors.

Science.gov (United States)

Shimoyama, Y; Akihara, Y; Kirat, D; Iwano, H; Hirayama, K; Kagawa, Y; Ohmachi, T; Matsuda, K; Okamoto, M; Kadosawa, T; Yokota, H; Taniyama, H

2007-07-01

Solid tumors are composed of a heterogeneous population of cells surviving in various concentrations of oxygen. In a hypoxic environment, tumor cells generally up-regulate glycolysis and, therefore, generate more lactate that must be expelled from the cell through proton transporters to prevent intracellular acidosis. Monocarboxylate transporter 1 (MCT1) is a major proton transporter in mammalian cells that transports monocarboxylates, such as lactate and pyruvate, together with a proton across the plasma membrane. Melanocytic neoplasia occurs frequently in dogs, but the prognosis is highly site-dependent. In this study, 50 oral canine melanomas, which were subdivided into 3 histologic subtypes, and 17 ocular canine melanocytic neoplasms (14 melanocytomas and 3 melanomas) were used to examine and compare MCT1 expression. Immunohistochemistry using a polyclonal chicken anti-rat MCT1 antibody showed that most oral melanoma exhibited cell membrane staining, although there were no significant differences observed among the 3 histologic subtypes. In contrast, the majority of ocular melanocytic tumors were not immunoreactive. Additionally, we documented the presence of a 45-kDa band in cell membrane protein Western blots, and sequencing of a reverse transcriptase polymerase chain reaction band of expected size confirmed its identity as a partial canine MCT1 transcript in 3 oral tumors. Increased MCT1 expression in oral melanomas compared with ocular melanocytic tumors may reflect the very different biology between these tumors in dogs. These results are the first to document canine MCT1 expression in canine tumors and suggest that increased MCT1 expression may provide a potential therapeutic target for oral melanoma.

Migrastatin analogues inhibit canine mammary cancer cell migration and invasion.

Directory of Open Access Journals (Sweden)

Kinga Majchrzak

Full Text Available BACKGROUND: Cancer spread to other organs is the main cause of death of oncological patients. Migration of cancer cells from a primary tumour is the crucial step in the complex process of metastasis, therefore blocking this process is currently the main treatment strategy. Metastasis inhibitors derived from natural products, such as, migrastatin, are very promising anticancer agents. Thus, the aim of our study was to investigate the effect of six migrastatin analogues (MGSTA-1 to 6 on migration and invasion of canine mammary adenocarcinoma cell lines isolated from primary tumours and their metastases to the lungs. Canine mammary tumours constitute a valuable tool for studying multiple aspect of human cancer. RESULTS: OUR RESULTS SHOWED THAT TWO OF SIX FULLY SYNTHETIC ANALOGUES OF MIGRASTATIN: MGSTA-5 and MGSTA-6 were potent inhibitors of canine mammary cancer cells migration and invasion. These data were obtained using the wound healing test, as well as trans-well migration and invasion assays. Furthermore, the treatment of cancer cells with the most effective compound (MGSTA-6 disturbed binding between filamentous F-actin and fascin1. Confocal microscopy analyses revealed that treatment with MGSTA-6 increased the presence of unbound fascin1 and reduced co-localization of F-actin and fascin1 in canine cancer cells. Most likely, actin filaments were not cross-linked by fascin1 and did not generate the typical filopodial architecture of actin filaments in response to the activity of MGSTA-6. Thus, administration of MGSTA-6 results in decreased formation of filopodia protrusions and stress fibres in canine mammary cancer cells, causing inhibition of cancer migration and invasion. CONCLUSION: Two synthetic migrastatin analogues (MGSTA-5 and MGSTA-6 were shown to be promising compounds for inhibition of cancer metastasis. They may have beneficial therapeutic effects in cancer therapy in dogs, especially in combination with other anticancer drugs

Detection of Ammonium Nitrate Variants by Canine: A Study of Generalization between Like Substances

Science.gov (United States)

2018-04-30

Memorandum Report Homemade explosive Detector dog Canine behavior/ learning Ammonium nitrate Canine training 61-4687-08 Office...varying temperatures and humidities...presence of contaminants, the form in which the AN is found (i.e. prill, ground, or crystalline), and environmental conditions (i.e. temperature and

Nasolacrimal obstruction caused by root abscess of the upper canine in a cat.

Science.gov (United States)

Anthony, James M G; Sandmeyer, Lynne S; Laycock, Amanda R

2010-03-01

A 10-year-old, castrated male domestic short hair cat was presented to the Small Animal Clinic at the Western College of Veterinary Medicine with a presenting complaint of chronic, ocular discharge from the left eye. Ocular examination confirmed epiphora and mucopurulent discharge but there were no apparent reasons for the ocular discharge, and nasolacrimal obstruction was suspected. The cat had swelling of the left side of the face, severe periodontal disease and a fractured upper left canine tooth with pulpal exposure. Dacryocystorhinography revealed narrowing of the nasolacrimal duct above the root of the fractured upper left canine and dental radiographs showed a severe periapical lucency at the apex of the upper left canine tooth. The fractured canine tooth was removed. Subsequently, the ocular discharge and facial swelling resolved. After 2 years, the epiphora has never reoccurred. This is a noteworthy case because a suspected root abscess resulted in extralumenal compression of the nasolacrimal duct, which shows the importance of a thorough oral examination when nasolacrimal obstruction is evident.

Characterization of STAT3 activation and expression in canine and human osteosarcoma

Directory of Open Access Journals (Sweden)

Li Pui-Kai

2009-03-01

Full Text Available Abstract Background Dysregulation of signal transducer and activator of transcription 3 (STAT3 has been implicated as a key participant in tumor cell survival, proliferation, and metastasis and is often correlated with a more malignant tumor phenotype. STAT3 phosphorylation has been demonstrated in a subset of human osteosarcoma (OSA tissues and cell lines. OSA in the canine population is known to exhibit a similar clinical behavior and molecular biology when compared to its human counterpart, and is often used as a model for preclinical testing of novel therapeutics. The purpose of this study was to investigate the potential role of STAT3 in canine and human OSA, and to evaluate the biologic activity of a novel small molecule STAT3 inhibitor. Methods To examine STAT3 and Src expression in OSA, we performed Western blotting and RT-PCR. OSA cells were treated with either STAT3 siRNA or small molecule Src (SU6656 or STAT3 (LLL3 inhibitors and cell proliferation (CyQUANT, caspase 3/7 activity (ELISA, apoptosis (Western blotting for PARP cleavage and/or viability (Wst-1 were determined. Additionally, STAT3 DNA binding after treatment was determined using EMSA. Expression of STAT3 targets after treatment was demonstrated with Western blotting, RT-PCR, or gel zymography. Results Our data demonstrate that constitutive activation of STAT3 is present in a subset of canine OSA tumors and human and canine cell lines, but not normal canine osteoblasts. In both canine and human OSA cell lines, downregulation of STAT3 activity through inhibition of upstream Src family kinases using SU6656, inhibition of STAT3 DNA binding and transcriptional activities using LLL3, or modulation of STAT3 expression using siRNA, all resulted in decreased cell proliferation and viability, ultimately inducing caspase-3/7 mediated apoptosis in treated cells. Furthermore, inhibition of either Src or STAT3 activity downregulated the expression of survivin, VEGF, and MMP2, all known

Characterization of STAT3 activation and expression in canine and human osteosarcoma

International Nuclear Information System (INIS)

Fossey, Stacey L; Liao, Albert T; McCleese, Jennifer K; Bear, Misty D; Lin, Jiayuh; Li, Pui-Kai; Kisseberth, William C; London, Cheryl A

2009-01-01

Dysregulation of signal transducer and activator of transcription 3 (STAT3) has been implicated as a key participant in tumor cell survival, proliferation, and metastasis and is often correlated with a more malignant tumor phenotype. STAT3 phosphorylation has been demonstrated in a subset of human osteosarcoma (OSA) tissues and cell lines. OSA in the canine population is known to exhibit a similar clinical behavior and molecular biology when compared to its human counterpart, and is often used as a model for preclinical testing of novel therapeutics. The purpose of this study was to investigate the potential role of STAT3 in canine and human OSA, and to evaluate the biologic activity of a novel small molecule STAT3 inhibitor. To examine STAT3 and Src expression in OSA, we performed Western blotting and RT-PCR. OSA cells were treated with either STAT3 siRNA or small molecule Src (SU6656) or STAT3 (LLL3) inhibitors and cell proliferation (CyQUANT), caspase 3/7 activity (ELISA), apoptosis (Western blotting for PARP cleavage) and/or viability (Wst-1) were determined. Additionally, STAT3 DNA binding after treatment was determined using EMSA. Expression of STAT3 targets after treatment was demonstrated with Western blotting, RT-PCR, or gel zymography. Our data demonstrate that constitutive activation of STAT3 is present in a subset of canine OSA tumors and human and canine cell lines, but not normal canine osteoblasts. In both canine and human OSA cell lines, downregulation of STAT3 activity through inhibition of upstream Src family kinases using SU6656, inhibition of STAT3 DNA binding and transcriptional activities using LLL3, or modulation of STAT3 expression using siRNA, all resulted in decreased cell proliferation and viability, ultimately inducing caspase-3/7 mediated apoptosis in treated cells. Furthermore, inhibition of either Src or STAT3 activity downregulated the expression of survivin, VEGF, and MMP2, all known transcriptional targets of STAT3. These data

Orthodontic and surgical approach to the treatment of bilaterally impacted maxillary canines: a case report.

Science.gov (United States)

Ertan Erdinc, Aslihan M

2008-01-01

Impaction of maxillary canines is a common orthodontic anomaly that causes facial and dentoalveolar system problems, both functional and esthetic. A combination of surgery and orthodontics is important in bringing impacted canines to their ideal position in the dental arch. In this case report of a 14-year-old patient with impacted right and left maxillary canines, the crowns of these teeth were surgically exposed, brackets were bonded, and light orthodontic forces were delivered for 2 years to align the teeth in the dental arch.

Biomechanical characteristics of self-ligating brackets in a vertically displaced canine model: a finite element analysis.

Science.gov (United States)

Kim, S-J; Kwon, Y-H; Hwang, C-J

2016-05-01

The objective of this study was to compare the biomechanical characteristics between two types of self-ligating brackets and conventional metal brackets using finite element analysis of a vertically displaced canine model focusing on the desired force on the canine and undesirable forces on adjacent teeth. Three-dimensional finite element models of the maxillary dentition with 1-mm, 2-mm, and 3-mm vertically displaced canines were constructed. Two different self-ligating brackets (In-Ovation C and Smart clip) and a conventional metal bracket (Micro-arch) were modeled. After a 0.016-inch NiTi (0.40 mm, round) wire was engaged, the displacement of each tooth was calculated using x-, y-, and z-coordinates, and the tensile and compressive stresses were calculated. The extrusion and maximal tensile stress of the canine differed little between the three brackets, but the intrusion and minimal compressive stress values of the adjacent teeth differed considerably and were highest in the Smart clip and least in the In-Ovation C. The extrusion and maximal tensile stress of the canine in the 3-mm displacement model was less than that in the 2-mm displacement model, and the intrusion and minimal compressive stress of the adjacent teeth increased with the degree of displacement. Self-ligating brackets were not superior to conventional brackets in leveling a vertically displaced canine. A continuous arch wire may not be recommended for leveling of severely displaced canines whether using self-ligating or conventional brackets. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Comparison of 2 electrophoretic methods and a wet-chemistry method in the analysis of canine lipoproteins.

Science.gov (United States)

Behling-Kelly, Erica

2016-03-01

The evaluation of lipoprotein metabolism in small animal medicine is hindered by the lack of a gold standard method and paucity of validation data to support the use of automated chemistry methods available in the typical veterinary clinical pathology laboratory. The physical and chemical differences between canine and human lipoproteins draw into question whether the transference of some of these human methodologies for the study of canine lipoproteins is valid. Validation of methodology must go hand in hand with exploratory studies into the diagnostic or prognostic utility of measuring specific lipoproteins in veterinary medicine. The goal of this study was to compare one commercially available wet-chemistry method to manual and automated lipoprotein electrophoresis in the analysis of canine lipoproteins. Canine lipoproteins from 50 dogs were prospectively analyzed by 2 electrophoretic methods, one automated and one manual method, and one wet-chemistry method. Electrophoretic methods identified a higher proportion of low-density lipoproteins than the wet-chemistry method. Automated electrophoresis occasionally failed to identify very low-density lipoproteins. Wet-chemistry methods designed for evaluation of human lipoproteins are insensitive to canine low-density lipoproteins and may not be applicable to the study of canine lipoproteins. Automated electrophoretic methods will likely require significant modifications if they are to be used in the analysis of canine lipoproteins. Studies aimed at determining the impact of a disease state on lipoproteins should thoroughly investigate the selected methodology prior to the onset of the study. © 2016 American Society for Veterinary Clinical Pathology.

A comparison of Helicobacter pylori and non-Helicobacter pylori Helicobacter spp. Binding to canine gastric mucosa with defined gastric glycophenotype.

Science.gov (United States)

Amorim, Irina; Freitas, Daniela P; Magalhães, Ana; Faria, Fátima; Lopes, Célia; Faustino, Augusto M; Smet, Annemieke; Haesebrouck, Freddy; Reis, Celso A; Gärtner, Fátima

2014-08-01

The gastric mucosa of dogs is often colonized by non-Helicobacter pylori helicobacters (NHPH), while H. pylori is the predominant gastric Helicobacter species in humans. The colonization of the human gastric mucosa by H. pylori is highly dependent on the recognition of host glycan receptors. Our goal was to define the canine gastric mucosa glycophenotype and to evaluate the capacity of different gastric Helicobacter species to adhere to the canine gastric mucosa. The glycosylation profile in body and antral compartments of the canine gastric mucosa, with focus on the expression of histo-blood group antigens was evaluated. The in vitro binding capacity of FITC-labeled H. pylori and NHPH to the canine gastric mucosa was assessed in cases representative of the canine glycosylation pattern. The canine gastric mucosa lacks expression of type 1 Lewis antigens and presents a broad expression of type 2 structures and A antigen, both in the surface and glandular epithelium. Regarding the canine antral mucosa, H. heilmannii s.s. presented the highest adhesion score whereas in the body region the SabA-positive H. pylori strain was the strain that adhered more. The canine gastric mucosa showed a glycosylation profile different from the human gastric mucosa suggesting that alternative glycan receptors may be involved in Helicobacter spp. binding. Helicobacter pylori and NHPH strains differ in their ability to adhere to canine gastric mucosa. Among the NHPH, H. heilmannii s.s. presented the highest adhesion capacity in agreement with its reported colonization of the canine stomach. © 2014 John Wiley & Sons Ltd.

uPAR EXPRESSION IN CANINE NORMAL PROSTATE AND WITH PROLIFERATIVE DISORDERS

Directory of Open Access Journals (Sweden)

Mariana Rodrigues Faleiro

2013-06-01

Full Text Available Prostatic lesions such as prostatic intraepithelial neoplasia (PIN and proliferative inflammatory atrophy (PIA are studied in human and canine species due to their malignance potential. The plasminogen activator (PA system has been suggested to play a central role in cell adhesion, angiogenesis, inflammation, and tumor invasion. The urokinase-type plasminogen activator receptor (uPAR is a component of the PA, with a range of expression in tumor and stromal cells. In this study, uPAR expression in both canine normal prostates and with proliferative disorders (benign prostatic hyperplasia-BPH, proliferative inflammatory atrophy-PIA, prostatic intraepithelial neoplasia-PIN, and carcinoma-PC was evaluated by immunohistochemistry in a tissue microarray (TMA slide to establish the role of this enzyme in extracellular matrix (ECM remodeling and in the processes of tissue invasion. A total of 298 cores and 355 diagnoses were obtained, with 36 (10.1% normal prostates, 46 (13.0% with BPH, 128 (36.1% with PIA, 74 (20.8% with PIN and 71 (20.0% with PC. There is variation in the expression of uPAR in canine prostate according to the lesion, with lower expression in normal tissue and with BPH, and higher expression in tissue with PIA, PIN and PC. The high expression of uPAR in inflammatory and neoplastic microenvironment indicates increased proteolytic activity in canine prostates with PIA, PIN, and PC.

Penetration of ASM 981 in canine skin: a comparative study.

Science.gov (United States)

Gutzwiller, Meret E Ricklin; Reist, Martin; Persohn, Elke; Peel, John E; Roosje, Petra J

2006-01-01

ASM 981 has been developed for topical treatment of inflammatory skin diseases. It specifically inhibits the production and release of pro-inflammatory cytokines. We measured the skin penetration of ASM 981 in canine skin and compared penetration in living and frozen skin. To make penetration of ASM 981 visible in dog skin, tritium labelled ASM 981 was applied to a living dog and to defrosted skin of the same dog. Using qualitative autoradiography the radioactive molecules were detected in the lumen of the hair follicles until the infundibulum, around the superficial parts of the hair follicles and into a depth of the dermis of 200 to 500 microm. Activity could not be found in deeper parts of the hair follicles, the dermis or in the sebaceous glands. Penetration of ASM 981 is low in canine skin and is only equally spread in the upper third of the dermis 24 hours after application. Penetration in frozen skin takes even longer than in living canine skin but shows the same distribution.

Adjuvant therapy with carboplatin and pamidronate for canine appendicular osteosarcoma.

Science.gov (United States)

Kozicki, A R; Robat, C; Chun, R; Kurzman, I D

2015-09-01

Amputation and chemotherapy are the mainstay of treatment for canine appendicular osteosarcoma (OSA). In vitro studies have demonstrated anti-tumour activity of pamidronate against canine OSA. The purpose of this study was to assess the safety of adding pamidronate to standard post-operative carboplatin chemotherapy in 17 dogs with appendicular OSA treated with limb amputation. Median disease-free interval (DFI) and median survival time (MST) were evaluated as secondary endpoints. Incidence of side effects and treatment outcomes were compared to 14 contemporary control patients treated with carboplatin alone. There were no identified side effects to the pamidronate treatment. The median DFI for the study group was 185 days compared to 172 days for the control group (P = 0.90). The MST of the study group was 311 days compared to 294 days for the control group (P = 0.89). Addition of pamidronate to carboplatin chemotherapy for the treatment of canine appendicular OSA is safe and does not impair efficacy of standard carboplatin treatment. © 2013 Blackwell Publishing Ltd.

Surgical treatments of the impacted canine tooth in young dogs

International Nuclear Information System (INIS)

Amimoto, A.; Iwamoto, S.; Hachimura, H.; Sasaki, K.; Taura, Y.; Nakama, S.; Yamanouchi, T.

1993-01-01

Surgical treatments of the impacted canine tooth were carried out in 8 young dogs, and the results were successful in 12 out of 14 cases (85.7%). The treatments consisting of surgical correction by immediate tipping movement, fenestration of the gingiva, and removal of the impacted tooth, were applied to 14 cases radiographically showing the immature tooth root and no abnormalities in the tooth root or alveolar bone. Impacted teeth were seen in 8 regions of the maxilla and 6 regions of the mandible. Mesioversion was seen in almost all maxillary impacted teeth, while linguoversion or lingual mesioversion in all mandibular cases. Surgical correction was carried out by immediate tipping movement after removal of the retained deciduous canine with or without resection of the alveolar bone. Fixation of the moved teeth was done using a wedge made from the deciduous canine root, which was driven into the vacant alveolar cavity after moving. An additional fixation using a steel wire and/or self-curing resin was done, if necessary

Nonsurgical, nonextraction management of impacted maxillary canine

Directory of Open Access Journals (Sweden)

Jasneet Singh

2018-01-01

Full Text Available NS, a 12 year 2 months old female patient, presented with the chief complaint of irregular teeth. Diagnosis revealed skeletal Class II jaw base relation, with average (toward vertical growth pattern, dentoalveolar angles Class I molar relationship with severe crowding in upper and moderate crowding in the lower arch, normally positioned maxillary incisors but proclined lower incisors, “V” shape constricted maxillary arch with first premolar in crossbite, overretained deciduous molar and a high placed buccoversion canine in the first quadrant and an impacted canine in the second quadrant, constricted mandibular arch with first premolar blocked out in the third quadrant. Treatment with a nonsurgical, nonextraction treatment plan by expansion of the upper arch and taking advantage of natural eruptive forces of the tooth was planned. The final outcome solved the patient's complaints and achieved an esthetically pleasing and functionally adequate occlusal result.

Measurement of lower canine clinical crown index in male and female for gender identification

Directory of Open Access Journals (Sweden)

Rita Dewi Handayani

2007-11-01

Full Text Available The purpose of this research was to acquire the value index of clinical crown lower jaw canine male and female, and to prove whether the index of male's canine is bigger than female's. The samples of the research was the students of Faculty of Dentistry Universitas Padjadjaran class of 1998 until 2001 by using proportional random sampling method according to the criteria and also adjust with the numbers of male and female composition in per class. The characteristic of the research was analytical descriptive with survey technique. The result of t test statistic measurement was that index of clinical crown tower jaw canine of mate was 1.50 and female was 1.21, by using reliance 95%. The inference of the research showed that the index of clinical crown lower jaw canine of male was significantly bigger than female's. The result of the research can be used as auxiliary data from the techniques to process gender identification in odontology forensic.

Apical root resorption of incisors after orthodontic treatment of impacted maxillary canines: a radiographic study.

Science.gov (United States)

Brusveen, Elin Marie Gravdal; Brudvik, Pongsri; Bøe, Olav Egil; Mavragani, Maria

2012-04-01

The purpose of the study was to evaluate impacted maxillary canines as risk factor for orthodontic apical root resorption. The sample comprised 66 patients treated with fixed appliances. Thirty-two patients with a unilateral impacted maxillary canine, which was distanced from the roots of the incisors at a preliminary phase of treatment before bonding, formed the impaction group, and 34 patients without impactions served as the controls. Root shortening was calculated by using pretreatment and posttreatment intraoral radiographs. Inclination of the eruption path of the impacted canine relative to the midline, axis of the lateral incisor, and nasal line, root development, and the medial and vertical positions of the impacted tooth were recorded on orthopantomograms and lateral cephalometric films. The follicle/tooth ratio was evaluated by using periapical radiographs. No significant difference in apical resorption of the maxillary incisors was detected between the impaction and control groups, or between the incisors of the impacted and contralateral sides in the same subject. Likewise, no difference in the severity of root resorption was found between the incisors of impacted side alone and the incisors of the control group. Mesial and vertical inclinations of the impacted canines were negatively related to a lateral incisor's root resorption. No correlations were found between resorption and medial or vertical position of the crown of the canine. The follicle/tooth ratio was significantly related to the mesial inclination of the impacted canine, but not to root resorption. An impacted maxillary canine, after being distanced from the incisor roots, does not seem to be a risk factor for apical root resorption during orthodontic treatment. Copyright © 2012 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

Directory of Open Access Journals (Sweden)

Mehdi Hayat Shahi

Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

Intracellular Route of Canine Parvovirus Entry

Science.gov (United States)

Vihinen-Ranta, Maija; Kalela, Anne; Mäkinen, Päivi; Kakkola, Laura; Marjomäki, Varpu; Vuento, Matti

1998-01-01

The present study was designed to investigate the endocytic pathway involved in canine parvovirus (CPV) infection. Reduced temperature (18°C) or the microtubule-depolymerizing drug nocodazole was found to inhibit productive infection of canine A72 cells by CPV and caused CPV to be retained in cytoplasmic vesicles as indicated by immunofluorescence microscopy. Consistent with previously published results, these data indicate that CPV enters a host cell via an endocytic route and further suggest that microtubule-dependent delivery of CPV to late endosomes is required for productive infection. Cytoplasmic microinjection of CPV particles was used to circumvent the endocytosis and membrane fusion steps in the entry process. Microinjection experiments showed that CPV particles which were injected directly into the cytoplasm, thus avoiding the endocytic pathway, were unable to initiate progeny virus production. CPV treated at pH 5.0 prior to microinjection was unable to initiate virus production, showing that factors of the endocytic route other than low pH are necessary for the initiation of infection by CPV. PMID:9420290

Canine urothelial carcinoma: genomically aberrant and comparatively relevant.

Science.gov (United States)

Shapiro, S G; Raghunath, S; Williams, C; Motsinger-Reif, A A; Cullen, J M; Liu, T; Albertson, D; Ruvolo, M; Bergstrom Lucas, A; Jin, J; Knapp, D W; Schiffman, J D; Breen, M

2015-06-01

Urothelial carcinoma (UC), also referred to as transitional cell carcinoma (TCC), is the most common bladder malignancy in both human and canine populations. In human UC, numerous studies have demonstrated the prevalence of chromosomal imbalances. Although the histopathology of the disease is similar in both species, studies evaluating the genomic profile of canine UC are lacking, limiting the discovery of key comparative molecular markers associated with driving UC pathogenesis. In the present study, we evaluated 31 primary canine UC biopsies by oligonucleotide array comparative genomic hybridization (oaCGH). Results highlighted the presence of three highly recurrent numerical aberrations: gain of dog chromosome (CFA) 13 and 36 and loss of CFA 19. Regional gains of CFA 13 and 36 were present in 97 % and 84 % of cases, respectively, and losses on CFA 19 were present in 77 % of cases. Fluorescence in situ hybridization (FISH), using targeted bacterial artificial chromosome (BAC) clones and custom Agilent SureFISH probes, was performed to detect and quantify these regions in paraffin-embedded biopsy sections and urine-derived urothelial cells. The data indicate that these three aberrations are potentially diagnostic of UC. Comparison of our canine oaCGH data with that of 285 human cases identified a series of shared copy number aberrations. Using an informatics approach to interrogate the frequency of copy number aberrations across both species, we identified those that had the highest joint probability of association with UC. The most significant joint region contained the gene PABPC1, which should be considered further for its role in UC progression. In addition, cross-species filtering of genome-wide copy number data highlighted several genes as high-profile candidates for further analysis, including CDKN2A, S100A8/9, and LRP1B. We propose that these common aberrations are indicative of an evolutionarily conserved mechanism of pathogenesis and harbor genes

Canine osteosarcoma: a naturally occurring disease to inform pediatric oncology.

Science.gov (United States)

Fenger, Joelle M; London, Cheryl A; Kisseberth, William C

2014-01-01

Osteosarcoma (OSA) is the most common form of malignant bone cancer in children and dogs, although the disease occurs in dogs approximately 10 times more frequently than in people. Multidrug chemotherapy and aggressive surgical techniques have improved survival; however, new therapies for OSA are critical, as little improvement in survival times has been achieved in either dogs or people over the past 15 years, even with significant efforts directed at the incorporation of novel therapeutic approaches. Both clinical and molecular evidence suggests that human and canine OSA share many key features, including tumor location, presence of microscopic metastatic disease at diagnosis, development of chemotherapy-resistant metastases, and altered expression/activation of several proteins (e.g. Met, ezrin, phosphatase and tensin homolog, signal transducer and activator of transcription 3), and p53 mutations, among others. Additionally, canine and pediatric OSA exhibit overlapping transcriptional profiles and shared DNA copy number aberrations, supporting the notion that these diseases are similar at the molecular level. This review will discuss the similarities between pediatric and canine OSA with regard to histology, biologic behavior, and molecular genetic alterations that indicate canine OSA is a relevant, spontaneous, large animal model of the pediatric disease and outline how the study of naturally occurring OSA in dogs will offer additional insights into the biology and future treatment of this disease in both children and dogs. © The Author 2014. Published by Oxford University Press on behalf of the Institute for Laboratory Animal Research. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Long-lived immunity to canine core vaccine antigens in UK dogs as assessed by an in-practice test kit.

Science.gov (United States)

Killey, R; Mynors, C; Pearce, R; Nell, A; Prentis, A; Day, M J

2018-01-01

To determine the utility of an in-practice test kit to detect protective serum antibody against canine distemper virus, canine adenovirus and canine parvovirus type 2 in a sample of the UK dog population. Serum samples from 486 dogs, last vaccinated between less than 1 month and 124 months previously, were tested with the VacciCheck™ test kit for protective antibodies against distemper, adenovirus and parvovirus type 2. A high proportion of the dogs tested (93·6%) had protective antibody against all three of the core vaccine antigens: 95·7% of the dogs were seropositive against canine distemper virus, 97·3% against canine adenovirus and 98·5% against canine parvovirus type 2. The small number of dogs that were seronegative for one or more of the antigens (n = 31) may have had waning of previous serum antibody or may have been rare genetic non-responders to that specific antigen. UK veterinarians can be reassured that triennial revaccination of adult dogs with core vaccines provides long-lived protective immunity. In-practice serological test kits are a valuable tool for informing decision-making about canine core revaccination. © 2017 British Small Animal Veterinary Association.

High-dose antibiotic therapy is superior to a 3-drug combination of prostanoids and lipid A derivative in protecting irradiated canines

International Nuclear Information System (INIS)

Kumar, K.S.; Srinivasan, V.; Toles, R.E.; Miner, V.L.; Jackson, W.E.; Seed, T.M.

2002-01-01

There is an urgent need to develop non-toxic radioprotectors. We tested the efficacy of a 3-drug combination (3-DC) of iloprost, misoprostol, and 3D-MPL (3-deacylated monophosphoryl lipid A) and the effects of postirradiation clinical support with high doses of antibiotics and blood transfusion. Canines were given 3-DC or the vehicle and exposed to 3.4 Gy or 4.1 Gy of 60 Co radiation. Canines irradiated at 4.1 Gy were also given clinical support, which consisted of blood transfusion and antibiotics (gentamicin, and cefoxitin or cephalexin). Peripheral blood cell profile and 60-day survival were used as indices of protection. At 3.4 Gy, 3-DC- or vehicle-treated canines without postirradiation clinical support survived only for 10 to 12 days. Fifty percent of the canines treated with 3-DC or vehicle and provided postirradiation clinical support survived 4.1-Gy irradiation. Survival of canines treated with vehicle before irradiation significantly correlated with postirradiation antibiotic treatments, but not with blood transfusion. The recovery profile of peripheral blood cells in 4.1 Gy-irradiated canines treated with vehicle and antibiotics was better than drug-treated canines. These results indicate that therapy with high doses of intramuscular aminoglycoside antibiotic (gentamicin) and an oral cephalosporin (cephalexin) enhanced survival of irradiated canines. Although blood transfusion correlated with survival of 3-DC treated canines, there were no additional survivors with 3-DC treated canines than the controls. (author)

Pharmacological characterization of canine melancortin-4 receptor and its natural variant V213F.

Science.gov (United States)

Yan, J; Tao, Y-X

2011-08-01

Dogs have become one of the most important companion animals in modern society. However, it is estimated that 20% to 40% of owned dogs are obese, suggesting that obesity has become one of the most important canine health problem. In addition, obesity in dogs also leads to type II diabetes. Because the melanocortin-4 receptor (MC4R) has been shown to be essential in maintaining energy homeostasis in several different species, including rodents and humans, we initiated studies toward elucidating the roles of MC4R in obesity pathogenesis in dogs. Canine MC4R has been cloned, and a missense variant V213F was identified. We designed primers and successfully cloned canine MC4R and generated the variant V213F by site-directed mutagenesis. The objective of this study was to investigate the pharmacological properties of canine MC4R and its natural variant V213F. We measured ligand binding and signaling properties with the use of both natural and synthetic ligands. Human MC4R was also included in the experiments for comparison. Both wild-type canine MC4R and its natural variant V213F functioned normally in terms of binding and signaling. Of the ligands we used, [Nle(4), D-Phe(7)]-α-melanocyte-stimulating hormone is the most potent ligand. We conclude that the cloned canine MC4R is a functional receptor, and the natural variant V213F does not have any functional defect and therefore is not likely to cause obesity in dogs. Copyright © 2011 Elsevier Inc. All rights reserved.

Influence of Radiographic Positioning on Canine Sacroiliac and Lumbosacral Angle Measurements.

Science.gov (United States)

Jones, Susan; Savage, Mason; Naughton, Brian; Singh, Susheela; Robertson, Ian; Roe, Simon C; Marcellin-Little, Denis J; Mathews, Kyle G

2018-01-01

 To evaluate the influence of radiographic malpositioning on canine sacroiliac and lumbosacral inclination angles.  Using canine cadavers, lateral pelvic radiographs were acquired with the radiographic beam in a neutral position and then rotated 5, 10 and 15° to mimic rotational malpositioning. The focal point of the beam was then focused over the abdomen and again over mid-diaphysis of the femur to mimic an abdominal or femoral radiographic study.  Five degrees of rotational malpositioning did not influence measurements of sacroiliac or lumbosacral inclination, but malpositioning by more than 5° led to a significant decrease in both sacroiliac and lumbosacral angles. Moving the focal point to the femur significantly decreased the measured lumbosacral angle. Abdominally centred radiographs had no effect on lumbosacral and sacroiliac angle measurements.  When evaluating canine lumbosacral and sacroiliac angles radiographically, pelvic rotation of more than 5° should be avoided as should the use of lateral radiographs centred over the femur. Schattauer GmbH Stuttgart.

Characterization and modulation of canine mast cell derived eicosanoids

Science.gov (United States)

Lin, Tzu-Yin; London, Cheryl A.

2013-01-01

Mast cells play an important role in both innate and acquired immunity as well as several pathological conditions including allergy, arthritis and neoplasia. They influence these processes by producing a variety of mediators including cytokines, chemokines and eicosanoids. Very little is currently known about the spectrum of inflammatory mediators, particularly eicosanoids (prostaglandins and leukotrienes), produced by canine mast cells. This is important since modulating mast cell derived eicosanoids may help in the treatment of autoimmune and inflammatory disorders. The purpose of this study was to investigate the spectrum of eicosanoids produced by normal canine mast cells and to evaluate the effects of cytokines and non-steroidal anti-inflammatory mediators (NSAIDS) on eicosanoid production and release. Canine bone marrow derived cultured mast cells (cBMCMCs) expressed COX-1, COX-2, and 5-LOX and synthesized and released PGD2, PGE2, LTB4, and LTC4 following activation by a variety of stimuli. The selective COX-2 NSAIDs carprofen (Rimadyl®) and deracoxib (Deramaxx®) inhibited PGD2 and PGE2 production but only slightly inhibited LTB4 and LTC4. The mixed COX-1/COX-2 inhibitor piroxicam blocked PGD2 and PGE2 production, but upregulated LTC4 following treatment while tepoxilan (Zubrin®), a pan COX/LOX inhibitor, markedly reduced the production of all eicosanoids. The LOX inhibitor nordihydroguaiaretic acid (NDGA) prevented LTB4/LTC4 release and BMBMC degranulation. Pre-incubation of cBMCMCs with IL-4 and SCF sensitized these cells to degranulation in response to substance P. In conclusion, canine BMCMCs produce an array of eicosanoids similar to those produced by mast cells from other species. Tepoxilan appeared to be the most effective NSAID for blocking eicosanoid production and thus may be useful for modulating mast cell mediated responses in dogs. PMID:20036014

Molecular Epidemiology of Canine Parvovirus, Europe

Science.gov (United States)

Desario, Costantina; Addie, Diane D.; Martella, Vito; Vieira, Maria João; Elia, Gabriella; Zicola, Angelique; Davis, Christopher; Thompson, Gertrude; Thiry, Ethienne; Truyen, Uwe; Buonavoglia, Canio

2007-01-01

Canine parvovirus (CPV), which causes hemorrhagic enteritis in dogs, has 3 antigenic variants: types 2a, 2b, and 2c. Molecular method assessment of the distribution of the CPV variants in Europe showed that the new variant CPV-2c is widespread in Europe and that the viruses are distributed in different countries. PMID:17953097

Extraction of maxillary canines: Esthetic perceptions of patient smiles among dental professionals and laypeople.

Science.gov (United States)

Thiruvenkatachari, Badri; Javidi, Hanieh; Griffiths, Sarah Elizabeth; Shah, Anwar A; Sandler, Jonathan

2017-10-01

Maxillary canines are generally considered important both cosmetically and functionally. Most claims on the importance of maxillary canines, however, have been based on expert opinions and clinician-based studies. There are no scientific studies in the literature reporting on their cosmetic importance or how laypeople perceive a smile treated by maxillary canine extractions. Our objective was to investigate whether there is any difference in the perceptions of patients' smiles treated by extracting either maxillary canines or first premolars, as judged by orthodontists, dentists, and laypeople. This retrospective study included 24 participants who had unilateral or bilateral extraction of maxillary permanent canines and fixed appliances in the maxillary and mandibular arches to comprehensively correct the malocclusion, selected from orthodontic patients treated at Chesterfield Royal Hospital NHS trust in the United Kingdom over the last 20 years. The control group of patients had extraction of maxillary first premolars followed by fixed appliances and finished to an extremely high standard judged by the requirement that they had been submitted for the Membership in Orthodontics examination. The finished Peer Assessment Rating scores for this group were less than 5. The end-of-treatment frontal extraoral smiling and frontal intraoral views were presented for both groups. The photographs were blinded for extraction choice and standardized for size and brightness using computer software (Adobe Photoshop CC version 14.0; Adobe Systems, San Jose, Calif). The work file was converted to an editable pdf file and e-mailed to the assessors. The assessor panel consisted of 30 members (10 orthodontists, 10 dentists, and 10 laypeople), who were purposely selected. The measures were rated on a 10-point Likert scale. The attractiveness ratings were not statistically significantly different between the canine extraction and premolar extraction groups, with a mean difference of 0

Dentigerous Cyst Associated with Ectopic Canine and a ...

African Journals Online (AJOL)

ankylosis, cystic or neoplastic lesion or trauma may be the local factors ... After clinical and radiographic examination, a provisional diagnosis of ... bone along with the impacted teeth (permanent ectopic canine ... [7] Panoramic radiograph and ...

Expression, Purification and Characterization of Recombinant Canine FGF21 in Escherichia coli.

Science.gov (United States)

Zheng, Zhong; Yang, Chengjun; Yin, Ruofeng; Jiang, Jinxi; He, Haiting; Wang, Xinxin; Kan, Mujie; Xiao, Yechen

2016-01-01

The canine metabolic diseases, such as obesity and diabetes, have become a worldwide problem. Fibroblast growth factor 21 (FGF21) is a potent regulator which has many biological functions relative to metabolism regulation. It suggests that FGF21 plays important roles in regulating canine metabolic diseases. To acquire the recombinant canine FGF21 (rcFGF21) in Escherichia coli, the recombinant bacteria were induced by 0.5 mM IPTG for 16 hours at 16 °C, and the rcFGF21 protein was purified by Ni-NTA. 8 mg rcFGF21 was acquired from one liter bacteria. The rcFGF21 protein has specific immunoblot reactivity against anti-FGF21 and anti-His antibody. The in vivo experimental result showed that rcFGF21 can significantly reduce plasma glucose of STZ-induced diabetic mice.

Establishment of Demodex canis on canine skin engrafted onto scid-beige mice.

Science.gov (United States)

Caswell, J L; Yager, J A; Barta, J R; Parker, W

1996-12-01

A small animal model of canine demodicosis is described. Normal canine skin was engrafted onto scid (severe combined immunodeficient)-beige mice, which lack functional B and T lymphocytes and have reduced natural killer cell activity. The xenografts were later infected with Demodex canis collected from a dog with demodicosis. At 30-112 days following infection, mites were seen histologically in the canine hair follicles of the engrafted skin. Demodex canis adults, nymphs, larvae, and eggs were present in samples macerated in sodium hydroxide. Mite infestations could not be demonstrated in the mouse skin, nor were mites passed from the infected graft to uninfected skin grafts on in-contact mice. This model may be utilized to assess the efficacy of miticidal treatments, to evaluate the importance of specific components of the immune response, and to study the biology of D. canis.

Potential hazard of zoonotic parasites present in canine feces in Puerto Escondido, Oaxaca

Directory of Open Access Journals (Sweden)

León Vélez-Hernández

2014-11-01

Full Text Available Objective. To estimate the zoonotic parasites prevalence in feral dog feces in Puerto Escondido. Material and methods. The fecalism frecuency was estimated in ten zones. To identify the parasites parasitological flotation and direct smear methods were used. The parasitic prevalence was estimated in the canine feces. Results. All the zones presented canine fecalism. The parasitic prevalence in the feces was 73.33%. The parasites with the highest prevalence were Toxocara canis (47.78%, Ancylostoma caninum (17.88%, and Dipylidium caninum (13.89%. Conclusion. Canine fecalism comes from strayed and owned dogs. 66.66% of the parasites found in the dog feces are zoonotics. The factors associated to this problem are the suburban habitat, waste mishandling and nil tenure of stray dogs.

Radioimmunoassay of canine growth hormone

International Nuclear Information System (INIS)

Eigenmann, J.E.; Eigenmann, R.Y.

1981-01-01

A sensitive radioimmunoassay (RIA) for canine growth hormone (GH) was developed. Antibodies were elicited in rhesus monkeys. One antiserum exhibited a working titer at a dilution of 1:500 000. Radioiodination was performed enzymatically employing lactoperoxidase. Logit-log transformation and least squares fitting resulted in straight line fitting of the standard curve between 0.39 and 50 ng/ml. Formation of large-molecular [ 125 I]GH during storage caused diminished assay sensitivity. Therefore [ 125 I]GH was re-purified by gel chromatography. Using this procedure, high and reproducible assay sensitivity was obtained. Tracer preparations were used for as long as 3 months after iodination. Diluted plasma from normal and acromegalic dogs resulted in a dose-response curve parallel to the standard curve. Canine prolactin exhibited a cross-reactivity of 2%. The within-assay coefficient of variation (CV) was 3.8 and the between-assay CV was 7.2%. Mean plasma GH concentration in normal dogs was 1.92 +- 0.14 ng/ml (mean +- SEM.) GH levels in acromegalic dogs were appreciably higher. Insulin-induced hypoglycaemia, arginine and ornithine administration resulted in inconsistent and sluggish GH increment. A better response was obtained by injecting a low dose of clonidine. Clonidine administration to hypopituitary dogs resulted in absent or poor GH increment. (author)

An evaluation of the histological effects of intra-articular methadone in the canine model.

Science.gov (United States)

Jones, Timothy A; Hand, Walter R; Ports, Michael D; Unger, Daniel V; Herbert, Daniel; Pellegrini, Joseph E

2003-02-01

Methadone hydrochloride is an opiate that has pharmacodynamic and pharmacokinetic properties that suggest it may provide longer analgesia than morphine when administered via the intra-articular route. However, no studies to date have been conducted examining the effects of intra-articular methadone hydrochloride on local tissues. Therefore, the purpose of this study was to determine the histopathologic effects of intra-articular methadone hydrochloride on local tissues in the canine knee. Nine canines, 1 to 4 years old, weighing between 20 kg and 23 kg were used. All canines had their knees randomized to receive either bupivacaine, 0.5% with epinephrine 1:200,000 (4.5 mL), and 5 mg methadone hydrochloride (0.5 mL) for the study knee, or bupivacaine, 0.5% with epinephrine 1:200,000 (4.5 mL), and 0.5 mL normal saline for the control knee. Serum methadone hydrochloride levels were obtained on all canines at 6 and 24 hours. Canines were randomly assigned to 1 of 3 groups to be euthanized at either 24 hours, 14 days, or 28 days. Following euthanization and necropsy, synovial fluid levels and tissue samples were obtained and examined for histopathologic changes. Synovial fluid samples noted a few white blood cells at 24 hours and none at 14 and 28 days. Tissue samples showed no histopathologic changes, and serum concentration levels of methadone hydrochloride were negligible.

Military veterans and canine assistance for post-traumatic stress disorder: A narrative review of the literature.

Science.gov (United States)

Krause-Parello, Cheryl A; Sarni, Sarah; Padden, Eleni

2016-12-01

Veterans with post-traumatic stress disorder (PTSD) are a vulnerable population at high risk for depression, isolation, and suicide. A substantial body of anecdotal evidence exists supporting the use of canines as an effective adjunct treatment for this population. However, a comprehensive review of its use based on scientific literature has thus far not been conducted. A narrative literature review was conducted to examine the current state of the science on canine assistance for veterans diagnosed with PTSD in order to synthesize current empirical knowledge on the subject. Articles were retrieved among the small body of recent literature using computerized database searches. Inclusion criteria included peer-reviewed journal publications published through October 1st, 2015. Only originally published articles that examined the outcomes of canine assistance on veterans with PTSD were examined. Additionally, each included article was specific to veterans, dogs, and, PTSD in combination rather than article that discuss the concepts separately. Exclusion criteria included symposia and conference material, dissertations, media articles, and no mention of canines as a treatment modality. 563 articles were retrieved; 6 met the criteria. When evaluating data, information and themes were extracted into an Excel table; this table was employed in the synthesis of information into manuscript form. The following themes were explored within the selected publications: What is Canine Assistance; Why Use Canine Assistance for PTSD in Veterans; Concerns; and Future Directions. The literature endorsed canine assistance for PTSD in veterans as a promising modality. Authors also raised concerns about lack of protocols, cost and availability barriers, and animal welfare calling for additional, rigorous research to advance its use as a treatment for veterans with PTSD. PTSD continues to pose significant psychological, health, and welfare challenges to veterans and the multi

Orthodontic tooth movement of total buccally blocked-out canine: a case report

OpenAIRE

Alkhal, Hessa M; Rabie, Bakr; Wong, Ricky W K

2009-01-01

Orthodontic tooth movement of total buccally blocked-out canine is usually difficult as it is related with the problems of severe crowding, midline deviation, involvement of long root movement and risk of gingival recession. A case report was presented to illustrate the treatment principles. It demonstrated with careful planning in extraction sequence and orthodontic mechanics to deliver light, controlled force, condition of totally blocked out canine could be corrected with good results.

T cell cytokine gene polymorphisms in canine diabetes mellitus.

Science.gov (United States)

Short, Andrea D; Catchpole, Brian; Kennedy, Lorna J; Barnes, Annette; Lee, Andy C; Jones, Chris A; Fretwell, Neale; Ollier, William E R

2009-03-15

Insulin-deficiency diabetes in dogs shares some similarities with human latent autoimmune diabetes of adults (LADA). Canine diabetes is likely to have a complex pathogenesis with multiple genes contributing to overall susceptibility and/or disease progression. An association has previously been shown between canine diabetes and MHC class II genes, although other genes are also likely to contribute to the genetic risk. Potential diabetes susceptibility genes include immuno-regulatory TH1/TH2 cytokines such as IFNgamma, IL-12, IL-4 and IL-10. We screened these candidate genes for single nucleotide polymorphisms (SNPs) in a range of different dog breeds using dHPLC analysis and DNA sequencing. Thirty-eight of the SNPs were genotyped in crossbreed dogs and seven other breed groups (Labrador Retriever, West Highland White Terrier, Collie, Schnauzer, Cairn Terrier, Samoyed and Cavalier King Charles Spaniel), which demonstrated substantial intra-breed differences in allele frequencies. When SNPs were examined for an association with diabetes by case:control analysis significant associations were observed for IL-4 in three breeds, the Collie, Cairn Terrier and Schnauzer and for IL-10 in the Cavalier King Charles Spaniel. These results suggest that canine cytokine genes regulating the TH1/TH2 immune balance might play a contributory role in determining susceptibility to diabetes in some breeds.

Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012-2013

DEFF Research Database (Denmark)

Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted

2015-01-01

During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit...... distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine...... distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case...

Evaluation of the biological differences of canine and human factor VIII in gene delivery: Implications in human hemophilia treatment

Science.gov (United States)

The canine is the most important large animal model for testing novel hemophilia A(HA) treatment. It is often necessary to use canine factor VIII (cFIII) gene or protein for the evaluation of HA treatment in the canine model. However, the different biological properties between cFVIII and human FVII...

Root length and alveolar bone level of impacted canines and adjacent teeth after orthodontic traction: a long-term evaluation

Science.gov (United States)

da SILVA, Aldir Cordeiro; CAPISTRANO, Anderson; de ALMEIDA-PEDRIN, Renata Rodrigues; CARDOSO, Maurício de Almeida; CONTI, Ana Cláudia de Castro Ferreira; CAPELOZZA, Leopoldino

2017-01-01

Abstract Objective The aim of this retrospective study was to evaluate the long-term effects of orthodontic traction on root length and alveolar bone level in impacted canines and adjacent teeth. Material and Methods Sample consisted of 16 patients (nine males and seven females), mean initial age 11 years and 8 months presenting with unilaterally maxillary impacted canines, palatally displaced, treated with the same surgical and orthodontic approach. Teeth from the impacted-canine side were assigned as Group I (GI), and contralateral teeth as control, Group II (GII). The mean age of patients at the end of orthodontic treatment was 14 years and 2 months and the mean post-treatment time was 5 years and 11 months. Both contralateral erupted maxillary canines and adjacent teeth served as control. Root length and alveolar bone level (buccal and palatal) were evaluated on cone-beam computed tomography (CBCT) images. The comparison of root length and alveolar bone level changes between groups were assessed by applying paired t-test, at a significance level of 5% (p<0.05). Results There were no statistically significant differences in root length and buccal and palatal bone levels of canines and adjacent teeth among groups. Conclusions Impacted canine treatment by closed-eruption technique associated with canine crown perforation, has a minimal effect on root length and buccal and palatal alveolar bone level in both canine and adjacent teeth, demonstrating that this treatment protocol has a good long-term prognosis. PMID:28198979

Orthodontic management of a dilacerated central incisor and partially impacted canine with unilateral extraction - A case report.

Science.gov (United States)

Felicita, A Sumathi

2017-10-01

To align a dilacerated maxillary central incisor and partially impacted canine with unilateral extraction in a young patient with skeletal deep bite. A 14 year old male patient reported to the hospital with skeletal deep bite (basal plane angle-17°), severe horizontal pattern of growth (Go-Gn to Sn -22°), upright maxillary incisors (U1 to NA -26°) and retroclined lower incisors (L1 to NB -11°). The maxillary left central incisor was dilacerated, and the maxillary left canine was partially impacted. Unilateral extraction of the left maxillary premolar and left mandibular central incisor was done. A canine disimpaction spring was used to align the impacted canine. An anterior bite plane was given to open the bite. Superimposition of lateral cephalogram (T1, T2) revealed bite opening, normal overjet and overbite. There was backward rotation of the mandible and increase in lower anterior facial height. There was no evidence of root resorption or loss of vitality in the dilacerated tooth. Clinically the canine was well aligned in the arch. Orthodontic management of a dilacerated incisor can be done without root resorption or loss of vitality. The partially impacted canine was well aligned in the arch. Unilateral extraction can produce good treatment results.

In vitro anti-tubulin effects of mebendazole and fenbendazole on canine glioma cells.

Science.gov (United States)

Lai, S R; Castello, S A; Robinson, A C; Koehler, J W

2017-12-01

Benzimidazole anthelmintics have reported anti-neoplastic effects both in vitro and in vivo. The purpose of this study was to evaluate the in vitro chemosensitivity of three canine glioma cell lines to mebendazole and fenbendazole. The mean inhibitory concentration (IC 50 ) (±SD) obtained from performing the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay after treating J3T, G06-A, and SDT-3G cells for 72 h with mebendazole were 0.030 ± 0.003, 0.080 ± 0.015 and 0.030 ± 0.006 μM respectively, while those for fenbendazole were 0.550  ± 0.015, 1.530 ± 0.159 and 0.690 ± 0.095 μM; treatment of primary canine fibroblasts for 72 h at IC 50 showed no significant effect. Immunofluorescence studies showed disruption of tubulin after treatment. Mebendazole and fenbendazole are cytotoxic in canine glioma cell lines in vitro and may be good candidates for treatment of canine gliomas. Further in vivo studies are required. © 2017 John Wiley & Sons Ltd.

Surgical innovations in canine gonadectomy

OpenAIRE

Van Goethem, Bart

2016-01-01

In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated negative consequences (lengthy placement, impaired wound healing around bulky knots, and the effect of unsightly knots on cosmetics). A study in 9 dogs found that celiotomy closure was easily achiev...

Effects of the canine rattlesnake vaccine in moderate to severe cases of canine crotalid envenomation

Directory of Open Access Journals (Sweden)

Leonard MJ

2014-10-01

Full Text Available McGee J Leonard,1 Catherine Bresee,2 Andrew Cruikshank1 1Animal Specialty and Emergency Center, Los Angeles, CA, USA; 2The Biostatistics and Bioinformatics Research Center, Cedars-Sinai Medical Center, Los Angeles, CA, USA Abstract: This is a retrospective multicenter study (2006–2012 examining a population of dogs with moderate to severe crotalid envenomation for protective effects of the canine rattlesnake vaccine. Five nonacademic emergency and referral veterinary hospitals in Southern California were involved in the study and contributed records regarding a total of 82 client-owned dogs that were treated for naturally occurring rattlesnake envenomation. All dogs received antivenin (Crotalidae polyvalent, with dosages ranging from one to three vials (mean: 1.3±0.6. Fourteen dogs (17% had a history of prior vaccination against crotalid venom. In univariate logistic regression modeling, cases with lower body weight (P=0.0001 or higher snakebite severity scores (P<0.0001 were associated with greater morbidity. No statistically significant difference in morbidity or mortality between vaccinated and unvaccinated dogs was found. The findings of this study did not identify a significantly protective effect of previous vaccination in the cases of moderate to severe rattlesnake envenomation that require treatment with antivenin. Keywords: rattlesnake envenomation, vaccine, antivenin, canine

Assessment of radiographic factors affecting surgical exposure and orthodontic alignment of impacted canines of the palate: a 15-year retrospective study.

Science.gov (United States)

Motamedi, Mohammad Hosein Kalantar; Tabatabaie, Fataneh Alavi; Navi, Fina; Shafeie, Hasan Ali; Fard, Behnam Khosravani; Hayati, Zahra

2009-06-01

Impacted canines require a combination of both surgical and orthodontic management. In this study, patients treated for bone-impacted canines of the hard palatal were evaluated to assess which radiographic factors influenced the feasibility to move impacted maxillary permanent canines from the hard palate into the alveolar arch. Eighty patients aged 12 to 24 (average 16 years) were treated surgically and orthodontically to align 146 bone-impacted canines of the hard palate (from 1994 to 2008). Factors such as age, sex, angulation of the canine to the midline (CAM), anomaly of the canine root (RA), overlap of the adjacent lateral incisor root (OALIR), and ratio of root formation (RRF) upon treatment were documented. Radiographic records and demographic data were assessed. The following radiographic measurements of canine position were made from the orthopantomogram (OPG): (1) angulation to the midline, (2) anteroposterior position of the root, (3) overlap of the adjacent incisor. RA or dilaceration was assessed from the OPG, maxillary occlusal (MO), and periapical (PA) radiographs. Whether the impacted canine had responded to surgical exposure and was orthodontically aligned, or surgically removed and discarded was also recorded. The data were analyzed to assess and correlate significance. Eighty patients aged 12 to 24 (19 males and 61 females) with 146 bone-impacted permanent canines of the hard palatal were treated. One hundred and three teeth (70.54%) had responded to surgical exposure and orthodontic alignment within 9 to 12 months. Forty-three impacted canine teeth (29.46%) had to be surgically removed because of ankylosis and no movement after 8 to 9 months using 50 to 60 g of traction force via elastic chains. Data analysis via chi-square and Pearson correlation tests showed that as the CAM increased (> 45 degrees), the canine was more likely to be unresponsive to treatment (P half the root) of the adjacent lateral incisor root (OALIR) via the canine crown

Genetic characterization of canine distemper virus involved in outbreaks in farmed mink in Denmark 2012

DEFF Research Database (Denmark)

Trebbien, Ramona; Struve, T.; Hjulsager, Charlotte Kristiane

Danish farmed mink herds experienced a large outbreak of canine distemper virus in 2012. Full-length sequence analysis (1824 nucleotides) of the variable hemagglutinin (H) gene were performed on 27 viruses collected from mink and on 7 viruses collected from wild foxes. Results of the study showed...... with other European canine distemper viruses and showed the highest level of similarity (99.3 - 99.6 %) to viruses isolated from wild foxes in Germany. The fox should therefore be considered as an important wild life reservoir of canine distemper virus and may also contribute to the transmission of the virus...

The effect of buccal corticotomy on accelerating orthodontic tooth movement of maxillary canine

Science.gov (United States)

Jahanbakhshi, Mohammad Reza; Motamedi, Ali Mohammad Kalantar; Feizbakhsh, Masoud; Mogharehabed, Ahmad

2016-01-01

Background: Selective alveolar corticotomy is defined as an intentional injury to cortical bone. This technique is an effective means of accelerating orthodontic tooth movement. The aim of this study is to evaluate the effect of buccal corticotomy in accelerating maxillary canine retraction. Materials and Methods: The sample in this clinical trial study consisted of 15 adult female patients with therapeutic need for extraction of maxillary first premolars and maximum canine retraction. By use of split-mouth design, at the time of premolars extraction, buccal corticotomy was performed around the maxillary first premolar, randomly on one side of maxilla, and the other side was reserved as the control side. Canine retraction was performed by use of friction – less mechanic with simple vertical loop. Every 2 weeks, distance between canines and second premolars was measured until complete space closure. The velocity of space closure was calculated to evaluate the effect of this technique in accelerating orthodontic tooth movement. The obtained data were statistically analyzed using independent t-test, and the significance was set at 0.05. Results: The rate of canine retraction was significantly higher on the corticotomy side than the control side by an average of 1.8 mm/month versus 1.1 mm/month in the corticotomy side and control side, respectively (P orthodontic tooth movement about two times faster than conventional orthodontics and it is significant in early stages after surgical porsedure. Therefore Buccal corticotomy is a useful adjunct technique for accelerating orthodontic tooth movement. PMID:27605986

CD117 immunoexpression in canine mast cell tumours: correlations with pathological variables and proliferation markers

Directory of Open Access Journals (Sweden)

Pires Maria A

2007-08-01

Full Text Available Abstract Background Cutaneous mast cell tumours are one of the most common neoplasms in dogs and show a highly variable biologic behaviour. Several prognosis tools have been proposed for canine mast cell tumours, including histological grading and cell proliferation markers. CD117 is a receptor tyrosine kinase thought to play a key role in human and canine mast cell neoplasms. Normal (membrane-associated and aberrant (cytoplasmic, focal or diffuse CD117 immunoexpression patterns have been identified in canine mast cell tumours. Cytoplasmic CD117 expression has been found to correlate with higher histological grade and with a worsened post-surgical prognosis. This study addresses the role of CD117 in canine mast cell tumours by studying the correlations between CD117 immunoexpression patterns, two proliferation markers (Ki67 and AgNORs histological grade, and several other pathological variables. Results Highly significant (p Conclusion These findings highlight the key role of CD117 in the biopathology of canine MCTs and confirm the relationship between aberrant CD117 expression and increased cell proliferation and higher histological grade. Further studies are needed to unravel the cellular mechanisms underlying focal and diffuse cytoplasmic CD117 staining patterns, and their respective biopathologic relevance.

Ligand-independent canonical Wnt activity in canine mammary tumor cell lines associated with aberrant LEF1 expression.

Directory of Open Access Journals (Sweden)

Ana Gracanin

Full Text Available Pet dogs very frequently develop spontaneous mammary tumors and have been suggested as a good model organism for breast cancer research. In order to obtain an insight into underlying signaling mechanisms during canine mammary tumorigenesis, in this study we assessed the incidence and the mechanism of canonical Wnt activation in a panel of 12 canine mammary tumor cell lines. We show that a subset of canine mammary cell lines exhibit a moderate canonical Wnt activity that is dependent on Wnt ligands, similar to what has been described in human breast cancer cell lines. In addition, three of the tested canine mammary cell lines have a high canonical Wnt activity that is not responsive to inhibitors of Wnt ligand secretion. Tumor cell lines with highly active canonical Wnt signaling often carry mutations in key members of the Wnt signaling cascade. These cell lines, however, carry no mutations in the coding regions of intracellular Wnt pathway components (APC, β-catenin, GSK3β, CK1α and Axin1 and have a functional β-catenin destruction complex. Interestingly, however, the cell lines with high canonical Wnt activity specifically overexpress LEF1 mRNA and the knock-down of LEF1 significantly inhibits TCF-reporter activity. In addition, LEF1 is overexpressed in a subset of canine mammary carcinomas, implicating LEF1 in ligand-independent activation of canonical Wnt signaling in canine mammary tumors. We conclude that canonical Wnt activation may be a frequent event in canine mammary tumors both through Wnt ligand-dependent and novel ligand-independent mechanisms.

TaqMan probe real-time polymerase chain reaction assay for the quantification of canine DNA in chicken nugget.

Science.gov (United States)

Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub

2016-01-01

This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.

Canine specific ELISA for coagulation factor VII

DEFF Research Database (Denmark)

Knudsen, Tom; Kjelgaard-Hansen, Mads; Tranholm, Mikael

2011-01-01

available to date. In this study, a canine specific ELISA for measurement of FVII:Ag in plasma was developed and validated. The FVII:Ag ELISA correctly diagnosed homozygous and heterozygous hereditary FVII deficiency. Together with activity based assays, such as FVII:C, the FVII:Ag ELISA should be valuable...

Orthodontic management of a patient with impacted and transposed mandibular canines.

Science.gov (United States)

Almeida, Rhita C; Carvalho, Felipe A R; Almeida, Marco A O; Capelli, Jonas

2009-01-01

This patient report describes the treatment of a 10-year-old female with complete transposition of her impacted mandibular canines and lateral incisors. The patient had a Class I occlusion, and her mandibular lateral incisors were in crossbite with the maxillary central incisors. The treatment objectives were to create space for the impacted canines and align them with the incisors, one of which was extracted. After treatment, the appearance of the patient's teeth was improved, the occlusion was preserved, and overjet and overbite were corrected. © 2009 BY QUINTESSENCE PUBLISHING CO, INC.

Mandibular canine intrusion with the segmented arch technique: A finite element method study.

Science.gov (United States)

Caballero, Giselle Milagros; Carvalho Filho, Osvaldo Abadia de; Hargreaves, Bernardo Oliveira; Brito, Hélio Henrique de Araújo; Magalhães Júnior, Pedro Américo Almeida; Oliveira, Dauro Douglas

2015-06-01

Mandibular canines are anatomically extruded in approximately half of the patients with a deepbite. Although simultaneous orthodontic intrusion of the 6 mandibular anterior teeth is not recommended, a few studies have evaluated individual canine intrusion. Our objectives were to use the finite element method to simulate the segmented intrusion of mandibular canines with a cantilever and to evaluate the effects of different compensatory buccolingual activations. A finite element study of the right quadrant of the mandibular dental arch together with periodontal structures was modeled using SolidWorks software (Dassault Systèmes Americas, Waltham, Mass). After all bony, dental, and periodontal ligament structures from the second molar to the canine were graphically represented, brackets and molar tubes were modeled. Subsequently, a 0.021 × 0.025-in base wire was modeled with stainless steel properties and inserted into the brackets and tubes of the 4 posterior teeth to simulate an anchorage unit. Finally, a 0.017 × 0.025-in cantilever was modeled with titanium-molybdenum alloy properties and inserted into the first molar auxiliary tube. Discretization and boundary conditions of all anatomic structures tested were determined with HyperMesh software (Altair Engineering, Milwaukee, Wis), and compensatory toe-ins of 0°, 4°, 6°, and 8° were simulated with Abaqus software (Dassault Systèmes Americas). The 6° toe-in produced pure intrusion of the canine. The highest amounts of periodontal ligament stress in the anchor segment were observed around the first molar roots. This tooth showed a slight tendency for extrusion and distal crown tipping. Moreover, the different compensatory toe-ins tested did not significantly affect the other posterior teeth. The segmented mechanics simulated in this study may achieve pure mandibular canine intrusion when an adequate amount of compensatory toe-in (6°) is incorporated into the cantilever to prevent buccal and lingual crown

An experimental in-vivo canine model for adult shunt infection

Directory of Open Access Journals (Sweden)

Procop Gary

2008-10-01

Full Text Available Abstract Background Detailed human studies of the mechanisms and development of shunt infection in real time are not possible, and we have developed a canine hydrocephalus model to overcome this. The intention of this pilot study was to show that the canine hydrocephalus model could be shunted using conventional "human" shunts, and that a shunt infection could be established so that further studies could then be planned. Methods Hydrocephalus was induced in seven dogs (Canis familiaris by fourth ventricle obstruction. Four weeks later they were shunted using a Hakim Precision valve. Four of the dogs received shunts whose ventricular catheter had been inoculated with Staphylococcus epidermidis, and three were uninoculated controls. Four weeks after shunting the dogs were sacrificed and necropsy was performed. Removed shunts and tissue samples were examined microbiologically and isolates were subjected to detailed identification and genomic comparison. Results All the dogs remained well after shunting. Examination of removed shunt components revealed S. epidermidis in the brain and throughout the shunt system in the four inoculated animals, but in two of these Staphylococcus intermedius was also found. S. intermedius was also isolated from all three "negative" controls. There were slight differences between S. intermedius strains suggesting endogenous infection rather than cross- infection from a point source. Conclusion Shunt infection was established in the canine model, and had the experiment been extended beyond four weeks the typical microbiological, pathological and clinical features might have appeared. The occurrence of unplanned shunt infections in control animals due to canine normal skin flora reflects human clinical experience and underlines the usual source of bacteria causing shunt infection.

Extraglandular and intraglandular vascularization of canine prostate.

Science.gov (United States)

Stefanov, Miroslav

2004-03-01

The literature on the vascularization of the canine prostate is reviewed and the clinical significance of prostate morphology is described. Scanning Electron Microscopy (SEM), combined with improved corrosion casting methods, reveal new morphological details that promise better diagnostics and treatment but also require expansion of clinical nomenclature. A proposal is made for including two previously unnamed veins in Nomina Anatomica Veterinaria (NAV). The canine prostate has two lobes with independent vascularization. Each lobe is supplied through the left and right a. prostatica, respectively. The a. prostatica sprouts three small vessels (cranial, middle, and caudal) towards the prostate gland. A. prostatica is a small-size artery whose wall structure is similar to the arteries of the muscular type. V. prostatica is a small-size valved vein. The canine prostate has capsular, parenchymal, and urethral vascular zones. The surface vessels of the capsule are predominantly veins and the diameter of arterial vessels is larger than that of the veins. The trabecular vessels are of two types: direct and branched. The prostate parenchyma is supplied by branches of the trabecular vessels. The periacinary capillaries are fenestrated and form a net in a circular pattern. The processes of the myoepithelial cells embrace both the acins and the periacinar capillaries. In the prostate ductal system. there are spermatozoa. The prostatic part of the urethra is supplied by an independent branch of a. prostatica. The prostatic urethral part is drained by v. prostatica, the vein of the urethral bulb and the ventral prostate veins. M. urethralis begins as early as the urethral prostatic part. The greater part of the white muscle fibers in m. urethralis suggest an enhanced anaerobic metabolism. Copyright 2004 Wiley-Liss, Inc.

Measurement of plasma canine C peptide by radioimmunoassay

Energy Technology Data Exchange (ETDEWEB)

Besch, W; Woltanski, K P; Fischer, U; Kohnert, K D; Ziegler, M

1985-12-01

A sensitive radioimmunoassay for canine C peptide (CCP) was established using synthetic CCP, a specific antiserum, and rabbit anti-guinea pig serum. Radioiodination was performed according to a modified chloramine T method. Tracer preparations have been used for 6 weeks after iodination. The standard curve ranges from 0.028 to 3.0 nmol/l. The intra-assay coefficient of variation (CV) was 3-5% and the inter-assay CV was 6-9% in the optimal range between 0.3 and 0.8 nmol/l. The average recovery of CCP added to plasma samples was 100.6% (n = 9). Canine insulin, porcine proinsulin, bovine proinsulin, and human C peptide exhibited no cross-reactivity. The mean fasting plasma CCP concentration was 0.089 +- 0.021 nmol/l in normal dogs and -0.005 +- 0.007 nmol/l (mean +- SEM) in diabetic dogs, respectively.

Altered oxidative stress and carbohydrate metabolism in canine mammary tumors

Directory of Open Access Journals (Sweden)

K. Jayasri

2016-12-01

Full Text Available Aim: Mammary tumors are the most prevalent type of neoplasms in canines. Even though cancer induced metabolic alterations are well established, the clinical data describing the metabolic profiles of animal tumors is not available. Hence, our present investigation was carried out with the aim of studying changes in carbohydrate metabolism along with the level of oxidative stress in canine mammary tumors. Materials and Methods: Fresh mammary tumor tissues along with the adjacent healthy tissues were collected from the college surgical ward. The levels of thiobarbituric acid reactive substances (TBARS, glutathione, protein, hexose, hexokinase, glucose-6-phosphatase, fructose-1, 6-bisphosphatase, and glucose-6-phosphate dehydrogenase (G6PD were analyzed in all the tissues. The results were analyzed statistically. Results: More than two-fold increase in TBARS and three-fold increase in glutathione levels were observed in neoplastic tissues. Hexokinase activity and hexose concentration (175% was found to be increased, whereas glucose-6-phosphatase (33%, fructose-1, 6-bisphosphatase (42%, and G6PD (5 fold activities were reduced in tumor mass compared to control. Conclusion: Finally, it was revealed that lipid peroxidation was increased with differentially altered carbohydrate metabolism in canine mammary tumors.

Spiral computed tomography in the evaluation of relations of the impacted maxillary canines and the adjacent incisor roots

International Nuclear Information System (INIS)

Siegel, R.; Stos, W.; Dyras, M.; Urbanik, A.; Wojciechowski, W.; Sztuk, S.

2009-01-01

Background: The relations of the crowns of impacted maxillary canines and the roots of adjacent incisors are difficult to evaluate on conventional radiographs due to superimposition of shadows of these structures. The aim of this study was to analyse the relations between the crowns of impacted canines and the roots of adjacent incisors with the use of computed tomography. Material/Methods: The study involved a group of 65 patients suspicious for an impacted maxillary permanent canine. All the patients underwent pantomography. In 44 individuals in the age of 13-31 years (mean age 17.1 ± 4.5) the examination revealed shadows of the impacted crowns superimposed on the roots of incisors. These patients were subjected to CT. On the basis of those CT examinations (including multiplanar and three-dimensional reconstructions) we defined the location of the impacted canines as buccal, palatal and horizontal. Likewise, the relations between the crowns of impacted canines and the roots of lateral or/and central incisors were studied. Results: From among 54 impacted maxillary canines, 41 (75.9%) were located palatally, 10 (18.5%) buccally, and 3 (5.6%) horizontally. In 14 cases (29.5%), the impacted canine remained in various kind of contact with both adjacent incisors. In addition to those aforementioned 14 cases, the impacted maxillary canine remained in contact with adjacent root of the lateral incisor in 34 cases (in total: 48 cases of contact). We found 17 cases (35.4%) of adherence without features of root resorption and 31 cases (64.4%) of resorption. Among the cases of resorption, there were 18 instances of deep resorption (58.1%) and 13 instances of light resorption (41.9%). There were also 18 cases (33.3%) of contact between the impacted canine and the root of the central incisor, including 10 instances (55.6%) of adjacency without root resorption and 8 cases (44.4%) of resorption. Conclusions: Computed tomography allows for a precise localisation of the impacted

First detection of canine parvovirus type 2c in Brazil.

OpenAIRE

Streck, André Felipe; Souza, Carine Kunzler; Gonçalves, K. R.; Zang, Luciana; Pinto, Luciane Dubina; Canal, Cláudio Wageck

2009-01-01

The presence of canine parvovirus type 2 (CPV-2), 2a and 2b has been described in Brazil, however, the type 2c had not been reported until now. In the current study, seven out of nine samples from dogs with diarrhea were characterized as CPV-2c, indicating that this virus is already circulating in the Brazilian canine population.No Brasil, a presença do parvovírus canino do tipo 2 (CPV-2), 2a e 2b já havia sido descrita, contudo, ainda não havia sido verificada a presença do tipo 2c. No prese...

When the Nose Doesn’t Know: Canine Olfactory Function Associated With Health, Management, and Potential Links to Microbiota

Science.gov (United States)

Jenkins, Eileen K.; DeChant, Mallory T.; Perry, Erin B.

2018-01-01

The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI) microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines. PMID:29651421

When the Nose Doesn’t Know: Canine Olfactory Function Associated With Health, Management, and Potential Links to Microbiota

Directory of Open Access Journals (Sweden)

Eileen K. Jenkins

2018-03-01

Full Text Available The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines.

When the Nose Doesn't Know: Canine Olfactory Function Associated With Health, Management, and Potential Links to Microbiota.

Science.gov (United States)

Jenkins, Eileen K; DeChant, Mallory T; Perry, Erin B

2018-01-01

The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI) microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines.

Development of new therapy for canine mammary cancer with recombinant measles virus

Directory of Open Access Journals (Sweden)

Koichiro Shoji

2016-01-01

Full Text Available Oncolytic virotherapy is a promising treatment strategy for cancer. We previously generated a recombinant measles virus (rMV-SLAMblind that selectively uses a poliovirus receptor-related 4 (PVRL4/Nectin4 receptor, but not signaling lymphocyte activation molecule (SLAM. We demonstrated that the virus exerts therapeutic effects against human breast cancer cells. Here, we examined the applicability of rMV-SLAMblind to treating canine mammary cancers (CMCs. We found that the susceptibilities of host cells to rMV-SLAMblind were dependent on canine Nectin-4 expression. Nectin-4 was detected in four of nine CMC cell lines. The rMV-SLAMblind efficiently infected those four Nectin-4-positive cell lines and was cytotoxic for three of them (CF33, CHMm, and CTBm. In vivo experiment showed that the administration of rMV-SLAMblind greatly suppressed the progression of tumors in mice xenografted with a CMC cell line (CF33. Immunohistochemistry revealed that canine Nectin-4 was expressed in 45% of canine mammary tumors, and the tumor cells derived from one clinical specimen were efficiently infected with rMV-SLAMblind. These results suggest that rMV-SLAMblind infects CMC cells and displays antitumor activity in vitro, in xenografts, and ex vivo. Therefore, oncolytic virotherapy with rMV-SLAMblind can be a novel method for treating CMCs.

Altered anatomy in a case with a buccally impacted maxillary canine tooth.

Science.gov (United States)

Rusu, M C; Comes, C A; Stanciu, D; Ciuluvică, R C; Motoc, A; Niculescu, M C; Jianu, Adelina Maria

2010-01-01

Bilateral dissections of maxilla were performed in a human adult cadaver head, male, aged 53 years. After the en block removal of the soft tissues in the oral and infraorbital regions, the antero-lateral surface of maxilla was exposed and also the vestibular aspect of the upper alveolar process. An oblique labially impacted right upper canine was evidenced, completely submucosal: its apex was tangent to the maxillary sinus floor, while the superior side of the apical part of the root was in close relation with the floor of the laterally expanded inferior nasal meatus. Superior and adjacent to the neck of that impacted canine a follicular cyst was evidenced and the antral wall presented distally to the apex of the impacted canine a dehiscent area, where the antral mucosa was only covered by an incomplete thin bony lamella. The incisors on that side were present but no resorption was identified at their level. Within the anterior border of the wall separating the maxillary sinus, small, and the inferior nasal meatus, the nerve for that impacted canine was coursing; the nerves for the upper incisors were initially located within the antero-lateral wall of the inferior nasal meatus. Although small, the maxillary sinus presented a supero-medial recess above the enlarged inferior nasal meatus and lateral to the normally-sized middle nasal meatus.

Cloning and characterization of the canine receptor for advanced glycation end products.

Science.gov (United States)

Murua Escobar, Hugo; Soller, Jan T; Sterenczak, Katharina A; Sperveslage, Jan D; Schlueter, Claudia; Burchardt, Birgit; Eberle, Nina; Fork, Melanie; Nimzyk, Rolf; Winkler, Susanne; Nolte, Ingo; Bullerdiek, Jörn

2006-03-15

Metastasis is one of the major problems when dealing with malignant neoplasias. Accordingly, the finding of molecular targets, which can be addressed to reduce tumour metastasising, will have significant impact on the development of new therapeutic approaches. Recently, the receptor for advanced glycation end products (RAGE)-high mobility group B1 (HMGB1) protein complex has been shown to have significant influence on invasiveness, growth and motility of tumour cells, which are essential characteristics required for metastatic behaviour. A set of in vitro and in vivo approaches showed that blocking of this complex resulted in drastic suppression of tumour cell growth. Due to the similarities of human and canine cancer the dog has joined the common rodent animal model for therapeutic and preclinical studies. However, complete characterisation of the protein complex is a precondition to a therapeutic approach based on the blocking of the RAGE-HMGB1 complex to spontaneously occurring tumours in dogs. We recently characterised the canine HMGB1 gene and protein completely. Here we present the complete characterisation of the canine RAGE gene including its 1384 bp mRNA, the 1215 bp protein coding sequence, the 2835 bp genomic structure, chromosomal localisation, gene expression pattern, and its 404 amino acid protein. Furthermore we compared the CDS of six different canine breeds and screened them for single nucleotide polymorphisms.

Effect of high contents of dietary animal-derived protein or carbohydrates on canine fecal microbiota

NARCIS (Netherlands)

Hang, I.; Rinttila, T.; Zentek, J.; Kettunen, A.; Alaja, S.; Apajalahti, J.A.; Harmoinen, J.; Vos, de W.M.; Spillmann, T.

2012-01-01

BACKGROUND: Considerable evidence suggests that food impacts both the gastro-intestinal (GI) function and the microbial ecology of the canine GI tract. The aim of this study was to evaluate the influence of high-carbohydrate (HC), high-protein (HP) and dry commercial (DC) diets on the canine colonic

Animal-Assisted Therapy for persons with disabilities based on canine tail language interpretation via fuzzy emotional behavior model.

Science.gov (United States)

Phanwanich, Warangkhana; Kumdee, Orrawan; Ritthipravat, Panrasee; Wongsawat, Yodchanan

2011-01-01

Animal-Assisted Therapy (AAT) is the science that employs the merit of human-animal interaction to alleviate mental and physical problems of persons with disabilities. However, to achieve the goal of AAT for persons with severe disabilities (e.g. spinal cord injury and amyotrophic lateral sclerosis), real-time animal language interpretation is needed. Since canine behaviors can be visually distinguished from its tail, this paper proposes the automatic real-time interpretation of canine tail language for human-canine interaction in the case of persons with severe disabilities. Canine tail language is captured via two 3-axis accelerometers. Directions and frequency are selected as our features of interests. New fuzzy rules and center of gravity (COG)-based defuzzification method are proposed in order to interpret the features into three canine emotional behaviors, i.e., agitate, happy, and scare as well as its blended emotional behaviors. The emotional behavior model is performed in the simulated dog. The average recognition rate in real dog is 93.75% accuracy.

A new system for assessment of growth using mandibular canine calcification stages and its correlation with modified MP3 stages.

Science.gov (United States)

Hegde, Gautham; Hegde, Nanditha; Kumar, Anil; Keshavaraj

2014-07-01

Orthodontic diagnosis and treatment planning for growing children must involve growth prediction, especially in the treatment of skeletal problems. Studies have shown that a strong association exists between skeletal maturity and dental calcification stages. The present study was therefore taken up to provide a simple and practical method for assessing skeletal maturity using a dental periapical film and standard dental X-ray machine, to compare the developmental stages of the mandibular canine with that of developmental stages of modified MP3 and to find out if any correlation exists, to determine if the developmental stages of the mandibular canine alone can be used as a reliable indicator for assessment of skeletal maturity. A total of 160 periapical radiographs, of the mandibular right canine and the MP3 region was taken and assessed according to the Dermirjian's stages of dental calcification and the modified MP3 stages. The correlation coefficient between MP3 stages and developmental stages of mandibular canine was found to be significant in both male and female groups. When the canine calcification stages were compared with the MP3 stages it was found that with the exception of the D stage of canine calcification the remaining stages showed a very high correlation with the modified MP3 stages. The correlation between the mandibular canine calcification stages, and the MP3 stages was found to be significant. The canine calcification could be used as a sole indicator for assessment of skeletal maturity.

The avian-origin H3N2 canine influenza virus has limited replication in swine

Science.gov (United States)

A genetically and antigenically distinct H3N2 canine influenza of avian-origin was detected in March of 2015 in Chicago, Illinois. A subsequent outbreak was reported with over 1,000 dogs in the Midwest affected. The potential for canine-to-swine transmission was unknown. Experimental infection in pi...

Canine classical seminoma: a specific malignant type with human classifications is highly correlated with tumor angiogenesis

International Nuclear Information System (INIS)

Kim, Jong-Hyuk; Yu, Chi-Ho; Yhee, Ji-Young; Im, Keum-Soon; Kim, Na-Hyun; Sur, Jung-Hyang

2010-01-01

Human seminoma is classified as classical seminoma (SE) and spermatocytic seminoma (SS). Human SE is known to be more malignant and metastasizing more frequently than SS. Tumor angiogenesis is highly related with tumor progression and metastasis, with microvessel density (MVD) being an important parameter of metastatic potential. Canine seminoma is not yet well-established as SE or SS type including correlation with angiogenesis. We classified canine SE and SS, and then compared them to tumor associated vessels. Twenty-three cases of canine seminomas (2 intratubular, 9 diffuse, and 12 intratubular/diffuse seminomas showing both intratubular and diffuse patterns) were classified as SE or SS by immunohistochemistry (IHC) using monoclonal antibody against PLAP and by PAS stain. The histopathological data were then compared to see if there was a correlation with SE or SS. Angiogenesis of seminomas were evaluated by immunohistochemical assay using polyclonal antibody against Von Willebrand factor (vWF) and by calculating the means of MVD, vessels area and perimeters using computerized image analysis. Statistical Package for Social Sciences (SPSS) program was used for various statistical analyses. The numbers of PLAP+/PAS+ canine SEs were 8/23 (34.8%) and PLAP-/PAS- SSs were 15/23 (61.2%). All SE cases (8/8, 100%) were intratubular/diffuse types. SS types included 2 intratubular (2/15, 13.3%), 9 diffuse (9/15, 60%), and 4 intratubular/diffuse (4/15, 26.7%) types. MVD and vascular parameters in SEs were significantly higher than in SSs, showing the highest value in the intratubular/diffuse type. Seminomas observed with neoplastic cells invasion of vessels presented higher perimeter and area values than seminomas without conformed neoplastic cells invasion. In this study, we demonstrated a positive relationship between canine SE and tumor angiogenesis. Furthermore, we also showed that a tumor cells invasion of vessels were a correlated vascular parameter. Although

Canine classical seminoma: a specific malignant type with human classifications is highly correlated with tumor angiogenesis

Directory of Open Access Journals (Sweden)

Kim Jong-Hyuk

2010-05-01

Full Text Available Abstract Background Human seminoma is classified as classical seminoma (SE and spermatocytic seminoma (SS. Human SE is known to be more malignant and metastasizing more frequently than SS. Tumor angiogenesis is highly related with tumor progression and metastasis, with microvessel density (MVD being an important parameter of metastatic potential. Canine seminoma is not yet well-established as SE or SS type including correlation with angiogenesis. We classified canine SE and SS, and then compared them to tumor associated vessels. Methods Twenty-three cases of canine seminomas (2 intratubular, 9 diffuse, and 12 intratubular/diffuse seminomas showing both intratubular and diffuse patterns were classified as SE or SS by immunohistochemistry (IHC using monoclonal antibody against PLAP and by PAS stain. The histopathological data were then compared to see if there was a correlation with SE or SS. Angiogenesis of seminomas were evaluated by immunohistochemical assay using polyclonal antibody against Von Willebrand factor (vWF and by calculating the means of MVD, vessels area and perimeters using computerized image analysis. Statistical Package for Social Sciences (SPSS program was used for various statistical analyses. Results The numbers of PLAP+/PAS+ canine SEs were 8/23 (34.8% and PLAP-/PAS- SSs were 15/23 (61.2%. All SE cases (8/8, 100% were intratubular/diffuse types. SS types included 2 intratubular (2/15, 13.3%, 9 diffuse (9/15, 60%, and 4 intratubular/diffuse (4/15, 26.7% types. MVD and vascular parameters in SEs were significantly higher than in SSs, showing the highest value in the intratubular/diffuse type. Seminomas observed with neoplastic cells invasion of vessels presented higher perimeter and area values than seminomas without conformed neoplastic cells invasion. Conclusion In this study, we demonstrated a positive relationship between canine SE and tumor angiogenesis. Furthermore, we also showed that a tumor cells invasion of vessels

Canine distemper outbreak in rhesus monkeys, China.

Science.gov (United States)

Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang; Hu, Rongliang

2011-08-01

Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People's Republic of China. Approximately 10,000 animals were infected (25%-60% disease incidence); 5%-30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain.

9 CFR 113.316 - Canine Parainfluenza Vaccine.

Science.gov (United States)

2010-01-01

... furnished or approved by Animal and Plant Health Inspection Service. (4) The rectal temperature of each dog...: (1) Twenty-five canine parainfluenza susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Nasal swabs shall be collected from each dog on the day the first dose of vaccine is...

Canine and feline obesity: a review of pathophysiology, epidemiology, and clinical management

Directory of Open Access Journals (Sweden)

Loftus JP

2014-12-01

Full Text Available John P Loftus, Joseph J Wakshlag Cornell University College of Veterinary Medicine, Veterinary Medical Center, Ithaca, NY, USAAbstract: Canine and feline obesity rates have reached pandemic proportions and are similar to those in humans, with approximately 30%–40% of dogs and cats being overweight to obese. Obesity has been associated with other health problems, including osteoarthritis, renal disease, skin disease, insulin resistance, and neoplasia in dogs, while in cats obesity is associated with dermatological issues, diabetes mellitus, neoplasia, and urolithiasis. The health issues appear to be slightly different across the two species, which may be due to some inherent differences in the hormonal milieu involved in obesity that differs between the dog and the cat. In this review, we discuss the complicated nature of the pathogenesis of obesity, the hormonal stimulus for orexigenic and anorexigenic behavior, adipose tissue as an endocrine organ, and most importantly, clinical management of the number one disease in canine and feline medicine.Keywords: obesity, canine, feline, veterinary

ΔNp63 mediates cellular survival and metastasis in canine osteosarcoma.

Science.gov (United States)

Cam, Maren; Gardner, Heather L; Roberts, Ryan D; Fenger, Joelle M; Guttridge, Denis C; London, Cheryl A; Cam, Hakan

2016-07-26

p63 is a structural homolog within the 53 family encoding two isoforms, ΔNp63 and TAp63. The oncogenic activity of ΔNp63 has been demonstrated in multiple cancers, however the underlying mechanisms that contribute to tumorigenesis are poorly characterized. Osteosarcoma (OSA) is the most common primary bone tumor in dogs, exhibiting clinical behavior and molecular biology essentially identical to its human counterpart. The purpose of this study was to evaluate the potential contribution of ΔNp63 to the biology of canine OSA. As demonstrated by qRT-PCR, nearly all canine OSA cell lines and tissues overexpressed ΔNp63 relative to normal control osteoblasts. Inhibition of ΔNp63 by RNAi selectively induced apoptosis in the OSA cell lines overexpressing ΔNp63. Knockdown of ΔNp63 upregulated expression of the proapoptotic Bcl-2 family members Puma and Noxa independent of p53. However the effects of ΔNp63 required transactivating isoforms of p73, suggesting that ΔNp63 promotes survival in OSA by repressing p73-dependent apoptosis. In addition, ΔNp63 modulated angiogenesis and invasion through its effects on VEGF-A and IL-8 expression, and STAT3 phosphorylation. Lastly, the capacity of canine OSA cell lines to form pulmonary metastasis was directly related to expression levels of ΔNp63 in a murine model of metastatic OSA. Together, these data demonstrate that ΔNp63 inhibits apoptosis and promotes metastasis, supporting continued evaluation of this oncogene as a therapeutic target in both human and canine OSA.

Segmentation of the Canine Corpus Callosum using Diffusion Tensor Imaging Tractography

Science.gov (United States)

Pierce, T.T.; Calabrese, E.; White, L.E.; Chen, S.D.; Platt, S.R.; Provenzale, J.M.

2014-01-01

Background We set out to determine functional white matter (WM) connections passing through the canine corpus callosum useful for subsequent studies of canine brains that serve as models for human WM pathway disease. Based on prior studies, we anticipated that the anterior corpus callosum would send projections to the anterior cerebral cortex while progressively posterior segments would send projections to more posterior cortex. Methods A post mortem canine brain was imaged using a 7T MRI producing 100 micron isotropic resolution DTI analyzed by tractography. Using ROIs within cortical locations, which were confirmed by a Nissl stain that identified distinct cortical architecture, we successfully identified 6 important WM pathways. We also compared fractional anisotropy (FA), apparent diffusion coefficient (ADC), radial diffusivity (RD), and axial diffusivity (AD) in tracts passing through the genu and splenium. Results Callosal fibers were organized based upon cortical destination, i.e. fibers from the genu project to the frontal cortex. Histologic results identified the motor cortex based on cytoarchitectonic criteria that allowed placement of ROIs to discriminate between frontal and parietal lobes. We also identified cytoarchitecture typical of the orbital frontal, anterior frontal, and occipital regions and placed ROIs accordingly. FA, ADC, RD and AD values were all higher in posterior corpus callosum fiber tracts. Conclusions Using 6 cortical ROIs, we identified 6 major white matter tracts that reflect major functional divisions of the cerebral hemispheres and we derived quantitative values that can be used for study of canine models of human WM pathological states. PMID:24370161

Segmentation of the canine corpus callosum using diffusion-tensor imaging tractography.

Science.gov (United States)

Pierce, Theodore T; Calabrese, Evan; White, Leonard E; Chen, Steven D; Platt, Simon R; Provenzale, James M

2014-01-01

We set out to determine functional white matter (WM) connections passing through the canine corpus callosum; these WM connections would be useful for subsequent studies of canine brains that serve as models for human WM pathway disease. Based on prior studies, we anticipated that the anterior corpus callosum would send projections to the anterior cerebral cortex whereas progressively posterior segments would send projections to more posterior cortex. A postmortem canine brain was imaged using a 7-T MRI system producing 100-μm-isotropic-resolution diffusion-tensor imaging analyzed by tractography. Using regions of interest (ROIs) within cortical locations, which were confirmed by a Nissl stain that identified distinct cortical architecture, we successfully identified six important WM pathways. We also compared fractional anisotropy (FA), apparent diffusion coefficient (ADC), radial diffusivity, and axial diffusivity in tracts passing through the genu and splenium. Callosal fibers were organized on the basis of cortical destination (e.g., fibers from the genu project to the frontal cortex). Histologic results identified the motor cortex on the basis of cytoarchitectonic criteria that allowed placement of ROIs to discriminate between frontal and parietal lobes. We also identified cytoarchitecture typical of the orbital frontal, anterior frontal, and occipital regions and placed ROIs accordingly. FA, ADC, radial diffusivity, and axial diffusivity values were all higher in posterior corpus callosum fiber tracts. Using six cortical ROIs, we identified six major WM tracts that reflect major functional divisions of the cerebral hemispheres, and we derived quantitative values that can be used for study of canine models of human WM pathologic states.

Canine osteosarcoma cell lines contain stem-like cancer cells: biological and pharmacological characterization.

Science.gov (United States)

Gatti, Monica; Wurth, Roberto; Vito, Guendalina; Pattarozzi, Alessandra; Campanella, Chiara; Thellung, Stefano; Maniscalco, Lorella; De Maria, Raffaella; Villa, Valentina; Corsaro, Alessandro; Nizzari, Mario; Bajetto, Adriana; Ratto, Alessandra; Ferrari, Angelo; Barbieri, Federica; Florio, Tullio

2016-05-01

Cancer stem cells (CSCs) represent a small subpopulation of cells responsible for tumor formation and progression, drug resistance, tumor recurrence and metastasization. CSCs have been identified in many human tumors including osteosarcoma (OSA). CSC distinctive properties are the expression of stem cell markers, sustained growth, self-renewal and tumorigenicity. Here we report the isolation of stem-like cells from two canine OSA cultures, characterized by self-renewal, evaluated by sphere formation ability, differential marker expression, and in vitro proliferation when cultured in a medium containing EGF and bFGF. Current therapies for OSA increased survival time, but prognosis remains poor, due to the development of drug resistance and metastases. Chemotherapy shrinks the tumor mass but CSCs remain unaffected, leading to tumor recurrence. Metformin, a drug for type 2 diabetes, has been shown to possess antitumor properties affecting CSC survival in different human and animal cancers. Here we show that metformin has a significant antiproliferative effect on canine OSA stem-like cells, validating this in vitro model for further pre-clinical drug evaluations. In conclusion, our results demonstrate the feasibility of obtaining CSC-enriched cultures from primary canine OSA cells as a promising model for biological and pharmacological studies of canine and human OSAs.

Three-dimensional finite element analysis on canine teeth distalization by different accessories of bracket-free invisible orthodontics technology

Science.gov (United States)

Xu, Nuo; Lei, Xue; Yang, Xiaoli; Li, Xinhui; Ge, Zhenlin

2018-04-01

Objective: to compare canine tooth stress distribution condition during maxillary canine tooth distalization by different accessories of bracket-free invisible orthodontics technology after removal of maxillary first premolar, and provide basis for clinical design of invisible orthodontics technology. Method: CBCT scanning image of a patient with individual normal occlusion was adopted, Mimics, Geomagic and ProlE software were used for establishing three-dimensional models of maxilla, maxillary dentition, parodontium, invisible orthodontics appliance and accessories, ANSYS WORKBENCH was utilized as finite element analysis tools for analyzing stress distribution and movement pattern of canine tooth and parodontium when canine tooth was equipped with power arm and vertical rectangle accessory. Meanwhile, canine tooth none-accessory design group was regarded as a control. Result: teeth had even bistal surface stress distribution in the power arm group; stress was concentrated on distal tooth neck, and the stress was gradually deviated to mesial-labial side and distal lingual side in vertical rectangle group and none-accessory group. Conclusion: teeth tend to move as a whole in the Power arm group, vertical rectangle group has lower tooth gradient compared with the none-accessory group, teeth are inclined for movement in the none-accessory group, and canine teeth tend to rotate to the distal lingual side.

Biology, diagnosis and treatment of canine appendicular osteosarcoma: similarities and differences with human osteosarcoma.

Science.gov (United States)

Morello, Emanuela; Martano, Marina; Buracco, Paolo

2011-09-01

Osteosarcoma (OSA) is the most common primary bone tumour in dogs. The appendicular locations are most frequently involved and large to giant breed dogs are commonly affected, with a median age of 7-8 years. OSA is a locally invasive neoplasm with a high rate of metastasis, mostly to the lungs. Due to similarities in biology and treatment of OSA in dogs and humans, canine OSA represents a valid and important tumour model. Differences between canine and human OSAs include the age of occurrence (OSA is most commonly an adolescent disease in humans), localisation (the stifle is the most common site of localisation in humans) and limited use of neoadjuvant chemotherapy in canine OSA. Copyright © 2010 Elsevier Ltd. All rights reserved.

Molecular characterisation of canine parvovirus strains circulating in ...

African Journals Online (AJOL)

STORAGESEVER

2010-07-19

Jul 19, 2010 ... Canine parvovirus (CPV) was first isolated at 1978 in the USA. Analysis of ... Japan, Australia, Italy and Africa although the proportions of CPV-2a ... T/A clone PCR product cloning Kit (Takara, DaLian, China). Sequencing was ...

Orthodontic Treatment of Maxillary Incisors with Severe Root Resorption Caused by Bilateral Canine Impaction in a Class II Division 1 Patient.

Science.gov (United States)

Chang, Na-Young; Park, Jae Hyun; Lee, Mi-Young; Cho, Jin-Woo; Cho, Jin-Hyoung; An, Ki-Yong; Chae, Jong-Moon

2016-01-01

This case report shows the successful alignment of bilateral impacted maxillary canines. A 12-year-old male with the chief complaint of the protrusion of his maxillary anterior teeth happened to have bilateral maxillary canine impaction on the labial side of his maxillary incisors. Four maxillary incisors showed severe root resorption because of the impacted canines. The patient was diagnosed as skeletal Class II malocclusion with proclined maxillary incisors. The impacted canine was carefully retracted using sectional buccal arch wires to avoid further root resorption of the maxillary incisors. To distalize the maxillary dentition, two palatal miniscrews were used. After 25 months of treatment, the maxillary canines were well aligned without any additional root resorption of the maxillary incisors.

Canine oral mucosa evaluation as a potential autograft tissue for the treatment of unresponsive keratoconjunctivitis sicca.

Science.gov (United States)

Cherry, Rose L; Smith, Jodi D; Ben-Shlomo, Gil

2018-01-01

Labial mucosa transplantation for the treatment of canine keratoconjunctivitis sicca (KCS) has been reported recently. Postoperative alleviation of clinical signs was noted and assumed to be the result of labial salivary glands providing lubrication to the ocular tissue. The aim of this study was to evaluate the presence of minor salivary glands (MSG) in the canine oral mucosa. Oral mucosal biopsies were collected from six dogs that died (n = 1) or were euthanized (n = 5) for reasons unrelated to this study. The breeds included were two Doberman Pinschers, one Labrador Retriever, one Portuguese Water Dog, one German Shepherd Dog, and one mixed canine. Three were spayed females, and three were castrated males with the median age of 9 years (range, 6-13 years). Samples were obtained by an 8-mm punch biopsy at the following locations of the canine oral cavity: upper rostral labial mucosa at midline, lower rostral labial mucosa at midline, upper labial mucosa near the commissure, lower labial mucosa near the commissure, and buccal mucosa approximately 1 cm caudal to the commissure. Samples were routinely processed with hematoxylin and eosin, and periodic acid-Schiff stains. Samples were evaluated by light microscopy. At the selected locations, no MSG or other secreting cells were detected. Minor salivary glands are not associated with alleviation of canine KCS symptoms following labial mucosa transplantation. Further studies are needed to determine the mechanism leading to the transient improvement of KCS symptoms in canine patients following labial mucosa transplantation. © 2017 American College of Veterinary Ophthalmologists.

Establishment of reverse transcription loop-mediated isothermal amplification for rapid detection and differentiation of canine distemper virus infected and vaccinated animals.

Science.gov (United States)

Liu, Da-Fei; Liu, Chun-Guo; Tian, Jin; Jiang, Yi-Tong; Zhang, Xiao-Zhan; Chai, Hong-Liang; Yang, Tian-Kuo; Yin, Xiu-Chen; Zhang, Hong-Ying; Liu, Ming; Hua, Yu-Ping; Qu, Lian-Dong

2015-06-01

Although widespread vaccination against canine distemper virus (CDV) has been conducted for many decades, several canine distemper outbreaks in vaccinated animals have been reported frequently. In order to detect and differentiate the wild-type and vaccine strains of the CDV from the vaccinated animals, a novel reverse transcription loop-mediated isothermal amplification (RT-LAMP) method was developed. A set of four primers-two internal and two external-were designed to target the H gene for the specific detection of wild-type CDV variants. The CDV-H RT-LAMP assay rapidly amplified the target gene, within 60 min, using a water bath held at a constant temperature of 65°C. The assay was 100-fold more sensitive than conventional RT-PCR, with a detection limit of 10(-1)TCID50ml(-1). The system showed a preference for wild-type CDV, and exhibited less sensitivity to canine parvovirus, canine adenovirus type 1 and type 2, canine coronavirus, and canine parainfluenza virus. The assay was validated using 102 clinical samples obtained from vaccinated dog farms, and the results were comparable to a multiplex nested RT-PCR assay. The specific CDV-H RT-LAMP assay provides a simple, rapid, and sensitive tool for the detection of canines infected with wild-type CDV from canines vaccinated with attenuated vaccine. Copyright © 2015 Elsevier B.V. All rights reserved.

An update on the treatment of canine atopic dermatitis

Directory of Open Access Journals (Sweden)

Marsella R

2012-08-01

Full Text Available Rosanna MarsellaDepartment of Small Animal Clinical Sciences, College of Veterinary Medicine, University of Florida Gainesville, FL, USAAbstract: Remarkable progress has been made in recent years concerning our understanding of the pathogenesis of canine atopic dermatitis (AD. As our understanding improves, the therapeutic approach evolves. Of utmost importance is the documentation of skin barrier impairment in canine AD: ceramides deficiency leads to increased permeability and increased allergen penetration and sensitization. It is currently unknown whether this dysfunction is primary and genetically inherited or secondary to inflammation but it is accepted that skin barrier deficiency plays an important role in either starting or minimally exacerbating canine AD. Thus, the therapeutic approach has changed from focusing on the control of the inflammation to a combined approach that includes therapies aimed at skin barrier repair. The issue of skin barrier repair has been addressed both with oral administration of essential fatty acids and the topical application of products containing a combination of ceramides and fatty acids. These strategies are most helpful as adjunctive treatments and would be best used in young patients that have not developed chronic skin changes. Importantly, treatment for canine AD is multimodal and tailored to the individual patient, the age, and the duration of the disease. Client education plays an important role in explaining the importance of a long-term approach to minimize flare-ups and, in this context, topical therapy to correct skin barrier can be of great benefit. This is an area still in infancy and much work is needed to identify the best formulation. In human medicine, long-term use of moisturizers can have a profound effect on skin barrier and gene expression of proteins involved in skin barrier. This effect is variable depending on the formulation used. It is reasonable to speculate that the same may be

Diagnosis, prevention, and management of canine hip dysplasia: a review

Directory of Open Access Journals (Sweden)

Schachner ER

2015-05-01

Full Text Available Emma R Schachner, Mandi J Lopez Department of Veterinary Clinical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA, USA Abstract: Canine hip dysplasia (CHD is a polygenic and multifactorial developmental disorder characterized by coxofemoral (hip joint laxity, degeneration, and osteoarthritis (OA. Current diagnostic techniques are largely subjective measures of joint conformation performed at different stages of development. Recently, measures on three-dimensional images generated from computed tomography scans predicted the development of OA associated with CHD. Continued refinement of similar imaging methods may improve diagnostic imaging techniques to identify dogs predisposed to degenerative hip joint changes. By current consensus, joint changes consistent with CHD are influenced by genetic predisposition as well as environmental and biomechanical factors; however, despite decades of work, the relative contributions of each to the development and extent of CHD signs remain elusive. Similarly, despite considerable effort to decipher the genetic underpinnings of CHD for selective breeding programs, relevant genetic loci remain equivocal. As such, prevention of CHD within domestic canine populations is marginally successful. Conservative management is often employed to manage signs of CHD, with lifelong maintenance of body mass as one of the most promising methods. Surgical intervention is often employed to prevent joint changes or restore joint function, but there are no gold standards for either goal. To date, all CHD phenotypes are considered as a single entity in spite of recognized differences in expression and response to environmental conditions and treatment. Identification of distinct CHD phenotypes and targeting evidence-based conservative and invasive treatments for each may significantly advance prevention and management of a prevalent, debilitating condition in canine companions. Keywords: canine

A Case of Maxillary Protrusion with Congenitally Missing Canine Teeth in the Mandible

OpenAIRE

松井, 啓至; 酒徳, 明彦

1996-01-01

A patient that had a maxillary protrusion with congenitally missing canine teeth in the mandible was successfully treated with the extraction of the maxillary first premolars. The patient's cooperation in wearing headgear appliance was highly favorable. Her profile changes were pronounced and esthetically pleasing. A review of her post-treatment records revealed an excellent esthetic and occlusal result even though the first premolars were aligned instead of the canine teeth in the mandible. ...

Canine leishmaniosis in the Old and New Worlds: unveiled similarities and differences.

Science.gov (United States)

Dantas-Torres, Filipe; Solano-Gallego, Laia; Baneth, Gad; Ribeiro, Vitor Marcio; de Paiva-Cavalcanti, Milena; Otranto, Domenico

2012-12-01

Canine leishmaniosis is a potentially life-threatening disease which is spreading geographically in the Old and New Worlds, where different diagnostic procedures, treatments, and control strategies are currently in place. This Opinion article outlines the similarities and differences between canine leishmaniosis in the Old and New Worlds, with emphasis on South America and Europe. Finally, it calls the attention of veterinary and public health authorities to standardize and improve practices for diagnosing, treating, and preventing the disease. Copyright © 2012 Elsevier Ltd. All rights reserved.

Radiographic studies on the development of incisors and canine teeth in donkeys

International Nuclear Information System (INIS)

Misk, N.A.; Semieka, M.M.A.

1997-01-01

The aim of the present work is to study the time of radiographic appearance in donkeys of different stages of development of deciduous incisors, permanent incisors and canine teeth; the radiographic length of deciduous incisors, permanent incisors and canines; the process of root resorption of deciduous incisors; and the appearance of the pulp cavity and ifs relation to denial Infundibulum at different ages. Sixty specimens were used and all were radiographed. Interpretation was stated for each, from 1 day up to 17 years of age

Targeting VEGF in canine oxygen-induced retinopathy - a model for human retinopathy of prematurity.

Science.gov (United States)

McLeod, D Scott; Lutty, Gerard A

2016-01-01

Development of the dog superficial retinal vasculature is similar to the mechanism of human retinal vasculature development; they both develop by vasculogenesis, differentiation, and assembly of vascular precursors called angioblasts. Canine oxygen-induced retinopathy (OIR) was first developed by Arnall Patz in an effort to experimentally determine the effects of hyperoxia on the development of the retinal vasculature. The canine OIR model has many characteristics in common with human retinopathy of prematurity. Exposure of 1-day-old dogs to hyperoxia for 4 days causes a vaso-obliteration throughout the retina. Vasoproliferation, after the animals have returned to room air, is robust. The initial small preretinal neovascular formations anastomose to form large preretinal membranes that eventually cause tractional retinal folds. The end-stage pathology of the canine model is similar to stage IV human retinopathy of prematurity. Therefore, canine OIR is an excellent forum to evaluate the response to drugs targeting VEGF and its receptors. Evaluation of an antibody to VEGF-R2 and the VEGF-Trap demonstrated that doses should be titered down so that preretinal neovascularization is inhibited but retinal revascularization is able to proceed, vascularizing peripheral retina and preventing it from being a source of VEGF.

Magnetic resonance imaging of canine degenerative lumbar spine diseases

International Nuclear Information System (INIS)

Karkkainen, M.; Punto, L.U.; Tulamo, R.M.

1993-01-01

Degenerative lumbar spine diseases, i.e., sacrolumbar stenosis, intervertebral disk degeneration and protrusion and spondylosis deformans of the canine lumbar spine were studied in eleven canine patients and three healthy controls using radiography and 0.02 T and 0.04 T low field magnetic resonance imaging. The T1 and T2 weighted images were obtained in sagittal and transverse planes. The loss of hydration of nucleus pulposus, taken as a sign of degeneration in the intervertebral disks, could be evaluated in both T1 and T2 weighted images. As a noninvasive method magnetic resonance imaging gave more exact information about the condition of intervertebral disks than did radiography. Sacrolumbar stenosis and compression of the spinal cord or cauda equina and surrounding tissue could be evaluated without contrast medium

Towards immunotherapy with redirected T cells in a large animal model: Ex vivo activation, expansion, and genetic modification of canine T cells

Science.gov (United States)

Mata, Melinda; Vera, Juan; Gerken, Claudia; Rooney, Cliona M.; Miller, Tasha; Pfent, Catherine; Wang, Lisa L.; Wilson-Robles, Heather M.; Gottschalk, Stephen

2014-01-01

Adoptive transfer of T cells expressing chimeric antigen receptors (CARs) has shown promising anti-tumor activity in early phase clinical studies, especially for hematological malignancies. However, most preclinical models do not reliably mimic human disease. We reasoned that developing an adoptive T-cell therapy approach for spontaneous osteosarcoma (OS) occurring in dogs would more closely reproduce the condition in human cancer. To generate CAR-expressing canine T cells we developed expansion and transduction protocols that allow for the generation of sufficient numbers of CAR-expressing canine T cells for future clinical studies in dogs within 2 weeks of ex vivo culture. To evaluate the functionality of CAR-expressing canine T cells we targeted HER2-positive OS. We demonstrate that canine OS is positive for HER2, and that canine T cells expressing a HER2-specific CAR with human-derived transmembrane and CD28.ζ signaling domains recognize and kill HER2-positive canine OS cell lines in an antigen-dependent manner. To reduce the potential immunogenicity of the CAR we evaluated a CAR with canine-derived transmembrane and signaling domains, and found no functional difference between human and canine CARs. Hence, we have successfully developed a strategy to generate CAR-expressing canine T cells for future preclinical studies in dogs. Testing T-cell therapies in an immunocompetent, outbred animal model may improve our ability to predict their safety and efficacy prior to conducting studies in humans. PMID:25198528

Expression of PD-L1 on canine tumor cells and enhancement of IFN-γ production from tumor-infiltrating cells by PD-L1 blockade.

Directory of Open Access Journals (Sweden)

Naoya Maekawa

Full Text Available Programmed death 1 (PD-1, an immunoinhibitory receptor, and programmed death ligand 1 (PD-L1, its ligand, together induce the "exhausted" status in antigen-specific lymphocytes and are thus involved in the immune evasion of tumor cells. In this study, canine PD-1 and PD-L1 were molecularly characterized, and their potential as therapeutic targets for canine tumors was discussed. The canine PD-1 and PD-L1 genes were conserved among canine breeds. Based on the sequence information obtained, the recombinant canine PD-1 and PD-L1 proteins were constructed; they were confirmed to bind each other. Antibovine PD-L1 monoclonal antibody effectively blocked the binding of recombinant PD-1 with PD-L1-expressing cells in a dose-dependent manner. Canine melanoma, mastocytoma, renal cell carcinoma, and other types of tumors examined expressed PD-L1, whereas some did not. Interestingly, anti-PD-L1 antibody treatment enhanced IFN-γ production from tumor-infiltrating cells. These results showed that the canine PD-1/PD-L1 pathway is also associated with T-cell exhaustion in canine tumors and that its blockade with antibody could be a new therapeutic strategy for canine tumors. Further investigations are needed to confirm the ability of anti-PD-L1 antibody to reactivate canine antitumor immunity in vivo, and its therapeutic potential has to be further discussed.

Compound odontoma associated with impacted maxillary central incisor dictates a need to be vigilant to canine eruption pattern: A 2-year follow-up

Directory of Open Access Journals (Sweden)

Shilpy Singla

2016-01-01

Full Text Available Canine deviation from its path of eruption is usually followed by either delayed or impaction of canine. One of the important and not so noticed reasons for canine displacement is formerly impacted central incisor. The difference in age of eruption of these two teeth is 4 years; however, the absence of maxillary incisor should be perceived with utmost conviction about impending canine displacement leading to its impaction as well. This case presents similar picture where composite, compound odontoma with respect to maxillary central incisor led to its impaction resulted in deviated path of eruption for erupting canine. This canine displacement to worsen prognosis ended up getting impacted if not dealt with cautiously in the later stages of occlusal development.

Expression of Bcl-2 in canine osteosarcoma

Science.gov (United States)

Piro, F.; Leonardi, L.

2015-01-01

Osteosarcoma (OS) is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines. PMID:26623359

Canine Platelet Lysate Is Inferior to Fetal Bovine Serum for the Isolation and Propagation of Canine Adipose Tissue- and Bone Marrow-Derived Mesenchymal Stromal Cells

Science.gov (United States)

Russell, Keith A.; Gibson, Thomas W. G.; Chong, Andrew; Co, Carmon; Koch, Thomas G.

2015-01-01

Background Mesenchymal stromal cells (MSC) are increasingly investigated for their clinical utility in dogs. Fetal bovine serum (FBS) is a common culture supplement used for canine MSC expansion. However, FBS content is variable, its clinical use carries risk of an immune response, and its cost is increasing due to global demand. Platelet lysate (PL) has proven to be a suitable alternative to FBS for expansion of human MSC. Hypothesis and Objectives We hypothesized that canine adipose tissue (AT) and bone marrow (BM) MSC could be isolated and expanded equally in PL and FBS at conventionally-used concentrations with differentiation of these MSC unaffected by choice of supplement. Our objectives were to evaluate the use of canine PL in comparison with FBS at four stages: 1) isolation, 2) proliferation, 3) spontaneous differentiation, and 4) directed differentiation. Results 1) Medium with 10% PL was unable to isolate MSC. 2) MSC, initially isolated in FBS-supplemented media, followed a dose-dependent response with no significant difference between PL and FBS cultures at up to 20% (AT) or 30% (BM) enrichment. Beyond these respective peaks, proliferation fell in PL cultures only, while a continued dose-dependent proliferation response was noted in FBS cultures. 3) Further investigation indicated PL expansion culture was inducing spontaneous adipogenesis in concentrations as low as 10% and as early as 4 days in culture. 4) MSC isolated in FBS, but expanded in either FBS or PL, maintained ability to undergo directed adipogenesis and osteogenesis, but not chondrogenesis. Conclusions/Significance Canine PL did not support establishment of MSC colonies from AT and BM, nor expansion of MSC, which appear to undergo spontaneous adipogenesis in response to PL exposure. In vivo studies are warranted to determine if concurrent use of MSC with any platelet-derived products such as platelet-rich plasma are associated with synergistic, neutral or antagonistic effects. PMID:26353112

Canine Platelet Lysate Is Inferior to Fetal Bovine Serum for the Isolation and Propagation of Canine Adipose Tissue- and Bone Marrow-Derived Mesenchymal Stromal Cells.

Directory of Open Access Journals (Sweden)

Keith A Russell

Full Text Available Mesenchymal stromal cells (MSC are increasingly investigated for their clinical utility in dogs. Fetal bovine serum (FBS is a common culture supplement used for canine MSC expansion. However, FBS content is variable, its clinical use carries risk of an immune response, and its cost is increasing due to global demand. Platelet lysate (PL has proven to be a suitable alternative to FBS for expansion of human MSC.We hypothesized that canine adipose tissue (AT and bone marrow (BM MSC could be isolated and expanded equally in PL and FBS at conventionally-used concentrations with differentiation of these MSC unaffected by choice of supplement. Our objectives were to evaluate the use of canine PL in comparison with FBS at four stages: 1 isolation, 2 proliferation, 3 spontaneous differentiation, and 4 directed differentiation.1 Medium with 10% PL was unable to isolate MSC. 2 MSC, initially isolated in FBS-supplemented media, followed a dose-dependent response with no significant difference between PL and FBS cultures at up to 20% (AT or 30% (BM enrichment. Beyond these respective peaks, proliferation fell in PL cultures only, while a continued dose-dependent proliferation response was noted in FBS cultures. 3 Further investigation indicated PL expansion culture was inducing spontaneous adipogenesis in concentrations as low as 10% and as early as 4 days in culture. 4 MSC isolated in FBS, but expanded in either FBS or PL, maintained ability to undergo directed adipogenesis and osteogenesis, but not chondrogenesis.Canine PL did not support establishment of MSC colonies from AT and BM, nor expansion of MSC, which appear to undergo spontaneous adipogenesis in response to PL exposure. In vivo studies are warranted to determine if concurrent use of MSC with any platelet-derived products such as platelet-rich plasma are associated with synergistic, neutral or antagonistic effects.

β-Catenin transcriptional activity is minimal in canine osteosarcoma and its targeted inhibition results in minimal changes to cell line behaviour.

Science.gov (United States)

Piskun, Caroline M; Stein, Timothy J

2016-06-01

Canine osteosarcoma (OS) is an aggressive malignancy associated with poor outcomes. Therapeutic improvements are likely to develop from an improved understanding of signalling pathways contributing to OS development and progression. The Wnt signalling pathway is of interest for its role in osteoblast differentiation, its dysregulation in numerous cancer types, and the relative frequency of cytoplasmic accumulation of β-catenin in canine OS. This study aimed to determine the biological impact of inhibiting canonical Wnt signalling in canine OS, by utilizing either β-catenin siRNA or a dominant-negative T-cell factor (TCF) construct. There were no consistent, significant changes in cell line behaviour with either method compared to parental cell lines. Interestingly, β-catenin transcriptional activity was three-fold higher in normal canine primary osteoblasts compared to canine OS cell lines. These results suggest canonical Wnt signalling is minimally active in canine OS and its targeted inhibition is not a relevant therapeutic strategy. © 2013 John Wiley & Sons Ltd.

Chemical and canine analysis as complimentary techniques for the identification of active odors of the invasive fungus, Raffaelea lauricola.

Science.gov (United States)

Simon, Alison G; Mills, DeEtta K; Furton, Kenneth G

2017-06-01

Raffaelea lauricola, a fungus causing a vascular wilt (laurel wilt) in Lauraceae trees, was introduced into the United States in the early 2000s. It has devastated forests in the Southeast and has now moved into the commercial avocado groves in southern Florida. Trained detection canines are currently one of the few successful methods for early detection of pre-symptomatic diseased trees. In order to achieve the universal and frequent training required to have successful detection canines, it is desirable to create accessible, safe, and long-lasting training aids. However, identification of odorants and compounds is limited by several factors, including both the availability of chemicals and the need to present chemicals individually and in combination to detection canines. A method for the separation and identification of volatile organic compounds (VOCs) from environmental substances for the creation of such a canine training aid is presented here. Headspace solid phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS) was used to identify the odors present in avocado trees infected with the R. lauricola phytopathogen. Twenty-eight compounds were detected using this method, with nine present in greater than 80% of samples. The majority of these compounds were not commercially available as standard reference materials, and a canine trial was designed to identify the active odors without the need of pure chemical compounds. To facilitate the creation of a canine training aid, the VOCs above R. lauricola were separated by venting a 0.53mm ID solgel-wax gas chromatography column to the atmosphere. Ten minute fractions of the odor profile were collected on cotton gauze in glass vials and presented to the detection canines in a series of field trials. The canines alerted to the VOCs from the vials that correspond to a portion of the chromatogram containing the most volatile species from R. lauricola. This innovative fractionation and collection

The elevated serum urea:creatinine ratio in canine babesiosis in South Africa is not of renal origin.

Science.gov (United States)

de Scally, M P; Leisewitz, A L; Lobetti, R G; Thompson, P N

2006-12-01

Pigmented serum, usually due to free haemoglobin and/or bilirubin, is a common finding in dogs with babesiosis, resulting in interference with all biochemical tests that rely on photochemistry. This is particularly true of urea and creatinine determinations, complicating the diagnosis of acute renal failure, which is a serious complication of babesiosis. A disproportionately raised serum urea concentration of unknown origin occurs in severely anaemic canine babesiosis patients and gives rise to an increased serum urea:creatinine ratio. The assay for cystatin-C, an excellent measure of glomerular filtration rate, is unaffected by free serum haemoglobin, and due to its different intrinsic origins, is free of influence by the metabolic derangements and organ pathology, other than renal disease, encountered in canine babesiosis. Serum cystatin-C was used to compare the concentrations of serum urea and serum creatinine in dogs with the severely anaemic form of canine babesiosis as well as a canine babesiosis-free reference group. Mean serum urea and mean serum urea:creatinine ratio were significantly elevated in the babesia-infected group relative to the reference population in this study. Mean serum creatinine and mean serum cystatin-C were within the reference ranges. Therefore an elevated urea:creatinine ratio in canine babesiosis in the presence of a normal serum creatinine concentration is considered to be caused by an elevated serum urea concentration and is most likely of non-renal origin. Serum creatinine was therefore as specific a measure of renal function as serum cystatin-C in canine babesiosis in this study. The sensitivity of serum creatinine as a measure of renal function was not established by this study. Serum urea, however, proved to be of little use compared to serum cystatin-C and serum creatinine. Serum urea should therefore not be used to diagnose renal failure in canine babesiosis.

Flow cytometric techniques for detection of candidate cancer stem cell subpopulations in canine tumour models.

Science.gov (United States)

Blacking, T M; Waterfall, M; Samuel, K; Argyle, D J

2012-12-01

The cancer stem cell (CSC) hypothesis proposes that tumour growth is maintained by a distinct subpopulation of 'CSC'. This study applied flow cytometric methods, reported to detect CSC in both primary and cultured cancer cells of other species, to identify candidate canine subpopulations. Cell lines representing diverse canine malignancies, and cells derived from spontaneous canine tumours, were evaluated for expression of stem cell-associated surface markers (CD34, CD44, CD117 and CD133) and functional properties [Hoecsht 33342 efflux, aldehyde dehydrogenase (ALDH) activity]. No discrete marker-defined subsets were identified within established cell lines; cells derived directly from spontaneous tumours demonstrated more heterogeneity, although this diminished upon in vitro culture. Functional assays produced variable results, suggesting context-dependency. Flow cytometric methods may be adopted to identify putative canine CSC. Whilst cell lines are valuable in assay development, primary cells may provide a more rewarding model for studying tumour heterogeneity in the context of CSC. However, it will be essential to fully characterize any candidate subpopulations to ensure that they meet CSC criteria. © 2011 Blackwell Publishing Ltd.

Hypoxia-activated prodrug TH-302 decreased survival rate of canine lymphoma cells under hypoxic condition.

Science.gov (United States)

Yamazaki, Hiroki; Lai, Yu-Chang; Tateno, Morihiro; Setoguchi, Asuka; Goto-Koshino, Yuko; Endo, Yasuyuki; Nakaichi, Munekazu; Tsujimoto, Hajime; Miura, Naoki

2017-01-01

We tested the hypotheses that hypoxic stimulation enhances growth potentials of canine lymphoma cells by activating hypoxia-inducible factor 1α (HIF-1α), and that the hypoxia-activated prodrug (TH-302) inhibits growth potentials in the cells. We investigated how hypoxic culture affects the growth rate, chemoresistance, and invasiveness of canine lymphoma cells and doxorubicin (DOX)-resistant lymphoma cells, and influences of TH-302 on survival rate of the cells under hypoxic conditions. Our results demonstrated that hypoxic culture upregulated the expression of HIF-1α and its target genes, including ATP-binding cassette transporter B1 (ABCB1), ATP-binding cassette transporter G2 (ABCG2), platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), and survivin, and enhanced the growth rate, DOX resistance, and invasiveness of the cells. Additionally, TH-302 decreased the survival rate of the cells under hypoxic condition. Our studies suggest that hypoxic stimulation may advance the tumorigenicity of canine lymphoma cells, favoring malignant transformation. Therefore, the data presented may contribute to the development of TH-302-based hypoxia-targeting therapies for canine lymphoma.

A new system for assessment of growth using mandibular canine calcification stages and its correlation with modified MP3 stages

Directory of Open Access Journals (Sweden)

Gautham Hegde

2014-01-01

Full Text Available Objective: Orthodontic diagnosis and treatment planning for growing children must involve growth prediction, especially in the treatment of skeletal problems. Studies have shown that a strong association exists between skeletal maturity and dental calcification stages. The present study was therefore taken up to provide a simple and practical method for assessing skeletal maturity using a dental periapical film and standard dental X-ray machine, to compare the developmental stages of the mandibular canine with that of developmental stages of modified MP3 and to find out if any correlation exists, to determine if the developmental stages of the mandibular canine alone can be used as a reliable indicator for assessment of skeletal maturity. Materials and Methods: A total of 160 periapical radiographs, of the mandibular right canine and the MP3 region was taken and assessed according to the Dermirjian′s stages of dental calcification and the modified MP3 stages. Results and Discussion: The correlation coefficient between MP3 stages and developmental stages of mandibular canine was found to be significant in both male and female groups. When the canine calcification stages were compared with the MP3 stages it was found that with the exception of the D stage of canine calcification the remaining stages showed a very high correlation with the modified MP3 stages. Conclusion: The correlation between the mandibular canine calcification stages, and the MP3 stages was found to be significant. The canine calcification could be used as a sole indicator for assessment of skeletal maturity.

Preclinical Evaluation of the Novel BTK Inhibitor Acalabrutinib in Canine Models of B-Cell Non-Hodgkin Lymphoma.

Directory of Open Access Journals (Sweden)

Bonnie K Harrington

Full Text Available Acalabrutinib (ACP-196 is a second-generation inhibitor of Bruton agammaglobulinemia tyrosine kinase (BTK with increased target selectivity and potency compared to ibrutinib. In this study, we evaluated acalabrutinib in spontaneously occurring canine lymphoma, a model of B-cell malignancy similar to human diffuse large B-cell lymphoma (DLBCL. First, we demonstrated that acalabrutinib potently inhibited BTK activity and downstream effectors in CLBL1, a canine B-cell lymphoma cell line, and primary canine lymphoma cells. Acalabrutinib also inhibited proliferation in CLBL1 cells. Twenty dogs were enrolled in the clinical trial and treated with acalabrutinib at dosages of 2.5 to 20mg/kg every 12 or 24 hours. Acalabrutinib was generally well tolerated, with adverse events consisting primarily of grade 1 or 2 anorexia, weight loss, vomiting, diarrhea and lethargy. Overall response rate (ORR was 25% (5/20 with a median progression free survival (PFS of 22.5 days. Clinical benefit was observed in 30% (6/20 of dogs. These findings suggest that acalabrutinib is safe and exhibits activity in canine B-cell lymphoma patients and support the use of canine lymphoma as a relevant model for human non-Hodgkin lymphoma (NHL.

Occurrence of severe gastroenteritis in pups after canine parvovirus vaccine administration: a clinical and laboratory diagnostic dilemma.

Science.gov (United States)

Decaro, Nicola; Desario, Costantina; Elia, Gabriella; Campolo, Marco; Lorusso, Alessio; Mari, Viviana; Martella, Vito; Buonavoglia, Canio

2007-01-26

A total of 29 faecal samples collected from dogs with diarrhoea following canine parvovirus (CPV) vaccination were tested by minor groove binder (MGB) probe assays for discrimination between CPV vaccine and field strains and by diagnostic tests for detection of other canine pathogens. Fifteen samples tested positive only for CPV field strains; however, both vaccine and field strains were detected in three samples. Eleven samples were found to contain only the vaccine strain, although eight of them tested positive for other pathogens of dogs. Only three samples were found to contain the vaccine strain without evidence of canine pathogens. The present study confirms that most cases of parvovirus-like disease occurring shortly after vaccination are related to infection with field strains of canine parvovirus type 2 (CPV-2) rather than to reversion to virulence of the modified live virus contained in the vaccine.

Comparison of the physiological properties of human periodontal-masseteric reflex evoked by incisor and canine stimulation

Directory of Open Access Journals (Sweden)

Hiroko eOhmori

2012-06-01

Full Text Available Introduction: The present study was designed to clarify whether the bilateral cooperation in the human periodontal-masseteric reflex (PMR differs between central incisors and canines. Methods: Surface array electrodes were placed on the bilateral masseter muscles to simultaneously record the firing activities of single motor units from both sides in 7 healthy adults. During light clenching, mechanical stimulation was applied to the right maxillary central incisor and canine to evoke the PMR. Unitary activity was plotted with respect to the background activity and firing frequency. The slope of the regression line (sRL and the correlation coefficient (CC between the central incisor and canine and the lateral differences between these values were compared. Results: There were significant differences in the sRL and CC, as well as lateral differences, between the central incisor- and canine-driven PMR. Discussion: These results suggest that the PMR differs depending on both the tooth position and laterality.

Glycogen storage disease type Ia in canines: a model for human metabolic and genetic liver disease.

Science.gov (United States)

Specht, Andrew; Fiske, Laurie; Erger, Kirsten; Cossette, Travis; Verstegen, John; Campbell-Thompson, Martha; Struck, Maggie B; Lee, Young Mok; Chou, Janice Y; Byrne, Barry J; Correia, Catherine E; Mah, Cathryn S; Weinstein, David A; Conlon, Thomas J

2011-01-01

A canine model of Glycogen storage disease type Ia (GSDIa) is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including "lactic acidosis", larger size, and longer lifespan compared to other animal models. Use of this model in preclinical trials of gene therapy is described and briefly compared to the murine model. Although the canine model offers a number of advantages for evaluating potential therapies for GSDIa, there are also some significant challenges involved in its use. Despite these challenges, the canine model of GSDIa should continue to provide valuable information about the potential for generating curative therapies for GSDIa as well as other genetic hepatic diseases.

Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease

Directory of Open Access Journals (Sweden)

Andrew Specht

2011-01-01

Full Text Available A canine model of Glycogen storage disease type Ia (GSDIa is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size, and longer lifespan compared to other animal models. Use of this model in preclinical trials of gene therapy is described and briefly compared to the murine model. Although the canine model offers a number of advantages for evaluating potential therapies for GSDIa, there are also some significant challenges involved in its use. Despite these challenges, the canine model of GSDIa should continue to provide valuable information about the potential for generating curative therapies for GSDIa as well as other genetic hepatic diseases.

Orthodontic treatment of the transposition of a maxillary canine and a first premolar: a case report.

Science.gov (United States)

Teresa, Dinoi Maria; Stefano, Mummolo; Annalisa, Monaco; Enrico, Marchetti; Vincenzo, Campanella; Giuseppe, Marzo

2015-03-01

Transposition is an anomaly of tooth position, the most frequent of which involves the canine and the first maxillary premolar. We describe the orthodontic treatment of a unilateral transposition of an upper canine and an upper right first premolar in the permanent dentition. A 12-year-old Caucasian boy presented with transposition of his upper right canine and upper right first premolar. He had combined surgical-orthodontic treatment to correct the transposition and to obtain a Class I relationship between the molar and canine. This treatment resolved the dental crowding and achieved good functional and aesthetic results. In transposition, the choice of the most suitable treatment depends on the occlusion, level of dental crowding, aesthetics, position of the radicular apices, and the specific needs of the patient. In this case, orthodontic alignment of the transposed teeth into their physiological position achieved all of our objectives and our patient was satisfied with the aesthetic results obtained.

Canine Distemper Outbreak in Rhesus Monkeys, China

Science.gov (United States)

Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang

2011-01-01

Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People’s Republic of China. Approximately 10,000 animals were infected (25%–60% disease incidence); 5%–30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain. PMID:21801646

Blocking signaling at the level of GLI regulates downstream gene expression and inhibits proliferation of canine osteosarcoma cells.

Science.gov (United States)

Shahi, Mehdi Hayat; Holt, Roseline; Rebhun, Robert B

2014-01-01

The Hedgehog-GLI signaling pathway is active in a variety of human malignancies and is known to contribute to the growth and survival of human osteosarcoma cells. In this study, we examined the expression and regulation of GLI transcription factors in multiple canine osteosarcoma cell lines and analyzed the effects of inhibiting GLI with GANT61, a GLI-specific inhibitor. Compared with normal canine osteoblasts, real-time PCR showed that GLI1 and GLI2 were highly expressed in two out of three cell lines and correlated with downstream target gene expression of PTCH1and PAX6. Treatment of canine osteosarcoma cells with GANT61 resulted in decreased expression of GLI1, GLI2, PTCH1, and PAX6. Furthermore, GANT61 inhibited proliferation and colony formation in all three canine osteosarcoma cell lines. The finding that GLI signaling activity is present and active in canine osteosarcoma cells suggests that spontaneously arising osteosarcoma in dogs might serve as a good model for future preclinical testing of GLI inhibitors.

Blocking signaling at the level of GLI regulates downstream gene expression and inhibits proliferation of canine osteosarcoma cells.

Directory of Open Access Journals (Sweden)

Mehdi Hayat Shahi

Full Text Available The Hedgehog-GLI signaling pathway is active in a variety of human malignancies and is known to contribute to the growth and survival of human osteosarcoma cells. In this study, we examined the expression and regulation of GLI transcription factors in multiple canine osteosarcoma cell lines and analyzed the effects of inhibiting GLI with GANT61, a GLI-specific inhibitor. Compared with normal canine osteoblasts, real-time PCR showed that GLI1 and GLI2 were highly expressed in two out of three cell lines and correlated with downstream target gene expression of PTCH1and PAX6. Treatment of canine osteosarcoma cells with GANT61 resulted in decreased expression of GLI1, GLI2, PTCH1, and PAX6. Furthermore, GANT61 inhibited proliferation and colony formation in all three canine osteosarcoma cell lines. The finding that GLI signaling activity is present and active in canine osteosarcoma cells suggests that spontaneously arising osteosarcoma in dogs might serve as a good model for future preclinical testing of GLI inhibitors.

Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production

OpenAIRE

Nuno Carinhas; Daniel A. M. Pais; Alexey Koshkin; Paulo Fernandes; Ana S. Coroadinha; Manuel J. T. Carrondo; Paula M. Alves; Ana P. Teixeira

2016-01-01

Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-13C]glucose and [U-13C]glutamine, we apply for the first time 13C-Metabolic flux analysis (13C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells meta...

Use of canine small intestinal submucosa allograft for treating perineal hernias in two dogs.

Science.gov (United States)

Lee, A-Jin; Chung, Wook-Hun; Kim, Dae-Hyun; Lee, Kyung-Pil; Suh, Hyun Jung; Do, Sun Hee; Eom, Ki-Dong; Kim, Hwi-Yool

2012-09-01

Here, we describe two dogs in which canine small intestinal submucosa (SIS) was implanted as a biomaterial scaffold during perineal herniorrhaphy. Both dogs had developed severe muscle weakness, unilaterally herniated rectal protrusions, and heart problems with potential anesthetic risks. Areas affected by the perineal hernia (PH) located between the internal obturator and external anal sphincter muscles were reconstructed with naïve canine SIS sheets. In 12 months, post-operative complications such as wound infections, sciatic paralysis, rectal prolapse, or recurrence of the hernia were not observed. Symptoms of defecatory tenesmus also improved. Neither case showed any signs of rejection or specific immune responses as determined by complete and differential cell counts. Our findings demonstrate that canine SIS can be used as a biomaterial scaffold for PH repair in dogs.

Expression and activity of the urokinase plasminogen activator system in canine primary brain tumors

Directory of Open Access Journals (Sweden)

Rossmeisl JH

2017-04-01

Full Text Available John H Rossmeisl,1–3 Kelli Hall-Manning,4 John L Robertson,1,3,5 Jamie N King,1,2 Rafael V Davalos,3,5 Waldemar Debinski,3 Subbiah Elankumaran6,† 1Veterinary and Comparative Neuro-Oncology Laboratory, 2Department of Small Animal Clinical Sciences, 3The Brain Tumor Center of Excellence, Wake Forest Baptist Medical Center Comprehensive Cancer Center, Winston-Salem, NC, 4Virginia Tech Animal Laboratory Services, Virginia-Maryland College of Veterinary Medicine, 5Department of Biomedical Engineering and Mechanics, Virginia Tech-Wake Forest University School of Biomedical Engineering and Sciences, Virginia Tech, 6Department of Biomedical Sciences and Pathobiology, Virginia-Maryland College of Veterinary Medicine, Blacksburg, VA, USA†The authors regret to advise of the passing of Dr Subbiah Elankumaran prior to publicationBackground: The expression of the urokinase plasminogen activator receptor (uPAR, a glycosylphosphatidylinositol-anchored protein family member, and the activity of its ligand, urokinase-type plasminogen activator (uPA, have been associated with the invasive and metastatic potentials of a variety of human brain tumors through their regulation of extracellular matrix degradation. Domesticated dogs develop naturally occurring brain tumors that share many clinical, phenotypic, molecular, and genetic features with their human counterparts, which has prompted the use of the dogs with spontaneous brain tumors as models to expedite the translation of novel brain tumor therapeutics to humans. There is currently little known regarding the role of the uPA system in canine brain tumorigenesis. The objective of this study was to characterize the expression of uPAR and the activity of uPA in canine brain tumors as justification for the development of uPAR-targeted brain tumor therapeutics in dogs.Methods: We investigated the expression of uPAR in 37 primary canine brain tumors using immunohistochemistry, Western blotting, real

Comparative review of human and canine osteosarcoma: morphology, epidemiology, prognosis, treatment and genetics.

Science.gov (United States)

Simpson, Siobhan; Dunning, Mark David; de Brot, Simone; Grau-Roma, Llorenç; Mongan, Nigel Patrick; Rutland, Catrin Sian

2017-10-24

Osteosarcoma (OSA) is a rare cancer in people. However OSA incidence rates in dogs are 27 times higher than in people. Prognosis in both species is relatively poor, with 5 year OSA survival rates in people not having improved in decades. For dogs, 1 year survival rates are only around ~ 45%. Improved and novel treatment regimens are urgently required to improve survival in both humans and dogs with OSA. Utilising information from genetic studies could assist in this in both species, with the higher incidence rates in dogs contributing to the dog population being a good model of human disease. This review compares the clinical characteristics, gross morphology and histopathology, aetiology, epidemiology, and genetics of canine and human OSA. Finally, the current position of canine OSA genetic research is discussed and areas for additional work within the canine population are identified.

Detection of a group 2 coronavirus in dogs with canine infectious respiratory disease

International Nuclear Information System (INIS)

Erles, Kerstin; Toomey, Crista; Brooks, Harriet W.; Brownlie, Joe

2003-01-01

An investigation into the causes of canine infectious respiratory disease was carried out in a large rehoming kennel. Tissue samples taken from the respiratory tract of diseased dogs were tested for the presence of coronaviruses using RT-PCR with conserved primers for the polymerase gene. Sequence analysis of four positive samples showed the presence of a coronavirus with high similarity to both bovine and human coronavirus (strain OC43) in their polymerase and spike genes, whereas there was a low similarity to comparable genes in the enteric canine coronavirus. This canine respiratory coronavirus (CRCV) was detected by RT-PCR in 32/119 tracheal and 20/119 lung samples, with the highest prevalence being detected in dogs with mild clinical symptoms. Serological analysis showed that the presence of antibodies against CRCV on the day of entry into the kennel decreased the risk of developing respiratory disease

Canine distemper virus detection by different methods of One-Step RT-qPCR

Directory of Open Access Journals (Sweden)

Claudia de Camargo Tozato

2016-01-01

Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

Clinical manifestations of canine distemper in Nigerian dogs ...

African Journals Online (AJOL)

Twenty dogs of local breeds found in Nigeria, experimentally infected with local isolate of canine distemper virus, manifested fever, conjunctivitis, photophobia salivation, anorexia, dermatitis, and diarrhoea. Apart from these clinical signs already described for the disease in other breeds of dogs,45% of the dogs showed ...

Canine distemper associated with generalized oedema in Nigerian ...

African Journals Online (AJOL)

Twenty puppies of Nigeria local breed of dogs which were experimentally infected with a local isolate of canine distemper virus manifested clinical signs known for the disease including anorexia, ocular discharges, postular dermatitis on the lower abdomen and diarrhoea. In addition, they also manifested generalized ...

Canine distemper virus-associated hypocalcemia.

Science.gov (United States)

Weisbrode, S E; Krakowka, S

1979-01-01

A retrospective study was done to correlate serum calcium concentrations and parathyroid gland ultrastructure to clinical, immunologic, and pathologic changes experimentally induced in gnotobiotic dogs by canine distemper virus (CDV). Dogs infected with CDV had significantly reduced serum calcium concentrations associated with ultrastructural evidence of parathyroid gland inactivity, degeneration, and viral inclusions. Although CDV-infected dogs exhibited neurologic signs, minimal lesions were present in the central nervous system. It is suggested that viral-induced parathyroid dysfunction may contribute to neutrologic disturbance of CDV infection.

Death of a wild wolf from canine parvovirus enteritis

Science.gov (United States)

Mech, L.D.; Kurtz, H.J.; Goyal, S.

1997-01-01

A 9-mo-old female wolf (Canis lupus) in the Superior National Forest of Minnesota (USA) died from a canine parvovirus (CPV) infection. This is the first direct evidence that this infection effects free-ranging wild wolves.

An Update on Therapeutic Management of Canine Demodicosis

Directory of Open Access Journals (Sweden)

S. K. Singh

2011-02-01

Full Text Available Canine demodicosis is a common noncontagious parasitic dermatosis caused by different spp of Demodex mites including Demodex canis, Demodex injai and D. cornei. Generalized demodicosis can be one of the most frustrating skin diseases, one will ever treat. Conventional and newer miticidal therapies are available to veterinarian to treat this frustrating skin disease. All recognized Demodex mites in dogs appear to respond similarly to mite targeted therapy. Treatment for canine demodicosis includes amitraz, ivermectin, milbemicin oxime, moxidectin, and doramectin. The use of any glucocorticoid-containing products is contraindicated and could favour disease generalization. Conventional treatments will often appear to work however, but it relies heavily on a highly toxic method of treatment. Using natural remedies for mange, on the other hand, can enhance the dog’s immune system, so that the body can fight off the mange mite infection by itself. [Veterinary World 2011; 4(1.000: 41-44

The Study of Factors Influencing on Orthodontic Treatment Difficulty of Impacted Maxillary Canine with Cone Beam Computed Tomography

Directory of Open Access Journals (Sweden)

A.F. Miresmaeili

2012-10-01

Full Text Available Introduction & Objective: Maxillary canines are esthetically and functionally important, but patients with impacted maxillary canines are perceived to be more difficult and time-consuming to treat than the average orthodontic patient. The aim of this study was to define orthodontic Treatment Difficulty Index (TDI of impacted maxillary canine with CBCT according to experts' opinions.Materials & Methods: In this cross sectional study, nine variables in CBCT of thirty six consecutive patients with 50 impacted maxillary canines were measured using Dolphin 3D. The related 3D and 2D pictures and the measured data were uploaded on a website. Ten orthodontists were asked to judge the difficulty of bringing the impacted canine to occlusal plane from 1 to 10 (1 = easy, 10 = extremely difficult.Then, they were also asked to evaluate the effect of each variable on treatment from 1 to 5 (1= very low, 5= very high. Random effect linear regression was used in exploration stage and then simple linear regression was used for the application of the model.Results: The patients mean age was 19.08 ± 5.8 years. Mean clinical experience of examiners was 22.7 ±12.02 years. Three variables were deleted at exploration stage and two other in model application stage. Vertical distance to the occlusal plane (P=0.000, overlap in frontal view (P=0.000, angulations of the canine to the occlusal plan (P=0.029, dilacerations (P=0.000, and rotation (P=0.029 had a significant relationship with TDI.Conclusion: Treatment difficulty of impacted maxillary canines could be predicted quantitatively by measuring variables in CBCT.(Sci J Hamadan Univ Med Sci 2012;19(3:30-35

Canine tumor cross-species genomics uncovers targets linked to osteosarcoma progression

Science.gov (United States)

2009-01-01

Background Pulmonary metastasis continues to be the most common cause of death in osteosarcoma. Indeed, the 5-year survival for newly diagnosed osteosarcoma patients has not significantly changed in over 20 years. Further understanding of the mechanisms of metastasis and resistance for this aggressive pediatric cancer is necessary. Pet dogs naturally develop osteosarcoma providing a novel opportunity to model metastasis development and progression. Given the accelerated biology of canine osteosarcoma, we hypothesized that a direct comparison of canine and pediatric osteosarcoma expression profiles may help identify novel metastasis-associated tumor targets that have been missed through the study of the human cancer alone. Results Using parallel oligonucleotide array platforms, shared orthologues between species were identified and normalized. The osteosarcoma expression signatures could not distinguish the canine and human diseases by hierarchical clustering. Cross-species target mining identified two genes, interleukin-8 (IL-8) and solute carrier family 1 (glial high affinity glutamate transporter), member 3 (SLC1A3), which were uniformly expressed in dog but not in all pediatric osteosarcoma patient samples. Expression of these genes in an independent population of pediatric osteosarcoma patients was associated with poor outcome (p = 0.020 and p = 0.026, respectively). Validation of IL-8 and SLC1A3 protein expression in pediatric osteosarcoma tissues further supported the potential value of these novel targets. Ongoing evaluation will validate the biological significance of these targets and their associated pathways. Conclusions Collectively, these data support the strong similarities between human and canine osteosarcoma and underline the opportunities provided by a comparative oncology approach as a means to improve our understanding of cancer biology and therapies. PMID:20028558

Canine tumor cross-species genomics uncovers targets linked to osteosarcoma progression

Directory of Open Access Journals (Sweden)

Triche Timothy

2009-12-01

Full Text Available Abstract Background Pulmonary metastasis continues to be the most common cause of death in osteosarcoma. Indeed, the 5-year survival for newly diagnosed osteosarcoma patients has not significantly changed in over 20 years. Further understanding of the mechanisms of metastasis and resistance for this aggressive pediatric cancer is necessary. Pet dogs naturally develop osteosarcoma providing a novel opportunity to model metastasis development and progression. Given the accelerated biology of canine osteosarcoma, we hypothesized that a direct comparison of canine and pediatric osteosarcoma expression profiles may help identify novel metastasis-associated tumor targets that have been missed through the study of the human cancer alone. Results Using parallel oligonucleotide array platforms, shared orthologues between species were identified and normalized. The osteosarcoma expression signatures could not distinguish the canine and human diseases by hierarchical clustering. Cross-species target mining identified two genes, interleukin-8 (IL-8 and solute carrier family 1 (glial high affinity glutamate transporter, member 3 (SLC1A3, which were uniformly expressed in dog but not in all pediatric osteosarcoma patient samples. Expression of these genes in an independent population of pediatric osteosarcoma patients was associated with poor outcome (p = 0.020 and p = 0.026, respectively. Validation of IL-8 and SLC1A3 protein expression in pediatric osteosarcoma tissues further supported the potential value of these novel targets. Ongoing evaluation will validate the biological significance of these targets and their associated pathways. Conclusions Collectively, these data support the strong similarities between human and canine osteosarcoma and underline the opportunities provided by a comparative oncology approach as a means to improve our understanding of cancer biology and therapies.

Survey of Borreliae in ticks, canines, and white-tailed deer from Arkansas, U.S.A.

Directory of Open Access Journals (Sweden)

Fryxell Rebecca T

2012-07-01

Full Text Available Abstract Background In the Eastern and Upper Midwestern regions of North America, Ixodes scapularis (L. is the most abundant tick species encountered by humans and the primary vector of B. burgdorferi, whereas in the southeastern region Amblyomma americanum (Say is the most abundant tick species encountered by humans but cannot transmit B. burgdorferi. Surveys of Borreliae in ticks have been conducted in the southeastern United States and often these surveys identify B. lonestari as the primary Borrelia species, surveys have not included Arkansas ticks, canines, or white-tailed deer and B. lonestari is not considered pathogenic. The objective of this study was to identify Borrelia species within Arkansas by screening ticks (n = 2123, canines (n = 173, and white-tailed deer (n = 228 to determine the identity and locations of Borreliae endemic to Arkansas using PCR amplification of the flagellin (flaB gene. Methods Field collected ticks from canines and from hunter-killed white-tailed were identified to species and life stage. After which, ticks and their hosts were screened for the presence of Borrelia using PCR to amplify the flaB gene. A subset of the positive samples was confirmed with bidirectional sequencing. Results In total 53 (21.2% white-tailed deer, ten (6% canines, and 583 (27.5% Ixodid ticks (252 Ixodes scapularis, 161 A. americanum, 88 Rhipicephalus sanguineus, 50 Amblyomma maculatum, 19 Dermacentor variabilis, and 13 unidentified Amblyomma species produced a Borrelia flaB amplicon. Of the positive ticks, 324 (22.7% were collected from canines (151 A. americanum, 78 R. sanguineus, 43 I. scapularis, 26 A. maculatum, 18 D. variabilis, and 8 Amblyomma species and 259 (37.2% were collected from white-tailed deer (209 I. scapularis, 24 A. maculatum, 10 A. americanum, 10 R. sanguineus, 1 D. variabilis, and 5 Amblyomma species. None of the larvae were PCR positive. A majority of the flaB amplicons were homologous with B

Why is Southern African canine babesiosis so virulent? An evolutionary perspective

Directory of Open Access Journals (Sweden)

Penzhorn Barend L

2011-04-01

Full Text Available Abstract Canine babesiosis is a common, highly virulent disease in Southern Africa with even pups and juveniles being severely affected. This contrasts with bovine babesiosis, for example, where host, parasite and vector co-evolved and young animals develop immunity after infection without showing clinical signs. Babesia rossi, the main causative organism of canine babesiosis in sub-Saharan Africa, was first described from a side-striped jackal (Canis adustus in Kenya. Although data are meagre, there is evidence that indigenous African canids, such as jackals and wild dogs (Lycaon pictus, can harbour the parasite without showing untoward effects. Dogs are not indigenous to Africa. The vast majority of dogs presented at veterinary facilities in South Africa represent recently introduced European, Asian or American breeds. The contention is that B. rossi is a new challenge to which these dogs have not adapted. With intensive treatment of clinical cases, natural selection is effectively negated and the status quo will probably be maintained indefinitely. It is postulated that Babesia vogeli, which frequently results in unapparent infections or mild manifestations in dogs, represents or is closely related to the ancestral form of the canine parasite, possibly originating from wolves (Canis lupus.

Mast cells in Canine parvovirus-2-associated enteritis with crypt abscess.

Science.gov (United States)

Woldemeskel, M W; Saliki, J T; Blas-Machado, U; Whittington, L

2013-11-01

The role of mast cells (MCs) in allergic reactions and parasitic infections is well established. Their involvement in host immune response against bacterial and viral infections is reported. In this study, investigation is made to determine if MCs are associated with Canine parvovirus-2 (CPV-2)-induced enteritis with crypt abscess (ECA). Mast cell count (MCC) was made on toluidine blue-stained intestinal sections from a total of 34 dogs. These included 16 dogs exhibiting ECA positive for CPV-2 and negative for Canine distemper virus and Canine coronavirus by immunohistochemistry and fluorescent antibody test, 12 dogs with inflammatory bowel disease (IBD), and 6 non-ECA/non-IBD (control) dogs. The average total MCC per high-power field in ECA (40.8 ± 2.2) and IBD (24.7 ± 2.1) was significantly higher (P .05), MCC was also higher in ECA than in IBD. The present study for the first time has documented significantly increased MCs in CPV-2-associated ECA as was previously reported for IBD, showing that MCs may also play an important role in CPV-2-associated ECA. Further studies involving more CPV-infected dogs are recommended to substantiate the findings.

Antibody study in canine distemper virus nucleocapsid protein gene-immunized mice.

Science.gov (United States)

Yuan, B; Li, X Y; Zhu, T; Yuan, L; Hu, J P; Chen, J; Gao, W; Ren, W Z

2015-04-10

The gene for the nucleocapsid (N) protein of canine distemper virus was cloned into the pMD-18T vector, and positive recombinant plasmids were obtained by enzyme digestion and sequencing. After digestion by both EcoRI and KpnI, the plasmid was directionally cloned into the eukaryotic expression vector pcDNA; the positive clone pcDNA-N was screened by electrophoresis and then transfected into COS-7 cells. Immunofluorescence analysis results showed that the canine distemper virus N protein was expressed in the cytoplasm of transfected COS-7 cells. After emulsification in Freund's adjuvant, the recombinant plasmid pcDNA-N was injected into the abdominal cavity of 8-week-old BABL/c mice, with the pcDNA original vector used as a negative control. Mice were immunized 3 times every 2 weeks. The blood of immunized mice was drawn 2 weeks after completing the immunizations to measure titer levels. The antibody titer in the pcDNA-N test was 10(1.62 ± 0.164), while in the control group this value was 10(0.52 ± 0.56), indicating that specific humoral immunity was induced in canine distemper virus nucleocapsid protein-immunized mice.

Heterogeneity within the hemagglutinin genes of canine distemper virus (CDV) strains detected in Italy

DEFF Research Database (Denmark)

Martella, V.; Cirone, F.; Elia, G.

2006-01-01

Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause....... These results suggest that at least three different CDV lineages are present in Italy. Keywords: Canine distemper virus; Dogs; Lineages; H gene...

A modified live canine parvovirus vaccine. II. Immune response.

Science.gov (United States)

Carmichael, L E; Joubert, J C; Pollock, R V

1983-01-01

The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.

Molecular characterization of canine distemper vi- rus circulating in ...

African Journals Online (AJOL)

2OIE Collaborating Centre for Diseases at Animal and Human Interface, FAO Reference Centre for Rabies, Viale ... Asia-1 lineage canine distemper virus is circulating in outbreak. .... jected to cell culture on Vero cell lines for virus isolation.

Orthodontic treatment of impacted maxillary canines: an appraisal of prognostic factors.

Science.gov (United States)

Baccetti, Tiziano; Crescini, Aldo; Nieri, Michele; Rotundo, Roberto; Pini Prato, Giovan Paolo

2007-01-01

The aim of the study was to evaluate the influence of pre-treatment radiographic features (alpha-angle, d-distance and s-sector) on the duration of active orthodontic traction of impacted maxillary canines treated by a combined surgical (flap approach) and orthodontic (direct traction to the center of the ridge) treatment. A study population of 168 patients (168 canines) was evaluated. Multiple regression analysis was used. Pre-treatment radiographic variables were associated significantly with the duration of orthodontic traction. Age, gender and site of impaction did not affect the duration of traction significantly. Alpha-angle, d-distance and s-sector are valid indicators for the duration of orthodontic traction.

Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus

DEFF Research Database (Denmark)

Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter

2009-01-01

The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper...

Detection of intracellular canine distemper virus antigen in mink inoculated with an attenuated or a virulent strain of canine distemper virus.

Science.gov (United States)

Blixenkrone-Møller, M

1989-09-01

Using an indirect immunofluorescence technique, the distribution of viral antigen in various tissues and blood mononuclear leukocytes was studied in wild mink, either vaccinated with an attenuated vaccine strain of canine distemper virus (CDV) or experimentally inoculated with the virulent Snyder-Hill strain of CDV. Viral antigen was detected in cells of the lymphoid system 6 to 12 days after vaccination. From 2 to 3 days after inoculation with the virulent strain, CDV antigen was demonstrated in cells of the lymphoid system and, during the incubation period, the antigen had spread to the epithelia and brain at days 6 and 12, respectively. In clinical cases of acute fatal canine distemper, the viral antigen was detected in a wide variety of tissues, including the cells of the lymphoid system, epithelial cells of skin, mucous membranes, lung, kidney, and cells of the CNS. The diagnostic importance of CDV antigen detection is discussed on the basis of these findings.

Canine degenerative myelopathy: biochemical characterization of superoxide dismutase 1 in the first naturally occurring non-human amyotrophic lateral sclerosis model.

Science.gov (United States)

Crisp, Matthew J; Beckett, Jeffrey; Coates, Joan R; Miller, Timothy M

2013-10-01

Mutations in canine superoxide dismutase 1 (SOD1) have recently been shown to cause canine degenerative myelopathy, a disabling neurodegenerative disorder affecting specific breeds of dogs characterized by progressive motor neuron loss and paralysis until death, or more common, euthanasia. This discovery makes canine degenerative myelopathy the first and only naturally occurring non-human model of amyotrophic lateral sclerosis (ALS), closely paralleling the clinical, pathological, and genetic presentation of its human counterpart, SOD1-mediated familial ALS. To further understand the biochemical role that canine SOD1 plays in this disease and how it may be similar to human SOD1, we characterized the only two SOD1 mutations described in affected dogs to date, E40K and T18S. We show that a detergent-insoluble species of mutant SOD1 is present in spinal cords of affected dogs that increases with disease progression. Our in vitro results indicate that both canine SOD1 mutants form enzymatically active dimers, arguing against a loss of function in affected homozygous animals. Further studies show that these mutants, like most human SOD1 mutants, have an increased propensity to form aggregates in cell culture, with 10-20% of cells possessing visible aggregates. Creation of the E40K mutation in human SOD1 recapitulates the normal enzymatic activity but not the aggregation propensity seen with the canine mutant. Our findings lend strong biochemical support to the toxic role of SOD1 in canine degenerative myelopathy and establish close parallels for the role mutant SOD1 plays in both canine and human disorders. Copyright © 2013 Elsevier Inc. All rights reserved.

Etude s?ro-?pid?miologique de la leishmaniose canine au centre du Maroc

OpenAIRE

Fellah, Hajiba; Doughmi, Oursula; Maniar, Sa?d; Lalami, Abdelhakim El Ouali

2014-01-01

Dans le monde, la leishmaniose visc?rale humaine est connue pour avoir comme principale source d'infection les Canid?s domestiques et sauvages. Au centre du Maroc, les donn?es ?pid?miologiques, cliniques et parasitologiques sur la leishmaniose canine, sont quasiment inexistantes. Ce travail traite une ?tude prospective au cours de laquelle 61 s?rums canins ont ?t? analys?s par un test rapide et par l'immunofluorescence indirecte. La sensibilit? du test rapide par rapport ? celle de l'immunofl...

Long-term periodontal response to orthodontic treatment of palatally impacted maxillary canines.

Science.gov (United States)

Caprioglio, Alberto; Vanni, Arianna; Bolamperti, Laura

2013-06-01

One of the most important aspects to take into consideration when evaluating the outcome of treatment of impacted maxillary canines is the final periodontal status. The aim of the present study was to evaluate the long-term periodontal response of palatally impacted maxillary canines aligned using a codified procedure and the 'Easy Cuspid' compared with contralateral spontaneously erupted teeth. The periodontal conditions of the adjacent teeth were also considered. From an initial sample of 124 patients, 33 patients (24 females and 9 males) were selected. All patients who had undergone surgical orthodontic treatment conducted in accordance with a standardized protocol were recalled for follow-up at an average of 4.6 years after the end of treatment. The average treatment time was 29 months and the mean eruption time of the previously impacted tooth was 3.1 months. The average probing depth values showed no significant clinical differences. Probing depths recorded at the vestibular surface of the lateral incisor (P alignment of palatally impacted canines without damage to the periodontium.

Apoptotic intrinsic pathway proteins predict survival in canine cutaneous mast cell tumours.

Science.gov (United States)

Barra, C N; Macedo, B M; Cadrobbi, K G; Pulz, L H; Huete, G C; Kleeb, S R; Xavier, J G; Catão-Dias, J L; Nishiya, A T; Fukumasu, H; Strefezzi, R F

2018-03-01

Mast cell tumours (MCTs) are the most frequent canine round cell neoplasms and show variable biological behaviours with high metastatic and recurrence rates. The disease is treated surgically and wide margins are recommended. Adjuvant chemotherapy and radiotherapy used in this disease cause DNA damage in neoplastic cells, which is aimed to induce apoptotic cell death. Resisting cell death is a hallmark of cancer, which contributes to the development and progression of tumours. The aim of this study was to investigate the expression of the proteins involved in the apoptotic intrinsic pathway and to evaluate their potential use as prognostic markers for canine cutaneous MCTs. Immunohistochemistry for BAX, BCL2, APAF1, Caspase-9, and Caspase-3 was performed in 50 canine cases of MCTs. High BAX expression was associated with higher mortality rate and shorter survival. BCL2 and APAF1 expressions offered additional prognostic information to the histopathological grading systems. The present results indicate that variations in the expression of apoptotic proteins are related to malignancy of cutaneous MCTs in dogs. © 2017 John Wiley & Sons Ltd.

Genome Sequence of Canine Polyomavirus in Respiratory Secretions of Dogs with Pneumonia of Unknown Etiology.

Science.gov (United States)

Delwart, Eric; Kapusinszky, Beatrix; Pesavento, Patricia A; Estrada, Marko; Seguin, M Alexis; Leutenegger, Christian M

2017-07-20

We report here the first canine polyomavirus genome, identified by metagenomics in respiratory secretions of two dogs with severe pneumonia, which tested negative for all canine respiratory pathogens except Mycoplasma cynos The isolate, Canis familiaris polyomavirus 1 (DogPyV-1), is a beta polyomavirus whose closest known LT antigen relatives are primate polyomaviruses. Copyright © 2017 Delwart et al.

Direct magnetic resonance arthrography of the canine elbow

Directory of Open Access Journals (Sweden)

Yauheni Zhalniarovich

2017-01-01

Full Text Available This study compares the effects of four dilutions of the gadolinium-containing contrast media (1:100; 1:400; 1:800; 1:1,200 administered to the elbow on the quality of magnetic resonance images. All the examined dilutions had a positive effect on image quality, and 1:800 was regarded as the optimal dilution of gadolinium for viewing the elbow because it imparted good contrast to the joint cavity without obliterating the contours of articular surfaces. Transverse, sagittal, and dorsal low-field magnetic resonance images were obtained in 24 canine cadaver front limbs. The musculus biceps brachii, m. triceps brachii, m. extensor carpi radialis, m. flexor carpi ulnaris, the articular surfaces, the medial coronoid process and the anconeal process of the ulna were well visualized by High Resolution Gradient Echo, XBONE T2 and Spin Echo T1 sequences in the sagittal plane. The biceps brachii, pronator teres, flexor carpi radialis, extensor digitorum communis, extensor carpi radialis, deltoid muscle and the articular surface of the medial condyle of the humerus were very well visualized by 3D SST1 and XBONE T2 sequences in the transverse plane. The triceps brachii muscle, extensor digitorum lateralis muscle, superficial digital flexor, deep digital flexor and the medial condyle of the humerus were very well visualized by the Spin Echo T1 sequence in the dorsal plane. This article describes for the first time the use of the gadolinium contrast agent administered to the canine elbow joint during magnetic resonance modality. Magnetic resonance arthrography can be a helpful visualization technique in treating canine soft tissue elbow injury.

Resident Macrophages and Lymphocytes in the Canine Endometrium.

Science.gov (United States)

Pires, M A; Payan-Carreira, R

2015-10-01

Resident immune cells play a major role in endometrial immunity and in tissue homoeostasis. This study aimed to analyse the distribution of macrophages, B and T lymphocytes (respectively, Mø, B-Lym and T-Lym) in the canine endometrium throughout the oestrous cycle and in late involution (at the proestrus stage post-parturition). An immunohistochemistry technique was used on samples from 50 post-pubertal healthy female dogs, of which five in late post-partum. The distribution of resident immune cells was analysed in three endometrial layers (superficial, intermediate and basal areas). Mø, B-Lym and T-Lym were demonstrated to reside in the endometrium in all the stages of the canine cycle; their numbers being considerably higher during late involution. T-Lym were scattered in the stroma or amidst the glandular epithelium, constituting the predominant immune cell population in anestrus and proestrus, but decreased in number at all other stages. Endometrial B-Lym remained fairly constant during the canine cycle, although its numbers were higher in late involution. Mø counts were higher during anestrus compared to the other stages, the cells being displaced into the superficial endometrial layer. Mø demonstrated the highest level in late involution samples, forming small aggregates below the surface epithelium. The number of immune cells was not normally distributed, suggesting the influence of individual factors, such as age or parity, not explored herein due to limited sample availability. Still, this study provides important information for the interpretation of endometrial biopsies in dogs and for the understanding of the increased susceptibility to uterine infection during dioestrus found in the bitch. © 2015 Blackwell Verlag GmbH.

Clinical features and endodontic treatment of two-rooted mandibular canines: Report of four cases

Directory of Open Access Journals (Sweden)

Stojanac Igor

2014-01-01

Full Text Available Introduction. Predictable endodontic treatment depends on the dentist’s knowledge about root canal morphology and its possible anatomic variations. The majority of mandibular canines have one root and root canal, but 15% may have two canals and a smaller number may have two distinct roots. The following clinical reports describe endodontic treatment of mandibular canines with two roots and two root canals. Outline of Cases. Four clinical case reports are presented to exemplify anatomical variation in the human mandibular canine. Detailed analysis of the preoperative radiographs and careful examination of the pulp chamber floor detected the presence of two root canal orifices in all canines. Working length was determined with an electronic apex locator and biomechanical preparation was carried out by using engine driven BioRaCe Ni-Ti rotary instruments in a crown-down manner, followed by copious irrigation with 1% sodium hypochlorite. Definitive obturation was performed using cold lateral condensation with gutta-percha cones and Top Seal paste. The treatment outcome was evaluated using postoperative radiographs. Conclusion. Endodontists should be aware of anatomical variations of the treated teeth, and should never presume that canal systems are simple. [Projekat Ministarstva nauke Republike Srbije, br. 174005: Viscoelasticity of fractional type and optimization of shape in rod theory

Characterization of the Canine Anthracycline-Metabolizing Enzyme Carbonyl Reductase 1 (cbr1) and the Functional Isoform cbr1 V218.

Science.gov (United States)

Ferguson, Daniel C; Cheng, Qiuying; Blanco, Javier G

2015-07-01

The anthracyclines doxorubicin and daunorubicin are used in the treatment of various human and canine cancers, but anthracycline-related cardiotoxicity limits their clinical utility. The formation of anthracycline C-13 alcohol metabolites (e.g., doxorubicinol and daunorubicinol) contributes to the development of anthracycline-related cardiotoxicity. The enzymes responsible for the synthesis of anthracycline C-13 alcohol metabolites in canines remain to be elucidated. We hypothesized that canine carbonyl reductase 1 (cbr1), the homolog of the prominent anthracycline reductase human CBR1, would have anthracycline reductase activity. Recombinant canine cbr1 (molecular weight: 32.8 kDa) was purified from Escherichia coli. The enzyme kinetics of "wild-type" canine cbr1 (cbr1 D218) and a variant isoform (cbr1 V218) were characterized with the substrates daunorubicin and menadione, as well as the flavonoid inhibitor rutin. Canine cbr1 catalyzes the reduction of daunorubicin to daunorubicinol, with cbr1 D218 and cbr1 V218 displaying different kinetic parameters (cbr1 D218 Km: 188 ± 144 μM versus cbr1 V218 Km: 527 ± 136 μM, P < 0.05, and cbr1 D218 Vmax: 6446 ± 3615 nmol/min per milligram versus cbr1 V218 Vmax: 15539 ± 2623 nmol/min per milligram, P < 0.01). Canine cbr1 also metabolized menadione (cbr1 D218 Km: 104 ± 50 μM, Vmax: 2034 ± 307 nmol/min per milligram). Rutin acted as a competitive inhibitor for the reduction of daunorubicin (cbr1 D218 Ki: 1.84 ± 1.02 μM, cbr1 V218 Ki: 1.38 ± 0.47 μM). These studies show that canine cbr1 metabolizes daunorubicin and provide the necessary foundation to characterize the role of cbr1 in the variable pharmacodynamics of anthracyclines in canine cancer patients. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

Prognosis in canine idiopathic immune-mediated haemolytic anaemia

NARCIS (Netherlands)

Piek, C.J.

2011-01-01

Canine idiopathic immune-mediated haemolytic anaemia (iIMHA) is one of the most frequently occurring immune-mediated diseases in dogs. A gel-based Coombs' test was shown to perform equally well as a classical Coombs' test. Since the gel-based Coombs' test can be commercially produced and is easy and

Polymerase spiral reaction (PSR): a novel, visual isothermal amplification method for detection of canine parvovirus 2 genomic DNA.

Science.gov (United States)

Gupta, Vikas; Chakravarti, Soumendu; Chander, Vishal; Majumder, Saurabh; Bhat, Shabir Ahmad; Gupta, Vivek Kumar; Nandi, Sukdeb

2017-07-01

Canine parvovirus-2 (CPV-2), which is ubiquitously distributed worldwide, causes severe and often fatal gastroenteritis in dogs. Accurate, differential and rapid diagnosis of canine parvoviral enteritis remains a challenge for clinicians. A recently developed isothermal amplification technique, polymerase spiral reaction (PSR), was optimized for the first time for a viral pathogen with reference recombinant plasmid standards from different CPV-2 antigenic variants (CPV-2, CPV-2a, CPV-2b and CPV-2c) and subsequently validated using clinical samples. Addition of chromogenic substrate SYBR Green I after the completion of the reaction resulted in bright green fluorescence in positive samples, while negative samples and a no-template control remained orange. These results were further substantiated through visualization of a laddering pattern of the PSR-amplified product in an agarose gel in positive cases and the absence of this pattern in no-template control and negative samples. The PSR assay was found to be highly specific, as it did not react with other putative canine pathogens (canine adenovirus 1 and canine distemper virus). The sensitivity of the newly developed PSR technique was compared with that of conventional PCR, real-time PCR and LAMP, using a serial tenfold dilution of canine parvovirus DNA. The detection limit of PSR was found to be at the femtogram level, which is comparable with that of real-time PCR and LAMP, which are ten times more sensitive than conventional PCR. The assay was validated using 90 clinical samples, of which 54 were found positive, while only 45 samples were positive in conventional PCR. This novel assay, which is fully compliant with the 'ASSURED' concept for disease diagnosis, provides a simple, rapid, specific, sensitive and cost-effective method for diagnosis of canine parvoviral enteritis in veterinary clinics.

Rapid and sensitive detection of canine distemper virus by real-time reverse transcription recombinase polymerase amplification.

Science.gov (United States)

Wang, Jianchang; Wang, Jinfeng; Li, Ruiwen; Liu, Libing; Yuan, Wanzhe

2017-08-15

Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious and fatal systemic disease in free-living and captive carnivores worldwide. Recombinase polymerase amplification (RPA), as an isothermal gene amplification technique, has been explored for the molecular detection of diverse pathogens. A real-time reverse transcription RPA (RT-RPA) assay for the detection of canine distemper virus (CDV) using primers and exo probe targeting the CDV nucleocapsid protein gene was developed. A series of other viruses were tested by the RT-RPA.Thirty-two field samples were further tested by RT-RPA, and the resuts were compared with those obtained by the real-time RT-PCR. The RT-RPA assay was performed successfully at 40 °C, and the results were obtained within 3 min-12 min. The assay could detect CDV, but did not show cross-detection of canine parvovirus-2 (CPV-2), canine coronavirus (CCoV), canine parainfluenza virus (CPIV), pseudorabies virus (PRV) or Newcastle disease virus (NDV), demonstrating high specificity. The analytical sensitivity of RT-RPA was 31.8 copies in vitro transcribed CDV RNA, which is 10 times lower than the real-time RT-PCR. The assay performance was validated by testing 32 field samples and compared to real-time RT-PCR. The results indicated an excellent correlation between RT-RPA and a reference real-time RT-PCR method. Both assays provided the same results, and R 2 value of the positive results was 0.947. The results demonstrated that the RT-RPA assay offers an alternative tool for simple, rapid, and reliable detection of CDV both in the laboratory and point-of-care facility, especially in the resource-limited settings.

Enrofloxacin enhances the effects of chemotherapy in canine osteosarcoma cells with mutant and wild-type p53.

Science.gov (United States)

York, D; Withers, S S; Watson, K D; Seo, K W; Rebhun, R B

2017-09-01

Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. © 2016 John Wiley & Sons Ltd.

Novel region of interest interrogation technique for diffusion tensor imaging analysis in the canine brain.

Science.gov (United States)

Li, Jonathan Y; Middleton, Dana M; Chen, Steven; White, Leonard; Ellinwood, N Matthew; Dickson, Patricia; Vite, Charles; Bradbury, Allison; Provenzale, James M

2017-08-01

Purpose We describe a novel technique for measuring diffusion tensor imaging metrics in the canine brain. We hypothesized that a standard method for region of interest placement could be developed that is highly reproducible, with less than 10% difference in measurements between raters. Methods Two sets of canine brains (three seven-week-old full-brains and two 17-week-old single hemispheres) were scanned ex-vivo on a 7T small-animal magnetic resonance imaging system. Strict region of interest placement criteria were developed and then used by two raters to independently measure diffusion tensor imaging metrics within four different white-matter regions within each specimen. Average values of fractional anisotropy, radial diffusivity, and the three eigenvalues (λ1, λ2, and λ3) within each region in each specimen overall and within each individual image slice were compared between raters by calculating the percentage difference between raters for each metric. Results The mean percentage difference between raters for all diffusion tensor imaging metrics when pooled by each region and specimen was 1.44% (range: 0.01-5.17%). The mean percentage difference between raters for all diffusion tensor imaging metrics when compared by individual image slice was 2.23% (range: 0.75-4.58%) per hemisphere. Conclusion Our results indicate that the technique described is highly reproducible, even when applied to canine specimens of differing age, morphology, and image resolution. We propose this technique for future studies of diffusion tensor imaging analysis in canine brains and for cross-sectional and longitudinal studies of canine brain models of human central nervous system disease.

Chromosomal mapping of canine-derived BAC clones to the red fox and American mink genomes.

Science.gov (United States)

Kukekova, Anna V; Vorobieva, Nadegda V; Beklemisheva, Violetta R; Johnson, Jennifer L; Temnykh, Svetlana V; Yudkin, Dmitry V; Trut, Lyudmila N; Andre, Catherine; Galibert, Francis; Aguirre, Gustavo D; Acland, Gregory M; Graphodatsky, Alexander S

2009-01-01

High-quality sequencing of the dog (Canis lupus familiaris) genome has enabled enormous progress in genetic mapping of canine phenotypic variation. The red fox (Vulpes vulpes), another canid species, also exhibits a wide range of variation in coat color, morphology, and behavior. Although the fox genome has not yet been sequenced, canine genomic resources have been used to construct a meiotic linkage map of the red fox genome and begin genetic mapping in foxes. However, a more detailed gene-specific comparative map between the dog and fox genomes is required to establish gene order within homologous regions of dog and fox chromosomes and to refine breakpoints between homologous chromosomes of the 2 species. In the current study, we tested whether canine-derived gene-containing bacterial artificial chromosome (BAC) clones can be routinely used to build a gene-specific map of the red fox genome. Forty canine BAC clones were mapped to the red fox genome by fluorescence in situ hybridization (FISH). Each clone was uniquely assigned to a single fox chromosome, and the locations of 38 clones agreed with cytogenetic predictions. These results clearly demonstrate the utility of FISH mapping for construction of a whole-genome gene-specific map of the red fox. The further possibility of using canine BAC clones to map genes in the American mink (Mustela vison) genome was also explored. Much lower success was obtained for this more distantly related farm-bred species, although a few BAC clones were mapped to the predicted chromosomal locations.

Guided tooth eruption: Comparison of open and closed eruption techniques in labially impacted maxillary canines

Directory of Open Access Journals (Sweden)

S M londhe

2014-01-01

Full Text Available Background: After third molars, the maxillary canines are the most commonly impacted permanent teeth and one-third of these are labial impactions. Impacted canines often require orthodontic guidance in the eruption. This study was conducted to assess the posttreatment results of surgically exposed and orthodontically aligned labially impacted maxillary canines comparing two different surgical techniques. Materials and Methods: The study was conducted in two phases, a surgical phase and an orthodontic phase. In surgical phase, events during surgical exposure and recovery of 31 patients with labially impacted maxillary canine were recorded. Patients were managed with open and closed eruption technique. The assessment included comparison of two techniques of surgical exposure, postoperative pain, mobility, vitality, periodontal health, level of impaction, and duration of orthodontic treatment. Results: The postoperative recovery was longer after open eruption than close eruption technique (P = 0.000. Postoperative pain experienced by patients was similar, but regression of pain was faster in closed eruption technique. The mean surgical time for open eruption technique was lesser when compared with closed eruption technique (P = 0.000. The total duration of orthodontic treatment was directly dependent upon the level of impaction, with deeper level of impaction having longer duration of orthodontic treatment. The mobility and vitality of guided canine was similar in both techniques. Conclusion: The closed eruption technique was a longer surgical procedure, but the postoperative pain regression was faster. The duration of orthodontic treatment was longer with deeper level of impaction. The closed eruption surgical techniques provide better periodontal tissues around the guided erupted teeth.

Esthetic judgments of palatally displaced canines 3 months postdebond after surgical exposure with either a closed or an open technique.

Science.gov (United States)

Parkin, Nicola A; Freeman, Jennifer V; Deery, Chris; Benson, Philip E

2015-02-01

The aim of this study was to compare the esthetic judgments of orthodontists and laypeople regarding the appearance of palatally displaced canines 3 months after treatment with either a closed or an open surgical exposure and orthodontic alignment. A multicenter randomized controlled trial was undertaken in 3 hospitals in the United Kingdom. Patients with unilateral palatally displaced canines were randomly allocated to receive either a closed or an open surgical exposure. The teeth were aligned with fixed appliances, and 3 months after debond, intraoral photographs were taken. The photographs were projected in random order to 2 panels of judges (orthodontists and laypeople), who completed a questionnaire. The images of 67 participants (closed, 33; open, 34) were included. The laypeople were able to identify the operated tooth only 49.7% of the time (95% CI, 45.3%-54.0%); this was no better than chance (P = 0.880). The orthodontists were more successful but still identified the treated canine with certainty only 60.7% of the time (95% CI, 53.7%-67.8%; P = 0.003). Both panels more frequently assessed the unoperated canine to have a better appearance than the contralateral operated canine; however, there were no differences between the closed and open groups (proportion preferring unoperated canine-laypeople: closed, 58.7%; open, 57.0%; P = 0.43; and orthodontists: closed, 60.9%; open, 60.6%; P = 0.27). There is an esthetic impact to aligning a palatally displaced canine, but it is mostly minor and unlikely to be detectable by laypeople. The esthetic impact was the same, whether the canine was exposed with a closed or an open surgical technique. Copyright © 2015 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

Seroepidemiology of Canine parvovirus infection in dogs

Directory of Open Access Journals (Sweden)

Indrawati Sendow

2004-10-01

Full Text Available Canine parvovirus is an acute and fatal viral disease in dogs. A total of 209 local, cross breed and breed dogs sera from Kodya Bogor, Kabupaten Bogor, Sukabumi, and Jakarta, had been tested using Haemagglutination Inhibition Test (HI with pig red blood cells. A total of 64 breed and cross breed dogs from Sukabumi and Kodya Bogor, were used as a sentinel dogs to study the epidemiology of Canine parvovirus (CPV infection and its immunological responses caused by vaccination. The results indicated that 78% (95 breed and cross bred dogs and 59% (51 local dogs had antibody to CPV. Sentinel dogs results indicated that dogs had been vaccinated showed antibody response with the varied titre dependant upon prevaccination titre. Low prevaccinated titre gave better response than protective level titre. From 19 puppies observed, Maternal antibodi were still detected until 5 weeks old puppies. First vaccination given at less than 3 months old, should be boosted after 3 months old puppied. Antibodi titre produced by natural infection will keep untill 2 years. These data concluded that the dog condition and time of vaccination will affect the optimum antibody response.

Expression of Bcl-2 in canine osteosarcoma

Directory of Open Access Journals (Sweden)

F. Piro

2015-03-01

Full Text Available Osteosarcoma (OS is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines.

Effects of epidermal growth factor receptor kinase inhibition on radiation response in canine osteosarcoma cells.

Science.gov (United States)

Mantovani, Fernanda B; Morrison, Jodi A; Mutsaers, Anthony J

2016-05-31

Radiation therapy is a palliative treatment modality for canine osteosarcoma, with transient improvement in analgesia observed in many cases. However there is room for improvement in outcome for these patients. It is possible that the addition of sensitizing agents may increase tumor response to radiation therapy and prolong quality of life. Epidermal growth factor receptor (EGFR) expression has been documented in canine osteosarcoma and higher EGFR levels have been correlated to a worse prognosis. However, effects of EGFR inhibition on radiation responsiveness in canine osteosarcoma have not been previously characterized. This study examined the effects of the small molecule EGFR inhibitor erlotinib on canine osteosarcoma radiation responses, target and downstream protein expression in vitro. Additionally, to assess the potential impact of treatment on tumor angiogenesis, vascular endothelial growth factor (VEGF) levels in conditioned media were measured. Erlotinib as a single agent reduced clonogenic survival in two canine osteosarcoma cell lines and enhanced the impact of radiation in one out of three cell lines investigated. In cell viability assays, erlotinib enhanced radiation effects and demonstrated single agent effects. Erlotinib did not alter total levels of EGFR, nor inhibit downstream protein kinase B (PKB/Akt) activation. On the contrary, erlotinib treatment increased phosphorylated Akt in these osteosarcoma cell lines. VEGF levels in conditioned media increased after erlotinib treatment as a single agent and in combination with radiation in two out of three cell lines investigated. However, VEGF levels decreased with erlotinib treatment in the third cell line. Erlotinib treatment promoted modest enhancement of radiation effects in canine osteosarcoma cells, and possessed activity as a single agent in some cell lines, indicating a potential role for EGFR inhibition in the treatment of a subset of osteosarcoma patients. The relative radioresistance of