
Sample records for canines

  1. Canine gastritis. (United States)

    Webb, Craig; Twedt, David C


    Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.

  2. Canine thymoma

    International Nuclear Information System (INIS)

    Aronsohn, M.


    Thymoma is an uncommon canine neoplasm of thymic epithelial cells. It is seen in various breeds but may occur more frequently in German Shepherd Dogs. Middle-aged or older dogs can be affected and no sex predilection exists. A paraneoplastic syndrome of myasthenia gravis, nonthymic malignant tumors, and/or polymyositis occurs in a significant number of dogs with thymoma. Clinical signs are variable and are related to a space-occupying cranial mediastinal mass and/or manifestations of the paraneo-plastic syndrome. Dyspnea is the most common presenting clinical sign. Thoracic radiographs usually show a cranial mediastinal mass. Lymphoma is the main differential diagnosis. A definitive diagnosis may be made by closed biopsy but is more likely to be confirmed by thoracotomy. Thymomas may be completely contained within the thymic capsule or may spread by local invasion or metastasis. A staging system allows for an accurate prognosis and a therapeutic plan. Surgical removal of encapsulated thymomas may result in long-term survival or cure. Invasive or metastatic thymomas carry a guarded prognosis. Manifestations of the paraneoplastic syndrome complicate treatment. Adjuvant radiation and chemotherapy may be of value for advanced cases; however, adequate clinical trials have not been done in the dog

  3. Vaccines for Canine Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Faeze Foroughi-Parvar


    Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

  4. Canine Parvovirus: Current Perspective


    Nandi, S.; Kumar, Manoj


    Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...

  5. Vaccines for canine leishmaniasis

    Directory of Open Access Journals (Sweden)

    Clarisa B. Palatnik-De-Sousa


    Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans

  6. Canine parvovirus: current perspective. (United States)

    Nandi, S; Kumar, Manoj


    Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.

  7. American Canine Hepatozoonosis (United States)

    Ewing, S. A.; Panciera, R. J.


    American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294

  8. Bilateral supernumerary primary maxillary canines

    Directory of Open Access Journals (Sweden)

    Santanu Mukhopadhyay


    Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.

  9. Canine obesity: an overview. (United States)

    Gossellin, J; Wren, J A; Sunderland, S J


    Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.

  10. Peracute Infectious Canine Hepatitis

    Directory of Open Access Journals (Sweden)

    A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam


    Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.

  11. Radioresistant canine hematopoietic cells

    International Nuclear Information System (INIS)

    Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.


    Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells

  12. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

    Directory of Open Access Journals (Sweden)

    Mostfa Shahabi


    Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.

  13. Podoplanin Expression in Canine Melanoma


    Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari


    A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...

  14. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos

    Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  15. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.


    INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  16. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction


    Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch


    Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...

  17. Canine oral melanoma. (United States)

    Bergman, Philip J


    Melanoma is the most common oral malignancy in the dog. Oral and/or mucosal melanoma has been routinely considered an extremely malignant tumor with a high degree of local invasiveness and high metastatic propensity. Primary tumor size has been found to be extremely prognostic. The World Health Organization staging scheme for dogs with oral melanoma is based on size, with stage I = or = 4cm tumor and/or lymph node metastasis, and stage IV = distant metastasis. Median survival times for dogs with oral melanoma treated with surgery are approximately 17 to 18, 5 to 6, and 3 months with stage I, II, and III disease, respectively. Significant negative prognostic factors include stage, size, evidence of metastasis, and a variety of histologic criteria. Standardized treatments such as surgery, coarse-fractionation radiation therapy, and chemotherapy have afforded minimal to modest stage-dependent clinical benefits and death is usually due to systemic metastasis. Numerous immunotherapeutic strategies have been employed to date with limited clinical efficacy; however, the use of xenogeneic DNA vaccines may represent a leap forward in clinical efficacy. Oral melanoma is a spontaneous syngeneic cancer occurring in outbred, immunocompetent dogs and appears to be a more clinically faithful therapeutic model for human melanoma; further use of canine melanoma as a therapeutic model for human melanoma is strongly encouraged. In addition, the development of an expanded but clinically relevant staging system incorporating the aforementioned prognostic factors is also strongly encouraged.

  18. Podoplanin Expression in Canine Melanoma. (United States)

    Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari


    A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.

  19. Approaches to canine health surveillance. (United States)

    O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C


    Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.

  20. Canine and feline colostrum. (United States)

    Chastant-Maillard, S; Aggouni, C; Albaret, A; Fournier, A; Mila, H


    Puppy and kitten survival over the first weeks is particularly dependent on colostrum, a specific secretion of the mammary gland produced during the first 2 days post-partum. Colostrum is a source of nutrients and immunoglobulins. It also contributes to the digestive tract maturation. Colostrum differentiates from milk mainly based on its concentration in immunoglobulins G: 20-30 g/L in dog colostrum, 40-50 g/L in cats' vs <1 g/L in milk. IgG concentration rapidly drops after parturition (-50% in 24 hr). Immune quality of colostrum is highly variable between bitches, with no relationship with maternal blood IgG level, dam's age, breed size or litter size. In addition to systemic immune protection, colostrum also plays a major role for local digestive protection, due to IgA, lysozyme, lactoferrin, white blood cells and various cytokines. Energetic concentration of canine and feline colostrum is not superior to that of mature milk. It depends on colostrum fat concentration and is affected by breed size (higher in breeds <10 kg adult body weight). As puppies and kittens are almost agammaglobulinemic at birth, transfer of IgG from their digestive tract into their bloodstream is crucial for their survival, IgG absorption ending at 12-16 hr after birth. Energetic supply over the two first days of life, as evidenced by growth rate over the two first days of life, also affects risk of neonatal mortality. Early and sufficient suckling of colostrum is thus the very first care to be provided to newborns for their later health and survival. © 2016 Blackwell Verlag GmbH.

  1. Surgical innovations in canine gonadectomy

    NARCIS (Netherlands)

    Van Goethem, Bart


    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated

  2. Immunohistochemical Characterization of Canine Lymphomas

    Directory of Open Access Journals (Sweden)

    Roxana CORA


    Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.

  3. Ontogeny of canine dimorphism in extant hominoids. (United States)

    Schwartz, G T; Dean, C


    Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.

  4. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus. (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo


    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  5. Genetics of Human and Canine Dilated Cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Siobhan Simpson


    Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

  6. Genetics of Human and Canine Dilated Cardiomyopathy. (United States)

    Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S


    Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

  7. Cryopreservation of microencapsulated canine sperm. (United States)

    Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu


    The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. Surgical innovations in canine gonadectomy


    Van Goethem, Bart


    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated negative consequences (lengthy placement, impaired wound healing around bulky knots, and the effect of unsightly knots on cosmetics). A study in 9 dogs found that celiotomy closure was easily achiev...

  9. 9 CFR 113.306 - Canine Distemper Vaccine. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...

  10. 9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...

  11. Canine scent detection of canine cancer: a feasibility study

    Directory of Open Access Journals (Sweden)

    Dorman DC


    Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of

  12. New and emerging pathogens in canine infectious respiratory disease. (United States)

    Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J


    Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.

  13. Concomitant canine distemper, infectious canine hepatitis, canine parvoviral enteritis, canine infectious tracheobronchitis, and toxoplasmosis in a puppy. (United States)

    Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes


    The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.

  14. Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

    International Nuclear Information System (INIS)

    Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.


    Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

  15. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies


    J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides


    Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...

  16. Characterization of the canine urinary proteome. (United States)

    Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E


    Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.

  17. Radioimmunoassay of canine growth hormone

    International Nuclear Information System (INIS)

    Eigenmann, J.E.; Eigenmann, R.Y.


    A sensitive radioimmunoassay (RIA) for canine growth hormone (GH) was developed. Antibodies were elicited in rhesus monkeys. One antiserum exhibited a working titer at a dilution of 1:500 000. Radioiodination was performed enzymatically employing lactoperoxidase. Logit-log transformation and least squares fitting resulted in straight line fitting of the standard curve between 0.39 and 50 ng/ml. Formation of large-molecular [ 125 I]GH during storage caused diminished assay sensitivity. Therefore [ 125 I]GH was re-purified by gel chromatography. Using this procedure, high and reproducible assay sensitivity was obtained. Tracer preparations were used for as long as 3 months after iodination. Diluted plasma from normal and acromegalic dogs resulted in a dose-response curve parallel to the standard curve. Canine prolactin exhibited a cross-reactivity of 2%. The within-assay coefficient of variation (CV) was 3.8 and the between-assay CV was 7.2%. Mean plasma GH concentration in normal dogs was 1.92 +- 0.14 ng/ml (mean +- SEM.) GH levels in acromegalic dogs were appreciably higher. Insulin-induced hypoglycaemia, arginine and ornithine administration resulted in inconsistent and sluggish GH increment. A better response was obtained by injecting a low dose of clonidine. Clonidine administration to hypopituitary dogs resulted in absent or poor GH increment. (author)

  18. Extrusion processing : effects on dry canine diets

    NARCIS (Netherlands)

    Tran, Q.D.


    Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying.

    Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the

  19. Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells. (United States)

    Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D


    To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.

  20. Varied clinico-radiological presentations of transmigrated canines

    Directory of Open Access Journals (Sweden)

    Ishita Gupta


    Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.

  1. Canine adenovirus type 1 in a fennec fox (Vulpes zerda). (United States)

    Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku


    A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.

  2. Canine babesiosis: from molecular taxonomy to control

    Directory of Open Access Journals (Sweden)

    Irwin Peter J


    Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

  3. [Nonsurgical endodontic treatment of an invaginated canine]. (United States)

    Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P


    We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.

  4. Treatment modalities of palatal impacted canines


    Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona


    Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...

  5. Orthodontic Traction of Impacted Canine Using Cantilever


    Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé


    The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...

  6. A new method for rapid Canine retraction

    Directory of Open Access Journals (Sweden)

    "Khavari A


    Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.

  7. Platelets Inhibit Migration of Canine Osteosarcoma Cells. (United States)

    Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C


    The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.

  8. Clinical and Statistical Study on Canine Impaction

    Directory of Open Access Journals (Sweden)

    Adina-Simona Coșarcă


    Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic

  9. CANINE: a robotic mine dog (United States)

    Stancil, Brian A.; Hyams, Jeffrey; Shelley, Jordan; Babu, Kartik; Badino, Hernán.; Bansal, Aayush; Huber, Daniel; Batavia, Parag


    Neya Systems, LLC competed in the CANINE program sponsored by the U.S. Army Tank Automotive Research Development and Engineering Center (TARDEC) which culminated in a competition held at Fort Benning as part of the 2012 Robotics Rodeo. As part of this program, we developed a robot with the capability to learn and recognize the appearance of target objects, conduct an area search amid distractor objects and obstacles, and relocate the target object in the same way that Mine dogs and Sentry dogs are used within military contexts for exploration and threat detection. Neya teamed with the Robotics Institute at Carnegie Mellon University to develop vision-based solutions for probabilistic target learning and recognition. In addition, we used a Mission Planning and Management System (MPMS) to orchestrate complex search and retrieval tasks using a general set of modular autonomous services relating to robot mobility, perception and grasping.

  10. Ultrasonography of the canine pancreas

    Directory of Open Access Journals (Sweden)

    Michelle L Avante


    Full Text Available This study describes the ultrasonographic techniques currently used in the evaluation of the canine pancreas. Ultrasonography was the first method to enable direct visualization of the pancreas in humans and it has been subsequently applied to animals. Currently, it is the method of choice for pancreatic evaluation and is essential as a diagnostic tool in the detection of abnormalities, especially tumors. Innovative equipment technology has led to the emergence of techniques complementary to B-mode ultrasound; such as Doppler, elastography, and contrast-enhanced ultrasonography, which have enabled more accurate diagnosis. Doppler provides information on vascular architecture and the hemodynamic aspect of blood vessels in multiple organs. ARFI elastography provides detailed images of the alterations detected by conventional examination (qualitative method and assists in differentiating between benign and malignant processes (quantitative method. Microbubble contrast agents determine parameters related to homogeneous and heterogeneous filling of organs with microbubbles, mainly nodular areas, thus defining high and low intensity patterns.

  11. 9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus. (United States)


    ... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...

  12. Role of canine circovirus in dogs with acute haemorrhagic diarrhoea. (United States)

    Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S


    Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.

  13. Evaluation of post-vaccination immunity to canine distemper and ...

    African Journals Online (AJOL)



    Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...

  14. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe. (United States)

    McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A


    Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  15. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

    Directory of Open Access Journals (Sweden)

    Anna McRee


    Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  16. 9 CFR 113.317 - Parvovirus Vaccine (Canine). (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...

  17. 9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine). (United States)


    ... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...

  18. Development of the canine tooth in the beagle

    International Nuclear Information System (INIS)

    Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.


    The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla

  19. Canine hypothyroidism. A diagnostic challenge?

    International Nuclear Information System (INIS)

    Boretti, Felicitos; Reusch, C.E.


    Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen registered ) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high

  20. Antibody titers for canine parvovirus type-2, canine distemper virus, and canine adenovirus type-1 in adult household dogs. (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki


    Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.

  1. Booster effect of canine distemper, canine parvovirus infection and infectious canine hepatitis combination vaccine in domesticated adult dogs. (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki


    Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

  2. Orthodontic Traction of Impacted Canine Using Cantilever

    Directory of Open Access Journals (Sweden)

    Cláudia Nakandakari


    Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.

  3. Transmigration of mandibular canine – case report

    International Nuclear Information System (INIS)

    Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia


    Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation

  4. Ultrasonographic description of canine mastitis. (United States)

    Trasch, Katja; Wehrend, Axel; Bostedt, Hartwig


    Ultrasonographic images were acquired of the mammary glands of 40 bitches with physiologically lactating (n = 20) or inflamed glands (n = 20). Echogenicity, structure, homogeneity, thickness, and distinguishability of each tissue layer were assessed. Additionally, overall echogenicity was noted. In the normal lactating gland, different tissues could be differentiated easily. The parenchyma was, without exception, separated from adjacent tissues and was visible as medium echogenic tissue with a coarse-grained structure. The tissue always had some echogenic lines and anechoic areas and was slightly heterogeneous. The loss of distinct layering of the tissue was characteristic of an inflamed mammary gland and inflamed regions had reduced echogenicity. Additionally in five bitches with mastitis, the ultrasound examination was repeated five times for documentation of the progress of the illness and associated changes, supplemented with a color Doppler sonogram to assess changes in blood vessel density. Information from the examinations carried out via B-mode did not allow treatment success to be predicted. Two bitches with reduced blood vessel density centrally had a poor outcome whereas three bitches with increased blood vessel density had a good outcome. Thus, Doppler sonography might be a useful tool to obtain information of the prognosis in acute canine mastitis.

  5. Canine Intracranial Meningioma: Case report

    Directory of Open Access Journals (Sweden)

    José Ricardo Gomes de Carvalho


    Full Text Available ABSTRACT. Carvalho J.R.G., Vasconcellos C.H.C., Bastos I. P.B., Trajano F.L.C., Costa T.S. & Fernandes J.I [Canine Intracranial Meningioma: Case report.] Meningioma intracraniano canino: Relato de caso. Revista Brasileira de Medicina Veterinária, 38(supl. 3:1- 7, 2016. Programa de Pós-Graduação em Ciências Veterinária, Universidade Federal Rural do Rio de Janeiro, BR 465 Km 7, Seropédica, RJ 23.897-000, Brasil, E-mail: Intracranial neoplasms usually show their signals in a moderate way, revealing a long background of nonspecific signs, making the diagnosis more difficult. The meningioma is the most common intracranial neoplasm in dogs and cats. Along the years, the Veterinary Medicine has experienced important technological improvements, making it possible the diagnosis of a lot of diseases. Therefore, diseases considered not common in the past, started being diagnosed more frequently, for instance, brain lesions. The objective of this research is to report a case of intracranial meningioma in a Boxer dog that arrived at the Veterinary Hospital of the Federal Rural University of Rio de Janeiro, highlighting its clinical improvement, diagnosis and treatment.

  6. Overexpression of vimentin in canine prostatic carcinoma

    DEFF Research Database (Denmark)

    Rodrigues, M M P; Rema, A; Gärtner, F


    Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....

  7. Genetics of Human and Canine Dilated Cardiomyopathy


    Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland


    Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...

  8. Tooth fractures in canine clinical practice

    International Nuclear Information System (INIS)

    Capik, I.; Ledecky, V.; Sevcik, A.


    Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients

  9. Reliability of mandibular canines as indicators for sexual dichotomy. (United States)

    Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa


    Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.

  10. [Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus]. (United States)

    Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia


    To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

  11. Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War (United States)


    anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges

  12. Cardiac involvement in canine babesiosis : review article

    Directory of Open Access Journals (Sweden)

    R.G. Lobetti


    Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.

  13. Canine distemper outbreak in rhesus monkeys, China. (United States)

    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang; Hu, Rongliang


    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People's Republic of China. Approximately 10,000 animals were infected (25%-60% disease incidence); 5%-30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain.

  14. Canine trypanosomosis: Clinical observations and morphological ...

    African Journals Online (AJOL)

    Clinical and pathological aspects of canine trypanosomosis were determined in naturally infected dogs presented to the Veterinary Teaching Hospital, Federal University of Agriculture, Abeokuta, at different times between 2012 and 2013. The breeds, sexes, ages and body weights of the dogs were recorded. Clinical signs ...

  15. Molecular Epidemiology of Canine Parvovirus, Europe (United States)

    Desario, Costantina; Addie, Diane D.; Martella, Vito; Vieira, Maria João; Elia, Gabriella; Zicola, Angelique; Davis, Christopher; Thompson, Gertrude; Thiry, Ethienne; Truyen, Uwe; Buonavoglia, Canio


    Canine parvovirus (CPV), which causes hemorrhagic enteritis in dogs, has 3 antigenic variants: types 2a, 2b, and 2c. Molecular method assessment of the distribution of the CPV variants in Europe showed that the new variant CPV-2c is widespread in Europe and that the viruses are distributed in different countries. PMID:17953097

  16. Prostate histotripsy for BPH: initial canine results (United States)

    Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.


    Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.

  17. Canine specific ELISA for coagulation factor VII

    DEFF Research Database (Denmark)

    Knudsen, Tom; Kjelgaard-Hansen, Mads; Tranholm, Mikael


    available to date. In this study, a canine specific ELISA for measurement of FVII:Ag in plasma was developed and validated. The FVII:Ag ELISA correctly diagnosed homozygous and heterozygous hereditary FVII deficiency. Together with activity based assays, such as FVII:C, the FVII:Ag ELISA should be valuable...

  18. Canine Distemper Outbreak in Rhesus Monkeys, China (United States)

    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang


    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People’s Republic of China. Approximately 10,000 animals were infected (25%–60% disease incidence); 5%–30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain. PMID:21801646

  19. A novel bocavirus in canine liver

    Directory of Open Access Journals (Sweden)

    Li Linlin


    Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.

  20. Duration of serological response to canine parvovirus-type 2, canine distemper virus, canine adenovirus type 1 and canine parainfluenza virus in client-owned dogs in Australia. (United States)

    Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J


    To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.

  1. Novel canine circovirus strains from Thailand: Evidence for genetic recombination. (United States)

    Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E


    Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.

  2. Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma. (United States)

    Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H


    Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.

  3. European canine lymphoma network consensus recommendations for reporting flow cytometry in canine hematopoietic neoplasms. (United States)

    Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W


    Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.

  4. Development and Characterization of Canine Distemper Virus Monoclonal Antibodies. (United States)

    Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong


    Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.

  5. Canine Detection of Illict Drugs: Sensory Apparatus Technology

    National Research Council Canada - National Science Library

    Morrison, Edward


    This report describes basic anatomical and physiological observations of the peripheral canine olfactory system, provided by means of investigations into its structural and molecular characteristics...

  6. Antigenic typing Polish isolates of canine parvovirus

    Energy Technology Data Exchange (ETDEWEB)

    Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)


    Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.

  7. Coryneform bacteria associated with canine otitis externa

    DEFF Research Database (Denmark)

    Aalbæk, Bent; Bemis, David A.; Schjærff, Mette


    This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...

  8. Nonsurgical, nonextraction management of impacted maxillary canine

    Directory of Open Access Journals (Sweden)

    Jasneet Singh


    Full Text Available NS, a 12 year 2 months old female patient, presented with the chief complaint of irregular teeth. Diagnosis revealed skeletal Class II jaw base relation, with average (toward vertical growth pattern, dentoalveolar angles Class I molar relationship with severe crowding in upper and moderate crowding in the lower arch, normally positioned maxillary incisors but proclined lower incisors, “V” shape constricted maxillary arch with first premolar in crossbite, overretained deciduous molar and a high placed buccoversion canine in the first quadrant and an impacted canine in the second quadrant, constricted mandibular arch with first premolar blocked out in the third quadrant. Treatment with a nonsurgical, nonextraction treatment plan by expansion of the upper arch and taking advantage of natural eruptive forces of the tooth was planned. The final outcome solved the patient's complaints and achieved an esthetically pleasing and functionally adequate occlusal result.

  9. Impacted canines: Etiology, diagnosis, and orthodontic management

    Directory of Open Access Journals (Sweden)

    Ranjit Manne


    Full Text Available Impaction of maxillary and mandibular canines is a frequently encountered clinical problem, the treatment of which usually requires an interdisciplinary approach. Surgical exposure of the impacted tooth and the complex orthodontic mechanisms that are applied to align the tooth into the arch may lead to varying amounts of damage to the supporting structures of the tooth, not to mention the long treatment duration and the financial burden to the patient. Hence, it seems worthwhile to focus on the means of early diagnosis and interception of this clinical situation. In the present article, an overview of the incidence and sequelae, as well as the surgical, periodontal, and orthodontic considerations in the management of impacted canines is presented.

  10. Antigenic typing Polish isolates of canine parvovirus

    International Nuclear Information System (INIS)

    Mizak, B.; Plucienniczak, A.


    Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs

  11. Expression of nociceptive ligands in canine osteosarcoma. (United States)

    Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M


    Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.

  12. Radiation, chemotherapy and surgery for canine osteosarcoma

    International Nuclear Information System (INIS)

    Powers, B.E.; Withrow, S.J.; La Rue, S.M.; Straw, R.C.; Gillette, E.L.


    Spontaneous canine osteosarcomas is an excellent model for of human osterosarcoma. Twenty dogs with obsteorsarcoma were treated with intravenous or intraarterial cisplatin with or without radiation therapy. This treatment was given 3 weeks prior to limb sparing surgery involving excision of the tumor and allograft replacement. The excised tumor specimen was examined for complete removal and percentage of necrotic tumor measured by planimetry. Intraveneous and intraarterial cisplatin and radiation methods were compared. Data discussing rate of disease development and recurrences is given

  13. Leishmania (infantum) chagasi in canine urinary sediment


    Mendonça, Ivete Lopes de; Batista, Joilson Ferreira; Alves, Leucio Camara


    Canine visceral leishmaniasis (CVL) is difficult to diagnosis, mainly due to the presence of asymptomatic animals, the diversity of clinical symptoms and the difficulty in obtaining diagnostic evidence of high sensitivity and specificity. The purpose of this study was to diagnose CVL in urinary sediment of 70 dogs of different breeds, sexes and ages from the veterinary hospital of the Federal University of Piauí and Zoonosis Control Center of Teresina, Brazil. The serological tests were TR DP...

  14. Remote detection of explosives using trained canines

    International Nuclear Information System (INIS)

    Smith, J.C.


    Use of dogs is a search method which combines high probability of detection, speed of search, and low cost. It was concluded that the canine could be used for explosive screening of personnel, but that it was imperative that the dog be in a position remote from employees and employee traffic. A study was made of the design of booths and air flow for this purpose. Results of tests and conclusions are given and discussed

  15. Ultrasonographic evaluation of the canine shoulder. (United States)

    Long, C D; Nyland, T G


    The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.

  16. Increasing Incidence of Canine Leptospirosis in Switzerland

    Directory of Open Access Journals (Sweden)

    Andrea Major


    Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.

  17. Laparoscopic radical prostatectomy in the canine model. (United States)

    Price, D T; Chari, R S; Neighbors, J D; Eubanks, S; Schuessler, W W; Preminger, G M


    The purpose of this study was to determine the feasibility of performing laparoscopic radical prostatectomy in a canine model. Laparoscopic radical prostatectomy was performed on six adult male canines. A new endoscopic needle driver was used to construct a secure vesicourethral anastomosis. Average operative time required to complete the procedure was 304 min (range 270-345 min). Dissection of the prostate gland took an average of 67 min (range 35-90 min), and construction of the vesicourethral anastomosis took 154 min (rage 80-240 min). There were no intraoperative complications and only one postoperative complication (anastomotic leak). Five of the six animals recovered uneventfully from the procedure, and their foley catheters were removed 10-14 days postoperatively after a retrograde cystourethrogram demonstrated an intact vesicourethral anastomosis. Four (80%) of the surviving animals were clinically continent within 10 days after catheter removal. Post mortem examination confirmed that the vesicourethral anastomosis was intact with no evidence of urine extravasation. These data demonstrate the feasibility of laparoscopic radical prostatectomy in a canine model, and suggest that additional work with this technique should be continued to develop its potential clinical application.

  18. Molecular characterization of the canine HMGB1. (United States)

    Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I


    Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel

  19. Canine tooth size and fitness in male mandrills (Mandrillus sphinx). (United States)

    Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean


    Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.

  20. Vaccine-induced canine distemper in a lesser panda. (United States)

    Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J


    A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.

  1. Glucosamine and chondroitin use in canines for osteoarthritis: A ...

    African Journals Online (AJOL)

    Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...

  2. Management of an impacted and transposed maxillary canine

    Directory of Open Access Journals (Sweden)

    Deepti A


    Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.

  3. The Ondersteport Canine distemper virus strain and measles ...

    African Journals Online (AJOL)

    Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...

  4. Surgical considerations and management of bilateral labially impacted canines

    Directory of Open Access Journals (Sweden)

    Yu-Shan Huang


    Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.

  5. Recombinant canine distemper virus serves as bivalent live vaccine against rabies and canine distemper. (United States)

    Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao


    Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Application of xenogeneic anti-canine distemper virus antibodies in treatment of canine distemper puppies. (United States)

    Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L


    The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.

  7. Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review

    Directory of Open Access Journals (Sweden)

    Parviz Torkzaban


    Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.

  8. Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report. (United States)

    Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka


    Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.

  9. Simultaneous canine distemper encephalitis and canine parvovirus infection with distemper-associated cardiac necrosis in a pup


    Headley,Selwyn Arlington; Saito,Taís Berelli


    Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...

  10. Three-year duration of immunity in dogs following vaccination against canine adenovirus type-1, canine parvovirus, and canine distemper virus. (United States)

    Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J


    A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.

  11. Validation of commercially available automated canine-specific immunoturbidimetric method for measuring canine C-reactive protein

    DEFF Research Database (Denmark)

    Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold


    BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was

  12. Extraglandular and intraglandular vascularization of canine prostate. (United States)

    Stefanov, Miroslav


    The literature on the vascularization of the canine prostate is reviewed and the clinical significance of prostate morphology is described. Scanning Electron Microscopy (SEM), combined with improved corrosion casting methods, reveal new morphological details that promise better diagnostics and treatment but also require expansion of clinical nomenclature. A proposal is made for including two previously unnamed veins in Nomina Anatomica Veterinaria (NAV). The canine prostate has two lobes with independent vascularization. Each lobe is supplied through the left and right a. prostatica, respectively. The a. prostatica sprouts three small vessels (cranial, middle, and caudal) towards the prostate gland. A. prostatica is a small-size artery whose wall structure is similar to the arteries of the muscular type. V. prostatica is a small-size valved vein. The canine prostate has capsular, parenchymal, and urethral vascular zones. The surface vessels of the capsule are predominantly veins and the diameter of arterial vessels is larger than that of the veins. The trabecular vessels are of two types: direct and branched. The prostate parenchyma is supplied by branches of the trabecular vessels. The periacinary capillaries are fenestrated and form a net in a circular pattern. The processes of the myoepithelial cells embrace both the acins and the periacinar capillaries. In the prostate ductal system. there are spermatozoa. The prostatic part of the urethra is supplied by an independent branch of a. prostatica. The prostatic urethral part is drained by v. prostatica, the vein of the urethral bulb and the ventral prostate veins. M. urethralis begins as early as the urethral prostatic part. The greater part of the white muscle fibers in m. urethralis suggest an enhanced anaerobic metabolism. Copyright 2004 Wiley-Liss, Inc.

  13. Normal blood supply of the canine patella

    International Nuclear Information System (INIS)

    Howard, P.E.; Wilson, J.W.; Robbins, T.A.; Ribble, G.A.


    The normal blood supply of the canine patella was evaluated, using microangiography and correlated histology. Arterioles entered the cortex of the patella at multiple sites along the medial, lateral, and dorsal aspects. The body of the patella was vascularized uniformly, with many arterioles that branched and anastomosed extensively throughout the patella. The patella was not dependent on a single nutrient artery for its afferent supply, but had an extensive interior vascular network. These factors should ensure rapid revascularization and healing of patellar fractures, provided appropriate fracture fixation is achieved

  14. Definition, Classification, and Pathophysiology of Canine Glaucoma. (United States)

    Pizzirani, Stefano


    Glaucoma is a common ocular condition in humans and dogs leading to optic nerve degeneration and irreversible blindness. Primary glaucoma is a group of spontaneous heterogeneous diseases. Multiple factors are involved in its pathogenesis and these factors vary across human ethnic groups and canine breeds, so the clinical phenotypes are numerous and their classification can be challenging and remain superficial. Aging and oxidative stress are major triggers for the manifestation of disease. Multiple, intertwined inflammatory and biochemical cascades eventually alter cellular and extracellular physiology in the optic nerve and trabecular meshwork and lead to vision loss. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Canine distemper virus-associated hypocalcemia. (United States)

    Weisbrode, S E; Krakowka, S


    A retrospective study was done to correlate serum calcium concentrations and parathyroid gland ultrastructure to clinical, immunologic, and pathologic changes experimentally induced in gnotobiotic dogs by canine distemper virus (CDV). Dogs infected with CDV had significantly reduced serum calcium concentrations associated with ultrastructural evidence of parathyroid gland inactivity, degeneration, and viral inclusions. Although CDV-infected dogs exhibited neurologic signs, minimal lesions were present in the central nervous system. It is suggested that viral-induced parathyroid dysfunction may contribute to neutrologic disturbance of CDV infection.

  16. Canine parvovirus in asymptomatic feline carriers. (United States)

    Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D


    Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog

  17. Triple bone labeling of canine mandibles

    DEFF Research Database (Denmark)

    Pinholt, E M; Kwon, P H


    Fluorescence microscopy was used for evaluation of new bone formation in 16 canine mandibles augmented with hydroxylapatite (HA) granules. Three fluorochromes were injected at different time intervals during therapeutic radiation treatment. Oxytetracycline, DCAF, and alizarin-complexone were given...... intravenously to mark the bone level at these times, respectively. Oxytetracycline, which defined the baseline of bone at implantation of HA, was detectable in 42% of animals that were irradiated and in no animal of the nonirradiated control group. The marker DCAF, designating levels of bone at the start...

  18. Embolus radiolabelling in a new canine model

    International Nuclear Information System (INIS)

    Kaufman, H.H.; Huchton, J.D.; Woo, J.; Cannon, D.C.; Anderson, J.H.


    Embolus radiolabelling with 131 I fibrinogen was studied in a canine model of internal carotid artery embolization. The dog was chosen as the experimental animal because of its maxillocarotid artery which permits collateral flow round the occlusion and helps to prevent strokes. Clot was prepared by incubating blood at room temperature to inactivate plasminogen activators and then refrigerating it to promote clot retraction. Emboli persisting 48 hours were seen in 80% of animals. Major strokes were not seen when 0.25 to 0.30 cm 3 were used. Autoradiography and well counting revealed uptake of isotope. The test, when refined, should provide a tool for the investigation of thromboemboli. (author)

  19. Functional Characterization of Canine Interferon-Lambda (United States)

    Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun


    In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142

  20. Esthetic orthodontic correction of a canine crossbite. (United States)

    Park, Jae Hyun; Kim, Tae Weon


    Serial Aligners are fabricated from the working cast at certain intervals during treatment. It offers flexibility to change the treatment plan at any stage throughout the course of treatment. The tooth movement is very efficient and the patient feels comfortable because Clear Aligner comes in three different thicknesses of plastic sheets. It enables the patient to receive necessary dental treatments during the aligner treatment. The treatment can also be restarted easily even when the patient has not worn the aligners for a period of time. This article reports a patient with canine crossbite combined with moderate crowding that was successfully treated using Serial Aligners.

  1. The Genetics of Canine Skull Shape Variation (United States)

    Schoenebeck, Jeffrey J.; Ostrander, Elaine A.


    A dog’s craniofacial diversity is the result of continual human intervention in natural selection, a process that began tens of thousands of years ago. To date, we know little of the genetic underpinnings and developmental mechanisms that make dog skulls so morphologically plastic. In this Perspectives, we discuss the origins of dog skull shapes in terms of history and biology and highlight recent advances in understanding the genetics of canine skull shapes. Of particular interest are those molecular genetic changes that are associated with the development of distinct breeds. PMID:23396475

  2. Skeletal maturity assessment using mandibular canine calcification stages

    Directory of Open Access Journals (Sweden)

    Vildana Džemidžić


    Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.

  3. Stem Cell-Associated Marker Expression in Canine Hair Follicles. (United States)

    Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J


    Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.

  4. Cone beam computed tomography findings of impacted upper canines

    Energy Technology Data Exchange (ETDEWEB)

    Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)


    To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

  5. Evaluation of P16 expression in canine appendicular osteosarcoma. (United States)

    Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K


    Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.

  6. Upper canine inclination influences the aesthetics of a smile. (United States)

    Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S


    This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.

  7. Cone beam computed tomography findings of impacted upper canines

    International Nuclear Information System (INIS)

    Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio


    To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

  8. Rate of retraction of anterior teeth after canine distraction

    Directory of Open Access Journals (Sweden)

    Litesh Singla


    Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.

  9. Canine neosporosis: perspectives on pathogenesis and management

    Directory of Open Access Journals (Sweden)

    Silva RC


    Full Text Available Rodrigo C Silva,1 Gustavo P Machado2 1Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Starkville, MS, USA; 2Department of Internal Medicine and Surgery of Small Animals, Dr Munhoz Veterinary Hospital, Itápolis, Brazil Abstract: Canine neosporosis is a worldwide disease caused by the obligate intracellular parasite protozoan Neospora caninum, manifesting mainly neurological symptoms. N. caninum has a heteroxenous life cycle and affects a wide range of warm-blooded animals. The domestic and wild canids are the definitive host of the parasite. They shed oocysts after ingestion of tissue cysts from infected intermediate hosts (ovine, equine, bovine, canine, and many other species, containing bradyzoites, or oocyst-contaminated water and food. The presence of dogs in farms is considered a risk factor for production animals. A wide range of diagnostic methods are currently available, but the most used is serology, ie, indirect fluorescent antibody test specific to the antibody detection in blood serum samples. No vaccine is available, but control strategies should be focused on the vertical and horizontal transmission of the parasite, ie, avoid feeding dogs with raw or undercooked meat, and taking care with water for human and animal consumption. No medicines to control the transplacental transmission are available yet. Keywords: neosporosis, Neospora caninum, pathogenesis, management, dogs

  10. Seroepidemiology of Canine parvovirus infection in dogs

    Directory of Open Access Journals (Sweden)

    Indrawati Sendow


    Full Text Available Canine parvovirus is an acute and fatal viral disease in dogs. A total of 209 local, cross breed and breed dogs sera from Kodya Bogor, Kabupaten Bogor, Sukabumi, and Jakarta, had been tested using Haemagglutination Inhibition Test (HI with pig red blood cells. A total of 64 breed and cross breed dogs from Sukabumi and Kodya Bogor, were used as a sentinel dogs to study the epidemiology of Canine parvovirus (CPV infection and its immunological responses caused by vaccination. The results indicated that 78% (95 breed and cross bred dogs and 59% (51 local dogs had antibody to CPV. Sentinel dogs results indicated that dogs had been vaccinated showed antibody response with the varied titre dependant upon prevaccination titre. Low prevaccinated titre gave better response than protective level titre. From 19 puppies observed, Maternal antibodi were still detected until 5 weeks old puppies. First vaccination given at less than 3 months old, should be boosted after 3 months old puppied. Antibodi titre produced by natural infection will keep untill 2 years. These data concluded that the dog condition and time of vaccination will affect the optimum antibody response.

  11. Intracellular Route of Canine Parvovirus Entry (United States)

    Vihinen-Ranta, Maija; Kalela, Anne; Mäkinen, Päivi; Kakkola, Laura; Marjomäki, Varpu; Vuento, Matti


    The present study was designed to investigate the endocytic pathway involved in canine parvovirus (CPV) infection. Reduced temperature (18°C) or the microtubule-depolymerizing drug nocodazole was found to inhibit productive infection of canine A72 cells by CPV and caused CPV to be retained in cytoplasmic vesicles as indicated by immunofluorescence microscopy. Consistent with previously published results, these data indicate that CPV enters a host cell via an endocytic route and further suggest that microtubule-dependent delivery of CPV to late endosomes is required for productive infection. Cytoplasmic microinjection of CPV particles was used to circumvent the endocytosis and membrane fusion steps in the entry process. Microinjection experiments showed that CPV particles which were injected directly into the cytoplasm, thus avoiding the endocytic pathway, were unable to initiate progeny virus production. CPV treated at pH 5.0 prior to microinjection was unable to initiate virus production, showing that factors of the endocytic route other than low pH are necessary for the initiation of infection by CPV. PMID:9420290

  12. Expression of Bcl-2 in canine osteosarcoma (United States)

    Piro, F.; Leonardi, L.


    Osteosarcoma (OS) is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines. PMID:26623359

  13. Expression of Bcl-2 in canine osteosarcoma

    Directory of Open Access Journals (Sweden)

    F. Piro


    Full Text Available Osteosarcoma (OS is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines.

  14. Orthodontic treatment of a complete transposed impacted maxillary canine

    Directory of Open Access Journals (Sweden)

    Pi-Huei Liu


    Full Text Available Tooth transposition is a positional interchange of two adjacent teeth. Transposition most often occurs at maxillary canine. Moving transposed teeth to their normal positions is challenging because this requires bodily movement and translation of one tooth to pass another. This procedure may cause damage to the teeth or supporting structures. We report a case of complete transposition of maxillary canine and lateral incisor. Transposed teeth were successfully moved orthodontically to their normal positions. Multiple mechanics were meticulously applied to achieve complete correction of the tooth positions and to minimize root resorption and/or periodontal defects of canine and lateral incisors. Factors concerning treatment planning for transposed teeth are discussed.

  15. Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough). (United States)

    Glickman, L T; Appel, M J


    Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.

  16. Models of experimental saccular aneurysms of carotid arteries in canine

    International Nuclear Information System (INIS)

    Zhang Haixia; Cheng Yingsheng; Li Minghua


    Objective: To study the availability by making experimental saccular aneurysm models of carotid arteries in canine similar to human intracranial aneurysms. Methods: Twenty healthy canines with experimental saccular side-wall aneurysms of carotid arteries were created successfully by surgery. Results: Forty experimental saccular side-wall aneurysms of carotid arteries were created successfully with 36 aneurysms and parent arteries maintaining patency with each other and four spontaneously occluded confirmed by angiography. Model successful rate reached 90%. Conclusions: Experimental saccular side-wall aneurysms of carotid arteries in canines were one of best models created for simulating human intracranial aneurysms. (authors)

  17. Canine Visceral Leishmaniasis in Wild Canines (Fox, Jackal, and Wolf in Northeastern Iran Using Parasitological, Serological, and Molecular Methods

    Directory of Open Access Journals (Sweden)

    Mehdi Mohebali


    Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.

  18. Kinetics of canine dental calculus crystallization: an in vitro study on the influence of inorganic components of canine saliva. (United States)

    Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H


    This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Clinical and serological response of wild dogs (Lycaon pictus to vaccination against canine distemper, canine parvovirus infection and rabies

    Directory of Open Access Journals (Sweden)

    J. Van Heerden


    Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

  20. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies. (United States)

    van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E


    Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

  1. Severe canine distemper outbreak in unvaccinated dogs in Mozambique

    Directory of Open Access Journals (Sweden)

    Julieta Zacarias


    Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

  2. Management of an Unusual Ectopic Eruption of Maxillary Canine. (United States)

    Aileni, Kaladhar Reddy; Rachala, Madhukar Reddy; Prathima, Chintakunta Reddy; Naveen, Pitalla Kumar; Soujanya, Donthula


    Transposition of teeth is a rare condition, with a prevalence of 0.3-0.4% in general population. They are more commonly observed in females, and may occur unilaterally/bilaterally with greater frequency of left side occurrence in unilateral transposition cases. A 17-year-old female patient reported with the chief complaint of unaesthetic smile. On clinical examination the patient was diagnosed with Angle's class I malocclusion with an ectopically erupted maxillary left canine labial to the left central incisor with retained deciduous canine. The treatment plan decided was to extract the retained deciduous canine, level and align the ectopic canine using an R-loop. The treatment for the patient was finished in 14 months and was retained using a fixed lingual retainer in the upper and lower arches.

  3. Molecular characterization of canine distemper vi- rus circulating in ...

    African Journals Online (AJOL)

    2OIE Collaborating Centre for Diseases at Animal and Human Interface, FAO Reference Centre for Rabies, Viale ... Asia-1 lineage canine distemper virus is circulating in outbreak. .... jected to cell culture on Vero cell lines for virus isolation.

  4. The Comparative Diagnostic Features of Canine and Human Lymphoma

    Directory of Open Access Journals (Sweden)

    Davis M. Seelig


    Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

  5. Death of a wild wolf from canine parvovirus enteritis (United States)

    Mech, L.D.; Kurtz, H.J.; Goyal, S.


    A 9-mo-old female wolf (Canis lupus) in the Superior National Forest of Minnesota (USA) died from a canine parvovirus (CPV) infection. This is the first direct evidence that this infection effects free-ranging wild wolves.

  6. Canine index – A tool for sex determination

    Directory of Open Access Journals (Sweden)

    Shankar M. Bakkannavar


    Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.

  7. The Comparative Diagnostic Features of Canine and Human Lymphoma. (United States)

    Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A


    The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

  8. Difficulties in estimating the human burden of canine rabies. (United States)

    Taylor, Louise H; Hampson, Katie; Fahrion, Anna; Abela-Ridder, Bernadette; Nel, Louis H


    Current passive surveillance data for canine rabies, particularly for the regions where the burden is highest, are inadequate for appropriate decision making on control efforts. Poor enforcement of existing legislation and poor implementation of international guidance reduce the effectiveness of surveillance systems, but another set of problems relates to the fact that canine rabies is an untreatable condition which affects very poor sectors of society. This results in an unknown, but potentially large proportion of rabies victims dying outside the health system, deaths that are unlikely to be recorded by surveillance systems based on health center records. This article critically evaluates the potential sources of information on the number of human deaths attributable to canine rabies, and how we might improve the estimates required to move towards the goal of global canine rabies elimination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  9. Dentigerous Cyst Associated with Ectopic Canine and a ...

    African Journals Online (AJOL)

    ankylosis, cystic or neoplastic lesion or trauma may be the local factors ... After clinical and radiographic examination, a provisional diagnosis of ... bone along with the impacted teeth (permanent ectopic canine ... [7] Panoramic radiograph and ...

  10. Emerging perspectives on hereditary glomerulopathies in canines

    Directory of Open Access Journals (Sweden)

    Littman MP


    Full Text Available Meryl P LittmanDepartment of Clinical Studies – Philadelphia, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA, USAAbstract: Familial glomerulopathies have been described in more than two dozen dog breeds. These canine spontaneous cases of glomerular disease are good models for their human counterparts. The dogs present clinically with protein-losing nephropathy and variable signs of hypertension, thromboembolic events, edema/effusions/nephrotic syndrome, or eventually with signs of renal disease such as anorexia, vomiting, weight loss, and/or polyuria/polydipsia. Laboratory changes include proteinuria, hypoalbuminemia, hypercholesterolemia, and eventually azotemia, hyperphosphatemia, anemia, and isosthenuria. Renal biopsies examined with transmission electron microscopy, immunofluorescence, and thin section light microscopy may show ultrastructural glomerular basement membrane abnormalities, glomerulosclerosis, amyloidosis, non-amyloid fibrillary deposition, or breed-associated predispositions for immune-complex glomerulonephritis. Genome-wide association studies and fine sequencing of candidate genes have led to the discovery of variant alleles associated with disease in some breeds; eg, 1 glomerular basement membrane ultrastructural abnormalities due to defective collagen type IV, caused by different premature stop codons in each of four breeds; ie, in COL4A5 in Samoyeds and Navasota mix breed dogs (X-linked, and in COL4A4 in English Cocker Spaniels and English Springer Spaniels (autosomal recessive; and 2 glomerulosclerosis-related podocytopathy with slit diaphragm protein anomalies of both nephrin and Neph3/filtrin due to non-synonymous single nucleotide polymorphisms in conserved regions of their encoding genes, NPHS1 and KIRREL2, in Soft Coated Wheaten Terriers and Airedale Terriers, with a complex mode of inheritance. Age at onset and progression to end-stage renal disease vary depending on the model. Genetic

  11. Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature

    Directory of Open Access Journals (Sweden)

    Gaurav Sharma


    Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.

  12. Genomic instability and telomere fusion of canine osteosarcoma cells.

    Directory of Open Access Journals (Sweden)

    Junko Maeda

    Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.

  13. Asymmetry in development (mineralisation of permanent mandibular canine roots

    Directory of Open Access Journals (Sweden)

    Burić Mirjana V.


    Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.

  14. Successful experimental challenge of dogs with canine parvovirus-2.


    Carman, S; Povey, C


    Withholding food from dogs for 24 hours prior to, and for 48 hours following oral challenge with a gut mucosal homogenate of canine parvovirus-2, was a successful means of reproducing gastroenteric signs of canine parvovirus-2 infection. Twenty-one of 24 dogs, which had previously received various vaccine preparations of mink enteritis virus or were unvaccinated, and which were starved at challenge, developed soft or liquid feces with large or without large clots of mucus. Altered feces were ...

  15. Orthodontic-surgical treatment of bilateral maxillary canine impaction




    A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle's Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth an...

  16. Bilateral Second Premolars Agenesia Together with a Unilateral Canine Radiculomegaly. (United States)

    Kemoli, Arthur Musakulu; Junior, Thomas Munyao


    Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.

  17. Bilateral second premolars agenesia together with a unilateral canine radiculomegaly

    Directory of Open Access Journals (Sweden)

    Arthur Musakulu Kemoli


    Full Text Available Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.

  18. Three-year serologic immunity against canine parvovirus type 2 and canine adenovirus type 2 in dogs vaccinated with a canine combination vaccine. (United States)

    Larson, L J; Schultz, R D


    A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.

  19. Consequences of crown shortening canine teeth in Greenland sled dogs

    DEFF Research Database (Denmark)

    Kortegaard, H E; Anthony Knudsen, T; Dahl, S


    OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...

  20. Current practices and research updates on diabetes mellitus in canine

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar


    Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.

  1. Chlamydia in canine or feline coronary arteriosclerotic lesions. (United States)

    Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas


    There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.

  2. Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma. (United States)

    von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H


    Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.

  3. Chlamydia in canine or feline coronary arteriosclerotic lesions

    Directory of Open Access Journals (Sweden)

    Grabarevic Zeljko


    Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.

  4. Eruption of the maxillary canines in relation to skeletal maturity. (United States)

    Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica


    Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.

  5. Canine distemper in endangered Ethiopian wolves. (United States)

    Gordon, Christopher H; Banyard, Ashley C; Hussein, Alo; Laurenson, M Karen; Malcolm, James R; Marino, Jorgelina; Regassa, Fekede; Stewart, Anne-Marie E; Fooks, Anthony R; Sillero-Zubiri, Claudio


    The Ethiopian wolf (Canis simensis) is the world's rarest canid; ≈500 wolves remain. The largest population is found within the Bale Mountains National Park (BMNP) in southeastern Ethiopia, where conservation efforts have demonstrated the negative effect of rabies virus on wolf populations. We describe previously unreported infections with canine distemper virus (CDV) among these wolves during 2005-2006 and 2010. Death rates ranged from 43% to 68% in affected subpopulations and were higher for subadult than adult wolves (83%-87% vs. 34%-39%). The 2010 CDV outbreak started 20 months after a rabies outbreak, before the population had fully recovered, and led to the eradication of several focal packs in BMNP's Web Valley. The combined effect of rabies and CDV increases the chance of pack extinction, exacerbating the typically slow recovery of wolf populations, and represents a key extinction threat to populations of this highly endangered carnivore.

  6. Canine vector-borne diseases in Brazil (United States)

    Dantas-Torres, Filipe


    Canine vector-borne diseases (CVBDs) are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi), bacteria (e.g., Anaplasma platys and Ehrlichia canis), and helminths (e.g., Dirofilaria immitis and Dipylidium caninum) that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance) of CVBDs in Brazil and discusses research gaps to be addressed in future studies. PMID:18691408

  7. Canine vector-borne diseases in Brazil

    Directory of Open Access Journals (Sweden)

    Dantas-Torres Filipe


    Full Text Available Abstract Canine vector-borne diseases (CVBDs are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi, bacteria (e.g., Anaplasma platys and Ehrlichia canis, and helminths (e.g., Dirofilaria immitis and Dipylidium caninum that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance of CVBDs in Brazil and discusses research gaps to be addressed in future studies.

  8. European Surveillance for Pantropic Canine Coronavirus (United States)

    Cordonnier, Nathalie; Demeter, Zoltan; Egberink, Herman; Elia, Gabriella; Grellet, Aurélien; Le Poder, Sophie; Mari, Viviana; Martella, Vito; Ntafis, Vasileios; von Reitzenstein, Marcela; Rottier, Peter J.; Rusvai, Miklos; Shields, Shelly; Xylouri, Eftychia; Xu, Zach; Buonavoglia, Canio


    Highly virulent pantropic canine coronavirus (CCoV) strains belonging to subtype IIa were recently identified in dogs. To assess the distribution of such strains in Europe, tissue samples were collected from 354 dogs that had died after displaying systemic disease in France (n = 92), Hungary (n = 75), Italy (n = 69), Greece (n = 87), The Netherlands (n = 27), Belgium (n = 4), and Bulgaria (n = 1). A total of 124 animals tested positive for CCoV, with 33 of them displaying the virus in extraintestinal tissues. Twenty-four CCoV strains (19.35% of the CCoV-positive dogs) detected in internal organs were characterized as subtype IIa and consequently assumed to be pantropic CCoVs. Sequence and phylogenetic analyses of the 5′ end of the spike protein gene showed that pantropic CCoV strains are closely related to each other, with the exception of two divergent French viruses that clustered with enteric strains. PMID:23100349

  9. Relationship between analytic values and canine obesity. (United States)

    Peña, C; Suárez, L; Bautista, I; Montoya, J A; Juste, M C


    The objective of this study was to assess the relationship between canine body condition and metabolic parameters like serum lipids, blood glucose and alanine aminotransferase (ALT) concentrations. We selected 127 dogs (42 males and 85 females) that were taken to our veterinary medicine service during routine visits. The mean age was 6.67 +/- 5.24 years. Body condition (BC) was measured by Laflamme scale and dogs were considered as obese when BC score was over 6. The following variables were collected: total cholesterol, high-density lipoprotein cholesterol, triglycerides, basal glucose and ALT. 66.1% of the dog cohort were obese. Total cholesterol and triglycerides were found to be higher (p obese dogs with respect to normal weight dogs. In conclusion, obesity in dogs is associated with higher serum lipid levels.

  10. Evaluation of the efficacy and duration of immunity of a canine combination vaccine against virulent parvovirus, infectious canine hepatitis virus, and distemper virus experimental challenges. (United States)

    Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald


    The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.

  11. Genetic diversity of canine olfactory receptors

    Directory of Open Access Journals (Sweden)

    Hitte Christophe


    Full Text Available Abstract Background Evolution has resulted in large repertoires of olfactory receptor (OR genes, forming the largest gene families in mammalian genomes. Knowledge of the genetic diversity of olfactory receptors is essential if we are to understand the differences in olfactory sensory capability between individuals. Canine breeds constitute an attractive model system for such investigations. Results We sequenced 109 OR genes considered representative of the whole OR canine repertoire, which consists of more than 800 genes, in a cohort of 48 dogs of six different breeds. SNP frequency showed the overall level of polymorphism to be high. However, the distribution of SNP was highly heterogeneous among OR genes. More than 50% of OR genes were found to harbour a large number of SNP, whereas the rest were devoid of SNP or only slightly polymorphic. Heterogeneity was also observed across breeds, with 25% of the SNP breed-specific. Linkage disequilibrium within OR genes and OR clusters suggested a gene conversion process, consistent with a mean level of polymorphism higher than that observed for introns and intergenic sequences. A large proportion (47% of SNP induced amino-acid changes and the Ka/Ks ratio calculated for all alleles with a complete ORF indicated a low selective constraint with respect to the high level of redundancy of the olfactory combinatory code and an ongoing pseudogenisation process, which affects dog breeds differently. Conclusion Our demonstration of a high overall level of polymorphism, likely to modify the ligand-binding capacity of receptors distributed differently within the six breeds tested, is the first step towards understanding why Labrador Retrievers and German Shepherd Dogs have a much greater potential for use as sniffer dogs than Pekingese dogs or Greyhounds. Furthermore, the heterogeneity in OR polymorphism observed raises questions as to why, in a context in which most OR genes are highly polymorphic, a subset of

  12. Osteocalcin and Osteonectin Expression in Canine Osteosarcoma. (United States)

    Wehrle-Martinez, A S; Dittmer, K E; Aberdein, D; Thompson, K G


    Osteosarcoma (OSA) is a malignant heterogeneous primary bone tumor responsible for up to 90% of all primary bone tumors in dogs. In this study, osteocalcin (OC) and osteonectin (ON) immunoreactivity was evaluated in 23 canine OSAs, 4 chondrosarcomas, 4 fibrosarcomas, 2 hemangiosarcomas, and 4 histiocytic sarcomas. The effects of three different decalcification agents (ethylenediaminetetraetic acid [EDTA], formic acid and hydrochloric acid [HCl]) on the immunoreactivity for OC and ON was also assessed. Immunoreactivity to OC was present in 19/23 (83%) cases of OSA and all cases of chondrosarcoma. In three OSAs the extracellular matrix showed immunoreactivity to OC. None of the fibrosarcomas, histiocytic sarcomas or hemangiosarcomas showed immunoreactivity to OC. The sensitivity and specificity for OC in canine OSA in this study was 83% and 71% respectively. For ON, 100% of both OSAs (23/23) and non-OSAs (14/14) showed cytoplasmic immunoreactivity to this antibody, giving a sensitivity of 100% but a complete lack of specificity. There were no significant differences in immunoreactivity for OC and ON between the different decalcification agents used. In conclusion, OC showed high sensitivity for identifying OSA but it failed to distinguish between OSA and chondrosarcoma, and the osteoid produced by neoplastic cells in most cases did not show immunoreactivity to OC. These factors may limit the practical utility of OC in the diagnosis of OSA in dogs when chondrosarcoma is a differential diagnosis. ON showed no specificity in detecting OSA and has little practical application for the diagnosis of OSA in dogs. © The Author(s) 2016.

  13. Nuclear Glycogen Inclusions in Canine Parietal Cells. (United States)

    Silvestri, S; Lepri, E; Dall'Aglio, C; Marchesi, M C; Vitellozzi, G


    Nuclear glycogen inclusions occur infrequently in pathologic conditions but also in normal human and animal tissues. Their function or significance is unclear. To the best of the authors' knowledge, no reports of nuclear glycogen inclusions in canine parietal cells exist. After initial observations of nuclear inclusions/pseudoinclusions during routine histopathology, the authors retrospectively examined samples of gastric mucosa from dogs presenting with gastrointestinal signs for the presence of intranuclear inclusions/pseudoinclusions and determined their composition using histologic and electron-microscopic methods. In 24 of 108 cases (22%), the authors observed various numbers of intranuclear inclusions/pseudoinclusions within scattered parietal cells. Nuclei were characterized by marked karyomegaly and chromatin margination around a central optically empty or slightly eosinophilic area. The intranuclear inclusions/pseudoinclusions stained positive with periodic acid-Schiff (PAS) and were diastase sensitive, consistent with glycogen. Several PAS-positive/diastase-sensitive sections were further examined by transmission electron microscopy, also using periodic acid-thiocarbohydrazide-silver proteinate (PA-TCH-SP) staining to identify polysaccharides. Ultrastructurally, the nuclear inclusions were composed of electron-dense particles that were not membrane bound, without evidence of nuclear membrane invaginations or cytoplasmic organelles in the nuclei, and positive staining with PA-TCH-SP, confirming a glycogen composition. No cytoplasmic glycogen deposits were observed, suggesting that the intranuclear glycogen inclusions were probably synthesized in loco. Nuclear glycogen inclusions were not associated with gastritis or colonization by Helicobacter-like organisms ( P > .05). Our findings suggest that nuclear glycogen inclusions in canine parietal cells could be an incidental finding. Nevertheless, since nuclear glycogen is present in several pathologic

  14. Development of a Vaccine Incorporating Killed Virus of Canine Origin for the Prevention of Canine Parvovirus Infection


    Povey, C.


    A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...

  15. A compendium of canine normal tissue gene expression.

    Directory of Open Access Journals (Sweden)

    Joseph Briggs

    Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.

  16. IQGAP1 is an oncogenic target in canine melanoma.

    Directory of Open Access Journals (Sweden)

    Becky H Lee

    Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.

  17. Canine detection of free-ranging brown treesnakes on Guam (United States)

    Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.


    We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.

  18. The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells. (United States)

    Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki


    Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. A rare case of canine anomaly - a possible algorithm for treating it. (United States)

    Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore


    Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.

  20. Two interceptive approaches to palatally displaced canines: a prospective longitudinal study. (United States)

    Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano


    This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.

  1. 78 FR 29698 - Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA (United States)


    ...] Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA AGENCY: Animal and... Canine Lymphoma Vaccine, DNA. The environmental assessment, which is based on a risk analysis prepared to... biological product: Requester: Merial, Inc. Product: Canine Lymphoma Vaccine, DNA. Possible Field Test...

  2. The Effect of Using a Modified Dentoalveolar Distractor on Canine Angulation following Rapid Canine Retraction: A Split-mouth Design Randomized Controlled Trial. (United States)

    Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y


    New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.

  3. Purification and partial characterization of canine S100A12. (United States)

    Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M


    Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the

  4. Citizen science: a new direction in canine behavior research. (United States)

    Hecht, Julie; Spicer Rice, Eleanor


    Researchers increasingly rely on members of the public to contribute to scientific projects-from collecting or identifying, to analyzing and disseminating data. The "citizen science" model proves useful to many thematically distinctive fields, like ornithology, astronomy, and phenology. The recent formalization of citizen science projects addresses technical issues related to volunteer participation--like data quality--so that citizen scientists can make longstanding, meaningful contributions to scientific projects. Since the late 1990s, canine science research has relied with greater frequency on the participation of the general public, particularly dog owners. These researchers do not typically consider the methods and technical issues that those conducting citizen science projects embrace and continue to investigate. As more canine science studies rely on public input, an in-depth knowledge of the benefits and challenges of citizen science can help produce relevant, high-quality data while increasing the general public's understanding of canine behavior and cognition as well as the scientific process. We examine the benefits and challenges of current citizen science models in an effort to enhance canine citizen science project preparation, execution, and dissemination. This article is part of a Special Issue entitled: Canine Behavior. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Alkaline phosphatase activity in gingival crevicular fluid during canine retraction. (United States)

    Batra, P; Kharbanda, Op; Duggal, R; Singh, N; Parkash, H


    The aim of the study was to investigate alkaline phosphatase activity in the gingival crevicular fluid (GCF) during orthodontic tooth movement in humans. Postgraduate orthodontic clinic. Ten female patients requiring all first premolar extractions were selected and treated with standard edgewise mechanotherapy. Canine retraction was done using 100 g sentalloy springs. Maxillary canine on one side acted as experimental site while the contralateral canine acted as control. Gingival crevicular fluid was collected from mesial and distal of canines before initiation of canine retraction (baseline), immediately after initiation of retraction, and on 1st, 7th, 14th and 21st day and the alkaline phosphatase activity was estimated. The results show significant (p < 0.05) changes in alkaline phosphatase activity on the 7th, 14th and 21st day on both mesial and distal aspects of the compared experimental and control sides. The peak in enzyme activity occurred on the 14th day of initiation of retraction followed by a significant fall in activity especially on the mesial aspect. The study showed that alkaline phosphatase activity could be successfully estimated in the GCF using calorimetric estimation assay kits. The enzyme activity showed variation according to the amount of tooth movement.

  6. Influence of feeding on serum canine pancreatic lipase immunoreactivity concentrations

    Directory of Open Access Journals (Sweden)

    Steiner JM


    Full Text Available Jörg M Steiner, Craig G Ruaux, David A Williams Gastrointestinal Laboratory, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, USA Abstract: Measurement of serum concentration of pancreatic lipase immunoreactivity (PLI has been shown to be highly specific for exocrine pancreatic function and sensitive for the diagnosis of canine pancreatitis. Currently, it is recommended that food be withheld for at least 12 hours before collecting a blood sample for analysis from dogs. However, it is unknown whether feeding has any influence on serum canine PLI concentration. Thus, the goal of this study was to evaluate the influence of feeding on serum canine PLI concentrations in healthy dogs. Food was withheld from eight healthy adult Beagle dogs for at least 17 hours and a baseline serum sample (0 minutes was collected. Dogs were fed and serum samples were collected at 15, 30, 45, 60, 75, 90, 105, 150, 180, 210, 240, 300, 360, 420, and 480 minutes. There was no significant difference in serum canine PLI concentrations at any time after feeding (P=0.131. We conclude that feeding has no significant influence on serum canine PLI concentrations. Keywords: dog, pancreatic function, pancreatitis, biomarker, diagnostic test

  7. Detection of canine pneumovirus in dogs with canine infectious respiratory disease. (United States)

    Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe


    Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.

  8. Soluble Form of Canine Transferrin Receptor Inhibits Canine Parvovirus Infection In Vitro and In Vivo (United States)

    Wen, Jiexia; Pan, Sumin; Liang, Shuang; Zhong, Zhenyu; He, Ying; Lin, Hongyu; Li, Wenyan; Wang, Liyue; Li, Xiujin; Zhong, Fei


    Canine parvovirus (CPV) disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR) was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR)) possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo. PMID:24089666

  9. Soluble Form of Canine Transferrin Receptor Inhibits Canine Parvovirus Infection In Vitro and In Vivo

    Directory of Open Access Journals (Sweden)

    Jiexia Wen


    Full Text Available Canine parvovirus (CPV disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo.

  10. Effects of the canine rattlesnake vaccine in moderate to severe cases of canine crotalid envenomation

    Directory of Open Access Journals (Sweden)

    Leonard MJ


    Full Text Available McGee J Leonard,1 Catherine Bresee,2 Andrew Cruikshank1 1Animal Specialty and Emergency Center, Los Angeles, CA, USA; 2The Biostatistics and Bioinformatics Research Center, Cedars-Sinai Medical Center, Los Angeles, CA, USA Abstract: This is a retrospective multicenter study (2006–2012 examining a population of dogs with moderate to severe crotalid envenomation for protective effects of the canine rattlesnake vaccine. Five nonacademic emergency and referral veterinary hospitals in Southern California were involved in the study and contributed records regarding a total of 82 client-owned dogs that were treated for naturally occurring rattlesnake envenomation. All dogs received antivenin (Crotalidae polyvalent, with dosages ranging from one to three vials (mean: 1.3±0.6. Fourteen dogs (17% had a history of prior vaccination against crotalid venom. In univariate logistic regression modeling, cases with lower body weight (P=0.0001 or higher snakebite severity scores (P<0.0001 were associated with greater morbidity. No statistically significant difference in morbidity or mortality between vaccinated and unvaccinated dogs was found. The findings of this study did not identify a significantly protective effect of previous vaccination in the cases of moderate to severe rattlesnake envenomation that require treatment with antivenin. Keywords: rattlesnake envenomation, vaccine, antivenin, canine

  11. Molecular epidemiology of canine parvovirus in Morocco. (United States)

    Amrani, Nadia; Desario, Costantina; Kadiri, Ahlam; Cavalli, Alessandra; Berrada, Jaouad; Zro, Khalil; Sebbar, Ghizlane; Colaianni, Maria Loredana; Parisi, Antonio; Elia, Gabriella; Buonavoglia, Canio; Malik, Jamal; Decaro, Nicola


    Since it first emergence in the mid-1970's, canine parvovirus 2 (CPV-2) has evolved giving rise to new antigenic variants termed CPV-2a, CPV-2b and CPV-2c, which have completely replaced the original strain and had been variously distributed worldwide. In Africa limited data are available on epidemiological prevalence of these new types. Hence, the aim of the present study was to determine circulating variants in Morocco. Through TaqMan-based real-time PCR assay, 91 samples, collected from symptomatic dogs originating from various cities between 2011 and 2015, were diagnosed. Positive specimens were characterised by means of minor groove binder (MGB) probe PCR. The results showed that all samples but one (98.9%) were CPV positive, of which 1 (1.1%) was characterised as CPV-2a, 43 (47.7%) as CPV-2b and 39 (43.3%) as CPV-2c. Interestingly, a co-infection with CPV-2b and CPV-2c was detected in 4 (4.4%) samples and 3 (3.3%) samples were not characterised. Sequencing of the full VP2 gene revealed these 3 uncharacterised strains as CPV-2c, displaying a change G4068A responsible for the replacement of aspartic acid with asparagine at residue 427, impacting the MGB probe binding. In this work we provide a better understanding of the current status of prevailing CPV strains in northern Africa. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Canine oral cavity neoplasias - Brief review

    Directory of Open Access Journals (Sweden)

    João Filipe Requicha


    Full Text Available ABSTRACT. Requicha J.F., Pires M. dos A., Albuquerque C.M. & Viegas C.A. [Canine oral cavity neoplasias - Brief review.] Neoplasias da cavidade oral do cão - Breve revisão. Revista Brasileira de Medicina Veterinária, 37(1:41-46, 2015. Faculdade de Medicina Veterinária, Universidade Lusófona de Humanidades e Tecnologias, Campo Grande, 1749-024 Lisboa, Portugal e Department of Veterinary Sciences, School of Agriculture and Veterinary Sciences, University of Trás-os-Montes e Alto Douro, P.O. Box 1013, 5001-801 Vila Real, Portugal. E-mail: Oral proliferative lesions are relatively common in domestic carnivores but, fortunately, a lot of these lesions are benign. The oral cavity is place of 6% of all tumours in dogs, being the sixth most important localization of neoplasias in this specie. The non-odontogenic tumors arise from structures of the oral cavity, except from dental tissue, and they are mostly malignant. Odontogenic tumors are those originated from the dental structures. In the case of tumors of non-odontogenic, will be described the oral papillomatosis, the melanoma, the squamous cell carcinoma, and the fibrosarcoma. Among the odontogenic tumors, the focus will be on the epulides, ameloblastoma, odontoma and dentigerous cysts.

  13. Radiologic study of the canine urethra

    International Nuclear Information System (INIS)

    Poogird, W.; Wood, A.K.W.


    The structure and function of the canine urethra were studied during retrograde and voiding urethrography in 9 male and 8 female dogs. The lumen of the prostatic portion of the urethra was variable in diameter. During retrograde urethrography, the lumen was narrow with streaks of contrast medium outlining mucosal folds, but during voiding, it was dilated and a spindle-shaped seminal hillock was detected. Retrograde urethrography revealed other regions of the urethra of males and females had a smooth radiographic outline. During voiding urethrography, characteristic identical urethral contractions were observed in the caudal portion of the pelvic urethra (male) and in the caudal half of the urethra (female). Contractions were progressive, occurred where striated muscle was present in the urethral wall, and resulted in an intermittent flow of urine from the urethra. In the male, contractions had a rate of 2.02 +/- 0.23 contraction/s and 1.65 +/- 0.53 in the females. Contractions may have a role in the controlled voiding of small volumes of urine necessary for the repeated marking of territory, in the passage of the ejaculate along the male urethra during copulation, and in the clearance of any residual urine from the urethra at the completion of micturition

  14. Nodular Epiescleritis Granulomatous Canine. Case Report

    Directory of Open Access Journals (Sweden)

    Camilo Guarín Patarroyo


    Full Text Available Granulomatous epiescleritis nodular disease in canines is a very unusual presentation that affects or external fibrous tunic of the eyeball and conjunctiva, which was an increase similar to a unilateral or bilateral tumor. Suspected immune-mediated disease due to lack of identification of an etiologic agent and the response to treatment with immunosuppressive drugs (Couto, 1992. The ideal therapy is the application of steroids via intralesional, topical or systemic, or other immunosuppressants such as cyclosporine and azathioprine; it is still advisable to apply antibiotic is the ideal combination of tetracycline and neomycin (Gilger & Whitley, 1999. The diagnostic method of episcleritis is made by histopathology, which is evident in changes similar to chronic granulomatous inflammation. Are claiming a racial bias in Alsatian, Shepherd Collie Shetland Shepherd, Coker Spaniel, Rottweiler and Labrador Retriever (Gough & Thomas, 2004. The following case is a report of a nodular epiescleritis affecting the cornea, sclera, and the corneoscleral limbus, which describes the diagnosis, signology and treatment.

  15. Phenotypic characterization of canine Malassezia spp., isolates

    Directory of Open Access Journals (Sweden)

    Angélica Hurtado-Suárez


    Full Text Available Objective. To characterize and identify yeasts of the genus Malassezia by phenotypic features. Materials and methods. First, the macroscopic and microscopic morphological characteristics were described. In addition we performed biochemical and physiological assays as Tweens and Cremophor, including more. Results. Our results evidenced of 105 isolates obtained from dogs diagnosed with external otitis, it was possible to identify two distinct species from 46 isolates within the Malassezia genus: 36.19% (n=38 were identified as M. pachydermatis and 7.62% (n=8 as M. furfur. According to phenotypic patterns the remaining 56.19% (n=59 were reported as Malassezia spp., possibly corresponding to M. furfur and/or M. pachydermatis. Conclusions. Results emphasize the necessity to characterize according to species. It is not feasible to define Malassezia by species based on morphological, biochemical, and physiological findings. Therefore, molecular genotyping should be performed to identify markers allowing a more precise isolate identification. This would broaden our epidemiological knowledge regarding different species involved in canine otitis pathologies.

  16. Secretory pattern of canine growth hormone

    International Nuclear Information System (INIS)

    French, M.B.; Vaitkus, P.; Cukerman, E.; Sirek, A.; Sirek, O.V.


    The aim of this paper was to define the secretory pattern of growth hormone (GH) under basal conditions in fasted, conscious, male dogs accustomed to handling. Blood samples were withdrawn from a cephalic vein at 15-min intervals. In this way, any ultradian rhythms, if present, could be detected within the frequency range of 0.042-2 cycles/h. In addition, samples were drawn at either 1- or 2.5-min intervals for 2.5 or 5 h to determine whether frequency components greater than 2 cycles/h were present. GH was measured by radioimmunoassay and the raw data were submitted to time series analysis employing power spectral estimation by means of fast Fourier transformation techniques. Peak plasma levels were up to 12 times higher than the baseline concentration of ∼ 1 ng/ml. Spectral analysis revealed an endogenous frequency of 0.22 cycles/h, i.e., a periodicity of 4.5 h/cycle. The results indicate that under basal conditions the secretory bursts of canine GH are limited to one peak every 4.5 h

  17. Canine sporotrichosis: report of 15 advanced cases

    Directory of Open Access Journals (Sweden)

    Mariana B. Mascarenhas

    Full Text Available ABSTRACT: Sporotrichosis is a chronic, granulomatous and usually lymphocutaneous infection of animals and humans, caused by a dimorphic fungus, Sporothrix schenckii complex. The disease in dogs is considered rare, however, in the last years a crescent registration of cases was observed in Brazil, especially in the city of Rio de Janeiro. Fifteen dogs with ulcerated cutaneous lesions were seen at the Dermatology Service in the Small Animal’s Hospital at Universidade Federal Rural do Rio de Janeiro, between January 2014 and October 2015. Most lesions were located on the head, mainly the nose. Lesions were even seen on the chest, disseminated on the body and on the limbs. Three dogs (20% exhibited the cutaneous-lymphatic form, with lesions initially on the distal aspect of one leg and ascending via lymphatics up the leg to the trunk and head. It was not ruled out the disseminated form in at least 3 dogs (20%. They had consistent signs of generalized or disseminated disease exhibiting respiratory symptoms (nasal discharge, sneezing, stertorous breathing, anorexia and weight loss. Draining tracts and cellulitis were very common. Some had large areas of skin necrosis with exposure of muscle and bone. Definitive diagnosis was obtained by cytological examination of exudates, histological examination, and/or isolation of S. schenckii complex by fungal culture. Because of the severity of the lesions that mimic other disorders like neoplasms or autoimmune skin diseases, and due to the difficulties of getting an accurate diagnosis, this study describes 15 advanced cases of canine sporotrichosis.

  18. Countercurrent exchange of water in canine jejunum

    International Nuclear Information System (INIS)

    Ryu, K.H.; Grim, E.


    The possibility of countercurrent exchange of water molecules in canine intestinal villi has been examined. Tritium-labeled water ( 3 H 2 O) molecules were introduced either into the fluid lavaging the intestinal lumen or into the arterial blood supply for varying periods of time. Quickly frozen samples of intestinal tissue were sectioned such that isotopic concentrations at the villus tip, midvillus, villus base, and underlying submucosa and muscle could be determined. The villus concentration gradients observed were consistent with the existence of a countercurrent exchange but could also be explained by alternative arrangements. More convincing evidence of a countercurrent was obtained from experiments in which [ 14 C]inulin was introduced simultaneously with 3 H 2 O into the intestinal artery. The villus tip-to-base concentration ratio for 3 H 2 O was less than one while the ratio for inulin was greater than one, thus vitiating the alternative explanations and leading to the conclusion that the labeled water molecules must have undergone a countercurrent exchange

  19. Cryopreservation of canine ovarian and testicular fibroblasts. (United States)

    Yu, Il-Jeoung; Leibo, S P; Songsasen, Nucharin; Dresser, Betsy L; Kim, In-Shik


    To derive a practical procedure to store canine somatic cells, fibroblasts isolated from testicular or ovarian tissues were cryopreserved in 1.2 M ethylene glycol or in 1.2 M dimethylsulfoxide prepared in Dulbecco's Modified Eagle Medium as cryoprotectants, and were frozen either in plastic straws or vials. Thawed cells were cultured for 24 hr at 38.5 degree C in a humidified atmosphere of 5 percent CO2 95 percent air, and then their membrane integrity was assayed with a double fluorescent stain, Fertilight. In addition, frozen-thawed fibroblasts were cultured for 4 days, and then their functional survival was measured after staining small colonies with trypan blue. After freezing and thawing, membrane integrity of testicular fibroblasts was 55-70 percent and functional survival ranged from 20-40 percent. With frozen-thawed ovarian cells, the average membrane integrity was 55-75 percent and the average functional survival was 35-40 percent. When frozen in ethylene glycol, functional survival of ovarian fibroblasts was significantly higher than that of testicular cells (P less than 0.05). These methods should prove useful to preserve cells collected from canids in the wild.


    Directory of Open Access Journals (Sweden)

    John Henry Rossmeisl


    Full Text Available In humans, high-grade gliomas may infiltrate across the corpus callosum resulting in bihemispheric lesions that may have symmetrical, winged-like appearances. This particular tumor manifestation has been coined a ‘butterfly’ glioma (BG. While canine and human gliomas share many neuroradiological and pathological features, the BG morphology has not been previously reported in dogs. Here we describe the magnetic resonance imaging (MRI characteristics of BG in three dogs, and review the potential differential diagnoses based on neuroimaging findings. All dogs presented with generalized seizures and interictal neurological deficits referable to multifocal or diffuse forebrain disease. MRI examinations revealed asymmetrical (2/3 or symmetrical (1/3, bihemispheric intra-axial mass lesions that predominantly affected the frontoparietal lobes and associated with extensive perilesional edema, and involvement of the corpus callosum. The masses displayed heterogeneous T1, T2, and FLAIR signal intensities, variable contrast enhancement (2/3, and mass effect. All tumors demonstrated classical histopathological features of glioblastoma (GBM including glial cell pseudopalisading, serpentine necrosis, microvascular proliferation, as well as invasion of the corpus callosum by neoplastic astrocytes. Although rare, GBM should be considered a differential diagnosis in dogs with MRI evidence of asymmetric or symmetric bilateral, intra-axial cerebral mass lesions with signal characteristics compatible with glioma.

  1. Genotyping of Canine parvovirus in western Mexico. (United States)

    Pedroza-Roldán, César; Páez-Magallan, Varinia; Charles-Niño, Claudia; Elizondo-Quiroga, Darwin; De Cervantes-Mireles, Raúl Leonel; López-Amezcua, Mario Alberto


    Canine parvovirus (CPV) is one of the most common infectious agents related to high morbidity rates in dogs. In addition, the virus is associated with severe gastroenteritis, diarrhea, and vomiting, resulting in high death rates, especially in puppies and nonvaccinated dogs. To date, there are 3 variants of the virus (CPV-2a, CPV-2b, and CPV-2c) circulating worldwide. In Mexico, reports describing the viral variants circulating in dog populations are lacking. In response to this deficiency, a total of 41 fecal samples of suspected dogs were collected from October 2013 through April 2014 in the Veterinary Hospital of the University of Guadalajara in western Mexico. From these, 24 samples resulted positive by polymerase chain reaction, and the viral variant was determined by restriction fragment length polymorphism. Five positive diagnosed samples were selected for partial sequencing of the vp2 gene and codon analysis. The results demonstrated that the current dominant viral variant in Mexico is CPV-2c. The current study describes the genotyping of CPV strains, providing valuable evidence of the dominant frequency of this virus in a dog population from western Mexico. © 2014 The Author(s).

  2. GdNCT of spontaneous canine melanoma

    International Nuclear Information System (INIS)

    Mitin, V.N.; Kulakov, V.N.; Khokhlov, V.F.


    The effectiveness of GdNCT has been studied in dogs with spontaneous melanoma of the mucousmembrane of the oral cavity patients on the NCT base at the IRT MEPhI reactor. The control group with melanomas was treated with neutrons. Fourteen canine patients were selected in the Clinic of Experimental Therapy affiliated with the RCRC RAMS. The calculation of doses has shown that the total dose of energy release depending on Gd concentration in the target can be several times higher than the dose produced by the reactor neutron beam. The calculations were carried out using the diffusion pharmacokinetic model. The gadolinium drug dipentast was administered intratumorally immediately prior to irradiation. The tumor size was estimated by measuring it in three projections. The tumor was irradiated for 60-90 minutes with a thermal neutron flux of 0.7x10 9 n/cm 2 s. The dose on tumor was 80-120 Gy, on surrounding tissues - 12-15 Gy. The treatment plan included immunotherapy with Roncoleikin in a dose of (15-10)x10 3 IE/kg. The results of GdNCT are still under observation. The results conform to those obtained by us earlier in cell cultures and inoculated experimental tumors. GdNCT is also effective in combination with immunotherapy. (author)

  3. [Diagnostic tools for canine parvovirus infection]. (United States)

    Proksch, A L; Hartmann, K


    Canine parvovirus (CPV) infection is one of the most important and common infectious diseases in dogs, in particular affecting young puppies when maternal antibodies have waned and vaccine-induced antibodies have not yet developed. The mortality rate remains high. Therefore, a rapid and safe diagnostic tool is essential to diagnose the disease to 1) provide intensive care treatment and 2) to identify virus-shedding animals and thus prevent virus spread. Whilst the detection of antibodies against CPV is considered unsuitable to diagnose the disease, there are several different methods to directly detect complete virus, virus antigen or DNA. Additionally, to test in commercial laboratories, rapid in-house tests based on ELISA are available worldwide. The specificity of the ELISA rapid in-house tests is reported to be excellent. However, results on sensitivity vary and high numbers of false-negative results are commonly reported, which potentially leads to misdiagnosis. Polymerase chain reaction (PCR) is a very sensitive and specific diagnostic tool. It also provides the opportunity to differentiate vaccine strains from natural infection when sequencing is performed after PCR.

  4. Canine Oral Eosinophilic Granuloma Treated with Electrochemotherapy

    Directory of Open Access Journals (Sweden)

    Matías Nicolás Tellado


    Full Text Available A case of a canine oral eosinophilic granuloma in a 14-year-old female crossbred is described. The dog was presented with a history of ptyalism, halitosis, local pain, decreased appetite, and blood staining noted on food and water bowls. Clinical, hematologic, and biochemical examinations, abdominal ultrasonography, and 3-view chest radiographs were performed, and no metastases were found. Histopathologic examination of two 6 mm punch biopsies from the oral lesion revealed the presence of eosinophilic granulomatous lesions in the submucosa. After treatment with corticosteroids and wide spectrum antibiotics no significant changes in clinical signs and lesion size were observed. Electrochemotherapy (ECT, a novel tumor treatment routinely used for cutaneous and subcutaneous tumors in human patients in the European Union since 2006, was used to treat the eosinophilic granuloma. The procedure was performed under general anesthesia, followed by intravenous administration of bleomycin. Six weeks after treatment a complete response with disappearance of the mass and improvement of clinical signs were observed.

  5. Investigation of nanodiamonds interactions in canine blood (United States)

    WÄ sowicz, Michał; Marek, Kulka; Cićkiewicz, Maciej; Cymerman, Magdalena


    The whole blood contains red cells, white cells, and platelets suspended in plasma. In the following study we investigated an impact of nanodiamond particles on blood elements over various periods of time.The material used in the study consisted of samples taken from ten healthy canines (Canis lupus f. domestica) of various age, different blood types and both sexes. The markings were conducted by adding to the blood unmodified diamonds (SND), modified O2 (SO2) suspended in 0,9% NaCl. The blood was put under an impact of two diamond concentrations: 20μl and 100μl. The amount of abnormal cells increased with time. The percentage of echinocytes as a result of interaction with nanodiamonds in various time periods for individual specimens was scarce. In the examined microscopic image a summary was made for 100 white blood cells. Following cells were included in said group: band neutrophils, segmented neutrophils, eosinophils, basophils, lymphocytes, monocytes, lymphocytes with granulates, stimulated lymphocytes, lymphocytes with vacuoles, metamielocytes and smudge cells. The impact of the three diamond types had no clinical importance on red blood cells. After the diamonds mixed with white blood cells, atypical cells came into being, in the range of agranulocytes in stimulated form or with granulates and/or vacuoles. It is supposed that as a result of longlasting exposure a stimulation and vacuolisation takes place, because of the function of the cells.

  6. Finite element analysis of rapid canine retraction through reducing resistance and distraction

    Directory of Open Access Journals (Sweden)

    Junjie XUE


    Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.

  7. Establishment of sexual dimorphism in north indian population by odontometric study of permanent maxillary canine teeth

    Directory of Open Access Journals (Sweden)

    Shalini Gupta


    Full Text Available Aim: To investigate whether sexual dimorphism can be established by odontometric study of permanent maxillary canine teeth as well as inter-canine width in north Indian population. Study Design: The study was carried out at department of oral and maxillofacial pathology, King George′s Medical University, Lucknow, India on students and patients reporting at OPD. Out of total 180 subjects examined 90 subjects were female and 90 were male. Impressions of the upper arch were made using alginate and casts poured in dental stone. The mesiodistal diameter (MD of the crown of permanent maxillary canine both on right and left sides and inter-canine width were measured. From these measurements, maxillary canine index was calculated. The percentage of sexual dimorphism (SD was assessed for all the parameters. Results: In the present study, the MD of maxillary canine for both right (P = 0.001 and left side (P = 0.005 was significantly higher among male subjects than females, Similar observation was found for inter-canine width too (P = 0.0001. However, the maxillary canine index for right and left was almost similar (P > 0.05 for both male and female subjects. The SD in right and left MDs of maxillary canine was 4.2% and 3.6% respectively. For, inter-canine width it was maximum (13.7%. However, SD in right and left canine index showed negative values (−2.1% and -0.9% respectively. Conclusion: There was SD in MD and inter-canine width of permanent maxillary canine teeth. SD was more on right permanent maxillary canine teeth than left permanent maxillary canine.

  8. MicroRNAs as tumour suppressors in canine and human melanoma cells and as a prognostic factor in canine melanomas. (United States)

    Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y


    Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.

  9. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    Directory of Open Access Journals (Sweden)

    Otávio Valério Carvalho


    Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.

  10. Severe canine distemper outbreak in unvaccinated dogs in Mozambique. (United States)

    Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G


    Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.

  11. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus (United States)

    Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo


    Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403

  12. Testosterone biotransformation by the isolated perfused canine pancreas

    International Nuclear Information System (INIS)

    Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G.


    There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis

  13. Feline and canine coronaviruses: common genetic and pathobiological features. (United States)

    Le Poder, Sophie


    A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP) and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV) will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

  14. Cellular endocytic compartment localization of expressed canine CD1 molecules

    DEFF Research Database (Denmark)

    Schjærff, Mette; Keller, Stefan M.; Affolter, Verena K.


    CD1 molecules are glycoproteins present primarily on dendritic cells (DCs), which recognize and presenta variety of foreign- and self-lipid antigens to T-cells. Humans have five different CD1 isoforms that sur-vey distinct cellular compartments allowing for recognition of a large repertoire...... onlya diminished GFP expression. In conclusion, canine CD1 transfectants show distinct localization patternsthat are similar to human CD1 proteins with the exception of the canine CD1d isoform, which most likelyis non-functional. These findings imply that canine CD1 localization overall resembles human...... CD1 traf-ficking patterns. This knowledge is important for the understanding of lipid antigen-receptor immunityin the dog....

  15. Orthodontic-surgical treatment of bilateral maxillary canine impaction

    Directory of Open Access Journals (Sweden)



    Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.

  16. PMab-38 Recognizes Canine Podoplanin of Squamous Cell Carcinomas. (United States)

    Kaneko, Mika K; Honma, Ryusuke; Ogasawara, Satoshi; Fujii, Yuki; Nakamura, Takuro; Saidoh, Noriko; Takagi, Michiaki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari


    Podoplanin, a type I transmembrane protein, is expressed in lymphatic endothelial cells. Although we previously developed an anticanine podoplanin monoclonal antibody (mAb), PMab-38, immunohistochemistry (IHC) showed that it did not react with canine lymphatic endothelial cells. Here, we determined whether PMab-38 recognizes canine podoplanin of squamous cell carcinomas (SCCs) and clarified its epitope. In IHC, PMab-38 reacted with 83% of SCCs (15/18 cases). Flow cytometry showed that the epitope of PMab-38 was different from that of the platelet aggregation-stimulating domain of the N-terminus, which was detected by almost all antipodoplanin mAbs such as D2-40 or NZ-1. PMab-38 is expected to be useful for investigating the function of podoplanin in canine tumors.

  17. Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features

    Directory of Open Access Journals (Sweden)

    Sophie Le Poder


    Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

  18. Testosterone biotransformation by the isolated perfused canine pancreas

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))


    There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.

  19. Management of impacted all canines with surgical exposure and alignment by orthodontic treatment

    Directory of Open Access Journals (Sweden)

    Radha Katiyar


    Full Text Available Canine impaction is a dental problem very often encountered in orthodontic practice. After the third molar, the canine is the most frequently impacted tooth. Bringing the impacted canine into a normal position is important for functional occlusion and the final esthetics of the orthodontic treatment. This article illustrates a peculiar case, in which all four permanent canines maintained their unerupted status at age of 16 years. All four impacted canines were surgically exposed, attachment bonded, traction given with K-9 spring and ideally positioned with fixed orthodontic mechanotherapy.

  20. FLT3 mutations in canine acute lymphocytic leukemia

    International Nuclear Information System (INIS)

    Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L


    FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias

  1. Canine distemper spillover in domestic dogs from urban wildlife. (United States)

    Kapil, Sanjay; Yeary, Teresa J


    Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.

  2. Comprehensive characterization of commercially available canine training aids. (United States)

    Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A


    Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine

  3. First detection of canine parvovirus type 2c in Brazil.


    Streck, André Felipe; Souza, Carine Kunzler; Gonçalves, K. R.; Zang, Luciana; Pinto, Luciane Dubina; Canal, Cláudio Wageck


    The presence of canine parvovirus type 2 (CPV-2), 2a and 2b has been described in Brazil, however, the type 2c had not been reported until now. In the current study, seven out of nine samples from dogs with diarrhea were characterized as CPV-2c, indicating that this virus is already circulating in the Brazilian canine population.No Brasil, a presença do parvovírus canino do tipo 2 (CPV-2), 2a e 2b já havia sido descrita, contudo, ainda não havia sido verificada a presença do tipo 2c. No prese...

  4. The effects of sulforaphane on canine osteosarcoma proliferation and invasion. (United States)

    Rizzo, V L; Levine, C B; Wakshlag, J J


    Recent evidence in in vitro and in vivo models suggests that sulforaphane (SFN), found in raw cruciferous vegetables, may have utility in chemoprevention, as an antineoplastic agent and as a free radical scavenger. The effects of SFN alone or with doxorubicin on cell viability were examined, as well as cell cycle kinetics, invasion capabilities and apoptosis in three canine osteosarcoma cell line (D17, OS 2.4 and HMPOS). Results showed that SFN could not induce cell death at potentially physiological concentrations (canine osteosarcoma. © 2016 John Wiley & Sons Ltd.

  5. Electroencephalography as a diagnostic technique for canine neurological diseases

    Directory of Open Access Journals (Sweden)

    Wrzosek Marcin


    Full Text Available Electroencephalography (EEG is a non-invasive examination method for the assessment of functional central nervous system (CNS disturbances. In human medicine it has a special importance as a diagnostic tool for epilepsy. Although many studies were done on the use of EEG for diagnostics of canine central nervous system disorders, the technique is still not applied routinely. The purpose of this paper was to review the use of the electroencephalography in canine neurological disorders of central nervous system diagnosis and assess the future perspectives of this technique in veterinary medicine.


    Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi


    Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.

  7. Identification of quantitative trait loci (QTL for canine hip dysplasia and canine elbow dysplasia in Bernese mountain dogs.

    Directory of Open Access Journals (Sweden)

    Sophia Pfahler

    Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.

  8. Brazilian canine hepatozoonosis Hepatozoonose canina brasileira

    Directory of Open Access Journals (Sweden)

    Lucia Helena O'Dwyer


    Full Text Available The genus Hepatozoon includes hundreds of species that infect birds, reptiles, amphibians and mammals, in all continents with tropical and subtropical climates. Two species have been described in domestic dogs: H. canis, reported in Europe, Asia, Africa, South America and the United States; and H. americanum, which so far has only been diagnosed in the United States. In Brazil, the only species found infecting dogs is H. canis. The objective of this review was to detail some aspects of canine hepatozoonosis, caused by H. canis, and the main points of its biology, transmission, pathogenicity, symptoms, epidemiology and diagnostic methods, with emphasis on research developed in Brazil.O gênero Hepatozoon compreende centenas de espécies que infectam aves, répteis, anfíbios e mamíferos, em todos os continentes de clima tropical e subtropical. No cão doméstico duas espécies são descritas, H. canis e H. americanum; a primeira presente na Europa, Ásia, África, América do Sul e nos Estados Unidos da América do Norte (EUA, e a segunda, diagnosticada até o momento somente nos EUA. No Brasil, a espécie que infecta o cão foi caracterizada como H. canis. Esta revisão objetiva detalhar alguns aspectos da hepatozoose canina, causada pelo H. canis e principais pontos de biologia, transmissão, patogenia e sintomas, epidemiologia e métodos de diagnóstico, enfatizando as pesquisas desenvolvidas no Brasil.

  9. Diode laser prostatectomy (VLAP): initial canine evaluation (United States)

    Kopchok, George E.; Verbin, Chris; Ayres, Bruce; Peng, Shi-Kaung; White, Rodney A.


    This study evaluated the acute and chronic effects of diode laser (960 nm) prostatectomy using a Prolase II fiber in a canine model (n equals 5). The laser fiber consists of a 1000 um quartz fiber which reflects a cone of laser energy, at 45 degree(s) to the axis of the fiber, into the prostatic urethra (Visual Laser Ablation of Prostate). Perineal access was used to guide a 15.5 Fr cystoscope to the level of the prostate. Under visual guidance and continual saline irrigation, 60 watts of laser power was delivered for 60 seconds at 3, 9, and 12 o'clock and 30 seconds at the 6 o'clock (posterior) positions for a total energy fluence of 12,600 J. One prostate received an additional 60 second exposure at 3 and 9 o'clock for a total fluence of 19,800 J. The prostates were evaluated at one day (n equals 1) and 8 weeks (n equals 4). The histopathology of laser effects at one day show areas of necrosis with loss of glandular structures and stromal edema. Surrounding this area was a zone of degenerative glandular structures extending up to 17.5 mm (cross sectional diameter). The histopathology of the 8 week laser treated animals demonstrated dilated prostatic urethras with maximum cross- sectional diameter of 23.4 mm (mean equals 18.5 +/- 3.9 mm). This study demonstrates the effectiveness of diode laser energy for prostatic tissue coagulation and eventual sloughing. The results also demonstrate the safety of diode laser energy, with similar tissue response as seen with Nd:YAG laser, for laser prostatectomy.

  10. Recent developments in Canine Cognitive Dysfunction Syndrome

    Directory of Open Access Journals (Sweden)

    Alejandro Seisdedos Benzal


    Full Text Available Canine Cognitive Dysfunction Syndrome (CCD is a neurodegenerative disease affecting aging dogs. CCD is an underdiagnosed disease that involves at least 14% of geriatric dogs, but apparently less than 2% of diseased dogs are diagnosed. There are several physiopathological similarities between Alzheimer disease (AD and CCD, developing amyloid-β deposits in brain parenchyma and blood vessels, brain atrophy and neuronal loss. The clinical signs lead to behavioural changes. They are unspecific and could appear as soon as seven years of age, but are more relevant in senior dogs. The abnormal behaviour could be classified following the acronym DISHA: Disorientation in the immediate environment; altered Interactions with humans and other animals; Sleep-wake cycle disturbances; House-soiling; and changes in Activity levels. There is no specific diagnostic test or biomarker to demonstrate the presence of CCD; therefore, it is often assessed by ruling out other diseases that may cause similar behavioural changes. Veterinarians have to be able to make an accurate account of veterinary history asking for abnormal behaviour that could be misreported by the owners. CCD is a neurodegenerative disorder that cannot be cured. It is possible to delay the progression of the clinical signs and improve the quality of life of patients, but like in AD, the progression of the illness will depend on the individual. There are three treatment pathways, which could be used in combination: drug therapy to improve cognition and reduce anxiety, antioxidant diet and nutraceutical supplements to reduce the progression of the illness, and finally, environmental enrichment to maintain brain activity. The aim of this review article is to contribute to the knowledge of the illness, presenting recent advances in the pathophysiology, diagnosis and treatment of the disease

  11. Myogenic potential of canine craniofacial satellite cells

    Directory of Open Access Journals (Sweden)

    Rita Maria Laura La Rovere


    Full Text Available The skeletal fibres have different embryological origin; the extraocular and jaw-closer muscles develop from prechordal mesoderm while the limb and trunk muscles from somites. These different origins characterise also the adult muscle stem cells, known as satellite cells (SCs and responsible for the fibre growth and regeneration. The physiological properties of presomitic SCs and their epigenetics are poorly studied despite their peculiar characteristics to preserve muscle integrity during chronic muscle degeneration. Here we isolated SCs from canine somitic (SDM: vastus lateralis, rectus abdominus, gluteus superficialis, biceps femoris, psoas and presomitic (PSDM: lateral rectus, temporalis and retractor bulbi muscles as myogenic progenitor cells from young and old animals. In addition, SDM and PSDM satellite cells were obtained also from Golden retrievers affected by muscular dystrophy (GRMD. We characterised the lifespan, the myogenic potential and functions and oxidative stress of both somitic and presomitic SCs with the aim to reveal differences with ageing and between healthy and dystrophic animals. The different proliferation rate was consistent with higher telomerase activity in PSDM-SCs compared to SDM-SCs, although restricted at early passages. SDM-SCs express early (Pax7, MyoD and late (MyHC, Myogenin myogenic markers differently from PSDM-SCs resulting in a more efficient and faster cell differentiation. Taken together our results showed that PSDM-SCs elicit a stronger stem cell phenotype compared to SDM ones. Finally, myomiR expression profile reveals a unique epigenetic signature in GRMD satellite cells and miR-206, highly expressed in dystrophic SCs, seems to play a critical role in muscle degeneration. Thus, miR-206 could represent a potential target for novel therapeutic approaches.

  12. Radiographic imaging of the canine intercondylar fossa

    International Nuclear Information System (INIS)

    Montgomery, R.D.; Fitch, R.B.; Hathcock, J.T.; LaPrade, R.F.; Wilson, M.E.; Garrett, P.D.


    The intercondylar fossa is believed to play an important role in the pathology of cranial cruciate ligament rupture and therefore has received considerable attention in the last decade. Accurate radiographic imaging of the intercondylar fossa requires that the central x-ray beam pass through the center of the intercondylar “tunnel”. The anatomy of the canine intercondylar fossa is similar to humans, however, the orientations of the intercondylar fossa's differ. Consequently, the positioning techniques described for humans are not appropriate for the dog. To pass through the center of the dog, intercondylar fossa, the central x-ray beam should be 12° (S.D. 1.7°) caudal from the femoral diaphysis in the sagittal plane and obliqued caudolateral to craniomedial 7° (S.D. 0.60°) (caudo78°proximo7° lateralcraniodistomedial oblique). Cross table positioning was used with the hip flexed and the radiograph cassette placed on the cranial surface of the stifle. However, superimposition of the tuber ischii and soft tissues caudal to the femur made 15° to 20° the best angle obtainable. There was not a significant difference (p = 0.17) in the notch width index between a 12° versus 20° angle of the central x-ray beam caudal to the femoral diaphysis, both with 7° of external rotation of the stifle. The notch width index of 0.252 obtained from radiographic measurements was not significantly different from measurements obtained grossly of 0.254 (n = 26; p = 0.69). Failure to oblique the central x-ray beam caused a significant (p = 0.0008) decrease in the apparent fossa width radiographically

  13. Molecular detection of canine parvovirus in flies (Diptera) at open and closed canine facilities in the eastern United States. (United States)

    Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan


    More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year

  14. Development of a Vaccine Incorporating Killed Virus of Canine Origin for the Prevention of Canine Parvovirus Infection (United States)

    Povey, C.


    A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted form was immunogenic in 20 of 20 vaccinated dogs. The double adjuvanted vaccine is selected as the one of choice on the basis of best and most persistent seriological response. PMID:7039811

  15. Rabies, canine distemper, and canine parvovirus exposure in large carnivore communities from two Zambian ecosystems. (United States)

    Berentsen, Are R; Dunbar, Mike R; Becker, Matthew S; M'soka, Jassiel; Droge, Egil; Sakuya, Nicholas M; Matandiko, Wigganson; McRobb, Rachel; Hanlon, Cathleen A


    Disease transmission within and among wild and domestic carnivores can have significant impacts on populations, particularly for threatened and endangered species. We used serology to evaluate potential exposure to rabies virus, canine distemper virus (CDV), and canine parvovirus (CPV) for populations of African lions (Panthera leo), African wild dogs (Lycaon pictus), and spotted hyenas (Crocuta crocuta) in Zambia's South Luangwa National Park (SLNP) and Liuwa Plain National Park (LPNP) as well as community lands bordering these areas. In addition, domestic dogs in the study region were evaluated for exposure to CDV and rabies. We provide the first comprehensive disease exposure data for these species in these ecosystems. Twenty-one lions, 20 hyenas, 13 wild dogs, and 38 domestic dogs were sampled across both regions from 2009 to 2011. Laboratory results show 10.5% of domestic dogs, 5.0% of hyenas, and 7.7% of wild dogs sampled were positive for CDV exposure. All lions were negative. Exposure to CPV was 10.0% and 4.8% for hyenas and lions, respectively. All wild dogs were negative, and domestic dogs were not tested due to insufficient serum samples. All species sampled were negative for rabies virus neutralizing antibodies except lions. Forty percent of lions tested positive for rabies virus neutralizing antibodies. Because these lions appeared clinically healthy, this finding is consistent with seroconversion following exposure to rabies antigen. To our knowledge, this finding represents the first ever documentation of rabies virus neutralizing antibodies consistent with rabies exposure that did not lead to clinical disease in free-ranging African lions from this region. With ever-increasing human pressure on these ecosystems, understanding disease transmission dynamics is essential for proper management and conservation of these carnivore species.

  16. Canine distemper virus - a morbillivirus in search of new hosts?

    NARCIS (Netherlands)

    T.C. Harder (Timm); A.D.M.E. Osterhaus (Albert)


    textabstractCanine distemper morbillivirus (CDV) induces a multisystemic, often fatal disease in a wide and seemingly expanding host range among the Carnivora. Several genotypes of an otherwise monotypic virus species co-circulate in a geographically restricted pattern. Interspecies transmissions

  17. Canine distemper virus in Lake Baikal seals (Phoca sibirica).

    NARCIS (Netherlands)

    L.V. Mamaev; I.K.G. Visser (Ilona); S.I. Belikov; N.N. Denikina; T.C. Harder (Timm); L. Goatley; B. Rima; B. Edginton; A.D.M.E. Osterhaus (Albert); T. Barrett (Thomas)


    textabstractThe virus epizootic which resulted in significant mortality in Siberian seals (Phoca sibirica) in Lake Baikal during 1987/88 was caused by canine distemper virus. Sequence analysis of the virus glycoprotein genes revealed that it was most closely related to recent European field isolates

  18. Automation of gender determination in human canines using artificial intelligence

    Directory of Open Access Journals (Sweden)

    F. Fidya


    Full Text Available Background: Gender determination is an important aspect of the identification process. The tooth represents a part of the human body that indicates the nature of sexual dimorphism. Artificial intelligence enables computers to perform to the same standard the same tasks as those carried out by humans. Several methods of classification exist within an artificial intelligence approach to identifying sexual dimorphism in canines. Purpose: This study aimed to quantify the respective accuracy of the Naive Bayes, decision tree, and multi-layer perceptron (MLP methods in identifying sexual dimorphism in canines. Methods: A sample of results derived from 100 measurements of the diameter of mesiodistal, buccolingual, and diagonal upper and lower canine jaw models of both genders were entered into an application computer program that implements the algorithm (MLP. The analytical process was conducted by the program to obtain a classification model with testing being subsequently carried out in order to obtain 50 new measurement results, 25 each for males and females. A comparative analysis was conducted on the program-generated information. Results: The accuracy rate of the Naive Bayes method was 82%, while that of the decision tree and MLP amounted to 84%. The MLP method had an absolute error value lower than that of its decision tree counterpart. Conclusion: The use of artificial intelligence methods produced a highly accurate identification process relating to the gender determination of canine teeth. The most appropriate method was the MLP with an accuracy rate of 84%.

  19. Recent advances in canine leptospirosis: focus on vaccine development

    Directory of Open Access Journals (Sweden)

    Klaasen HLBM


    Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis

  20. Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia

    Directory of Open Access Journals (Sweden)

    Víctor Acero P


    Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.

  1. Canine Gouging: A Taboo Resurfacing in Migrant Urban Population. (United States)

    Noman, Anila Virani; Wong, Ferranti; Pawar, Ravikiran Ramakrishna


    Cosmopolitan cities have become a pool of migrants from different parts of the world, who carry their cultural beliefs and superstitions with them around the globe. Canine gouging is a kind of infant oral mutilation (IOM) which is widely practiced among rural population of Africa where the primary tooth bud of the deciduous canine is enucleated. The belief is that the life threatening illnesses in children like vomiting, diarrhoea, and fevers are caused by worms which infest on tooth buds. This case report is of a 15-year-old Somalian born boy, who presented at the dental institute with intermittent pain in his lower right permanent canine which was associated with a discharging intra oral buccal sinus. The tooth was endodontically treated and then restored with composite. General dental practitioners need to be vigilant when encountered with tooth presenting unusual morphology, unilateral missing tooth, and shift in the midline due to early loss of deciduous/permanent canines. Identification of any such dental mutilation practice will need further counselling of the individual and family members. It is the duty of every dental professional to educate and safeguard the oral and dental health of general public.

  2. Soft tissue artifact in canine kinematic gait analysis

    NARCIS (Netherlands)

    Schwencke, M.; Smolders, L.A.; Bergknut, N.; Gustas, P.; Meij, B.P.; Hazewinkel, H.A.W.


    Vet Surg. 2012 Oct;41(7):829-37. doi: 10.1111/j.1532-950X.2012.01021.x. Soft tissue artifact in canine kinematic gait analysis. Schwencke M, Smolders LA, Bergknut N, Gustås P, Meij BP, Hazewinkel HA. Source Department of Clinical Sciences of Companion Animals,, Faculty of Veterinary Medicine,

  3. In vitro activity of difloxacin against canine bacterial isolates

    NARCIS (Netherlands)

    Hoven, van den J.R.; Wagenaar, J.A.; Walker, R.D.


    The in vitro activity of difloxacin against canine bacterial isolates from clinical cases was studied in the United States and The Netherlands. Minimal inhibitory concentrations (MIC), the postantibiotic effect, the effect of pH on antimicrobial activity, and the bacterial killing rate tests were

  4. The Human-Canine Bond: Closer than Family Ties? (United States)

    Barker, Sandra B.; Barker, Randolph T.


    Used Family Life Space Diagram to compare relationship between human family members with the human-canine relationship. Subjects were 29 dog enthusiasts, 66 typical pet owners, and 27 elementary school students with dogs. Results suggest that individuals may perceive their relationship with their pet dog as being as close as their relationship…

  5. Maxillary canine teeth as supplement tool in sex determination ...

    African Journals Online (AJOL)

    Maxillary impressions for all subjects were taken in alginate impression material. Study models were prepared immediately in dental stone to prevent dimensional change. Apart from the inter-canine distance and the left mesio-distal crown width which exhibited statistically significant differences, other parameters as ...


    Directory of Open Access Journals (Sweden)

    P. Siva Parvathamma


    Full Text Available Twenty six cases were studied for analysis of uroliths surgically retrieved from canine of different age, sex, body weight, geographical location and nutritional status. The uroliths were quantitatively analyzed by atomic absorption spectrophotometric analysis (AAS, Flame photometry and calcium and phosphorus estimation. The struvite stones were found to be more predominant in number, than other type of uroliths.

  7. Aberrant hepatic lipid storage and metabolism in canine portosystemic shunts

    NARCIS (Netherlands)

    Van Den Bossche, Lindsay; Schoonenberg, Vivien A.C.; Burgener, Iwan A.; Penning, Louis C.; Schrall, Ingrid M.; Kruitwagen, Hedwig S.; Van Wolferen, Monique E.; Grinwis, Guy C.M.; Kummeling, Anne; Rothuizen, Jan; Van Velzen, Jeroen F.; Stathonikos, Nikolas; Molenaar, Martijn R.; Helms, Bernd J.; Brouwers, Jos F.H.M.; Spee, Bart; Van Steenbeek, Frank G.


    Non-alcoholic fatty liver disease (NAFLD) is a poorly understood multifactorial pandemic disorder. One of the hallmarks of NAFLD, hepatic steatosis, is a common feature in canine congenital portosystemic shunts. The aim of this study was to gain detailed insight into the pathogenesis of steatosis in

  8. Molecular characterisation of canine parvovirus strains circulating in ...

    African Journals Online (AJOL)



    Jul 19, 2010 ... Canine parvovirus (CPV) was first isolated at 1978 in the USA. Analysis of ... Japan, Australia, Italy and Africa although the proportions of CPV-2a ... T/A clone PCR product cloning Kit (Takara, DaLian, China). Sequencing was ...

  9. Prognosis in canine idiopathic immune-mediated haemolytic anaemia

    NARCIS (Netherlands)

    Piek, C.J.


    Canine idiopathic immune-mediated haemolytic anaemia (iIMHA) is one of the most frequently occurring immune-mediated diseases in dogs. A gel-based Coombs' test was shown to perform equally well as a classical Coombs' test. Since the gel-based Coombs' test can be commercially produced and is easy and


    Folitse, R D; Kodie, D O; Amemor, E; Dei, D; Tasiame, W; Burimuah, V; Emikpe, B O


    Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT ® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α 0.05 . We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection.

  11. Orthodontic traction of impacted canine using magnet: a case report


    Li, Larry CF; Wong, Ricky WK; King, Nigel M


    ABSTRACT: A 15 year and 1 month old Chinese female with palatally impacted upper left canine was successfully treated with an upper removable appliance with a magnet incorporated to provide orthodontic traction force. This case report indicates the possibility of using magnetic force as a safe, effective and comfortable way for orthodontic traction.

  12. Esthetics with prosthetics in case of maxillary canine transposition: A ...

    African Journals Online (AJOL)

    Esthetics with prosthetics in case of maxillary canine transposition: A clinical report. ... provides a helpful Frequently Asked Questions about PDFs. Alternatively, you can download the PDF file directly to your computer, from where it can be opened using a PDF reader. To download the PDF, click the Download link above.

  13. Compensatory canine angulation in angle Class II and III patients

    Directory of Open Access Journals (Sweden)

    Mauro Carlos Agner Busato


    Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.

  14. Expression and function of survivin in canine osteosarcoma. (United States)

    Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H


    Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.

  15. Clinical manifestations of canine distemper in Nigerian dogs ...

    African Journals Online (AJOL)

    Twenty dogs of local breeds found in Nigeria, experimentally infected with local isolate of canine distemper virus, manifested fever, conjunctivitis, photophobia salivation, anorexia, dermatitis, and diarrhoea. Apart from these clinical signs already described for the disease in other breeds of dogs,45% of the dogs showed ...

  16. Genetic variant of canine distemper virus from clinical cases in ...

    African Journals Online (AJOL)

    Canine distemper virus (CDV) is a highly contagious viral pathogen of worldwide distribution that can cause lethal disease in domestic dogs and other members of the family Canidae. Genetic diversity is found among reference strains and isolates of CDV, mainly in the haemagglutinin (H) protein, and this may be ...

  17. Canine distemper associated with generalized oedema in Nigerian ...

    African Journals Online (AJOL)

    Twenty puppies of Nigeria local breed of dogs which were experimentally infected with a local isolate of canine distemper virus manifested clinical signs known for the disease including anorexia, ocular discharges, postular dermatitis on the lower abdomen and diarrhoea. In addition, they also manifested generalized ...

  18. Risk Factors Associated With Canine Parvovirus Enteritis In Vom ...

    African Journals Online (AJOL)

    Risk Factors Associated With Canine Parvovirus Enteritis In Vom And Environs. J G Mohammed, AO Ogbe, NJ Zwandor, JU Umoh. Abstract. No Abstract. Animal Research International Vol. 2 (3) 2005 pp. 366-368. Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT.

  19. Diagnosis of canine rabies by the direct fluorescent antibody ...

    African Journals Online (AJOL)

    Diagnosis of canine rabies by the direct fluorescent antibody technique in Plateau State, Nigeria. DO Ehizibolo, EA Ogunsan, MJ Muhammad, CI Nwosuh, S Olaleye, OOC Chuckwu, MY Sugun, NM Sati, NE Waziri, OK Egwu, J Kamani, CA Meseko, SE Idachaba, GI Dogo ...

  20. Esthetics with prosthetics in case of maxillary canine transposition: A ...

    African Journals Online (AJOL)

    These are mainly genetically governed and are treated orthodontically if complete segment of tooth is present; in case of missing teeth, participation of cosmetic dentist is must. The present case report describes a situation where left canine to lateral incisor complete transposition was present along with a missing left central ...

  1. 9 CFR 113.316 - Canine Parainfluenza Vaccine. (United States)


    ... furnished or approved by Animal and Plant Health Inspection Service. (4) The rectal temperature of each dog...: (1) Twenty-five canine parainfluenza susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Nasal swabs shall be collected from each dog on the day the first dose of vaccine is...


    Folitse, R. D; Kodie, D.O; Amemor, E.; Dei, D.; Tasiame, W.; Burimuah, V.; Emikpe, B.O


    Background: Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Materials and Methods: Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α0.05 Results: We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. Conclusion: The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection. PMID:29302647

  3. Experimental research of covered stent implanted in canine hepatic artery

    International Nuclear Information System (INIS)

    Zhou Bing; Liu Linxiang; Li Minghua; Wang Yongli; Cheng Yongde


    Objective: To evaluate the feasibility of success rate of implantation, post-procedure stenosis rate, apposition ability and endothelialization level, etc. for implantation with balloon-expandable covered stent in canine hepatic artery. Methods: 8 adult canines were implanted with balloon-expendable stents covered by expandable poly Teflon ester membrane (e-PTFEM). Follow-up DSA was performed immediately, 2, 4 and 12 wk after the procedure. The canines were sacrificed for histopathologic examination and statistical analysis with correlation of implantation manenvor and angiographic manifestations. Results: 8 cases were all implanted with the covered stents in proper hepatic artery/right hepatic artery successfully; showing good apposition ability and non-opacification of the separated branches. 2 cases showed intraluminal obvious stenosis( > 50%)of the stent at 2 weeks follow-up, so did 3 cases at 12 weeks follow-up, and the total stenosis rate was 37.5% and 5 cases manifested full endothelialization (3 different locations of the sample all manifested full endothelialization), 3 cased manifested partial endothelialization (at least 1 location of the sample didn't show full endothelialization), and the two terminal parts were easier to get endothelialization than the central part. Before and after the stent implantation, hepatic function of all cases didn't demonstrate any obvious changes. Conclusions: Balloon-expandable covered stent can be implanted in canine hepatic artery. successfully, with good apposition ability, full endothelialization, and no influence on hepatic function. (authors)

  4. Canine hip dysplasia: significance of early bony spurring

    International Nuclear Information System (INIS)

    Morgan, J.P.


    It is the purpose of this study to call attention to new bone production that often occurs early in the sequence of pathological changes associated with canine hip dysplasia. New bone production extending to bony remodeling, as well as femoral head subluxation, both occur in the sequence of pathologic changes associated with canine hip dysplasia. Subluxation is considered primary, while osteoarthrosis is a secondary feature, and both are used in the diagnosis of canine hip dysplasia. This report concerns the significance of the presence of a solitary bony osteophyte, or spur, that is frequently evident on the caudal aspect of the femoral neck as viewed on the conventional ventrodorsal projection. This report utilizes findings from pelvic radiographs of 605 dogs (five breeds). There was a greater frequency (54%)of this bony change in cases diagnosed radiographically as dysplastic than in cases diagnosed as normal(15%).Thus, it is suggested that this minimal radiographic change can be used as an indicator of early canine hip dysplasia, especially in the absence of subluxation of the femoral head

  5. Morphological study of maxillary canine region based on CT

    International Nuclear Information System (INIS)

    Yamada, Maiko; Takamori, Hitoshi; Ide, Yoshiaki; Yosue, Takashi


    The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)

  6. Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman


    Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.

  7. Surgical Removal of a Canine Aortic Thromboembolism Secondary to Pancreatitis

    Directory of Open Access Journals (Sweden)

    Jill Narak


    Full Text Available A 7-year-old castrated male Pomeranian was evaluated on emergency for diagnostic work-up and treatment for acute nonpainful paraparesis. The neurologic examination suggested a L4-S3 myelopathy, but physical examination revealed lack of femoral pulses and rectal hypothermia, as well as a grade II/VI systolic heart murmur, so ischemic neuromyopathy was suspected. Clinicopathologic analysis revealed increased muscle enzymes and proteinuria. Abdominal ultrasonography confirmed aortic thromboembolism (ATE, and surgical histopathology diagnosed necrotizing pancreatitis. Surgical aortic thrombectomy was performed, and antithrombotic therapy was instituted. Pancreatitis was treated supportively. The dog was discharged to the owners after 10 days of hospitalization. Recheck examination 6 weeks after initial presentation revealed a normal neurologic examination and normal femoral pulses. The patient has had no further bouts of pancreatitis and remains neurologically normal 5 years after initial presentation. Canine ATE is relatively rare compared to the feline counterpart. Directed therapy for feline ATE is often not recommended, as underlying conditions are oftentimes ultimately fatal. Underlying etiologies for canine ATE include cardiovascular disease and endocrinopathies, but canine ATE secondary to pancreatitis has not yet been reported. Surgical removal of aortic thromboembolus should be considered as curative for pelvic limb dysfunction in the canine patient without a terminal underlying disease.

  8. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    Directory of Open Access Journals (Sweden)

    Helen L. Del Puerto


    Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

  9. Effects of body weight on antibody titers against canine parvovirus type 2, canine distemper virus, and canine adenovirus type 1 in vaccinated domestic adult dogs. (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki


    The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.

  10. Comparative trial of the canine parvovirus, canine distemper virus and canine adenovirus type 2 fractions of two commercially available modified live vaccines. (United States)

    Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G


    The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.

  11. Health of periodontal tissues and resorption status after orthodontic treatment of impacted maxillary canines. (United States)

    Oz, A Z; Ciger, S


    The aim of the present study was to evaluate the changes of incisor root resorption associated with impacted maxillary canines and health of periodontal tissues around maxillary canines erupted with orthodontic treatment. Twenty patients with a unilateral palatally impacted maxillary canine were included in the study. Cone-beam computed tomography images taken before and after orthodontic treatment were compared with the contralateral canines serving as control teeth. Root resorption was present in 10% of central and 40% of lateral incisors before treatment. After treatment, the incidence of resorption decreased. The thickness of the buccal bone surrounding the impacted canines was similar to that surrounding the contralateral canines, except in the apical area. Periodontal pocket depth and alveolar bone loss were greater for the impacted canine teeth than for the contralateral canines. Incisor root resorption associated with impacted canine teeth showed signs of repair after orthodontic treatment. Slight differences related to periodontal health were found between the previously impacted teeth and contralateral canine teeth.

  12. Age estimation by canines' pulp/tooth ratio in an Iranian population using digital panoramic radiography. (United States)

    Dehghani, Mahdieh; Shadkam, Elaheh; Ahrari, Farzaneh; Dehghani, Mahboobe


    Age estimation in adults is an important issue in forensic science. This study aimed to estimate the chronological age of Iranians by means of pulp/tooth area ratio (AR) of canines in digital panoramic radiographs. The sample consisted of panoramic radiographs of 271 male and female subjects aged 16-64 years. The pulp/tooth area ratio (AR) of upper and lower canines was calculated by AutoCAD software. Data were subjected to correlation and regression analysis. There was a significant and inverse correlation between age and pulp/tooth area ratio of upper and lower canines (r=-0.794 for upper canine and r=-0.282 for lower canine; p-value<0.001). Linear regression equations were derived separately for upper, lower and both canines. The mean difference between actual and estimated age using upper canine was 6.07±1.7. The results showed that the pulp/tooth area ratios of canines are a reliable method for age estimation in Iranians. The pulp/tooth area ratio of upper canine was better correlated with chronological age than that of lower canine. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Morphology of palatally impacted canines: A case-controlled cone-beam volumetric tomography study. (United States)

    Hettiarachchi, Pilana Vithanage Kalani Shihanika; Olive, Richard John; Monsour, Paul


    The aim of this study was to investigate the relationships between an apical curvature or a hook and the crown/root ratio in subjects with and without palatally impacted maxillary canines. An experimental group of 44 patients (17 boys, 27 girls; mean age, 13.6 years) with 59 palatally impacted maxillary canines was selected from the records of patients referred to a radiology practice for cone-beam imaging. If a patient had bilateral palatally impacted canines, 1 canine was randomly selected for analysis. The palatally impacted canine group was matched for age and sex with 49 normal subjects (25 boys, 24 girls; mean age, 13.2 years) with 98 canines. Cone-beam DICOM files were imported into In Vivo imaging software (version 5.3; Anatomage, San Jose, Calif) for analysis. The angulations and linear variables of the maxillary canines were measured by using the software measurement tools. Chi-square and independent t tests were used to test for differences between the groups. The presence of a hook at the apical third and other root curvature were significantly different between the 2 groups (P <0.001 and P <0.05, respectively). Of the 44 palatally impacted canines, 16 (36.4%) had an apical hook and only 1 canine in the control group had an apical hook (1.0%). The mean root length of the palatally impacted canines was 2.66 mm shorter (P <0.001), and the mean crown/root ratio was significantly greater for the palatally impacted canines compared with the nonimpacted group (P <0.001). Palatally impacted canines have a greater tendency to develop apical hooks and are less likely to develop other root curvatures than are nonimpacted canines. Also, they have shorter roots resulting in larger crown/root ratios compared with the control group. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

  14. Current state of knowledge: the canine gastrointestinal microbiome. (United States)

    Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S


    Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.

  15. Migrastatin analogues inhibit canine mammary cancer cell migration and invasion.

    Directory of Open Access Journals (Sweden)

    Kinga Majchrzak

    Full Text Available BACKGROUND: Cancer spread to other organs is the main cause of death of oncological patients. Migration of cancer cells from a primary tumour is the crucial step in the complex process of metastasis, therefore blocking this process is currently the main treatment strategy. Metastasis inhibitors derived from natural products, such as, migrastatin, are very promising anticancer agents. Thus, the aim of our study was to investigate the effect of six migrastatin analogues (MGSTA-1 to 6 on migration and invasion of canine mammary adenocarcinoma cell lines isolated from primary tumours and their metastases to the lungs. Canine mammary tumours constitute a valuable tool for studying multiple aspect of human cancer. RESULTS: OUR RESULTS SHOWED THAT TWO OF SIX FULLY SYNTHETIC ANALOGUES OF MIGRASTATIN: MGSTA-5 and MGSTA-6 were potent inhibitors of canine mammary cancer cells migration and invasion. These data were obtained using the wound healing test, as well as trans-well migration and invasion assays. Furthermore, the treatment of cancer cells with the most effective compound (MGSTA-6 disturbed binding between filamentous F-actin and fascin1. Confocal microscopy analyses revealed that treatment with MGSTA-6 increased the presence of unbound fascin1 and reduced co-localization of F-actin and fascin1 in canine cancer cells. Most likely, actin filaments were not cross-linked by fascin1 and did not generate the typical filopodial architecture of actin filaments in response to the activity of MGSTA-6. Thus, administration of MGSTA-6 results in decreased formation of filopodia protrusions and stress fibres in canine mammary cancer cells, causing inhibition of cancer migration and invasion. CONCLUSION: Two synthetic migrastatin analogues (MGSTA-5 and MGSTA-6 were shown to be promising compounds for inhibition of cancer metastasis. They may have beneficial therapeutic effects in cancer therapy in dogs, especially in combination with other anticancer drugs

  16. Cryopreservation of canine semen - new challenges. (United States)

    Farstad, W


    Egg yolk (EY) protects cell membranes against cold shock, and it prevents or restores the loss of phospholipids from the membrane. EY has been widely used in semen extenders. It has been added to Tris-Glucose buffer and has been widely used for cooling and cryopreservation of canine semen. EY is not a defined entity, but a complex biological compound containing proteins, vitamins, phospholipids, glucose and antioxidants which are all potentially useful for cell membrane integrity. Unfortunately, it also is a biologically hazardous compound. Hence, whole EY needs to be replaced by other chemically defined components for semen processing in dogs. Freezing poor semen does not improve its quality, so attention must be focused on how to cope with dogs whose semen does not freeze well, and on designing individual freezing extenders for semen from such males. Furthermore, differences have been found among canid species in the ability of their spermatozoa to withstand freezing. There are differences in sperm membrane fatty acid composition among species, which may explain part of these differences. If the presence of long-chained polyunsaturated fatty acids contributes to increased membrane fluidity, this relationship may be biphasic, i.e. either too much membrane fluidity, or too little, could compromise successful sperm cryopreservation. An increase in fluidity of the outer leaflet of the plasma membrane has been shown in frozen thawed dog spermatozoa. The protective effect of exogenous lipids may lie in close association with the membrane rather than in modification or rearrangement of the membrane. This also points at lipids as an important, if not entirely new group of substances, which may substitute standard EY-based diluents in preserving sperm survival during freezing. EY-derived phospholipids or lecithin could be used to replace whole EY. Vegetable lecithin is currently investigated to avoid using substances of animal origin. EY also contains antioxidants which

  17. Release of canine parvovirus from endocytic vesicles

    International Nuclear Information System (INIS)

    Suikkanen, Sanna; Antila, Mia; Jaatinen, Anne; Vihinen-Ranta, Maija; Vuento, Matti


    Canine parvovirus (CPV) is a small nonenveloped virus with a single-stranded DNA genome. CPV enters cells by clathrin-mediated endocytosis and requires an acidic endosomal step for productive infection. Virion contains a potential nuclear localization signal as well as a phospholipase A 2 like domain in N-terminus of VP1. In this study we characterized the role of PLA 2 activity on CPV entry process. PLA 2 activity of CPV capsids was triggered in vitro by heat or acidic pH. PLA 2 inhibitors inhibited the viral proliferation suggesting that PLA 2 activity is needed for productive infection. The N-terminus of VP1 was exposed during the entry, suggesting that PLA 2 activity might have a role during endocytic entry. The presence of drugs modifying endocytosis (amiloride, bafilomycin A 1 , brefeldin A, and monensin) caused viral proteins to remain in endosomal/lysosomal vesicles, even though the drugs were not able to inhibit the exposure of VP1 N-terminal end. These results indicate that the exposure of N-terminus of VP1 alone is not sufficient to allow CPV to proliferate. Some other pH-dependent changes are needed for productive infection. In addition to blocking endocytic entry, amiloride was able to block some postendocytic steps. The ability of CPV to permeabilize endosomal membranes was demonstrated by feeding cells with differently sized rhodamine-conjugated dextrans together with the CPV in the presence or in the absence of amiloride, bafilomycin A 1 , brefeldin A, or monensin. Dextran with a molecular weight of 3000 was released from vesicles after 8 h of infection, while dextran with a molecular weight of 10,000 was mainly retained in vesicles. The results suggest that CPV infection does not cause disruption of endosomal vesicles. However, the permeability of endosomal membranes apparently changes during CPV infection, probably due to the PLA 2 activity of the virus. These results suggest that parvoviral PLA 2 activity is essential for productive infection and

  18. Genetic mapping of canine fear and aggression. (United States)

    Zapata, Isain; Serpell, James A; Alvarez, Carlos E


    Fear/anxiety and anger/aggression greatly influence health, quality of life and social interactions. They are a huge burden to wellbeing, and personal and public economics. However, while much is known about the physiology and neuroanatomy of such emotions, little is known about their genetics - most importantly, why some individuals are more susceptible to pathology under stress. We conducted genomewide association (GWA) mapping of breed stereotypes for many fear and aggression traits across several hundred dogs from diverse breeds. We confirmed those findings using GWA in a second cohort of partially overlapping breeds. Lastly, we used the validated loci to create a model that effectively predicted fear and aggression stereotypes in a third group of dog breeds that were not involved in the mapping studies. We found that i) known IGF1 and HMGA2 loci variants for small body size are associated with separation anxiety, touch-sensitivity, owner directed aggression and dog rivalry; and ii) two loci, between GNAT3 and CD36 on chr18, and near IGSF1 on chrX, are associated with several traits, including touch-sensitivity, non-social fear, and fear and aggression that are directed toward unfamiliar dogs and humans. All four genome loci are among the most highly evolutionarily-selected in dogs, and each of those was previously shown to be associated with morphological traits. We propose that the IGF1 and HMGA2 loci are candidates for identical variation being associated with both behavior and morphology. In contrast, we show that the GNAT3-CD36 locus has distinct variants for behavior and morphology. The chrX region is a special case due to its extensive linkage disequilibrium (LD). Our evidence strongly suggests that sociability (which we propose is associated with HS6ST2) and fear/aggression are two distinct GWA loci within this LD block on chrX, but there is almost perfect LD between the peaks for fear/aggression and animal size. We have mapped many canine fear and

  19. Cardiac troponin I levels in canine pyometra

    Directory of Open Access Journals (Sweden)

    Hagman Ragnvi


    Full Text Available Abstract Background Myocardial injury may contribute to unexpected deaths due to pyometra. To detect myocardial damage, measurement of cardiac troponin I (cTnI is currently the most sensitive and specific method. The aims of the present study were to evaluate presence of myocardial damage in canine pyometra by analysis of cTnI, to explore whether myocardial injury was associated with systemic inflammatory response syndrome (SIRS and to evaluate whether other clinical or laboratory parameters were associated with cTnI increase. Methods Preoperative plasma levels of cTnI were investigated in 58 female dogs with pyometra and 9 controls. The value of physical examination findings, haematological, serum biochemical and pro-inflammatory (CRP and TNF-α parameters as possible predictors of increased cTnI levels was also evaluated. Results Seven dogs with pyometra (12% and one control dog (11% had increased levels of cTnI. In the pyometra group, the levels ranged between 0.3–0.9 μg l-1 and in the control dog the level was 0.3 μg l-1. The cTnI levels did not differ significantly between the two groups. No cardiac abnormalities were evident on preoperative physical examinations. Four of the pyometra patients died within two weeks of surgery, of which two were examined post mortem. In one of these cases (later diagnosed with myocarditis and disseminated bacterial infection the cTnI levels increased from 0.9 μg l-1 preoperatively to 180 μg l-1 the following day when also heart arrhythmia was also detected. The other patient had cTnI levels of 0.7 μg l-1 with no detectable heart pathology post mortem. CTnI increase was not associated with presence of SIRS. There was a trend for the association of cTnI increase with increased mortality. No preoperative physical examination findings and few but unspecific laboratory parameters were associated with increased cTnI levels. Conclusion Increased cTnI levels were observed in 12% of the dogs with pyometra. The

  20. Headspace concentrations of explosive vapors in containers designed for canine testing and training: theory, experiment, and canine trials. (United States)

    Lotspeich, Erica; Kitts, Kelley; Goodpaster, John


    It is a common misconception that the amount of explosive is the chief contributor to the quantity of vapor that is available to trained canines. In fact, this quantity (known as odor availability) depends not only on the amount of explosive material, but also the container volume, explosive vapor pressure and temperature. In order to better understand odor availability, headspace experiments were conducted and the results were compared to theory. The vapor-phase concentrations of three liquid explosives (nitromethane, nitroethane and nitropropane) were predicted using the Ideal Gas Law for containers of various volumes that are in use for canine testing. These predictions were verified through experiments that varied the amount of sample, the container size, and the temperature. These results demonstrated that the amount of sample that is needed to saturate different sized containers is small, predictable and agrees well with theory. In general, and as expected, once the headspace of a container is saturated, any subsequent increase in sample volume will not result in the release of more vapors. The ability of canines to recognize and alert to differing amounts of nitromethane has also been studied. In particular, it was found that the response of trained canines is independent of the amount of nitromethane present, provided it is a sufficient quantity to saturate the container in which it is held. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  1. The Effects of Orthodontic Forces during Canine Retraction Using Self-ligating Brackets on Gingival Crevicular Fluid Enzyme Activity, Canine Movement and Root Resorption

    International Nuclear Information System (INIS)

    Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin


    Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)

  2. Orthodontic management of buccally erupted ectopic canine with two case reports

    Directory of Open Access Journals (Sweden)

    Avesh Sachan


    Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.

  3. Permanent maxillary canines - review of eruption pattern and local etiological factors leading to impaction. (United States)

    Sajnani, Anand K


    The position of the permanent maxillary canine at the angle of the mouth is strategically significant in maintaining the harmony and symmetry of the occlusal relationship. However, the maxillary canine is the second most frequently impacted tooth, with prevalence reported to be between 1% and 2%. Moreover, treatment of this condition is often complex and involves substantial time and financial cost. Hence, it is only prudent to monitor the eruption and identify the etiological factors that lead to impaction of the maxillary canine. Numerous researchers have tried to identify specific and nonspecific etiological factors responsible for displacement of canines. The purpose of this review was to track the development processes of maxillary canines and determine the hindrances that affect the eruption at different ages. Awareness of the eruption process and etiology of noneruption will help to reduce the incidence of impacted canines by allowing for early recognition and interceptive treatment. © 2013 Wiley Publishing Asia Pty Ltd.

  4. Genetic characterization of canine influenza A virus (H3N2) in Thailand. (United States)

    Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn


    In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.

  5. Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma. (United States)

    Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid


    Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma.

  6. Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel

    International Nuclear Information System (INIS)

    Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.


    Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old

  7. Canine hypothyroidism. A diagnostic challenge?; Die canine Hypothyreose. Eine diagnostische Herausforderung?

    Energy Technology Data Exchange (ETDEWEB)

    Boretti, Felicitos; Reusch, C.E. [Klinik fuer Kleintiermedizin, Vetsuisse Fakultaet Zuerich, Univ. Zuerich (Switzerland)


    Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen {sup registered}) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high

  8. Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus

    Directory of Open Access Journals (Sweden)

    Lourdes M. B. Pessoa


    Full Text Available The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.

  9. Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus)


    Pessoa, Lourdes M. B.; Roza, Marcello; Farias, Anderson; Jesus, Pedro Henrique de; Campbell, Rita de Cassia; Pinho, Mariângela Pereira de


    The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.

  10. Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.


    McMaster, G K; Tratschin, J D; Siegl, G


    The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.

  11. Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma


    Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid


    Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...

  12. A case of unusual root morphology: Maxillary canine with two roots

    Directory of Open Access Journals (Sweden)

    Nagesh Bolla


    Full Text Available The case describes a 3 months follow-up of the treatment of a maxillary canine with two roots. Clinical examination revealed a maxillary canine with a large carious lesion and an exaggerated response to cold thermal tests. Radiographic examination revealed a large distal carious lesion that appeared to invade the pulp chamber. The radiograph also revealed what appeared to be an extra root in this permanent maxillary canine.

  13. Assessment of Periodontal Status of Surgically Exposed and Orthodontically Aligned Impacted Maxillary Canines


    Adina Coșarcă; Mariana Păcurar; Cecilia Petrovan; Alina Ormenișan


    Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of t...

  14. Endocrinologic control of normal canine ovarian function. (United States)

    Concannon, P W


    regression after day 20 to 30 involves periodic cell death, diminution in cell size, low levels of apoptosis and minimal or modest involvement of endogenous prostaglandin F (PGF) production. The canine corpus luteum (CL) is dependent on both LH and prolactin as stimulating luteotrophins by day 15, and as required luteotrophins by days 20-25, if not earlier. Thereafter, both luteotrophins likely have cellular mechanisms of action similar to those reported for other species. Progesterone secretion during pregnancy is greatly enhanced by characteristic, and probably relaxin-stimulated, increases in prolactin concentration starting at or after day 25, and persisting to term. Near term, foetoplacental maturation results in the placental release of large, luteolytic amounts of PGF for 1-2 days pre-partum. Pre-partum luteolysis, like that induced by exogenous prostaglandin, likely involves a cascade enhanced by the removal of progesterone inhibition of PGF release and some degree of intra-luteal PGF synthesis. That a likely twofold or greater increase in progesterone production by the CL of pregnancy does not result in significantly higher serum progesterone than in non-pregnant metoestrus relates to several biological changes, including a large increase in plasma volume of distribution, increased metabolism of progesterone by increased uterine, placental and mammary masses and increased liver clearance and excretion of progesterone and progesterone metabolite. Anoestrus length and ovarian cycle intervals, variable within and among bitches, are likely affected by neuroendocrine components of an endogenous circannual cycle, albeit only photo-entrained in the Basenji breed. This may be modified by the prior luteal phase, exposure to oestrus female pheromones and as yet unknown mechanisms that likely operate via inhibitory opioidergic and/or stimulatory dopaminergic hypothalamic pathways affecting late anoestrus increases in LH.

  15. Feeding ecology and morphology of the upper canines in bears (carnivora: Ursidae). (United States)

    Christiansen, Per


    The morphology and mechanical strength of the upper canines in all eight extant species of ursids is analyzed, and the findings are discussed in relation to feeding ecology. Ursids have proportionally smaller canines than other large carnivores with a specialized feeding ecology, such as large felids, and the upper canine morphology is both canid-like and felid-like. The giant panda is the most divergent species, and its short, blunt, and cone-like canines appear well adapted for tearing into bamboo. The almost equally herbivorous spectacled bear has a less derived canine morphology. The large canines of the sun bear are divergent from other ursine ursids, and may be an adaptation for tearing open tree trunks in search of insects. Discriminant Analysis is successful in separating ursid species on the basis of canine morphology, but the canines of ursine ursids, and also of the spectacled bear, show greater resemblance among the species than the marked differences in feeding ecology would suggest. This could be in part due to a short evolutionary history, and in part due to canines not having been subjected to much evolutionary selection as has been the case among other large carnivores, such as large felids. Ursids are probably evolutionarily and ecologically successful due to physical size and strength rather than a derived craniodental anatomy. Copyright 2008 Wiley-Liss, Inc.

  16. Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas. (United States)

    Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara


    Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.

  17. Aspects and clinical procedures of eruptive changes of permanent upper canines

    Directory of Open Access Journals (Sweden)

    Sheila Marcia Francisco


    Full Text Available INTRODUCTION: Even though the upper canine is the tooth that presents most eruption anomalies, after the third molars, canine retention prevalence in the population is quite low. Local, physiologic and pathologic factors can provide difficulties for the tooth eruptive process. The correct diagnosis in trying to prevent upper canine retention with ectopic eruption is fundamental to choose the ideal treatment, which can be performed by various methods. OBJECTIVE: The present paper has the purpose of approaching aspects related to impacted upper permanent canines by a literature review, including localization and treatment conducts.

  18. [Biological characteristics of a chimeric rabies virus expressing canine parvovirus VP2 protein]. (United States)

    Niu, Xue-Feng; Liu, Xiao-Hui; Sun, Zhao-Jin; Shi, He-He; Chen, Jing; Jiang, Bido; Sun, Jing-Chen; Guo, Xiao-Feng


    To obtain a bivalence vaccine against canine rabies virus and canine parvovirus, a chimeric rabies virus expressing canine parvovirus VP2 protein was generated by the technique of reverse genetics. It was shown that the chimeric virus designated as HEP-Flury (VP2) grew well on BHK-21 cells and the VP2 gene could still be stably expressed after ten passages on BHK-21 cells. Experiments on the mice immunized with the chimeric virus HEP-Flury (VP2) demonstrated that specific antibodies against rabies virus and canine parvovirus were induced in immunized mice after vaccination with the live chimeric virus.

  19. Canine length in wild male baboons: maturation, aging and social dominance rank.

    Directory of Open Access Journals (Sweden)

    Jordi Galbany

    Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.

  20. Serotonin transporter and dopamine transporter imaging in the canine brain

    Energy Technology Data Exchange (ETDEWEB)

    Peremans, Kathelijne [Department of Medical Imaging, Faculty of Veterinary Sciences, Ghent University, B-9000 Ghent (Belgium); Goethals, Ingeborg [Division of Nuclear Medicine, University Hospital Ghent, B-9000 Ghent (Belgium); De Vos, Filip [Laboratory of Radiopharmacy, Pharmaceutical Sciences, Ghent University, B-9000 Ghent (Belgium); Dobbeleir, A. [Department of Medical Imaging, Faculty of Veterinary Sciences, Ghent University, B-9000 Ghent (Belgium); Ham, Hamphrey [Division of Nuclear Medicine, University Hospital Ghent, B-9000 Ghent (Belgium); Van Bree, Henri [Department of Medical Imaging, Faculty of Veterinary Sciences, Ghent University, B-9000 Ghent (Belgium); Heeringen, Cees van [Department of Psychiatry and Medical Psychology, Faculty of Medical and Health Sciences, Ghent University, B-9000, Ghent (Belgium); Audenaert, Kurt [Division of Nuclear Medicine, University Hospital Ghent, B-9000 Ghent (Belgium) and Department of Psychiatry and Medical Psychology, Faculty of Medical and Health Sciences, Ghent University, B-9000, Ghent (Belgium)]. E-mail:


    The serotonergic and dopaminergic systems are involved in a wide range of emotional and behavioral aspects of animals and humans and are involved in many neuropsychiatric disorders. Selective serotonin (5-HT) reuptake inhibitors (SSRIs) are designed to block the 5-HT transporter (SERT), thereby increasing the available 5-HT in the brain. Functional imaging with specific SERT and dopamine transporter (DAT) ligands contributes to the study of the SSRI-transporter interaction. First, we evaluated the feasibility of a canine model in the study of the SERT and DAT with the radioligands [{sup 123}I]-{beta}-CIT and [{sup 123}I]-FP-CIT as well as single-photon emission computed tomography imaging. Second, we studied the effect of SSRIs (sertraline, citalopram and escitalopram) on the SERT and DAT in two dogs. The position of the canine model in the study of the SERT and DAT is discussed and compared with other animal models.

  1. Magnetic resonance imaging of canine degenerative lumbar spine diseases

    International Nuclear Information System (INIS)

    Karkkainen, M.; Punto, L.U.; Tulamo, R.M.


    Degenerative lumbar spine diseases, i.e., sacrolumbar stenosis, intervertebral disk degeneration and protrusion and spondylosis deformans of the canine lumbar spine were studied in eleven canine patients and three healthy controls using radiography and 0.02 T and 0.04 T low field magnetic resonance imaging. The T1 and T2 weighted images were obtained in sagittal and transverse planes. The loss of hydration of nucleus pulposus, taken as a sign of degeneration in the intervertebral disks, could be evaluated in both T1 and T2 weighted images. As a noninvasive method magnetic resonance imaging gave more exact information about the condition of intervertebral disks than did radiography. Sacrolumbar stenosis and compression of the spinal cord or cauda equina and surrounding tissue could be evaluated without contrast medium

  2. An Update on Therapeutic Management of Canine Demodicosis

    Directory of Open Access Journals (Sweden)

    S. K. Singh


    Full Text Available Canine demodicosis is a common noncontagious parasitic dermatosis caused by different spp of Demodex mites including Demodex canis, Demodex injai and D. cornei. Generalized demodicosis can be one of the most frustrating skin diseases, one will ever treat. Conventional and newer miticidal therapies are available to veterinarian to treat this frustrating skin disease. All recognized Demodex mites in dogs appear to respond similarly to mite targeted therapy. Treatment for canine demodicosis includes amitraz, ivermectin, milbemicin oxime, moxidectin, and doramectin. The use of any glucocorticoid-containing products is contraindicated and could favour disease generalization. Conventional treatments will often appear to work however, but it relies heavily on a highly toxic method of treatment. Using natural remedies for mange, on the other hand, can enhance the dog’s immune system, so that the body can fight off the mange mite infection by itself. [Veterinary World 2011; 4(1.000: 41-44

  3. Computed Tomography Imaging of the Topographical Anatomy of Canine Prostate

    International Nuclear Information System (INIS)

    Dimtrox, R.; Yonkova, P.; Vladova, D.; Kostov, D.


    AIM: To investigate the topographical anatomy of canine prostate gland by computed tomography (CT) for diagnostic imaging purposes. ÐœATERIAL AND METHODS: Seven clinically healthy mongrel male dogs at the age of 3−4 years and body weight of 10−15 kg were submitted to transverse computerized axial tomography (CAT) with cross section thickness of 5 mm. RESULTS: The CT image of canine prostate is visualized throughout the scans of the pelvis in the planes through the first sacral vertebra (S1) dorsally; the bodies of iliac bones laterally and cranially to the pelvic brim (ventrally). The body of prostate appears as an oval homogenous relatively hypo dense finding with soft tissue density. The gland is well differentiated from the adjacent soft tissues. CONCLUSION: By means of CT, the cranial part of prostate gland in adult dogs aged 3−4 years exhibited an abdominal localization. (author)

  4. Radioreceptor assay of opioid peptides in selected canine brain regions

    Energy Technology Data Exchange (ETDEWEB)

    Desiderio, D.M.; Takeshita, H.


    A radioreceptor assay using the opioid delta receptor-preferring ligand D-/sup 2/ala, D-/sup 5/leu leucine enkephalin (/sup 3/H-DADL) and the broader-specificity ligand /sup 3/H-etorphine was used to measure five HPLC-purified neuropeptide fractions derived from the peptide-rich fraction of tissue homogenates of nine anatomical regions of the canine brain. The receptoractive peptides studied were methionine enkephalin, alpha-neo-endorphin, dynorphin 1-8, methionine enkephalin-Arg-Phe, and leucine enkephalin. These peptides derive from two larger precursors: proenkephalin A, which contains methionine enkephalin, leucine enkephalin, methionine enkephalin-Arg-Phe; and proenkephalin B, which contains alpha-neo-endorphin and dynorphin 1-8. Receptoractive peptides were measured in the peptide-rich fraction derived from homogenates of canine hypothalamus, pituitary, caudate nucleus, amygdala, hippocampus, mid-brain, thalamus, pons-medulla, and cortex.

  5. Serotonin transporter and dopamine transporter imaging in the canine brain

    International Nuclear Information System (INIS)

    Peremans, Kathelijne; Goethals, Ingeborg; De Vos, Filip; Dobbeleir, A.; Ham, Hamphrey; Van Bree, Henri; Heeringen, Cees van; Audenaert, Kurt


    The serotonergic and dopaminergic systems are involved in a wide range of emotional and behavioral aspects of animals and humans and are involved in many neuropsychiatric disorders. Selective serotonin (5-HT) reuptake inhibitors (SSRIs) are designed to block the 5-HT transporter (SERT), thereby increasing the available 5-HT in the brain. Functional imaging with specific SERT and dopamine transporter (DAT) ligands contributes to the study of the SSRI-transporter interaction. First, we evaluated the feasibility of a canine model in the study of the SERT and DAT with the radioligands [ 123 I]-β-CIT and [ 123 I]-FP-CIT as well as single-photon emission computed tomography imaging. Second, we studied the effect of SSRIs (sertraline, citalopram and escitalopram) on the SERT and DAT in two dogs. The position of the canine model in the study of the SERT and DAT is discussed and compared with other animal models

  6. Canine hepatozoonosis in Brazil: description of eight naturally occurring cases. (United States)

    Gondim, L F; Kohayagawa, A; Alencar, N X; Biondo, A W; Takahira, R K; Franco, S R


    Eight cases of canine hepatozoonosis were diagnosed at the Veterinary Hospital (Faculdade de Medicina Veterinária e Zootecnia, Universidade Estadual Paulista, Campus de Botucatu), between October 1993 and April 1994. Clinical signs included anorexia, pale mucous membranes, weight loss, pain, diarrhoea, vomit, gait abnormalities, fever, polyuria and polydipsia. Haematologic findings revealed anaemia in seven cases, leucocytosis with neutrophilia in three cases, lymphopenia in three cases and monocytosis in four cases. Serum biochemistries included alterations in many parameters. The micrometry of Hepatozoon canis gametocytes ranged from 6.8 x 4.0 microns to 7.5 x 4.5 microns. Parasitaemia ranged from less than 0.5% to 2%. In all the cases reported other concurrent diseases were present. Diagnosis of canine hepatozoonosis was made by identifying H. canis gametocytes within leucocytes in stained blood smears.

  7. Glucosamine and chondroitin use in canines for osteoarthritis: A review

    Directory of Open Access Journals (Sweden)

    Angel Bhathal


    Full Text Available Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine’s quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and conflicting evidence, the natural products glucosamine hydrochloride (HCl and chondroitin sulfate are commonly recommended by veterinarians for treating osteoarthritis in dogs. There is a paucity of well-designed clinical veterinary studies investigating the true treatment effect of glucosamine and chondroitin. The purposes of this review article are to provide a brief background on glucosamine and chondroitin use in canine osteoarthritis and to critically review the available literature on the role of these products for improving clinical outcomes. Based on critical review, recommendations for practice are suggested and a future study design is proposed.

  8. The unerupted maxillary canine - a post-surgical review.

    LENUS (Irish Health Repository)

    O'Dowling, Ian


    The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.

  9. Radioreceptor assay of opioid peptides in selected canine brain regions

    International Nuclear Information System (INIS)

    Desiderio, D.M.; Takeshita, H.


    A radioreceptor assay using the opioid delta receptor-preferring ligand D- 2 ala, D- 5 leu leucine enkephalin ( 3 H-DADL) and the broader-specificity ligand 3 H-etorphine was used to measure five HPLC-purified neuropeptide fractions derived from the peptide-rich fraction of tissue homogenates of nine anatomical regions of the canine brain. The receptoractive peptides studied were methionine enkephalin, alpha-neo-endorphin, dynorphin 1-8, methionine enkephalin-Arg-Phe, and leucine enkephalin. These peptides derive from two larger precursors: proenkephalin A, which contains methionine enkephalin, leucine enkephalin, methionine enkephalin-Arg-Phe; and proenkephalin B, which contains alpha-neo-endorphin and dynorphin 1-8. Receptoractive peptides were measured in the peptide-rich fraction derived from homogenates of canine hypothalamus, pituitary, caudate nucleus, amygdala, hippocampus, mid-brain, thalamus, pons-medulla, and cortex

  10. Characterization of Canine parvovirus 2 variants circulating in Greece. (United States)

    Ntafis, Vasileios; Xylouri, Eftychia; Kalli, Iris; Desario, Costantina; Mari, Viviana; Decaro, Nicola; Buonavoglia, Canio


    The aim of the present study was to characterize Canine parvovirus 2 (CPV-2) variants currently circulating in Greece. Between March 2008 and March 2009, 167 fecal samples were collected from diarrheic dogs from different regions of Greece. Canine parvovirus 2 was detected by standard polymerase chain reaction, whereas minor groove binder probe assays were used to distinguish genetic variants and discriminate between vaccine and field strains. Of 84 CPV-2-positive samples, 81 CPV-2a, 1 CPV-2b, and 2 CPV-2c were detected. Vaccine strains were not detected in any sample. Sequence analysis of the VP2 gene of the 2 CPV-2c viruses revealed up to 100% amino acid identity with the CPV-2c strains previously detected in Europe. The results indicated that, unlike other European countries, CPV-2a remains the most common variant in Greece, and that the CPV-2c variant found in Europe is also present in Greece.

  11. Construct canine intracranial aneurysm model by endovascular technique

    International Nuclear Information System (INIS)

    Liang Xiaodong; Liu Yizhi; Ni Caifang; Ding Yi


    Objective: To construct canine bifurcation aneurysms suitable for evaluating the exploration of endovascular devices for interventional therapy by endovascular technique. Methods: The right common carotid artery of six dogs was expanded with a pliable balloon by means of endovascular technique, then embolization with detached balloon was taken at their originations DAS examination were performed on 1, 2, 3 d after the procedurse. Results: 6 aneurysm models were created in six dogs successfully with the mean width and height of the aneurysms decreasing in 3 days. Conclusions: This canine aneurysm model presents the virtue in the size and shape of human cerebral bifurcation saccular aneurysms on DSA image, suitable for developing the exploration of endovascular devices for aneurismal therapy. The procedure is quick, reliable and reproducible. (authors)

  12. The unerupted maxillary canine--a post-surgical review. (United States)

    O'Dowling, Ian


    The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.

  13. Measurement of plasma canine C peptide by radioimmunoassay

    Energy Technology Data Exchange (ETDEWEB)

    Besch, W; Woltanski, K P; Fischer, U; Kohnert, K D; Ziegler, M


    A sensitive radioimmunoassay for canine C peptide (CCP) was established using synthetic CCP, a specific antiserum, and rabbit anti-guinea pig serum. Radioiodination was performed according to a modified chloramine T method. Tracer preparations have been used for 6 weeks after iodination. The standard curve ranges from 0.028 to 3.0 nmol/l. The intra-assay coefficient of variation (CV) was 3-5% and the inter-assay CV was 6-9% in the optimal range between 0.3 and 0.8 nmol/l. The average recovery of CCP added to plasma samples was 100.6% (n = 9). Canine insulin, porcine proinsulin, bovine proinsulin, and human C peptide exhibited no cross-reactivity. The mean fasting plasma CCP concentration was 0.089 +- 0.021 nmol/l in normal dogs and -0.005 +- 0.007 nmol/l (mean +- SEM) in diabetic dogs, respectively.

  14. Characterization and modulation of canine mast cell derived eicosanoids (United States)

    Lin, Tzu-Yin; London, Cheryl A.


    Mast cells play an important role in both innate and acquired immunity as well as several pathological conditions including allergy, arthritis and neoplasia. They influence these processes by producing a variety of mediators including cytokines, chemokines and eicosanoids. Very little is currently known about the spectrum of inflammatory mediators, particularly eicosanoids (prostaglandins and leukotrienes), produced by canine mast cells. This is important since modulating mast cell derived eicosanoids may help in the treatment of autoimmune and inflammatory disorders. The purpose of this study was to investigate the spectrum of eicosanoids produced by normal canine mast cells and to evaluate the effects of cytokines and non-steroidal anti-inflammatory mediators (NSAIDS) on eicosanoid production and release. Canine bone marrow derived cultured mast cells (cBMCMCs) expressed COX-1, COX-2, and 5-LOX and synthesized and released PGD2, PGE2, LTB4, and LTC4 following activation by a variety of stimuli. The selective COX-2 NSAIDs carprofen (Rimadyl®) and deracoxib (Deramaxx®) inhibited PGD2 and PGE2 production but only slightly inhibited LTB4 and LTC4. The mixed COX-1/COX-2 inhibitor piroxicam blocked PGD2 and PGE2 production, but upregulated LTC4 following treatment while tepoxilan (Zubrin®), a pan COX/LOX inhibitor, markedly reduced the production of all eicosanoids. The LOX inhibitor nordihydroguaiaretic acid (NDGA) prevented LTB4/LTC4 release and BMBMC degranulation. Pre-incubation of cBMCMCs with IL-4 and SCF sensitized these cells to degranulation in response to substance P. In conclusion, canine BMCMCs produce an array of eicosanoids similar to those produced by mast cells from other species. Tepoxilan appeared to be the most effective NSAID for blocking eicosanoid production and thus may be useful for modulating mast cell mediated responses in dogs. PMID:20036014

  15. Diagnosis, prevention, and management of canine hip dysplasia: a review

    Directory of Open Access Journals (Sweden)

    Schachner ER


    Full Text Available Emma R Schachner, Mandi J Lopez Department of Veterinary Clinical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA, USA Abstract: Canine hip dysplasia (CHD is a polygenic and multifactorial developmental disorder characterized by coxofemoral (hip joint laxity, degeneration, and osteoarthritis (OA. Current diagnostic techniques are largely subjective measures of joint conformation performed at different stages of development. Recently, measures on three-dimensional images generated from computed tomography scans predicted the development of OA associated with CHD. Continued refinement of similar imaging methods may improve diagnostic imaging techniques to identify dogs predisposed to degenerative hip joint changes. By current consensus, joint changes consistent with CHD are influenced by genetic predisposition as well as environmental and biomechanical factors; however, despite decades of work, the relative contributions of each to the development and extent of CHD signs remain elusive. Similarly, despite considerable effort to decipher the genetic underpinnings of CHD for selective breeding programs, relevant genetic loci remain equivocal. As such, prevention of CHD within domestic canine populations is marginally successful. Conservative management is often employed to manage signs of CHD, with lifelong maintenance of body mass as one of the most promising methods. Surgical intervention is often employed to prevent joint changes or restore joint function, but there are no gold standards for either goal. To date, all CHD phenotypes are considered as a single entity in spite of recognized differences in expression and response to environmental conditions and treatment. Identification of distinct CHD phenotypes and targeting evidence-based conservative and invasive treatments for each may significantly advance prevention and management of a prevalent, debilitating condition in canine companions. Keywords: canine

  16. Biotinylated dextran amine anterograde tracing of the canine corticospinal tract?


    Han, Xiao; Lv, Guangming; Wu, Huiqun; Ji, Dafeng; Sun, Zhou; Li, Yaofu; Tang, Lemin


    In this study, biotinylated dextran amine (BDA) was microinjected into the left cortical motor area of the canine brain. Fluorescence microscopy results showed that a large amount of BDA-labeled pyramidal cells were visible in the left cortical motor area after injection. In the left medulla oblongata, the BDA-labeled corticospinal tract was evenly distributed, with green fluorescence that had a clear boundary with the surrounding tissue. The BDA-positive corticospinal tract entered into the ...

  17. Epidemiology of canine gastrointestinal helminths in sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Nozyechi Ngulube Chidumayo


    Full Text Available Abstract Background Dogs have a close association with humans providing companionship, security and a source of dietary protein. However, dogs are also potential carriers of zoonotic pathogens. Dogs, therefore, pose a public health risk and a good understanding of canine diseases is important for planning and implementing control measures. The aim of this study was to characterise canine helminthiasis in sub-Saharan Africa using a systematic approach. Methods Pubmed and Google Scholar were searched for relevant primary studies published from 2000. Forty-one eligible studies were included in the meta-analysis. Pooled prevalences were estimated using the quality effects model. Results and conclusions Twenty-six genera of enteric helminths were reported and the pooled estimate of canine helminthiasis was 71% (95% CI: 63–79%. Species of Ancylostoma and Toxocara, causative agents of larva migrans in humans, were the most frequently reported helminths with pooled estimated prevalences of 41% (95% CI: 32–50% and 22% (95% CI: 16–29%, respectively. Dipylidium caninum and Taenia spp. were the most frequently reported cestodes with pooled estimated prevalences of 20% (95% CI: 12–29% and 9% (95% CI: 5–15%, respectively. Trematodes were rarely reported. There was a high level of heterogeneity in most pooled estimates (I2 ˃ 80%. The results of this study show that canine helminthiasis is highly prevalent in sub-Saharan Africa and there is need for regular deworming programmes to improve the health status of the dogs and minimise the potential health risk to humans.

  18. Canine parvovirus effect on wolf population change and pup survival (United States)

    Mech, L.D.; Goyal, S.M.


    Canine parvovirus infected wild canids more than a decade ago, but no population effect has been documented. In wild Minnesota wolves (Canis lupus) over a 12-yr period, the annual percent population increase and proportion of pups each were inversely related to the percentage of wolves serologically positive to the disease. Although these effects did not seem to retard this large extant population, similar relationships in more isolated wolf populations might hinder recovery of this endangered and threatened species.

  19. Cathepsin K expression and activity in canine osteosarcoma. (United States)

    Schmit, J M; Pondenis, H C; Barger, A M; Borst, L B; Garrett, L D; Wypij, J M; Neumann, Z L; Fan, T M


    Cathepsin K (CatK) is a lysosomal protease with collagenolytic activity, and its secretion by osteoclasts is responsible for degrading organic bone matrix. People with pathologic bone resorption have higher circulating CatK concentrations. Canine osteosarcoma (OS) cells will possess CatK, and its secretion will be cytokine inducible. Circulating CatK concentrations will be increased in dogs with OS, and will be a surrogate marker of bone resorption. Fifty-one dogs with appendicular OS and 18 age- and weight-matched healthy control dogs. In a prospective study, expressions of CatK mRNA and protein were investigated in OS cells. The inducible secretion and proteolytic activity of CatK from OS cells was assessed in vitro. Serum CatK concentrations were quantified in normal dogs and dogs with OS and its utility as a bone resorption marker was evaluated in dogs with OS treated with palliative radiation and antiresorptive agents. Canine OS cells contain preformed CatK within cytoplasmic vesicles. In OS cells, TGFβ1 induced the secretion of CatK, which degraded bone-derived type I collagen in vitro. CatK concentrations were higher in dogs with OS than healthy dogs (11.3 ± 5.2 pmol/L versus 8.1 ± 5.0 pmol/L, P = .03). In a subset of dogs with OS, pretreatment CatK concentrations gradually decreased after palliative radiation and antiresorptive treatment, from 9.3 ± 3.2 pmol/L to 5.0 ± 3.1 pmol/L, P = .03. Canine OS is associated with pathologic bone resorption, and CatK inhibitors might aid in the management of canine OS-related malignant osteolysis. Copyright © 2011 by the American College of Veterinary Internal Medicine.

  20. Canine osteosarcoma: a naturally occurring disease to inform pediatric oncology. (United States)

    Fenger, Joelle M; London, Cheryl A; Kisseberth, William C


    Osteosarcoma (OSA) is the most common form of malignant bone cancer in children and dogs, although the disease occurs in dogs approximately 10 times more frequently than in people. Multidrug chemotherapy and aggressive surgical techniques have improved survival; however, new therapies for OSA are critical, as little improvement in survival times has been achieved in either dogs or people over the past 15 years, even with significant efforts directed at the incorporation of novel therapeutic approaches. Both clinical and molecular evidence suggests that human and canine OSA share many key features, including tumor location, presence of microscopic metastatic disease at diagnosis, development of chemotherapy-resistant metastases, and altered expression/activation of several proteins (e.g. Met, ezrin, phosphatase and tensin homolog, signal transducer and activator of transcription 3), and p53 mutations, among others. Additionally, canine and pediatric OSA exhibit overlapping transcriptional profiles and shared DNA copy number aberrations, supporting the notion that these diseases are similar at the molecular level. This review will discuss the similarities between pediatric and canine OSA with regard to histology, biologic behavior, and molecular genetic alterations that indicate canine OSA is a relevant, spontaneous, large animal model of the pediatric disease and outline how the study of naturally occurring OSA in dogs will offer additional insights into the biology and future treatment of this disease in both children and dogs. © The Author 2014. Published by Oxford University Press on behalf of the Institute for Laboratory Animal Research. All rights reserved. For permissions, please e-mail:

  1. Seroprevalence of Canine Parvovirus in Dogs in Lusaka District, Zambia


    Saasa, Ngonda; Nalubamba, King Shimumbo; M’kandawire, Ethel; Siwila, Joyce


    Canine parvovirus (CPV) enteritis is a highly contagious enteric disease of young dogs. Limited studies have been done in Zambia to investigate the prevalence of CPV in dogs. Blood was collected from dogs from three veterinary clinics (clinic samples, n = 174) and one township of Lusaka (field samples, n = 56). Each dog's age, sex, breed, and vaccination status were recorded. A haemagglutination assay using pig erythrocytes and modified live parvovirus vaccine as the antigen was used. Antibod...

  2. The Evidence Behind the Treatment of Canine Idiopathic Epilepsy

    Directory of Open Access Journals (Sweden)

    Marios Charalambous


    Full Text Available Oral phenobarbital and imepitoin in particular, followed by potassium bromide and levetiracetam are likely to be effective for the treatment of canine idiopathic epilepsy. There is strong evidence supporting the use of oral phenobarbital and imepitoin as ‘first line’ medications. However, there remains a lack of evidence for targeted treatment for the various individual epileptic phenotypes and quite limited evidence on direct comparisons of the efficacy between various anti-epileptic drugs.

  3. Ecology of genus Porphyromonas in canine periodontal disease. (United States)

    Isogai, H; Kosako, Y; Benno, Y; Isogai, E


    Asaccharolytic pigmented Porphyromonas species, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were isolated from the plaque of adult dogs, but not from any oral sites of puppies and adolescent dogs. With age-dependency, the proportion of Porphyromonas species in the flora of plaque increased. Isolation of the genus Porphyromonas was clearly associated with the progress of periodontol disease. We suggested that Porphyromonas is the exogenous organism and obligate pathogen for canine periodontal diseases.

  4. Effect of Japanese Green Tea Extract on Canine Periodontal Diseases


    Isogai, E.; Isogai, H.; Kimura, K.; Nishikawa, T.; Fujii, N.; Benno, Y.


    Asaccharolytic pigmented Porphyromonas strains were isolated from the plaque of dogs with gingivitis and periodontitis. Various species of Porphyromonas, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were detectable. Canine Porphyromonas were sensitive to Japanese green tea extract (JGTE). We examined the effects of dietary JGTE on periodontal diseases. A special diet was prepared on the basis of the minimum inhibitory concentration (MIC: 0.8 mg/ml) of ...

  5. Penetration of ASM 981 in canine skin: a comparative study. (United States)

    Gutzwiller, Meret E Ricklin; Reist, Martin; Persohn, Elke; Peel, John E; Roosje, Petra J


    ASM 981 has been developed for topical treatment of inflammatory skin diseases. It specifically inhibits the production and release of pro-inflammatory cytokines. We measured the skin penetration of ASM 981 in canine skin and compared penetration in living and frozen skin. To make penetration of ASM 981 visible in dog skin, tritium labelled ASM 981 was applied to a living dog and to defrosted skin of the same dog. Using qualitative autoradiography the radioactive molecules were detected in the lumen of the hair follicles until the infundibulum, around the superficial parts of the hair follicles and into a depth of the dermis of 200 to 500 microm. Activity could not be found in deeper parts of the hair follicles, the dermis or in the sebaceous glands. Penetration of ASM 981 is low in canine skin and is only equally spread in the upper third of the dermis 24 hours after application. Penetration in frozen skin takes even longer than in living canine skin but shows the same distribution.

  6. T cell cytokine gene polymorphisms in canine diabetes mellitus. (United States)

    Short, Andrea D; Catchpole, Brian; Kennedy, Lorna J; Barnes, Annette; Lee, Andy C; Jones, Chris A; Fretwell, Neale; Ollier, William E R


    Insulin-deficiency diabetes in dogs shares some similarities with human latent autoimmune diabetes of adults (LADA). Canine diabetes is likely to have a complex pathogenesis with multiple genes contributing to overall susceptibility and/or disease progression. An association has previously been shown between canine diabetes and MHC class II genes, although other genes are also likely to contribute to the genetic risk. Potential diabetes susceptibility genes include immuno-regulatory TH1/TH2 cytokines such as IFNgamma, IL-12, IL-4 and IL-10. We screened these candidate genes for single nucleotide polymorphisms (SNPs) in a range of different dog breeds using dHPLC analysis and DNA sequencing. Thirty-eight of the SNPs were genotyped in crossbreed dogs and seven other breed groups (Labrador Retriever, West Highland White Terrier, Collie, Schnauzer, Cairn Terrier, Samoyed and Cavalier King Charles Spaniel), which demonstrated substantial intra-breed differences in allele frequencies. When SNPs were examined for an association with diabetes by case:control analysis significant associations were observed for IL-4 in three breeds, the Collie, Cairn Terrier and Schnauzer and for IL-10 in the Cavalier King Charles Spaniel. These results suggest that canine cytokine genes regulating the TH1/TH2 immune balance might play a contributory role in determining susceptibility to diabetes in some breeds.

  7. Altered oxidative stress and carbohydrate metabolism in canine mammary tumors

    Directory of Open Access Journals (Sweden)

    K. Jayasri


    Full Text Available Aim: Mammary tumors are the most prevalent type of neoplasms in canines. Even though cancer induced metabolic alterations are well established, the clinical data describing the metabolic profiles of animal tumors is not available. Hence, our present investigation was carried out with the aim of studying changes in carbohydrate metabolism along with the level of oxidative stress in canine mammary tumors. Materials and Methods: Fresh mammary tumor tissues along with the adjacent healthy tissues were collected from the college surgical ward. The levels of thiobarbituric acid reactive substances (TBARS, glutathione, protein, hexose, hexokinase, glucose-6-phosphatase, fructose-1, 6-bisphosphatase, and glucose-6-phosphate dehydrogenase (G6PD were analyzed in all the tissues. The results were analyzed statistically. Results: More than two-fold increase in TBARS and three-fold increase in glutathione levels were observed in neoplastic tissues. Hexokinase activity and hexose concentration (175% was found to be increased, whereas glucose-6-phosphatase (33%, fructose-1, 6-bisphosphatase (42%, and G6PD (5 fold activities were reduced in tumor mass compared to control. Conclusion: Finally, it was revealed that lipid peroxidation was increased with differentially altered carbohydrate metabolism in canine mammary tumors.

  8. A modified live canine parvovirus vaccine. II. Immune response. (United States)

    Carmichael, L E; Joubert, J C; Pollock, R V


    The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.

  9. Pathophysiology, diagnosis, and treatment of canine hip dysplasia

    International Nuclear Information System (INIS)

    Cook, J.L.; Tomlinson, J.L.; Constantinescu, G.M.


    Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education

  10. Adjuvant therapy with carboplatin and pamidronate for canine appendicular osteosarcoma. (United States)

    Kozicki, A R; Robat, C; Chun, R; Kurzman, I D


    Amputation and chemotherapy are the mainstay of treatment for canine appendicular osteosarcoma (OSA). In vitro studies have demonstrated anti-tumour activity of pamidronate against canine OSA. The purpose of this study was to assess the safety of adding pamidronate to standard post-operative carboplatin chemotherapy in 17 dogs with appendicular OSA treated with limb amputation. Median disease-free interval (DFI) and median survival time (MST) were evaluated as secondary endpoints. Incidence of side effects and treatment outcomes were compared to 14 contemporary control patients treated with carboplatin alone. There were no identified side effects to the pamidronate treatment. The median DFI for the study group was 185 days compared to 172 days for the control group (P = 0.90). The MST of the study group was 311 days compared to 294 days for the control group (P = 0.89). Addition of pamidronate to carboplatin chemotherapy for the treatment of canine appendicular OSA is safe and does not impair efficacy of standard carboplatin treatment. © 2013 Blackwell Publishing Ltd.

  11. Canine osteosarcoma cells exhibit resistance to aurora kinase inhibitors. (United States)

    Cannon, C M; Pozniak, J; Scott, M C; Ito, D; Gorden, B H; Graef, A J; Modiano, J F


    We evaluated the effect of Aurora kinase inhibitors AZD1152 and VX680 on canine osteosarcoma cells. Cytotoxicity was seen in all four cell lines; however, half-maximal inhibitory concentrations were significantly higher than in human leukaemia and canine lymphoma cells. AZD1152 reduced Aurora kinase B phosphorylation, indicating resistance was not because of failure of target recognition. Efflux mediated by ABCB1 and ABCG2 transporters is one known mechanism of resistance against these drugs and verapamil enhanced AZD1152-induced apoptosis; however, these transporters were only expressed by a small percentage of cells in each line and the effects of verapamil were modest, suggesting other mechanisms contribute to resistance. Our results indicate that canine osteosarcoma cells are resistant to Aurora kinase inhibitors and suggest that these compounds are unlikely to be useful as single agents for this disease. Further investigation of these resistance mechanisms and the potential utility of Aurora kinase inhibitors in multi-agent protocols is warranted. © 2013 Blackwell Publishing Ltd.

  12. Mechanical properties of canine osteosarcoma-affected antebrachia. (United States)

    Steffey, Michele A; Garcia, Tanya C; Daniel, Leticia; Zwingenberger, Allison L; Stover, Susan M


    To determine the influence of neoplasia on the biomechanical properties of canine antebrachia. Ex vivo biomechanical study. Osteosarcoma (OSA)-affected canine antebrachia (n = 12) and unaffected canine antebrachia (n = 9). Antebrachia were compressed in axial loading until failure. A load-deformation curve was used to acquire the structural mechanical properties of neoplastic and unaffected specimens. Structural properties and properties normalized by body weight (BW) and radius length were compared using analysis of variance (ANOVA). Modes of failure were compared descriptively. Neoplastic antebrachia fractured at, or adjacent to, the OSA in the distal radial diaphysis. Unaffected antebrachia failed via mid-diaphyseal radial fractures with a transverse cranial component and an oblique caudal component. Structural mechanical properties were more variable in neoplastic antebrachia than unaffected antebrachia, which was partially attributable to differences in bone geometry related to dog size. When normalized by dog BW and radial length, strength, stiffness, and energy to yield and failure, were lower in neoplastic antebrachia than in unaffected antebrachia. OSA of the distal radial metaphysis in dogs presented for limb amputation markedly compromises the structural integrity of affected antebrachia. However, biomechanical properties of affected bones was sufficient for weight-bearing, as none of the neoplastic antebrachia fractured before amputation. The behavior of tumor invaded bone under cyclic loading warrants further investigations to evaluate the viability of in situ therapies for bone tumors in dogs. © 2017 The American College of Veterinary Surgeons.

  13. Surgical treatments of the impacted canine tooth in young dogs

    International Nuclear Information System (INIS)

    Amimoto, A.; Iwamoto, S.; Hachimura, H.; Sasaki, K.; Taura, Y.; Nakama, S.; Yamanouchi, T.


    Surgical treatments of the impacted canine tooth were carried out in 8 young dogs, and the results were successful in 12 out of 14 cases (85.7%). The treatments consisting of surgical correction by immediate tipping movement, fenestration of the gingiva, and removal of the impacted tooth, were applied to 14 cases radiographically showing the immature tooth root and no abnormalities in the tooth root or alveolar bone. Impacted teeth were seen in 8 regions of the maxilla and 6 regions of the mandible. Mesioversion was seen in almost all maxillary impacted teeth, while linguoversion or lingual mesioversion in all mandibular cases. Surgical correction was carried out by immediate tipping movement after removal of the retained deciduous canine with or without resection of the alveolar bone. Fixation of the moved teeth was done using a wedge made from the deciduous canine root, which was driven into the vacant alveolar cavity after moving. An additional fixation using a steel wire and/or self-curing resin was done, if necessary

  14. Does contemporary canine diet cause cancer? ; A review

    Directory of Open Access Journals (Sweden)

    Joseph B Gentzel


    Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer

  15. Detection and genetic characterization of Canine parvovirus and Canine coronavirus strains circulating in district of Tirana in Albania. (United States)

    Cavalli, Alessandra; Desario, Costantina; Kusi, Ilir; Mari, Viviana; Lorusso, Eleonora; Cirone, Francesco; Kumbe, Ilirjan; Colaianni, Maria Loredana; Buonavoglia, Domenico; Decaro, Nicola


    An epidemiological survey for Canine parvovirus 2 (CPV-2) and Canine coronavirus (CCoV) was conducted in Albania. A total of 57 fecal samples were collected from diarrheic dogs in the District of Tirana during 2011-2013. The molecular assays detected 53 and 31 CPV- and CCoV-positive specimens, respectively, with mixed CPV-CCoV infections diagnosed in 28 dogs. The most frequently detected CPV type was 2a, whereas IIa was the predominant CCoV subtype. A better comprehension of the CPV-CCoV epidemiology in eastern European countries will help to assess the most appropriate vaccination strategies to prevent disease due to infections with these widespread agents of acute gastroenteritis in the dog.

  16. Impacted maxillary canines and root resorption of adjacent teeth: A retrospective observational study. (United States)

    Guarnieri, R; Cavallini, C; Vernucci, R; Vichi, M; Leonardi, R; Barbato, E


    The prevalence of impacted maxillary canine is reported to be between 1% and 3%. The lack of monitoring and the delay in the treatment of the impacted canine can cause different complications such as: displacement of adjacent teeth, loss of vitality of neighbouring teeth, shortening of the dental arch, follicular cysts, canine ankylosis, recurrent infections, recurrent pain, internal resorption of the canine and the adjacent teeth, external resorption of the canine and the adjacent teeth, combination of these factors. An appropriate diagnosis, accurate predictive analysis and early intervention are likely to prevent such undesirable effects. The objective is to evaluate, by means of a retrospective observational study, the possibility of carrying out a predictive analysis of root resorption adjacent to the impacted canines by means of orthopantomographs, so as to limit the prescription of additional 3D radiography. 120 subjects with unilateral or bilateral maxillary impacted canine were examined and 50 patients with 69 impacted maxillary canine (22 male, 28 female; mean age: 11.7 years) satisfied the inclusion criteria of the study. These patients were subjected to a basic clinical and radiographic investigation (orthopantomographs and computerized tomography). All panoramic films were viewed under standardized conditions for the evaluation of two main variables: maxillary canine angulations (a, b, g angles) and the overlapping between the impacted teeth and the lateral incisor (Analysis of Lindauer). Binary logistic regression was used to estimate the likelihood of resorbed lateral incisors depending on sector location and angle measurements. Results indicated that b angle has the greatest influence on the prediction of root resorption (predictive value of b angle = 76%). If β angle <18° and Lindauer = I, the probability of resorption is 0.06. Evaluation of b angle and superimposition lateral incisor/impacted canine analysed on orthopantomographs could be one of

  17. A survey of canine tick-borne diseases in India

    Directory of Open Access Journals (Sweden)

    Coleman Glen T


    Full Text Available Abstract Background There are few published reports on canine Babesia, Ehrlichia, Anaplasma, Hepatozoon and haemotropic Mycoplasma infections in India and most describe clinical disease in individual dogs, diagnosed by morphological observation of the microorganisms in stained blood smears. This study investigated the occurrence and distribution of canine tick-borne disease (TBD pathogens using a combination of conventional and molecular diagnostic techniques in four cities in India. Results On microscopy examination, only Hepatozoon gamonts were observed in twelve out of 525 (2.3%; 95% CI: 1.2, 4 blood smears. Using polymerase chain reaction (PCR, a total of 261 from 525 dogs (49.7%; 95% CI: 45.4, 54.1 in this study were infected with one or more canine tick-borne pathogen. Hepatozoon canis (30%; 95% CI: 26.0, 34.0 was the most common TBD pathogen found infecting dogs in India followed by Ehrlichia canis (20.6%; 95% CI: 17.2, 24.3, Mycoplasma haemocanis (12.2%; 95% CI: 9.5, 15.3, Anaplasma platys (6.5%; 95% CI: 4.5, 8.9, Babesia vogeli (5.5%, 95% CI: 3.7, 7.8 and Babesia gibsoni (0.2%, 95% CI: 0.01, 1.06. Concurrent infection with more than one TBD pathogen occurred in 39% of cases. Potential tick vectors, Rhipicephalus (most commonly and/or Haemaphysalis ticks were found on 278 (53% of dogs examined. Conclusions At least 6 species of canine tick-borne pathogens are present in India. Hepatozoon canis was the most common pathogen and ticks belonging to the genus Rhipicephalus were encountered most frequently. Polymerase chain reaction was more sensitive in detecting circulating pathogens compared with peripheral blood smear examination. As co-infections with canine TBD pathogens were common, Indian veterinary practitioners should be cognisant that the discovery of one such pathogen raises the potential for multiple infections which may warrant different clinical management strategies.

  18. Evaluation of the biological differences of canine and human factor VIII in gene delivery: Implications in human hemophilia treatment (United States)

    The canine is the most important large animal model for testing novel hemophilia A(HA) treatment. It is often necessary to use canine factor VIII (cFIII) gene or protein for the evaluation of HA treatment in the canine model. However, the different biological properties between cFVIII and human FVII...

  19. Evaluation of microbial contamination of canine plasma eyedropper bottles following clinical use in canine patients. (United States)

    Strauss, Rachel A; Genschel, Ulrike; Allbaugh, Rachel A; Sebbag, Lionel; Ben-Shlomo, Gil


    To investigate microbial contamination of canine plasma eye drops when used clinically and to compare the effect of two different eyedropper bottles on contamination rate. Forty-six bottles containing plasma were randomly dispensed for use on 42 dogs with ulcerative keratitis. Of these, 23 were standard eyedropper bottles and 23 were Novelia ® bottles designed to prevent contamination. After use for up to 2 weeks, samples for bacterial culture were obtained from a drop of plasma, the bottle tip, the plasma inside the bottle, and the corneal surface. Fungal culture was performed from a drop of plasma. The overall microbial contamination rate was 17.4% (8/46 bottles); however, only one bottle had growth from the plasma inside the bottle. There was a lower contamination rate of Novelia ® bottles (3/23 = 13.0%) compared to standard bottles (5/23 = 21.7%), but this difference was not statistically significant (P = .57). There were also no significant differences in contamination rate of bottles used greater than 7 days compared to less than or equal to 7 days, or in bottles used greater than 4 times daily compared to 4 times daily or less. Three corneal samples (6.5%) had bacterial growth, but none matched contamination from the bottles. Novelia ® bottles may decrease contamination of plasma eye drops used clinically. However, while microbial contamination of plasma bottles was documented, no clinically relevant complications were observed. This study supports safe use of plasma eye drops for up to 2 weeks when refrigerated and dispensed from either Novelia ® or standard eyedropper bottles. © 2018 American College of Veterinary Ophthalmologists.

  20. Automated tru-cut imaging-guided core needle biopsy of canine ...

    African Journals Online (AJOL)

    The purpose of this study was to evaluate the diagnostic value of imaging-guided core needle biopsy for canine orbital mass diagnosis. A second excisional biopsy obtained during surgery or necropsy was used as the reference standard. A prospective feasibility study was conducted in 23 canine orbital masses at a single ...


    NARCIS (Netherlands)



    A canine model is described to study the tolerance of the pancreas to intra-operative radiotherapy (IORT). The canine pancreas is a horseshoe-shaped organ. To create a homogeneous delivery of IORT to the whole pancreas surgical manipulation is necessary which may induce pancreatitis. A resection of

  2. Comparative Analysis of Human and Canine Campylobacter upsaliensis Isolates by Amplified Fragment Length Polymorphism

    DEFF Research Database (Denmark)

    Damborg, Peter; Guardabassi, Luca; Pedersen, Karl


    Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...

  3. The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D

    Directory of Open Access Journals (Sweden)

    MarkéŽta Vaňkov‡á


    Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.

  4. Effect of high contents of dietary animal-derived protein or carbohydrates on canine fecal microbiota

    NARCIS (Netherlands)

    Hang, I.; Rinttila, T.; Zentek, J.; Kettunen, A.; Alaja, S.; Apajalahti, J.A.; Harmoinen, J.; Vos, de W.M.; Spillmann, T.


    BACKGROUND: Considerable evidence suggests that food impacts both the gastro-intestinal (GI) function and the microbial ecology of the canine GI tract. The aim of this study was to evaluate the influence of high-carbohydrate (HC), high-protein (HP) and dry commercial (DC) diets on the canine colonic

  5. Sequence-independent VIDISCA-454 technique to discover new viruses in canine livers

    NARCIS (Netherlands)

    van der Heijden, Mitzi; de Vries, Michel; van Steenbeek, Frank G.; Favier, Robert P.; Deijs, Martin; Brinkhof, Bas; Rothuizen, Jan; van der Hoek, Lia; Penning, Louis C.


    In many mammals, viruses cause hepatitis. Despite many efforts a specific virus responsible for canine idiopathic hepatitis has not been identified. The discovery of a viral etiology in canine hepatitis will promote the development of specific drugs and vaccines for the treatment of idiopathic

  6. Vertical periodontal ligament distraction--a new method for aligning ankylosed and displaced canines. (United States)

    Wilmes, Benedict; Drescher, Dieter


    In the course of a clinical pilot study we tested the vertical periodontal ligament (V-PDL) distraction as a means of aligning ankylosed upper canines. The objective of this study was to analyze the appropriateness und effectiveness of this method. The ankylosed upper canines of five female patients aged between 16 und 19 years were surgically exposed, luxated, and after a latency period of 5 to 7 days, distracted at a rate of 0.5 mm per day. The installed distractors were borne by the periodontal-mucosa, the periodontal-mucosa and the bone, or by the bone exclusively. We evaluated the distraction distance and time and degree of hard and soft tissue generation present in the region surrounding the distracted teeth. All canines were aligned after a mean distraction period of 43.2 days (+/- 3.6 days). The mean distraction distance was 10.8 mm. Three canines had defects at the cemento-enamel junction, and one canine had to be extracted due to a large defect at the root. Vertical PDL distraction is a minimally-invasive therapy to align ankylosed impacted canines. Even if the long-term prognosis of distracted canines with defects is uncertain, the patient benefits from the vertical PDL distraction because both hard and soft tissues are generated in the vicinity of the distracted canine.

  7. The avian-origin H3N2 canine influenza virus has limited replication in swine (United States)

    A genetically and antigenically distinct H3N2 canine influenza of avian-origin was detected in March of 2015 in Chicago, Illinois. A subsequent outbreak was reported with over 1,000 dogs in the Midwest affected. The potential for canine-to-swine transmission was unknown. Experimental infection in pi...

  8. Nd : YAG surgical laser effects in canine prostate tissue: temperature and damage distribution

    NARCIS (Netherlands)

    van Nimwegen, S. A.; L'Eplattenier, H. F.; Rem, A. I.; van der Lugt, J. J.; Kirpensteijn, J.


    An in vitro model was used to predict short-term, laser-induced, thermal damage in canine prostate tissue. Canine prostate tissue samples were equipped with thermocouple probes to measure tissue temperature at 3, 6, 9 and 12 mm depths. The tissue surface was irradiated with a Nd:YAG laser in contact

  9. Orthodontic treatment of a stubborn palatally ectopic canine: a case report. (United States)

    Al-Musfir, Tumadher M; Morris, David O


    This is a case report that highlights a different treatment approach in dealing with palatally ectopic canines. The modified transpalatal arch with an 'active' arm was used to align a palatally ectopic canine with 'push' mechanics after the initial use of more conventional 'pull' mechanics (piggy-back archwire technique) had failed.

  10. Detection of Ammonium Nitrate Variants by Canine: A Study of Generalization between Like Substances (United States)


    Memorandum Report Homemade explosive Detector dog Canine behavior/ learning Ammonium nitrate Canine training 61-4687-08 Office...varying temperatures and humidities...presence of contaminants, the form in which the AN is found (i.e. prill, ground, or crystalline), and environmental conditions (i.e. temperature and

  11. Molecular surveillance of traditional and emerging pathogens associated with canine infectious respiratory disease. (United States)

    Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio


    A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Genome Sequence of Canine Polyomavirus in Respiratory Secretions of Dogs with Pneumonia of Unknown Etiology. (United States)

    Delwart, Eric; Kapusinszky, Beatrix; Pesavento, Patricia A; Estrada, Marko; Seguin, M Alexis; Leutenegger, Christian M


    We report here the first canine polyomavirus genome, identified by metagenomics in respiratory secretions of two dogs with severe pneumonia, which tested negative for all canine respiratory pathogens except Mycoplasma cynos The isolate, Canis familiaris polyomavirus 1 (DogPyV-1), is a beta polyomavirus whose closest known LT antigen relatives are primate polyomaviruses. Copyright © 2017 Delwart et al.

  13. National clinical guidelines for management of the palatally ectopic maxillary canine. (United States)

    Husain, J; Burden, D; McSherry, P; Morris, D; Allen, M


    This review summarises updated clinical guidelines produced by the Clinical Standards Committee of the Faculty of Dental Surgery, Royal College of Surgeons of England (FDSRCS). This guideline on the management of the palatally ectopic maxillary canine illustrates the information contained in the recently updated online version. The timely recognition of ectopic canines is important for the overall management of the dentition. This review illustrates five management strategies for ectopic permanent canines: interceptive treatment by extraction of the deciduous canine, surgical exposure and orthodontic alignment, surgical removal of the palatally ectopic permanent canine, auto-transplantation and no active treatment/leave and observe. The current available evidence for each of these management options has been evaluated and awarded a grade used by the Scottish Intercollegiate Guidelines Network.

  14. Oncolytic virotherapy in veterinary medicine: current status and future prospects for canine patients

    Directory of Open Access Journals (Sweden)

    Patil Sandeep S


    Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.

  15. A re-evaluation of subspecific variation and canine dimorphism in woolly spider monkeys (Brachyteles arachnoides). (United States)

    Leigh, S R; Jungers, W L


    A recent study suggests that differing populations of woolly spider monkeys exhibit a substantial degree of morphological, cytogenetic, and behavioral variation. We re-evaluate the differences between populations in the degree of canine tooth height sexual dimorphism and in the frequency of thumbs. Statistical analysis of variation in the degree of canine sexual dimorphism between these populations fails to provide strong evidence for subspecific variation: differences in the degree of canine dimorphism cannot be considered statistically significant. Differences between populations in the frequency of thumbs are, however, statistically significant. The lack of clear distinctions between populations in the degree of canine dimorphism complicates assessments of behavioral variation between these populations. We suggest that the level of geographic variation in woolly spider monkey canine dimorphism is not consistent with subspecific status.

  16. Antiviral effect of lithium chloride on infection of cells by canine parvovirus. (United States)

    Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun


    Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.

  17. Canine Babesiosis in China Caused by Babesia gibsoni: A Molecular Approach.

    Directory of Open Access Journals (Sweden)

    Da-Wei Yao


    Full Text Available To provide a point of reference to study the epidemiology and clinical expression of canine babesiosis in China.A total of 30 dogs infected with canine babesiosis were evaluated by mean of clinical history, physical examination, hematological, restriction fragment length polymorphism of PCR products (PCR-RFLP and sequencing analysis.The most prevalent clinical abnormalities were lethargy (100%, anorexia (100%, pale or icteric mucous membranes (80%, fever (70% and dark urine (70%. Hematology parameters revealed that anemia and thrombocytopenia were the major abnormalities in blood of dogs infected with canine babesia. The results of PCR-RFLP and sequencing analysis indicated that B. gibsoni was the main species responsible for canine babesiosis cases at the time of the study in Nanjing, China.The results provide valuable information for better understanding of the epidemiology of canine babesiosis in China.

  18. Radiographic assessment of dental anomalies in patients with ectopic maxillary canines

    DEFF Research Database (Denmark)

    Sørensen, Helle Budtz; Artmann, Lone; Larsen, Helle Juul


    dental deviations in cases with either palatal or labial ectopic canines. Design. Panoramic and intra-oral radiographs from 50 patients with palatally located (38 females and 12 males) and 19 patients with labially located ectopic canines (11 females and 8 males), aged 10 years, 2 months-18 years, 1...... month, were analysed. Dental deviations registered were crown and root malformations, agenesis, and eruption deviations. Registrations were performed in the maxillary incisor field and in the dentition in general. Results. The study documented that palatally as well as labially located ectopic canines...... can occur in dentitions without other dental deviations. Dental deviations occurred in approximately two-thirds of all cases, more often in females and in cases with palatally located canines. More than half of the females with palatally located canines had deviations in the maxillary incisors...

  19. Maxillary canine displacement and genetically determined predisposition to disturbed development of the dentition. (United States)

    Stahl, Franka; Grabowski, Rosemarie


    The relationship between maxillary canine displacement and the simultaneous occurrence of "genetically determined predisposition to disturbed development of the dentition" as defined by Hoffmeister was investigated in 675 patients. Panoramic radiographs taken of each patient during the first and the second mixed dentition periods were evaluated. Canine inclination and the distance between the tip of the canine and a line connecting the cusps of the molars were computed in five different age groups according to Dausch-Neumann. Statistical analysis revealed 34 patients with "potential canine displacement", who exhibited further symptoms of "genetically determined predisposition to disturbed development of the dentition" significantly more frequently than the total group. The symptoms concerned were agenesia, displaced tooth buds, rotated or tilted incisors, aplasia and microdontia of lateral incisors. Careful follow-ups in patients with a predisposition to disturbed dental development enables risks to be anticipated and canine displacement to be detected at an early stage.

  20. How far is the root apex of a unilateral impacted canine from the root apices' arch form? (United States)

    Kim, Sung-Hun; Kim, You-Min; Oh, Sewoong; Kim, Seong-Sik; Park, Soo-Byung; Son, Woo-Sung; Kim, Yong-Il


    The purpose of this study was to determine the arch form of the root apices of normally erupting teeth and then determine the differences in the location of the apex of impacted canines relative to normally erupting canines. In addition, we sought to determine whether the labiopalatal position of the impacted canines influences the position of the apices. The study included 21 patients with unerupted canines that subsequently had a normal eruption, 21 patients with palatally impacted canines, 27 patients with labially impacted canines, and 17 patients with midalveolus impacted canines. Images were obtained using cone beam computed tomography, and the x, y, and z coordinates of the root apices were determined using Ondemand3D software (Cybermed Co., Seoul, Korea). Two-dimensional coordinates were converted from acquired 3-dimensional coordinates via projection on a palatal plane, and the Procrustes method was used to process the converted 2-dimensional coordinates and to draw the arch forms of the root apices. Finally, we measured the extent of root apex deviation from the arch forms of the root apices. Normally erupting canines showed that even though calcifications may be immature, their positions were aligned with a normal arch form. The root apices of the impacted canines were an average of 6.572 mm away from the root apices' arch form, whereas those of the contralateral nonimpacted canines were an average distance of 2.221 mm away, a statistically significant difference. The palatally impacted canines' root apices distribution tended toward the first premolar root apices. Incompletely calcified, unerupted teeth with a subsequent normal eruption showed a normal arch form of the root apices. The root apices of impacted canines were farther from the arch forms than were the nonimpacted canines. Also, the root apices of impacted canines in the palatal area showed distributions different from those of the other impacted canine groups. Copyright © 2017 American

  1. A randomized clinical study of two interceptive approaches to palatally displaced canines. (United States)

    Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela


    This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.

  2. Effects of Carbenoxolone on the Canine Pituitary-Adrenal Axis. (United States)

    Teshima, Takahiro; Matsumoto, Hirotaka; Okusa, Tomoko; Nakamura, Yumi; Koyama, Hidekazu


    Cushing's disease caused by pituitary corticotroph adenoma is a common endocrine disease in dogs. A characteristic biochemical feature of corticotroph adenomas is their relative resistance to suppressive negative feedback by glucocorticoids. The abnormal expression of 11beta-hydroxysteroid dehydrogenase (11HSD), which is a cortisol metabolic enzyme, is found in human and murine corticotroph adenomas. Our recent studies demonstrated that canine corticotroph adenomas also have abnormal expression of 11HSD. 11HSD has two isoforms in dogs, 11HSD type1 (HSD11B1), which converts cortisone into active cortisol, and 11HSD type2 (HSD11B2), which converts cortisol into inactive cortisone. It has been suggested that glucocorticoid resistance in corticotroph tumors is related to the overexpression of HSD11B2. Therefore it was our aim to investigate the effects of carbenoxolone (CBX), an 11HSD inhibitor, on the healthy dog's pituitary-adrenal axis. Dogs were administered 50 mg/kg of CBX twice each day for 15 days. During CBX administration, no adverse effects were observed in any dogs. The plasma adrenocorticotropic hormone (ACTH), and serum cortisol and cortisone concentrations were significantly lower at day 7 and 15 following corticotropin releasing hormone stimulation. After completion of CBX administration, the HSD11B1 mRNA expression was higher, and HSD11B2 mRNA expression was significantly lower in the pituitaries. Moreover, proopiomelanocortin mRNA expression was lower, and the ratio of ACTH-positive cells in the anterior pituitary was also significantly lower after CBX treatment. In adrenal glands treated with CBX, HSD11B1 and HSD11B2 mRNA expression were both lower compared to normal canine adrenal glands. The results of this study suggested that CBX inhibits ACTH secretion from pituitary due to altered 11HSD expressions, and is potentially useful for the treatment of canine Cushing's disease.

  3. Genetic Mapping of Novel Loci Affecting Canine Blood Phenotypes.

    Directory of Open Access Journals (Sweden)

    Michelle E White

    Full Text Available Since the publication of the dog genome and the construction of high-quality genome-wide SNP arrays, thousands of dogs have been genotyped for disease studies. For many of these dogs, additional clinical phenotypes are available, such as hematological and clinical chemistry results collected during routine veterinary care. Little is known about the genetic basis of variation in blood phenotypes, but this variation may play an important role in the etiology and progression of many diseases. From a cohort of dogs that had been previously genotyped on a semi-custom Illumina CanineHD array for various genome-wide association studies (GWAS at Cornell University Hospital for Animals, we chose 353 clinically healthy, adult dogs for our analysis of clinical pathologic test results (14 hematological tests and 25 clinical chemistry tests. After correcting for age, body weight and sex, genetic associations were identified for amylase, segmented neutrophils, urea nitrogen, glucose, and mean corpuscular hemoglobin. Additionally, a strong genetic association (P = 8.1×10-13 was evident between a region of canine chromosome 13 (CFA13 and alanine aminotransferase (ALT, explaining 23% of the variation in ALT levels. This region of CFA13 encompasses the GPT gene that encodes the transferase. Dogs homozygous for the derived allele exhibit lower ALT activity, making increased ALT activity a less useful marker of hepatic injury in these individuals. Overall, these associations provide a roadmap for identifying causal variants that could improve interpretation of clinical blood tests and understanding of genetic risk factors associated with diseases such as canine diabetes and anemia, and demonstrate the utility of holistic phenotyping of dogs genotyped for disease mapping studies.

  4. Prognostic factors in canine appendicular osteosarcoma - a meta-analysis. (United States)

    Boerman, Ilse; Selvarajah, Gayathri T; Nielen, Mirjam; Kirpensteijn, Jolle


    Appendicular osteosarcoma is the most common malignant primary canine bone tumor. When treated by amputation or tumor removal alone, median survival times (MST) do not exceed 5 months, with the majority of dogs suffering from metastatic disease. This period can be extended with adequate local intervention and adjuvant chemotherapy, which has become common practice. Several prognostic factors have been reported in many different studies, e.g. age, breed, weight, sex, neuter status, location of tumor, serum alkaline phosphatase (SALP), bone alkaline phosphatase (BALP), infection, percentage of bone length affected, histological grade or histological subtype of tumor. Most of these factors are, however, only reported as confounding factors in larger studies. Insight in truly significant prognostic factors at time of diagnosis may contribute to tailoring adjuvant therapy for individual dogs suffering from osteosarcoma. The objective of this study was to systematically review the prognostic factors that are described for canine appendicular osteosarcoma and validate their scientific importance. A literature review was performed on selected studies and eligible data were extracted. Meta-analyses were done for two of the three selected possible prognostic factors (SALP and location), looking at both survival time (ST) and disease free interval (DFI). The third factor (age) was studied in a qualitative manner. Both elevated SALP level and the (proximal) humerus as location of the primary tumor are significant negative prognostic factors for both ST and DFI in dogs with appendicular osteosarcoma. Increasing age was associated with shorter ST and DFI, however, was not statistically significant because information of this factor was available in only a limited number of papers. Elevated SALP and proximal humeral location are significant negative prognosticators for canine osteosarcoma.

  5. Genetic Mapping of Novel Loci Affecting Canine Blood Phenotypes. (United States)

    White, Michelle E; Hayward, Jessica J; Stokol, Tracy; Boyko, Adam R


    Since the publication of the dog genome and the construction of high-quality genome-wide SNP arrays, thousands of dogs have been genotyped for disease studies. For many of these dogs, additional clinical phenotypes are available, such as hematological and clinical chemistry results collected during routine veterinary care. Little is known about the genetic basis of variation in blood phenotypes, but this variation may play an important role in the etiology and progression of many diseases. From a cohort of dogs that had been previously genotyped on a semi-custom Illumina CanineHD array for various genome-wide association studies (GWAS) at Cornell University Hospital for Animals, we chose 353 clinically healthy, adult dogs for our analysis of clinical pathologic test results (14 hematological tests and 25 clinical chemistry tests). After correcting for age, body weight and sex, genetic associations were identified for amylase, segmented neutrophils, urea nitrogen, glucose, and mean corpuscular hemoglobin. Additionally, a strong genetic association (P = 8.1×10-13) was evident between a region of canine chromosome 13 (CFA13) and alanine aminotransferase (ALT), explaining 23% of the variation in ALT levels. This region of CFA13 encompasses the GPT gene that encodes the transferase. Dogs homozygous for the derived allele exhibit lower ALT activity, making increased ALT activity a less useful marker of hepatic injury in these individuals. Overall, these associations provide a roadmap for identifying causal variants that could improve interpretation of clinical blood tests and understanding of genetic risk factors associated with diseases such as canine diabetes and anemia, and demonstrate the utility of holistic phenotyping of dogs genotyped for disease mapping studies.

  6. Interspecies dynamics among bacteria associated with canine periodontal disease. (United States)

    Sanguansermsri, P; Nobbs, A H; Jenkinson, H F; Surarit, R


    The etiology and pathogenic mechanisms associated with canine periodontal disease are less well understood than the disease in humans. In this study we have reconstructed defined consortia biofilms in vitro of microorganisms identified as prevalent in a same-breed cohort of dogs with or without periodontal disease. Frederiksenia canicola and Neisseria canis were selected as potential early colonizers of salivary pellicle, and Fusobacterium nucleatum and Porphyromonas gulae were included as high incidence canine oral bacteria. N. canis formed a biofilm substratum under aerobic conditions, but was unable to tolerate anaerobic conditions. Fr. canicola exhibited synergistic biofilm growth with Po. gulae under anaerobic conditions, but displayed an antagonistic relationship with Fu. nucleatum. However, strong co-adhesion between Fu. nucleatum and Po. gulae was able to overcome the inhibitory effects of Fr. canicola to facilitate three-species biofilm formation. Parvimonas micra, an anaerobic, asaccharolytic Gram-positive coccus found only under disease conditions in vivo, was able to form biofilms in conjunction with Fr. canicola and Po. gulae. Furthermore, the specific proteolytic activities of biofilms containing Fr. canicola and Po. gulae or Fu. nucleatum and Po. gulae were increased several-fold upon the addition of Pa. micra. This suggests that anaerobic cocci such as Pa. micra might provide a catalyst for progressive tissue destruction, inflammation and alveolar bone loss in canine periodontal disease, in keeping with the keystone-pathogen hypothesis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Appearance of the canine meninges in subtraction magnetic resonance images. (United States)

    Lamb, Christopher R; Lam, Richard; Keenihan, Erin K; Frean, Stephen


    The canine meninges are not visible as discrete structures in noncontrast magnetic resonance (MR) images, and are incompletely visualized in T1-weighted, postgadolinium images, reportedly appearing as short, thin curvilinear segments with minimal enhancement. Subtraction imaging facilitates detection of enhancement of tissues, hence may increase the conspicuity of meninges. The aim of the present study was to describe qualitatively the appearance of canine meninges in subtraction MR images obtained using a dynamic technique. Images were reviewed of 10 consecutive dogs that had dynamic pre- and postgadolinium T1W imaging of the brain that was interpreted as normal, and had normal cerebrospinal fluid. Image-anatomic correlation was facilitated by dissection and histologic examination of two canine cadavers. Meningeal enhancement was relatively inconspicuous in postgadolinium T1-weighted images, but was clearly visible in subtraction images of all dogs. Enhancement was visible as faint, small-rounded foci compatible with vessels seen end on within the sulci, a series of larger rounded foci compatible with vessels of variable caliber on the dorsal aspect of the cerebral cortex, and a continuous thin zone of moderate enhancement around the brain. Superimposition of color-encoded subtraction images on pregadolinium T1- and T2-weighted images facilitated localization of the origin of enhancement, which appeared to be predominantly dural, with relatively few leptomeningeal structures visible. Dynamic subtraction MR imaging should be considered for inclusion in clinical brain MR protocols because of the possibility that its use may increase sensitivity for lesions affecting the meninges. © 2014 American College of Veterinary Radiology.

  8. Direct magnetic resonance arthrography of the canine elbow

    Directory of Open Access Journals (Sweden)

    Yauheni Zhalniarovich


    Full Text Available This study compares the effects of four dilutions of the gadolinium-containing contrast media (1:100; 1:400; 1:800; 1:1,200 administered to the elbow on the quality of magnetic resonance images. All the examined dilutions had a positive effect on image quality, and 1:800 was regarded as the optimal dilution of gadolinium for viewing the elbow because it imparted good contrast to the joint cavity without obliterating the contours of articular surfaces. Transverse, sagittal, and dorsal low-field magnetic resonance images were obtained in 24 canine cadaver front limbs. The musculus biceps brachii, m. triceps brachii, m. extensor carpi radialis, m. flexor carpi ulnaris, the articular surfaces, the medial coronoid process and the anconeal process of the ulna were well visualized by High Resolution Gradient Echo, XBONE T2 and Spin Echo T1 sequences in the sagittal plane. The biceps brachii, pronator teres, flexor carpi radialis, extensor digitorum communis, extensor carpi radialis, deltoid muscle and the articular surface of the medial condyle of the humerus were very well visualized by 3D SST1 and XBONE T2 sequences in the transverse plane. The triceps brachii muscle, extensor digitorum lateralis muscle, superficial digital flexor, deep digital flexor and the medial condyle of the humerus were very well visualized by the Spin Echo T1 sequence in the dorsal plane. This article describes for the first time the use of the gadolinium contrast agent administered to the canine elbow joint during magnetic resonance modality. Magnetic resonance arthrography can be a helpful visualization technique in treating canine soft tissue elbow injury.

  9. Identification of 5α-reductase isoenzymes in canine skin. (United States)

    Bernardi de Souza, Lucilene; Paradis, Manon; Zamberlam, Gustavo; Benoit-Biancamano, Marie-Odile; Price, Christopher


    Alopecia X in dogs is a noninflammatory alopecia that may be caused by a hormonal dysfunction. It may be similar to androgenic alopecia in men that is caused by the effect of dihydrotestosterone (DHT). The 5α-reductase isoenzymes, 5αR1 and 5αR2, and a recently described 5αR3, are responsible for the conversion of testosterone into DHT. However, which 5α-reductases are present in canine skin has not yet been described. The main objective of this study was to determine the pattern of expression of 5α-reductase genes in canine skin. Skin biopsies were obtained from healthy, intact young-mature beagles (three males, four females) at three anatomical sites normally affected by alopecia X (dorsal neck, back of thighs and base of tail) and two sites generally unaffected (dorsal head and ventral thorax). Prostate samples (n = 3) were collected as positive controls for 5α-reductase mRNA abundance measurement by real-time PCR. We detected mRNA encoding 5αR1 and 5αR3 but not 5αR2. There were no significant differences in 5αR1 and 5αR3 mRNA levels between the different anatomical sites, irrespective of gender (P > 0.05). Moreover, the mean mRNA abundance in each anatomical site did not differ between males and females (P > 0.05). To the best of the authors' knowledge, this is the first study demonstrating the expression of 5α-reductases in canine skin and the expression of 5αR3 in this tissue. These results may help to elucidate the pathogenesis of alopecia X and to determine more appropriate treatments for this disorder. © 2015 ESVD and ACVD.

  10. Characterization of lipoproteins in human and canine cerebrospinal fluid (CSF)

    International Nuclear Information System (INIS)

    Pitas, R.E.; Weisgraber, K.H.; Boyles, J.K.; Lee, S.; Mahley, R.W.


    Previously the authors demonstrated that rat brain astrocytes in vitro synthesize and secrete apo-E and possess apo-B,E(LDL) receptors. The apo-E secreted by astrocytes and apo-E in rat brain extracts differed from serum apo-E in two respects. Brain apo-E had a higher apparent molecular weight and a higher percentage of more acidic isoforms. To characterize further the apo-E within the central nervous system, apo-E in human and canine CSF was investigated. Compared to plasma apo-E, CSF apo-E had a higher apparent M/sub r/ and a higher percentage of acidic isoforms which were sialylated, as shown by neuraminidase digestion. The apo-E in human CSF was approx.5-10% of the plasma level. In CSF 60-80% of the apo-E was in lipoproteins with d = 1.09-1.15. The remainder of the apo-E was in the d > 1.21 fraction. Human CSF lipoproteins were primarily spherical (110-190 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) and spheres (100-150 A). The CSF also contained apo-AI in the d = 1.09-1.15 g/ml fraction. Human CSF lipoproteins containing both apo-E and apo-AI were isolated on an anti-apo-E affinity column, suggesting that apo-E and AI occurred in the same particles. The CSF apo-E-containing lipoproteins competed for binding of 125 I-LDL to the apo-B,E(LDL) receptor. There was no detectable apo-B in CSF. These data suggest that CSF lipoproteins might transport lipid and regulate lipid homeostasis within the brain

  11. Resident Macrophages and Lymphocytes in the Canine Endometrium. (United States)

    Pires, M A; Payan-Carreira, R


    Resident immune cells play a major role in endometrial immunity and in tissue homoeostasis. This study aimed to analyse the distribution of macrophages, B and T lymphocytes (respectively, Mø, B-Lym and T-Lym) in the canine endometrium throughout the oestrous cycle and in late involution (at the proestrus stage post-parturition). An immunohistochemistry technique was used on samples from 50 post-pubertal healthy female dogs, of which five in late post-partum. The distribution of resident immune cells was analysed in three endometrial layers (superficial, intermediate and basal areas). Mø, B-Lym and T-Lym were demonstrated to reside in the endometrium in all the stages of the canine cycle; their numbers being considerably higher during late involution. T-Lym were scattered in the stroma or amidst the glandular epithelium, constituting the predominant immune cell population in anestrus and proestrus, but decreased in number at all other stages. Endometrial B-Lym remained fairly constant during the canine cycle, although its numbers were higher in late involution. Mø counts were higher during anestrus compared to the other stages, the cells being displaced into the superficial endometrial layer. Mø demonstrated the highest level in late involution samples, forming small aggregates below the surface epithelium. The number of immune cells was not normally distributed, suggesting the influence of individual factors, such as age or parity, not explored herein due to limited sample availability. Still, this study provides important information for the interpretation of endometrial biopsies in dogs and for the understanding of the increased susceptibility to uterine infection during dioestrus found in the bitch. © 2015 Blackwell Verlag GmbH.

  12. Occurrence of different Canine distemper virus lineages in Italian dogs. (United States)

    Balboni, Andrea; De Lorenzo Dandola, Giorgia; Scagliarini, Alessandra; Prosperi, Santino; Battilani, Mara


    This study describes the sequence analysis of the H gene of 7 Canine distemper virus (CDV) strains identified in dogs in Italy between years 2002-2012. The phylogenetic analysis showed that the CDV strains belonged to 2 clusters: 6 viruses were identified as Arctic-like lineage and 1 as Europe 1 lineage. These data show a considerable prevalence of Arctic-like-CDVs in the analysed dogs. The dogs and the 3 viruses more recently identified showed 4 distinctive amino acid mutations compared to all other Arctic CDVs.

  13. Canine distemper antibodies in lions of the Masai Mara. (United States)

    Kock, R; Chalmers, W S; Mwanzia, J; Chillingworth, C; Wambua, J; Coleman, P G; Baxendale, W


    Canine distemper virus (CDV) has been implicated in some recent deaths of lions, which showed clinical signs of distemper, in the the Serengeti plain. Similar clinical findings have since been reported in lions of the Masai Mara. Fifty-five per cent of serum samples obtained from wild lions of the Masai Mara have been found to contain neutralising antibody to CDV, indicating that they had been exposed to the virus. Adult orphan lions kept in captivity, were vaccinated with the live attenuated Onderstepoort strain of CDV. The results indicated that the vaccine is both safe and immunogenic, and may be potentially useful for the prophylactic vaccination of lions at high risk.

  14. Canine urothelial carcinoma: genomically aberrant and comparatively relevant. (United States)

    Shapiro, S G; Raghunath, S; Williams, C; Motsinger-Reif, A A; Cullen, J M; Liu, T; Albertson, D; Ruvolo, M; Bergstrom Lucas, A; Jin, J; Knapp, D W; Schiffman, J D; Breen, M


    Urothelial carcinoma (UC), also referred to as transitional cell carcinoma (TCC), is the most common bladder malignancy in both human and canine populations. In human UC, numerous studies have demonstrated the prevalence of chromosomal imbalances. Although the histopathology of the disease is similar in both species, studies evaluating the genomic profile of canine UC are lacking, limiting the discovery of key comparative molecular markers associated with driving UC pathogenesis. In the present study, we evaluated 31 primary canine UC biopsies by oligonucleotide array comparative genomic hybridization (oaCGH). Results highlighted the presence of three highly recurrent numerical aberrations: gain of dog chromosome (CFA) 13 and 36 and loss of CFA 19. Regional gains of CFA 13 and 36 were present in 97 % and 84 % of cases, respectively, and losses on CFA 19 were present in 77 % of cases. Fluorescence in situ hybridization (FISH), using targeted bacterial artificial chromosome (BAC) clones and custom Agilent SureFISH probes, was performed to detect and quantify these regions in paraffin-embedded biopsy sections and urine-derived urothelial cells. The data indicate that these three aberrations are potentially diagnostic of UC. Comparison of our canine oaCGH data with that of 285 human cases identified a series of shared copy number aberrations. Using an informatics approach to interrogate the frequency of copy number aberrations across both species, we identified those that had the highest joint probability of association with UC. The most significant joint region contained the gene PABPC1, which should be considered further for its role in UC progression. In addition, cross-species filtering of genome-wide copy number data highlighted several genes as high-profile candidates for further analysis, including CDKN2A, S100A8/9, and LRP1B. We propose that these common aberrations are indicative of an evolutionarily conserved mechanism of pathogenesis and harbor genes

  15. Milk C-reactive protein in canine mastitis. (United States)

    Vasiu, Iosif; Dąbrowski, Roman; Martinez-Subiela, Silvia; Ceron, Jose J; Wdowiak, Anna; Pop, Raul Alexandru; Brudaşcă, Florinel Gheorghe; Pastor, Josep; Tvarijonaviciute, Asta


    Presence of mastitis in lactating bitches can become life threatening for both the bitch and pups. The aim of the present study was to evaluate a possible utility of C-reactive protein (CRP) in both milk and serum for canine mastitis diagnosis. Our study showed that milk CRP levels ranged between 0.1 and 4.9μg/mL and from 0.3 to 40.0μg/mL in healthy and diseased bitches (Pcanine mastitis. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. First molecular characterization of canine parvovirus strains in Sardinia, Italy. (United States)

    Dei Giudici, S; Cubeddu, T; Giagu, A; Sanna, G; Rocca, S; Oggiano, A


    Canine parvovirus type 2 (CPV-2) is responsible of acute hemorrhagic gastroenteritis in young dogs. CPV-2 emerged in 1978 in the USA, but new antigenic types, CPV-2a, 2b and 2c, have completely replaced the original type. In this study, we analyzed 81 animals collected in Sardinia, Italy. The VP2 sequence analysis of 27 positive samples showed that all antigenic CPV-2 types are circulating. CPV-2b seems to be the most widespread variant, followed by CPV-2a. Furthermore, 12 CPV-2b strains displayed further amino acid substitutions and formed a separate cluster in a phylogenetic tree, indicating regional genetic variation.

  17. An update on the treatment of canine atopic dermatitis

    Directory of Open Access Journals (Sweden)

    Marsella R


    Full Text Available Rosanna MarsellaDepartment of Small Animal Clinical Sciences, College of Veterinary Medicine, University of Florida Gainesville, FL, USAAbstract: Remarkable progress has been made in recent years concerning our understanding of the pathogenesis of canine atopic dermatitis (AD. As our understanding improves, the therapeutic approach evolves. Of utmost importance is the documentation of skin barrier impairment in canine AD: ceramides deficiency leads to increased permeability and increased allergen penetration and sensitization. It is currently unknown whether this dysfunction is primary and genetically inherited or secondary to inflammation but it is accepted that skin barrier deficiency plays an important role in either starting or minimally exacerbating canine AD. Thus, the therapeutic approach has changed from focusing on the control of the inflammation to a combined approach that includes therapies aimed at skin barrier repair. The issue of skin barrier repair has been addressed both with oral administration of essential fatty acids and the topical application of products containing a combination of ceramides and fatty acids. These strategies are most helpful as adjunctive treatments and would be best used in young patients that have not developed chronic skin changes. Importantly, treatment for canine AD is multimodal and tailored to the individual patient, the age, and the duration of the disease. Client education plays an important role in explaining the importance of a long-term approach to minimize flare-ups and, in this context, topical therapy to correct skin barrier can be of great benefit. This is an area still in infancy and much work is needed to identify the best formulation. In human medicine, long-term use of moisturizers can have a profound effect on skin barrier and gene expression of proteins involved in skin barrier. This effect is variable depending on the formulation used. It is reasonable to speculate that the same may be

  18. Canine aggression toward people: a guide for practitioners. (United States)

    Sueda, Karen Lynn C; Malamed, Rachel


    This article reviews the various causes of human-directed aggression in dogs and provides a step-by-step plan guiding the general practitioner through history taking, behavior observations, diagnosis, consultation, treatment, and follow-up care. Charts summarizing how to obtain behavioral information, the client's management options, treatment recommendations, diagnosis and treatment of human-directed aggression, and the clinician's role in preventing human-directed aggression are included. A graphic illustration of canine body language is also provided. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Escherichia coli : host interactions in the pathogenesis of canine pyometra


    Henriques, Sofia Correia Rosa de Barros


    Tese de Doutoramento em Ciências Veterinárias na Especialidade de Ciências Biológicas e Biomédicas Canine pyometra develops as a result of a complex interaction of etiological and physiopathological factors, such as the virulence and type of the bacteria and the individual host defence mechanisms. Since Escherichia coli is the most common bacterium isolated from uterus of bitches with pyometra, one main objective of this work was to characterize E. coli virulence potential, and...

  20. An assessment of the relationship between cervical vertebrae maturation index and eruption of permanent maxillary canines

    Directory of Open Access Journals (Sweden)

    D S Kothavade


    Full Text Available Aim : The purpose of the present study was to establish the relationship between the eruption of permanent maxillary canines and cervical vertebral maturation stages (CVMs to assess an alternative method for determining time of canine eruption in the late mixed dentition. Materials and Methods : One hundred and twenty subjects with erupting permanent maxillary canines were observed both intraorally and radiographically with orthopantamograms. Lateral cephalograms were recorded to divide subjects according to CVM stage into prepeak (CS1 and CS2, peak (CS3 and CS4 and postpeak (CS5 and CS6 groups of puberty. Statistical Analysis : The differences between the prevalence rates of canine eruption in different groups of puberty were estimated using ′z test′. Results : Prepeak group comprised of forty six subjects, peak group sixty eight subjects and postpeak group six subjects. The differences in prevalence rates between peak and prepeak and between peak and postpeak groups were noticed highly significant (p<0.001, while prevalence rates between peak and postpeak was found less significant ( p0 <0.01. Conclusion : Eruption of the permanent maxillary canine can occur at any CVM stage till end of the puberty or after puberty (CS1-CS6. Thus, an absence of maxillary canine during or after postpeak stage of puberty (CS5 or CS6 suggests delayed eruption and canine impaction.

  1. Canine as a biomedical research model: immunological, hematological, and oncological aspects

    International Nuclear Information System (INIS)

    Shifrine, M.; Wilson, F.D.


    The canine has been used as a biomedical research model in radiation studies by a number of laboratories supported primarily by the US Department of Energy and its predecessors. These studies were unique in that they covered the life spans of the canines and permitted the collection of data from birth to death under controlled conditions. Since these were multiparametric studies, an extensive data base has been established, not the least of which are normative values covering all biologic systems, including immunohematology. The canine model has also been extensively used by other groups, such as transplantation biologists. The virtues of the canine as a model in these and many other endeavors are becoming increasingly more apparent with the passing of time. One of the primary goals of this volume was to compile the knowledge and experience of researchers using the canine model and to focus their expertise on furthering the use of the canine for studies in immunology, hematology, and oncology. We have attempted to present some of the contemporary, diverse uses of the canine in biomedical research, emphasizing immunologic endpoints, and also to present in detail some of the latest technology used in such studies

  2. Assessment of Growth Using Mandibular Canine Calcification Stages and Its Correlation with Modified MP3 Stages. (United States)

    Nayak, Reshma; Nayak, Us Krishna; Hegde, Gautam


    Orthodontic diagnosis and treatment planning for growing children must involve growth prediction, especially in the treatment of skeletal problems. Studies have shown that a strong association exists between skeletal maturity and dental calcification stages. The present study was therefore taken up to provide a simple and practical method for assessing skeletal maturity using a dental periapical film and standard dental X-ray machine, to compare the developmental stages of the mandibular canine with that of developmental stages of modified MP3 and to find out if any correlation exists, to determine if the developmental stages of the mandibular canine alone can be used as a reliable indicator for assessment of skeletal maturity. A total of 160 periapical radiographs (80 males and 80 females), of the mandibular right canine and the MP3 region was taken and assessed according to the Dermirjian's stages of dental calcification and the modified MP3 stages. The correlation between the developmental stages of MP3 and the mandibular right canine in male and female groups, is of high statistical significance (p = 0.001). The correlation coefficient between MP3 stages and developmental stages of mandibular canine and chronological age in male and females was found to be not significant. The correlation between the mandibular canine calcification stages and MP3 stages was found to be significant. The developmental stages of the mandibular canine could be used very reliably as a sole indicator for assessment of skeletal maturity.

  3. Comparative analysis of the surface exposed proteome of two canine osteosarcoma cell lines and normal canine osteoblasts. (United States)

    Milovancev, Milan; Hilgart-Martiszus, Ian; McNamara, Michael J; Goodall, Cheri P; Seguin, Bernard; Bracha, Shay; Wickramasekara, Samanthi I


    Osteosarcoma (OSA) is the most common primary bone tumor of dogs and carries a poor prognosis despite aggressive treatment. An improved understanding of the biology of OSA is critically needed to allow for development of novel diagnostic, prognostic, and therapeutic tools. The surface-exposed proteome (SEP) of a cancerous cell includes a multifarious array of proteins critical to cellular processes such as proliferation, migration, adhesion, and inter-cellular communication. The specific aim of this study was to define a SEP profile of two validated canine OSA cell lines and a normal canine osteoblast cell line utilizing a biotinylation/streptavidin system to selectively label, purify, and identify surface-exposed proteins by mass spectrometry (MS) analysis. Additionally, we sought to validate a subset of our MS-based observations via quantitative real-time PCR, Western blot and semi-quantitative immunocytochemistry. Our hypothesis was that MS would detect differences in the SEP composition between the OSA and the normal osteoblast cells. Shotgun MS identified 133 putative surface proteins when output from all samples were combined, with good consistency between biological replicates. Eleven of the MS-detected proteins underwent analysis of gene expression by PCR, all of which were actively transcribed, but varied in expression level. Western blot of whole cell lysates from all three cell lines was effective for Thrombospondin-1, CYR61 and CD44, and indicated that all three proteins were present in each cell line. Semi-quantitative immunofluorescence indicated that CD44 was expressed at much higher levels on the surface of the OSA than the normal osteoblast cell lines. The results of the present study identified numerous differences, and similarities, in the SEP of canine OSA cell lines and normal canine osteoblasts. The PCR, Western blot, and immunocytochemistry results, for the subset of proteins evaluated, were generally supportive of the mass spectrometry data

  4. Molecular biological and immunohistological characterization of canine dermal papilla cells and the evaluation of culture conditions. (United States)

    Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu


    The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.

  5. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    International Nuclear Information System (INIS)

    Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma


    Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs

  6. Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.

    Directory of Open Access Journals (Sweden)

    Emily J Shields

    Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.

  7. New hominin fossils from Kanapoi, Kenya, and the mosaic evolution of canine teeth in early hominins

    Directory of Open Access Journals (Sweden)

    J. Michael Plavcan


    Full Text Available Whilst reduced size, altered shape and diminished sexual dimorphism of the canine–premolar complex are diagnostic features of the hominin clade, little is known about the rate and timing of changes in canine size and shape in early hominins. The earliest Australopithecus, Australopithecus anamensis, had canine crowns similar in size to those of its descendant Australopithecus afarensis, but a single large root alveolus has suggested that this species may have had larger and more dimorphic canines than previously recognised. Here we present three new associated dentitions attributed to A. anamensis, recently recovered from the type site of Kanapoi, Kenya, that provide evidence of canine evolution in early Australopithecus. These fossils include the largest mandibular canine root in the hominin fossil record. We demonstrate that, although canine crown height did not differ between these species, A. anamensis had larger and more dimorphic roots, more like those of extant great apes and Ardipithecus ramidus, than those of A. afarensis. The canine and premolar occlusal shapes of A. anamensis also resemble those of Ar. ramidus, and are intermediary between extant great apes and A. afarensis. A. afarensis achieved Homo-like maxillary crown basal proportions without a reduction in crown height. Thus, canine crown size and dimorphism remained stable during the early evolution of Australopithecus, but mandibular root dimensions changed only later within the A. anamensis–afarensis lineage, coincident with morphological changes in the canine–premolar complex. These observations suggest that selection on canine tooth crown height, shape and root dimensions was not coupled in early hominin evolution, and was not part of an integrated adaptive package.

  8. Comparison of canine retraction using single and Siamese edgewise brackets: An in vivo study

    Directory of Open Access Journals (Sweden)

    Zeeshan Iqbal Bhat


    Full Text Available Objectives: The purpose of this study was to check the rate of canine retraction with bodily mechanics using two different pre-adjusted edgewise bracket Systems. Materials and Methods: A split mouth study with twenty patients who were randomly selected and allotted to a single operator. Duration of canine retraction, angulation of canine during its retraction, degree of Rotation, anchorage Loss, distance between canine and premolar at different time intervals were then evaluated, pre- (To, 3 months- (T1 and canine tip touches the second premolar- (T2. Descriptive statistics including mean values and standard deviations were calculated. Paired and unpaired t-test was performed to evaluate the differences between the groups. Results: Rotation and angulation of the canines did not show significant difference in both the systems. There was statistically significant difference (P<0.01 in anchorage loss between single wing and Siamese bracket being 2.65 ±1.41 mm and 1.31 ± 0.93 respectively. There was statistically significant intergroup difference (P<0.01 in canine movement i.e distance between canine and premolar was recorded as 4.72mm (15.06 ± 1.69 to 10.34 ± 1.68mm in single wing bracket and 6.25mm in Siamese (15.52 ± 1.41 to 9.27 ± 1.94. Conclusion: In cases where high anchorage is required and the rate of canine retraction is a concern, Siamese brackets pose a definite advantage over Single wing brackets.

  9. Early Life Experiences and Exercise Associate with Canine Anxieties.

    Directory of Open Access Journals (Sweden)

    Katriina Tiira

    Full Text Available Personality and anxiety disorders across species are affected by genetic and environmental factors. Shyness-boldness personality continuum exists across species, including the domestic dog, with a large within- and across-breed variation. Domestic dogs are also diagnosed for several anxiety-related behavioral conditions, such as generalized anxiety disorders, phobias, and separation anxiety. Genetic and environmental factors contributing to personality and anxiety are largely unknown. We collected questionnaire data from a Finnish family dog population (N = 3264 in order to study the associating environmental factors for canine fearfulness, noise sensitivity, and separation anxiety. Early life experiences and exercise were found to associate with anxiety prevalence. We found that fearful dogs had less socialization experiences (p = 0.002 and lower quality of maternal care (p < 0.0001 during puppyhood. Surprisingly, the largest environmental factor associating with noise sensitivity (p < 0.0001 and separation anxiety (p = 0.007 was the amount of daily exercise; dogs with noise sensitivity and separation anxiety had less daily exercise. Our findings suggest that dogs share many of the same environmental factors that contribute to anxiety in other species as well, such as humans and rodents. Our study highlights the importance of early life experiences, especially the quality of maternal care and daily exercise for the welfare and management of the dogs, and reveals important confounding factors to be considered in the genetic characterization of canine anxiety.

  10. A canine distemper model of virus-induced anergy. (United States)

    Mangi, R J; Munyer, T P; Krakowka, S; Jacoby, R O; Kantor, F S


    For development of an animal model of virus-induced anergy, the effect of canine distemper virus (CDV) upon cell-mediated immunity in dogs was investigated. First, canine cutaneous reactions and in vitro lymphocyte responses to soluble protein antigens were characterized. Dogs immunized with picryl guinea pig albumin and with keyhole limpet hemocyanin (both in complete Freund's adjuvant) responded reproducibly to intracutaneous challenge with these antigens. Reactivity peaked in 20-40 days (maximal induration, 6-50 mm). Lymphocytes from these animals responded in vitro to stimulation with keyhole limpet hemocyanin or purified protein derivative. This stimulation was antigen-specific and was maximal on day 6 of culture. Infection with CDV depressed cutaneous reactivity and lymphocyte response in vitro to antigens and mitogens. This effect was transient in animals previously vaccinated with attenuated CDV; however, gnotobiotic puppies (susceptible to CDV) had prolonged depression of cell-mediated immunity and lymphopenia. Some of these animals developed neurologic symptoms and died. The findings indicate that CDV infection is a potentially useful model for study of virus-induced depression of T (thymus)-cell responses and support the hypothesis that there is more than one mechanism responsible for this phenomenon.

  11. New developments in canine hepatozoonosis in North America: a review (United States)

    Little, Susan E; Allen, Kelly E; Johnson, Eileen M; Panciera, Roger J; Reichard, Mason V; Ewing, Sidney A


    Canine hepatozoonosis is caused by Hepatozoon canis and Hepatozoon americanum, apicomplexan parasites transmitted to dogs by ingestion of infectious stages. Although the two agents are phylogenetically related, specific aspects, including characteristics of clinical disease and the natural history of the parasites themselves, differ between the two species. Until recently, H. canis infections had not been clearly documented in North America, and autochthonous infection with H. americanum has yet to be reported outside of the southern United States. However, recent reports demonstrate H. canis is present in areas of North America where its vector tick, Rhipicephalus sanguineus, has long been endemic, and that the range of H. americanum is likely expanding along with that of its vector tick, Amblyomma maculatum; co-infections with the two organisms have also been identified. Significant intraspecific variation has been reported in the 18S rRNA gene sequence of both Hepatozoon spp.-infecting dogs, suggesting that each species may represent a complex of related genogroups rather than well-defined species. Transmission of H. americanum to dogs via ingestion of cystozoites in muscle of infected vertebrates was recently demonstrated, supporting the concept of predation as a means of natural transmission. Although several exciting advances have occurred in recent years, much remains to be learned about patterns of infection and the nature of clinical disease caused by the agents of canine hepatozoonosis in North America. PMID:19426444

  12. The immuno-pathological conversions of canine demodicosis. (United States)

    Singh, Shanker K; Dimri, Umesh


    Canine demodicosis is a common but exigent noncontagious parasitic dermatosis caused by overpopulation of the host-specific follicular mites of various Demodex species. Receptivity of dogs to demodicosis and progression of the clinical disease are influenced by numerous factors including; genetic defect, alteration of skin's structure and biochemistry, immunological disorders, hormonal status, breed, age, nutritional status, oxidative stress, length of hair coat, stage of oestrus cycle, parturition, endoparasitism and debilitating diseases. Of these, the immune status is thought to be the most significant. Thus, in the present review we intended to edify the immuno-pathological conversions of canine demodicosis. Generalized demodicosis requires a cutaneous environment that is ecologically and immunologically favorable for extreme colonization of demodectic mites. Demodex canis mites can down regulate the CD4+ T cells; possibly by an increased rate of apoptosis or immunological exhaustion of CD4+ T cells. An increased apoptosis of peripheral leukocytes confers progression of the clinical manifestations. Mites induced elevation of TGF-β and inhibition of TNF-α mRNA expression might be a key factor for revealing the difference in the mechanism of onset between localized and generalized demodicosis. Moreover, an elevated serum level of IL-10 could be accountable for the recurrence as well as occurrence of demodicosis in dogs. Over production of reactive oxygen species can corroborate immunological discrepancies in dogs with demodicosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Duchenne Muscular Dystrophy Gene Therapy in the Canine Model (United States)


    Abstract Duchenne muscular dystrophy (DMD) is an X-linked lethal muscle disease caused by dystrophin deficiency. Gene therapy has significantly improved the outcome of dystrophin-deficient mice. Yet, clinical translation has not resulted in the expected benefits in human patients. This translational gap is largely because of the insufficient modeling of DMD in mice. Specifically, mice lacking dystrophin show minimum dystrophic symptoms, and they do not respond to the gene therapy vector in the same way as human patients do. Further, the size of a mouse is hundredfolds smaller than a boy, making it impossible to scale-up gene therapy in a mouse model. None of these limitations exist in the canine DMD (cDMD) model. For this reason, cDMD dogs have been considered a highly valuable platform to test experimental DMD gene therapy. Over the last three decades, a variety of gene therapy approaches have been evaluated in cDMD dogs using a number of nonviral and viral vectors. These studies have provided critical insight for the development of an effective gene therapy protocol in human patients. This review discusses the history, current status, and future directions of the DMD gene therapy in the canine model. PMID:25710459

  14. Study on clinical symptoms in canine cardiac diseases

    Directory of Open Access Journals (Sweden)

    F. Karlette Anne

    Full Text Available Cardiac diseases in canines are an extensively studied phenomenon all over the world but meagre information has been reported in India. Certain problems, including historical, physical, and laboratory abnormalities, are associated with cardiovascular or pulmonary disease. In India however, the recognition of canine cardiac diseases has been delayed, and ignored on account of lack of awareness and knowledge by the owner and inadequate diagnostic facility to a field veterinarian. Considering the above facts, the present study was undertaken in Gujarat to survey the prevalence of common cardiac diseases in hospital population of dogs along with the clinical symptoms which often goes undetected due to lack of proper diagnostic techniques to be implied and the most forms of heart disease may be present for many years before any evidence of failure develops. In the present study most of the clinical cases of cardiac diseases were presented with a history of nocturnal coughing (seven cases; 2.55%, exercise intolerance (five cases; 1.82%, partial or complete anorexia (five cases; 1.82%, swelling in abdominal area (four cases; 1.45%, dullness and depression (two cases; 0.72%, cachexia and hepatojugular pulsation (one case each; 0.36% each at times. [Vet World 2009; 2(8.000: 307-309

  15. Morphological and Immunohistochemical Characterization of Canine Osteosarcoma Spheroid Cell Cultures. (United States)

    Gebhard, C; Gabriel, C; Walter, I


    Spheroid cell culture emerges as powerful in vitro tool for experimental tumour research. In this study, we established a scaffold-free three-dimensional spheroid system built from canine osteosarcoma (OS) cells (D17). Spheroids (7, 14 and 19 days of cultivation) and monolayer cultures (2 and 7 days of cultivation) were evaluated and compared on light and electron microscopy. Monolayer and spheroid cultures were tested for vimentin, cytokeratin, alkaline phosphatase, osteocalcin and collagen I by means of immunohistochemistry. The spheroid cell culture exhibited a distinct network of collagen I in particular after 19-day cultivation, whereas in monolayer cultures, collagen I was arranged as a lamellar basal structure. Necrotic centres of large spheroids, as observed in 14- and 19-day cultures, were characterized by significant amounts of osteocalcin. Proliferative activity as determined by Ki-67 immunoreactivity showed an even distribution in two-dimensional cultures. In spheroids, proliferation was predominating in the peripheral areas. Metastasis-associated markers ezrin and S100A4 were shown to be continuously expressed in monolayer and spheroid cultures. We conclude that the scaffold-free spheroid system from canine OS cells has the ability to mimic the architecture of the in vivo tumour, in particular cell-cell and cell-matrix interactions. © 2015 The Authors. Anatomia, Histologia, Embryologia Published by Blackwell Verlag GmbH.

  16. Effect of Arctium lappa (burdock) extract on canine dermal fibroblasts. (United States)

    Pomari, Elena; Stefanon, Bruno; Colitti, Monica


    Although the biological activities of Arctium lappa (burdock) have been already investigated in human and other species, data evaluating the molecular mechanisms have not been reported in the dog. In this study we analyzed for the first time the effect of a root extract of burdock on molecular responses in canine dermal fibroblasts with H2O2 stimulation (H group), with burdock treatment (B group) and with H2O2 stimulation and burdock treatment (BH group), using RNAseq technology. Differentially expressed genes (P<0.05) of H, B and BH groups in comparison to the untreated sample (negative control, C group) were identified with MeV software and were functional annotated and monitored for signaling pathways and candidate biomarkers using the Ingenuity Pathways Analysis (IPA). The expression profile of canine dermal fibroblasts treated with burdock extract with or without H2O2 stimulation, showed an up-regulation of mitochondrial superoxide dismutase (SOD2), disheveled 3 (DVL3) and chondroitin sulfate N-acetylgalactosaminyltransferase 2 (CSGALNACT2). The data suggested that burdock has implications in cell adhesion and gene expression with the modulation of Wnt/β catenin signaling and Chondroitin Sulphate Biosynthesis that are particularly important for the wound healing process. © 2013 Elsevier B.V. All rights reserved.

  17. Environmental tobacco smoke and canine urinary cotinine level

    International Nuclear Information System (INIS)

    Bertone-Johnson, Elizabeth R.; Procter-Gray, Elizabeth; Gollenberg, Audra L.; Ryan, Michele B.; Barber, Lisa G.


    Epidemiologic studies of companion animals such as dogs have been established as models for the relationship between exposure to environmental tobacco smoke (ETS) and cancer risk in humans. While results from these studies are provocative, pet owner report of a dog's ETS exposure has not yet been validated. We have evaluated the relationship between dog owner's report of household smoking by questionnaire and dog's urinary cotinine level. Between January and October 2005, dog owners presenting their pet for non-emergency veterinary care at the Foster Hospital for Small Animals at Cummings School of Veterinary Medicine, Tufts University, were asked to complete a 10-page questionnaire measuring exposure to household ETS in the previous 24 h and other factors. A free-catch urine sample was also collected from dogs. Urinary cotinine level was assayed for 63 dogs, including 30 whose owners reported household smoking and 33 unexposed dogs matched on age and month of enrollment. Urinary cotinine level was significantly higher in dogs exposed to household smoking in the 24 h before urine collection compared to unexposed dogs (14.6 ng/ml vs. 7.4 ng/ml; P=0.02). After adjustment for other factors, cotinine level increased linearly with number of cigarettes smoked by all household members (P=0.004). Other canine characteristics including age, body composition and nose length were also associated with cotinine level. Findings from our study suggest that household smoking levels as assessed by questionnaire are significantly associated with canine cotinine levels

  18. Aberrant hepatic lipid storage and metabolism in canine portosystemic shunts.

    Directory of Open Access Journals (Sweden)

    Lindsay Van den Bossche

    Full Text Available Non-alcoholic fatty liver disease (NAFLD is a poorly understood multifactorial pandemic disorder. One of the hallmarks of NAFLD, hepatic steatosis, is a common feature in canine congenital portosystemic shunts. The aim of this study was to gain detailed insight into the pathogenesis of steatosis in this large animal model. Hepatic lipid accumulation, gene-expression analysis and HPLC-MS of neutral lipids and phospholipids in extrahepatic (EHPSS and intrahepatic portosystemic shunts (IHPSS was compared to healthy control dogs. Liver organoids of diseased dogs and healthy control dogs were incubated with palmitic- and oleic-acid, and lipid accumulation was quantified using LD540. In histological slides of shunt livers, a 12-fold increase of lipid content was detected compared to the control dogs (EHPSS P<0.01; IHPSS P = 0.042. Involvement of lipid-related genes to steatosis in portosystemic shunting was corroborated using gene-expression profiling. Lipid analysis demonstrated different triglyceride composition and a shift towards short chain and omega-3 fatty acids in shunt versus healthy dogs, with no difference in lipid species composition between shunt types. All organoids showed a similar increase in triacylglycerols after free fatty acids enrichment. This study demonstrates that steatosis is probably secondary to canine portosystemic shunts. Unravelling the pathogenesis of this hepatic steatosis might contribute to a better understanding of steatosis in NAFLD.

  19. Canine sterile nodular panniculitis: a retrospective study of 39 dogs. (United States)

    Contreary, Caitlin L; Outerbridge, Catherine A; Affolter, Verena K; Kass, Philip H; White, Stephen D


    Canine sterile nodular panniculitis (SNP) is an inflammatory disease of the panniculus that is typically managed with immunomodulatory or immunosuppressive treatments. It has been reported to be a cutaneous marker of an underlying systemic disease. To assess the presence or absence of concurrent systemic diseases associated with canine SNP and to document breed predispositions. Thirty nine dogs presented to a veterinary teaching hospital from 1990 to 2012 which met inclusion criteria. Inclusion in this retrospective study required a diagnosis of SNP via histopathological analysis and negative special stains for infectious organisms. Breed distributions of affected dogs were compared to all other dogs examined at this hospital during the study period. Correlations between the histological pattern of panniculitis and the histological presence of dermatitis, clinical presentation of lesions, dog breed and therapeutic outcomes were assessed. Australian shepherd dogs, Brittany spaniels, Dalmatians, Pomeranians and Chihuahuas were significantly over-represented, but correlations between inflammatory patterns of panniculitis and other histological and clinical factors were not identified. Based on the information available in medical records, 32 dogs (82.1%) had no concurrent systemic diseases identified. Four dogs had concurrent polyarthritis, which may be related to SNP through unknown mechanisms. This study identified several novel breed predilections for SNP; it failed to find any clear correlations with associated systemic diseases other than polyarthritis. The histological inflammatory pattern of SNP does not predict therapeutic outcome. © 2015 ESVD and ACVD.

  20. Towards canine rabies elimination: Economic comparisons of three project sites. (United States)

    Elser, J L; Hatch, B G; Taylor, L H; Nel, L H; Shwiff, S A


    An appreciation of the costs of implementing canine rabies control in different settings is important for those planning new or expanded interventions. Here we compare the costs of three canine rabies control projects in South Africa, the Philippines and Tanzania to identify factors that influence the overall costs of rabies control efforts. There was considerable variation in the cost of vaccinating each dog, but across the sites these were lower where population density was higher, and later in the projects when dog vaccination coverage was increased. Transportation costs comprised a much higher proportion of total costs in rural areas and where house-to-house vaccination campaigns were necessary. The association between the cost of providing PEP and human population density was less clear. The presence of a pre-existing national rabies management programme had a marked effect on keeping infrastructure and equipment costs for the project low. Finally, the proportion of the total costs of the project provided by the external donor was found to be low for the projects in the Philippines and South Africa, but likely covered close to the complete costs of the project in Tanzania. The detailed economic evaluation of three recent large-scale rabies control pilot projects provides the opportunity to examine economic costs across these different settings and to identify factors influencing rabies control costs that could be applied to future projects. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  1. An epidemiological study of environmental factors associated with canine obesity. (United States)

    Courcier, E A; Thomson, R M; Mellor, D J; Yam, P S


    To assess the relationships between socioeconomic and other environmental factors with canine obesity. This was a cross-sectional questionnaire study of dog owners attending five primary veterinary practices in the UK. Owners were asked about dog age, neuter status, feeding habits, dog exercise, household income and owner age. The body condition score of the dogs was also assessed. Factors hypothesised to be associated with obesity were investigated. In total, data from 696 questionnaires were evaluated. Out of those data evaluated, 35.3% of dogs (n=246) were classed as an ideal body shape, 38.9% (n=271) were overweight, 20.4% (n=142) were obese and 5.3% (n=37) were underweight. Identified risk factors associated with obesity included owner age, hours of weekly exercise, frequency of snacks/treats and personal income. Environmental risk factors associated with canine obesity are multifactorial and include personal income, owner age, frequency of snacks/treats and amount of exercise the dog receives. Awareness about health risks associated with obesity in dogs is significantly less in people in lower income brackets. This phenomenon is recognised in human obesity.

  2. Early Life Experiences and Exercise Associate with Canine Anxieties. (United States)

    Tiira, Katriina; Lohi, Hannes


    Personality and anxiety disorders across species are affected by genetic and environmental factors. Shyness-boldness personality continuum exists across species, including the domestic dog, with a large within- and across-breed variation. Domestic dogs are also diagnosed for several anxiety-related behavioral conditions, such as generalized anxiety disorders, phobias, and separation anxiety. Genetic and environmental factors contributing to personality and anxiety are largely unknown. We collected questionnaire data from a Finnish family dog population (N = 3264) in order to study the associating environmental factors for canine fearfulness, noise sensitivity, and separation anxiety. Early life experiences and exercise were found to associate with anxiety prevalence. We found that fearful dogs had less socialization experiences (p = 0.002) and lower quality of maternal care (p daily exercise; dogs with noise sensitivity and separation anxiety had less daily exercise. Our findings suggest that dogs share many of the same environmental factors that contribute to anxiety in other species as well, such as humans and rodents. Our study highlights the importance of early life experiences, especially the quality of maternal care and daily exercise for the welfare and management of the dogs, and reveals important confounding factors to be considered in the genetic characterization of canine anxiety.

  3. Canine parvovirus: the worldwide occurrence of antigenic variants. (United States)

    Miranda, Carla; Thompson, Gertrude


    The most important enteric virus infecting canids is canine parvovirus type 2 (CPV-2). CPV is the aetiologic agent of a contagious disease, mainly characterized by clinical gastroenteritis signs in younger dogs. CPV-2 emerged as a new virus in the late 1970s, which could infect domestic dogs, and became distributed in the global dog population within 2 years. A few years later, the virus's original type was replaced by a new genetic and antigenic variant, called CPV-2a. Around 1984 and 2000, virus variants with the single change to Asp or Glu in the VP2 residue 426 were detected (sometimes termed CPV-2b and -2c). The genetic and antigenic changes in the variants have also been correlated with changes in their host range; in particular, in the ability to replicate in cats and also host range differences in canine and other tissue culture cells. CPV-2 variants have been circulating among wild carnivores and have been well-documented in several countries around the world. Here, we have reviewed and summarized the current information about the worldwide distribution and evolution of CPV-2 variants since they emerged, as well as the host ranges they are associated with.

  4. Molecular characterization of canine parvovirus in Vientiane, Laos. (United States)

    Vannamahaxay, Soulasack; Vongkhamchanh, Souliya; Intanon, Montira; Tangtrongsup, Sahatchai; Tiwananthagorn, Saruda; Pringproa, Kidsadagon; Chuammitri, Phongsakorn


    The global emergence of canine parvovirus type 2c (CPV-2c) has been well documented. In the present study, 139 rectal swab samples collected from diarrheic dogs living in Vientiane, Laos, in 2016 were tested for the presence of the canine parvovirus (CPV) VP2 gene by PCR. The results showed that 82.73% (115/139) of dogs were CPV positive by PCR. The partial VP2 gene was sequenced in 94 of the positive samples; 91 samples belonged to CPV-2c (426Glu) subtype, while 3 samples belonged to the CPV-2a (426Asn) subtype. Notably, phylogenetic analysis of amino acid sequences revealed a close relationship between Laotian isolates and novel Chinese CPV-2c isolates. In Laotian CPV isolates, aligned protein sequences indicated a high rate of residue substitutions at positions 305, 324, 345, 370, 375, and 426 in the GH loop. The mutation at residue 370 (Q370R), a single mutation, was characterized as a unique mutant residue specific to the Laotian CPV-2c variant.

  5. Differential genetic regulation of canine hip dysplasia and osteoarthritis.

    Directory of Open Access Journals (Sweden)

    Zhengkui Zhou


    Full Text Available Canine hip dysplasia (HD is a common polygenic trait characterized by hip malformation that results in osteoarthritis (OA. The condition in dogs is very similar to developmental dysplasia of the human hip which also leads to OA.A total of 721 dogs, including both an association and linkage population, were genotyped. The association population included 8 pure breeds (Labrador retriever, Greyhounds, German Shepherd, Newfoundland, Golden retriever, Rottweiler, Border Collie and Bernese Mountain Dog. The linkage population included Labrador retrievers, Greyhounds, and their crosses. Of these, 366 dogs were genotyped at ∼22,000 single nucleotide polymorphism (SNP loci and a targeted screen across 8 chromosomes with ∼3,300 SNPs was performed on 551 dogs (196 dogs were common to both sets. A mixed linear model approach was used to perform an association study on this combined association and linkage population. The study identified 4 susceptibility SNPs associated with HD and 2 SNPs associated with hip OA.The identified SNPs included those near known genes (PTPRD, PARD3B, and COL15A1 reported to be associated with, or expressed in, OA in humans. This suggested that the canine model could provide a unique opportunity to identify genes underlying natural HD and hip OA, which are common and debilitating conditions in both dogs and humans.

  6. Aberrant hepatic lipid storage and metabolism in canine portosystemic shunts. (United States)

    Van den Bossche, Lindsay; Schoonenberg, Vivien A C; Burgener, Iwan A; Penning, Louis C; Schrall, Ingrid M; Kruitwagen, Hedwig S; van Wolferen, Monique E; Grinwis, Guy C M; Kummeling, Anne; Rothuizen, Jan; van Velzen, Jeroen F; Stathonikos, Nikolas; Molenaar, Martijn R; Helms, Bernd J; Brouwers, Jos F H M; Spee, Bart; van Steenbeek, Frank G


    Non-alcoholic fatty liver disease (NAFLD) is a poorly understood multifactorial pandemic disorder. One of the hallmarks of NAFLD, hepatic steatosis, is a common feature in canine congenital portosystemic shunts. The aim of this study was to gain detailed insight into the pathogenesis of steatosis in this large animal model. Hepatic lipid accumulation, gene-expression analysis and HPLC-MS of neutral lipids and phospholipids in extrahepatic (EHPSS) and intrahepatic portosystemic shunts (IHPSS) was compared to healthy control dogs. Liver organoids of diseased dogs and healthy control dogs were incubated with palmitic- and oleic-acid, and lipid accumulation was quantified using LD540. In histological slides of shunt livers, a 12-fold increase of lipid content was detected compared to the control dogs (EHPSS Plipid-related genes to steatosis in portosystemic shunting was corroborated using gene-expression profiling. Lipid analysis demonstrated different triglyceride composition and a shift towards short chain and omega-3 fatty acids in shunt versus healthy dogs, with no difference in lipid species composition between shunt types. All organoids showed a similar increase in triacylglycerols after free fatty acids enrichment. This study demonstrates that steatosis is probably secondary to canine portosystemic shunts. Unravelling the pathogenesis of this hepatic steatosis might contribute to a better understanding of steatosis in NAFLD.

  7. Immunohistochemical Expression of MCAM/CD146 in Canine Melanoma. (United States)

    Abou Asa, S


    MCAM/CD146 (melanoma cell adhesion molecule/CD146) is a transmembrane immunoglobulin superfamily cell adhesion molecule involved in transendothelial migration and signal transduction. It is expressed in melanoma, squamous cell carcinoma, prostatic, ovarian, cervical and endometrial cancers and promotes tumour growth, angiogenesis and metastasis. Melanoma is the most common malignant oral tumour of dogs and also arises in the skin, nail bed and footpad. The aim of this study was to investigate the immunohistochemical expression of MCAM/CD146 in 51 canine melanomas, including oral, cutaneous and ocular tumours. Seventeen of the 51 (33.3%) cases were negative, eight (15.7%) were weakly positive, seven (13.7%) were moderately positive and 19 (37.3%) were strongly positive. MCAM/CD146 was expressed by both oral and cutaneous melanomas; however, the intensity and the extent of the immunoreactivity was higher in oral (P = 0.009) than in cutaneous tumours (P = 0.058). Most ocular melanomas did not express MCAM/CD146 (P = 0.256). Expression of MCAM/CD146 by canine melanomas may suggest the molecule as a target for treatment, especially in oral melanomas. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. The immunotherapy of canine osteosarcoma: a historical and systematic review. (United States)

    Wycislo, K L; Fan, T M


    Osteosarcoma is a malignant mesenchymal neoplasm that accounts for the majority of primary bone tumors in dogs and shares biological and clinical similarities with osteosarcoma in humans. Despite dose intensification with conventional cytotoxic therapies, survival times for dogs and humans diagnosed with high-grade osteosarcoma have not changed in the past 20 years, with the principal cause of mortality being the development of pulmonary metastases. Given the therapeutic plateau reached for delaying metastatic progression with cytotoxic agents, exploration of alterative adjuvant therapies for improving management of osteosarcoma micrometastases is clinically justified. Evidence suggests that osteosarcoma is an immunogenic tumor, and development of immunotherapies for the treatment of microscopic lung metastases might improve long-term outcomes. In this review, the history and foundational knowledge of immune interactions to canine osteosarcoma are highlighted. In parallel, immunotherapeutic strategies that have been explored for the treatment of canine osteosarcoma are summarized. With a greater understanding and awareness for how the immune system might be redirected toward combating osteosarcoma metastases, the rational development of diverse immune strategies for managing osteosarcoma holds substantial promise for transforming the therapeutic landscape and improving disease management in both dogs and human beings. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  9. Genomic organization of the canine herpesvirus US region. (United States)

    Haanes, E J; Tomlinson, C C


    Canine herpesvirus (CHV) is an alpha-herpesvirus of limited pathogenicity in healthy adult dogs and infectivity of the virus appears to be largely limited to cells of canine origin. CHV's low virulence and species specificity make it an attractive candidate for a recombinant vaccine vector to protect dogs against a variety of pathogens. As part of the analysis of the CHV genome, the authors determined the complete nucleotide sequence of the CHV US region as well as portions of the flanking inverted repeats. Seven full open reading frames (ORFs) encoding proteins larger than 100 amino acids were identified within, or partially within the CHV US: cUS2, cUS3, cUS4, cUS6, cUS7, cUS8 and cUS9; which are homologs of the herpes simplex virus type-1 US2; protein kinase; gG, gD, gI, gE; and US9 genes, respectively. An eighth ORF was identified in the inverted repeat region, cIR6, a homolog of the equine herpesvirus type-1 IR6 gene. The authors identified and mapped most of the major transcripts for the predicted CHV US ORFs by Northern analysis.

  10. Isolation and phylogenetic characterization of Canine distemper virus from India. (United States)

    Swati; Deka, Dipak; Uppal, Sanjeev Kumar; Verma, Ramneek


    Canine distemper (CD), caused by canine distemper virus (CDV) is a highly contagious disease that infects a variety of carnivores. Sequence analysis of CDVs from different geographical areas has shown a lot of variation in the genome of the virus especially in haemagglutinin gene which might be one of the causes of vaccine failure. In this study, we isolated the virus (place: Ludhiana, Punjab; year: 2014) and further cloned, sequenced and analyzed partial haemagglutinin (H) gene and full length genes for fusion protein (F), phosphoprotein (P) and matrix protein (M) from an Indian wild-type CDV. Higher sequence homology was observed with the strains from Switzerland, Hungary, Germany; and lower with the vaccine strains like Ondersteport, CDV3, Convac for all the genes. The multiple sequence alignment showed more variation in partial H (45 nucleotide and 5 amino acid substitutions) and complete F (79 nucleotide and 30 amino acid substitutions) than in complete P (44 nucleotide and 22 amino acid substitutions) and complete M (22 nucleotide and 4 amino acid substitutions) gene/protein. Predicted potential N-linked glycosylation sites in H, F, M and P proteins were similar to the previously known wild-type CDVs but different from the vaccine strains. The Indian CDV formed a distinct clade in the phylogenetic tree clearly separated from the previously known wild-type and vaccine strains.

  11. Experimental chemonucleolysis with chymopapain in canine intervertebral disks

    International Nuclear Information System (INIS)

    Kudo, T.; Sumi, A.; Hashimoto, A.


    The present study describes the radiological and histological changes in the canine intervertebral disk after the experimental injection of chymopapain as the chemical reagent, and determines the appropriate dose of the enzyme for treatment of herniated disks. By radiography, narrowing of the disk space was observed within 2 weeks after the injection of chymopapain, and recovered to 74.1% in the 0.1 mg group, 61.1% in the 1.0 mg group and 71.7% in the 10.0 mg group at 12 weeks. The disk space recovery showed a tendency to delay with aging. Microscopically, proteoglycan positive matrix appeared and the nuclear space was reduced in each disk at 2 weeks after chymopapain injection. The nucleus pulposus contained an irregularly-defined mass consisting of clusters of degenerated notochordal cells surrounded by proliferated chondrocytes and collagen matrix. In each disk at 12 weeks after chymopapain injection, the center of the nucleus pulposus was replaced by fibrocartilage tissue. In the disk into which 10.0 mg chymopapain was injected, the nuclear space filled with dense fibrocartilage tissue without a regenerated matrix component and narrowing of the disk were maintained. It is suggested that canine chemonucleolysis with 10.0 mg of chymopapain reduces the interdiskal pressure. This treatment may therefore relieve the signs and symptoms of herniation of the nucleus pulposus, and may effect chemical disk decompression

  12. Transmission dynamics and prospects for the elimination of canine rabies.

    Directory of Open Access Journals (Sweden)

    Katie Hampson


    Full Text Available Rabies has been eliminated from domestic dog populations in Western Europe and North America, but continues to kill many thousands of people throughout Africa and Asia every year. A quantitative understanding of transmission dynamics in domestic dog populations provides critical information to assess whether global elimination of canine rabies is possible. We report extensive observations of individual rabid animals in Tanzania and generate a uniquely detailed analysis of transmission biology, which explains important epidemiological features, including the level of variation in epidemic trajectories. We found that the basic reproductive number for rabies, R0, is very low in our study area in rural Africa (approximately 1.2 and throughout its historic global range (<2. This finding provides strong support for the feasibility of controlling endemic canine rabies by vaccination, even near wildlife areas with large wild carnivore populations. However, we show that rapid turnover of domestic dog populations has been a major obstacle to successful control in developing countries, thus regular pulse vaccinations will be required to maintain population-level immunity between campaigns. Nonetheless our analyses suggest that with sustained, international commitment, global elimination of rabies from domestic dog populations, the most dangerous vector to humans, is a realistic goal.

  13. Epizootic canine distemper virus infection among wild mammals. (United States)

    Kameo, Yuki; Nagao, Yumiko; Nishio, Yohei; Shimoda, Hiroshi; Nakano, Hitoshi; Suzuki, Kazuo; Une, Yumi; Sato, Hiroshi; Shimojima, Masayuki; Maeda, Ken


    In the spring of 2007, seven raccoon dogs and a weasel were captured near the city of Tanabe in Wakayama prefecture, Japan. The causative agent of the animals' death 1-2 days after capture was identified as canine distemper virus (CDV) by virus isolation, immunostaining with an anti-CDV polyclonal antibody, and a commercially available CDV antigen-detection kit. Sequence analysis of hemagglutinin genes indicated the isolated viruses belong to genotype Asia-1 and possess the substitution from tyrosine (Y) to histidine (H) at position 549 that is associated with the spread of CDV to non-canine hosts. A serosurvey for CDV was then conducted among wild animals in the region. The animals assayed consisted of 104 raccoons, 41 wild boars, 19 raccoon dogs, five Sika deer, two badgers, one weasel, one marten, one Siberian weasel and one fox. Virus-neutralization (VN) tests showed that, except for fox and weasel, all of the species assayed had VN antibodies to CDV. Interestingly, 11 of the 41 wild boars (27%) and two of the five Sika deer assayed possessed VN antibodies to CDV. These findings indicate that CDV infection was widespread among wild mammals during this epizootic. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Oxygenation of spontaneous canine tumors during fractionated radiation therapy

    International Nuclear Information System (INIS)

    Achermann, R.E.; Ohlerth, S.M.; Bley, C.R.; Inteeworn, N.; Schaerz, M.; Wergin, M.C.; Kaser-Hotz, B.; Gassmann, M.; Roos, M.


    Background and purpose: tumor oxygenation predicts treatment outcome, and reoxygenation is considered important in the efficacy of fractionated radiation therapy. Therefore, the purpose of this study was to document the changes of the oxygenation status in spontaneous canine tumors during fractionated radiation therapy using polarographic needle electrodes. Material and methods: tumor oxygen partial pressure (pO 2 ) measurements were performed with the eppendorf-pO 2 -Histograph. The measurements were done under general anesthesia, and probe tracks were guided with ultrasound. pO 2 was measured before radiation therapy in all dogs. In patients treated with curative intent, measurements were done sequentially up to eight times (total dose: 45-59.5 Gy). Oxygenation status of the palliative patient group was examined before each fraction of radiation therapy up to five times (total dose: 24-30 Gy). Results: 15/26 tumors had a pretreatment median pO 2 ≤ 10 mmHg. The pO 2 values appeared to be quite variable in individual tumors during fractionated radiation therapy. The pO 2 of initially hypoxic tumors (pretreatment median pO 2 ≤ 10 mmHg) remained unchanged during fractionated radiotherapy, whereas in initially normoxic tumors the pO 2 decreased. Conclusion: hypoxia is common in spontaneous canine tumors, as 57.7% of the recorded values were ≥ 10 mmHg. The data of this study showed that initially hypoxic tumors remained hypoxic, whereas normoxic tumors became more hypoxic. (orig.)

  15. Evolution of canine parvovirus--a need for new vaccines? (United States)

    Truyen, Uwe


    Canine parvovirus (CPV) is a new virus, which is continuing to evolve, giving rise to new antigenic types and virus mutants that spread through the dog population. The most successful mutants, from an evolutionary perspective, appear to be selected by improved binding to the CPV receptor, the canine transferrin receptor, and by an extended host range, which for the newer antigenic types now includes both the dog and the cat. The new viruses also show antigenic differences that can be defined by binding of certain monoclonal antibodies; they also differ in their reactivity in virus neutralisation tests, using immune sera raised against the various antigenic types. These differences may influence the susceptibility of young animals to infection at the time when the level of maternally derived antibody decreases to the minimum protective titre. This minimum protective titre may vary depending on the infecting virus type. There is, however, a high degree of cross-protection between the virus types and the true relevance of the differences in neutralisation titer is currently not known.

  16. Canine babesiosis: a perspective on clinical complications, biomarkers, and treatment

    Directory of Open Access Journals (Sweden)

    Köster LS


    Full Text Available Liza S Köster,1 Remo G Lobetti,2 Patrick Kelly1 1Department of Clinical Sciences, One Health Center for Zoonoses and Tropical Veterinary Medicine, Ross University School of Veterinary Medicine, St Kitts, West Indies; 2Bryanston Veterinary Hospital, Bryanston, South Africa Abstract: Canine babesiosis is a common tick transmitted disease of dogs worldwide. A number of Babesia sp. can infect dogs and the spectrum is increasing as molecular methods are developed to differentiate organisms. Clinical signs are generally attributed to hemolysis caused by the organisms in the erythrocytes but in some animals with some Babesia spp. there can be an immune mediated component to the anemia and/or a severe inflammatory reaction associated. This complicated form of canine babesiosis is associated with high morbidity and mortality. A variety of clinical markers has been investigated to enable clinicians to provide more accurate prognoses and adapt their treatments which vary according to the infecting species. In this review, we discuss the taxonomy, clinical signs, diagnostic imaging, clinical biomarkers, treatment, and prophylaxis of one of the most common and important diseases of dogs worldwide. Keywords: babesiosis, vector-borne disease, dog

  17. Computerized digital image processing on radiographs of canine filariosis

    International Nuclear Information System (INIS)

    Miyatake, K.; Okamoto, Y.; Minami, S.


    For objective evaluation in the lung arterial lesions, density histogram revealed by survey thoracic radiographies of fifteen canine filariosis and five normal canine were digitally analyzed, and preparation of pulmonary artery angiogram with inflated-fixed lung, the changes in the histogram and the pulmonary arterial lesion by a soft X-ray examination were compared. In the lung areas affected by filariosis, the density histogram increased the white level and decreased the black level in each part compared to a normal lung. In comparison with the normal parameters, those of the filariosis it were significantly increased in minimum grey level values (Min), maximum grey level values (Max), and the maximum frequency grey level values (Mode) and, it was significantly decreased in maximum frequency values (MaF). The pulmonary arterial lesion of the filariosis showed obvious morphological changes such as in distinction, pruning, angiectasis, and meandering. In the grade of pulmonary arterial lesion, the parameter Min, Max, Mode and MaF were changed significantly. From these results, it was clear that the methods for the lung arterial lesions analysis of X-ray images were confirmed to be highly beneficial in the lung arterial lesions for objective diagnosis

  18. The relationship between the Southern Oscillation Index, rainfall and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. (United States)

    Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P


    The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Genetic characterization of canine distemper virus involved in outbreaks in farmed mink in Denmark 2012

    DEFF Research Database (Denmark)

    Trebbien, Ramona; Struve, T.; Hjulsager, Charlotte Kristiane

    Danish farmed mink herds experienced a large outbreak of canine distemper virus in 2012. Full-length sequence analysis (1824 nucleotides) of the variable hemagglutinin (H) gene were performed on 27 viruses collected from mink and on 7 viruses collected from wild foxes. Results of the study showed...... with other European canine distemper viruses and showed the highest level of similarity (99.3 - 99.6 %) to viruses isolated from wild foxes in Germany. The fox should therefore be considered as an important wild life reservoir of canine distemper virus and may also contribute to the transmission of the virus...

  20. Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis. (United States)

    Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D


    Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis.

  1. Orthodontic and surgical approach to the treatment of bilaterally impacted maxillary canines: a case report. (United States)

    Ertan Erdinc, Aslihan M


    Impaction of maxillary canines is a common orthodontic anomaly that causes facial and dentoalveolar system problems, both functional and esthetic. A combination of surgery and orthodontics is important in bringing impacted canines to their ideal position in the dental arch. In this case report of a 14-year-old patient with impacted right and left maxillary canines, the crowns of these teeth were surgically exposed, brackets were bonded, and light orthodontic forces were delivered for 2 years to align the teeth in the dental arch.

  2. Canine faecal contamination and parasitic risk in the city of Naples (southern Italy

    Directory of Open Access Journals (Sweden)

    Veneziano Vincenzo


    Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between

  3. Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro

    Directory of Open Access Journals (Sweden)

    Cintia Xavier de Mello


    Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.

  4. Assessment of Periodontal Status of Surgically Exposed and Orthodontically Aligned Impacted Maxillary Canines

    Directory of Open Access Journals (Sweden)

    Adina Coșarcă


    Full Text Available Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of teeth. Conclusions: The assessed periodontal indices may signal the appearance of a periodontal disease around the teeth that were surgically and orthodontically treated

  5. Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction. (United States)

    Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas


    Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

  6. Detection of canine distemper virus nucleocapsid protein gene in canine peripheral blood mononuclear cells by RT-PCR. (United States)

    Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T


    For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.

  7. Immunohistochemical expression study of proapoptotic BH3-only protein bad in canine nonneoplastic tissues and canine lymphomas. (United States)

    Dettwiler, M; Croci, M; Vaughan, L; Guscetti, F


    The BH3-only protein Bad is a proapoptotic Bcl-2 family member that acts as a sensitizer in intrinsic apoptosis by inactivating antiapoptotic members through heterodimer formation. Bad has been shown to contribute to tumorigenesis, including lymphoma formation in humans and mice, through alteration in expression or functional status. Here, its immunohistochemical expression was analyzed in canine nonneoplastic and lymphoma tissues using tissue microarrays. Bad was expressed in the cytoplasm of a wide range of nonneoplastic tissues, especially epithelial cells. Nonneoplastic lymph nodes displayed weak immunostaining in the follicular germinal centers only. Immunoblotting supported these observations but also revealed presence of nonspecific labeling in some organs. Of 81 lymphomas, 29 (35.8%) displayed moderate to strong immunohistochemical Bad labeling, and a significant expression increase was found in lymphomas (especially B cell and double negative) compared to nonneoplastic lymph nodes. These findings warrant further investigations of the functional status, the involvement of partner proteins, and a possible impact of Bad on prognosis in canine lymphoma.

  8. Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012-2013

    DEFF Research Database (Denmark)

    Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted


    During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit...... distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine...... distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case...


    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha


    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  10. Glycogen storage disease type Ia in canines: a model for human metabolic and genetic liver disease. (United States)

    Specht, Andrew; Fiske, Laurie; Erger, Kirsten; Cossette, Travis; Verstegen, John; Campbell-Thompson, Martha; Struck, Maggie B; Lee, Young Mok; Chou, Janice Y; Byrne, Barry J; Correia, Catherine E; Mah, Cathryn S; Weinstein, David A; Conlon, Thomas J


    A canine model of Glycogen storage disease type Ia (GSDIa) is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including "lactic acidosis", larger size, and longer lifespan compared to other animal models. Use of this model in preclinical trials of gene therapy is described and briefly compared to the murine model. Although the canine model offers a number of advantages for evaluating potential therapies for GSDIa, there are also some significant challenges involved in its use. Despite these challenges, the canine model of GSDIa should continue to provide valuable information about the potential for generating curative therapies for GSDIa as well as other genetic hepatic diseases.

  11. Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease

    Directory of Open Access Journals (Sweden)

    Andrew Specht


    Full Text Available A canine model of Glycogen storage disease type Ia (GSDIa is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size, and longer lifespan compared to other animal models. Use of this model in preclinical trials of gene therapy is described and briefly compared to the murine model. Although the canine model offers a number of advantages for evaluating potential therapies for GSDIa, there are also some significant challenges involved in its use. Despite these challenges, the canine model of GSDIa should continue to provide valuable information about the potential for generating curative therapies for GSDIa as well as other genetic hepatic diseases.

  12. Orthodontic treatment of the transposition of a maxillary canine and a first premolar: a case report. (United States)

    Teresa, Dinoi Maria; Stefano, Mummolo; Annalisa, Monaco; Enrico, Marchetti; Vincenzo, Campanella; Giuseppe, Marzo


    Transposition is an anomaly of tooth position, the most frequent of which involves the canine and the first maxillary premolar. We describe the orthodontic treatment of a unilateral transposition of an upper canine and an upper right first premolar in the permanent dentition. A 12-year-old Caucasian boy presented with transposition of his upper right canine and upper right first premolar. He had combined surgical-orthodontic treatment to correct the transposition and to obtain a Class I relationship between the molar and canine. This treatment resolved the dental crowding and achieved good functional and aesthetic results. In transposition, the choice of the most suitable treatment depends on the occlusion, level of dental crowding, aesthetics, position of the radicular apices, and the specific needs of the patient. In this case, orthodontic alignment of the transposed teeth into their physiological position achieved all of our objectives and our patient was satisfied with the aesthetic results obtained.

  13. Extensive expression of craniofacial related homeobox genes in canine mammary sarcomas

    NARCIS (Netherlands)

    Wensman, H.; Goransson, H.; Leuchowius, K.J.; Stromberg, S.; Ponten, F.; Isaksson, A.; Rutteman, G.R.; Heldin, N.; Pejler, G.; Hellmen, E.


    Extensive expression of craniofacial related homeobox genes in canine mammary sarcomas Journal Breast Cancer Research and Treatment Publisher Springer Netherlands ISSN 0167-6806 (Print) 1573-7217 (Online) Issue Volume 118, Number 2 / November, 2009 Category Preclinical Study DOI

  14. A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article

    Directory of Open Access Journals (Sweden)

    S. Gur


    Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.

  15. In vitro development of canine somatic cell nuclear transfer embryos in different culture media. (United States)

    Kim, Dong-Hoon; No, Jin-Gu; Choi, Mi-Kyung; Yeom, Dong-Hyeon; Kim, Dong-Kyo; Yang, Byoung-Chul; Yoo, Jae Gyu; Kim, Min Kyu; Kim, Hong-Tea


    The objective of the present study was to investigate the effects of three different culture media on the development of canine somatic cell nuclear transfer (SCNT) embryos. Canine cloned embryos were cultured in modified synthetic oviductal fluid (mSOF), porcine zygote medium-3 (PZM-3), or G1/G2 sequential media. Our results showed that the G1/G2 media yielded significantly higher morula and blastocyst development in canine SCNT embryos (26.1% and 7.8%, respectively) compared to PZM-3 (8.5% and 0%or mSOF (2.3% and 0%) media. In conclusion, this study suggests that blastocysts can be produced more efficiently using G1/G2 media to culture canine SCNT embryos.

  16. Reference genes for reverse transcription quantitative PCR in canine brain tissue

    NARCIS (Netherlands)

    Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C


    BACKGROUND: In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and

  17. Identification of gender using radiomorphometric measurements of canine by discriminant function analysis

    Directory of Open Access Journals (Sweden)

    Lakshmi Kavitha Nadendla


    Conclusion: It can be concluded that both the clinical and radiographic measurements of MD width of canine and ICD are quick and easy methods for determining sex and in identification of an unknown individual with a substantial accuracy.

  18. Orthodontic management of bilaterally impacted mandibular canines in a growing patient

    Directory of Open Access Journals (Sweden)

    Rajaganesh J Gautam


    Full Text Available KK, an 11.9-year-old male patient, presented with the chief complaint of forwardly placed upper front teeth. Diagnosis revealed a Class II subdivision right malocclusion on an underlying Class I skeletal base with a horizontal growth pattern, bimaxillary proclination, crowding in the lower arch, over retained deciduous canines in the upper right and lower quadrants, an unerupted maxillary right permanent canine, and bilaterally impacted mandibular permanent canines, an increased overjet, and a deep overbite. He had a mild convex profile, a toothy smile with a nonconsonant smile arc and mildly protrusive lips. Treatment with a nonextraction treatment plan, which included surgical uncovering and orthodontic eruptive guidance of the impacted mandibular canines, with multibracket metallic fixed appliances, solved the patient′s complaints and achieved an esthetically pleasing and functionally adequate occlusal result.

  19. Heat shock protein expression in canine malignant mammary tumours

    International Nuclear Information System (INIS)

    Romanucci, Mariarita; Marinelli, Alessia; Sarli, Giuseppe; Salda, Leonardo Della


    Abnormal levels of Heat Shock Proteins (HSPs) have been observed in many human neoplasms including breast cancer and it has been demonstrated that they have both prognostic and therapeutic implications. In this study, we evaluated immunohistochemical expression of HSPs in normal and neoplastic canine mammary glands and confronted these results with overall survival (OS), in order to understand the role of HSPs in carcinogenesis and to establish their potential prognostic and/or therapeutic value. Immunohistochemical expression of Hsp27, Hsp72, Hsp73 and Hsp90 was evaluated in 3 normal canine mammary glands and 30 malignant mammary tumours (10 in situ carcinomas, 10 invasive carcinomas limited to local structures without identifiable invasion of blood or lymphatic vessels, 10 carcinomas with invasion of blood or lymphatic vessels and/or metastases to regional lymph nodes). A semi-quantitative method was used for the analysis of the results. Widespread constitutive expression of Hsp73 and Hsp90 was detected in normal tissue, Hsp72 appeared to be focally distributed and Hsp27 showed a negative to rare weak immunostaining. In mammary tumours, a significant increase in Hsp27 (P < 0.01), Hsp72 (P < 0.05) and Hsp90 (P < 0.01) expression was observed as well as a significant reduction in Hsp73 (P < 0.01) immunoreactivity compared to normal mammary gland tissue. Hsp27 demonstrated a strong positivity in infiltrating tumour cells and metaplastic squamous elements of invasive groups. High Hsp27 expression also appeared to be significantly correlated to a shorter OS (P = 0.00087). Intense immunolabelling of Hsp72 and Hsp73 was frequently detected in infiltrative or inflammatory tumour areas. Hsp90 expression was high in all tumours and, like Hsp73, it also showed an intense positivity in lymphatic emboli. These results suggest that Hsp27, Hsp72 and Hsp90 are involved in canine mammary gland carcinogenesis. In addition, Hsp27 appears to be implicated in tumour invasiveness and

  20. Molecular and serological surveillance of canine enteric viruses in stray dogs from Vila do Maio, Cape Verde. (United States)

    Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis


    Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from

  1. Heterogeneity within the hemagglutinin genes of canine distemper virus (CDV) strains detected in Italy

    DEFF Research Database (Denmark)

    Martella, V.; Cirone, F.; Elia, G.


    Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause....... These results suggest that at least three different CDV lineages are present in Italy. Keywords: Canine distemper virus; Dogs; Lineages; H gene...

  2. Canine Distemper Viral Inclusions in Blood Cells of Four Vaccinated Dogs


    McLaughlin, Bruce G.; Adams, Pamela S.; Cornell, William D.; Elkins, A. Darrel


    Four cases of canine distemper were detected by the presence of numerous cytoplasmic inclusions in various circulating blood cells. Fluorescent antibody techniques and electron microscopy confirmed the identity of the viral inclusions. The cases occurred in the same geographic area and within a short time span. All four dogs had been vaccinated against canine distemper, but stress or other factors may have compromised their immune status. The possibility of an unusually virulent virus strain ...

  3. Phylogenetic analysis of Austrian canine distemper virus strains from clinical samples from dogs and wild carnivores. (United States)

    Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K


    Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.

  4. Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease


    Specht, Andrew; Fiske, Laurie; Erger, Kirsten; Cossette, Travis; Verstegen, John; Campbell-Thompson, Martha; Struck, Maggie B.; Lee, Young Mok; Chou, Janice Y.; Byrne, Barry J.; Correia, Catherine E.; Mah, Cathryn S.; Weinstein, David A.; Conlon, Thomas J.


    A canine model of Glycogen storage disease type Ia (GSDIa) is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size,...

  5. Orthodontic tooth movement of total buccally blocked-out canine: a case report


    Alkhal, Hessa M; Rabie, Bakr; Wong, Ricky W K


    Orthodontic tooth movement of total buccally blocked-out canine is usually difficult as it is related with the problems of severe crowding, midline deviation, involvement of long root movement and risk of gingival recession. A case report was presented to illustrate the treatment principles. It demonstrated with careful planning in extraction sequence and orthodontic mechanics to deliver light, controlled force, condition of totally blocked out canine could be corrected with good results.

  6. An RCT on treatment of palatally displaced canines with RME and/or a transpalatal arch. (United States)

    Baccetti, Tiziano; Sigler, Lauren M; McNamara, James A


    To investigate the effect of rapid maxillary expansion (RME) and/or transpalatal arch (TPA) therapy in combination with deciduous canine extraction on the eruption of palatally displaced canines (PDCs). Hundred and twenty subjects were enrolled in an RCT based on PDCs diagnosed on panoramic radiographs and they were randomly assigned to one of four study groups. Three treatment groups (TGs) (RME followed by TPA therapy plus extraction of deciduous canines, RME/TPA/EC group, 40 subjects; TPA therapy plus extraction of deciduous canines, TPA/EC group, 25 subjects; extraction of deciduous canines, EC group, 25 subjects) were analyzed. A control group (CG, 30 subjects) received no orthodontic treatment. Prevalence rates of eruption of PDCs in the three TGs were compared with the CG at T2. Predictive features at T1 for successful canine eruption were tested in the three TGs. The prevalence of canine eruption was 80 per cent for the RME/TPA/EC group, 79 per cent for the TPA/EC group, 62.5 per cent for the EC group, versus 28 per cent in the CG, with statistically significant differences between all the groups, with the exception of the comparison between RME/TPA/EC and TPA/EC. Predictive pretreatment variables for the success of treatment were less severe sectors of canine displacement, prepubertal stages of skeletal maturity, and an open root apex of PDCs. The use of a TPA in absence of RME can be equally effective than the RME/TPA combination in PDC cases not requiring maxillary expansion, thus reducing the burden of treatment for the patient.

  7. A Case of Maxillary Protrusion with Congenitally Missing Canine Teeth in the Mandible


    松井, 啓至; 酒徳, 明彦


    A patient that had a maxillary protrusion with congenitally missing canine teeth in the mandible was successfully treated with the extraction of the maxillary first premolars. The patient's cooperation in wearing headgear appliance was highly favorable. Her profile changes were pronounced and esthetically pleasing. A review of her post-treatment records revealed an excellent esthetic and occlusal result even though the first premolars were aligned instead of the canine teeth in the mandible. ...

  8. Orthodontic tooth movement after extraction of previously autotransplanted maxillary canines and ridge augmentation. (United States)

    Collett, A R; Fletcher, B


    A case report is detailed in which autotransplanted maxillary canines were removed and the spaces closed. Substantial surrounding bone loss was associated with the upper right canine, and a bone graft was needed to reestablish normal dentoalveolar ridge morphology. Bone was taken from the maxillary tuberosity and placed in the canine extraction site, fixed with a bone screw, and covered with GoreTex. Seven months after placement of the bone graft, the GoreTex and stabilizing screw were removed to allow for consolidation of the bone. The upper left canine and lower second premolars were extracted, and fixed appliances were placed in both arches to align the teeth and close the spaces. Protraction of the upper right first premolar and retraction of the lateral incisor into the graft site were kept slow and constant with continued periodontal assessment. During the space closure, there was some concern that the bone in the graft site might resorb, leaving the teeth with compromised periodontal support. However, no significant periodontal attachment loss occurred despite ongoing concern about the amount of keratinized tissue. Perhaps the relatively slow rate of tooth movement provided for bone to be maintained and recreated ahead of the tooth. Almost complete closure of the upper canine extraction spaces was achieved. The upper premolars were substituted for the maxillary canines, and unfavorable prosthetic options were thus avoided. The lower arch was aligned, and the extraction spaces completely closed.

  9. Canine oral mucosa evaluation as a potential autograft tissue for the treatment of unresponsive keratoconjunctivitis sicca. (United States)

    Cherry, Rose L; Smith, Jodi D; Ben-Shlomo, Gil


    Labial mucosa transplantation for the treatment of canine keratoconjunctivitis sicca (KCS) has been reported recently. Postoperative alleviation of clinical signs was noted and assumed to be the result of labial salivary glands providing lubrication to the ocular tissue. The aim of this study was to evaluate the presence of minor salivary glands (MSG) in the canine oral mucosa. Oral mucosal biopsies were collected from six dogs that died (n = 1) or were euthanized (n = 5) for reasons unrelated to this study. The breeds included were two Doberman Pinschers, one Labrador Retriever, one Portuguese Water Dog, one German Shepherd Dog, and one mixed canine. Three were spayed females, and three were castrated males with the median age of 9 years (range, 6-13 years). Samples were obtained by an 8-mm punch biopsy at the following locations of the canine oral cavity: upper rostral labial mucosa at midline, lower rostral labial mucosa at midline, upper labial mucosa near the commissure, lower labial mucosa near the commissure, and buccal mucosa approximately 1 cm caudal to the commissure. Samples were routinely processed with hematoxylin and eosin, and periodic acid-Schiff stains. Samples were evaluated by light microscopy. At the selected locations, no MSG or other secreting cells were detected. Minor salivary glands are not associated with alleviation of canine KCS symptoms following labial mucosa transplantation. Further studies are needed to determine the mechanism leading to the transient improvement of KCS symptoms in canine patients following labial mucosa transplantation. © 2017 American College of Veterinary Ophthalmologists.

  10. Three-dimensional localization of impacted canines and root resorption assessment using cone beam computed tomography. (United States)

    Almuhtaseb, Eyad; Mao, Jing; Mahony, Derek; Bader, Rawan; Zhang, Zhi-xing


    The purpose of this study was to develop a new way to localize the impacted canines from three dimensions and to investigate the root resorption of the adjacent teeth by using cone beam computed tomography (CBCT). Forty-six patients undergoing orthodontic treatments and having impacted canines in Tongji Hospital were examined. The images of CBCT scans were obtained from KaVo 3D exam vision. Angular and linear measurements of the cusp tip and root apex according to the three planes (mid-sagittal, occlusal and frontal) have been taken using the cephalometric tool of the InVivo Dental Anatomage Version 5.1.10. The measurements of the angular and linear coordinates of the maxillary and mandibular canines were obtained. Using this technique the operators could envision the location of the impacted canine according to the three clinical planes. Adjacent teeth root resorption of 28.26 % was in the upper lateral incisors while 17.39% in upper central incisors, but no lower root resorption was found in our samples. Accurate and reliable localization of the impacted canines could be obtained from the novel analysis system, which offers a better surgical and orthodontic treatment for the patients with impacted canines.

  11. Efficacy of feline anti-parvovirus antibodies in the treatment of canine parvovirus infection. (United States)

    Gerlach, M; Proksch, A L; Unterer, S; Speck, S; Truyen, U; Hartmann, K


    This prospective, randomised, placebo-controlled, double-blinded study aimed to evaluate efficacy of commercially available feline anti-parvovirus antibodies in dogs with canine parvovirus infection. First, cross-protection of feline panleukopenia virus antibodies against canine parvovirus was evaluated in vitro. In the subsequent prospective clinical trial, 31 dogs with clinical signs of canine parvovirus infection and a positive faecal canine parvovirus polymerase chain reaction were randomly assigned to a group receiving feline panleukopenia virus antibodies (n=15) or placebo (n=16). All dogs received additional routine treatment. Clinical signs, blood parameters, time to clinical recovery and mortality were compared between the groups. Serum antibody titres and quantitative faecal polymerase chain reaction were compared on days 0, 3, 7, and 14. In vitro, canine parvovirus was fully neutralised by feline panleukopenia virus antibodies. There were no detected significant differences in clinical signs, time to clinical recovery, blood parameters, mortality, faecal virus load, or viral shedding between groups. Dogs in the placebo group showed a significant increase of serum antibody titres and a significant decrease of faecal virus load between day 14 and day 0, which was not detectable in dogs treated with feline panleukopenia virus antibodies. No significant beneficial effect of passively transferred feline anti-parvovirus antibodies in the used dosage regimen on the treatment of canine parvovirus infection was demonstrated. © 2017 British Small Animal Veterinary Association.

  12. A comparative study between mixed-type tumours from human salivary and canine mammary glands

    International Nuclear Information System (INIS)

    Genelhu, Marisa CLS; Cardoso, Sérgio V; Gobbi, Helenice; Cassali, Geovanni D


    In comparative pathology, canine mammary tumours have special interest because of their similarities with human breast cancer. Mixed tumours are uncommon lesions in the human breast, but they are found most frequently in the mammary gland of the female dogs and in the human salivary glands. The aim of the study was to compare clinical, morphological and immunohistochemical features of human salivary and canine mammary gland mixed tumours, in order to evaluate the latter as an experimental model for salivary gland tumours. Ten examples of each mixed tumour type (human pleomorphic adenoma and carcinomas ex-pleomorphic adenomas and canine mixed tumour and metaplastic carcinoma) were evaluated. First, clinical and morphologic aspects of benign and malignant variants were compared between the species. Then, streptavidin-biotin-peroxidase immunohistochemistry was performed to detect the expression of cytokeratins, vimentin, p63 protein, estrogen receptor, β-catenin, and E-cadherin. After standardization, similar age and site distributions were observed in human and canine tumours. Histological similarities were identified in the comparison of the benign lesions as well. Metaplastic carcinomas also resembled general aspects of carcinomas ex-pleomorphic adenomas in morphological evaluation. Additionally, immunohistochemical staining further presented similar antigenic expression between lesions. There are many similar features between human salivary and canine mammary gland mixed tumours. This observation is of great relevance for those interested in the study and management of salivary gland tumours, since canine lesions may constitute useful comparative models for their investigations

  13. A CBCT Investigation of the Association between Sella-Turcica Bridging and Maxillary Palatal Canine Impaction

    Directory of Open Access Journals (Sweden)

    Pamela M. Ortiz


    Full Text Available Objectives. To investigate the association between unilateral/bilateral maxillary canine impaction and sella-turcica bridging using CBCT imaging. Methods. This retrospective comparative study analyzed 76 CBCT images of the craniofacial complex including sella-turcica. The impacted cuspid group consisted of thirty-eight subjects (7 males, 31 females; mean age, 14.6 ± 3.2 years diagnosed with unilateral (left n=14, right n=11 or bilateral (n=13 palatal canine impaction. The control group included thirty-eight subjects matched by sex (7 males, 31 females; mean age, 19.5 ± 3.6 years with no impaction. Multinomial logistic regression analysis was used to determine the association between unilateral/bilateral canine impaction and right and left sella-turcica bridging. Results. The prevalence of sella-turcica bridging was 59.3% and 50% in the impacted canine and control groups, respectively. Although the odds for unilateral canine impaction were increased in the right and left sella-turcica bridging groups compared to the controls, the difference was not statistically significant. The risk of bilateral impaction was different between the two sides of sella-turcica bridging, but, again, the findings were not statistically significant. Conclusion. Contrary to previous 2D studies, there is no statistically significant association between unilateral/bilateral palatal canine impaction and sella-turcica bridging when using 3D CBCT.

  14. Canine spontaneous head and neck squamous cell carcinomas represent their human counterparts at the molecular level.

    Directory of Open Access Journals (Sweden)

    Deli Liu


    Full Text Available Spontaneous canine head and neck squamous cell carcinoma (HNSCC represents an excellent model of human HNSCC but is greatly understudied. To better understand and utilize this valuable resource, we performed a pilot study that represents its first genome-wide characterization by investigating 12 canine HNSCC cases, of which 9 are oral, via high density array comparative genomic hybridization and RNA-seq. The analyses reveal that these canine cancers recapitulate many molecular features of human HNSCC. These include analogous genomic copy number abnormality landscapes and sequence mutation patterns, recurrent alteration of known HNSCC genes and pathways (e.g., cell cycle, PI3K/AKT signaling, and comparably extensive heterogeneity. Amplification or overexpression of protein kinase genes, matrix metalloproteinase genes, and epithelial-mesenchymal transition genes TWIST1 and SNAI1 are also prominent in these canine tumors. This pilot study, along with a rapidly growing body of literature on canine cancer, reemphasizes the potential value of spontaneous canine cancers in HNSCC basic and translational research.

  15. Dental anomalies associated with buccally- and palatally-impacted maxillary canines. (United States)

    Sajnani, Anand K; King, Nigel M


    The aim of the present study was to determine the association of both buccally- and palatally-impacted canines with other dental anomalies. This retrospective study was conducted on a population of 533 southern Chinese children and adolescents who had impacted maxillary canines that had been treated in the Paediatric Dentistry and Orthodontics Clinic, Prince Philip Dental Hospital, The University of Hong Kong, Hong Kong. Descriptions of the impacted canine and other associated anomalies were obtained from the case notes and radiographs. Clinical photographs and study casts were used, where available. A total of 253 (47.5%) patients with impacted maxillary canines were diagnosed with other dental anomalies. Microdontia was the most frequently-occurring anomaly reported in these patients, with the maxillary lateral incisor the most commonly affected tooth. Other odontogenic anomalies that were associated with both buccally- and palatally-impacted canines included hypodontia, supernumerary teeth, transposition of other teeth, enamel hypoplasia, other impacted teeth, and dens invaginatus. Both buccally- and palatally-impacted canines were found to be associated with other odontogenic anomalies. © 2013 Wiley Publishing Asia Pty Ltd.

  16. Canines in the Classroom: Boccaccio, Dante, and the Visual Arts

    Directory of Open Access Journals (Sweden)

    Julia Cozzarelli


    Full Text Available The article has two primary objectives: it presents an analysis of the representation of animals in selected Italian literary works; and it utilizes that analysis as an example of how to incorporate the visual arts in teaching literature in the undergraduate classroom. The literary works discussed include Dante’s Inferno and the myth of Romulus and Remus as preparation for Boccaccio’s Decameron, specifically novelle IX.7 and V.8, with a thematic focus on portrayals of canines. The article argues that the use of artwork from the medieval and Renaissance periods, such as statuary, illustrated manuscripts, images in bestiaries, and works by Botticelli and other well-known artists, can be used to complement and reinforce interpretations of the texts, and are a powerful and effective tool in the learning process.

  17. Advances in canine distemper virus pathogenesis research: a wildlife perspective. (United States)

    Loots, Angelika K; Mitchell, Emily; Dalton, Desiré L; Kotzé, Antoinette; Venter, Estelle H


    Canine distemper virus (CDV) has emerged as a significant disease of wildlife, which is highly contagious and readily transmitted between susceptible hosts. Initially described as an infectious disease of domestic dogs, it is now recognized as a global multi-host pathogen, infecting and causing mass mortalities in a wide range of carnivore species. The last decade has seen the effect of numerous CDV outbreaks in various wildlife populations. Prevention of CDV requires a clear understanding of the potential hosts in danger of infection as well as the dynamic pathways CDV uses to gain entry to its host cells and its ability to initiate viral shedding and disease transmission. We review recent research conducted on CDV infections in wildlife, including the latest findings on the causes of host specificity and cellular receptors involved in distemper pathogenesis.

  18. Canine distemper virus infection in fennec fox (Vulpes zerda). (United States)

    Woo, Gye-Hyeong; Jho, Yeon-Sook; Bak, Eun-Jung


    Fifteen 8-month-old fennec foxes imported from Sudan showed fever, mucopurulent ocular discharge, diarrhea, severe emaciation, seizures, and generalized ataxia, and died. Three of the 15 animals were presented for diagnostic investigation. Severe dehydration, brain congestion, and gastric ulcers were observed in all animals. In one animal, the lungs had failed to collapse and were multifocally dark red in appearance. Histopathologically, there were lymphohistiocytic meningoencephalitis with malacia, mild interstitial pneumonia, lymphoid depletion of lymphoid tissues and organs, and intestinal villous atrophy with intralesional coccidia. There were many intracytoplasmic and/or intranuclear inclusion bodies in the epithelial cells of the medullary velum, lungs, liver, kidneys, trachea, pancreas, stomach, gall bladder, urinary bladder, and ureters, and in macrophages of malacia foci and lymphocytes and macrophages of lymphoid organs. Additionally, intestinal coccidia were confirmed to be Isospora species by a fecal test. To our knowledge, this is the first report of canine distemper with intestinal coccidiosis in fennec fox.

  19. Novel Areas for Prevention and Control of Canine Leishmaniosis. (United States)

    Miró, Guadalupe; Petersen, Christine; Cardoso, Luís; Bourdeau, Patrick; Baneth, Gad; Solano-Gallego, Laia; Pennisi, Maria Grazia; Ferrer, Lluís; Oliva, Gaetano


    There have been multiple recent advances regarding tools for the control and prevention of canine leishmaniosis (CanL), including new preventative vaccines. In this review, these advances are evaluated based on control targets, including vector and parasite. Leishvet recommendations are provided for control practices based on the dog's risk of infection. New topical insecticide formulations have proven to be effective in preventing sand fly bites, and subsequently infection. Parasite control occurs through chemotherapeutic or immunologic means, which decrease or prevent transmission to other animals, including humans. Leishmaniosis control programs that include a combination of coordinated measures, either in individuals or for prevention across reservoir populations, are required. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Leishmania spp. Epidemiology of Canine Leishmaniasis in the Yucatan Peninsula

    Directory of Open Access Journals (Sweden)

    A. López-Céspedes


    Full Text Available Canine Leishmaniasis is widespread in various Mexican states, where different species of Leishmania have been isolated from dogs. In the present study, we describe the detection of L. braziliensis, L. infantum, and L. mexicana in serum of dogs from the states of Yucatan and Quintana Roo in the Yucatan Peninsula (Mexico. A total of 412 sera were analyzed by ELISA using the total extract of the parasite and the iron superoxide dismutase excreted by different trypanosomatids as antigens. We found the prevalence of L. braziliensis to be 7.52%, L. infantum to be 6.07%, and L. mexicana to be 20.63%, in the dog population studied. The results obtained with ELISA using iron superoxide dismutase as the antigen were confirmed by western blot analysis with its greater sensitivity, and the agreement between the two techniques was very high.

  1. The first reported case of canine subcutaneous Cryptococcus flavescens infection. (United States)

    Kano, Rui; Ishida, Rinei; Nakane, Shinsuke; Sekiguchi, Maiko; Hasegawa, Atsuhiko; Kamata, Hiroshi


    This report describes the first documented case of subcutaneous infection due to Cryptococcus flavescens in a dog. The chief symptoms of the patient dog were abscessed lesions on the dorsal muzzle, right eyelid, and lower jaw. Biopsy specimens from the lesions on the dorsal muzzle and lower jaw showed pyogranulomatous inflammation with numerous yeast cells. The patient dog was diagnosed with a subcutaneous fungal infection and orally received 5 mg/kg itraconazole once a day for 2 months, the abscesses disappeared. After 1 month at the end of treatment, the skin lesions did not redevelop. Isolates from the biopsy specimens were identified as C. flavescens by molecular analysis as well as morphologic and biochemical examination, indicating that C. flavescens is a potential canine pathogen.

  2. Leishmania spp. epidemiology of canine leishmaniasis in the Yucatan Peninsula. (United States)

    López-Céspedes, A; Longoni, S S; Sauri-Arceo, C H; Sánchez-Moreno, M; Rodríguez-Vivas, R I; Escobedo-Ortegón, F J; Barrera-Pérez, M A; Bolio-González, M E; Marín, C


    Canine Leishmaniasis is widespread in various Mexican states, where different species of Leishmania have been isolated from dogs. In the present study, we describe the detection of L. braziliensis, L. infantum, and L. mexicana in serum of dogs from the states of Yucatan and Quintana Roo in the Yucatan Peninsula (Mexico). A total of 412 sera were analyzed by ELISA using the total extract of the parasite and the iron superoxide dismutase excreted by different trypanosomatids as antigens. We found the prevalence of L. braziliensis to be 7.52%, L. infantum to be 6.07%, and L. mexicana to be 20.63%, in the dog population studied. The results obtained with ELISA using iron superoxide dismutase as the antigen were confirmed by western blot analysis with its greater sensitivity, and the agreement between the two techniques was very high.

  3. Canine parvovirus (CPV-2) variants circulating in Nigerian dogs (United States)

    Apaa, T. T.; Daly, J. M.; Tarlinton, R. E.


    Canine parvovirus type 2 (CPV-2) is a highly contagious viral disease with three variants (CPV-2a, CPV-2b and CPV-2c) currently circulating in dogs worldwide. The main aim of this study was to determine the prevalent CPV-2 variant in faecal samples from 53 dogs presenting with acute gastroenteritis suspected to be and consistent with CPV-2 to Nigerian Veterinary Clinics in 2013–2014. Seventy-five per cent of these dogs tested positive for CPV-2 in a commercial antigen test and/or by PCR. Partial sequencing of the VP2 gene of six of these demonstrated them to be CPV-2a. Most of the dogs (60 per cent) were vaccinated, with 74 per cent of them puppies less than six months old. PMID:27933190

  4. Prevalence of canine parvovirus infection in Grand Tunis, Tunisia

    Directory of Open Access Journals (Sweden)

    Ghada Tagorti


    Results: The overall prevalence of CPV-2 was 32.14% (n=54/168. A total number of 54 young dogs, aging 1 to 7 months, of American Staffordshire terrier, German shepherd, Rottweiler and Spaniel breeds were affected. There was no sex predisposition and German shepherd was the over-represented breed (n=33/54; 61.11%. The prevalence of clinical cases below the three months old was 70.37% (n=38/54 with autumn (n=27/54; 50% as the most common season of infection. Furthermore, the study showed that 87.04% (n=47/54 of CPV-2 unvaccinated young dogs were positive. Conclusion: This work was a new descriptive study concerning canine parvovirus infection in the Grand Tunis; further studies are required to better characterize the epidemiology of CPV-2 infection in Tunisia. [J Adv Vet Anim Res 2018; 5(1.000: 93-97

  5. Genetic characterization of canine parvovirus from dogs in Pakistan. (United States)

    Shabbir, M Z; Sohail, M U; Chaudhary, U N; Yaqub, W; Rashid, I; Saleem, M H; Munir, M

    Canine parvoviruses (CPV) exist as antigenic variants with varying frequencies and genetic variabilities across the globe. Given the endemicity and high prevalence in Pakistan, we characterized the CPVs originating from dogs-population to elucidate viral diversity and evolution. Fecal samples from clinically diseased pups (n = 17) of different breeds and age (2-6 months) were processed for hemagglutination assay (HA), and later for partial amplification of VP2 gene sequence and amino acid analysis. A total of 11 samples (64.71%) were found positive both in hemagglutination and PCR assays. Phylogenetic and evolutionary analysis demonstrated higher genetic heterogeneity in studied strains and constituted seven clusters within the CPV-2a group, however, they shared high level of identity with Chinese strains. Further studies are necessary to elucidate genetic analysis and epidemiology of CPV variants across a wide geographical area of the country.

  6. Low-Field Magnetic Resonance Imaging of Canine Hydrocephalus

    Directory of Open Access Journals (Sweden)

    Z. Adamiak* and M. Jaskólska and A. Pomianowski1


    Full Text Available The aim of presented study was to evaluate selected surface spine coil, and low-field magnetic resonance (MR selected sequences in diagnosing hydrocephalus in dogs. This paper discusses 19 dogs (14 canine patients with hydrocephalus and 5 healthy dogs, of five breeds, subjected to low-field magnetic resonance imaging (MRI of hydrocephalus. Area of the lateral ventricles and brain were examined in dogs with hydrocephalus using low-field MRI (at 0.25 Tesla. The MRI of FSE REL, SE, FLAIR, STIR, 3D HYCE, T3DT1, GE STIR 3D and 3D SHARC sequences with an indication of the most effective sequences are described. Additionally, coils for MR were compared, and models for infusion anesthesia were described. As a result of performed study all estimated sequences were diagnostically useful. However, spinal coil No. 2 (ESAOTE was the most optimal for examining and positioning the cranium.

  7. Canine angiostrongylosis: recent advances in diagnosis, prevention, and treatment

    Directory of Open Access Journals (Sweden)

    Di Cesare A


    Full Text Available Angela Di Cesare, Donato Traversa Faculty of Veterinary Medicine, University of Teramo, Teramo, Italy Abstract: Angiostrongylus vasorum is a parasitic nematode affecting the heart and pulmonary arteries of wild (eg, foxes and domestic canids. The parasite has an indirect life cycle in which slugs and snails act as intermediate hosts. In the last few years the parasite has spread outside the traditional endemic foci, and there is a rise of documented cases of canine angiostrongylosis across Europe. Angiostrongylus vasorum causes cardiopulmonary disorders and coagulopathies, along with different nonspecific clinical signs. Fatal infections are frequently reported. Given the severity of the infection and the recent geographic spreading of the parasite, this article reviews and discusses the current knowledge of A. vasorum, with a special focus on recent insights on diagnosis, prevention, and treatment of dog angiostrongylosis. Keywords: Angiostrongylus vasorum, dog, epidemiology, diagnostic approaches, control, therapy

  8. Treatment of canine benign prostatic hyperplasia with medroxyprogesterone acetate

    International Nuclear Information System (INIS)

    Bamberg-Thalen, B.; Linde-Forsberg, C.


    Nineteen dogs with clinical signs of benign prostatic hyperplasia (BPH) were given a subcutaneous injection of medroxyprogesterone acetate (MPA). At the first follow-up four to six weeks after treatment, 16 (84%) showed no signs of prostatic disease, and in 10 (53%) radiography revealed that the prostate had decreased in size. The dogs were followed for an average of 17 months. Twelve (64%) showed no signs of prostatic disease for at least 10 months. Relapses occurred in 10 between 10 and 24 months after treatment. Based on the results of this study and an earlier study on the effects of estrogen on BPH, it was concluded that MPA was a good alternative for treatment of canine BPH

  9. Immunohistochemical study of doublecortin and nucleostemin in canine brain

    Directory of Open Access Journals (Sweden)

    E. De Nevi


    Full Text Available Finding a marker of neural stem cells remains a medical research priority. It was reported that the proteins doublecortin and nucleostemin were related with stem/progenitor cells in central nervous system. The aim of the present immunohistochemical study was to evaluate the expression of these proteins and their pattern of distribution in canine brain, including age-related changes, and in non-nervous tissues. We found that doublecortin had a more specific expression pattern, related with neurogenesis and neuronal migration, while nucleostemin was expressed in most cells of almost every tissue studied. The immunolabeling of both proteins decreased with age. We may conclude that nucleostemin is not a specific marker of stem/progenitor cells in the dog. Doublecortin, however, is not an exclusive marker of neural stem cells, but also of neuronal precursors.

  10. Evidence supporting the conceptual framework of cancer chemoprevention in canines. (United States)

    Kondratyuk, Tamara P; Adrian, Julie Ann Luiz; Wright, Brian; Park, Eun-Jung; van Breemen, Richard B; Morris, Kenneth R; Pezzuto, John M


    As with human beings, dogs suffer from the consequences of cancer. We investigated the potential of a formulation comprised of resveratrol, ellagic acid, genistein, curcumin and quercetin to modulate biomarkers indicative of disease prevention. Dog biscuits were evaluated for palatability and ability to deliver the chemopreventive agents. The extent of endogenous DNA damage in peripheral blood lymphocytes from dogs given the dietary supplement or placebo showed no change. However, H2O2-inducible DNA damage was significantly decreased after consumption of the supplement. The expression of 11 of 84 genes related to oxidative stress was altered. Hematological parameters remained in the reference range. The concept of chemoprevention for the explicit benefit of the canine is compelling since dogs are an important part of our culture. Our results establish a proof-of-principle and provide a framework for improving the health and well-being of "man's best friend".


    Chinnadurai, Sathya K; Kinsel, Michael J; Adkesson, Michael J; Terio, Karen


    A 6-yr-old male snow leopard ( Panthera uncia) presented with acute seizures, hyperthermia, and tachypnea. Because of a diagnosis of anuric renal failure, the animal was euthanized. On histopathologic examination, numerous intralesional intracytoplasmic and intranuclear inclusions were found in the lungs, lymph nodes, and stomach. Positive immunohistochemical staining for canine distemper virus (CDV) was found in the lungs and, to a lesser extent, in the lymph nodes and brain. Molecular testing yielded a CDV H gene sequence that was closely related to CDV isolates concurrently found in wild raccoons from adjacent forested areas. The leopard had been vaccinated once against CDV with the use of a recombinant canarypox-vectored live vaccine during a routine wellness examination 12 wk prior to death. Serial serum neutralization titers performed on banked serum collected between vaccination and death showed poor serologic response to the vaccine. This case demonstrates a probable failure of protection against naturally occurring CDV.

  12. Echocardiography as an approach for canine cardiac disease diagnosis

    Directory of Open Access Journals (Sweden)

    P. Singh


    Full Text Available Aim: The aim of the study was to establish the methods for diagnosis various canine cardiac ailments using echocardiography. Materials and Methods: M-mode, two-dimensional echocardiography and Doppler studies were performed on 10 cases. Dogs showing signs of cardiac ailment either clinically, radiographic or via electrocardiographic examination were selected for study. Right parasternal short axis view was used for echocardiographic measurements. Right parasternal long axis and left parasternal apical views were used for Doppler studies. Doppler studies were performed at the level of aortic valve and atrioventricular valves for semi quantitative diagnosis of regurgitation. Results: Dogs were found affected with dilated cardiomyopathy (DCM (n=5, pericardial effusion (PE (n=1, combined PE and DCM (n=2 and remaining two showed abnormality on radiographic or electrographically evaluation but were found out to be normal echocardiographically (n=2. Conclusion: Echocardiography is an effective tool for diagnosis of various heart ailments.

  13. Vertebral scale system to measure canine heart size in radiographs

    International Nuclear Information System (INIS)

    Buchanan, J.W.; Bucheler, J.


    A method for measuring canine heart size in radiographs was developed on the basis that there is a good correlation between heart size and body length regardless of the conformation of the thorax. The lengths of the long and short axes of the heart of 100 clinically normal dogs were determined with calipers, and the dimensions were scaled against the length of vertebrae dorsal to the heart beginning with T4. The sum of the long and short axes of the heart expressed as vertebral heart size was 9.7 +/- 0.5 vertebrae. The differences between dogs with a wide or deep thorax, males and females, and right or left lateral recumbency were not significant. The caudal vena cava was 0.75 vertebrae +/- 0.13 in comparison to the length of the vertebra over the tracheal bifurcation

  14. Seroprevalence of Canine Parvovirus in Dogs in Lusaka District, Zambia. (United States)

    Saasa, Ngonda; Nalubamba, King Shimumbo; M'kandawire, Ethel; Siwila, Joyce


    Canine parvovirus (CPV) enteritis is a highly contagious enteric disease of young dogs. Limited studies have been done in Zambia to investigate the prevalence of CPV in dogs. Blood was collected from dogs from three veterinary clinics (clinic samples, n = 174) and one township of Lusaka (field samples, n = 56). Each dog's age, sex, breed, and vaccination status were recorded. A haemagglutination assay using pig erythrocytes and modified live parvovirus vaccine as the antigen was used. Antibodies to CPV were detected in 100% of dogs (unvaccinated or vaccinated). The titres ranged from 160 to 10240 with a median of 1280. Vaccinated dogs had significantly higher antibody titres compared to unvaccinated ( p vaccination status were significant predictors of antibody titres. The presence of antibody in all dogs suggests that the CPV infection is ubiquitous and the disease is endemic, hence the need for research to determine the protection conferred by vaccination and natural exposure to the virus under local conditions.

  15. Constructing canine carotid artery stenosis model by endovascular technique

    International Nuclear Information System (INIS)

    Cheng Guangsen; Liu Yizhi


    Objective: To establish a carotid artery stenosis model by endovascular technique suitable for neuro-interventional therapy. Methods: Twelve dogs were anesthetized, the unilateral segments of the carotid arteries' tunica media and intima were damaged by a corneous guiding wire of home made. Twenty-four carotid artery stenosis models were thus created. DSA examination was performed on postprocedural weeks 2, 4, 8, 10 to estimate the changes of those stenotic carotid arteries. Results: Twenty-four carotid artery stenosis models were successfully created in twelve dogs. Conclusions: Canine carotid artery stenosis models can be created with the endovascular method having variation of pathologic characters and hemodynamic changes similar to human being. It is useful for further research involving the new technique and new material for interventional treatment. (authors)

  16. Microangiographic study of the canine dental tissues: a preliminary report

    International Nuclear Information System (INIS)

    Miyabayashi, T.; Morgan, J.P.


    A microangiographic study of the dental tissues was performed on one adult mongrel dog to examine the usefulness of the technique. This preliminary study used 30% wt/vol Micropaque suspension which was perfused into the common carotid arteries. After the complete perfusion, the specimen was fixed into a mixture of 10% buffered neutral formalin solution and 95% ethyl alcohol. The mandibular bone with teeth in situ was decalcified. The specimen was embedded in methyl methacrylate. One mm slab sections were made, and then the microangiographs were made. Adequate filling of arterioles was evident on the microangiographs. This technique is shown to be useful in characterizing the nature of the blood supply to the bone and teeth that might be involved in the pathogenesis of radiation-induced injury in the canine dental and periodontal tissues

  17. Bone compaction enhances implant fixation in a canine gap model

    DEFF Research Database (Denmark)

    Kold, Søren; Rahbek, Ole; Toft, Marianne


    A new bone preparation technique, compaction, has increased fixation of implants inserted with exact-fit or press-fit to bone. Furthermore, a demonstrated spring-back effect of compacted bone might be of potential value in reducing the initial gaps that often exist between clinical inserted...... implants and bone. However, it is unknown whether the compression and breakage of trabeculae during the compaction procedure results in impaired gap-healing of compacted bone. Therefore, we compared compaction with conventional drilling in a canine gap model. Grit-blasted titanium implants (diameter 6 mm...... that the beneficial effect of reduced gap size, as compacted bone springs back, is not eliminated by an impaired gap-healing of compacted bone....

  18. Psychiatric Nurses' Views on Caring: Patients and Canine Companions. (United States)

    King, Camille


    Psychiatric nurses are expert care providers for individuals with mental health needs. The art of caring spans across multiple species, is important to understand, and is universal whether intentions are toward individuals or animals. Pets are often cared for and viewed as family members. The current research examined psychiatric nurses' views on the similarities and differences of caring for patients and their pet dogs. Twenty-five nurses were interviewed. Similarities of caring for patients and canines included trusting relationships, companionship, daily basic needs, and improved communication through monitored body language. Differences in caring included personal expectations, unconditional love, and professional boundaries. Understanding the concepts of caring for patients and pet dogs will provide the opportunity for insight into familial versus professional relationships, improve communication with others, and strengthen the human-animal bond. [Journal of Psychosocial Nursing and Mental Health Services, 55(3), 46-52.]. Copyright 2017, SLACK Incorporated.

  19. Evaluation of the status of canine hydrotherapy in the UK. (United States)

    Waining, M; Young, I S; Williams, S B


    To establish the current status of canine hydrotherapy in the UK and to ascertain information regarding the current use of hydrotherapy, a questionnaire was sent to 152 hydrotherapy centres throughout the UK, from which 89 responded. Hydrotherapy was found to be a rapidly growing business. Stand-alone centres were in existence; however, many centres were connected to other businesses, including boarding kennels and general practice veterinary surgeries. The dogs using the facility were mainly pedigree breeds, particularly labrador retrievers (30 per cent), and the most commonly encountered conditions were rupture of the cranial cruciate ligament (25 per cent), hip dysplasia (24 per cent) and osteoarthritis (18 per cent). The proportion of qualified versus unqualified staff varied between centres, highlighting a need for improved regulation of this aspect of the industry. However, all the dogs treated by the hydrotherapy centres surveyed were direct veterinary referrals, suggesting a good degree of professionalism in the field and a high regard for the benefits of hydrotherapy.

  20. In vivo proton MR spectroscopy of canine status epilepticus

    International Nuclear Information System (INIS)

    Sandstrom, J.C.; Partington, C.R.; Perman, W.H.


    Invasive studies of rodent seizure models have demonstrated twice-normal lactate accumulation at the seizure focus. The authors investigated metabolic changes in canine kainic acid-induced seizures by means of in vivo volume-selective water-suppressed proton MR spectroscopy (MVSTE pulse sequence). Spectra from several experiments are presented demonstrating changes in lactate and MR imaging-visible lipid concentration. Spectra were obtained with interlaced acquisition from the brain and an external standard for relative quantification, with best-case line width of 4 Hz and typical line widths of 7-15 Hz at 1.5 T. Direct injection of NAA and lactate in the brain allowed in vivo identification of resonances

  1. Telomere length in normal and neoplastic canine tissues. (United States)

    Cadile, Casey D; Kitchell, Barbara E; Newman, Rebecca G; Biller, Barbara J; Hetler, Elizabeth R


    To determine the mean telomere restriction fragment (TRF) length in normal and neoplastic canine tissues. 57 solid-tissue tumor specimens collected from client-owned dogs, 40 samples of normal tissue collected from 12 clinically normal dogs, and blood samples collected from 4 healthy blood donor dogs. Tumor specimens were collected from client-owned dogs during diagnostic or therapeutic procedures at the University of Illinois Veterinary Medical Teaching Hospital, whereas 40 normal tissue samples were collected from 12 control dogs. Telomere restriction fragment length was determined by use of an assay kit. A histologic diagnosis was provided for each tumor by personnel at the Veterinary Diagnostic Laboratory at the University of Illinois. Mean of the mean TRF length for 44 normal samples was 19.0 kilobases (kb; range, 15.4 to 21.4 kb), and the mean of the mean TRF length for 57 malignant tumors was 19.0 kb (range, 12.9 to 23.5 kb). Although the mean of the mean TRF length for tumors and normal tissues was identical, tumor samples had more variability in TRF length. Telomerase, which represents the main mechanism by which cancer cells achieve immortality, is an attractive therapeutic target. The ability to measure telomere length is crucial to monitoring the efficacy of telomerase inhibition. In contrast to many other mammalian species, the length of canine telomeres and the rate of telomeric DNA loss are similar to those reported in humans, making dogs a compelling choice for use in the study of human anti-telomerase strategies.

  2. Genomic prediction of traits related to canine hip dysplasia

    Directory of Open Access Journals (Sweden)

    Enrique eSanchez-Molano


    Full Text Available Increased concern for the welfare of pedigree dogs has led to development of selection programs against inherited diseases. An example is canine hip dysplasia (CHD, which has a moderate heritability and a high prevalence in some large-sized breeds. To date, selection using phenotypes has led to only modest improvement, and alternative strategies such as genomic selection may prove more effective. The primary aims of this study were to compare the performance of pedigree- and genomic-based breeding against CHD in the UK Labrador retriever population and to evaluate the performance of different genomic selection methods. A sample of 1179 Labrador Retrievers evaluated for CHD according to the UK scoring method (hip score, HS was genotyped with the Illumina CanineHD BeadChip. Twelve functions of HS and its component traits were analyzed using different statistical methods (GBLUP, Bayes C and Single-Step methods, and results were compared with a pedigree-based approach (BLUP using cross-validation. Genomic methods resulted in similar or higher accuracies than pedigree-based methods with training sets of 944 individuals for all but the untransformed HS, suggesting that genomic selection is an effective strategy. GBLUP and Bayes C gave similar prediction accuracies for HS and related traits, indicating a polygenic architecture. This conclusion was also supported by the low accuracies obtained in additional GBLUP analyses performed using only the SNPs with highest test statistics, also indicating that marker-assisted selection would not be as effective as genomic selection. A Single-Step method that combines genomic and pedigree information also showed higher accuracy than GBLUP and Bayes C for the log-transformed HS, which is currently used for pedigree based evaluations in UK. In conclusion, genomic selection is a promising alternative to pedigree-based selection against CHD, requiring more phenotypes with genomic data to improve further the accuracy

  3. Molecular identification of bacteria associated with canine periodontal disease. (United States)

    Riggio, Marcello P; Lennon, Alan; Taylor, David J; Bennett, David


    Periodontal disease is one of the most common diseases of adult dogs, with up to 80% of animals affected. The aetiology of the disease is poorly studied, although bacteria are known to play a major role. The purpose of this study was to identify the bacteria associated with canine gingivitis and periodontitis and to compare this with the normal oral flora. Swabs were obtained from the gingival margin of three dogs with gingivitis and three orally healthy controls, and subgingival plaque was collected from three dogs with periodontitis. Samples were subjected to routine bacterial culture. The prevalent species identified in the normal, gingivitis and periodontitis groups were uncultured bacterium (12.5% of isolates), Bacteroides heparinolyticus/Pasteurella dagmatis (10.0%) and Actinomyces canis (19.4%), respectively. Bacteria were also identified using culture-independent methods (16S rRNA gene sequencing) and the predominant species identified were Pseudomonas sp. (30.9% of clones analysed), Porphyromonas cangingivalis (16.1%) and Desulfomicrobium orale (12.0%) in the normal, gingivitis and periodontitis groups, respectively. Uncultured species accounted for 13.2%, 2.0% and 10.5%, and potentially novel species for 38.2%, 38.3% and 35.3%, of clones in the normal, gingivitis and periodontitis groups, respectively. This is the first study to use utilise culture-independent methods for the identification of bacteria associated with this disease. It is concluded that the canine oral flora in health and disease is highly diverse and also contains a high proportion of uncultured and, in particular, potentially novel species. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Long-term effects of canine parvovirus infection in dogs. (United States)

    Kilian, Elena; Suchodolski, Jan S; Hartmann, Katrin; Mueller, Ralf S; Wess, Gerhard; Unterer, Stefan


    Canine parvovirus (CPV) is the most important viral cause of acute canine enteritis leading to severe damage of the intestinal barrier. It has been speculated that dogs might develop chronic disorders after surviving CPV infection. However, no studies regarding the long-term implications of CPV infection have been published to date. The aim of this study was to evaluate whether dogs that have survived CPV infection will have an increased risk for developing chronic gastroenteritis, atopic dermatitis, or cardiac disease. Dogs that had been treated at the Clinic of Small Animal Medicine, LMU Munich, for CPV infection for which a follow-up of at least 12 months was available, were included in the study. Owners completed a questionnaire on the presence of chronic gastrointestinal and cutaneous signs, cardiac disease, and other potential disorders. An identical questionnaire was sent to owners of matched control dogs during the same time period. Seventy-one questionnaires of dogs with CPV infection and 67 of control dogs were analyzed. Significantly more CPV-infected dogs (30/71) compared to control dogs (8/67) had developed chronic gastrointestinal signs later in their lives (P < 0.001). No significant differences were observed regarding skin diseases (P = 1), cardiac problems (P = 0.160), or any other diseases (P = 0.173) later in life. Results of this study suggest that dogs that survive CPV infection have a significantly higher risk (odds ratio = 5.33) for developing a chronic gastrointestinal disease. Further prospective studies to identify the trigger for the development of chronic diarrhoea and possible targeted treatment strategies are needed.

  5. Immunohistochemical detection of estrogen receptors in canine mammary tumors

    Directory of Open Access Journals (Sweden)

    Elena Atanaskova Petrov


    Full Text Available Mammary tumors are among the most common neoplasms in intact female dogs.They have a complex morphology, usually affecting middle age and older bitches. Almost 50% of the mammary tumors in dogs are malignant neoplasms. Prognosis is based on several factors: stage, age, tumor size, metastasis, histopathology, ovariectomy status and hormone-receptor activity. Immunohistochemical (IHC measurement has become increasingly an important diagnostic and prognostic parameter, with the development of monoclonal antibodies against nuclear estrogen and progestin receptors. The aim of this study was to detect the presence of ER receptors in malignant canine mammary tumors and to identify their association with the clinical course of the tumor. Mammary tumor samples have been obtained by mastectomy from dogs presented at our clinic. Detailed clinical examination, CBC and basic serum biochemical profile were performed in all patients. Surgery was the only treatment. Histopathological examination and immunohistochemical detection of estrogen α receptors (ERα was performed on 8 formalin-fixed, paraffin-embedded tissue samples, using the PT LINK immunoperoxidase technique. Histopathological examination of the mammary tumor samples (n=11 revealed tubular adenocarcinoma (n=6,54.5% and ductal adenocarcinoma (n=3, 27.3%, one patient with benign adenoma and one with mastitis. Patients with positive ER tumors are alive, without remission, while 3 of the patients that were ER negative died due to lung metastases. According to our results, it can be concluded that the appearance and development of canine mammary tumors is highly connected with ovarian steroid hormones and that immunostaining of the tumors may be used as a good prognostic parameter in these patients.

  6. Comparative expression pathway analysis of human and canine mammary tumors

    Directory of Open Access Journals (Sweden)

    Marconato Laura


    Full Text Available Abstract Background Spontaneous tumors in dog have been demonstrated to share many features with their human counterparts, including relevant molecular targets, histological appearance, genetics, biological behavior and response to conventional treatments. Mammary tumors in dog therefore provide an attractive alternative to more classical mouse models, such as transgenics or xenografts, where the tumour is artificially induced. To assess the extent to which dog tumors represent clinically significant human phenotypes, we performed the first genome-wide comparative analysis of transcriptional changes occurring in mammary tumors of the two species, with particular focus on the molecular pathways involved. Results We analyzed human and dog gene expression data derived from both tumor and normal mammary samples. By analyzing the expression levels of about ten thousand dog/human orthologous genes we observed a significant overlap of genes deregulated in the mammary tumor samples, as compared to their normal counterparts. Pathway analysis of gene expression data revealed a great degree of similarity in the perturbation of many cancer-related pathways, including the 'PI3K/AKT', 'KRAS', 'PTEN', 'WNT-beta catenin' and 'MAPK cascade'. Moreover, we show that the transcriptional relationships between different gene signatures observed in human breast cancer are largely maintained in the canine model, suggesting a close interspecies similarity in the network of cancer signalling circuitries. Conclusion Our data confirm and further strengthen the value of the canine mammary cancer model and open up new perspectives for the evaluation of novel cancer therapeutics and the development of prognostic and diagnostic biomarkers to be used in clinical studies.

  7. Wound healing modulators in a tracheoplasty canine model. (United States)

    Olmos-Zúñiga, J Raúl; Hernández-Jiménez, Claudia; Díaz-Martínez, Emmanuel; Jasso-Victoria, Rogelio; Sotres-Vega, Avelina; Gaxiola-Gaxiola, Miguel O; Villalba-Caloca, Jaime; Baltazares-Lipp, Matilde; Santillán-Doherty, Patricio; Santibáñez-Salgado, J Alfredo


    Postsurgical tracheal stenosis results from fibrosis formation due to ischemia. There are healing modulators, hyaluronic acid (HA) and collagen polyvinylpyrrolidone (CPVP), which reduce collagen fibers formation. Thus we can hypothesize that the topical application of one of these modulators can diminish postsurgical tracheal scarring and stenosis. The aim of this work was to evaluate the macroscopic, microscopic, and biochemical changes of tracheal healing after the application of HA or CPVP in a canine tracheoplasty model. The study design was prospective experimental investigation in a canine model. Eighteen mongrel dogs underwent three cervical tracheal rings resection and end-to-end anastomosis. They were randomized into three groups according to treatment: group I (control group) (n = 6), topical application of saline solution on tracheal anastomosis; group II (n = 6), topical application of 15 microg HA on tracheal anastomosis; and group III (n = 6), topical application of 2.5 mg CPVP on tracheal anastomosis. They were evaluated clinical, radiological and tracheoscopically during 4 weeks. They were euthanized at the end of the study time. Macroscopic, microscopic, and biochemical changes of tracheal anastomosis healing were analyzed. Collagen formation was quantified by the Woessner method. All the animals survived the surgical procedure and study period. Macroscopic, radiologic, and endoscopic studies showed that animals in group I developed tracheal stenosis, inflammation, and firm fibrous tissue formation, and histological studies also showed severe inflammatory reaction and fibrosis formation. Groups II (HA) and III (CPVP) showed well-organized thin collagen fibers with minimal inflammatory response. Biochemical evaluation revealed a higher collagen concentration in group I animals (analysis of variance [ANOVA] p anastomosis diminished the degree of stenosis and inflammatory reaction. Both modulators improved tracheal healing.

  8. Surgical construction of a novel simulated carotid siphon in canines

    International Nuclear Information System (INIS)

    Tan Huaqiao; Li Minghua; Zhu Yueqi; Fang Chun; Wang Jue; Wu Chungen; Cheng Yingsheng; Xie Jian; Zhang He


    Objective: To develop in vivo carotid siphon models by surgical method using the shaped devices for testing the performance of covered stent specially designed for intracranial vascular diseases. Methods: Six carotid siphon-shaped devices were established using stereolithographic biomodeling and the lost-wax technique. Six canines underwent surgery to expose and isolate bilateral CCA. The right CCA origin was ligated and incised distal to the ligation point after the distal right CCA was temporarily closed. The distal left CCA was ligated and incised proximal to the ligation point after the left CCA origin was closed. The proximal isolated left CCA was passed through the shaped device. The distal isolated right CCA and the proximal isolated left CCA were anastomosed end-to-end. Finally, the shaped device of carotid siphon was fixed with suture and embedded in the left neck. The intraarterial DSA was performed on postprocedural 7 days, 2 weeks and 1 month. The morphological characteristics of carotid siphon models were visually evaluated by two observers. The patency of siphon model and the stenosis of anastomotic stoma were followed-up. Results: All animals tolerated the surgical procedure well with mean model time construction of 90 minutes. The morphological characteristics of siphon models were similar to those in human. The anastomotic stoma stenosis occurred in 2 siphon models, and thrombosis of anastomotic stoma in 1, but all siphons of these models were patent on post-procedural follow-up angiography. Conclusion: Surgical construction of an in vivo carotid siphon model of canine with shaped device is practically feasible. This model can be used for testing neurovascular devices. (authors)

  9. In vivo facet joint loading of the canine lumbar spine. (United States)

    Buttermann, G R; Schendel, M J; Kahmann, R D; Lewis, J L; Bradford, D S


    This study describes a technique to measure in vivo loads and the resultant load-contact locations in the facet joint of the canine lumbar spine. The technique is a modification of a previously described in vitro method that used calibrated surface strains of the lateral aspect of the right L3 cranial articular process. In the present study, strains were measured during various in vivo static and dynamic activities 3 days after strain gage implantation. The in vivo recording technique and its errors, which depend on the location of the applied facet loads, is described. The results of applying the technique to five dogs gave the following results. Relative resultant contact load locations on the facet tended to be in the central and caudal portion of the facet in extension activities, central and cranial in standing, and cranial and ventral in flexion or right-turning activities. Right-turning contact locations were ventral and cranial to left-turning locations. Resultant load locations at peak loading during walking were in the central region of the facet, whereas resultant load locations at minimum loading during walking were relatively craniad. This resultant load-contact location during a walk gait cycle typically migrated in an arc with a displacement of 4 mm from minimum to maximum loading. Static tests resulted in a range of facet loads of 0 N in flexion and lying to 185 N for two-legged standing erect, and stand resulted in facet loads of 26 +/- 15 N (mean +/- standard deviation [SD]). Dynamic tests resulted in peak facet loads ranging from 55 N while walking erect to 170 N for climbing up stairs. Maximum walk facet loads were 107 +/- 27 N. The technique is applicable to in vivo studies of a canine facet joint osteoarthritis model and may be useful for establishing an understanding of the biomechanics of low-back pain.

  10. NCR1 Expression Identifies Canine Natural Killer Cell Subsets with Phenotypic Similarity to Human Natural Killer Cells

    Directory of Open Access Journals (Sweden)

    Jennifer Ann Foltz


    Full Text Available Canines spontaneously develop many cancers similar to humans - including osteosarcoma, leukemia, and lymphoma - offering the opportunity to study immune therapies in a genetically heterogeneous and immunocompetent environment. However, a lack of antibodies recognizing canine NK cell markers has resulted in suboptimal characterization and unknown purity of NK cell products, hindering the development of canine models of NK cell adoptive immunotherapy. To this end, we generated a novel antibody to canine NCR1 (NKp46, the putative species-wide marker of NK cells, enabling purification of NK cells for further characterization. We demonstrate that CD3-/NKp46+ cells in healthy and osteosarcoma-bearing canines have phenotypic similarity to human CD3-/NKp46+ NK cells, expressing mRNA for CD16 and the natural cytotoxicity receptors NKp30, NKp44, and NKp80. Functionally, we demonstrate with the calcein release assay that canine CD3-/NKp46+ cells kill canine tumor cell lines without prior sensitization and secrete IFN-γ, TNF-α, IL-8, IL-10, and GM-CSF as measured by Luminex. Like human NK cells, CD3-/NKp46+ cells expand rapidly on feeder cells expressing 4-1BBL and membrane-bound IL-21 (median= 20,283-fold in 21 days. Further, we identify a minor Null population (CD3-/CD21-/CD14-/NKp46- with reduced cytotoxicity against osteosarcoma cells, but similar cytokine secretion as CD3-/NKp46+ cells. Null cells in canines and humans have reduced expression of NKG2D, NKp44, and CD16 compared to NKp46+ NK cells, and can be induced to express NKp46 with further expansion on feeder cells. In conclusion, we have identified and characterized canine NK cells, including an NKp46- subset of canine and human NK cells, using a novel anti-canine NKp46 antibody, and report robust ex vivo expansion of canine NK cells sufficient for adoptive immunotherapy.

  11. Prevalence of serum antibody titers against canine distemper virus and canine parvovirus in dogs hospitalized in an intensive care unit. (United States)

    Mahon, Jennifer L; Rozanski, Elizabeth A; Paul, April L


    OBJECTIVE To determine the prevalence of dogs hospitalized in an intensive care unit (ICU) with serum antibody titers against canine distemper virus (CDV) and canine parvovirus (CPV). DESIGN Prospective observational study. ANIMALS 80 dogs. PROCEDURES Dogs hospitalized in an ICU for > 12 hours between February 1 and June 1, 2015, that had at least 0.25 mL of serum left over from diagnostic testing were eligible for study inclusion. Dogs with serum antibody titers > 1:32 (as determined by serum neutralization) and > 1:80 (as determined by hemagglutination inhibition) were considered seropositive for CDV and CPV, respectively. The date of last vaccination was obtained from the medical record of each dog. RESULTS Of the 80 dogs, 40 (50%) and 65 (81%) dogs were seropositive for CDV and CPV, respectively. Of the 40 dogs that were seronegative for CDV, 27 had been vaccinated against CDV within 3 years prior to testing. Of the 15 dogs that were seronegative for CPV, 3 had been vaccinated against CPV within 3 years prior to testing. Ten dogs were seronegative for both CDV and CPV. CONCLUSIONS AND CLINICAL RELEVANCE Results indicated the prevalence of dogs hospitalized in an ICU that were seropositive for CDV and CPV was lower than expected given the high vaccination rate reported for dogs. Although the antibody titer necessary to prevent disease caused by CDV or CPV in critically ill dogs is unknown, adherence to infectious disease control guidelines is warranted when CDV- or CPV-infected dogs are treated in an ICU.

  12. Prevalence of protective antibody titers for canine distemper virus and canine parvovirus in dogs entering a Florida animal shelter. (United States)

    Lechner, Elizabeth S; Crawford, P Cynda; Levy, Julie K; Edinboro, Charlotte H; Dubovi, Edward J; Caligiuri, Randy


    To determine the proportion of dogs entering an animal shelter with protective antibody titers (PATs) for canine distemper virus (CDV) and canine parvovirus (CPV) and identify factors associated with having a PAT. Cross-sectional study. 431 dogs admitted to an open-admission municipal animal shelter in north central Florida with a history of infectious disease outbreaks. Blood was collected from dogs on the day of admission to the shelter. Antibody titers for CDV and CPV were measured by virus neutralization and hemagglutination inhibition, respectively. Age, sex, neuter status, address of origin, source (stray or previously owned), health status (healthy or not healthy), and outcome (adoption, euthanasia, or reclaimed by owner) data were also collected. Overall, 64.5% (278/431) of dogs had insufficient titers for antibodies against CDV, CPV, or both. A total of 153 (35.5%) dogs had PATs for both CDV and CPV, 33 (7.7%) had PATs for CDV but not CPV, 136 (31.5%) had PATs for CPV but not CDV, and 109 (25.3%) did not have PATs for either virus. Older dogs were more likely to have PATs for CDV and CPV. Neutered dogs were more likely to have PATs for CDV. Factors not associated with having a PAT included source, health status, and type of community from which the dog originated. Most dogs had insufficient antibody titers for CDV, CPV, or both at the time of admission to the animal shelter. Findings support current guidelines recommending vaccination of all dogs immediately upon admission to shelters, regardless of source or physical condition.

  13. Comparison of effects of uncomplicated canine babesiosis and canine normovolaemic anaemia on abdominal splanchnic Doppler characteristics - a preliminary investigation

    Directory of Open Access Journals (Sweden)

    L.M. Koma


    Full Text Available A preliminary study was conducted to compare uncomplicated canine babesiosis (CB and experimentally induced normovolaemic anaemia (EA using Doppler ultrasonography of abdominal splanchnic vessels. Fourteen dogs with uncomplicated CB were investigated together with 11 healthy Beagles during severe EA, moderate EA and the physiological state as a control group. Canine babesiosis was compared with severe EA, moderate EA and the physiological state using Doppler variables of the abdominal aorta, cranial mesenteric artery (CMA, coeliac, left renal and interlobar, and hilar splenic arteries, and the main portal vein. Patterns of haemodynamic changes during CB and EA were broadly similar and were characterised by elevations in velocities and reductions in resistance indices in all vessels except the renal arteries when compared with the physiological state. Aortic and CMA peak systolic velocities and CMA end diastolic and time-averaged mean velocities in CB were significantly lower (P < 0.023 than those in severe EA. Patterns of renal haemodynamic changes during CB and EA were similar. However, the renal patterns differed from those of aortic and gastrointestinal arteries, having elevations in vascular resistance indices, a reduction in end diastolic velocity and unchanged time-averaged mean velocity. The left renal artery resistive index in CB was significantly higher (P < 0.025 than those in EA and the physiological state. Renal interlobar artery resistive and pulsatility indices in CB were significantly higher (P < 0.016 than those of moderate EA and the physiological state. The similar haemodynamic patterns in CB and EA are attributable to anaemia, while significant differencesmayadditionally be attributed to pathophysiological factors peculiar to CB.

  14. Developmental and radiobiologic characteristics of canine multinucleated, osteoclast-like cells generated in vitro from canine bone marrow

    International Nuclear Information System (INIS)

    Seed, T.M.; Kaspar, L.V.; Domann, F.; Niiro, G.K.; LeBuis, D.A.


    We report here our initial observations on the growth and morphology, and developmental radiosensitivity of giant, multinucleated, osteoclast-like cells (MN-OS) generated through in vitro cultivation of hematopoietic progenitor-enriched canine bone marrow samples. Maximum cell densities of 5.5 x 10(3) to 6.5 x 10(3) MN-OS per cm2 of growth area were achieved following 10 to 14 days of culture at 37 degrees C. Acute gamma irradiation of the initial marrow inocula resulted in significant, dose-dependent perturbations of MN-OS formation, growth, and development. Attempts to estimate radiosensitivity of MN-OS progenitors from canine marrow yielded a range of Do values from a low of 212 cGy measured at six days of culture to higher values of 405 to 542 cGy following 10 to 22 days of culture. At the intermediate times of culture (10 to 14 days), the radiation-induced responses were clearly biphasic, reflecting either (a) the presence of multiple subpopulations of MN-OS progenitors with varying degrees of radiosensitivity or (b) the inherent biphasic nature of MN-OS development involving early progenitor cell proliferation followed by maturation and subsequent fusion. Morphologically, MN-OS generated from irradiated marrow inocula appeared only marginally altered, with alterations expressed largely in a biphasic, dose-dependent fashion in terms of smaller cell size, reduced number of nuclei, increased expression of both surface microprojections, and a unique set of crystalloid cytoplasmic inclusions. Functionally, MN-OS appeared to be impaired by irradiation of marrow progenitors, as evidenced by failure to initiate resorptive attachments to devitalized bone spicules in vitro

  15. MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.

    Directory of Open Access Journals (Sweden)

    Cecilia M Lopez

    Full Text Available Osteosarcoma (OSA is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease.RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes.These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.

  16. MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines. (United States)

    Lopez, Cecilia M; Yu, Peter Y; Zhang, Xiaoli; Yilmaz, Ayse Selen; London, Cheryl A; Fenger, Joelle M


    Osteosarcoma (OSA) is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease. RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes. These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.

  17. Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus

    Directory of Open Access Journals (Sweden)



    Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.

  18. Apical root resorption of incisors after orthodontic treatment of impacted maxillary canines: a radiographic study. (United States)

    Brusveen, Elin Marie Gravdal; Brudvik, Pongsri; Bøe, Olav Egil; Mavragani, Maria


    The purpose of the study was to evaluate impacted maxillary canines as risk factor for orthodontic apical root resorption. The sample comprised 66 patients treated with fixed appliances. Thirty-two patients with a unilateral impacted maxillary canine, which was distanced from the roots of the incisors at a preliminary phase of treatment before bonding, formed the impaction group, and 34 patients without impactions served as the controls. Root shortening was calculated by using pretreatment and posttreatment intraoral radiographs. Inclination of the eruption path of the impacted canine relative to the midline, axis of the lateral incisor, and nasal line, root development, and the medial and vertical positions of the impacted tooth were recorded on orthopantomograms and lateral cephalometric films. The follicle/tooth ratio was evaluated by using periapical radiographs. No significant difference in apical resorption of the maxillary incisors was detected between the impaction and control groups, or between the incisors of the impacted and contralateral sides in the same subject. Likewise, no difference in the severity of root resorption was found between the incisors of impacted side alone and the incisors of the control group. Mesial and vertical inclinations of the impacted canines were negatively related to a lateral incisor's root resorption. No correlations were found between resorption and medial or vertical position of the crown of the canine. The follicle/tooth ratio was significantly related to the mesial inclination of the impacted canine, but not to root resorption. An impacted maxillary canine, after being distanced from the incisor roots, does not seem to be a risk factor for apical root resorption during orthodontic treatment. Copyright © 2012 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

  19. Comparative photoelastic study of dental and skeletal anchorages in the canine retraction

    Directory of Open Access Journals (Sweden)

    Cristiane Aparecida de Assis Claro


    Full Text Available OBJECTIVE: To compare dental and skeletal anchorages in mandibular canine retraction by means of a stress distribution analysis. METHODS: A photoelastic model was produced from second molar to canine, without the first premolar, and mandibular canine retraction was simulated by a rubber band tied to two types of anchorage: dental anchorage, in the first molar attached to adjacent teeth, and skeletal anchorage with a hook simulating the mini-implant. The forces were applied 10 times and observed in a circular polariscope. The stresses located in the mandibular canine were recorded in 7 regions. The Mann-Whitney test was employed to compare the stress in each region and between both anchorage systems. The stresses in the mandibular canine periradicular regions were compared by the Kruskal-Wallis test. RESULTS: Stresses were similar in the cervical region and the middle third. In the apical third, the stresses associated with skeletal anchorage were higher than the stresses associated with dental anchorage. The results of the Kruskal-Wallis test showed that the highest stresses were identified in the cervical-distal, apical-distal, and apex regions with the use of dental anchorage, and in the apical-distal, apical-mesial, cervical-distal, and apex regions with the use of skeletal anchorage. CONCLUSIONS: The use of skeletal anchorage in canine retraction caused greater stress in the apical third than the use of dental anchorage, which indicates an intrusive component resulting from the direction of the force due to the position of the mini-implant and the bracket hook of the canine.

  20. Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma. (United States)

    Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L


    Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.