
Sample records for canines

  1. Canine Distemper (United States)

    Although this brochure provides basic information about canine distemper, your veterinarian is always your best source of ... Consult your veterinarian for more information about canine distemper and its prevention. And Now A Note On ...

  2. Vaccines for Canine Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Faeze Foroughi-Parvar


    Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

  3. Vaccines for canine leishmaniasis

    Directory of Open Access Journals (Sweden)

    Clarisa B. Palatnik-De-Sousa


    Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans

  4. The canine vomeronasal organ.


    Adams, D. R.; Wiekamp, M D


    The vomeronasal organ was studied in mature dogs with the optical, transmission electron, and scanning electron microscopes. The canine vomeronasal complex is structurally well developed. Large blood vessels are present deep to both the lateral, 'non-receptor' and medial, 'receptor' epithelia. In addition to the unmyelinated vomeronasal nerves in the lamina propria deep to the 'receptor' epithelium, numerous nerves containing both myelinated and unmyelinated fibres are present deep to the 'no...

  5. 9 CFR 113.305 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine. (United States)


    ... STANDARD REQUIREMENTS Live Virus Vaccines § 113.305 Canine Hepatitis and Canine Adenovirus Type 2 Vaccine. Canine Hepatitis Vaccine and Canine Adenovirus Type 2 Vaccine shall be prepared from virus-bearing cell... hepatitis, the test is inconclusive and may be repeated. (B) If at least 19 of the 20 vaccinates do...

  6. Current developments in canine genetics. (United States)

    Marschall, Yvonne; Distl, Ottmar


    In recent years, canine genetics had made huge progress. In 1999 the first complete karyotype and ideogram of the dog was published. Several linkage and RH maps followed. Using these maps, sets of microsatellite markers for whole genome scans were compiled. In 2003 the sequencing of the DNA of a female Boxer began. Now the second version of the dog genome assembly has been put online, and recently, a microchip SNP array became available. Parallel to these developments, some causal mutations for different traits have been identified. Most of the identified mutations were responsible for monogenic canine hereditary diseases. With the tools available now, it is possible to use the advantages of the population structure of the various dog breeds to unravel complex genetic traits. Furthermore, the dog is a suitable model for the research of a large number of human hereditary diseases and particularly for cancer genetics, heart and neurodegenerative diseases. There are some examples where it was possible to benefit from the knowledge of canine genetics for human research. The search for quantitative trait loci (QTL), the testing of candidate genes and genome-wide association studies can now be performed in dogs. QTL for skeletal size variations and for canine hip dysplasia have been already identified and for these complex traits the responsible genes and their possible interactions can now be identified. PMID:20690545

  7. Prognostic markers of canine pyometra


    M.C. Sant'Anna; L.G.P. Giordano; K.K.M.C. Flaiban; Muller, E.E.; M.I.M. Martins


    The pyometra is a disease that affects middle age and elderly female dogs during diestrus. Hormonal, microbiological, biochemical and hematological aspects are well described. However, few studies have evaluated the role of each in the prognosis of canine pyometra. The aim of this study was to identify markers associated with clinical worsening of dogs with pyometra. We prospectively evaluated 80 dogs with pyometra tre...

  8. Surgical innovations in canine gonadectomy

    NARCIS (Netherlands)

    Van Goethem, Bart


    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated n

  9. Surgical innovations in canine gonadectomy


    Van Goethem, Bart


    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated negative consequences (lengthy placement, impaired wound healing around bulky knots, and the effect of unsightly knots on cosmetics). A study in 9 dogs found that celiotomy closure was easily achiev...

  10. Genome Sequence of Canine Herpesvirus.

    Directory of Open Access Journals (Sweden)

    Konstantinos V Papageorgiou

    Full Text Available Canine herpesvirus is a widespread alphaherpesvirus that causes a fatal haemorrhagic disease of neonatal puppies. We have used high-throughput methods to determine the genome sequences of three viral strains (0194, V777 and V1154 isolated in the United Kingdom between 1985 and 2000. The sequences are very closely related to each other. The canine herpesvirus genome is estimated to be 125 kbp in size and consists of a unique long sequence (97.5 kbp and a unique short sequence (7.7 kbp that are each flanked by terminal and internal inverted repeats (38 bp and 10.0 kbp, respectively. The overall nucleotide composition is 31.6% G+C, which is the lowest among the completely sequenced alphaherpesviruses. The genome contains 76 open reading frames predicted to encode functional proteins, all of which have counterparts in other alphaherpesviruses. The availability of the sequences will facilitate future research on the diagnosis and treatment of canine herpesvirus-associated disease.

  11. 9 CFR 113.306 - Canine Distemper Vaccine. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of...

  12. Canine and feline parasitic zoonoses in China

    Directory of Open Access Journals (Sweden)

    Chen Jia


    Full Text Available Abstract Canine and feline parasitic zoonoses have not been given high priority in China, although the role of companion animals as reservoirs for zoonotic parasitic diseases has been recognized worldwide. With an increasing number of dogs and cats under unregulated conditions in China, the canine and feline parasitic zoonoses are showing a trend towards being gradually uncontrolled. Currently, canine and feline parasitic zoonoses threaten human health, and cause death and serious diseases in China. This article comprehensively reviews the current status of major canine and feline parasitic zoonoses in mainland China, discusses the risks dogs and cats pose with regard to zoonotic transmission of canine and feline parasites, and proposes control strategies and measures.

  13. Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

    International Nuclear Information System (INIS)

    Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

  14. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies


    J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides


    Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...

  15. Prognostic markers of canine pyometra

    Directory of Open Access Journals (Sweden)

    M.C. Sant'Anna


    Full Text Available The pyometra is a disease that affects middle age and elderly female dogs during diestrus. Hormonal, microbiological, biochemical and hematological aspects are well described. However, few studies have evaluated the role of each in the prognosis of canine pyometra. The aim of this study was to identify markers associated with clinical worsening of dogs with pyometra. We prospectively evaluated 80 dogs with pyometra treated surgically. Group 1 consisted of dogs that were discharged within 48 hours after surgery and Group 2 consisted of those who required prolonged hospitalization or died. The findings of hematological, biochemical and blood lactate levels were compared between groups and variables such as bacterial multidrug resistance, systemic inflammatory response syndrome (SIRS, hyperlactatemia and increased creatinine were analyzed through the dispersion of frequencies between groups. Among the variables studied, the presence of SIRS and elevated serum creatinine >2.5mg/mL were effective in predicting the worsening of the disease and can be used as prognostic markers of canine pyometra.

  16. Extrusion processing : effects on dry canine diets

    NARCIS (Netherlands)

    Tran, Q.D.


    Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying. Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the nutritional and

  17. Triple bone labeling of canine mandibles

    DEFF Research Database (Denmark)

    Pinholt, E M; Kwon, P H


    Fluorescence microscopy was used for evaluation of new bone formation in 16 canine mandibles augmented with hydroxylapatite (HA) granules. Three fluorochromes were injected at different time intervals during therapeutic radiation treatment. Oxytetracycline, DCAF, and alizarin-complexone were give...

  18. Canine babesiosis: from molecular taxonomy to control

    Directory of Open Access Journals (Sweden)

    Irwin Peter J


    Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

  19. [Nonsurgical endodontic treatment of an invaginated canine]. (United States)

    Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P


    We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment. PMID:2638021

  20. Systemic inflammarory response in canine pyometra


    Fransson, Boel


    Research efforts have focused mainly on the hormonal aspects of canine pyometra for more than 6 decades. However, this disease is often manifested as systemic illness in response to the bacterial uterine infection. Studies I-II were undertaken to clarify bacteriological aspects of canine pyometra; i.e. the origin of the infecting bacteria, the infecting bacteria’s impact on severity of the systemic illness and the presence of bacterial endotoxin in the systemic circulation. Study I, a bacteri...

  1. [Nonsurgical endodontic treatment of an invaginated canine]. (United States)

    Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P


    We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.

  2. Treatment modalities of palatal impacted canines


    Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona


    Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...

  3. Proliferative histiocytic disorders of canine skin. (United States)

    Middleton, D J


    Proliferative histiocytic disorders of canine skin present a clinical spectrum from the innocuous self-limiting solitary dermal lesion of cutaneous histiocytoma, through the recurrent deep dermal nodules of cutaneous histiocytosis to the generally fatal condition of Bernese Mountain Dogs termed systemic histiocytosis, in which visceral involvement is commonly encountered. Immunocytochemical characterization of the constituent histiocytic cells and accompanying lymphoid infiltrate using canine species specific reagents has elucidated considerably the mechanism by which these conditions exhibit their various biologic behaviours.

  4. Despre babesioza canină

    Directory of Open Access Journals (Sweden)

    Andrei Nanu


    Full Text Available The objective of this bibliographic essay, addressed both to veterinary clinicians and researchers, is to bring to mind the disease in terms of etiology, clinical manifestations and therapeutic and prophylactic management, as well as to remind the issues arising from recent researches. Depending on the virulence of the parasite species, body's immune response and therapeutic management approached, the plateau of disease evolution can be quite wide - from a favorable prognosis to a lethal outcome of the animal. The complexity of the pathogenic mechanism in babesiosis is due to soluble parasite antigens (SPA which, according to recent studies, have been obtained in vitro and then used as immunological product in disease prevention. Producing a vaccine against canine babesiosis with parasite antigens of local strains could play an important role to prevent the clinical expression of this disease in Romania.

  5. Environmental contamination by canine geohelminths. (United States)

    Traversa, Donato; Frangipane di Regalbono, Antonio; Di Cesare, Angela; La Torre, Francesco; Drake, Jason; Pietrobelli, Mario


    Intestinal nematodes affecting dogs, i.e. roundworms, hookworms and whipworms, have a relevant health-risk impact for animals and, for most of them, for human beings. Both dogs and humans are typically infected by ingesting infective stages, (i.e. larvated eggs or larvae) present in the environment. The existence of a high rate of soil and grass contamination with infective parasitic elements has been demonstrated worldwide in leisure, recreational, public and urban areas, i.e. parks, green areas, bicycle paths, city squares, playgrounds, sandpits, beaches. This review discusses the epidemiological and sanitary importance of faecal pollution with canine intestinal parasites in urban environments and the integrated approaches useful to minimize the risk of infection in different settings. PMID:24524656

  6. Biomarkers in canine parvovirus enteritis. (United States)

    Schoeman, J P; Goddard, A; Leisewitz, A L


    Canine parvovirus (CPV) enteritis has, since its emergence in 1978, remained a common and important cause of morbidity and mortality in young dogs. The continued incidence of parvoviral enteritis is partly due to the virus' capability to evolve into more virulent and resistant variants with significant local gastrointestinal and systemic inflammatory sequelae. This paper reviews current knowledge on historical-, signalment-, and clinical factors as well as several haematological-, biochemical- and endocrine parameters that can be used as diagnostic and prognostic biomarkers in CPV enteritis. These factors include season of presentation, purebred nature, bodyweight, vomiting, leukopaenia, lymphopaenia, thrombocytopaenia, hypercoagulability, hypercortisolaemia, hypothyroxinaemia, hypoalbuminaemia, elevated C-reactive protein and tumour necrosis factor, hypocholesterolaemia and hypocitrullinaemia. Factors contributing to the manifestations of CPV infection are multiple with elements of host, pathogen, secondary infections, underlying stressors and environment affecting severity and outcome. The availability of several prognosticators has made identification of patients at high risk of death and their subsequent targeted management more rewarding.

  7. CANINE: a robotic mine dog (United States)

    Stancil, Brian A.; Hyams, Jeffrey; Shelley, Jordan; Babu, Kartik; Badino, Hernán.; Bansal, Aayush; Huber, Daniel; Batavia, Parag


    Neya Systems, LLC competed in the CANINE program sponsored by the U.S. Army Tank Automotive Research Development and Engineering Center (TARDEC) which culminated in a competition held at Fort Benning as part of the 2012 Robotics Rodeo. As part of this program, we developed a robot with the capability to learn and recognize the appearance of target objects, conduct an area search amid distractor objects and obstacles, and relocate the target object in the same way that Mine dogs and Sentry dogs are used within military contexts for exploration and threat detection. Neya teamed with the Robotics Institute at Carnegie Mellon University to develop vision-based solutions for probabilistic target learning and recognition. In addition, we used a Mission Planning and Management System (MPMS) to orchestrate complex search and retrieval tasks using a general set of modular autonomous services relating to robot mobility, perception and grasping.

  8. A new method for rapid Canine retraction

    Directory of Open Access Journals (Sweden)

    "Khavari A


    Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.

  9. Three-dimensional canine loop for management of buccally erupted canines

    Directory of Open Access Journals (Sweden)

    Praveen Mehrotra


    Full Text Available Maxillary canines are known as the cornerstones of mouth. They are considered to be important for esthetics and for functional occlusion. Any disturbance in the eruption process leading to an aberrant position will hamper esthetics as well as function. Orthodontic tooth movement of total buccally blocked-out canine is usually difficult as it is related with the problems of severe crowding, midline deviation, involvement of long root movement and risk of gingival recession. Such conditions can be treated orthodontically in various ways, but this clinical innovation helps to correct the buccally placed canines into the arch with a precise control of the canine in all the Three-dimensions (3D of space as well as providing maximum comfort to the patient by placing the canine loop on the palatal surface of the tooth, reducing soreness on the labial mucosa. It can be easily fabricated and activated at chairside for either simultaneous or sequential control in 3D.

  10. Canine distemper virus detection in asymptomatic and non vaccinated dogs


    Del Puerto, Helen L; Vasconcelos, Anilton C.; Luciana Moro; Fabiana Alves; Braz, Gissandra F; Almir S. Martins


    A quantitative real time polymerase chain reaction (PCR) revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus...

  11. 9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus..., DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper...

  12. Canine hypothyroidism. A diagnostic challenge?

    International Nuclear Information System (INIS)

    Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen registered) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high interobserver

  13. Transmigration of mandibular canine – case report

    International Nuclear Information System (INIS)

    Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation

  14. Composite mandibular allografts in canines

    Institute of Scientific and Technical Information of China (English)


    Objective: To evaluate the feasibility of transplanting composite mandibular allografts to repair large mandibular defects. Methods: Three composite mandibular transplantation models were established. The first model consisted of hemimandible with the attached teeth, muscle and skin, and oral mucosa. The second model was transplanted in the same way with the first one excluding oral mucosa and some teeth, and third one excluding the oral mucosa and all dental crowns. Fourteen transplanting operations were performed in canines. Cyclosporine A and methylprednisone were given for immunosuppression. Results: The composite mandibular organs had an effective and closed return circuit. Transplantation of vascularized allograft of mandibular compound organs was feasible. Two longest time survivors of 67 d and 76 d were in the third model group. Cyclosporine A was successful in suppressing rejection of transplanted composite allograft and prolonging survival time of transplantation models. Conclusions: The composite mandibular allografts were available with large block of living composite tissue,and helpful in restoration of appearance and function for severe mandibular defects.

  15. Oncolytic Virotherapy of Canine and Feline Cancer

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev


    Full Text Available Cancer is the leading cause of disease-related death in companion animals such as dogs and cats. Despite recent progress in the diagnosis and treatment of advanced canine and feline cancer, overall patient treatment outcome has not been substantially improved. Virotherapy using oncolytic viruses is one promising new strategy for cancer therapy. Oncolytic viruses (OVs preferentially infect and lyse cancer cells, without causing excessive damage to surrounding healthy tissue, and initiate tumor-specific immunity. The current review describes the use of different oncolytic viruses for cancer therapy and their application to canine and feline cancer.

  16. Tooth fractures in canine clinical practice

    International Nuclear Information System (INIS)

    Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients

  17. A Study of Transmigrated Canine in an Indian Population (United States)

    Sharma, Gaurav; Nagpal, Archna


    Aim. The purpose of this study was to investigate the prevalence of transmigrated canines in a north Indian population and association with gender, side, associated pathologies, and dental anomalies. Subjects and methods. The prospective study consisted of panoramic radiographs of 3000 patients from two dental colleges in north India. The panoramic radiographs were screened for radiographically identified position of the transmigrated tooth, retained canine, and other coexisting dental anomalies. Results. The overall prevalence of transmigrated canines (15 mandibular and 5 maxillary) was 0.66%. The prevalence of mandibular transmigrated canine was 0.5% and maxillary transmigrated canine was 0.16%. All the transmigrated canines were unilateral. The age range was 15–53 years (average age 24.1 years) and there were 12 males (60%) and 8 females (40%). Type 1 mandibular canine transmigration was the commonest type found in our study (10 cases), followed by types 2 and 4 (2 cases each) and 1 case of type 5 transmigration. Conclusion. The prevalence of transmigrated canines in the north Indian population was 0.66% and no gender predilection was evident. The transmigrated canines have a low complication rate (10.0%) and no correlation with other dental anomalies was found. Type 3 canine is the rarest form of mandibular canine transmigration. PMID:27433532

  18. Experimental Forelimb Allotransplantation in Canine Model (United States)


    As reconstructive transplantation is gaining popularity as a viable alternative for upper limb amputees, it is becoming increasingly important for plastic surgeons to renew surgical skills and knowledge of this area. Forelimb allotransplantation research has been performed previously in rodent and swine models. However, preclinical canine forelimb allotransplantation studies are lacking in the literature. The purpose of this paper is to provide an overview of the surgical skills necessary to successfully perform forelimb transplantation in canines as a means to prepare for clinical application. A total of 18 transplantation operations on canines were performed. The recipient limb was shortened at the one-third proximal forearm level. The operation was performed in the following order: bones (two reconstructive plates), muscles and tendons (separately sutured), nerves (median, ulnar, and radial nerve), arteries (two), and veins (two). The total mean time of transplantation was 5 hours ± 30 minutes. All of the animals that received transplantation were treated with FK-506 (tacrolimus, 2 mg/kg) for 7 days after surgery. Most allografts survived with perfect viability without vascular problems during the early postoperative period. The canine forelimb allotransplantation model is well qualified to be a suitable training model for standard transplantation and future research work. PMID:27597952

  19. Seroprevalence of Canine Distemper Virus in Cats


    Ikeda, Yasuhiro; Nakamura, Kazuya; Miyazawa, Takayuki; Chen, Ming-Chu; Kuo, Tzong-Fu; Lin, James A; Mikami, Takeshi; Kai, Chieko; TAKAHASHI, Eiji


    A seroepidemiological survey of canine distemper virus (CDV) infection in Asian felids revealed that the prevalence of antibodies varied depending on region and, in some cases, exposure to dogs. The serologic pattern in cats with antibodies indicated that they had likely been exposed to field strains rather than typical CDV vaccine strains.

  20. Canine Distemper Outbreak in Rhesus Monkeys, China


    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang; Hu, Rongliang


    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People’s Republic of China. Approximately 10,000 animals were infected (25%–60% disease incidence); 5%–30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain.

  1. Experimental Forelimb Allotransplantation in Canine Model. (United States)

    Hong, Sa-Hyeok; Eun, Seok-Chan


    As reconstructive transplantation is gaining popularity as a viable alternative for upper limb amputees, it is becoming increasingly important for plastic surgeons to renew surgical skills and knowledge of this area. Forelimb allotransplantation research has been performed previously in rodent and swine models. However, preclinical canine forelimb allotransplantation studies are lacking in the literature. The purpose of this paper is to provide an overview of the surgical skills necessary to successfully perform forelimb transplantation in canines as a means to prepare for clinical application. A total of 18 transplantation operations on canines were performed. The recipient limb was shortened at the one-third proximal forearm level. The operation was performed in the following order: bones (two reconstructive plates), muscles and tendons (separately sutured), nerves (median, ulnar, and radial nerve), arteries (two), and veins (two). The total mean time of transplantation was 5 hours ± 30 minutes. All of the animals that received transplantation were treated with FK-506 (tacrolimus, 2 mg/kg) for 7 days after surgery. Most allografts survived with perfect viability without vascular problems during the early postoperative period. The canine forelimb allotransplantation model is well qualified to be a suitable training model for standard transplantation and future research work. PMID:27597952

  2. Overexpression of vimentin in canine prostatic carcinoma

    DEFF Research Database (Denmark)

    Rodrigues, M M P; Rema, A; Gärtner, F;


    is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...

  3. Canine specific ELISA for coagulation factor VII

    DEFF Research Database (Denmark)

    Knudsen, Tom; Kjelgaard-Hansen, Mads; Tranholm, Mikael;


    available to date. In this study, a canine specific ELISA for measurement of FVII:Ag in plasma was developed and validated. The FVII:Ag ELISA correctly diagnosed homozygous and heterozygous hereditary FVII deficiency. Together with activity based assays, such as FVII:C, the FVII:Ag ELISA should be valuable...

  4. Canine notoedric mange: a case report. (United States)

    Leone, Federico


    Notoedric mange is a cutaneous ectoparasitic disease of cats caused by Notoedres cati, a mite belonging to the Sarcoptidae family. The disease occurs in felids, occasionally in other mammals and in humans. The canine form, even if cited by some authors, has never been documented. This report describes for the first time a case of notoedric mange in a dog.

  5. Canine retraction with J hook headgear. (United States)

    Ayala Perez, C; de Alba, J A; Caputo, A A; Chaconas, S J


    Several methods have been described for accomplishing distal movement of canines without losing posterior anchorage. An accepted method in canine retraction is the use of headgear with J hooks. Since it incorporates extraoral anchorage, it is most effective in maximum-anchorage cases. It was the purpose of this study to analyze the distribution of force transmitted to the alveolus and surrounding structures by means of photoelastic visualization, utilizing J hook headgear for maxillary canine retraction. A three-dimensional model representing a human skull was used. This model was constructed with different birefringent materials to simulate bone, teeth, and periodontal membranes. Three different vectors of force were applied representing high-, medium-, and low-pull headgear, which were placed at angles of 40, 20, and 0 degrees to the occlusal plane. The photoelastic analysis was made by means of a circular-transmission polariscope arrangement, and the photoelastic data were recorded photographically. The stress areas created by the three different vectors of force were associated with various degrees of canine tipping. This effect was greater with the low-pull force component than with the medium-pull traction. The high-pull headgear produced the least tipping tendency, being closer to a bodily movemment effect. Further, stresses were transmitted to deeper structures of the simulated facial bones; these regions were the frontozygomatic, zygomaticomaxillary, and zygomaticotemporal sutures.

  6. Canine visceral leishmaniasis in Sicily. (United States)

    Orndorff, G R; Cooper, B A; Smith, W; Ryan, J R


    The Sicilian province of Catania is an active foci for human visceral leishmaniasis (VL) in the Mediterranean area. Approximately 10 to 15 cases of VL are diagnosed via hospital admissions each year in this community. Recently, an increase in VL case reporting by Sicilian physicians was noted, with 38 and 37 VL cases in 1996 and 1997, respectively. Before 1995, there were no reported VL cases among U.S. military personnel or their family members living in Sicily. However, since 1996, there have been four cases referred to Walter Reed Army Medical Center for diagnosis and treatment, all involving the children of personnel assigned to Naval Air Station Sigonella. Exposure histories for all infected individuals excluded exposure to Leishmania parasites outside of Sicily. All patients lived in areas where vectoring sandflies are present. All had dogs as family pets. To evaluate the level of infection among dogs owned by Navy personnel and their families, U.S. Navy Environmental and Preventive Medicine Unit 7, in a collaborative study with the U.S. Army Veterinary Clinic, Naval Air Station Sigonella, and the Walter Reed Army Institute of Research, performed clinical evaluation and serological testing of 50 dogs residing with U.S. personnel assigned to Naval Air Station Sigonella. The data indicate a high exposure rate to Leishmania (60% of the animals tested had elevated immunoglobulin M antibody levels) in the study population, suggesting that they were infected with Leishmania infantum. Distribution of seropositive dogs by sex was equal. Most of the dogs studied appeared to be in good health. However, inapparent infection of dogs, seen by Italian veterinarians, has been observed throughout all areas of Catania. Sandflies responsible for vectoring L. infantum were trapped in the same locations as the dogs sampled in this study. The level of subclinical infection was 75% among seropositive dogs. The overall level of canine infection observed was higher than expected

  7. Effects of canine serum collected from dogs at different estrous cycle stages on in vitro nuclear maturation of canine oocytes. (United States)

    Oh, Hyun Ju; Fibrianto, Yuda Heru; Kim, Min Kyu; Jang, Goo; Hossein, M Shamim; Kim, Hye Jin; Kang, Sung Keun; Lee, Byeong Chun; Hwang, Woo Suk


    Canine oocytes are ovulated at prophase of the first meiotic division and undergo maturation in the distal part of the oviduct for at least 48-72 h. Because of these differences from other domestic mammals, the efficiency of in vitro maturation (IVM) of canine oocyte is very low. The present study was conducted to evaluate the effects of canine serum on IVM of canine oocytes recovered from ovaries in various reproductive states (follicular, luteal or anestrous stages). Oocytes were recovered by mincing ovaries from bitches presented for ovariohysterectomy at various stages of the estrous cycle. Heat-inactivated canine serum was prepared with blood taken from dogs at the anestrous, estrous or diestrous stage of the estrous cycle as determined by progesterone concentration and vaginal cytology. Oocytes were cultured for 72 h in tissue culture medium (TCM)-199 supplemented with 10% canine anestrous, estrous or diestrous serum or fetal bovine serum (FBS) (experiment 1), or supplemented with 0 (control), 5%, 10% or 20% canine estrous serum (experiment 2). In experiment 1, IVM of oocytes collected at the follicular stage of the estrous cycle to metaphase II (MII) stage was higher (p < 0.05) with canine estrous serum (14.2%) than with canine anestrous (5.2%) or diestrous serum (6.3%), FBS (2.2%) or in the control (2.2%). In experiment 2, oocytes collected at the follicular stage of the estrous cycle cultured in TCM-199 with 10% canine estrous serum showed a higher maturation rate to MII stage (13.5%, p < 0.05) compared with those cultured with 5% (1.3% MII) or 20% canine estrous serum (5.1% MII) or the control (2.7% MII). In conclusion, our results demonstrate that supplementing culture medium with 10% canine estrous serum improves IVM of canine follicular stage oocytes. PMID:16261767

  8. Combined orthodontic-surgical management of a transmigrated mandibular canine. (United States)

    Cavuoti, Serena; Matarese, Giovanni; Isola, Gaetano; Abdolreza, Jamilian; Femiano, Felice; Perillo, Letizia


    The presence of an impacted mandibular canine is one of the most difficult challenges that an orthodontist will meet. Orthodontic treatment is planned on an individual basis after thoroughly considering the patient's overall facial and dentoskeletal characteristics; the duration, risks, and costs of treatment; patient preferences; and the orthodontist's experience. This article reports an orthodontic treatment of a boy, age 12.9 years, with an impacted mandibular canine in the permanent dentition that was successfully managed. Radiographic analysis indicated a transmigration of the mandibular right canine. The orthodontic treatment plan included extraction of the deciduous right canine followed by surgical exposure and ligation of the permanent canine. Eruption was properly guided, and the correct position of the tooth was achieved. This challenging treatment approach is described in detail, including the mechanics used to align the impacted canine. PMID:26502299

  9. Canine oral biofilms: Cultural, molecular, and in vitro studies.


    Elliott, D. R.


    The canine oral microbiota is poorly understood compared to that of humans. The aim of this work was to improve understanding of the canine oral microbiota. This was achieved by surveying the canine oral microbiota, determining coaggregation interactions between its members, and developing a laboratory microcosm. Bacteria were isolated from the dental plaque and saliva of dogs, and isolates were identified by comparative 16S rRNA gene sequencing. From 339 isolates, 84 phylotypes belonging to ...

  10. Portrait of a Canine Probiotic – from Gut to Gut


    O'Mahony, D.; Murphy, K. Barry; MacSharry, J.; Boileau, T.; Sunvold, G.; Reinhart, G.; Kiely, B.; Shanahan, F; O'Mahony, L.


    Abstract The gastrointestinal environment is a complex interactive system involving the host, ingested dietary components, and numerous microbial species. We hypothesised that isolation and screening of Lactobacilli and Bifidobacteria adherent to healthy canine gastrointestinal tissue would yield strains with commensal activity in canines. The aims of this study were 1) to isolate a bank of commensal organisms from the canine gastrointestinal tract; 2) to screen these novel microbi...

  11. Validation of commercially available automated canine-specific immunoturbidimetric method for measuring canine C-reactive protein

    DEFF Research Database (Denmark)

    Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold;


    with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was ..., there was good agreement between the validated human CRP assay and the new canine-specific assay. Healthy dogs had CRP concentrations that were less than the limit of quantification of the Gentian cCRP method (6.8 mg/L). CONCLUSIONS: The new canine-specific immunoturbidimetric CRP assay is a reliable and rapid......BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE...

  12. Breed predisposition to canine gastric carcinoma

    DEFF Research Database (Denmark)

    Seim-Wikse, Tonje; Jörundsson, Einar; Nødtvedt, Ane;


    Previous research has indicated a breed predisposition to gastric carcinoma in dogs. However, results to date are inconsistent since several studies have failed to prove such a predisposition. Better knowledge of breeds at risk could facilitate early detection of gastric carcinoma in dogs. The ai...... of the study was to retrospectively investigate the proportion and possible breed predisposition to canine gastric carcinoma using the Norwegian Canine Cancer Register for calculations of proportional morbidity ratios (PMRs) for the period 1998-2009.......Previous research has indicated a breed predisposition to gastric carcinoma in dogs. However, results to date are inconsistent since several studies have failed to prove such a predisposition. Better knowledge of breeds at risk could facilitate early detection of gastric carcinoma in dogs. The aim...

  13. Antigenic typing Polish isolates of canine parvovirus

    Energy Technology Data Exchange (ETDEWEB)

    Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)


    Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.

  14. Coryneform bacteria associated with canine otitis externa

    DEFF Research Database (Denmark)

    Aalbæk, Bent; Bemis, David A.; Schjærff, Mette;


    This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...

  15. Extrusion processing : effects on dry canine diets


    Tran, Q.D.


    Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying. Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the nutritional and physical quality of the product. Effects of extrusion on the feed quality for other animals than pets have been well recognized. Our studies investigated to what extent extrusion and/or drying of a c...

  16. Cardiac troponin I levels in canine pyometra


    Hagman Ragnvi; Lagerstedt Anne-Sofie; Fransson Boel A; Bergström Annika; Häggström Jens


    Abstract Background Myocardial injury may contribute to unexpected deaths due to pyometra. To detect myocardial damage, measurement of cardiac troponin I (cTnI) is currently the most sensitive and specific method. The aims of the present study were to evaluate presence of myocardial damage in canine pyometra by analysis of cTnI, to explore whether myocardial injury was associated with systemic inflammatory response syndrome (SIRS) and to evaluate whether other clinical or laboratory parameter...

  17. Microbiological and histopathological aspects of canine pyometra


    Coggan, Jennifer Anne; Melville, Priscilla Anne; de Oliveira, Clair Motos; Faustino, Marcelo; Moreno, Andréa Micke; Benites, Nilson Roberti


    As pyometra is recognized as one of the main causes of disease and death in the bitch the purposes of this study were to evaluate microbiological and histopathological aspects of canine pyometra and to research the virulence factors of the E. coli isolates identifying possible risks to human health. The microbiological isolation from the intrauterine contents of 100 dogs with pyometra was carried out and the virulence factors in the E. coli strains were identified using PCR method. This study...

  18. Remote detection of explosives using trained canines

    International Nuclear Information System (INIS)

    Use of dogs is a search method which combines high probability of detection, speed of search, and low cost. It was concluded that the canine could be used for explosive screening of personnel, but that it was imperative that the dog be in a position remote from employees and employee traffic. A study was made of the design of booths and air flow for this purpose. Results of tests and conclusions are given and discussed

  19. Treatment of canine scabies with milbemycin oxime. (United States)

    Miller, W H; de Jaham, C; Scott, D W; Cayatte, S M; Bagladi, M S; Buerger, R G


    The purpose of this study was to determine the efficacy of orally administered milbemycin oxime in the treatment of canine scabies. Forty dogs were treated. Mean drug dosage for all dogs was approximately 2 mg/kg body weight. Twenty-seven dogs received 3 doses separated by 7 d, and 13 dogs received 2 doses separated by 14 d. All dogs were clinically normal following treatment and no adverse reactions were detected.

  20. Microbial profile of canine persistent wound infections

    Directory of Open Access Journals (Sweden)

    A. Padhy


    Full Text Available Aim: To analyse the microbial profile of canine persistent wound infections. Materials and Methods: The total wound samples (n=172 taken from both traumatic (140 and post-surgical (32 persistent wounds in canines were processed for routine microbial isolation and identification during a period of 15 months. Results: Staphylococcus intermedius was found to be the predominant isolate from all types of wounds under study. It was followed by Staphylococcus aureus, Pseudomonas aeruginosa, E. coli, Pasteurella spp., Corynaebacterium spp. and Bacillus spp. From different traumatic wounds of dogs, S. intermedius (92/140=65.7% and from surgical wounds, P. aeruginosa (24/32=75% were found to be the predominant isolates recovered whereas the most commonly isolated bacterial genus in both traumatic and surgical wounds of dogs was Staphylococcus spp. Conclusion: Canine wounds are polymicrobial in nature. Hence proper microbial laboratory diagnosis and presence of multiple organisms in a wound are to be taken into consideration for effective treatment of persistent wound infections in dogs.

  1. Canine kobuviruses in diarrhoeic dogs in Italy. (United States)

    Di Martino, Barbara; Di Felice, Elisabetta; Ceci, Chiara; Di Profio, Federica; Marsilio, Fulvio


    Canine kobuviruses (CaKVs) are newly recognized picornaviruses recently detected in dogs in the US. By molecular analysis of the whole genome, CaKV that appeared genetically closest to the murine kobuvirus (MuKV) and to the human Aichi virus (AiV), may be classified in the Kobuvirus genus as new genotype (CaKV type 1) within the species Aichivirus A. To date, there are no information on the epidemiology of these novel viruses in other continents. In this study, by screening a collection of 256 dog fecal samples either from diarrhoeic or asymptomatic animals, CaKV was identified in six specimens with an overall prevalence of 2.34% (6/256). All the positive dogs presented diarrhea and were found to be infected by CaKV alone or in mixed infections with canine coronavirus (CCoV) and/or canine parvovirus type 2 (CPV-2). By molecular analysis of the partial 3D gene, all the strains detected displayed a close relatedness with the CaKVs recently identified in the US. This study provides evidence that CaKVs circulate in diarrhoeic dogs in Italy and are not geographically restricted to the North American continent, where they were first signaled. PMID:23806200

  2. Cytodiagnostics of canine lymphomas - possibilities and limitations. (United States)

    Sapierzyński, R; Kliczkowska-Klarowicz, K; Jankowska, U; Jagielski, D


    Malignant lymphomas are one of the most common malignant tumours occurring in dogs. The basic method of lymphoma diagnosis in human, as well as in canine oncology is histopathology supported by immunohistochemistry. It was suggested that in veterinary medicine excisional biopsy of lymph node and histopathology should be considered only where the cytologic diagnosis is equivocal or needs to be confirmed. There are at least three basic reasons for which cytological examination ought to be accepted as a sufficient and reliable diagnostic method for lymphoma in dogs. Firstly, most dog owners consider the fine-needle biopsy as an acceptable non-harmful method of sample collection. Secondly, an increasing number of studies recommend cytology as an accurate test for diagnosing and subtyping canine lymphoma. Finally, the vast majority of canine lymphoma subtypes belong to 4-5 categories characterized by a typical cytological picture. Immunocytochemical staining of cytological smears gives new diagnostic possibilities, such as detection of markers better characterizing given growth or a potential goal for target therapy in individual cases (for example inhibitors of platelet-derived growth factor). PMID:27487521

  3. 9 CFR 113.317 - Parvovirus Vaccine (Canine). (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... parvovirus susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood samples...

  4. Stroma and extracellular matrix proteins in canine tumours

    NARCIS (Netherlands)

    Mukaratirwa, Sydney


    In this thesis, studies on temporal and spatial changes in stromal cells and extracellular matrix (ECM) molecules in canine gastrointestinal (GIT) tumours and canine transmissible venereal (CTVT) tumours are described. The mechanisms involved in the phenotypic transformation of fibroblasts to myofib

  5. Canine evolution in sabretoothed carnivores: natural selection or sexual selection? (United States)

    Randau, Marcela; Carbone, Chris; Turvey, Samuel T


    The remarkable elongated upper canines of extinct sabretoothed carnivorous mammals have been the subject of considerable speculation on their adaptive function, but the absence of living analogues prevents any direct inference about their evolution. We analysed scaling relationships of the upper canines of 20 sabretoothed feliform carnivores (Nimravidae, Barbourofelidae, Machairodontinae), representing both dirk-toothed and scimitar-toothed sabretooth ecomorphs, and 33 non-sabretoothed felids in relation to body size in order to characterize and identify the evolutionary processes driving their development, using the scaling relationships of carnassial teeth in both groups as a control. Carnassials display isometric allometry in both sabretooths and non-sabretooths, supporting their close relationship with meat-slicing, whereas the upper canines of both groups display positive allometry with body size. Whereas there is no statistical difference in allometry of upper canine height between dirk-toothed and scimitar-toothed sabretooth ecomorphs, the significantly stronger positive allometry of upper canine height shown by sabretooths as a whole compared to non-sabretooths reveals that different processes drove canine evolution in these groups. Although sabretoothed canines must still have been effective for prey capture and processing by hypercarnivorous predators, canine morphology in these extinct carnivores was likely to have been driven to a greater extent by sexual selection than in non-sabretooths. Scaling relationships therefore indicate the probable importance of sexual selection in the evolution of the hypertrophied sabretooth anterior dentition. PMID:23951334

  6. Canine evolution in sabretoothed carnivores: natural selection or sexual selection?

    Directory of Open Access Journals (Sweden)

    Marcela Randau

    Full Text Available The remarkable elongated upper canines of extinct sabretoothed carnivorous mammals have been the subject of considerable speculation on their adaptive function, but the absence of living analogues prevents any direct inference about their evolution. We analysed scaling relationships of the upper canines of 20 sabretoothed feliform carnivores (Nimravidae, Barbourofelidae, Machairodontinae, representing both dirk-toothed and scimitar-toothed sabretooth ecomorphs, and 33 non-sabretoothed felids in relation to body size in order to characterize and identify the evolutionary processes driving their development, using the scaling relationships of carnassial teeth in both groups as a control. Carnassials display isometric allometry in both sabretooths and non-sabretooths, supporting their close relationship with meat-slicing, whereas the upper canines of both groups display positive allometry with body size. Whereas there is no statistical difference in allometry of upper canine height between dirk-toothed and scimitar-toothed sabretooth ecomorphs, the significantly stronger positive allometry of upper canine height shown by sabretooths as a whole compared to non-sabretooths reveals that different processes drove canine evolution in these groups. Although sabretoothed canines must still have been effective for prey capture and processing by hypercarnivorous predators, canine morphology in these extinct carnivores was likely to have been driven to a greater extent by sexual selection than in non-sabretooths. Scaling relationships therefore indicate the probable importance of sexual selection in the evolution of the hypertrophied sabretooth anterior dentition.

  7. Apicotomy: surgical management of maxillary dilacerated or ankylosed canines. (United States)

    Araújo, Eustáquio A; Araújo, Cristiana V; Tanaka, Orlando M


    This clinical article reports a technique, apicotomy, for managing dilacerated or ankylosed canines. The records of 3 patients successfully treated with apicotomy are presented. Orthodontists observe clinically significant incidences of impacted maxillary canines in their daily practices. Several procedures have been described to bring an ankylosed, impacted tooth into occlusion. Luxation is the most widely used solution, but there are risks involved with that approach, and the success rate is low. Surgical repositioning has also been used, but morbidity is high, and the aggressiveness of the procedure might also contraindicate it. Ankylosis might be related to the anatomic position of the canine's root apex and its adjacent anatomic structures. Apicotomy is a guided fracture of a canine root apex, followed by its orthodontic traction. It is a conservative surgical alternative for treating impacted canines with dilacerations or apical root ankylosis. PMID:24286914

  8. Morphology and immunoreactivity of canine and feline extramedullary plasmacytomas. (United States)

    Mikiewicz, M; Otrocka-Domagała, I; Paździor-Czapula, K; Gesek, M


    The aim of the study was the evaluation of morphology and immunophenotype of canine (19 cases) and feline (7 cases) extramedullary plasmacytomas. Tumours, located in skin, oral cavity and spleen were surgically excised, fixed and processed for histopathology and immunohistochemistry (CD79α, CD18, proliferating cell nuclear antigen, metallothionein). Histologically, tumours were classified into mature, cleaved, asynchronous, polymorphous blastic, hyalin, or monomorphous blastic type. All evaluated tumours showed cytoplasmic expression of CD79α antigen. The expression of CD18 was observed in canine cutaneous and splenic tumours. In canine tumours expression of metallothionein was low to moderate, while in feline plasmacytomas - absent or low. In canine tumours, the mitotic index and proliferating cell nuclear antigen index were positively correlated with the expression of metallothionein. In feline tumours no correlation between mitotic index, proliferating cell nuclear antigen and metallothionein was found. This is the first study describing expression of metallothionein in canine and feline extramedullary plasmacytoma. PMID:27487508

  9. Extraglandular and intraglandular vascularization of canine prostate. (United States)

    Stefanov, Miroslav


    The literature on the vascularization of the canine prostate is reviewed and the clinical significance of prostate morphology is described. Scanning Electron Microscopy (SEM), combined with improved corrosion casting methods, reveal new morphological details that promise better diagnostics and treatment but also require expansion of clinical nomenclature. A proposal is made for including two previously unnamed veins in Nomina Anatomica Veterinaria (NAV). The canine prostate has two lobes with independent vascularization. Each lobe is supplied through the left and right a. prostatica, respectively. The a. prostatica sprouts three small vessels (cranial, middle, and caudal) towards the prostate gland. A. prostatica is a small-size artery whose wall structure is similar to the arteries of the muscular type. V. prostatica is a small-size valved vein. The canine prostate has capsular, parenchymal, and urethral vascular zones. The surface vessels of the capsule are predominantly veins and the diameter of arterial vessels is larger than that of the veins. The trabecular vessels are of two types: direct and branched. The prostate parenchyma is supplied by branches of the trabecular vessels. The periacinary capillaries are fenestrated and form a net in a circular pattern. The processes of the myoepithelial cells embrace both the acins and the periacinar capillaries. In the prostate ductal system. there are spermatozoa. The prostatic part of the urethra is supplied by an independent branch of a. prostatica. The prostatic urethral part is drained by v. prostatica, the vein of the urethral bulb and the ventral prostate veins. M. urethralis begins as early as the urethral prostatic part. The greater part of the white muscle fibers in m. urethralis suggest an enhanced anaerobic metabolism.

  10. Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus




    Serum neutralisation test (SNT) has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA) is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig) G antibodies to canine distemper virus (CDV) was developed by using Onderstepoort strain of canine dis...

  11. Creation of distal canine limb lymphedema

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H.C.; Pribaz, J.J.; O' Brien, B.M.; Knight, K.R.; Morrison, W.A.


    A canine model of distal limb lymphedema was established in order to study the treatment of this condition by lymph node transfer. This model was more difficult to establish than whole-limb lymphedema. Significant edema was achieved by a combination of preoperative irradiation and circumferential removal of skin from the irradiated areas followed by removal of the contents of the popliteal fossa. Despite these measures, it was not possible to produce lymphedema in every case, possibly because of the presence of lymphaticovenous shunts and panvascular compensation mechanisms.

  12. Lactoferrin in canine sera: a pyometra study. (United States)

    Bartoskova, A; Adlerova, L; Kudlackova, H; Leva, L; Vitasek, R; Faldyna, M


    The concentration of lactoferrin was measured in canine sera from groups of healthy male dogs as well as pregnant and non-pregnant female dogs and was compared with that of bitches with pyometra. Lactoferrin concentrations were higher in bitches with pyometra. The role of elevated lactoferrin concentrations in the suppression of lymphocyte activity was examined in sera from bitches with pyometra in a series of investigations. Although the sera from bitches with pyometra were capable of suppressing lymphocyte activity, lactoferrin was not found to be involved in this action. PMID:19754566

  13. Definition, Classification, and Pathophysiology of Canine Glaucoma. (United States)

    Pizzirani, Stefano


    Glaucoma is a common ocular condition in humans and dogs leading to optic nerve degeneration and irreversible blindness. Primary glaucoma is a group of spontaneous heterogeneous diseases. Multiple factors are involved in its pathogenesis and these factors vary across human ethnic groups and canine breeds, so the clinical phenotypes are numerous and their classification can be challenging and remain superficial. Aging and oxidative stress are major triggers for the manifestation of disease. Multiple, intertwined inflammatory and biochemical cascades eventually alter cellular and extracellular physiology in the optic nerve and trabecular meshwork and lead to vision loss. PMID:26456751

  14. Cone beam computed tomography findings of impacted upper canines

    Energy Technology Data Exchange (ETDEWEB)

    Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)


    To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

  15. Cone beam computed tomography findings of impacted upper canines

    International Nuclear Information System (INIS)

    To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

  16. Establishment of a sensitized canine model for kidney transplantation

    Institute of Scientific and Technical Information of China (English)

    XIE Sen; XIA Sui-sheng; TANG Li-gong; CHENG Jun; CHEN Zhi-shui; ZHENG Shan-gen


    Objective:To establish a sensitized canine model for kidney transplantation. Methods:12 male dogs were averagely grouped as donors and recipients. A small number of donor canine lymphocytes was infused into different anatomic locations of a paired canine recipient for each time and which was repeated weekly. Specific immune sensitization was monitored by means of Complement Dependent Cytotoxicity (CDC) and Mixed Lymphocyte Culture (MLC) test. When CDC test conversed to be positive and MLC test showed a significant proliferation of reactive lymphocytes of canine recipients, the right kidneys of the paired dogs were excised and transplanted to each other concurrently. Injury of renal allograft function was scheduled determined by ECT dynamic kidney photography and pathologic investigation. Results :CDC test usually conversed to be positive and reactive lymphocytes of canine recipients were also observed to be proliferated significantly in MLC test after 3 to 4 times of canine donor lymphocyte infusions. Renal allograft function deterioration occurred 4 d post-operatively in 4 of 6 canine recipients, in contrast to none in control dogs. Pathologic changes suggested antibody-mediated rejection (delayed) or acute rejection in 3 excised renal allograft of sensitized dogs. Seven days after operation, all sensitized dogs had lost graft function, pathologic changes of which showed that the renal allografts were seriously rejected. 2 of 3 dogs in control group were also acutely rejected. Conclusion:A convenient method by means of repeated stimulation of canine lymphocyte may induce specific immune sensitization in canine recipients. Renal allografts in sensitized dogs will be earlier rejected and result in a more deteriorated graft function.

  17. Detection of canine echinococcosis by coproantigen ELISA

    Institute of Scientific and Technical Information of China (English)

    DeS; PanD; BeraAK; SreevatsavaV; DasSK; DasS; RanaT; BandyopadhyayS; BhattacharyaD


    Objective:To study the canine echinococcosis by coproantigen ELISA method. Methods:During the present investigation experimental infection was established using evaginated worms of Echinococcus granulosus (E. granulosus). To check cross reactivity two pups were infected with Taenia hydatigena(T. hydatigena). In order to detect the presence of antigen, hyperimmune sera were raised against excretory-secretory products of adult worms E. chinococcus granulosus. Faecal sample collected either from experimentally infected pups or from other sources were heated at 70℃to detect heat stable soluble antigen. Results:Pups harbouring less than 104 worms showed negative results. Samples collected from 14 days onwards from experimentally infected animals harbouring more than 104 worms showed positive value. The maximum positive samples were detected in samples collected from in and around slaughter house and the least number of samples were detected positive maintained by dog squad. Conclusions:The affinity purified IgG exhibited promising results for detection of canine echinococcosis by indirect ELISA.

  18. Seroepidemiology of Canine parvovirus infection in dogs

    Directory of Open Access Journals (Sweden)

    Indrawati Sendow


    Full Text Available Canine parvovirus is an acute and fatal viral disease in dogs. A total of 209 local, cross breed and breed dogs sera from Kodya Bogor, Kabupaten Bogor, Sukabumi, and Jakarta, had been tested using Haemagglutination Inhibition Test (HI with pig red blood cells. A total of 64 breed and cross breed dogs from Sukabumi and Kodya Bogor, were used as a sentinel dogs to study the epidemiology of Canine parvovirus (CPV infection and its immunological responses caused by vaccination. The results indicated that 78% (95 breed and cross bred dogs and 59% (51 local dogs had antibody to CPV. Sentinel dogs results indicated that dogs had been vaccinated showed antibody response with the varied titre dependant upon prevaccination titre. Low prevaccinated titre gave better response than protective level titre. From 19 puppies observed, Maternal antibodi were still detected until 5 weeks old puppies. First vaccination given at less than 3 months old, should be boosted after 3 months old puppied. Antibodi titre produced by natural infection will keep untill 2 years. These data concluded that the dog condition and time of vaccination will affect the optimum antibody response.

  19. A custom made jig for individual canine retraction

    Directory of Open Access Journals (Sweden)

    Vipul Kumar Sharma


    Full Text Available We face difficulty in individual canine retraction in the bracket system lacking power arms on the canines. When orthodontic force is applied through the center of resistance (CR, then, tooth translation ensues. Forces applied at a distance from the CR create a moment that tends to rotate and tip the tooth. The tendency of tipping is increased in the bracket system lacking power arm, since, force is applied more occlusally. Hence, we have designed a chair side custom made jig to retract the canines individually.

  20. Canine pluripotent stem cells: Are they ready for clinical applications?

    Directory of Open Access Journals (Sweden)

    Dean Harvey Betts


    Full Text Available The derivation of canine embryonic stem cells and generation of canine induced pluripotent stem cells are significant achievements that have unlocked the potential for developing novel cell-based disease models, drug discovery platforms and transplantation therapies in the dog. A progression from concept to cure in this clinically relevant companion animal will not only help our canine patients but also help advance human regenerative medicine. Nevertheless, many issues remain to be resolved before pluripotent cells can be used clinically in a safe and reproducible manner.

  1. Clinical and serological response of wild dogs (Lycaon pictus to vaccination against canine distemper, canine parvovirus infection and rabies

    Directory of Open Access Journals (Sweden)

    J. Van Heerden


    Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

  2. Case Report: Canine Fossa Abscess; A Rare Etiological Factor: The Lower Canine Tooth


    Agacayak, K. Serkan; Atılgan, S. Serhat; GORGUN, Belgin; Yaman, Ferhan; Ucan, M. Can; Atalay, Yusuf


    Odontogenic infection may be dangerous; especially when life-threatening complications occur. Infection spreads through the bone and periosteum toward nearby or more distant structures and spaces. Canine fossa abscess is an odontogenic infection that can lead to life-threatening complications. Successful treatment requires early recognition, determination of etiological factors, and proper medical and surgical management. The aim of this paper is to emphasize different and rare etiological fa...

  3. Emerging perspectives on hereditary glomerulopathies in canines

    Directory of Open Access Journals (Sweden)

    Littman MP


    Full Text Available Meryl P LittmanDepartment of Clinical Studies – Philadelphia, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA, USAAbstract: Familial glomerulopathies have been described in more than two dozen dog breeds. These canine spontaneous cases of glomerular disease are good models for their human counterparts. The dogs present clinically with protein-losing nephropathy and variable signs of hypertension, thromboembolic events, edema/effusions/nephrotic syndrome, or eventually with signs of renal disease such as anorexia, vomiting, weight loss, and/or polyuria/polydipsia. Laboratory changes include proteinuria, hypoalbuminemia, hypercholesterolemia, and eventually azotemia, hyperphosphatemia, anemia, and isosthenuria. Renal biopsies examined with transmission electron microscopy, immunofluorescence, and thin section light microscopy may show ultrastructural glomerular basement membrane abnormalities, glomerulosclerosis, amyloidosis, non-amyloid fibrillary deposition, or breed-associated predispositions for immune-complex glomerulonephritis. Genome-wide association studies and fine sequencing of candidate genes have led to the discovery of variant alleles associated with disease in some breeds; eg, 1 glomerular basement membrane ultrastructural abnormalities due to defective collagen type IV, caused by different premature stop codons in each of four breeds; ie, in COL4A5 in Samoyeds and Navasota mix breed dogs (X-linked, and in COL4A4 in English Cocker Spaniels and English Springer Spaniels (autosomal recessive; and 2 glomerulosclerosis-related podocytopathy with slit diaphragm protein anomalies of both nephrin and Neph3/filtrin due to non-synonymous single nucleotide polymorphisms in conserved regions of their encoding genes, NPHS1 and KIRREL2, in Soft Coated Wheaten Terriers and Airedale Terriers, with a complex mode of inheritance. Age at onset and progression to end-stage renal disease vary depending on the model. Genetic

  4. Death of a wild wolf from canine parvovirus enteritis (United States)

    Mech, L.D.; Kurtz, H.J.; Goyal, S.


    A 9-mo-old female wolf (Canis lupus) in the Superior National Forest of Minnesota (USA) died from a canine parvovirus (CPV) infection. This is the first direct evidence that this infection effects free-ranging wild wolves.

  5. Canine index – A tool for sex determination

    Directory of Open Access Journals (Sweden)

    Shankar M. Bakkannavar


    Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.

  6. Periodontal ligament distraction: A simplified approach for rapid canine retraction

    Directory of Open Access Journals (Sweden)

    K C Prabhat


    Full Text Available Distraction osteogenesis is a method of inducing new bone formation by applying mechanical strains on preexisting bone. The process of osteogenesis in the periodontal ligament during orthodontic tooth movement is similar to the osteogenesis in the midpalatal suture during rapid palatal expansion. A new concept of "distracting the periodontal ligament" is proposed to elicit rapid canine retraction in two weeks. At the time of first premolar extraction, the interseptal bone distal to the canine was undermined with a bone bur, grooving vertically inside the extraction socket along the buccal and lingual sides and extending obliquely toward the socket base. Then, a tooth-borne, custom-made, intraoral distraction device was placed to distract the canine distally into the extraction space. It was activated 0.5 mm/day, immediately after the extraction. Canine was distracted 6.5 mm into the extraction space within two weeks.

  7. Severe canine distemper outbreak in unvaccinated dogs in Mozambique

    Directory of Open Access Journals (Sweden)

    Julieta Zacarias


    Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

  8. Canine distemper virus in Lake Baikal seals (Phoca sibirica).


    Mamaev, L.V.; Visser, Ilona; Belikov, S.I.; Denikina, N.N.; Harder, Timm; Goatley, L.; Rima, B.; Edginton, B.; Osterhaus, Albert; Barrett, Thomas,


    textabstractThe virus epizootic which resulted in significant mortality in Siberian seals (Phoca sibirica) in Lake Baikal during 1987/88 was caused by canine distemper virus. Sequence analysis of the virus glycoprotein genes revealed that it was most closely related to recent European field isolates of canine distemper virus. This paper presents evidence that the same virus continued to circulate in seals in Lake Baikal after the initial epizootic. Three out of 45 brain tissue samples collect...

  9. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus


    Otávio Valério Carvalho; Clarisse Vieira Botelho; Caroline Gracielle Torres Ferreira; Paulo Oldemar Scherer; Jamária Adriana Pinheiro Soares-Martins; Márcia Rogéria de Almeida; Abelardo Silva Júnior


    Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availabilit...

  10. Characterization of a Canine Homolog of Human Aichivirus▿


    Kapoor, A; Simmonds, P.; Dubovi, E J; Qaisar, N.; Henriquez, J. A.; J. Medina; S Shields; Lipkin, W. I.


    Many of our fatal "civilization" infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5' and 3' untranslated regions...

  11. Permanent Maxillary Canine Agenesis: A Rare Case Report


    Halaswamy V Kambalimath; Jain, Somya; Patil, Raju Umaji; Asokan, Alexander; Kambalimath, Deepashri


    ABSTRACT Congenitally missing teeth (CMT) are among one of the commonly known dental anomalies. The most frequently missing teeth in the permanent dentition, excluding the third molars, are mandibular second premolars and maxillary lateral incisors. Exclusive agenesis of both maxillary canines is an extremely rare occurrence and only a few cases have been reported. Previous studies showed that the prevalence of maxillary canine agenesis varies between 0.07 and 0.13%. In recent studies on Indi...

  12. Genomic instability and telomere fusion of canine osteosarcoma cells.

    Directory of Open Access Journals (Sweden)

    Junko Maeda

    Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.

  13. Canine Evolution in Sabretoothed Carnivores: Natural Selection or Sexual Selection?


    Marcela Randau; Chris Carbone; Turvey, Samuel T.


    The remarkable elongated upper canines of extinct sabretoothed carnivorous mammals have been the subject of considerable speculation on their adaptive function, but the absence of living analogues prevents any direct inference about their evolution. We analysed scaling relationships of the upper canines of 20 sabretoothed feliform carnivores (Nimravidae, Barbourofelidae, Machairodontinae), representing both dirk-toothed and scimitar-toothed sabretooth ecomorphs, and 33 non-sabretoothed felids...

  14. Recent epidemiological status of canine viral enteric infections and Giardia infection in Japan. (United States)

    Mochizuki, M; Hashimoto, M; Ishida, T


    Epidemiology of canine enteric infections was studied. Rectal swabs collected from 95 dogs presented at animal hospitals during a period from January to June of 2000 were examined for enteric pathogens, including viruses and Giardia lamblia (G. lamblia). Most frequently detected in both diarrheal and normal feces were canine coronavirus (55.4%) and G. lamblia (48.2%). Canine parvovirus type 2 (CPV-2) was specifically associated with diarrheal cases and CPV-2b was the predominant antigenic type. Although canine rotavirus, canine adenovirus, and canine distemper virus were also detected in a small number of diarrheal cases, no evidence for calicivirus infection was obtained. PMID:11411507

  15. Transmigration of mandibular canine: report of four cases and review of literature. (United States)

    Sharma, Gaurav; Nagpal, Archna


    Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%-0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine. PMID:22570797

  16. Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature

    Directory of Open Access Journals (Sweden)

    Gaurav Sharma


    Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.

  17. Canine vector-borne diseases in Brazil

    Directory of Open Access Journals (Sweden)

    Dantas-Torres Filipe


    Full Text Available Abstract Canine vector-borne diseases (CVBDs are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi, bacteria (e.g., Anaplasma platys and Ehrlichia canis, and helminths (e.g., Dirofilaria immitis and Dipylidium caninum that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance of CVBDs in Brazil and discusses research gaps to be addressed in future studies.

  18. Canine distemper in endangered Ethiopian wolves. (United States)

    Gordon, Christopher H; Banyard, Ashley C; Hussein, Alo; Laurenson, M Karen; Malcolm, James R; Marino, Jorgelina; Regassa, Fekede; Stewart, Anne-Marie E; Fooks, Anthony R; Sillero-Zubiri, Claudio


    The Ethiopian wolf (Canis simensis) is the world's rarest canid; ≈500 wolves remain. The largest population is found within the Bale Mountains National Park (BMNP) in southeastern Ethiopia, where conservation efforts have demonstrated the negative effect of rabies virus on wolf populations. We describe previously unreported infections with canine distemper virus (CDV) among these wolves during 2005-2006 and 2010. Death rates ranged from 43% to 68% in affected subpopulations and were higher for subadult than adult wolves (83%-87% vs. 34%-39%). The 2010 CDV outbreak started 20 months after a rabies outbreak, before the population had fully recovered, and led to the eradication of several focal packs in BMNP's Web Valley. The combined effect of rabies and CDV increases the chance of pack extinction, exacerbating the typically slow recovery of wolf populations, and represents a key extinction threat to populations of this highly endangered carnivore. PMID:25898177

  19. European surveillance for pantropic canine coronavirus. (United States)

    Decaro, Nicola; Cordonnier, Nathalie; Demeter, Zoltan; Egberink, Herman; Elia, Gabriella; Grellet, Aurélien; Le Poder, Sophie; Mari, Viviana; Martella, Vito; Ntafis, Vasileios; von Reitzenstein, Marcela; Rottier, Peter J; Rusvai, Miklos; Shields, Shelly; Xylouri, Eftychia; Xu, Zach; Buonavoglia, Canio


    Highly virulent pantropic canine coronavirus (CCoV) strains belonging to subtype IIa were recently identified in dogs. To assess the distribution of such strains in Europe, tissue samples were collected from 354 dogs that had died after displaying systemic disease in France (n = 92), Hungary (n = 75), Italy (n = 69), Greece (n = 87), The Netherlands (n = 27), Belgium (n = 4), and Bulgaria (n = 1). A total of 124 animals tested positive for CCoV, with 33 of them displaying the virus in extraintestinal tissues. Twenty-four CCoV strains (19.35% of the CCoV-positive dogs) detected in internal organs were characterized as subtype IIa and consequently assumed to be pantropic CCoVs. Sequence and phylogenetic analyses of the 5' end of the spike protein gene showed that pantropic CCoV strains are closely related to each other, with the exception of two divergent French viruses that clustered with enteric strains. PMID:23100349

  20. A canine model of multiple portosystemic shunting. (United States)

    Howe, L M; Boothe, H W; Miller, M W; Boothe, D M


    The objective of this study was to develop and describe an experimental canine model of multiple acquired portosystemic shunts (PSS) similar in nature to spontaneously occurring PSS. Sixteen dogs were used and were divided into a control (n = 6) and a diseased group (n = 10). Dogs of the diseased group were administered dimethylnitrosamine (2 mg/kg of body weight, po) twice weekly, and clinicopathologic, ultrasonographic, and hepatic scintigraphic findings were recorded during the development of hepatic disease and PSS. Surgery was then performed to permit visual verification of multiple shunts, catheter placement for portography examination, and biopsy of the liver. All diseased dogs developed severe hepatic disease and multiple PSS as documented visually at surgery and on portography. Based on this study, dimethylnitrosamine-induced portosystemic shunting appears to be an appropriate model for spontaneously occurring multiple PSS secondary to portal hypertension. PMID:10741951

  1. Why segment the maxilla between laterals and canines?

    Directory of Open Access Journals (Sweden)

    Lucas Senhorinho Esteves


    Full Text Available Introduction: Maxillary surgery on a bone segment enables movement in the sagittal and vertical planes. When performed on multiple segments, it further provides movement in the transverse plane. Typical sites for interdental osteotomies are between laterals and canines, premolars and canines, or between incisors. Additionally, osteotomies can be bilateral, unilateral or asymmetric. The ability to control intercanine width, buccolingual angulation of incisors, and correct Bolton discrepancy are some of the advantages of maxillary segmentation between laterals and canines. Objective: This article describes important features to be considered in making a clinical decision to segment the maxilla between laterals and canines when treating a dentoskeletal deformity. It further discusses the history of this surgical approach, the indications for its clinical use, the technique used to implement it, as well as its advantages, disadvantages, complications and stability. It is therefore hoped that this paper will contribute to disseminate information on this topic, which will inform the decision-making process of those professionals who wish to make use of this procedure in their clinical practice. Conclusions: Segmental maxillary osteotomy between laterals and canines is a versatile technique with several indications. Furthermore, it offers a host of advantages compared with single-piece osteotomy, or between canines and premolars.

  2. Consequences of crown shortening canine teeth in Greenland sled dogs

    DEFF Research Database (Denmark)

    Kortegaard, H E; Anthony Knudsen, T; Dahl, S;


    OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P ... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...

  3. Chlamydia in canine or feline coronary arteriosclerotic lesions

    Directory of Open Access Journals (Sweden)

    Grabarevic Zeljko


    Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.

  4. A compendium of canine normal tissue gene expression.

    Directory of Open Access Journals (Sweden)

    Joseph Briggs

    Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.

  5. Canine detection of free-ranging brown treesnakes on Guam (United States)

    Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.


    We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.

  6. The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells. (United States)

    Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki


    Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. PMID:25680810

  7. A retrospective investigation of canine adenovirus (CAV) infection in adult dogs in Turkey : article


    Gur, S; A. Acar


    Canine adenovirus (CAV) type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11), and Akbash dogs (n = 17) and Turkish Greyhounds (n=15) in Es...

  8. Accuracy of Trained Canines for Detecting Bed Bugs (Hemiptera: Cimicidae). (United States)

    Cooper, Richard; Wang, Changlu; Singh, Narinderpal


    Detection of low-level bed bug, Cimex lectularius L. (Hemiptera: Cimicidae), infestations is essential for early intervention, confirming eradication of infestations, and reducing the spread of bed bugs. Despite the importance of detection, few effective tools and methods exist for detecting low numbers of bed bugs. Scent dogs were developed as a tool for detecting bed bugs in recent years. However, there are no data demonstrating the reliability of trained canines under natural field conditions. We evaluated the accuracy of 11 canine detection teams in naturally infested apartments. All handlers believed their dogs could detect infestations at a very high rate (≥95%). In three separate experiments, the mean (min, max) detection rate was 44 (10-100)% and mean false-positive rate was 15 (0-57)%. The false-positive rate was positively correlated with the detection rate. The probability of a bed bug infestation being detected by trained canines was not associated with the level of bed bug infestations. Four canine detection teams evaluated on multiple days were inconsistent in their ability to detect bed bugs and exhibited significant variance in accuracy of detection between inspections on different days. There was no significant relationship between the team's experience or certification status of teams and the detection rates. These data suggest that more research is needed to understand factors affecting the accuracy of canine teams for bed bug detection in naturally infested apartments. PMID:26470083

  9. Effect of simulated stages of the canine oestrous cycle on Escherichia coli binding to canine endometrium. (United States)

    Krekeler, N; Lodge, K M; Anderson, G A; Browning, G F; Charles, J A; Wright, P J


    Pyometra, a prevalent infectious uterine disease that affects intact middle-aged bitches, is typically associated with Escherichia coli. Our hypotheses were (i) that bacterial adhesion to canine endometrium differs between different stages of the oestrous cycle and (ii) that the adhesin FimH facilitates this adhesion. Twelve post-pubertal, ovariectomized greyhound bitches were treated with exogenous hormones to simulate different stages of the oestrous cycle. Tissue samples from each uterus were incubated with a pathogenic E. coli strain carrying the fimH gene, but no other adhesin genes (P4-wt)--or an E. coli strain in which fimH was insertionally inactivated (P4-∆fimH::kan)--or with phosphate-buffered saline as a negative control. After washing, tissue samples were homogenized for quantification of adherent bacteria. The differences in binding to canine endometrium at different stages of the oestrous cycle were not significant. However, the mean difference in binding of the P4-wt and the P4-∆fimH::kan across all stages of the simulated oestrous cycle was significant (p dogs might suggest genetic variations or epigenetic differences in FimH receptor expression by the endometrium, unrelated to the stage of the oestrous cycle. PMID:23279531

  10. Effects of the canine rattlesnake vaccine in moderate to severe cases of canine crotalid envenomation

    Directory of Open Access Journals (Sweden)

    Leonard MJ


    Full Text Available McGee J Leonard,1 Catherine Bresee,2 Andrew Cruikshank1 1Animal Specialty and Emergency Center, Los Angeles, CA, USA; 2The Biostatistics and Bioinformatics Research Center, Cedars-Sinai Medical Center, Los Angeles, CA, USA Abstract: This is a retrospective multicenter study (2006–2012 examining a population of dogs with moderate to severe crotalid envenomation for protective effects of the canine rattlesnake vaccine. Five nonacademic emergency and referral veterinary hospitals in Southern California were involved in the study and contributed records regarding a total of 82 client-owned dogs that were treated for naturally occurring rattlesnake envenomation. All dogs received antivenin (Crotalidae polyvalent, with dosages ranging from one to three vials (mean: 1.3±0.6. Fourteen dogs (17% had a history of prior vaccination against crotalid venom. In univariate logistic regression modeling, cases with lower body weight (P=0.0001 or higher snakebite severity scores (P<0.0001 were associated with greater morbidity. No statistically significant difference in morbidity or mortality between vaccinated and unvaccinated dogs was found. The findings of this study did not identify a significantly protective effect of previous vaccination in the cases of moderate to severe rattlesnake envenomation that require treatment with antivenin. Keywords: rattlesnake envenomation, vaccine, antivenin, canine

  11. [Diagnostic tools for canine parvovirus infection]. (United States)

    Proksch, A L; Hartmann, K


    Canine parvovirus (CPV) infection is one of the most important and common infectious diseases in dogs, in particular affecting young puppies when maternal antibodies have waned and vaccine-induced antibodies have not yet developed. The mortality rate remains high. Therefore, a rapid and safe diagnostic tool is essential to diagnose the disease to 1) provide intensive care treatment and 2) to identify virus-shedding animals and thus prevent virus spread. Whilst the detection of antibodies against CPV is considered unsuitable to diagnose the disease, there are several different methods to directly detect complete virus, virus antigen or DNA. Additionally, to test in commercial laboratories, rapid in-house tests based on ELISA are available worldwide. The specificity of the ELISA rapid in-house tests is reported to be excellent. However, results on sensitivity vary and high numbers of false-negative results are commonly reported, which potentially leads to misdiagnosis. Polymerase chain reaction (PCR) is a very sensitive and specific diagnostic tool. It also provides the opportunity to differentiate vaccine strains from natural infection when sequencing is performed after PCR.

  12. Canine Oral Eosinophilic Granuloma Treated with Electrochemotherapy

    Directory of Open Access Journals (Sweden)

    Matías Nicolás Tellado


    Full Text Available A case of a canine oral eosinophilic granuloma in a 14-year-old female crossbred is described. The dog was presented with a history of ptyalism, halitosis, local pain, decreased appetite, and blood staining noted on food and water bowls. Clinical, hematologic, and biochemical examinations, abdominal ultrasonography, and 3-view chest radiographs were performed, and no metastases were found. Histopathologic examination of two 6 mm punch biopsies from the oral lesion revealed the presence of eosinophilic granulomatous lesions in the submucosa. After treatment with corticosteroids and wide spectrum antibiotics no significant changes in clinical signs and lesion size were observed. Electrochemotherapy (ECT, a novel tumor treatment routinely used for cutaneous and subcutaneous tumors in human patients in the European Union since 2006, was used to treat the eosinophilic granuloma. The procedure was performed under general anesthesia, followed by intravenous administration of bleomycin. Six weeks after treatment a complete response with disappearance of the mass and improvement of clinical signs were observed.

  13. Nodular Epiescleritis Granulomatous Canine. Case Report

    Directory of Open Access Journals (Sweden)

    Camilo Guarín Patarroyo


    Full Text Available Granulomatous epiescleritis nodular disease in canines is a very unusual presentation that affects or external fibrous tunic of the eyeball and conjunctiva, which was an increase similar to a unilateral or bilateral tumor. Suspected immune-mediated disease due to lack of identification of an etiologic agent and the response to treatment with immunosuppressive drugs (Couto, 1992. The ideal therapy is the application of steroids via intralesional, topical or systemic, or other immunosuppressants such as cyclosporine and azathioprine; it is still advisable to apply antibiotic is the ideal combination of tetracycline and neomycin (Gilger & Whitley, 1999. The diagnostic method of episcleritis is made by histopathology, which is evident in changes similar to chronic granulomatous inflammation. Are claiming a racial bias in Alsatian, Shepherd Collie Shetland Shepherd, Coker Spaniel, Rottweiler and Labrador Retriever (Gough & Thomas, 2004. The following case is a report of a nodular epiescleritis affecting the cornea, sclera, and the corneoscleral limbus, which describes the diagnosis, signology and treatment.

  14. Haematological and biochemical analysis in canine enteritis

    Directory of Open Access Journals (Sweden)

    Abid Ali Bhat

    Full Text Available Aim: The present investigation screened eighteen clinical cases of canine enteritis for haematological and biochemical analyses. Materials and Methods: Eighteen dogs suffering from enteritis were selected and detailed clinical manifestations were noted. Hematological and biochemical parameters were estimated by using various kits. Blood was also collected from twelve healthy dogs for establishing control values and data obtained were subjected to statistical analysis. Results: The affected dogs showed anorexia, diarrhoea, depression, varying degree of dehydration and tachycardia. There were significant changes in packed cell volume, neutrophils, lymphocytes and mean corpuscular haemoglobin concentration. Biochemical investigation revealed significant decrease in plasma glucose, total plasma protein, albumin and albumin:globulin ratio (A:G ratio. The level of potassium and chloride was markedly decreased. Significant increase in alanine aminotransferase (ALT and blood urea nitrogen (BUN was observed. Conclusion: Packed Cell Volume (PCV and Total Erythrocyte Count (TEC remained almost similar between healthy dogs and dogs affected with diarrhoea. Mean Total Leukocyte Count (TLC value was significantly higher as compared to the control group. Hypoglycemia, hypoproteinemia, hypokalemia, hypochloremia and increase in blood urea nitrogen was observed in dogs suffering from enteritis. [Vet World 2013; 6(7.000: 380-383

  15. Canine detection odor signatures for explosives (United States)

    Williams, Marc; Johnston, J. M.; Cicoria, Matt; Paletz, E.; Waggoner, L. Paul; Edge, Cindy C.; Hallowell, Susan F.


    Dogs are capable of detecting and discriminating a number of compounds constituting a complex odor. However, they use only a few of these to recognize a substance. The focus of this research is to determine the compounds dogs learn to use in recognizing explosives. This is accomplished by training dogs under behavioral laboratory conditions to respond differentially on separate levers to 1) blank air, 2) a target odor, such as an explosive, and 3) all other odors (non-target odors). Vapor samples are generated by a serial dilution vapor generator whose operation and output is characterized by GC/MS. Once dogs learn this three-lever discrimination, testing sessions are conducted containing a number of probe trials in which vapor from constituent compounds of the target is presented. Which lever the dogs respond to on these probe trials indicates whether they can smell the compound at all (blank lever) or whether it smells like toe target odor (e.g., the explosive) or like something else. This method was conducted using TNT, C-4, and commercial dynamite. The data show the dogs' reactions to each of the constituent compounds tested for each explosive. Analysis of these data reveal the canine detection odor signature for these explosives.

  16. Canine Butterfly Glioblastomas: A Neuroradiological Review (United States)

    Rossmeisl, John H.; Clapp, Kemba; Pancotto, Theresa E.; Emch, Samantha; Robertson, John L.; Debinski, Waldemar


    In humans, high-grade gliomas may infiltrate across the corpus callosum resulting in bihemispheric lesions that may have symmetrical, winged-like appearances. This particular tumor manifestation has been coined a “butterfly” glioma (BG). While canine and human gliomas share many neuroradiological and pathological features, the BG morphology has not been previously reported in dogs. Here, we describe the magnetic resonance imaging (MRI) characteristics of BG in three dogs and review the potential differential diagnoses based on neuroimaging findings. All dogs presented for generalized seizures and interictal neurological deficits referable to multifocal or diffuse forebrain disease. MRI examinations revealed asymmetrical (2/3) or symmetrical (1/3), bihemispheric intra-axial mass lesions that predominantly affected the frontoparietal lobes that were associated with extensive perilesional edema, and involvement of the corpus callosum. The masses displayed heterogeneous T1, T2, and fluid-attenuated inversion recovery signal intensities, variable contrast enhancement (2/3), and mass effect. All tumors demonstrated classical histopathological features of glioblastoma multiforme (GBM), including glial cell pseudopalisading, serpentine necrosis, microvascular proliferation as well as invasion of the corpus callosum by neoplastic astrocytes. Although rare, GBM should be considered a differential diagnosis in dogs with an MRI evidence of asymmetric or symmetric bilateral, intra-axial cerebral mass lesions with signal characteristics compatible with glioma.


    Directory of Open Access Journals (Sweden)

    John Henry Rossmeisl


    Full Text Available In humans, high-grade gliomas may infiltrate across the corpus callosum resulting in bihemispheric lesions that may have symmetrical, winged-like appearances. This particular tumor manifestation has been coined a ‘butterfly’ glioma (BG. While canine and human gliomas share many neuroradiological and pathological features, the BG morphology has not been previously reported in dogs. Here we describe the magnetic resonance imaging (MRI characteristics of BG in three dogs, and review the potential differential diagnoses based on neuroimaging findings. All dogs presented with generalized seizures and interictal neurological deficits referable to multifocal or diffuse forebrain disease. MRI examinations revealed asymmetrical (2/3 or symmetrical (1/3, bihemispheric intra-axial mass lesions that predominantly affected the frontoparietal lobes and associated with extensive perilesional edema, and involvement of the corpus callosum. The masses displayed heterogeneous T1, T2, and FLAIR signal intensities, variable contrast enhancement (2/3, and mass effect. All tumors demonstrated classical histopathological features of glioblastoma (GBM including glial cell pseudopalisading, serpentine necrosis, microvascular proliferation, as well as invasion of the corpus callosum by neoplastic astrocytes. Although rare, GBM should be considered a differential diagnosis in dogs with MRI evidence of asymmetric or symmetric bilateral, intra-axial cerebral mass lesions with signal characteristics compatible with glioma.

  18. Chromosomal assignment of canine THADA gene to CFA 10q25

    Directory of Open Access Journals (Sweden)

    Dolf Gaudenz


    Full Text Available Abstract Background Chromosomal translocations affecting the chromosome 2p21 cluster in a 450 kb breakpoint region are frequently observed in human benign thyroid adenomas. THADA (thyroid adenoma associated was identified as the affected gene within this breakpoint region. In contrast to man tumours of the thyroid gland of dogs (Canis lupus familiaris constitute mainly as follicular cell carcinomas, with malignant thyroid tumours being more frequent than benign thyroid adenomas. In order to elucidate if the THADA gene is also a target of chromosomal rearrangements in thyroid adenomas of the dog we have physically mapped the canine THADA gene to canine chromosome 10. A PCR was established to screen a canine genome library for a BAC clone containing the gene sequence of canine THADA. Further PCR reactions were done using the identified BAC clone as a template in order to verify the corresponding PCR product by sequencing. Canine whole blood was incubated with colcemid in order to arrest the cultured cells in metaphases. The verified BAC DNA was digoxigenin labeled and used as a probe in fluorescence in situ hybridization (FISH. Ten well spread metaphases were examined indicating a signal on canine chromosome 10 on both chromatids. A detailed fine mapping was performed indicating the canine THADA gene locus on the q-arm of chromosome 10. Results The canine THADA gene locus was mapped on chromosome 10q25. Our mapping results obtained in this study following the previously described nomenclature for the canine karyotype. Conclusion We analysed whether the THADA gene locus is a hotspot of canine chromosomal rearrangements in canine neoplastic lesions of the thyroid and in addition might play a role as a candidate gene for a possible malignant transformation of canine thyroid adenomas. Although the available cytogenetic data of canine thyroid adenomas are still insufficient the chromosomal region to which the canine THADA has been mapped seems to be no

  19. Finite element analysis of rapid canine retraction through reducing resistance and distraction

    Directory of Open Access Journals (Sweden)

    Junjie XUE


    Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.

  20. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    Directory of Open Access Journals (Sweden)

    Otávio Valério Carvalho


    Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.

  1. Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features

    Directory of Open Access Journals (Sweden)

    Sophie Le Poder


    Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

  2. Canine dysautonomia in a litter of Havanese puppies. (United States)

    Hull, Noah C; O'Toole, Donal; Miller, Myrna M; Shoults, Hannah; Deck, Robin; Jones, Warren; Johnson, Gayle C; Shaw, Daniel P; Schumaker, Brant A


    Canine dysautonomia is a sporadic, generally fatal disease that rarely affects groups of related animals. Four 10-week-old Havanese puppies from a litter of 5 developed clinical signs of canine dysautonomia. The 4 affected dogs were exposed to an outdoor environment, whereas the fifth littermate was not exposed to the outdoors and remained clinically healthy. Clinical signs of dysautonomia developed 10-16 days after going outside the house. An unrelated dog also developed dysautonomia after exposure to 1 of the affected Havanese littermates. All 5 dogs had morphological changes consistent with dysautonomia (widespread neuronal degeneration in autonomic ganglia, select brainstem nuclei, and ventral horn motor neurons). Differential diagnoses were excluded through negative toxicological evaluation, fecal parasite screening, negative Canine distemper virus reverse transcription polymerase chain reaction, fluorescent antibody testing, attempted virus isolation, and electron microscopy. The 5 affected dogs were in the Kansas City, Missouri area, where there is a high incidence of dysautonomia. PMID:26179098

  3. Testosterone biotransformation by the isolated perfused canine pancreas

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))


    There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.

  4. Distribution of beta-amyloid in the canine brain. (United States)

    Hou, Y; White, R G; Bobik, M; Marks, J S; Russell, M J


    The distribution of amyloid-beta protein (A beta) in the canine brain was demonstrated by immunochemistry on serially sectioned tissues from 10 aged mixed breed dogs. Summation of quantitative data and relegation to anatomical sites for the 10 dogs showed A beta to be widely distributed in the cortex and hippocampus while completely absent in the brain stem and cerebellum. The highest density of A beta was in the dentate gyrus of the hippocampus. Cortical areas exhibiting the greatest A beta deposition were the posterior and medial suprasylvius gyrus and the proreus gyrus of the frontal lobe. Unlike humans the canine entorhinal cortex, amygdala, basal ganglia and olfactory bulbs were rarely affected. This suggested that the highly developed olfactory pathways of the canine are generally spared from A beta deposition. PMID:9141082

  5. Severe canine distemper outbreak in unvaccinated dogs in Mozambique. (United States)

    Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G


    Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. PMID:27543040

  6. Orthodontic-surgical treatment of bilateral maxillary canine impaction

    Directory of Open Access Journals (Sweden)



    Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.

  7. Complex odontoma associated to a primary maxillary canine: case report

    Directory of Open Access Journals (Sweden)

    Estela Maris LOSSO


    Full Text Available Introduction: Odontomas are malformations of the dental tissues and may interfere with the eruption of the associated tooth. The early diagnosis, followed by a proper treatment at the right time, will result in a favorable prognosis and a desirable occlusion development. Complex odontomas associated to primary teeth are rare. Case report and conclusion: This article describes a case of a complex odontoma in a four-year-old girl that prevented eruption of the left primary canine. The treatment choice was enucleation of the odontoma and the maintenance of the left primary canine.In this case, complete removal of the complex odontoma was successfully conducted, since after one year of follow-up the primary maxillary canine restarted its eruption process.

  8. Characterization of canine platelet adhesion to extracellular matrix proteins. (United States)

    Pelagalli, Alessandra; Pero, Maria Elena; Mastellone, Vincenzo; Cestaro, Anna; Signoriello, Simona; Lombardi, Pietro; Avallone, Luigi


    Canine platelets have been extensively studied but little is known about specific aspects such as adhesion. Platelet adhesion is a critical step during haemostasis and thrombosis as well as during inflammatory and immunopathogenic responses. The aim of this study was to evaluate the adhesive properties of canine platelets using fibrinogen and collagen as substrates immobilized on plates. Adhesion was monitored for 120 min and the effect of adenosine 5'-diphosphate (ADP) was assayed. The results showed that canine platelets displayed good adhesion activity that was significantly time-dependent. Moreover, ADP was able to enhance platelet adhesion in a dose-dependent manner. The findings aid knowledge of the adhesion process and suggest a specific role of surface platelet receptors in mediating the interaction with extracellular matrix proteins.

  9. Management of impacted all canines with surgical exposure and alignment by orthodontic treatment

    Directory of Open Access Journals (Sweden)

    Radha Katiyar


    Full Text Available Canine impaction is a dental problem very often encountered in orthodontic practice. After the third molar, the canine is the most frequently impacted tooth. Bringing the impacted canine into a normal position is important for functional occlusion and the final esthetics of the orthodontic treatment. This article illustrates a peculiar case, in which all four permanent canines maintained their unerupted status at age of 16 years. All four impacted canines were surgically exposed, attachment bonded, traction given with K-9 spring and ideally positioned with fixed orthodontic mechanotherapy.

  10. FDG PET/CT imaging in canine cancer patients

    DEFF Research Database (Denmark)

    Hansen, Anders Elias; McEvoy, Fintan; Engelholm, Svend Aage;


    and organs in canine cancer patients. FDG PET/CT was performed in 14 dogs including, nine mesenchymal tumors, four carcinomas, and one incompletely excised mast cell tumor. A generally higher FDG uptake was observed in carcinomas relative to sarcomas. Maximum SUV of carcinomas ranged from 7.6 to 27.......0, and for sarcomas from 2.0 to 10.6. The FDG SUV of several organs and tissues, including regional brain uptake is reported, to serve as a reference for future FDG PET studies in canine cancer patients. Several potential pitfalls have been recognized in interpretation of FDG PET images of human patients, a number...

  11. Canine distemper spillover in domestic dogs from urban wildlife. (United States)

    Kapil, Sanjay; Yeary, Teresa J


    Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing. PMID:22041204

  12. Survey of Canine Dirofilaria immitis Infection in New Caledonia


    Watier-Grillot, S.; J.-L. Marié; Cabre, O.; Davoust, B


    Canine dirofilariosis is a frequent parasitic disease in New-Caledonia. A survey of canine heartworm (Dirofilaria immitis) infection among dogs from the cities of Tontouta, Nandaï and Nouméa, was performed in March 2009 using two antigen test kits; the microwell ELISA test: DiroCHE (Synbiotics Europe) and the Rapid Immuno Migration ( R I M ) test: WITNESS DIROFILARIA (Synbiotics Europe). Blood samples were collected from 64 dogs: 49 strays and 15 military working dogs. The military dogs recei...

  13. Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report

    Directory of Open Access Journals (Sweden)

    Pavlović Jasna


    Full Text Available Introduction. Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Case report. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Conclusion. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.

  14. Identification of quantitative trait loci (QTL for canine hip dysplasia and canine elbow dysplasia in Bernese mountain dogs.

    Directory of Open Access Journals (Sweden)

    Sophia Pfahler

    Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.

  15. Brazilian canine hepatozoonosis Hepatozoonose canina brasileira

    Directory of Open Access Journals (Sweden)

    Lucia Helena O'Dwyer


    Full Text Available The genus Hepatozoon includes hundreds of species that infect birds, reptiles, amphibians and mammals, in all continents with tropical and subtropical climates. Two species have been described in domestic dogs: H. canis, reported in Europe, Asia, Africa, South America and the United States; and H. americanum, which so far has only been diagnosed in the United States. In Brazil, the only species found infecting dogs is H. canis. The objective of this review was to detail some aspects of canine hepatozoonosis, caused by H. canis, and the main points of its biology, transmission, pathogenicity, symptoms, epidemiology and diagnostic methods, with emphasis on research developed in Brazil.O gênero Hepatozoon compreende centenas de espécies que infectam aves, répteis, anfíbios e mamíferos, em todos os continentes de clima tropical e subtropical. No cão doméstico duas espécies são descritas, H. canis e H. americanum; a primeira presente na Europa, Ásia, África, América do Sul e nos Estados Unidos da América do Norte (EUA, e a segunda, diagnosticada até o momento somente nos EUA. No Brasil, a espécie que infecta o cão foi caracterizada como H. canis. Esta revisão objetiva detalhar alguns aspectos da hepatozoose canina, causada pelo H. canis e principais pontos de biologia, transmissão, patogenia e sintomas, epidemiologia e métodos de diagnóstico, enfatizando as pesquisas desenvolvidas no Brasil.

  16. Radiographic imaging of the canine intercondylar fossa

    International Nuclear Information System (INIS)

    The intercondylar fossa is believed to play an important role in the pathology of cranial cruciate ligament rupture and therefore has received considerable attention in the last decade. Accurate radiographic imaging of the intercondylar fossa requires that the central x-ray beam pass through the center of the intercondylar “tunnel”. The anatomy of the canine intercondylar fossa is similar to humans, however, the orientations of the intercondylar fossa's differ. Consequently, the positioning techniques described for humans are not appropriate for the dog. To pass through the center of the dog, intercondylar fossa, the central x-ray beam should be 12° (S.D. 1.7°) caudal from the femoral diaphysis in the sagittal plane and obliqued caudolateral to craniomedial 7° (S.D. 0.60°) (caudo78°proximo7° lateralcraniodistomedial oblique). Cross table positioning was used with the hip flexed and the radiograph cassette placed on the cranial surface of the stifle. However, superimposition of the tuber ischii and soft tissues caudal to the femur made 15° to 20° the best angle obtainable. There was not a significant difference (p = 0.17) in the notch width index between a 12° versus 20° angle of the central x-ray beam caudal to the femoral diaphysis, both with 7° of external rotation of the stifle. The notch width index of 0.252 obtained from radiographic measurements was not significantly different from measurements obtained grossly of 0.254 (n = 26; p = 0.69). Failure to oblique the central x-ray beam caused a significant (p = 0.0008) decrease in the apparent fossa width radiographically

  17. Myogenic potential of canine craniofacial satellite cells

    Directory of Open Access Journals (Sweden)

    Rita Maria Laura La Rovere


    Full Text Available The skeletal fibres have different embryological origin; the extraocular and jaw-closer muscles develop from prechordal mesoderm while the limb and trunk muscles from somites. These different origins characterise also the adult muscle stem cells, known as satellite cells (SCs and responsible for the fibre growth and regeneration. The physiological properties of presomitic SCs and their epigenetics are poorly studied despite their peculiar characteristics to preserve muscle integrity during chronic muscle degeneration. Here we isolated SCs from canine somitic (SDM: vastus lateralis, rectus abdominus, gluteus superficialis, biceps femoris, psoas and presomitic (PSDM: lateral rectus, temporalis and retractor bulbi muscles as myogenic progenitor cells from young and old animals. In addition, SDM and PSDM satellite cells were obtained also from Golden retrievers affected by muscular dystrophy (GRMD. We characterised the lifespan, the myogenic potential and functions and oxidative stress of both somitic and presomitic SCs with the aim to reveal differences with ageing and between healthy and dystrophic animals. The different proliferation rate was consistent with higher telomerase activity in PSDM-SCs compared to SDM-SCs, although restricted at early passages. SDM-SCs express early (Pax7, MyoD and late (MyHC, Myogenin myogenic markers differently from PSDM-SCs resulting in a more efficient and faster cell differentiation. Taken together our results showed that PSDM-SCs elicit a stronger stem cell phenotype compared to SDM ones. Finally, myomiR expression profile reveals a unique epigenetic signature in GRMD satellite cells and miR-206, highly expressed in dystrophic SCs, seems to play a critical role in muscle degeneration. Thus, miR-206 could represent a potential target for novel therapeutic approaches.

  18. Compensatory canine angulation in angle Class II and III patients

    Directory of Open Access Journals (Sweden)

    Mauro Carlos Agner Busato


    Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.

  19. 9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine). (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... established as follows: (1) Twenty-five parvovirus susceptible dogs (20 vaccinates and 5 controls) shall...

  20. In vitro activity of difloxacin against canine bacterial isolates

    NARCIS (Netherlands)

    Hoven, van den J.R.; Wagenaar, J.A.; Walker, R.D.


    The in vitro activity of difloxacin against canine bacterial isolates from clinical cases was studied in the United States and The Netherlands. Minimal inhibitory concentrations (MIC), the postantibiotic effect, the effect of pH on antimicrobial activity, and the bacterial killing rate tests were de

  1. Biofilm production by clinical staphylococci strains from canine otitis. (United States)

    Moreira, Camila Alencar; de Oliveira, Lis Christina; Mendes, Marina Silveira; Santiago, Thiago de Melo; Barros, Eduardo Bedê; de Carvalho, Cibele Barreto Mano


    This study determined the species of 54 staphylococci isolates from canine otitis and their ability to produce biofilm through the Congo red agar method, confirmed by scanning electron microscopy. The most frequently identified species were S. intermedius and S. simulans. Results showed that 30% of the strains were biofilm producers.

  2. Biofilm production by clinical staphylococci strains from canine otitis


    Moreira, Camila Alencar; de Oliveira, Lis Christina; Mendes, Marina Silveira; Santiago, Thiago de Melo; Barros, Eduardo Bedê; CARVALHO Cibele Barreto Mano de


    This study determined the species of 54 staphylococci isolates from canine otitis and their ability to produce biofilm through the Congo red agar method, confirmed by scanning electron microscopy. The most frequently identified species were S. intermedius and S. simulans. Results showed that 30% of the strains were biofilm producers.

  3. Biofilm production by clinical Staphylococci strains from canine otitis

    Directory of Open Access Journals (Sweden)

    Camila Alencar Moreira


    Full Text Available This study determined the species of 54 staphylococci isolates from canine otitis and their ability to produce biofilm through the Congo red agar method, confirmed by scanning electron microscopy. The most frequently identified species were S. intermedius and S. simulans. Results showed that 30% of the strains were biofilm producers.

  4. Biofilm production by clinical Staphylococci strains from canine otitis


    Camila Alencar Moreira; Lis Christina de Oliveira; Marina Silveira Mendes; Thiago de Melo Santiago; Eduardo Bedê Barros; Cibele Barreto Mano de Carvalho


    This study determined the species of 54 staphylococci isolates from canine otitis and their ability to produce biofilm through the Congo red agar method, confirmed by scanning electron microscopy. The most frequently identified species were S. intermedius and S. simulans. Results showed that 30% of the strains were biofilm producers.

  5. Canine distemper virus - a morbillivirus in search of new hosts?


    Harder, Timm; Osterhaus, Albert


    textabstractCanine distemper morbillivirus (CDV) induces a multisystemic, often fatal disease in a wide and seemingly expanding host range among the Carnivora. Several genotypes of an otherwise monotypic virus species co-circulate in a geographically restricted pattern. Interspecies transmissions frequently occur, often leading to devastating epizootics in highly susceptible or immunologically naive populations.

  6. Pneumocystosis associated with canine distemper virus infection in a mink.


    Dyer, N W; Schamber, G J


    An adult mink from a farm experiencing 100% mortality in affected animals was submitted for diagnostic examination. Clinical history included signs of respiratory disease, oculonasal discharge, and thickening of footpads. Canine distemper virus and Pneumocystis carinii were identified in lung tissue, suggesting immunosuppresion and secondary infection due to morbillivirus disease.

  7. Canine versus human epilepsy: are we up to date? (United States)

    Uriarte, A; Maestro Saiz, I


    In this paper we analyse and compare features of canine and human epilepsy and we suggest new tools for better future understanding of canine epilepsy. The prevalence of epileptic seizures in dogs ranges between 0.5% and 5.7% and between 1% and 3% in the human population. Studies on human epilepsy provide a ready-made format for classification, diagnosis and treatment in veterinary epilepsy. Human studies highlight the value of a thorough seizure classification. Nevertheless, a matter of concern in canine epilepsy is the limited information regarding seizure description and classification because of the lack of EEG-video recording. Establishment of a consensus protocol for ambulatory home video-recording in dogs who suffer from epilepsy, mainly considering indications, duration of monitoring, the sufficient essential training for an optimal interpretation of ictal semiology and the methodology of recordings is needed. The ultimate goal is that the information gathered by these videos will be analysed to describe the epileptic seizures thoroughly, recognize patterns and move towards a better understanding and therefore classification of canine epileptic seizures.

  8. Morphological study of maxillary canine region based on CT

    International Nuclear Information System (INIS)

    The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)

  9. Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia

    Directory of Open Access Journals (Sweden)

    Víctor Acero P


    Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.

  10. Canine distemper virus - a morbillivirus in search of new hosts?

    NARCIS (Netherlands)

    T.C. Harder (Timm); A.D.M.E. Osterhaus (Albert)


    textabstractCanine distemper morbillivirus (CDV) induces a multisystemic, often fatal disease in a wide and seemingly expanding host range among the Carnivora. Several genotypes of an otherwise monotypic virus species co-circulate in a geographically restricted pattern. Interspecies transmissions fr

  11. Canine distemper virus in Lake Baikal seals (Phoca sibirica).

    NARCIS (Netherlands)

    L.V. Mamaev; I.K.G. Visser (Ilona); S.I. Belikov; N.N. Denikina; T.C. Harder (Timm); L. Goatley; B. Rima; B. Edginton; A.D.M.E. Osterhaus (Albert); T. Barrett (Thomas)


    textabstractThe virus epizootic which resulted in significant mortality in Siberian seals (Phoca sibirica) in Lake Baikal during 1987/88 was caused by canine distemper virus. Sequence analysis of the virus glycoprotein genes revealed that it was most closely related to recent European field isolates

  12. Soft tissue artifact in canine kinematic gait analysis

    NARCIS (Netherlands)

    Schwencke, M.; Smolders, L.A.; Bergknut, N.; Gustas, P.; Meij, B.P.; Hazewinkel, H.A.W.


    Vet Surg. 2012 Oct;41(7):829-37. doi: 10.1111/j.1532-950X.2012.01021.x. Soft tissue artifact in canine kinematic gait analysis. Schwencke M, Smolders LA, Bergknut N, Gustås P, Meij BP, Hazewinkel HA. Source Department of Clinical Sciences of Companion Animals,, Faculty of Veterinary Medicine, Utrech

  13. Morphometric analysis of canine in gender determination: Revisited in India

    Directory of Open Access Journals (Sweden)

    Geetha Paramkusam


    Interpretation and Conclusion: Use of the standard mandibular CI in gender determination is recommended for forensic procedures as it was found to have an acceptable accuracy. MD width of canine may be used in a setup when only the single tooth or a fragment of a jaw is available for analysis, with due consideration to its relatively low accuracy.

  14. Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman


    Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.

  15. Canine hypertrophic osteopathy associated with extra-thoracic lesions


    Headley Selwyn Arlington; Ribeiro Eduardo Alcântara; Santos Gustavo José Von G. dos; Bettini Carlos Maia; Mattos Júnior Ewaldo


    Canine hypertrophic osteopathy is described in a dog that presented extra-thoracic lesions, mainly in the liver. Hepatic lesions were characterized by necrosis, hemorrhage, severe hydropic degeneration of centrolobular hepatocytes, proliferation of epithelial cells of bile ducts, and mild biliary stasis. The disease syndrome was diagnosed based on clinical signs, radiological evaluation, and inspection of macerated bones.

  16. The Human-Canine Bond: Closer than Family Ties? (United States)

    Barker, Sandra B.; Barker, Randolph T.


    Used Family Life Space Diagram to compare relationship between human family members with the human-canine relationship. Subjects were 29 dog enthusiasts, 66 typical pet owners, and 27 elementary school students with dogs. Results suggest that individuals may perceive their relationship with their pet dog as being as close as their relationship…

  17. Prognosis in canine idiopathic immune-mediated haemolytic anaemia

    NARCIS (Netherlands)

    Piek, C.J.


    Canine idiopathic immune-mediated haemolytic anaemia (iIMHA) is one of the most frequently occurring immune-mediated diseases in dogs. A gel-based Coombs' test was shown to perform equally well as a classical Coombs' test. Since the gel-based Coombs' test can be commercially produced and is easy and

  18. Clinical history and hematological findings among canines with monocytic ehrlichiosis. (United States)

    Moonarmart, Walasinee; Sungpradit, Sivapong; Rawangchue, Thanakorn; Suphaphiphat, Karuna; Suksusieng, Sineenart; Jirapattharasate, Charoonluk


    Canine monocytic ehrlichiosis is a tick borne disease caused by Ehrlichia canis, an obligate intracellular rickettsial organism belonging to the family Anaplasmataceae. Canine ehrlichiosis causes hemaotological changes among infected animals which could be used as a potential predictor for diagnosing canine monocytic ehrlichiosis (CME). Ninety-four blood samples were obtained from canines that either presented for a routine health check-up or for clinical illness. A history, physical and laboratory test were conducted on each animal. All samples were examined for E. canis using a 16S rDNA polymerase chain reaction (PCR) amplification to confirm CME infection. Thirty-six of the samples were positive for E. canis using PCR and the rest were negative. The Mann-Whitney and chi-square test were used to compare the differences between the PCR-positive and negative animals. PCR-positive animals had a higher mean body temperature than PCR-negative animals. The following were significantly lower in PCR-positive animals: white blood cell count, eosinophil count, red blood cell count, hemoglobin, hematocrit, platelet count, and the random distribution of width (RDW) of the red blood cells. We evaluated complete blood cell count findings to determine factors associated with CME using multivariable logistic regression analysis and found thrombocytopenia was significantly associated with CME (OR = 0.085; 95% CI: 0.78-0.92, p < 0.001). For every decrease in the platelet count of 10,000 there was a 15% increase in the likelihood of having CME.

  19. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    Directory of Open Access Journals (Sweden)

    Helen L. Del Puerto


    Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

  20. Current state of knowledge: the canine gastrointestinal microbiome. (United States)

    Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S


    Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome. PMID:22647637

  1. Establishment of Canine-Derived Giardia duodenalis Isolates in Culture. (United States)

    Tysnes, Kristoffer R; Robertson, Lucy J


    Researchers continue to rely on axenic cultivation of Giardia duodenalis trophozoites in vitro to study the life cycle and host-parasite interactions of G. duodenalis and to develop vaccines and drugs to prevent and treat giardiasis. The majority of in vitro studies of G. duodenalis have used a small subset of isolates, mostly of assemblage A, and these isolates are usually originally isolated from humans. The most commonly used isolate for lab studies is known as WB. Canine giardiasis is a disease of veterinary importance, but it may also be of relevance in zoonotic transmission. Few G. duodenalis isolates from dogs have been adapted to in vitro culture, probably because the methods used are not suitable for the canine-specific genotypes that tend to dominate in most dog populations. In the current study, an experimental approach to cultivating canine-derived isolates of G. duodenalis was attempted by modification of the standard protocol based on physiological differences between the human and canine digestive system. An adapted method is described for improving the rate of in vitro excystation of cysts isolated from dogs by chemically weakening the cyst wall. A new canine-derived assemblage A G. duodenalis isolate was successfully adapted to axenic culture by using this method; the dog apparently had a mixed infection of assemblages A and D, but the assemblage A successfully outcompeted the assemblage D under conditions of in vitro culture. Based on the results, reasons regarding why humans do not seem to be suitable hosts for G. duodenalis in assemblages C and D are discussed. PMID:26835750

  2. Current state of knowledge: the canine gastrointestinal microbiome. (United States)

    Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S


    Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.

  3. Cardiac troponin I levels in canine pyometra

    Directory of Open Access Journals (Sweden)

    Hagman Ragnvi


    Full Text Available Abstract Background Myocardial injury may contribute to unexpected deaths due to pyometra. To detect myocardial damage, measurement of cardiac troponin I (cTnI is currently the most sensitive and specific method. The aims of the present study were to evaluate presence of myocardial damage in canine pyometra by analysis of cTnI, to explore whether myocardial injury was associated with systemic inflammatory response syndrome (SIRS and to evaluate whether other clinical or laboratory parameters were associated with cTnI increase. Methods Preoperative plasma levels of cTnI were investigated in 58 female dogs with pyometra and 9 controls. The value of physical examination findings, haematological, serum biochemical and pro-inflammatory (CRP and TNF-α parameters as possible predictors of increased cTnI levels was also evaluated. Results Seven dogs with pyometra (12% and one control dog (11% had increased levels of cTnI. In the pyometra group, the levels ranged between 0.3–0.9 μg l-1 and in the control dog the level was 0.3 μg l-1. The cTnI levels did not differ significantly between the two groups. No cardiac abnormalities were evident on preoperative physical examinations. Four of the pyometra patients died within two weeks of surgery, of which two were examined post mortem. In one of these cases (later diagnosed with myocarditis and disseminated bacterial infection the cTnI levels increased from 0.9 μg l-1 preoperatively to 180 μg l-1 the following day when also heart arrhythmia was also detected. The other patient had cTnI levels of 0.7 μg l-1 with no detectable heart pathology post mortem. CTnI increase was not associated with presence of SIRS. There was a trend for the association of cTnI increase with increased mortality. No preoperative physical examination findings and few but unspecific laboratory parameters were associated with increased cTnI levels. Conclusion Increased cTnI levels were observed in 12% of the dogs with pyometra. The

  4. Release of canine parvovirus from endocytic vesicles. (United States)

    Suikkanen, Sanna; Antila, Mia; Jaatinen, Anne; Vihinen-Ranta, Maija; Vuento, Matti


    Canine parvovirus (CPV) is a small nonenveloped virus with a single-stranded DNA genome. CPV enters cells by clathrin-mediated endocytosis and requires an acidic endosomal step for productive infection. Virion contains a potential nuclear localization signal as well as a phospholipase A(2) like domain in N-terminus of VP1. In this study we characterized the role of PLA(2) activity on CPV entry process. PLA(2) activity of CPV capsids was triggered in vitro by heat or acidic pH. PLA(2) inhibitors inhibited the viral proliferation suggesting that PLA(2) activity is needed for productive infection. The N-terminus of VP1 was exposed during the entry, suggesting that PLA(2) activity might have a role during endocytic entry. The presence of drugs modifying endocytosis (amiloride, bafilomycin A(1), brefeldin A, and monensin) caused viral proteins to remain in endosomal/lysosomal vesicles, even though the drugs were not able to inhibit the exposure of VP1 N-terminal end. These results indicate that the exposure of N-terminus of VP1 alone is not sufficient to allow CPV to proliferate. Some other pH-dependent changes are needed for productive infection. In addition to blocking endocytic entry, amiloride was able to block some postendocytic steps. The ability of CPV to permeabilize endosomal membranes was demonstrated by feeding cells with differently sized rhodamine-conjugated dextrans together with the CPV in the presence or in the absence of amiloride, bafilomycin A(1), brefeldin A, or monensin. Dextran with a molecular weight of 3000 was released from vesicles after 8 h of infection, while dextran with a molecular weight of 10,000 was mainly retained in vesicles. The results suggest that CPV infection does not cause disruption of endosomal vesicles. However, the permeability of endosomal membranes apparently changes during CPV infection, probably due to the PLA(2) activity of the virus. These results suggest that parvoviral PLA(2) activity is essential for productive

  5. Cryopreservation of canine semen - new challenges. (United States)

    Farstad, W


    Egg yolk (EY) protects cell membranes against cold shock, and it prevents or restores the loss of phospholipids from the membrane. EY has been widely used in semen extenders. It has been added to Tris-Glucose buffer and has been widely used for cooling and cryopreservation of canine semen. EY is not a defined entity, but a complex biological compound containing proteins, vitamins, phospholipids, glucose and antioxidants which are all potentially useful for cell membrane integrity. Unfortunately, it also is a biologically hazardous compound. Hence, whole EY needs to be replaced by other chemically defined components for semen processing in dogs. Freezing poor semen does not improve its quality, so attention must be focused on how to cope with dogs whose semen does not freeze well, and on designing individual freezing extenders for semen from such males. Furthermore, differences have been found among canid species in the ability of their spermatozoa to withstand freezing. There are differences in sperm membrane fatty acid composition among species, which may explain part of these differences. If the presence of long-chained polyunsaturated fatty acids contributes to increased membrane fluidity, this relationship may be biphasic, i.e. either too much membrane fluidity, or too little, could compromise successful sperm cryopreservation. An increase in fluidity of the outer leaflet of the plasma membrane has been shown in frozen thawed dog spermatozoa. The protective effect of exogenous lipids may lie in close association with the membrane rather than in modification or rearrangement of the membrane. This also points at lipids as an important, if not entirely new group of substances, which may substitute standard EY-based diluents in preserving sperm survival during freezing. EY-derived phospholipids or lecithin could be used to replace whole EY. Vegetable lecithin is currently investigated to avoid using substances of animal origin. EY also contains antioxidants which

  6. Survey of canine babesiosis in South Africa

    Directory of Open Access Journals (Sweden)

    M.G. Collett


    Full Text Available A questionnaire, designed to obtain qualitative information on a number of variables concerning canine babesiosis (biliary fever in South Africa, was sent to 510 veterinary practices in late 1993. Of the 157 practices that responded, all were presented with cases of babesiosis and most were situated in Gauteng, the Western Cape and KwaZulu-Natal. Apart from the Western Cape, a winter-rainfall region, the prevalence of babesiosis cases in dogs was highest in summer. Most of the respondent practices treated between 1000 and 5000 sick dogs that included 100 to 500 babesiosis cases each year. Respondents identified cerebral babesiosis, enterorrhagia, 'red' or haemoconcentrated babesiosis, acute renal failure and pulmonary babesiosis or 'shock lung', amongst others, as the most prevalent forms of complicated ('atypical' babesiosis. Diminazene, imidocarb and trypan blue were the most popular antibabesials. Trypan blue was most often used in shocked patients, whereas diminazene and imidocarb were preferred when there was a high parasitaemia in the absence of shock. At least 19 antibabesial treatment regimens were used in practices. These comprised the use of single doses of antibabesial drugs; split doses with repeat injections, and combined drug variations, some of which are undesirable due to possible sterilisation of Babesia infection or potential toxicity. Side-effects were most commonly associated with imidocarb use. Ninety-six percent of respondents used supportive treatment (e.g. corticosteroids, vitamins and 'liver support' in all cases of babesiosis. The use of blood transfusion as supportive treatment varied according to practice and severity of the case. Most practices never cross-matched blood to be transfused, and transfusion reactions were rare. Diminazene was most frequently incriminated in cases where drug 'resistance' or relapses occurred. Cerebral and 'red' cases resulted in high mortality. Treatment of babesiosis costs the dog

  7. Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma. (United States)

    Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid


    Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma. PMID:26733734

  8. Canine hypothyroidism. A diagnostic challenge?; Die canine Hypothyreose. Eine diagnostische Herausforderung?

    Energy Technology Data Exchange (ETDEWEB)

    Boretti, Felicitos; Reusch, C.E. [Klinik fuer Kleintiermedizin, Vetsuisse Fakultaet Zuerich, Univ. Zuerich (Switzerland)


    Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen {sup registered}) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high

  9. Canine Bone Marrow Stromal Cells Promote Functional Recovery in Mice with Spinal Cord Injury


    Oda, Yasutaka; Tani, Kenji; ASARI, Yusuke; Quintanilha, Luiz Fernando; HARAGUCHI, Tomoya; MOMOTA, Yutaka; Katayama, Masaaki; Itamoto, Kazuhito; Nakazawa, Hiroshi; TAURA, Yasuho


    ABSTRACT Regenerative therapy has begun to be clinically applied in humans and dogs to treat neurological disorders, such as spinal cord injury (SCI). Here, we show the therapeutic potential of transplantation of cultured canine bone marrow stromal cells (BMSCs) into mice with SCI. Canine BMSC transplantation therapy was performed, immediately after the spinal cord was injured. Canine BMSC therapy enhanced functional recovery of the hind limbs in mice with SCI. Nestin-positive cells were obse...

  10. Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma


    Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid


    Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...

  11. Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus

    Directory of Open Access Journals (Sweden)

    Lourdes M. B. Pessoa


    Full Text Available The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.

  12. Optimization of canine interleukin-12 production using a baculovirus insect cell expression system


    de Pinheiro, Cristiane Garboggini Melo; Pedrosa, Mayara de Oliveira; Teixeira, Naiara Carvalho; Ano Bom, Ana Paula Dinis; van Oers, Monique M.; Oliveira, Geraldo Gileno de Sá


    Background Interleukin-12 is an important cytokine in mediating cellular immune responses. Results Recombinant single-chain canine IL-12 was produced in a baculovirus-insect cell system with the aim of conducting further studies on modulation of immune responses in dogs. To optimize the production of recombinant canine IL-12, a classical baculovirus and a modified vector (chitinase A and v-cathepsin knockout) were used containing a native or an optimized insert of canine IL-12. The optimized ...

  13. Orthodontic treatment of the transposition of a maxillary canine and a first premolar: a case report


    Teresa, Dinoi Maria; Stefano, Mummolo; Annalisa, Monaco; Enrico, Marchetti; Vincenzo, Campanella; Giuseppe, Marzo


    Introduction Transposition is an anomaly of tooth position, the most frequent of which involves the canine and the first maxillary premolar. We describe the orthodontic treatment of a unilateral transposition of an upper canine and an upper right first premolar in the permanent dentition. Case presentation A 12-year-old Caucasian boy presented with transposition of his upper right canine and upper right first premolar. He had combined surgical-orthodontic treatment to correct the transpositio...

  14. Evidence-based control of canine rabies: a critical review of population density reduction


    Morters, M.K.; Restif, O.; Hampson, K.; Cleaveland, S.; Wood, J.L.N.; Conlan, A J K; Boots, M.


    Control measures for canine rabies include vaccination and reducing population density through culling or sterilization. Despite the evidence that culling fails to control canine rabies, efforts to reduce canine population density continue in many parts of the world. The rationale for reducing population density is that rabies transmission is density-dependent, with disease incidence increasing directly with host density. This may be based, in part, on an incomplete interpretation of historic...

  15. Comparative Analysis of Human and Canine Campylobacter upsaliensis Isolates by Amplified Fragment Length Polymorphism

    DEFF Research Database (Denmark)

    Damborg, Peter; Guardabassi, Luca; Pedersen, Karl;


    Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains......, indicating that dogs may not be the main source of human infection.......Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...

  16. Modularity of the anthropoid dentition: Implications for the evolution of the hominin canine honing complex. (United States)

    Delezene, Lucas K


    In most anthropoid primates, the maxillary canine, mandibular canine, and mesial mandibular premolar form a functional complex that hones the canines. Characters in functional complexes are predicted to covary genetically, which constrains their evolutionary independence. As a result of substantial changes to canine and honing premolar size and shape, hominins are characterized by the apomorphic loss of canine honing. In early hominins, changes in canine and 'honing' premolar size and shape appear to have been uncoordinated, which is unexpected if there is strong genetic covariation coupling these teeth. Using the pattern and magnitude of phenotypic dental size covariation in extant anthropoids, results of this study indicate that certain dimensions of the anthropoid honing complex are characterized by strong size covariation within species and that canine and honing premolar size have evolved in a coordinated manner in both males and females, which undermines arguments that the complex is selectively important only in males. Further, there is no evidence for negative or strong positive covariance between canine and either incisor or postcanine size. If patterns of phenotypic covariation reflect genetic covariation, this suggests that canine reduction was unlikely to have been a dependent change associated with the development of postcanine megadontia or incisor reduction.

  17. Dental anomalies in first-degree relatives of transposed canine probands

    Institute of Scientific and Technical Information of China (English)

    Adriana Bartolo; Neville Calleja; Fraser McDonald; Simon Camilleri


    The aim of this study was to investigate and compare the inheritance pattern and prevalence of inheritable dental anomalies in a sample of patients with maxillary canine—first premolar transposition and their first-degree relatives with a sample of palatally displaced canine families. Thirty-five consecutive maxillary canine—first premolar transposition probands and 111 first-degree relatives were matched to 35 consecutive palatally displaced canine probands and 115 first-degree relatives. These were assessed for palatally displaced canines and incisor-premolar hypodontia. Parental age at birth of the proband was also noted. The results revealed that (i) there is no difference in the overall prevalence of palatally displaced canine or incisor-premolar hypodontia between the groups of relatives; (ii) first-degree relatives of bilateral palatally displaced canine probands have a higher prevalence of palatally displaced canine and incisor-premolar hypodontia than those with unilateral palatally displaced canine; and (iii) maternal age at birth of the maxillary canine—first premolar transposition probands was significantly higher than that of the palatally displaced canine probands. The results suggest that maxillary canine—first premolar transposition and palatally displaced canine are unlikely to be different genetic entities and also indicate environmental or epigenetic influences on dental development.

  18. Canine length in wild male baboons: maturation, aging and social dominance rank. (United States)

    Galbany, Jordi; Tung, Jenny; Altmann, Jeanne; Alberts, Susan C


    Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years) from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge) with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank), but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.

  19. Canine length in wild male baboons: maturation, aging and social dominance rank.

    Directory of Open Access Journals (Sweden)

    Jordi Galbany

    Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.

  20. Exposure of pampas fox (Pseudalopex gymnocercus) and crab-eating fox (Cerdocyon thous) from the Southern region of Brazil to Canine distemper virus (CDV), Canine parvovirus (CPV) and Canine coronavirus (CCoV)


    Silvia de Oliveira Hübner; Felipe Geraldes Pappen; Jerônimo Lopes Ruas; Gilberto D'Ávila Vargas; Geferson Fischer; Telmo Vidor


    The exposure of 13 Brazilian free-ranging nondomestic canids (five pampas fox - Pseudalopex gymnocercus and eight crab-eating fox -Cerdocyon thous) from Southern region of Brazil, to Canine distemper virus (CDV), canine parvovirus (CPV) and Canine coronavirus (CCoV) was investigated. Antibodies against CDV were detected in 38.5% (5/13) of the samples. There were anti-CDV antibodies in 60% (3/5) of P. gymnocercus and in 25% (2/8) of C. thous. The frequency was higher among the adults and males...

  1. Canine tooth wear in captive little brown bats (United States)

    Clark, D.R.


    Upper canine teeth of little brown bats Myotis lucifugus lucifugus held in stainless steel wire mesh cages underwent severe wear which exceeded that observed previously in caged big brown bats, Eptesicus fuscus fuscus. This suggests a relationship between amount of wear and size of the caged bats with damage increasing as size decreases. Rapid wear of canine teeth by little brown bats resembled that observed in big brown bats in that it was limited to the first 2 weeks of captivity. This result indicates a universal interval for acclimation to cage conditions among vespertilionid bats. Dietary toxicants DDE and PCB did not affect the extent of wear. If bats are to be released to the wild, confinement in wire mesh cages should be avoided.

  2. Computed Tomography Imaging of the Topographical Anatomy of Canine Prostate

    International Nuclear Information System (INIS)

    AIM: To investigate the topographical anatomy of canine prostate gland by computed tomography (CT) for diagnostic imaging purposes. ÐœATERIAL AND METHODS: Seven clinically healthy mongrel male dogs at the age of 3−4 years and body weight of 10−15 kg were submitted to transverse computerized axial tomography (CAT) with cross section thickness of 5 mm. RESULTS: The CT image of canine prostate is visualized throughout the scans of the pelvis in the planes through the first sacral vertebra (S1) dorsally; the bodies of iliac bones laterally and cranially to the pelvic brim (ventrally). The body of prostate appears as an oval homogenous relatively hypo dense finding with soft tissue density. The gland is well differentiated from the adjacent soft tissues. CONCLUSION: By means of CT, the cranial part of prostate gland in adult dogs aged 3−4 years exhibited an abdominal localization. (author)

  3. Canine trypanosomiasis: etiology of infection and implications for public health

    Directory of Open Access Journals (Sweden)

    LJ Eloy


    Full Text Available Canine trypanosomiasis, caused by protozoans of the genus Trypanosoma, is divided into two primary types: the American form (Chagas disease, due to Trypanosoma cruzi infection, and the African form (sleeping sickness or surra, provoked by Trypanosomaevansi. This disease was originally enzootic and affected only wild animals, including mammals and birds, which served as reservoirs. Later, it spread to domestic animals such as horses, cattle and dogs. The disease became a zoonosis when contact between rural inhabitants and natural Trypanosoma foci occurred, due to ecological imbalances and increasing migration. Dogs are significantly involved in this context, because they are the main domestic animals and participate in the transmission and maintenance cycles of these parasites. This article reports etiological, epidemiological and public health aspects of canine trypanosomiasis, and the most important peculiarities of this zoonosis in dogs.

  4. Effects of various drugs on canine tracheal mucociliary transport

    International Nuclear Information System (INIS)

    A study of the effects of dehydration, atropine, terbutaline and N-acetylcysteine on canine tracheobronchial mucus is presented. Mucociliary clearance rates, mucus secretion volumes and mucus rheologic properties were studied. Clearance rates were studied by a radioisotope technique mucus collected by a canine Tracheal pouch method and rheologic studies performed on a microrheometer. Clearance rate was unaffected by dehydration and terbutaline, increased by N-acetylcysteine and decreased by atropine. Secretion volume was increased by terbutaline while dehydration and atropine were without effect. Rheologic factors were increased by dehydration and atropine while terbutaline was without an effect. The effects of N-acetylcysteine on secretion volume and rheologic properties could not be studied because of the nature of the techniques employed

  5. Survivin and related proteins in canine mammary tumors: immunohistochemical expression. (United States)

    Bongiovanni, L; Romanucci, M; Malatesta, D; D'Andrea, A; Ciccarelli, A; Della Salda, L


    Survivin is reexpressed in most human breast cancers, where its expression has been associated with tumor aggressiveness, poor prognosis, and poor response to therapy. Survivin expression was evaluated in 41 malignant canine mammary tumors (CMTs) by immunohistochemistry, in relation to histological grade and stage, and correlated with that of some related molecules (β-catenin, caspase 3, heat shock proteins) to understand their possible role in canine mammary tumorigenesis. An increase in nuclear survivin expression, compared with healthy mammary glands, was observed in CMTs, where nuclear immunolabeling was related to the presence of necrosis. No statistically significant relation was found between the expression of the investigated molecules and the histological grade or stage. The present study may suggest an important involvement of survivin in CMT tumorigenesis. Its overexpression in most of the cases evaluated might suggest that targeting survivin in CMTs may be a valid anticancer therapy. PMID:24686389

  6. An Update on Therapeutic Management of Canine Demodicosis

    Directory of Open Access Journals (Sweden)

    S. K. Singh


    Full Text Available Canine demodicosis is a common noncontagious parasitic dermatosis caused by different spp of Demodex mites including Demodex canis, Demodex injai and D. cornei. Generalized demodicosis can be one of the most frustrating skin diseases, one will ever treat. Conventional and newer miticidal therapies are available to veterinarian to treat this frustrating skin disease. All recognized Demodex mites in dogs appear to respond similarly to mite targeted therapy. Treatment for canine demodicosis includes amitraz, ivermectin, milbemicin oxime, moxidectin, and doramectin. The use of any glucocorticoid-containing products is contraindicated and could favour disease generalization. Conventional treatments will often appear to work however, but it relies heavily on a highly toxic method of treatment. Using natural remedies for mange, on the other hand, can enhance the dog’s immune system, so that the body can fight off the mange mite infection by itself. [Veterinary World 2011; 4(1.000: 41-44

  7. Serotonin transporter and dopamine transporter imaging in the canine brain

    Energy Technology Data Exchange (ETDEWEB)

    Peremans, Kathelijne [Department of Medical Imaging, Faculty of Veterinary Sciences, Ghent University, B-9000 Ghent (Belgium); Goethals, Ingeborg [Division of Nuclear Medicine, University Hospital Ghent, B-9000 Ghent (Belgium); De Vos, Filip [Laboratory of Radiopharmacy, Pharmaceutical Sciences, Ghent University, B-9000 Ghent (Belgium); Dobbeleir, A. [Department of Medical Imaging, Faculty of Veterinary Sciences, Ghent University, B-9000 Ghent (Belgium); Ham, Hamphrey [Division of Nuclear Medicine, University Hospital Ghent, B-9000 Ghent (Belgium); Van Bree, Henri [Department of Medical Imaging, Faculty of Veterinary Sciences, Ghent University, B-9000 Ghent (Belgium); Heeringen, Cees van [Department of Psychiatry and Medical Psychology, Faculty of Medical and Health Sciences, Ghent University, B-9000, Ghent (Belgium); Audenaert, Kurt [Division of Nuclear Medicine, University Hospital Ghent, B-9000 Ghent (Belgium) and Department of Psychiatry and Medical Psychology, Faculty of Medical and Health Sciences, Ghent University, B-9000, Ghent (Belgium)]. E-mail:


    The serotonergic and dopaminergic systems are involved in a wide range of emotional and behavioral aspects of animals and humans and are involved in many neuropsychiatric disorders. Selective serotonin (5-HT) reuptake inhibitors (SSRIs) are designed to block the 5-HT transporter (SERT), thereby increasing the available 5-HT in the brain. Functional imaging with specific SERT and dopamine transporter (DAT) ligands contributes to the study of the SSRI-transporter interaction. First, we evaluated the feasibility of a canine model in the study of the SERT and DAT with the radioligands [{sup 123}I]-{beta}-CIT and [{sup 123}I]-FP-CIT as well as single-photon emission computed tomography imaging. Second, we studied the effect of SSRIs (sertraline, citalopram and escitalopram) on the SERT and DAT in two dogs. The position of the canine model in the study of the SERT and DAT is discussed and compared with other animal models.

  8. Measurement of plasma canine C peptide by radioimmunoassay

    International Nuclear Information System (INIS)

    A sensitive radioimmunoassay for canine C peptide (CCP) was established using synthetic CCP, a specific antiserum, and rabbit anti-guinea pig serum. Radioiodination was performed according to a modified chloramine T method. Tracer preparations have been used for 6 weeks after iodination. The standard curve ranges from 0.028 to 3.0 nmol/l. The intra-assay coefficient of variation (CV) was 3-5% and the inter-assay CV was 6-9% in the optimal range between 0.3 and 0.8 nmol/l. The average recovery of CCP added to plasma samples was 100.6% (n = 9). Canine insulin, porcine proinsulin, bovine proinsulin, and human C peptide exhibited no cross-reactivity. The mean fasting plasma CCP concentration was 0.089 +- 0.021 nmol/l in normal dogs and -0.005 +- 0.007 nmol/l (mean +- SEM) in diabetic dogs, respectively. (author)

  9. The unerupted maxillary canine - a post-surgical review.

    LENUS (Irish Health Repository)

    O'Dowling, Ian


    The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.

  10. Survey of Canine Dirofilaria immitis Infection in New Caledonia

    Directory of Open Access Journals (Sweden)

    S. Watier-Grillot


    Full Text Available Canine dirofilariosis is a frequent parasitic disease in New-Caledonia. A survey of canine heartworm (Dirofilaria immitis infection among dogs from the cities of Tontouta, Nandaï and Nouméa, was performed in March 2009 using two antigen test kits; the microwell ELISA test: DiroCHE (Synbiotics Europe and the Rapid Immuno Migration (RIM test: WITNESS DIROFILARIA (Synbiotics Europe. Blood samples were collected from 64 dogs: 49 strays and 15 military working dogs. The military dogs received a permanent chemoprophylaxis (moxidectin. In 11 stray dogs, both tests were positive (22.4%. All the military dogs were negative, showing efficiency of chemoprophaxis. Results were discrepant in 6 dogs, negative with one test and doubtful with the other. Antigen heartworm test kits are available and reliable diagnostic tools. They are useful to evaluate the efficiency of chemoprophylaxis and to detect infected animals in order to treat them and to prevent the spreading of the disease.

  11. Survey of Canine Dirofilaria immitis Infection in New Caledonia. (United States)

    Watier-Grillot, S; Marié, J-L; Cabre, O; Davoust, B


    Canine dirofilariosis is a frequent parasitic disease in New-Caledonia. A survey of canine heartworm (Dirofilaria immitis) infection among dogs from the cities of Tontouta, Nandaï and Nouméa, was performed in March 2009 using two antigen test kits; the microwell ELISA test: DiroCHE (Synbiotics Europe) and the Rapid Immuno Migration (RIM) test: WITNESS DIROFILARIA (Synbiotics Europe). Blood samples were collected from 64 dogs: 49 strays and 15 military working dogs. The military dogs received a permanent chemoprophylaxis (moxidectin). In 11 stray dogs, both tests were positive (22.4%). All the military dogs were negative, showing efficiency of chemoprophaxis. Results were discrepant in 6 dogs, negative with one test and doubtful with the other. Antigen heartworm test kits are available and reliable diagnostic tools. They are useful to evaluate the efficiency of chemoprophylaxis and to detect infected animals in order to treat them and to prevent the spreading of the disease. PMID:21547264

  12. Evaluation of a sponge-on therapy for canine scabies. (United States)

    Folz, S D; Kratzer, D D; Kakuk, T J; Rector, D L


    Forty dogs (20 treated, 20 controls) were utilized to evaluate a new treatment for naturally acquired canine scabies. A liquid concentrate formulation of amitraz was diluted and applied as a sponge-on therapy. Ninety-four percent of the dogs treated with the scabicide were cleared of mites and returned to clinical normality with a single topical treatment; one dog was retreated, cleared of mites and was also returned to normality. All dogs treated with the miticide responded clinically, therefore the treatment also may be useful when trial therapy is necessary to differentially diagnose the disease. The miticide was well tolerated by all dogs, and there was no evidence of dermal or ocular irritation. Topical treatment with the liquid concentrate was efficacious and safe as a therapy for naturally acquired canine scabies. Placebo controls did not improve clinically and these animals retained their mite populations.

  13. Differential Genetic Regulation of Canine Hip Dysplasia and Osteoarthritis


    Zhengkui Zhou; Xihui Sheng; Zhiwu Zhang; Keyan Zhao; Lan Zhu; Gang Guo; Steve G Friedenberg; Hunter, Linda S.; Vandenberg-Foels, Wendy S.; Hornbuckle, William E.; Ursula Krotscheck; Elizabeth Corey; Moise, Nancy S.; Dykes, Nathan L.; Junya Li


    BACKGROUND: Canine hip dysplasia (HD) is a common polygenic trait characterized by hip malformation that results in osteoarthritis (OA). The condition in dogs is very similar to developmental dysplasia of the human hip which also leads to OA. METHODOLOGY/PRINCIPAL FINDINGS: A total of 721 dogs, including both an association and linkage population, were genotyped. The association population included 8 pure breeds (Labrador retriever, Greyhounds, German Shepherd, Newfoundland, Golden retriever,...

  14. Morphologic and biochemical studies of canine mucopolysaccharidosis I.


    Shull, R M; Helman, R. G.; Spellacy, E.; Constantopoulos, G.; Munger, R. J.; Neufeld, E F


    This report presents the necropsy and biochemical findings on the first dog to die with alpha-L-iduronidase deficiency (mucopolysaccharidosis I, MPS I). Gross pathologic features, light- and electron-microscopic findings, and tissue enzyme, glycosaminoglycan (GAG), and sphingolipid levels are compared with the human disease counterpart and the previously described feline model. Results lend further support for the similarities of the canine disease and human MPS I.

  15. Acute pancreatitis : a newly recognised potential complication of canine babesiosis


    A.J. Möhr; Lobetti, R. G.; J.J. Van der Lugt


    This retrospective study describes 4 cases of canine babesiosis with histologically confirmed acute pancreatitis. In addition, 16 dogs with babesiosis are reported with serum amylase (>3500 U/l ) and/or lipase (>650 U/l ) activity elevations of a magnitude that would support a diagnosis of probable acute pancreatitis, although extra-pancreatic sources of the enzymes could not be excluded in these cases. Median time of pancreatitis diagnosis was 2.5 days post-admission, with primarily yo...

  16. Antioxidants in the Canine Model of Human Aging


    Dowling, Amy L. S.; Head, Elizabeth


    Oxidative damage can lead to neuronal dysfunction in the brain due to modifications to proteins, lipids and DNA/RNA. In both human and canine brain, oxidative damage progressively increases with age. In the Alzheimer’s disease (AD) brain, oxidative damage is further exacerbated, possibly due to increased deposition of beta-amyloid (Aβ) peptide in senile plaques. These observations have led to the hypothesis that antioxidants may be beneficial for brain aging and AD. Aged dogs naturally develo...

  17. Prediction of unerupted canines and premolars in a Syrian sample


    Burhan, Ahmad S; Nawaya, Fehmieh R


    Background The current study aimed to evaluate the applicability of the methods of Moyers and of Tanaka and Johnston to estimate the mesiodistal widths of permanent canines and premolars in Syrian individuals, to determine whether the predicting equations differ by sex, and to develop more accurate regression equations using various teeth groups as predictors. Methods A total of 670 pretreatment pairs of casts belonging to 342 female patients and 328 male patients were selected from the archi...

  18. Canine parvovirus effect on wolf population change and pup survival (United States)

    Mech, L.D.; Goyal, S.M.


    Canine parvovirus infected wild canids more than a decade ago, but no population effect has been documented. In wild Minnesota wolves (Canis lupus) over a 12-yr period, the annual percent population increase and proportion of pups each were inversely related to the percentage of wolves serologically positive to the disease. Although these effects did not seem to retard this large extant population, similar relationships in more isolated wolf populations might hinder recovery of this endangered and threatened species.

  19. Phylogenetic evidence of canine distemper virus in Serengeti's lions.


    Harder, Timm; Kenter, Marcel; Appel, Max; Roelke-Parker, Melody; Barrett, Thomas,; Osterhaus, Albert


    textabstractRecently an epizootic, reported to be due to a morbillivirus infection, affected the lion population of the Tanzanian Serengeti National Park. A morbillivirus phosphoprotein (P) gene fragment was amplified by PCR from tissue samples of several affected lions. Sequencing of the amplificates and subsequent phylogenetic analyses revealed that a wild-type strain of canine distemper morbillivirus (CDV) was involved. Vaccination of the local domestic dog population with proven safe CDV ...

  20. Fatal canine distemper virus infection of giant pandas in China


    Na Feng; Yicong Yu; Tiecheng Wang; Peter Wilker; Jianzhong Wang; Yuanguo Li; Zhe Sun; Yuwei Gao; Xianzhu Xia


    We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possess...

  1. Selection of reference genes in canine uterine tissues. (United States)

    Du, M; Wang, X; Yue, Y W; Zhou, P Y; Yao, W; Li, X; Ding, X B; Liu, X F; Guo, H; Ma, W Z


    Real-time quantitative polymerase chain reaction (RT-qPCR) is usually employed in gene expression studies in veterinary research, including in studies on canine pyometra. Canine pyometra is a common clinical disease in bitches. When using RT-qPCR, internal standards, such as reference genes, are necessary to investigate relative gene expression by quantitative measurements of mRNA levels. The aim of this study was to evaluate the stability of reference genes and select reference genes suitable for canine pyometra studies. We collected 24 bitch uterine tissue samples, including five healthy and 19 pyometra infected samples. These were used to screen the best reference genes of seven candidate genes (18SrRNA, ACTB, B2M, GAPDH, HPRT, RPL13A, and YWHAZ). The method of KH Sadek and the GeNorm, Normfinder, BestKeeper, and RefFinder software were used to evaluate the stability of gene expression in both pyometra and healthy uterine samples. The results showed that the expression stability of the candidate gene in pyometra and healthy tissues differed. We showed that YWHAZ was the best reference gene, which could be used as an accurate internal control gene in canine pyometra studies. To further validate this recommendation, the expression profile of a target gene insulin-like growth factor 1 receptor gene (IGF1R) was investigated. We found that the expression of IGF1R was significantly altered when different reference genes were used. All reference genes identified in the present study will enable more accurate normalization of gene expression data in both pyometra infected and healthy uterine tissues. PMID:27323194

  2. Classification and grading of canine malignant mammary tumors


    Abbas Tavasoly; Hannaneh Golshahi; Annahita Rezaie; Mohammad Farhadi


    Histological grading is a good parameter to stratify tumors according to their biological aggressiveness. The Elston and Ellis grading method in humans, invasive ductal breast carcinomas and other invasive tumors are routinely used. The aims of this study were classification of mammary gland tumors and also application of a human grading method in canine mammary carcinoma. The samples included 37 tumors of mammary glands. Mammary tumors were carcinomas (n = 32) and sarcomas (n = 5). The carci...

  3. Canine aggression toward people: a guide for practitioners. (United States)

    Sueda, Karen Lynn C; Malamed, Rachel


    This article reviews the various causes of human-directed aggression in dogs and provides a step-by-step plan guiding the general practitioner through history taking, behavior observations, diagnosis, consultation, treatment, and follow-up care. Charts summarizing how to obtain behavioral information, the client's management options, treatment recommendations, diagnosis and treatment of human-directed aggression, and the clinician's role in preventing human-directed aggression are included. A graphic illustration of canine body language is also provided. PMID:24766702

  4. Management of chemical burns of the canine cornea


    Christmas, Richard


    Significant clinical signs and general principles of treatment for chemical burns of the canine cornea are presented using three typical case studies for illustration. Alkali burns are more common in dogs than acid burns. The sources of alkali in this study were soap, cement, and mortar dust. Common signs of chemical burns are ocular pain, corneal ulceration, tear film inadequacy, corneal edema, and marked corneal neovascularity. Successful treatment requires thorough ocular lavage, treatment...

  5. The pathogenesis and diagnosis of canine hip dysplasia: a review.


    Fries, C L; Remedios, A M


    Hip dysplasia is a common developmental problem affecting the canine population. Despite extensive research into the condition, many questions remain unanswered and numerous misconceptions are present among the general public. The purpose of this paper is to review the current knowledge on the development of hip dysplasia, factors modifying its development, and current diagnostic techniques. A computerized literature search was conducted for the period of January 1983 to April 1985 using the ...

  6. Diagnosis, prevention, and management of canine hip dysplasia: a review

    Directory of Open Access Journals (Sweden)

    Schachner ER


    Full Text Available Emma R Schachner, Mandi J Lopez Department of Veterinary Clinical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA, USA Abstract: Canine hip dysplasia (CHD is a polygenic and multifactorial developmental disorder characterized by coxofemoral (hip joint laxity, degeneration, and osteoarthritis (OA. Current diagnostic techniques are largely subjective measures of joint conformation performed at different stages of development. Recently, measures on three-dimensional images generated from computed tomography scans predicted the development of OA associated with CHD. Continued refinement of similar imaging methods may improve diagnostic imaging techniques to identify dogs predisposed to degenerative hip joint changes. By current consensus, joint changes consistent with CHD are influenced by genetic predisposition as well as environmental and biomechanical factors; however, despite decades of work, the relative contributions of each to the development and extent of CHD signs remain elusive. Similarly, despite considerable effort to decipher the genetic underpinnings of CHD for selective breeding programs, relevant genetic loci remain equivocal. As such, prevention of CHD within domestic canine populations is marginally successful. Conservative management is often employed to manage signs of CHD, with lifelong maintenance of body mass as one of the most promising methods. Surgical intervention is often employed to prevent joint changes or restore joint function, but there are no gold standards for either goal. To date, all CHD phenotypes are considered as a single entity in spite of recognized differences in expression and response to environmental conditions and treatment. Identification of distinct CHD phenotypes and targeting evidence-based conservative and invasive treatments for each may significantly advance prevention and management of a prevalent, debilitating condition in canine companions. Keywords: canine

  7. Preserved irradiated homologous cartilage implants in canine eyelids

    Energy Technology Data Exchange (ETDEWEB)

    Schenk, W.; Linberg, J.V.; McCormick, S. (West Virginia Univ. School of Medicine, Morgantown (USA))


    Preserved irradiated homologous costal cartilage implants were placed in six canine lower lids for a period of 7-12 weeks. The three implants placed under a covering of conjunctiva simulating current clinical technique were well tolerated and demonstrated little change. Exposed implants produced obvious clinical inflammation and two of three exposed grafts disappeared during the 4- to 5-week interval. The single exposed implant that was retained demonstrated partial epithelialization but suffered extensive absorption and remodeling.

  8. Histamine concentration is involved in canine valvular disease


    Mitsuhiro Isaka; Masahiko Befu; Nami Matsubara; Mayuko Ishikawa; Yurie Arase; Shinichi Namba


    It has been known since many years that there are histamine receptors (H) in the heart. Histamines display chronotropic and inotropic activity, cardiovascular diseases, and are thought to be a systemic inflammatory disease. During heart failure, the histamine concentration is elevated. In addition, H2 blockers prolonged the survival period for human patients with heart failure. The aim of this study was to evaluate whether blood concentration of histamine is associated with canine valvular di...

  9. Canine aggression toward people: a guide for practitioners. (United States)

    Sueda, Karen Lynn C; Malamed, Rachel


    This article reviews the various causes of human-directed aggression in dogs and provides a step-by-step plan guiding the general practitioner through history taking, behavior observations, diagnosis, consultation, treatment, and follow-up care. Charts summarizing how to obtain behavioral information, the client's management options, treatment recommendations, diagnosis and treatment of human-directed aggression, and the clinician's role in preventing human-directed aggression are included. A graphic illustration of canine body language is also provided.

  10. Feline and canine coronaviruses : common genetic and pathobiological features


    Sophie Le Poder


    A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious ...

  11. Transmission Dynamics and Prospects for the Elimination of Canine Rabies


    Hampson, Katie; Dushoff, Jonathan; Cleaveland, Sarah; Haydon, Daniel T.; Kaare, Magai; Packer, Craig; Dobson, Andy


    Rabies has been eliminated from domestic dog populations in Western Europe and North America, but continues to kill many thousands of people throughout Africa and Asia every year. A quantitative understanding of transmission dynamics in domestic dog populations provides critical information to assess whether global elimination of canine rabies is possible. We report extensive observations of individual rabid animals in Tanzania and generate a uniquely detailed analysis of transmission biology...

  12. Transmission dynamics and prospects for the elimination of canine rabies.


    Katie Hampson; Jonathan Dushoff; Sarah Cleaveland; Haydon, Daniel T.; Magai Kaare; Craig Packer; Andy Dobson


    Rabies has been eliminated from domestic dog populations in Western Europe and North America, but continues to kill many thousands of people throughout Africa and Asia every year. A quantitative understanding of transmission dynamics in domestic dog populations provides critical information to assess whether global elimination of canine rabies is possible. We report extensive observations of individual rabid animals in Tanzania and generate a uniquely detailed analysis of transmission biology...

  13. In vitro susceptibility of Malassezia pachydermatis isolates from canine skin with atopic dermatitis to ketoconazole and itraconazole in East Asia. (United States)

    Watanabe, Shion; Koike, Anna; Kano, Rui; Nagata, Masahiko; Chen, Charles; Hwang, Cheol-Yong; Hasegawa, Atsuhiko; Kamata, Hiroshi


    Topical or oral azole antifungals are commonly used in canine atopic dermatitis (AD), as the lipophilic yeast Malassezia pachydermatis exacerbates canine AD. To examine whether canine AD lesions harbor azole-resistant M. pachydermatis isolates in East Asia, we investigated the in vitro susceptibility of M. pachydermatis isolates to ketoconazole (KTZ) and itraconazole (ITZ) obtained from AD lesions of canines in Japan, Korea and Taiwan. The minimum inhibitory concentrations (MICs) of KTZ and ITZ were measured by the E-test using Sabouraud dextrose agar with 0.5% Tween 40. The MICs of KTZ and ITZ for isolates from canines with AD were significantly higher than the MICs for isolates from healthy canines. Our findings suggested that the clinical isolates from canine AD skin lesions were less susceptible to azoles than those from normal canine skin in East Asia. PMID:24334863

  14. Biotinylated dextran amine anterograde tracing of the canine corticospinal tract

    Institute of Scientific and Technical Information of China (English)

    Xiao Han; Guangming Lv; Huiqun Wu; Dafeng Ji; Zhou Sun; Yaofu Li; Lemin Tang


    In this study, biotinylated dextran amine (BDA) was microinjected into the left cortical motor area of the canine brain. Fluorescence microscopy results showed that a large amount of BDA-labeled pyramidal cells were visible in the left cortical motor area after injection. In the left medulla oblongata, the BDA-labeled corticospinal tract was evenly distributed, with green fluorescence that had a clear boundary with the surrounding tissue. The BDA-positive corticospinal tract entered into the right lateral funiculus of the spinal cord and descended into the posterior part of the right lateral funiculus, close to the posterior horn, from cervical to sacral segments. There was a small amount of green fluorescence in the sacral segment. The distribution of BDA labeling in the canine central nervous system was consistent with the course of the corticospinal tract. Fluorescence labeling for BDA gradually diminished with time after injection. Our findings indicate that the BDA anterograde tracing technique can be used to visualize the localization and trajectory of the corticospinal tract in the canine central nervous system.

  15. Pharmacologic inhibition of MEK signaling prevents growth of canine hemangiosarcoma (United States)

    Andersen, Nicholas J.; Nickoloff, Brian J.; Dykema, Karl J.; Boguslawski, Elissa A.; Krivochenitser, Roman I.; Froman, Roe E.; Dawes, Michelle J.; Baker, Laurence H.; Thomas, Dafydd G.; Kamstock, Debra A.; Kitchell, Barbara E.; Furge, Kyle A.; Duesbery, Nicholas S.


    Angiosarcoma (AS) is a rare neoplasm of endothelial origin that has limited treatment options and poor five-year survival. As a model for human AS, we studied primary cells and tumorgrafts derived from canine hemangiosarcoma (HSA), which is also an endothelial malignancy with similar presentation and histology. Primary cells isolated from HSA showed constitutive ERK activation. The MEK inhibitor CI-1040 reduced ERK activation and the viability of primary cells derived from visceral, cutaneous, and cardiac HSA in vitro. HSA-derived primary cells were also sensitive to sorafenib, an inhibitor of B-Raf and multi-receptor tyrosine kinases. In vivo, CI-1040 or PD0325901 decreased the growth of cutaneous cell-derived xenografts and cardiac-derived tumorgrafts. Sorafenib decreased tumor size in both in vivo models, although cardiac tumorgrafts were more sensitive. In human AS, we noted that 50% of tumors stained positively for phosphorylated ERK1/2 and that the expression of several MEK-responsive transcription factors was up-regulated. Our data showed that MEK signaling is essential for the growth of HSA in vitro and in vivo and provided evidence that the same pathways are activated in human AS. This indicates that MEK inhibitors may form part of an effective therapeutic strategy for the treatment of canine HSA or human AS, and it highlights the utility of spontaneous canine cancers as a model of human disease. PMID:23804705

  16. Characterization of a Canine Homolog of Human Aichivirus▿ (United States)

    Kapoor, Amit; Simmonds, Peter; Dubovi, Edward J.; Qaisar, Natasha; Henriquez, Jose A.; Medina, Jan; Shields, Shelly; Lipkin, W. Ian


    Many of our fatal “civilization” infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5′ and 3′ untranslated regions. Comparative phylogenetic analysis using various structural and nonstructural proteins of CKoV confirmed it as the animal virus homolog most closely related to human Aichivirus (AiV). Bayesian Markov chain Monte Carlo analysis suggests a mean recent divergence time of CKoV and AiV within the past 20 to 50 years, well after the domestication of canines. The discovery of CKoV provides new insights into the origin and evolution of AiV and the species specificity and pathogenesis of kobuviruses. PMID:21880761

  17. Characterization of a canine homolog of human Aichivirus. (United States)

    Kapoor, Amit; Simmonds, Peter; Dubovi, Edward J; Qaisar, Natasha; Henriquez, Jose A; Medina, Jan; Shields, Shelly; Lipkin, W Ian


    Many of our fatal "civilization" infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5' and 3' untranslated regions. Comparative phylogenetic analysis using various structural and nonstructural proteins of CKoV confirmed it as the animal virus homolog most closely related to human Aichivirus (AiV). Bayesian Markov chain Monte Carlo analysis suggests a mean recent divergence time of CKoV and AiV within the past 20 to 50 years, well after the domestication of canines. The discovery of CKoV provides new insights into the origin and evolution of AiV and the species specificity and pathogenesis of kobuviruses. PMID:21880761

  18. Does contemporary canine diet cause cancer? ; A review

    Directory of Open Access Journals (Sweden)

    Joseph B Gentzel


    Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer

  19. Pathophysiology, diagnosis, and treatment of canine hip dysplasia

    International Nuclear Information System (INIS)

    Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education

  20. Video otoscopy as a diagnostic tool for canine otoacariasis. (United States)

    de Souza, Clarissa Pimentel; Verocai, Guilherme Gomes; Balbi, Margareth; Scott, Fabio Barbour


    Canine otoacariasis, or otodectic mange, is a common parasitic disorder of dogs' ear canals caused by the mite Otodectes cynotis. Infestation can be detected through diverse protocols of varying sensitivity. We evaluated the use of video otoscopy in comparison with conventional otoscopy and cerumen examination under a microscope for diagnosing O. cynotis in dogs. Thirty-five dogs were evaluated bilaterally for the presence of ear mites, using a veterinary otoscope (Gowlands®), a video otoscope (Welch Allyn®) and the gold-standard technique of examination of swab-collected cerumen under a microscope. Each ear was considered to represent one sample, and 69 ears were examined, since one dog presented with one completely stenotic ear canal. Ear mites were diagnosed in 59.42% (41/69) through video otoscopy. The same 41 infested ear canals were detected by means of cerumen examination under a microscope, whereas conventional otoscopy was able to diagnose mites in only 39.13% (27/69). This difference was statistically significant (p < 0.001). Video otoscopy proved to be superior to conventional otoscopy, and equivalent to the gold standard for detection of O. cynotis in canine ear canals, and should be recommended for controlled trials on drug efficacy for treatment of canine otoacariasis.

  1. Morphological characteristics of the canine and feline stomach mucosa. (United States)

    Zahariev, P; Sapundzhiev, E; Pupaki, D; Rashev, P; Palov, A; Todorov, T


    The stomach mucosa structure in animals belonging to Order Carnivora indicates some specific characteristics in comparison with the other mammals. Between the bases of the mucosal glands and the lamina muscularis mucosae there is an additional plate which most of the morphologists have defined as lamina subglandularis. In currently used Nomina histologica this layer is indicated as stratum compactum in carnivorous stomach mucosa. The investigation aims were to study and compare canine and feline stomach tunica mucosa characteristics as well as to measure the thickness of stratum compactum and to specify some of the certain collagen types and fibronectin compounds. Conventional and differential histological and ultrastructural methods and immuno-histochemical approaches for investigation of the canine and feline stomach samples were used. The specific organization of the carnivorous stomach wall arrangement was established. In the structure of the canine stomach mucosa, no evidence of stratum compactum was observed. The presence of stratum compactum in feline stomach mucosa was ascertained and measured. Using an immunohistochemical method very high expression of collagen type IV and fibronectin, moderate positive reaction of collagen type III, and a comparatively weakest expression of collagen types I and V in the structure of stratum compactum from cat stomach mucosa was shown. The obtained results clarify the characteristics of the stomach mucosa morphology and could be used as a basis for distinguishing the stomach wall structure of the animal species belonging to Canidae and Felidae families although they are both carnivores. PMID:20825386

  2. Somatostatin modulates cholinergic neurotransmission in canine antral muscle

    International Nuclear Information System (INIS)

    Somatostatin has been shown to inhibit antral motility in vivo. To examine the effect of somatostatin on cholinergic neurotransmission in the canine antrum, we studied the mechanical response of and the release of [3H]acetylcholine from canine longitudinal antral muscle in response to substance P, gastrin 17, and electrical stimulation. In unstimulated tissues, somatostatin had a positive inotropic effect on spontaneous phasic contractions. In tissues stimulated with substance P and gastrin 17, but not with electrical stimulation, somatostatin inhibited the phasic inotropic response dose dependently. This inhibitory effect was abolished by indomethacin. Somatostatin stimulated the release of prostaglandin E2 radioimmunoreactivity, and prostaglandin E2 inhibited the release of [3H]acetylcholine induced by substance P and electrical stimulation. Somatostatin increased the release of [3H]acetylcholine from unstimulated tissues by a tetrodotoxin-sensitive mechanism but inhibited the release induced by substance P and electrical stimulation. These results suggest that somatostatin has a dual modulatory effect on cholinergic neutrotransmission in canine longitudinal antral muscle. This effect is excitatory in unstimulated tissues and inhibitory in stimulated tissues. The inhibitory effect is partially mediated by prostaglandins

  3. Antiviral antibodies stimulate production of reactive oxygen species in cultured canine brain cells infected with canine distemper virus.


    Bürge, T; Griot, C; Vandevelde, M; Peterhans, E


    Canine distemper is characterized mainly by respiratory, enteric, and nervous symptoms. Infection of the central nervous system results in demyelination, to which inflammation has been shown to contribute significantly. It has been proposed that macrophages play a major role as effector cells in this process. We report that cultured dog brain cells contain a population of macrophages capable of producing reactive oxygen species as measured by luminol-dependent chemiluminescence. In cultures i...

  4. Genotypic characterization of canine coronaviruses associated with fatal canine neonatal enteritis in the United States. (United States)

    Licitra, Beth N; Whittaker, Gary R; Dubovi, Edward J; Duhamel, Gerald E


    Emerging canine coronavirus (CCoV) variants that are associated with systemic infections have been reported in the European Union; however, CCoV-associated disease in the United States is incompletely characterized. The purpose of this study was to correlate the clinicopathological findings and viral antigen distribution with the genotypic characteristics of CCoV in 11 puppies from nine premises in five states that were submitted for diagnostic investigation at Cornell University between 2008 and 2013. CCoV antigen was found in epithelial cells of small intestinal villi in all puppies and the colon in 2 of the 10 puppies where colon specimens were available. No evidence of systemic CCoV infection was found. Comparative sequence analyses of viral RNA extracted from intestinal tissues revealed CCoV-II genotype in 9 out of 11 puppies. Of the nine CCoV-IIs, five were subtyped as group IIa and one as IIb, while three CCoVs could not be subtyped. One of the CCoV-IIa variants was isolated in cell culture. Infection with CCoV alone was found in five puppies, of which two also had small intestinal intussusception. Concurrent infections with either parvovirus (n = 1), attaching-effacing Escherichia coli (n = 4), or protozoan parasites (n = 3) were found in the other six puppies. CCoV is an important differential diagnosis in outbreaks of severe enterocolitis among puppies between 4 days and 21 weeks of age that are housed at high population density. These findings will assist with the rapid laboratory diagnosis of enteritis in puppies and highlight the need for continued surveillance for CCoV variants and intestinal viral diseases of global significance.

  5. Evaluation of the biological differences of canine and human factor VIII in gene delivery: Implications in human hemophilia treatment (United States)

    The canine is the most important large animal model for testing novel hemophilia A(HA) treatment. It is often necessary to use canine factor VIII (cFIII) gene or protein for the evaluation of HA treatment in the canine model. However, the different biological properties between cFVIII and human FVII...

  6. Frequent alteration of the tumor suppressor gene APC in sporadic canine colorectal tumors.

    Directory of Open Access Journals (Sweden)

    Lydia Youmans

    Full Text Available Sporadic canine colorectal cancers (CRCs should make excellent models for studying the corresponding human cancers. To molecularly characterize canine CRC, we investigated exonic sequence mutations of adenomatous polyposis coli (APC, the best known tumor suppressor gene of human CRC, in 23 sporadic canine colorectal tumors, including 8 adenomas and 15 adenocarcinomas, via exon-resequencing analysis. As a comparison, we also performed the same sequencing analysis on 10 other genes, either located at human 5q22 (the same locus as APC or 18q21 (also frequently altered in human CRC, or known to play a role in human carcinogenesis. We noted that APC was the most significantly mutated gene in both canine adenomas and adenocarcinomas among the 11 genes examined. Significantly, we detected large deletions of ≥ 10 bases, many clustered near the mutation cluster region, as well as single or two base deletions in ~70% canine tumors of both subtypes. These observations indicate that like in the human, APC is also frequently altered in sporadic colorectal tumors in the dog and its alteration is an early event in canine colorectal tumorigenesis. Our study provides further evidence demonstrating the molecular similarity in pathogenesis between sporadic human and canine CRCs. This work, along with our previous copy number abnormality study, supports that sporadic canine CRCs are valid models of human CRCs at the molecular level.

  7. Molecular surveillance of traditional and emerging pathogens associated with canine infectious respiratory disease. (United States)

    Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio


    A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. PMID:27527760

  8. Mass die-Off of Caspian seals caused by canine distemper virus.


    Kennedy, S.; Kuiken, T.; Jepson, P. D.; Deaville, R.; Forsyth, M.; Barrett, T; van de Bildt, M. W.; Osterhaus, A D; Eybatov, T.; Duck, C.; Kydyrmanov, A; Mitrofanov, I.; Wilson, S


    Thousands of Caspian seals (Phoca caspica) died in the Caspian Sea from April to August 2000. Lesions characteristic of morbillivirus infection were found in tissue specimens from dead seals. Canine distemper virus infection was identified by serologic examination, reverse transcriptase- polymerase chain reaction, and sequencing of selected P gene fragments. These results implicate canine distemper virus infection as the primary cause of death.

  9. Mandibular Canine Dimorphism in Establishing Sex Identity in the Lebanese Population



    Background and Objective. In forensic investigations, mandibular canines provide excellent materials to identify gender since they are more likely to survive disasters. The objective of this study was to investigate gender dimorphism by comparing the mesiodistal width of mandibular permanent canines and intercanine distance in a group of Lebanese population. Methods. Participants consisted of undergraduate students from the Sch...

  10. Tratamento da papilomatose canina com Propionibacterium acnes Treatment of canine papillomatosis using Propionibacterium acnes

    Directory of Open Access Journals (Sweden)

    J. Megid


    Full Text Available Propionibacterium acnes as immunostimulant in oral canine papillomatosis treatment in 16 animals was studied. Regression of the pappiloma started being observed after the second aplication, with complete resolution in all dogs after the sixth aplication. These results suggest the use of P. acnes as an alternative in oral canine papillomatosis therapy.


    NARCIS (Netherlands)



    A canine model is described to study the tolerance of the pancreas to intra-operative radiotherapy (IORT). The canine pancreas is a horseshoe-shaped organ. To create a homogeneous delivery of IORT to the whole pancreas surgical manipulation is necessary which may induce pancreatitis. A resection of

  12. 78 FR 29698 - Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA (United States)


    ... a Canine Lymphoma Vaccine, DNA AGENCY: Animal and Plant Health Inspection Service, USDA. ACTION... testing, and then to field test, an unlicensed Canine Lymphoma Vaccine, DNA. The environmental assessment... Lymphoma Vaccine, DNA. Possible Field Test Locations: Arizona, Florida, Georgia, New York, North...

  13. Antiviral effect of lithium chloride on infection of cells by canine parvovirus. (United States)

    Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun


    Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.

  14. Multispecialty team management of a case with impacted maxillary permanent canines. (United States)

    Tang, E L


    A fifteen-year-old Chinese girl presented with unerupted maxillary permanent canines impacted against the roots of the central incisors, causing malalignment of the maxillary incisors. The canines were fully formed and their apices closed. The potential path of eruption of the canines contraindicated surgical exposure, followed by orthodontic traction. It was decided to transplant the impacted canines to their normal positions, and then align the maxillary anterior teeth, using a fixed orthodontic appliance. The transplantations and the orthodontic treatment were successful, and neither transplant showed signs of root resorption, periodontal pockets, mobility, or pain, three years after surgery. Root canal therapy was performed on the canines after transplantation, because their apices were closed. They were stained by the amalgam in the access cavities, but both responded well to nonvital bleaching using 30 percent H2O2.

  15. Oncolytic virotherapy in veterinary medicine: current status and future prospects for canine patients

    Directory of Open Access Journals (Sweden)

    Patil Sandeep S


    Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.

  16. Effects of Carbenoxolone on the Canine Pituitary-Adrenal Axis.

    Directory of Open Access Journals (Sweden)

    Takahiro Teshima

    Full Text Available Cushing's disease caused by pituitary corticotroph adenoma is a common endocrine disease in dogs. A characteristic biochemical feature of corticotroph adenomas is their relative resistance to suppressive negative feedback by glucocorticoids. The abnormal expression of 11beta-hydroxysteroid dehydrogenase (11HSD, which is a cortisol metabolic enzyme, is found in human and murine corticotroph adenomas. Our recent studies demonstrated that canine corticotroph adenomas also have abnormal expression of 11HSD. 11HSD has two isoforms in dogs, 11HSD type1 (HSD11B1, which converts cortisone into active cortisol, and 11HSD type2 (HSD11B2, which converts cortisol into inactive cortisone. It has been suggested that glucocorticoid resistance in corticotroph tumors is related to the overexpression of HSD11B2. Therefore it was our aim to investigate the effects of carbenoxolone (CBX, an 11HSD inhibitor, on the healthy dog's pituitary-adrenal axis. Dogs were administered 50 mg/kg of CBX twice each day for 15 days. During CBX administration, no adverse effects were observed in any dogs. The plasma adrenocorticotropic hormone (ACTH, and serum cortisol and cortisone concentrations were significantly lower at day 7 and 15 following corticotropin releasing hormone stimulation. After completion of CBX administration, the HSD11B1 mRNA expression was higher, and HSD11B2 mRNA expression was significantly lower in the pituitaries. Moreover, proopiomelanocortin mRNA expression was lower, and the ratio of ACTH-positive cells in the anterior pituitary was also significantly lower after CBX treatment. In adrenal glands treated with CBX, HSD11B1 and HSD11B2 mRNA expression were both lower compared to normal canine adrenal glands. The results of this study suggested that CBX inhibits ACTH secretion from pituitary due to altered 11HSD expressions, and is potentially useful for the treatment of canine Cushing's disease.

  17. Gastrotomy closure using bioabsorbable plugs in a canine model. (United States)

    Cios, Theodore J; Reavis, Kevin M; Renton, David R; Hazey, Jeffrey W; Mikami, Dean J; Narula, Vimal K; Allemang, Matthew T; Davis, S Scott; Melvin, W Scott


    The repair of gastric perforation commonly involves simple suture closure using an open or laparoscopic approach. An endolumenal approach using prosthetic materials may be beneficial. The role of bioprosthetics in this instance has not been thoroughly investigated, thus the authors evaluated the feasibility of gastric perforation repair using a bioabsorbable device and quantified gross and histological changes at the injury site. Twelve canines were anesthetized and underwent open gastrotomy. A 1-cm-diameter perforation was created in the anterior wall of the stomach and plugged with a bioabsorbable device. Intralumenal pH was recorded. Canines were sacrificed at one, four, six, eight, and 12 weeks. The stomach was explanted followed by gross and histological examination. The injury site was examined. The relative ability of the device to seal the perforation was recorded, as were postoperative changes. Tissue samples were analyzed for gross and microscopic tissue growth and compared to normal gastric tissue in the same animal as an internal control. A scoring system of -2 to +2 was used to measure injury site healing (-2= leak, -1= no leak and minimal ingrowth, 0= physiologic healing, +1= mild hypertrophic tissue, +2= severe hypertrophic tissue). In all canines, the bioprosthesis successfully sealed the perforation without leak under ex vivo insufflation. At one week, the device maintained its integrity but there was no tissue ingrowth. Histological healing score was -1. At 4-12 weeks, gross examination revealed a healed injury site in all animals. The lumenal portion of the plug was completely absorbed. The gross and histological healing score ranged from -1 to +1. The application of a bioabsorbable device results in durable closure of gastric perforation with physiologic healing of the injury site. This method of gastrotomy closure may aid in the evolution of advanced endoscopic approaches to perforation closure of hollow viscera.

  18. Genotypes and antibiotic resistance of canine Campylobacter jejuni isolates. (United States)

    Amar, Chantal; Kittl, Sonja; Spreng, David; Thomann, Andreas; Korczak, Bożena M; Burnens, André P; Kuhnert, Peter


    Campylobacter jejuni is the most important cause of bacterial gastroenteritis in humans. It is a commensal in many wild and domestic animals, including dogs. Whereas genotypes of human and chicken C. jejuni isolates have been described in some detail, only little information on canine C. jejuni genotypes is available. To gain more information on genotypes of canine C. jejuni and their zoonotic potential, isolates from routine diagnostics of diarrheic dogs as well as isolates of a prevalence study in non-diarrheic dogs were analyzed. Prevalence of thermophilic Campylobacter among non-diarrheic dogs was 6.3% for C. jejuni, 5.9% for Campylobacter upsaliensis and 0.7% for Campylobacter coli. The C. jejuni isolates were genotyped by multi locus sequence typing (MLST) and flaB typing. Resistance to macrolides and quinolones was genetically determined in parallel. Within the 134 genotyped C. jejuni isolates 57 different sequence types (ST) were found. Five STs were previously unrecognized. The most common STs were ST-48 (11.2%), ST-45 (10.5%) and ST-21 (6.0%). Whereas no macrolide resistance was found, 28 isolates (20.9%) were resistant to quinolones. ST-45 was significantly more prevalent in diarrheic than in non-diarrheic dogs. Within the common time frame of isolation 94% of the canine isolates had a ST that was also found in human clinical isolates. In conclusion, prevalence of C. jejuni in Swiss dogs is low but there is a large genetic overlap between dog and human isolates. Given the close contact between human and dogs, the latter should not be ignored as a potential source of human campylobacteriosis. PMID:24210812

  19. Root Canal Morphology of Permanent Maxillary and Mandibular Canines in Indian Population Using Cone Beam Computed Tomography

    Directory of Open Access Journals (Sweden)

    Nikhita Somalinga Amardeep


    Full Text Available Aim. To investigate the root canal anatomy of single-rooted permanent maxillary and mandibular canines in an Indian population using cone beam computed tomography (CBCT. Methodology. A total of 250 permanent maxillary canines and 250 permanent mandibular canines were selected and scanned using CBCT. The root anatomy of each tooth was evaluated for the following parameters: the pattern of the root canals, anatomic length of the crown and the root, the presence of accessory canals, the shape of the access cavity, the position of the apical foramina, root diameter, and dentin thickness of the root. Results. Majority of the teeth had a Type I canal configuration in both maxillary canines (81.6% and mandibular canines (79.6%. In maxillary canine the other canal patterns found were Type III (11.6%, Type II (2.8%, Type V (2%, Type XIX (1.2%, and Type IV (0.8%. In mandibular canines the various other canal patterns found were Type III (13.6%, Type II (3.2%, Type V (2%, and Type XIX (1.6%. Apical foramina were laterally positioned in the majority of the teeth, 70.4% and 65.6% in maxillary and mandibular canines, respectively. 12% of the maxillary canines and 12.8% of the mandibular canines had accessory canals. Conclusion. The root canal anatomy of permanent maxillary and mandibular canines varied widely in an Indian population.

  20. Establishment of a Rescue System for Canine Distemper Virus


    Gassen, Uta; Collins, Fergal M.; Duprex, W. Paul; Rima, Bert K.


    Canine distemper virus (CDV) has been rescued from a full-length cDNA clone. Besides Measles virus (MV) and Rinderpest virus, a third morbillivirus is now available for genetic analysis using reverse genetics. A plasmid p(+)CDV was constructed by sequential cloning using the Onderstepoort vaccine strain large-plaque-forming variant. The presence of a T7 promoter allowed transcription of full-length antigenomic RNA by a T7 RNA polymerase, which was provided by a host range mutant of vaccinia v...

  1. Novel canine bocavirus strain associated with severe enteritis in a dog litter. (United States)

    Bodewes, Rogier; Lapp, Stefanie; Hahn, Kerstin; Habierski, André; Förster, Christine; König, Matthias; Wohlsein, Peter; Osterhaus, Albert D M E; Baumgärtner, Wolfgang


    Bocaviruses are small non-enveloped viruses with a linear ssDNA genome, that belong to the genus Bocaparvovirus of the subfamiliy Parvovirinae. Bocavirus infections are associated with a wide spectrum of disease in humans and various mammalian species. Here we describe a fatal enteritis associated with infection with a novel strain of canine bocavirus 2 (CaBoV-2), that occurred in a litter of German wirehaired pointers. Necropsy performed on three puppies revealed an enteritis reminiscent of canine parvovirus associated enteritis, accompanied with signs of lymphocytolytic disease in bone marrow, spleen, lymph nodes and thymus. While other major causes of enteritis of young dogs, including canine parvovirus, were excluded, by random PCR in combination with next-generation sequencing, a novel CaBoV-2 strain was detected. Phylogenetic analysis of the genome of this novel canine bocavirus strain indicated that this virus was indeed most closely related to group 2 canine bocaviruses. Infection with canine bocavirus was confirmed by in situ hybridization, which revealed the presence of CaBoV-2 nucleic acid in the intestinal tract and lymphoid tissues of the dogs. In a small-scale retrospective analysis concerning the role of CaBoV-2 no additional cases were identified. The findings of this study provide novel insights into the pathogenicity of canine bocaviruses.

  2. New hominin fossils from Kanapoi, Kenya, and the mosaic evolution of canine teeth in early hominins

    Directory of Open Access Journals (Sweden)

    J. Michael Plavcan


    Full Text Available Whilst reduced size, altered shape and diminished sexual dimorphism of the canine–premolar complex are diagnostic features of the hominin clade, little is known about the rate and timing of changes in canine size and shape in early hominins. The earliest Australopithecus, Australopithecus anamensis, had canine crowns similar in size to those of its descendant Australopithecus afarensis, but a single large root alveolus has suggested that this species may have had larger and more dimorphic canines than previously recognised. Here we present three new associated dentitions attributed to A. anamensis, recently recovered from the type site of Kanapoi, Kenya, that provide evidence of canine evolution in early Australopithecus. These fossils include the largest mandibular canine root in the hominin fossil record. We demonstrate that, although canine crown height did not differ between these species, A. anamensis had larger and more dimorphic roots, more like those of extant great apes and Ardipithecus ramidus, than those of A. afarensis. The canine and premolar occlusal shapes of A. anamensis also resemble those of Ar. ramidus, and are intermediary between extant great apes and A. afarensis. A. afarensis achieved Homo-like maxillary crown basal proportions without a reduction in crown height. Thus, canine crown size and dimorphism remained stable during the early evolution of Australopithecus, but mandibular root dimensions changed only later within the A. anamensis–afarensis lineage, coincident with morphological changes in the canine–premolar complex. These observations suggest that selection on canine tooth crown height, shape and root dimensions was not coupled in early hominin evolution, and was not part of an integrated adaptive package.

  3. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    Directory of Open Access Journals (Sweden)

    Kiupel Matti


    Full Text Available Abstract Background Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. Methods In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. Results No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. Conclusion In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs.

  4. Isolation and phylogenetic characterization of Canine distemper virus from India. (United States)

    Swati; Deka, Dipak; Uppal, Sanjeev Kumar; Verma, Ramneek


    Canine distemper (CD), caused by canine distemper virus (CDV) is a highly contagious disease that infects a variety of carnivores. Sequence analysis of CDVs from different geographical areas has shown a lot of variation in the genome of the virus especially in haemagglutinin gene which might be one of the causes of vaccine failure. In this study, we isolated the virus (place: Ludhiana, Punjab; year: 2014) and further cloned, sequenced and analyzed partial haemagglutinin (H) gene and full length genes for fusion protein (F), phosphoprotein (P) and matrix protein (M) from an Indian wild-type CDV. Higher sequence homology was observed with the strains from Switzerland, Hungary, Germany; and lower with the vaccine strains like Ondersteport, CDV3, Convac for all the genes. The multiple sequence alignment showed more variation in partial H (45 nucleotide and 5 amino acid substitutions) and complete F (79 nucleotide and 30 amino acid substitutions) than in complete P (44 nucleotide and 22 amino acid substitutions) and complete M (22 nucleotide and 4 amino acid substitutions) gene/protein. Predicted potential N-linked glycosylation sites in H, F, M and P proteins were similar to the previously known wild-type CDVs but different from the vaccine strains. The Indian CDV formed a distinct clade in the phylogenetic tree clearly separated from the previously known wild-type and vaccine strains. PMID:26396979

  5. Duchenne muscular dystrophy gene therapy in the canine model. (United States)

    Duan, Dongsheng


    Duchenne muscular dystrophy (DMD) is an X-linked lethal muscle disease caused by dystrophin deficiency. Gene therapy has significantly improved the outcome of dystrophin-deficient mice. Yet, clinical translation has not resulted in the expected benefits in human patients. This translational gap is largely because of the insufficient modeling of DMD in mice. Specifically, mice lacking dystrophin show minimum dystrophic symptoms, and they do not respond to the gene therapy vector in the same way as human patients do. Further, the size of a mouse is hundredfolds smaller than a boy, making it impossible to scale-up gene therapy in a mouse model. None of these limitations exist in the canine DMD (cDMD) model. For this reason, cDMD dogs have been considered a highly valuable platform to test experimental DMD gene therapy. Over the last three decades, a variety of gene therapy approaches have been evaluated in cDMD dogs using a number of nonviral and viral vectors. These studies have provided critical insight for the development of an effective gene therapy protocol in human patients. This review discusses the history, current status, and future directions of the DMD gene therapy in the canine model. PMID:25710459

  6. Effect of Arctium lappa (burdock) extract on canine dermal fibroblasts. (United States)

    Pomari, Elena; Stefanon, Bruno; Colitti, Monica


    Although the biological activities of Arctium lappa (burdock) have been already investigated in human and other species, data evaluating the molecular mechanisms have not been reported in the dog. In this study we analyzed for the first time the effect of a root extract of burdock on molecular responses in canine dermal fibroblasts with H2O2 stimulation (H group), with burdock treatment (B group) and with H2O2 stimulation and burdock treatment (BH group), using RNAseq technology. Differentially expressed genes (P<0.05) of H, B and BH groups in comparison to the untreated sample (negative control, C group) were identified with MeV software and were functional annotated and monitored for signaling pathways and candidate biomarkers using the Ingenuity Pathways Analysis (IPA). The expression profile of canine dermal fibroblasts treated with burdock extract with or without H2O2 stimulation, showed an up-regulation of mitochondrial superoxide dismutase (SOD2), disheveled 3 (DVL3) and chondroitin sulfate N-acetylgalactosaminyltransferase 2 (CSGALNACT2). The data suggested that burdock has implications in cell adhesion and gene expression with the modulation of Wnt/β catenin signaling and Chondroitin Sulphate Biosynthesis that are particularly important for the wound healing process.

  7. Differential genetic regulation of canine hip dysplasia and osteoarthritis.

    Directory of Open Access Journals (Sweden)

    Zhengkui Zhou

    Full Text Available BACKGROUND: Canine hip dysplasia (HD is a common polygenic trait characterized by hip malformation that results in osteoarthritis (OA. The condition in dogs is very similar to developmental dysplasia of the human hip which also leads to OA. METHODOLOGY/PRINCIPAL FINDINGS: A total of 721 dogs, including both an association and linkage population, were genotyped. The association population included 8 pure breeds (Labrador retriever, Greyhounds, German Shepherd, Newfoundland, Golden retriever, Rottweiler, Border Collie and Bernese Mountain Dog. The linkage population included Labrador retrievers, Greyhounds, and their crosses. Of these, 366 dogs were genotyped at ∼22,000 single nucleotide polymorphism (SNP loci and a targeted screen across 8 chromosomes with ∼3,300 SNPs was performed on 551 dogs (196 dogs were common to both sets. A mixed linear model approach was used to perform an association study on this combined association and linkage population. The study identified 4 susceptibility SNPs associated with HD and 2 SNPs associated with hip OA. CONCLUSION/SIGNIFICANCE: The identified SNPs included those near known genes (PTPRD, PARD3B, and COL15A1 reported to be associated with, or expressed in, OA in humans. This suggested that the canine model could provide a unique opportunity to identify genes underlying natural HD and hip OA, which are common and debilitating conditions in both dogs and humans.

  8. Effect of Arctium lappa (burdock) extract on canine dermal fibroblasts. (United States)

    Pomari, Elena; Stefanon, Bruno; Colitti, Monica


    Although the biological activities of Arctium lappa (burdock) have been already investigated in human and other species, data evaluating the molecular mechanisms have not been reported in the dog. In this study we analyzed for the first time the effect of a root extract of burdock on molecular responses in canine dermal fibroblasts with H2O2 stimulation (H group), with burdock treatment (B group) and with H2O2 stimulation and burdock treatment (BH group), using RNAseq technology. Differentially expressed genes (P<0.05) of H, B and BH groups in comparison to the untreated sample (negative control, C group) were identified with MeV software and were functional annotated and monitored for signaling pathways and candidate biomarkers using the Ingenuity Pathways Analysis (IPA). The expression profile of canine dermal fibroblasts treated with burdock extract with or without H2O2 stimulation, showed an up-regulation of mitochondrial superoxide dismutase (SOD2), disheveled 3 (DVL3) and chondroitin sulfate N-acetylgalactosaminyltransferase 2 (CSGALNACT2). The data suggested that burdock has implications in cell adhesion and gene expression with the modulation of Wnt/β catenin signaling and Chondroitin Sulphate Biosynthesis that are particularly important for the wound healing process. PMID:24192279

  9. Behavioral and psychological characteristics of canine victims of abuse. (United States)

    McMillan, Franklin D; Duffy, Deborah L; Zawistowski, Stephen L; Serpell, James A


    Abuse is an intentional act that causes harm to an individual. Dogs (Canis familiaris) with a known or suspected history of abuse were solicited for the study. A panel of 5 experts in canine behavior and abuse selected the dogs judged as having a certain or near certain history of being abused for inclusion in the study. Behavioral evaluations of the dogs were obtained using the Canine Behavioral Assessment and Research Questionnaire, which utilizes ordinal scales to rate either the intensity or frequency of the dog's behaviors. Sixty-nine dogs ultimately met the criteria for inclusion in the study. When compared with a convenience sample of 5,239 companion dogs, abused dogs were reported as displaying significantly higher rates of aggression and fear directed toward unfamiliar humans and dogs, excitability, hyperactivity, attachment and attention-seeking behaviors, persistent barking, and miscellaneous strange or repetitive behaviors. Delineating the behavioral and psychological characteristics of abused dogs provides the first step in identifying and distinguishing the risk factors and sequelae associated with abuse, which may inform the development of preventive and therapeutic programs for nonhuman animal abuse.

  10. Minor histocompatibility antigens on canine hemopoietic progenitor cells. (United States)

    Weber, Martin; Lange, Claudia; Günther, Wolfgang; Franz, Monika; Kremmer, Elisabeth; Kolb, Hans-Jochem


    Adoptive immunotherapy with CTL against minor histocompatibility Ags (mHA) provides a promising way to treat leukemia relapse in allogeneic chimeras. Here we describe the in vitro generation of CTL against mHA in the dog. We tested their inhibitory effect on the growth of hemopoietic progenitor cells stimulated by hemopoietic growth factors in a 4-day suspension culture. CTL were produced by coculture of donor PBMC with bone marrow-derived dendritic cells (DCs). These DCs were characterized by morphology, high expression of MHC class II and CD1a, and the absence of the monocyte-specific marker CD14. Characteristically these cells stimulated allogeneic lymphocytes (MLR) and, after pulsing with a foreign Ag (keyhole limpet hemocyanin), autologous T cells. CTL were generated either ex vivo by coculture with DCs of DLA-identical littermates or in vivo by immunization of the responder with DCs obtained from a DLA-identical littermate. In suspension culture assays the growth of hemopoietic progenitor cells was inhibited in 53% of DLA-identical littermate combinations. In canine families mHA segregated with DLA as restriction elements. One-way reactivity against mHA was found in five littermate combinations. In two cases mHA might be Y chromosome associated, in three cases autosomally inherited alleles were detected. We conclude that CTL can be produced in vitro and in vivo against mHA on canine hemopoietic progenitor cells using bone marrow-derived DCs. PMID:12794111

  11. Potential of regenerative medicine techniques in canine hepatology. (United States)

    Schotanus, Baukje A; Penning, Louis C; Spee, Bart


    Liver cell turnover is very slow, especially compared to intestines and stomach epithelium and hair cells. Since the liver is the main detoxifying organ in the body, it does not come as a surprise that the liver has an unmatched regenerative capacity. After 70% partial hepatectomy, the liver size returns to normal in about two weeks due to replication of differentiated hepatocytes and cholangiocytes. Despite this, liver diseases are regularly encountered in the veterinary clinic. Dogs primarily present with parenchymal pathologies such as hepatitis. The estimated frequency of canine hepatitis depends on the investigated population and accounts for 1%-2% of our university clinic referral population, and up to 12% in a general population. In chronic and severe acute liver disease, the regenerative and replicative capacity of the hepatocytes and/or cholangiocytes falls short and the liver is not restored. In this situation, proliferation of hepatic stem cells or hepatic progenitor cells (HPCs), on histology called the ductular reaction, comes into play to replace the damaged hepatocytes or cholangiocytes. For unknown reasons the ductular reaction is often too little and too late, or differentiation into fully differentiated hepatocytes or cholangiocytes is hampered. In this way, HPCs fail to fully regenerate the liver. The presence and potential of HPCs does, however, provide great prospectives for their use in regenerative strategies. This review highlights the regulation of, and the interaction between, HPCs and other liver cell types and discusses potential regenerative medicine-oriented strategies in canine hepatitis, making use of (liver) stem cells. PMID:24422896

  12. Canine aural cholesteatoma: a histological and immunohistochemical study. (United States)

    Banco, Barbara; Grieco, Valeria; Di Giancamillo, Mauro; Greci, Valentina; Travetti, Olga; Martino, Pieranna; Mortellaro, Carlo M; Giudice, Chiara


    Canine aural cholesteatoma is an epidermoid cyst that forms in the middle ear cavity as a rare complication of otitis media but the aetiopathogenesis remains controversial. In the present study, 13 cases of canine aural cholesteatoma were investigated histologically and immunohistochemically and compared with cases of chronic otitis. The immunohistochemical investigation was performed using the following monoclonal antibodies: anti-cytokeratins (CK) 14, 16, 8/18, and 19, and anti-Ki67. The proliferative indexes (PIs) of cholesteatomata and otitis epithelium were calculated as the percentage of Ki67 positive nuclei/total nuclei. Histologically, the cholesteatomata were composed of a hyperplastic, hyperkeratotic epithelium (matrix) resting on a fibrous perimatrix, infiltrated by inflammatory cells and devoid of cutaneous adnexa. Immunohistochemically, the cholesteatoma epithelium was CK14- and CK16-positive, and CK8/18- and CK19-negative. A similar pattern of CK expression was found in otitis externa. In otitis media, ciliated epithelium stained CK8/18- and CK19-positive in all layers, CK14-positive in the basal layers, and CK16-negative. The mean PIs in cholesteatomata and otitides were 18.8 and 17.8, respectively. The immunohistochemical pattern of CK expression in cholesteatomata, when compared with chronic otitis, was suggestive of hyperproliferative epithelium, but its origin could not be demonstrated. Comparable PI values were obtained in cholesteatoma and in chronic otitis, which confirmed that Ki67 is a valuable indicator of a hyperproliferative state, but not a predictor of aggressiveness. PMID:24775276

  13. Behavioral and psychological characteristics of canine victims of abuse. (United States)

    McMillan, Franklin D; Duffy, Deborah L; Zawistowski, Stephen L; Serpell, James A


    Abuse is an intentional act that causes harm to an individual. Dogs (Canis familiaris) with a known or suspected history of abuse were solicited for the study. A panel of 5 experts in canine behavior and abuse selected the dogs judged as having a certain or near certain history of being abused for inclusion in the study. Behavioral evaluations of the dogs were obtained using the Canine Behavioral Assessment and Research Questionnaire, which utilizes ordinal scales to rate either the intensity or frequency of the dog's behaviors. Sixty-nine dogs ultimately met the criteria for inclusion in the study. When compared with a convenience sample of 5,239 companion dogs, abused dogs were reported as displaying significantly higher rates of aggression and fear directed toward unfamiliar humans and dogs, excitability, hyperactivity, attachment and attention-seeking behaviors, persistent barking, and miscellaneous strange or repetitive behaviors. Delineating the behavioral and psychological characteristics of abused dogs provides the first step in identifying and distinguishing the risk factors and sequelae associated with abuse, which may inform the development of preventive and therapeutic programs for nonhuman animal abuse. PMID:25257564

  14. Isolation and characterization of glycoproteins from canine tracheal pouch secretions. (United States)

    Liao, T H; Blumenfeld, O O; Park, S S


    Canine tracheal pouch secretions were solubilized with 1% sodium dodecyl sulfate and visualized by sodium dodecyl sulfate-agarose-acrylamide gel electrophoresis. Intact mucus, and water-soluble and insoluble fractions of mucus were shown to be composed of high molecular weight glycoproteins (Mr greater than or equal to 3 . 10(6)) and three major classes of proteins of lower molecular weight (Mr approximately 4 . 10(5), 2 . 10(5), and 6 . 10(4)). When the mucus secretions were further treated with a reducing agent, the glycoproteins were dissociated into subunits which appeared on the gel as three discrete bands. Separation of the high molecular weight glycoproteins from the other proteins was achieved by gel filtration on Biogel A-15m in the presence of 1% dodecyl sulfate following reduction and alkylation of mucus. These glycoproteins were further resolved, using DEAE cellulose chromatography in the presence of 6 M urea, into two protein fractions. Both fractions contained approximately 87% carbohydrate, high amounts of serine and threonine but differed significantly in contents of N-acetyl glucosamine and sialic acid; their mobility on gel electrophoresis was also different. Significant contents of cysteine were noted in both fractions. Results of this study indicate that the canine tracheal pouch preparations provide normal tracheal secretions which bear similarity in structure to the tracheobronchial secretions obtained from human patients. PMID:454656

  15. Serum antibodies to Malassezia yeasts in canine atopic dermatitis. (United States)

    Nuttall, T J; Halliwell, R E


    Significant numbers of humans with atopic dermatitis develop Malassezia-specific IgE. Immediate skin-test reactivity to Malassezia has been demonstrated in atopic dogs. The aim of this study was to compare the serum IgG and IgE response to Malassezia in atopic dogs with and without clinical evidence of Malassezia dermatitis and/or otitis, nonatopic dogs with clinical evidence of Malassezia dermatitis and/or otitis and healthy dogs. Cytology was used to diagnose clinically significant Malassezia dermatitis and otitis. Contact plate cultures confirmed the validity of this technique. Reproducible enzyme-linked immunosorbent assays for Malassezia-specific IgG and IgE in canine serum were established. Atopic dogs had significantly higher serum IgG and IgE levels than either healthy dogs or nonatopic dogs with clinical evidence of Malassezia dermatitis and/or otitis. There was no significant difference in IgG and IgE levels between atopic dogs with and without clinical evidence of Malassezia dermatitis and/or otitis. The implications of these findings in the pathogenesis and management of canine atopic dermatitis are discussed. PMID:11844222

  16. Humoral and Cellular Immune Response in Canine Hypothyroidism. (United States)

    Miller, J; Popiel, J; Chełmońska-Soyta, A


    Hypothyroidism is one of the most common endocrine diseases in dogs and is generally considered to be autoimmune in nature. In human hypothyroidism, the thyroid gland is destroyed by both cellular (i.e. autoreactive helper and cytotoxic T lymphocytes) and humoral (i.e. autoantibodies specific for thyroglobulin, thyroxine and triiodothyronine) effector mechanisms. Other suggested factors include impaired peripheral immune suppression (i.e. the malfunction of regulatory T cells) or an additional pro-inflammatory effect of T helper 17 lymphocytes. The aim of this study was to evaluate immunological changes in canine hypothyroidism. Twenty-eight clinically healthy dogs, 25 hypothyroid dogs without thyroglobulin antibodies and eight hypothyroid dogs with these autoantibodies were enrolled into the study. There were alterations in serum proteins in hypothyroid dogs compared with healthy controls (i.e. raised concentrations of α-globulins, β2- and γ-globulins) as well as higher concentration of acute phase proteins and circulating immune complexes. Hypothyroid animals had a lower CD4:CD8 ratio in peripheral blood compared with control dogs and diseased dogs also had higher expression of interferon γ (gene and protein expression) and CD28 (gene expression). Similar findings were found in both groups of hypothyroid dogs. Canine hypothyroidism is therefore characterized by systemic inflammation with dominance of a cellular immune response.

  17. Transmission dynamics and prospects for the elimination of canine rabies.

    Directory of Open Access Journals (Sweden)

    Katie Hampson


    Full Text Available Rabies has been eliminated from domestic dog populations in Western Europe and North America, but continues to kill many thousands of people throughout Africa and Asia every year. A quantitative understanding of transmission dynamics in domestic dog populations provides critical information to assess whether global elimination of canine rabies is possible. We report extensive observations of individual rabid animals in Tanzania and generate a uniquely detailed analysis of transmission biology, which explains important epidemiological features, including the level of variation in epidemic trajectories. We found that the basic reproductive number for rabies, R0, is very low in our study area in rural Africa (approximately 1.2 and throughout its historic global range (<2. This finding provides strong support for the feasibility of controlling endemic canine rabies by vaccination, even near wildlife areas with large wild carnivore populations. However, we show that rapid turnover of domestic dog populations has been a major obstacle to successful control in developing countries, thus regular pulse vaccinations will be required to maintain population-level immunity between campaigns. Nonetheless our analyses suggest that with sustained, international commitment, global elimination of rabies from domestic dog populations, the most dangerous vector to humans, is a realistic goal.

  18. Canine distemper virus detection by different methods of One-Step RT-qPCR


    Claudia de Camargo Tozato; Vívian Ferreira Zadra; Caroline Rodrigues Basso; João Pessoa Araújo Junior


    ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR) assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A) and a One-Step RT-qPCR combined with NESTED-qPCR (system B). Limits of detection for both systems were determined using a serial dilution of Canine Distemper...

  19. Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro

    Directory of Open Access Journals (Sweden)

    Cintia Xavier de Mello


    Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.

  20. Genetic characterization of canine distemper virus involved in outbreaks in farmed mink in Denmark 2012

    DEFF Research Database (Denmark)

    Trebbien, Ramona; Struve, T.; Hjulsager, Charlotte Kristiane;

    Danish farmed mink herds experienced a large outbreak of canine distemper virus in 2012. Full-length sequence analysis (1824 nucleotides) of the variable hemagglutinin (H) gene were performed on 27 viruses collected from mink and on 7 viruses collected from wild foxes. Results of the study showed...... phylogenetically with other European canine distemper viruses and showed the highest level of similarity (99.3 - 99.6 %) to viruses isolated from wild foxes in Germany. The fox should therefore be considered as an important wild life reservoir of canine distemper virus and may also contribute to the transmission...

  1. Assessment of Periodontal Status of Surgically Exposed and Orthodontically Aligned Impacted Maxillary Canines

    Directory of Open Access Journals (Sweden)

    Adina Coșarcă


    Full Text Available Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of teeth. Conclusions: The assessed periodontal indices may signal the appearance of a periodontal disease around the teeth that were surgically and orthodontically treated

  2. Canine faecal contamination and parasitic risk in the city of Naples (southern Italy

    Directory of Open Access Journals (Sweden)

    Veneziano Vincenzo


    Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between

  3. Prevalence of canine monocitic ehrlichiosis and canine thrombocytic anaplasmosis in dogs suspected of hemoparasitosis in Cuiabá Mato Grosso

    Directory of Open Access Journals (Sweden)

    Rute Witter


    Full Text Available The present study evaluated Canine Monocytic Ehrlichiosis and Canine Thrombocytic Anaplasmosis in 77 dogs treated at the Veterinary Hospital (HOVET of the Federal University of Mato Grosso (UFMT in 2009. An association among clinical and hematological, serological and molecular data was investigated. Dogs were evaluated by partial amplification of dsb and 16S rRNA of Ehrlichia canis and Anaplasma platys and by Indirect Fluorescence Antigen Test (IFAT for E. canis. DNA of E. canis and A. platys were detected in 18 (23.3% and 07 (9.1% dogs respectively. Fifty four (70.1% dogs were positive by IFAT with titers ranging from 40 to 327,680. There were higher frequencies of E. canis positive PCR in dogs less than 12 months old, with anemia, lymphopenia and thrombocytopenia (P?0.05. Leukopenic dogs presented tendency to be A. platys PCR positive (P=0.07. Thrombocytopenia and hyperproteinemia of dogs were associated with high anti-E. canis antibody titers (P?0.05. Lymphadenopathy and pulmonary changes were observed in 15 (30.6% and 4 (57.1% E. canis PCR positive dogs (P?0.05. No other clinical features were associated between E. canis and A. platys infected dogs. E. canis was the only specie of Ehrlichia detected in dogs attended at the HOVET with a higher infection rate in young dogs, and statistically associated with anemic and thrombocytopenic dogs. On the other side, A. platys presented low occurrence among evaluated dogs.

  4. Immunological changes in canine peripheral blood leukocytes triggered by immunization with first or second generation vaccines against canine visceral leishmaniasis. (United States)

    Araújo, Márcio Sobreira Silva; de Andrade, Renata Aline; Sathler-Avelar, Renato; Magalhães, Camila Paula; Carvalho, Andréa Teixeira; Andrade, Mariléia Chaves; Campolina, Sabrina Sidney; Mello, Maria Norma; Vianna, Leonardo Rocha; Mayrink, Wilson; Reis, Alexandre Barbosa; Malaquias, Luiz Cosme Cotta; Rocha, Luciana Morais; Martins-Filho, Olindo Assis


    In this study, we summarized the major phenotypic/functional aspects of circulating leukocytes following canine immunization with Leishvaccine and Leishmune®. Our findings showed that Leishvaccine triggered early changes in the innate immunity (neutrophils and eosinophils) with late alterations on monocytes. Conversely, Leishmune(®) induced early phenotypic changes in both, neutrophils and monocytes. Moreover, Leishvaccine triggered mixed activation-related phenotypic changes on T-cells (CD4+ and CD8+ and B-lymphocytes, whereas Leishmune(®) promoted a selective response, mainly associated with CD8+ T-cell activation. Mixed cytokine profile (IFN-γ/IL-4) was observed in Leishvaccine immunized dogs whereas a selective pro-inflammatory pattern (IFN-γ/NO) was induced by Leishmune® vaccination. The distinct immunological profile triggered by Leishvaccine and Leishmune® may be a direct consequence of the distinct biochemical composition of these immunobiological, i.e. complex versus purified Leishmania antigen along with Bacillus Calmette-Guérin (BCG) versus saponin adjuvant. Both immunobiologicals are able to activate phagocytes and CD8+ T-cells and therefore could be considered as a putative vaccines against canine visceral leishmaniasis (CVL).

  5. The potential of canine sentinels for reemerging Trypanosoma cruzi transmission (United States)

    Neyra, Ricardo Castillo; Chu, Lily Chou; Quispe-Machaca, Victor; Ancca-Juarez, Jenny; Malaga Chavez, Fernando S.; Mazuelos, Milagros Bastos; Naquira, Cesar; Bern, Caryn; Gilman, Robert H.; Levy, Michael Z.


    Background Chagas disease, a vector-borne disease transmitted by triatomine bugs and caused by the parasite Trypanosoma cruzi, affects millions of people in the Americas. In Arequipa, Peru, indoor residual insecticide spraying campaigns are routinely conducted to eliminate Triatoma infestans, the only vector in this area. Following insecticide spraying, there is risk of vector return and reinitiation of parasite transmission. Dogs are important reservoirs of T. cruzi and may play a role in reinitiating transmission in previously sprayed areas. Dogs may also serve as indicators of reemerging transmission. Methods We conducted a cross-sectional serological screening to detect T. cruzi antibodies in dogs, in conjunction with an entomological vector collection survey at the household level, in a disease endemic area that had been treated with insecticide 13 years prior. Spatial clustering of infected animals and vectors was assessed using Ripley’s K statistic, and the odds of being seropositive for dogs proximate to infected colonies was estimated with multivariate logistic regression. Results There were 106 triatomine-infested houses (41.1%), and 45 houses infested with T. cruzi-infected triatomine insects (17.4%). Canine seroprevalence in the area was 12.3% (n=154); all seropositive dogs were 9 months old or older. We observed clustering of vectors carrying the parasite, but no clustering of seropositive dogs. The age- and sex-adjusted odds ratio between seropositivity to T. cruzi and proximity to an infected triatomine (≤50m) was 5.67 (95% CI: 1.12 – 28.74; p=0.036). Conclusions Targeted control of reemerging transmission can be achieved by improved understanding of T. cruzi in canine populations. Our results suggest that dogs may be useful sentinels to detect re-initiation of transmission following insecticide treatment. Integration of canine T. cruzi blood sampling into existing interventions for zoonotic disease control (e.g. rabies vaccination programs

  6. Enhanced adherence of methicillin-resistant Staphylococcus pseudintermedius sequence type 71 to canine and human corneocytes

    DEFF Research Database (Denmark)

    Latronico, Francesca; Moodley, Arshnee; Nielsen, Søren Saxmose;


    adherence properties between MRSP and methicillin-susceptible (MSSP) strains. Four MRSP, including a human and a canine strain belonging to ST71 and two canine non-ST71 strains, and three genetically unrelated MSSP were tested on corneocytes collected from five dogs and six humans. All strains were fully......The recent worldwide spread of methicillin-resistant Staphylococcus pseudintermedius (MRSP) in dogs is a reason for concern due to the typical multidrug resistance patterns displayed by some MRSP lineages such as sequence type (ST) 71. The objective of this study was to compare the in vitro....... pseudintermedius adherence to canine corneocytes was significantly higher compared to human corneocytes (p human origin adhered equally well to canine and human corneocytes, suggesting that MRSP ST71 may be able to adapt to human skin. The genetic basis of the enhanced...

  7. Epidemiological Survey on Canine Parvovirus Disease in Taizhou Region,Jiangsu Province,China

    Institute of Scientific and Technical Information of China (English)

    Yuan; Weifeng; Liu; Jing; Zhao; Xuegang; Lu; Jiang; Zheng; Xiaoliang; Zhu; Hongfei


    The canine parvovirus disease is an acute infectious disease caused by canine parvovirus(CPV). It is clinically characterized by severe vomiting,hemorrhagic enteritis,significant reduction in white blood cells and myocarditis. The disease with high incidence,highly infectious and high mortality has become one of the serious infectious diseases threatening dog raising industry in China. In this research,260 cases of canine parvovirus case from an Aite Pet Clinic in Taizhou City during January 2010 and March 2011 were analyzed. This study discloses the epidemiology of CPV in Taizhou region of Jiangsu Province,i. e.,the incidence of CPV and canine motility are closely correlated with age,breed,immune inoculation and season. This study provides useful guide for the clinical treatment of CPV in the future.

  8. Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012-2013

    DEFF Research Database (Denmark)

    Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted;


    During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit in...... distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine...... distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case...

  9. Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease

    Directory of Open Access Journals (Sweden)

    Andrew Specht


    Full Text Available A canine model of Glycogen storage disease type Ia (GSDIa is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size, and longer lifespan compared to other animal models. Use of this model in preclinical trials of gene therapy is described and briefly compared to the murine model. Although the canine model offers a number of advantages for evaluating potential therapies for GSDIa, there are also some significant challenges involved in its use. Despite these challenges, the canine model of GSDIa should continue to provide valuable information about the potential for generating curative therapies for GSDIa as well as other genetic hepatic diseases.

  10. A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article

    Directory of Open Access Journals (Sweden)

    S. Gur


    Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.

  11. A retrospective investigation of canine adenovirus (CAV) infection in adult dogs in Turkey. (United States)

    Gür, S; Acar, A


    Canine adenovirus (CAV) type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serum samples were collected from native pure-bred Kangal(n = 11), and Akbash dogs (n = 17) and Turkish Greyhounds (n = 15) in Eskişehir and Konya provinces. None of the dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2%, 93.3% and 100% prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51) were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3%) were detected as seropositive. In total, 82 of 94 dogs (87.2%) were found to be positive for CAV serum antibodies. PMID:19831268

  12. Four cases of cell cannibalism in highly malignant feline and canine tumors. (United States)

    Ferreira, Fernando Costa; Soares, Maria João; Carvalho, Sandra; Borralho, Liliana; Vicente, Gonçalo; Branco, Sandra; Correia, Jorge; Peleteiro, Maria Conceição


    Four cases of tumors in which cell internalization was frequently visualized are reported: one feline mammary carcinoma, one feline cutaneous squamous cell carcinoma, one canine pulmonary squamous cell carcinoma and one canine pleural mesothelioma. Cell internalization was observed by cytology in two of these cases (the feline mammary tumour and the pleural effusion in the canine mesothelioma) and by histopathology in all but the canine mesothelioma. Immunohistochemical staining for pancytokeratin was positive for both internalized and host cells, while E-cadherin expression was frequently absent, although internalized cells occasionally stained positive. This cell-to-cell interaction seems to be associated with tumors displaying a strong epithelial-mesenchymal transitional phenotype, in which cancer cells become engulfed by other cancer cells. Such event could be regarded as an important hallmark of very high malignancy. PMID:26525147

  13. Radiographic assessment of dental anomalies in patients with ectopic maxillary canines

    DEFF Research Database (Denmark)

    Sørensen, Helle Budtz; Artmann, Lone; Larsen, Helle Juul;


    International Journal of Paediatric Dentistry 2008 Background. The aetiology of palatally and labially located ectopic maxillary canines is multifactorial. Accordingly, early prediction of this eruptional disturbance is in most cases not possible. Aim. The purpose of this study was to analyse...... dental deviations in cases with either palatal or labial ectopic canines. Design. Panoramic and intra-oral radiographs from 50 patients with palatally located (38 females and 12 males) and 19 patients with labially located ectopic canines (11 females and 8 males), aged 10 years, 2 months-18 years, 1...... month, were analysed. Dental deviations registered were crown and root malformations, agenesis, and eruption deviations. Registrations were performed in the maxillary incisor field and in the dentition in general. Results. The study documented that palatally as well as labially located ectopic canines...

  14. Establishment of a Canine Rabies Burden in Haiti through the Implementation of a Novel Surveillance Program


    Wallace, Ryan M.; Reses, Hannah; Franka, Richard; Dilius, Pierre; Fenelon, Natael; Orciari, Lillian; Etheart, Melissa; Destine, Apollon; Crowdis, Kelly; Blanton, Jesse D; Francisco, Calvin; Ludder, Fleurinord; Del Rio Vilas, Victor; Haim, Joseph; Millien, Max


    The Republic of Haiti is one of only several countries in the Western Hemisphere in which canine rabies is still endemic. Estimation methods have predicted that 130 human deaths occur per year, yet existing surveillance mechanisms have detected few of these rabies cases. Likewise, canine rabies surveillance capacity has had only limited capacity, detecting only two rabid dogs per year, on average. In 2013, Haiti initiated a community-based animal rabies surveillance program comprised of two c...

  15. Serosurvey for canine distemper virus exposure in dogs in communal lands in Zimbabwe


    Kelly, P. J.; G. Musuka; G. Nic Eoghin; J.B.U. Tebje-Kelly; Carter, S.


    Sera from 173 apparently healthy, unvaccinated dogs from 4 widely separated communal lands in Zimbabwe were tested by ELISA for antibodies against canine distemper virus. Overall, 82 % were positive with high prevalences found in each communal land. The highest seroprevalence was in dogs between 1 and 2 years of age (91 %; 49/54). These results show dogs in the communal lands of Zimbabwe are commonly exposed to canine distemper virus and that a substantial number survive infection. The role t...

  16. Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012–2013


    Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted; Andresen, Lars; Chriél, Mariann; Hagberg, Emma; Jensen, Mette Kragh; Hansen, Mette Sif; Hjulsager, Charlotte Kristiane; Struve, Tina


    Background During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit in biosecurity on the mink farms. The aim of this study was to investigate the extent and association of specific biosecurity measures with the outbreak. The study was carried out in an epidemiologic...

  17. Canine Distemper Viral Inclusions in Blood Cells of Four Vaccinated Dogs


    McLaughlin, Bruce G.; Adams, Pamela S.; Cornell, William D.; Elkins, A. Darrel


    Four cases of canine distemper were detected by the presence of numerous cytoplasmic inclusions in various circulating blood cells. Fluorescent antibody techniques and electron microscopy confirmed the identity of the viral inclusions. The cases occurred in the same geographic area and within a short time span. All four dogs had been vaccinated against canine distemper, but stress or other factors may have compromised their immune status. The possibility of an unusually virulent virus strain ...

  18. Canine distemper virus infection in a lesser grison (Galictis cuja): first report and virus phylogeny


    Jane Megid; Teixeira, Carlos R; Adriana Cortez; Heinemann, Marcos B; Antunes, João M.A.P.; Felipe Fornazari; Fabricio B. Rassy; Richtzenhain, Leonardo J


    Infectious diseases in wild animals have been increasing as a result of their habitat alterations and closer contact with domestic animals. Canine distemper virus (CDV) has been reported in several species of wild carnivores, presenting a threat to wildlife conservation. We described the first case of canine distemper virus infection in lesser grison (Galictis cuja). A free-ranging individual, with no visible clinical sigs, presented sudden death after one day in captivity. Molecular diagnosi...

  19. LeishVet guidelines for the practical management of canine leishmaniosis


    Bourdeau Patrick; Ferrer Luis; Pennisi Maria; Cardoso Luis; Koutinas Alek; Miró Guadalupe; Solano-Gallego Laia; Oliva Gaetano; Baneth Gad


    Abstract The LeishVet group has formed recommendations designed primarily to help the veterinary clinician in the management of canine leishmaniosis. The complexity of this zoonotic infection and the wide range of its clinical manifestations, from inapparent infection to severe disease, make the management of canine leishmaniosis challenging. The recommendations were constructed by combining a comprehensive review of evidence-based studies, extensive clinical experience and critical consensus...

  20. Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease


    Andrew Specht; Laurie Fiske; Kirsten Erger; Travis Cossette; John Verstegen; Martha Campbell-Thompson; Struck, Maggie B.; Young Mok Lee; Chou, Janice Y.; Byrne, Barry J; Correia, Catherine E.; Mah, Cathryn S.; Weinstein, David A.; Conlon, Thomas J.


    A canine model of Glycogen storage disease type Ia (GSDIa) is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size,...

  1. Major HGF-mediated regenerative pathways are similarly affected in human and canine cirrhosis


    Spee, Bart; Arends, Brigitte; van den Ingh, Ted SGAM; Roskams, Tania; Rothuizen, Jan; Penning, Louis C


    Background The availability of non-rodent animal models for human cirrhosis is limited. We investigated whether privately-owned dogs (Canis familiaris) are potential model animals for liver disease focusing on regenerative pathways. Several forms of canine hepatitis were examined: Acute Hepatitis (AH), Chronic Hepatitis (CH), Lobular Dissecting Hepatitis (LDH, a specific form of micronodulair cirrhosis), and Cirrhosis (CIRR). Canine cirrhotic samples were compared to human liver samples from ...

  2. Hepatitis in skunks caused by the virus of infectious canine hepatitis. (United States)

    Karstad, L; Ramsden, R; Berry, T J; Binn, L N


    Two cases of acute, fatal, hepatitis occurred in young, striped skunks (Mephitis mephitis) trapped in southern Ontario. Histologically, lesions in the liver were similar to infectious canine hepatitis. A virus was isolated which produced large intranuclear inclusions in dog kidney cell cultures. These inclusions were Feulgen-positive and fluoresced green with acridine orange stain. The skunk hepatitis isolate was identified as the virus of infectious canine hepatitis by virus neutralization tests. PMID:172663

  3. Age and Diet Affect Gene Expression Profile in Canine Skeletal Muscle


    Middelbos, Ingmar S.; Brittany M Vester; Lisa K Karr-Lilienthal; Schook, Lawrence B; Swanson, Kelly S.


    We evaluated gene transcription in canine skeletal muscle (biceps femoris) using microarray analysis to identify effects of age and diet on gene expression. Twelve female beagles were used (six 1-year olds and six 12-year olds) and they were fed one of two experimental diets for 12 months. One diet contained primarily plant-based protein sources (PPB), whereas the second diet contained primarily animal-based protein sources (APB). Affymetrix GeneChip Canine Genome Arrays were used to hybridiz...

  4. Spontaneous remission in canine myasthenia gravis: implications for assessing human MG therapies. (United States)

    Shelton, G D; Lindstrom, J M


    The natural course of autoimmune canine MG was determined in 53 dogs with muscular weakness and a positive acetylcholine receptor antibody titer. Dogs were treated with anticholinesterase therapy, without immunosuppression. Spontaneous clinical and immunologic remission occurred in 47 of 53 dogs within an average of 6.4 months. Neoplasia was identified in the six dogs that did not spontaneously remit. This study questions the value of using canine MG in studies designed to assess the effect of immunotherapies. PMID:11739846

  5. Sagittal, vertical and transversal dimensions of the maxillary complex in patients with ectopic maxillary canines

    DEFF Research Database (Denmark)

    Larsen, H J; Sørensen, H B; Artmann, L;


    To analyse the craniofacial maxillary complex in cases with labially and palatally located ectopic canines, subgrouped accordingly: Group I: no deviations in the dentition; Group IIa: deviations in the maxillary incisors only; Group IIb: deviations in the dentition in general.......To analyse the craniofacial maxillary complex in cases with labially and palatally located ectopic canines, subgrouped accordingly: Group I: no deviations in the dentition; Group IIa: deviations in the maxillary incisors only; Group IIb: deviations in the dentition in general....

  6. Comparison of sexual dimorphism of permanent mandibular canine with mandibular first molar by odontometrics (United States)

    Agrawal, Aditi; Manjunatha, Bhari Shranesha; Dholia, Bhavik; Althomali, Yousef


    Background and Objectives: Sexual dimorphism is one of important tool of forensic science. The objective of this study is to assess the dimorphic status of mesio-distal (MD) and bucco-lingual (BL) diameter of mandibular canine with mandibular first molar among the students of dental college. This study is of definite significance as sex chromosomes and hormonal production influenced tooth morphology. Materials and Methods: The descriptive study adopted the purposive sampling technique, of 50 male and 50 female aged 17-25 years, using study casts for mesio-distal and bucco-lingual dimensions of mandibular canine with mandibular first molar were taken using digital Vernier caliper. The data obtained were subjected to statistical analysis using descriptive statistics and t-test to compare MD and BL dimensions in male and female populations and P ≤ 0.05 was found statistically significant. Results: Sexual dimorphism can be predicted by measuring mesiodistal dimension of mandibular canine and mandibular first molar. The left mandibular canine showed more sexual dimorphism (12.66%) in comparison to left mandibular first molar (0.824%) only. Right mandibular canine showed greater dimorphism in MD dimensions (10.94%) in comparison to right mandibular first molar (6.96%). In bucco-lingual dimensions mandibular canine showed less variability when compared with mandibular first molar, thus our study showed more significance on mesio-distal dimensions of both teeth. Conclusion: The present study concludes statistically significant sexual dimorphism in mandibular canine over mandibular first molar on study casts. The MD dimensions in mandibular canine and mandibular first molar can help in determining sex and identification of unknown person. PMID:26816466

  7. Phylogenetic analysis of Austrian canine distemper virus strains from clinical samples from dogs and wild carnivores. (United States)

    Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K


    Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.

  8. Effects of thymol on calcium and potassium currents in canine and human ventricular cardiomyocytes


    Magyar, János; Szentandrássy, Norbert; Bányász, Tamás; Fülöp, László; Varró, András; Nánási, Péter P


    Concentration-dependent effects of thymol (1–1000 μM) was studied on action potential configuration and ionic currents in isolated canine ventricular cardiomyocytes using conventional microelectrode and patch clamp techniques.Low concentration of thymol (10 μM) removed the notch of the action potential, whereas high concentrations (100 μM or higher) caused an additional shortening of action potential duration accompanied by progressive depression of plateau and reduction of Vmax.In the canine...

  9. The feasibility of canine rabies elimination in Africa: dispelling doubts with data


    Lembo, T.; Hampson, K.; Kaare, M.T.; Ernest, E.; Knobel, D.; Kazwala, R.R.; Haydon, D. T.; Cleaveland, S.


    Background: Canine rabies causes many thousands of human deaths every year in Africa, and continues to increase throughout much of the continent. Methodology/Principal Findings: This paper identifies four common reasons given for the lack of effective canine rabies control in Africa: (a) a low priority given for disease control as a result of lack of awareness of the rabies burden; (b) epidemiological constraints such as uncertainties about the required levels of vaccination coverage and...

  10. Canines in the Classroom: Boccaccio, Dante, and the Visual Arts

    Directory of Open Access Journals (Sweden)

    Julia Cozzarelli


    Full Text Available The article has two primary objectives: it presents an analysis of the representation of animals in selected Italian literary works; and it utilizes that analysis as an example of how to incorporate the visual arts in teaching literature in the undergraduate classroom. The literary works discussed include Dante’s Inferno and the myth of Romulus and Remus as preparation for Boccaccio’s Decameron, specifically novelle IX.7 and V.8, with a thematic focus on portrayals of canines. The article argues that the use of artwork from the medieval and Renaissance periods, such as statuary, illustrated manuscripts, images in bestiaries, and works by Botticelli and other well-known artists, can be used to complement and reinforce interpretations of the texts, and are a powerful and effective tool in the learning process.

  11. Leishmania spp. Epidemiology of Canine Leishmaniasis in the Yucatan Peninsula

    Directory of Open Access Journals (Sweden)

    A. López-Céspedes


    Full Text Available Canine Leishmaniasis is widespread in various Mexican states, where different species of Leishmania have been isolated from dogs. In the present study, we describe the detection of L. braziliensis, L. infantum, and L. mexicana in serum of dogs from the states of Yucatan and Quintana Roo in the Yucatan Peninsula (Mexico. A total of 412 sera were analyzed by ELISA using the total extract of the parasite and the iron superoxide dismutase excreted by different trypanosomatids as antigens. We found the prevalence of L. braziliensis to be 7.52%, L. infantum to be 6.07%, and L. mexicana to be 20.63%, in the dog population studied. The results obtained with ELISA using iron superoxide dismutase as the antigen were confirmed by western blot analysis with its greater sensitivity, and the agreement between the two techniques was very high.

  12. KRAS Mutations in Canine and Feline Pancreatic Acinar Cell Carcinoma. (United States)

    Crozier, C; Wood, G A; Foster, R A; Stasi, S; Liu, J H W; Bartlett, J M S; Coomber, B L; Sabine, V S


    Companion animals may serve as valuable models for studying human cancers. Although KRAS is the most commonly mutated gene in human ductal pancreatic cancers (57%), with mutations frequently occurring at codons 12, 13 and 61, human pancreatic acinar cell carcinomas (ACCs) lack activating KRAS mutations. In the present study, 32 pancreatic ACC samples obtained from 14 dogs and 18 cats, including seven metastases, were analyzed for six common activating KRAS mutations located in codons 12 (n = 5) and 13 (n = 1) using Sequenom MassARRAY. No KRAS mutations were found, suggesting that, similar to human pancreatic ACC, KRAS mutations do not play a critical role in feline or canine pancreatic ACC. Due to the similarity of the clinical disease in dogs and cats to that of man, this study confirms that companion animals offer potential as a suitable model for investigating this rare subtype of pancreatic carcinoma. PMID:27290644


    Directory of Open Access Journals (Sweden)

    I. N. Bashir, Z. I. Chaudhry, S. Ahmed and M. A. Saeed


    Full Text Available Canine babesiosis is increasing in incidence and prevalence and is now a major problem in dogs. During this study, a total of 6204 dogs were examined for babesiosis over a 12 month period from January to December, 2006 in Lahore and 2.62% were found positive. The dogs were grouped on the basis of their age, sex and breed and season of the year. The male dogs were more prone to disease than female dogs (3.39 vs. 1.32%, whereas the incidence of disease was higher in younger dogs (6.9% than older age groups. Crossbreds were more prone to the infection (10.9% than purebreds. However, none of them were completely resistant. Warm and humid season played a key role in the spread of disease. Predominant vector of the disease was found to be Rhipicephalus species.

  14. [The canine neuronal ceroid-lipofuscinosis: a review]. (United States)

    Karli, P; Karol, A; Oevermann, A; Drögemüller, C; Gorgas, D; Henke, D


    The present article gives a survey over the current scientific knowledge of the canine neuronal ceroid-lipofuscinosis (NCL). NCL is a heterogenous group of lysosomal storage diseases in humans and animals. In consequence of a gene mutation, there is an accumulation of ceroid-lipofuscin in neurons, cells of the retina and the skin and other cells. The stored ceroid-lipofuscin in neurons leads to an impaired cell function and subsequently to cell death. Recently, the underlying genetic defect was discovered in several dog breeds. Genetic testing permits an ante mortem diagnosis of the disease, which up to now was only possible with a positive biopsy result. Another advantage is the identification of carrier animals to eliminate the deleterious alleles. PMID:25183673

  15. Serological Survey of Canine Leptospirosis in Southern China

    Directory of Open Access Journals (Sweden)

    Dayou Shi1§, Mingchao Liu§, Shining Guo1, Shenquan Liao2, Mingfei Sun2, Jianzhu Liu*, Lin Wang, Zhenyong Wang, Shujing Wang, Dubao Yang and Tongjie Chai


    Full Text Available The present study conducts a serological survey on the presence of canine leptospirosis in domestic dogs using ELISA kit. A total of 314 household dogs (168 females and 146 males in Chongqing, Kunming, Nanchang, Fuzhou, Guangzhou, Shenzheng, and Nanning in Southern China were examined. Of the 314 dogs, 23 (7.3% were seropositive for leptospirosis. No statistically significant difference was observed in terms of sex and age in the seroprevalence of leptospirosis, but statistically significant differences were observed among different regional groups in the seroprevalence of leptospirosis (P<0.05. The results of this survey indicate that the control and treatment of leptospirosis have been effective in some cities of Southern China. However, further implementation of integrated strategies is necessary to prevent and control leptospirosis in dogs.

  16. Antibiogram of bacterial species isolated from canine pyometra

    Directory of Open Access Journals (Sweden)

    Madhu Swamy


    Full Text Available Aim: The aim of the present work was to ascertain the bacterial flora causing pyometra in female dogs and their antibiotic sensitivity. Materials and Methods: A study was conducted to determine the antibiogram of bacterial species isolated from 20 female dogs diagnosed with pyometra. The vaginal discharge was collected by sterile swab and streaked smoothly over Mueller Hinton medium and sensitivity towards antibiotics was determined by measuring the zone of inhibition using a Hi-media scale. Results: The antobiogram showed that Gentamicin was the most sensitive (85% antibiotic followed by Enrofloxacin, Ciprofloxacin and Amoxicillin (65%, 65% and 55%, respectively. The isolates were most resistant to Oxytetracycline (85% followed by Tetracycline, Ampicillin, Chloramphenicol, Cloxacillin and Erythromycin (80%, 80%, 75%, 70% and 70%, respectively. Conclusion: Gentamicin was found to be most effective antibiotic against the bacterial species isolated from canine pyometra. [Vet World 2013; 6(8.000: 546-549

  17. Cytological diagnostic of canine transmissible venereal tumor - Case report

    Directory of Open Access Journals (Sweden)

    Ulčar Igor


    Full Text Available Canine Transmissible Venereal Tumor (CTVT is a benign reticuloendothelial (histiocytic tumor of the dog that mainly affects the external genitalia. This tumor was found in male 2 years old mongrel dog. According the anamnestic data, there was no visible change of its general clinical status, except spontaneous bleeding with blood drops on the praeputium and the presence of blood in the urine. With clinical examination a multilobular mass on radix penis mucosa was found, which actually caused pseudohemorrhagia. The material for cytological diagnostic was taken with the imprint method and 4 cytological films were prepared and strained. The conclusion of the cytological diagnosis was CTVT. The tumor cause only local disturbances, and the differential diagnosis of the other "round cells tumors", histiocytomas, plasmacytomas, lymphoma, some melanomas and especially lymphosarcomas, which could be located on the external genitalia, had a big significance. Although some authors are mentioning spontaneous regression, however, because this is invasive tumor, a complete chirurgical excision was made.

  18. Distribution and characterization of canine Chagas disease in Texas. (United States)

    Kjos, S A; Snowden, K F; Craig, T M; Lewis, B; Ronald, N; Olson, J K


    Although acute and chronic cases of canine Chagas disease have been reported from multiple areas in the southern region of the United States, little data are available on current disease occurrence patterns in endemic areas. Therefore, a study to assess frequency, geographic distribution, signalment, and clinical spectrum of Chagas disease in domestic dogs from Texas was conducted. Serology, histopathology, and clinical case records from multiple institutions for the time period 1993-2007 were analyzed. A total of 537 serologically and/or histopathologically confirmed cases were documented. Cases were reported from 48 of 254 counties within Texas, covering all major geographic regions. Forty-eight dog breeds were represented among the cases, primarily in the sporting and working groups. In histopathologically confirmed cases, acute death occurred in 42%, approximately half of which were ecoregions of Texas, affecting a broad range of dog breeds and age groups. PMID:18255233

  19. Evidence supporting the conceptual framework of cancer chemoprevention in canines. (United States)

    Kondratyuk, Tamara P; Adrian, Julie Ann Luiz; Wright, Brian; Park, Eun-Jung; van Breemen, Richard B; Morris, Kenneth R; Pezzuto, John M


    As with human beings, dogs suffer from the consequences of cancer. We investigated the potential of a formulation comprised of resveratrol, ellagic acid, genistein, curcumin and quercetin to modulate biomarkers indicative of disease prevention. Dog biscuits were evaluated for palatability and ability to deliver the chemopreventive agents. The extent of endogenous DNA damage in peripheral blood lymphocytes from dogs given the dietary supplement or placebo showed no change. However, H2O2-inducible DNA damage was significantly decreased after consumption of the supplement. The expression of 11 of 84 genes related to oxidative stress was altered. Hematological parameters remained in the reference range. The concept of chemoprevention for the explicit benefit of the canine is compelling since dogs are an important part of our culture. Our results establish a proof-of-principle and provide a framework for improving the health and well-being of "man's best friend". PMID:27216246

  20. Canine visceral leishmaniasis on Margarita Island (Nueva Esparta, Venezuela). (United States)

    Zerpa, O; Ulrich, M; Negrón, E; Rodríguez, N; Centeno, M; Rodríguez, V; Barrios, R M; Belizario, D; Reed, S; Convit, J


    The frequency of American visceral leishmaniasis affecting humans on Margarita Island, Venezuela, has increased in recent years, and infected dogs appear to constitute the principal source of infection. ELISA tests with Leishmania donovani promastigotes and rK39 antigen from L. chagasi in serum from 541 dogs were positive in 33.1% and 21.6% of the samples, respectively. A second blood sample taken from 50 animals after 8-10 months revealed an increase from 24% to 40% of ELISA positivity to both antigens, suggesting high susceptibility and transmission in the canine population. Among 42 serologically positive dogs, 33% of which showed clinical signs of disease, 79% were positive in polymerase chain reactions using primers specific for the L. donovani complex. Control measures including epidemiological hypersurveillance, the humane sacrifice of infected dogs, and rapid diagnosis and treatment of human cases have been initiated. PMID:11132371

  1. EGFR and microvessel density in canine malignant mammary tumours. (United States)

    Carvalho, Maria Isabel; Guimarães, Maria João; Pires, Isabel; Prada, Justina; Silva-Carvalho, Ricardo; Lopes, Carlos; Queiroga, Felisbina L


    The epidermal growth factor receptor (EGFR) is a transmembrane tyrosine kinase receptor which has been shown to have an important role in human breast cancer. Its role appears to be associated with increased angiogenesis and metastasis. In order to clarify its role in canine mammary tumours (CMT), 61 malignant neoplasms were studied by using immunohistochemistry, comparing expression of EGFR, microvessel density (MVD) by CD31 immunolabelling and characteristics of tumour aggressiveness. High EGFR immunoexpression was statistically significantly associated with tumour size, tumour necrosis, mitotic grade, histological grade of malignancy and clinical stage. High CD31 immunoreactivity was statistically significantly associated with tubule formation, histological grade of malignancy and clinical stage. A positive correlation between EGFR and CD31 immunoexpression (r = 0.843; P aggression in malignant CMT, presenting the possibility of using EGFR inhibitors in the context of metastatic disease treatment. PMID:24091029

  2. Epinephrine-enhanced computed tomographic arthrography of the canine shoulder. (United States)

    De Rycke, Lieve; van Bree, Henri; Van Caelenberg, Annemie; Polis, Ingeborgh; Duchateau, Luc; Gielen, Ingrid


    The aim of this study was to investigate the effect of epinephrine-enhanced computed tomographic arthrography (CTA) on the image sharpness of the lateral and medial glenohumeral ligaments (LGHL and MGHL, respectively), biceps tendon (BT) and joint cartilage (JC) in the canine shoulder. The shoulders of eight normal dogs were examined using a 4-slice helical CT scanner. The right shoulders were injected with Iohexol and the left shoulders with a mixture of Iohexol and epinephrine. CTA images were obtained after 1, 3, 5, 9, 13, 20 and 30 min and the image sharpness of the intra-articular structures in both shoulders was graded for visibility. The attenuation values were measured to examine the persistence of contrast appearance. Admixture of epinephrine and Iohexol significantly improved the image sharpness of the LGHL and the BT, especially on delayed CTA images. The use of epinephrine did not negatively affect post-CTA recovery.

  3. Coblation of the canine vocal fold: a histologic study. (United States)

    Divi, Venu; Benninger, Michael; Kiupel, Matti; Dobbie, Allison


    Controlled ablation (coblation) is a radiofrequency bipolar method of tissue ablation, which destroys tissue at very low temperatures. It has been used in a variety of clinical settings and is most frequently used by the otolaryngologist for tonsillectomy. In this study, we have examined the effect of coblation on the canine larynx by applying coblation to the vocal fold and harvesting the larynx on postoperative days (PODs) 0, 4, and 7. Histologic examination was performed with a variety of stains to examine the healing process. Coblation injury demonstrated complete epithelialization by POD 7. No injury to the underlying vocalis muscle was seen. The inflammatory response demonstrates less inflammation than previously reported with CO(2) laser injury. Coblation is a viable method for removal of tissue from the vocal fold resulting in minimal scar formation and a controlled depth of injury. Further studies should be performed to determine clinical utility in the removal of lesions such as respiratory papillomatosis.

  4. Low-Field Magnetic Resonance Imaging of Canine Hydrocephalus

    Directory of Open Access Journals (Sweden)

    Z. Adamiak* and M. Jaskólska and A. Pomianowski1


    Full Text Available The aim of presented study was to evaluate selected surface spine coil, and low-field magnetic resonance (MR selected sequences in diagnosing hydrocephalus in dogs. This paper discusses 19 dogs (14 canine patients with hydrocephalus and 5 healthy dogs, of five breeds, subjected to low-field magnetic resonance imaging (MRI of hydrocephalus. Area of the lateral ventricles and brain were examined in dogs with hydrocephalus using low-field MRI (at 0.25 Tesla. The MRI of FSE REL, SE, FLAIR, STIR, 3D HYCE, T3DT1, GE STIR 3D and 3D SHARC sequences with an indication of the most effective sequences are described. Additionally, coils for MR were compared, and models for infusion anesthesia were described. As a result of performed study all estimated sequences were diagnostically useful. However, spinal coil No. 2 (ESAOTE was the most optimal for examining and positioning the cranium.

  5. Evaluation of the status of canine hydrotherapy in the UK. (United States)

    Waining, M; Young, I S; Williams, S B


    To establish the current status of canine hydrotherapy in the UK and to ascertain information regarding the current use of hydrotherapy, a questionnaire was sent to 152 hydrotherapy centres throughout the UK, from which 89 responded. Hydrotherapy was found to be a rapidly growing business. Stand-alone centres were in existence; however, many centres were connected to other businesses, including boarding kennels and general practice veterinary surgeries. The dogs using the facility were mainly pedigree breeds, particularly labrador retrievers (30 per cent), and the most commonly encountered conditions were rupture of the cranial cruciate ligament (25 per cent), hip dysplasia (24 per cent) and osteoarthritis (18 per cent). The proportion of qualified versus unqualified staff varied between centres, highlighting a need for improved regulation of this aspect of the industry. However, all the dogs treated by the hydrotherapy centres surveyed were direct veterinary referrals, suggesting a good degree of professionalism in the field and a high regard for the benefits of hydrotherapy.

  6. Canine angiostrongylosis: recent advances in diagnosis, prevention, and treatment

    Directory of Open Access Journals (Sweden)

    Di Cesare A


    Full Text Available Angela Di Cesare, Donato Traversa Faculty of Veterinary Medicine, University of Teramo, Teramo, Italy Abstract: Angiostrongylus vasorum is a parasitic nematode affecting the heart and pulmonary arteries of wild (eg, foxes and domestic canids. The parasite has an indirect life cycle in which slugs and snails act as intermediate hosts. In the last few years the parasite has spread outside the traditional endemic foci, and there is a rise of documented cases of canine angiostrongylosis across Europe. Angiostrongylus vasorum causes cardiopulmonary disorders and coagulopathies, along with different nonspecific clinical signs. Fatal infections are frequently reported. Given the severity of the infection and the recent geographic spreading of the parasite, this article reviews and discusses the current knowledge of A. vasorum, with a special focus on recent insights on diagnosis, prevention, and treatment of dog angiostrongylosis. Keywords: Angiostrongylus vasorum, dog, epidemiology, diagnostic approaches, control, therapy


    Watts, Dominique E; Benson, Anna-Marie


    We collected blood samples from wolves ( Canis lupus ) on the Alaska Peninsula, southwest Alaska, US, 2006-11 and tested sera for antibodies to canine adenovirus (CAV), canine coronavirus (CCV), canine distemper virus (CDV), canine herpesvirus (CHV), canine parainfluenza (CPI), canine parvovirus (CPV), Neospora caninum , and Toxoplasma gondii . Detected antibody prevalence was 90% for CAV, 28% for CCV, 12% for CDV, 93% for CHV, 0% for CPI, 20% for CPV, 0% for N. caninum, and 86% for T. gondii . Prevalence of CCV antibodies suggested a seasonal pattern with higher prevalence during spring (43%) than in fall (11%). Prevalence of CCV antibodies also declined during the 6-yr study with high prevalence during spring 2006-08 (80%, n=24) and low prevalence during spring 2009-11 (4%, n=24). Prevalence of N. caninum and T. gondii antibodies were highly variable in the study area during 2006-11. Results suggested that some pathogens might be enzootic on the Alaska Peninsula (e.g., CAV and CHV) while others may be epizootic (e.g., CCV, N. caninum , T. gondii ). PMID:27195683

  8. Antigen profiling analysis of vaccinia virus injected canine tumors: oncolytic virus efficiency predicted by boolean models. (United States)

    Cecil, Alexander; Gentschev, Ivaylo; Adelfinger, Marion; Nolte, Ingo; Dandekar, Thomas; Szalay, Aladar A


    Virotherapy on the basis of oncolytic vaccinia virus (VACV) strains is a novel approach for cancer therapy. In this study we describe for the first time the use of dynamic boolean modeling for tumor growth prediction of vaccinia virus GLV-1h68-injected canine tumors including canine mammary adenoma (ZMTH3), canine mammary carcinoma (MTH52c), canine prostate carcinoma (CT1258), and canine soft tissue sarcoma (STSA-1). Additionally, the STSA-1 xenografted mice were injected with either LIVP 1.1.1 or LIVP 5.1.1 vaccinia virus strains.   Antigen profiling data of the four different vaccinia virus-injected canine tumors were obtained, analyzed and used to calculate differences in the tumor growth signaling network by type and tumor type. Our model combines networks for apoptosis, MAPK, p53, WNT, Hedgehog, TK cell, Interferon, and Interleukin signaling networks. The in silico findings conform with in vivo findings of tumor growth. Boolean modeling describes tumor growth and remission semi-quantitatively with a good fit to the data obtained for all cancer type variants. At the same time it monitors all signaling activities as a basis for treatment planning according to antigen levels. Mitigation and elimination of VACV- susceptible tumor types as well as effects on the non-susceptible type CT1258 are predicted correctly. Thus the combination of Antigen profiling and semi-quantitative modeling optimizes the therapy already before its start.

  9. 犬瘟热的诊治%Diagnosis and Treatment of Canine Distemper

    Institute of Scientific and Technical Information of China (English)

    罗厚强; 段龙川; 王清艳; 涂宜强; 涂国众


    Canine distemper is an acute infectious disease caused by the canine distemper virus in Canidae. Many symptoms were characterized by infected dogs, such as biphasic fever, rhinitis, severe inflammation of the digestive tract and respiratory inflammation. The pathogen, epidemiology, clinical symptoms and pathological changes of canine distemper were introduced in the paper. Though a typical case of canine distemper, a series of effective measures to treat canine distemper were introduced in order to provide reference for the control of canine distemper.%犬瘟热是一种由犬瘟热病毒引起的犬科动物急性传染病,病犬以双相热、鼻炎、严重的消化障碍和呼吸道炎症为特征。主要对该病的病原、流行病学、临床症状及病理变化等作一阐述,并以一例犬瘟热典型病例的诊治为例,介绍了治疗该病的有效措施,以期为有效防治犬瘟热提供参考。

  10. A comparative study between mixed-type tumours from human salivary and canine mammary glands

    International Nuclear Information System (INIS)

    In comparative pathology, canine mammary tumours have special interest because of their similarities with human breast cancer. Mixed tumours are uncommon lesions in the human breast, but they are found most frequently in the mammary gland of the female dogs and in the human salivary glands. The aim of the study was to compare clinical, morphological and immunohistochemical features of human salivary and canine mammary gland mixed tumours, in order to evaluate the latter as an experimental model for salivary gland tumours. Ten examples of each mixed tumour type (human pleomorphic adenoma and carcinomas ex-pleomorphic adenomas and canine mixed tumour and metaplastic carcinoma) were evaluated. First, clinical and morphologic aspects of benign and malignant variants were compared between the species. Then, streptavidin-biotin-peroxidase immunohistochemistry was performed to detect the expression of cytokeratins, vimentin, p63 protein, estrogen receptor, β-catenin, and E-cadherin. After standardization, similar age and site distributions were observed in human and canine tumours. Histological similarities were identified in the comparison of the benign lesions as well. Metaplastic carcinomas also resembled general aspects of carcinomas ex-pleomorphic adenomas in morphological evaluation. Additionally, immunohistochemical staining further presented similar antigenic expression between lesions. There are many similar features between human salivary and canine mammary gland mixed tumours. This observation is of great relevance for those interested in the study and management of salivary gland tumours, since canine lesions may constitute useful comparative models for their investigations

  11. Immunoglobulin G concentration in canine colostrum: Evaluation and variability. (United States)

    Mila, Hanna; Feugier, Alexandre; Grellet, Aurélien; Anne, Jennifer; Gonnier, Milène; Martin, Maelys; Rossig, Lisa; Chastant-Maillard, Sylvie


    Canine neonates are born hypogammaglobulinemic, and colostrum is their main source of immunoglobulins. The purpose of this study was to evaluate the immune quality of canine colostrum and its variability both among bitches and among mammary glands. The immune quality was estimated from immunoglobulin G (IgG) concentration (ELISA test). The correlation of IgG concentration with refractometry was evaluated. From a total of 44 bitches from 13 different breeds from a single breeding kennel, samples of colostrum and blood were collected one day after the parturition onset. Colostrum was collected separately from each pair of mammary glands (180 pairs). The mean colostrum IgG concentration in our population was 20.8 ± 8.1g/L (ranging from 8.0 to 41.7 g/L) with no influence of breed size, litter size, age of dam or serum IgG concentration. Colostrum IgG concentration varied widely among pairs of mammary glands within one bitch (variation coefficient: 42 ± 32.1%). Nevertheless, no single pair of mammary glands was found to produce regularly a secretion of higher quality. No difference in IgG concentration was recorded between anterior and posterior pairs either. The BRIX index and the refractive index were significantly, but moderately correlated with colostrum IgG concentration (r=0.53 and 0.42, respectively). This study demonstrates a great variability in immune quality of colostrum among bitches and among mammary glands within one bitch. Further studies on the suckling behavior of puppies and on determination of the minimal immune quality of colostrum are required to evaluate their impact of this high variability on neonatal mortality in dogs. PMID:26186389

  12. Genomic prediction of traits related to canine hip dysplasia

    Directory of Open Access Journals (Sweden)

    Enrique eSanchez-Molano


    Full Text Available Increased concern for the welfare of pedigree dogs has led to development of selection programs against inherited diseases. An example is canine hip dysplasia (CHD, which has a moderate heritability and a high prevalence in some large-sized breeds. To date, selection using phenotypes has led to only modest improvement, and alternative strategies such as genomic selection may prove more effective. The primary aims of this study were to compare the performance of pedigree- and genomic-based breeding against CHD in the UK Labrador retriever population and to evaluate the performance of different genomic selection methods. A sample of 1179 Labrador Retrievers evaluated for CHD according to the UK scoring method (hip score, HS was genotyped with the Illumina CanineHD BeadChip. Twelve functions of HS and its component traits were analyzed using different statistical methods (GBLUP, Bayes C and Single-Step methods, and results were compared with a pedigree-based approach (BLUP using cross-validation. Genomic methods resulted in similar or higher accuracies than pedigree-based methods with training sets of 944 individuals for all but the untransformed HS, suggesting that genomic selection is an effective strategy. GBLUP and Bayes C gave similar prediction accuracies for HS and related traits, indicating a polygenic architecture. This conclusion was also supported by the low accuracies obtained in additional GBLUP analyses performed using only the SNPs with highest test statistics, also indicating that marker-assisted selection would not be as effective as genomic selection. A Single-Step method that combines genomic and pedigree information also showed higher accuracy than GBLUP and Bayes C for the log-transformed HS, which is currently used for pedigree based evaluations in UK. In conclusion, genomic selection is a promising alternative to pedigree-based selection against CHD, requiring more phenotypes with genomic data to improve further the accuracy

  13. Safety assessment of potential food ingredients in canine hepatocytes. (United States)

    Zhang, Leshuai W; Koci, Juraj; Jeffery, Brett; Riviere, Jim E; Monteiro-Riviere, Nancy A


    This research aimed to develop in vitro methods to assess hazard of canine food ingredients. Canine hepatocytes were harvested and cell viability of clove-leaf oil (CLO), eugenol (EUG), lemongrass oil (LGO), guanosine monophosphate (GMP), inosine monophosphate (IMP), sorbose, ginger-root extract (GRE), cinnamon-bark oil (CBO), cinnamaldehyde (CINA), thymol oil (TO), thymol (THYM), and citric acid were assessed with positive controls: acetaminophen (APAP), aflatoxin B1 and xylitol. Molecular Toxicology PathwayFinder array (MTPF) analyzed toxicity mechanisms for LGO. LC50 for APAP was similar among human (3.45), rat (2.35), dog (4.26 mg/ml). Aflatoxin B1 had an LC50 of 4.43 (human), 5.78 (rat) and 6.05 (dog) µg/ml; xylitol did not decrease viability. LC50 of CLO (0.185 ± 0.075(SD)), EUG (0.165 ± 0.112), LGO (0.220 ± 0.012), GRE (1.54 ± 0.31) mg/ml; GMP (166.03 ± 41.83), GMP + IMP (208.67 ± 15.27) mM; CBO (0.08 ± 0.03), CINA (0.11 ± 0.01), TO (0.21 ± 0.03), THYM (0.05 ± 0.01), citric acid (1.58 ± 0.08) mg/ml, while sorbose was non-toxic. LGO induced upregulation of 16 and down-regulation of 24 genes, which CYP and heat shock most affected. These results suggest that in vitro assays such as this may be useful for hazard assessment of food ingredients for altered hepatic function. PMID:25660481

  14. Immunohistochemical detection of estrogen receptors in canine mammary tumors

    Directory of Open Access Journals (Sweden)

    Elena Atanaskova Petrov


    Full Text Available Mammary tumors are among the most common neoplasms in intact female dogs.They have a complex morphology, usually affecting middle age and older bitches. Almost 50% of the mammary tumors in dogs are malignant neoplasms. Prognosis is based on several factors: stage, age, tumor size, metastasis, histopathology, ovariectomy status and hormone-receptor activity. Immunohistochemical (IHC measurement has become increasingly an important diagnostic and prognostic parameter, with the development of monoclonal antibodies against nuclear estrogen and progestin receptors. The aim of this study was to detect the presence of ER receptors in malignant canine mammary tumors and to identify their association with the clinical course of the tumor. Mammary tumor samples have been obtained by mastectomy from dogs presented at our clinic. Detailed clinical examination, CBC and basic serum biochemical profile were performed in all patients. Surgery was the only treatment. Histopathological examination and immunohistochemical detection of estrogen α receptors (ERα was performed on 8 formalin-fixed, paraffin-embedded tissue samples, using the PT LINK immunoperoxidase technique. Histopathological examination of the mammary tumor samples (n=11 revealed tubular adenocarcinoma (n=6,54.5% and ductal adenocarcinoma (n=3, 27.3%, one patient with benign adenoma and one with mastitis. Patients with positive ER tumors are alive, without remission, while 3 of the patients that were ER negative died due to lung metastases. According to our results, it can be concluded that the appearance and development of canine mammary tumors is highly connected with ovarian steroid hormones and that immunostaining of the tumors may be used as a good prognostic parameter in these patients.

  15. Surgical construction of a novel simulated carotid siphon in canines

    International Nuclear Information System (INIS)

    Objective: To develop in vivo carotid siphon models by surgical method using the shaped devices for testing the performance of covered stent specially designed for intracranial vascular diseases. Methods: Six carotid siphon-shaped devices were established using stereolithographic biomodeling and the lost-wax technique. Six canines underwent surgery to expose and isolate bilateral CCA. The right CCA origin was ligated and incised distal to the ligation point after the distal right CCA was temporarily closed. The distal left CCA was ligated and incised proximal to the ligation point after the left CCA origin was closed. The proximal isolated left CCA was passed through the shaped device. The distal isolated right CCA and the proximal isolated left CCA were anastomosed end-to-end. Finally, the shaped device of carotid siphon was fixed with suture and embedded in the left neck. The intraarterial DSA was performed on postprocedural 7 days, 2 weeks and 1 month. The morphological characteristics of carotid siphon models were visually evaluated by two observers. The patency of siphon model and the stenosis of anastomotic stoma were followed-up. Results: All animals tolerated the surgical procedure well with mean model time construction of 90 minutes. The morphological characteristics of siphon models were similar to those in human. The anastomotic stoma stenosis occurred in 2 siphon models, and thrombosis of anastomotic stoma in 1, but all siphons of these models were patent on post-procedural follow-up angiography. Conclusion: Surgical construction of an in vivo carotid siphon model of canine with shaped device is practically feasible. This model can be used for testing neurovascular devices. (authors)

  16. Crowdsourcing reproducible seizure forecasting in human and canine epilepsy (United States)

    Wagenaar, Joost; Abbot, Drew; Adkins, Phillip; Bosshard, Simone C.; Chen, Min; Tieng, Quang M.; He, Jialune; Muñoz-Almaraz, F. J.; Botella-Rocamora, Paloma; Pardo, Juan; Zamora-Martinez, Francisco; Hills, Michael; Wu, Wei; Korshunova, Iryna; Cukierski, Will; Vite, Charles; Patterson, Edward E.; Litt, Brian; Worrell, Gregory A.


    See Mormann and Andrzejak (doi:10.1093/brain/aww091) for a scientific commentary on this article.   Accurate forecasting of epileptic seizures has the potential to transform clinical epilepsy care. However, progress toward reliable seizure forecasting has been hampered by lack of open access to long duration recordings with an adequate number of seizures for investigators to rigorously compare algorithms and results. A seizure forecasting competition was conducted on using open access chronic ambulatory intracranial electroencephalography from five canines with naturally occurring epilepsy and two humans undergoing prolonged wide bandwidth intracranial electroencephalographic monitoring. Data were provided to participants as 10-min interictal and preictal clips, with approximately half of the 60 GB data bundle labelled (interictal/preictal) for algorithm training and half unlabelled for evaluation. The contestants developed custom algorithms and uploaded their classifications (interictal/preictal) for the unknown testing data, and a randomly selected 40% of data segments were scored and results broadcasted on a public leader board. The contest ran from August to November 2014, and 654 participants submitted 17 856 classifications of the unlabelled test data. The top performing entry scored 0.84 area under the classification curve. Following the contest, additional held-out unlabelled data clips were provided to the top 10 participants and they submitted classifications for the new unseen data. The resulting area under the classification curves were well above chance forecasting, but did show a mean 6.54 ± 2.45% (min, max: 0.30, 20.2) decline in performance. The model using open access data and algorithms generated reproducible research that advanced seizure forecasting. The overall performance from multiple contestants on unseen data was better than a random predictor, and demonstrates the feasibility of seizure forecasting in canine and

  17. Comparative expression pathway analysis of human and canine mammary tumors

    Directory of Open Access Journals (Sweden)

    Marconato Laura


    Full Text Available Abstract Background Spontaneous tumors in dog have been demonstrated to share many features with their human counterparts, including relevant molecular targets, histological appearance, genetics, biological behavior and response to conventional treatments. Mammary tumors in dog therefore provide an attractive alternative to more classical mouse models, such as transgenics or xenografts, where the tumour is artificially induced. To assess the extent to which dog tumors represent clinically significant human phenotypes, we performed the first genome-wide comparative analysis of transcriptional changes occurring in mammary tumors of the two species, with particular focus on the molecular pathways involved. Results We analyzed human and dog gene expression data derived from both tumor and normal mammary samples. By analyzing the expression levels of about ten thousand dog/human orthologous genes we observed a significant overlap of genes deregulated in the mammary tumor samples, as compared to their normal counterparts. Pathway analysis of gene expression data revealed a great degree of similarity in the perturbation of many cancer-related pathways, including the 'PI3K/AKT', 'KRAS', 'PTEN', 'WNT-beta catenin' and 'MAPK cascade'. Moreover, we show that the transcriptional relationships between different gene signatures observed in human breast cancer are largely maintained in the canine model, suggesting a close interspecies similarity in the network of cancer signalling circuitries. Conclusion Our data confirm and further strengthen the value of the canine mammary cancer model and open up new perspectives for the evaluation of novel cancer therapeutics and the development of prognostic and diagnostic biomarkers to be used in clinical studies.

  18. Evaluation of the use of serum C-reactive protein concentration to predict outcome in puppies infected with canine parvovirus

    DEFF Research Database (Denmark)

    McClure, Vanessa; van Schoor, Mirinda; Thompson, Peter N.;


    Objective-To evaluate associations of serum C-reactive protein (CRP) concentration with duration of hospitalization and with outcome in puppies with canine parvoviral enteritis. Design-Prospective observational study. Animals-79 client-owned puppies with naturally acquired canine parvovirus.......7%, respectively (considered moderately accurate). Conclusions and Clinical Relevance-Although serum CRP concentration was associated with outcome in puppies with canine parvovirus enteritis, it did not prove to be a good predictor of outcome when used alone....

  19. A pRb-responsive, RGD-modified, and Hyaluronidase-armed Canine Oncolytic Adenovirus for Application in Veterinary Oncology


    Laborda, Eduardo; Puig-Saus, Cristina; Rodriguez-García, Alba; Moreno, Rafael; Cascalló, Manel; Pastor, Josep; Alemany, Ramon


    Human and canine cancer share similarities such as genetic and molecular aspects, biological complexity, tumor epidemiology, and targeted therapeutic treatment. Lack of good animal models for human adenovirotherapy has spurred the use of canine adenovirus 2-based oncolytic viruses. We have constructed a canine oncolytic virus that mimics the characteristics of our previously published human adenovirus ICOVIR17: expression of E1a controlled by E2F sites, deletion of the pRb-binding site of E1a...

  20. Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus

    Directory of Open Access Journals (Sweden)



    Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.

  1. Comparative photoelastic study of dental and skeletal anchorages in the canine retraction

    Directory of Open Access Journals (Sweden)

    Cristiane Aparecida de Assis Claro


    Full Text Available OBJECTIVE: To compare dental and skeletal anchorages in mandibular canine retraction by means of a stress distribution analysis. METHODS: A photoelastic model was produced from second molar to canine, without the first premolar, and mandibular canine retraction was simulated by a rubber band tied to two types of anchorage: dental anchorage, in the first molar attached to adjacent teeth, and skeletal anchorage with a hook simulating the mini-implant. The forces were applied 10 times and observed in a circular polariscope. The stresses located in the mandibular canine were recorded in 7 regions. The Mann-Whitney test was employed to compare the stress in each region and between both anchorage systems. The stresses in the mandibular canine periradicular regions were compared by the Kruskal-Wallis test. RESULTS: Stresses were similar in the cervical region and the middle third. In the apical third, the stresses associated with skeletal anchorage were higher than the stresses associated with dental anchorage. The results of the Kruskal-Wallis test showed that the highest stresses were identified in the cervical-distal, apical-distal, and apex regions with the use of dental anchorage, and in the apical-distal, apical-mesial, cervical-distal, and apex regions with the use of skeletal anchorage. CONCLUSIONS: The use of skeletal anchorage in canine retraction caused greater stress in the apical third than the use of dental anchorage, which indicates an intrusive component resulting from the direction of the force due to the position of the mini-implant and the bracket hook of the canine.

  2. Multi-drug resistance in a canine lymphoid cell line due to increased P-glycoprotein expression, a potential model for drug-resistant canine lymphoma

    NARCIS (Netherlands)

    Zandvliet, M; Teske, E; Schrickx, J A


    Canine lymphoma is routinely treated with a doxorubicin-based multidrug chemotherapy protocol, and although treatment is initially successful, tumor recurrence is common and associated with therapy resistance. Active efflux of chemotherapeutic agents by transporter proteins of the ATP-Binding Casset

  3. Efficacy of canine influenza virus (H3N8) vaccine to decrease severity of clinical disease after co-challenge with canine influenza virus and Streptococcus equi subsp. Zooepidemicus (United States)

    Since first emerging into the North American canine population in 2004, canine influenza virus (CIV) subtype H3N8 has shown horizontal transmission among dogs, with a high level of adaptation to this species. Severity of disease is variable, and co-infection by other respiratory pathogens is an impo...

  4. Canine Mammary Carcinomas: A Comparative Analysis of Altered Gene Expression

    Directory of Open Access Journals (Sweden)

    Farruk M. Lutful Kabir


    Full Text Available Breast cancer represents the second most frequent neoplasm in humans and sexually intact female dogs after lung and skin cancers, respectively. Many similar features in human and dog cancers including, spontaneous development, clinical presentation, tumor heterogeneity, disease progression and response to conventional therapies have supported development of this comparative model as an alternative to mice. The highly conserved similarities between canine and human genomes are also key to this comparative analysis, especially when compared to the murine genome. Studies with canine mammary tumor (CMT models have shown a strong genetic correlation with their human counterparts, particularly in terms of altered expression profiles of cell cycle regulatory genes, tumor suppressor and oncogenes and also a large group of non-coding RNAs or microRNAs (miRNAs. Because CMTs are considered predictive intermediate models for human breast cancer, similarities in genetic alterations and cancer predisposition between humans and dogs have raised further interest. Many cancer-associated genetic defects critical to mammary tumor development and oncogenic determinants of metastasis have been reported and appear to be similar in both species. Comparative analysis of deregulated gene sets or cancer signaling pathways has shown that a significant proportion of orthologous genes are comparably up- or down-regulated in both human and dog breast tumors. Particularly, a group of cell cycle regulators called cyclin-dependent kinase inhibitors (CKIs acting as potent tumor suppressors are frequently defective in CMTs. Interestingly, comparative analysis of coding sequences has also shown that these genes are highly conserved in mammals in terms of their evolutionary divergence from a common ancestor. Moreover, co-deletion and/or homozygous loss of the INK4A/ARF/INK4B (CDKN2A/B locus, encoding three members of the CKI tumor suppressor gene families (p16/INK4A, p14ARF and p15

  5. Functional anatomy and ultrasound examination of the canine penis. (United States)

    Goericke-Pesch, Sandra; Hölscher, Catharina; Failing, Klaus; Wehrend, Axel


    The aim of this study was to identify the functional-anatomical structures of the canine penis during and after erection to demonstrate the respective changes to provide a basis for further examinations of pathological conditions like priapism. Additionally, a gray-scale analysis was performed to quantify results from the ultrasound examination. In total, 80 dogs were examined. In group (Gr.) A, 44 intact or castrated dogs were examined, and in Gr. B, 36 dogs were examined during erection and after complete detumescence of the penis. The following parameters were assessed: (1) using physical measurements: length of the Pars longa glandis [Plg] and length of the Bulbus glandis [Bg]; and (2) using ultrasound: total penile diameter, width of the erectile tissue of the Plg, diameter of the Corpus spongiosum [Cs] including the penile bone and urethra, vertical diameter, circumference of the penis, cross-sectional area, and area of the Cs including the urethra. The mentioned parameters could be assessed in all dogs of Gr. A and Gr. B with the only exception being the urethra that could be visualized using ultrasound in some dogs only and predominantly in the erected penis (Gr. B). Concomitantly, the erectile tissue of the Plg and the Cs was more heterogenous and hypo- to anechoic during erection compared with dogs in Gr. A and Gr. B after detumescence. Comparing the results in Gr. B, the length of the Plg and the Bg were decreased approximately 40.6% and 38.0%, the total width of the penis 40.5%, the total width of the erectile tissue of the Plg 48.0%, and the width of the Cs 15.6% during detumescence compared with erection. Comparing the decrease in size at the different locations (apex penis, middle of Plg, middle of Bg) for vertical diameter, total circumference, and cross-section area, it was largest at the Bg. B-mode ultrasound is a suitable tool to investigate not only the morpho-functional structures of the resting canine penis, but also of the erected and

  6. Canine atopic dermatitis / Dermatite atópica canina

    Directory of Open Access Journals (Sweden)

    Thalita da Costa Teles


    Full Text Available Canine Atopic Dermatitis is a skin disease of genetic origin. The affected dog becomes sensible to antigens presents in the environment, developing a severe alergic, pruriginous reaction, which intervenes in the quality of life of the patient. Because of the genetic character, that is an illness that in most of the times has no cure, just control. The treatment in general is lifetime. Thus, some used drugs, for example the corticosteroides, might cause collateral effects when used for a long time, and might decrease the lifetime of the animals. By this way, the owner of the dog with atopia, must know about the complications of the disease, and occasional return of the clinical signs during the period of treatment. Therefore, this article has an objective of a review about Canine Atopic Dermatitis that is an increasing problem in the small animal practice.A Dermatite Atópica Canina é uma dermatopatia de origem genética. Os cães acometidos tornam-se sensíveis aos antígenos presentes no meio ambiente, desenvolvendo grave reação alérgica, pruriginosa, que interferem na qualidade de vida do paciente. Devido ao seu caráter genético, esta é uma doença que na maioria das vezes não tem cura, apenas controle. O tratamento em geral é vitalício. Assim sendo, algumas drogas utilizadas, a exemplo dos corticosteróides, podem causar efeitos colaterais que em longo prazo, são capazes de diminuir o período de vida do animal. Desta maneira, o proprietário do cão portador de atopia, precisa ser esclarecido em relação às complicações e provável recidiva dos sinais clínicos, durante o período de tratamento. Portanto, presente artigo tem como objetivo uma revisão sobre Dermatite Atópica Canina, que está se tornando um problema crescente na clínica de pequenos animais.

  7. Cutaneous immune mechanisms in canine leishmaniosis due to Leishmania infantum. (United States)

    Papadogiannakis, E I; Koutinas, A F


    Canine leishmaniosis (CanL) caused by the parasite Leishmania infantum is a systemic disease with variable clinical signs. The disease is endemic in the Mediterranean countries and dogs are the main domestic reservoir of the parasite. The quite complicated immune response against the parasite is crucial for the evolution of CanL infection with the skin playing a major role in its immunopathogenesis. After the inoculation of Leishmania promastigotes into the dermis by sand fly bites, complement factors, Langerhan's cells, neutrophils, fibroblasts and keratinocytes are involved in the activation of the innate arm of the skin immune system, with the macrophages and dendritic cells to play a major key role. The effective activation of cellular immunity is the cornerstone of dog's resistance against the parasite. Promastigotes reaching the dermis are engulfed, processed and transferred by APCs to draining lymph nodes to stimulate naïve T-cells for proliferation and differentiation into armed effector T-cells. Th1 cells activate the infected macrophages to kill Leishmania, whereas Th2 cells divert the immune response to humoral immunity and down regulation of cellular immunity with Th1 cell anergy. Inhibition of co-stimulatory molecules expression by infected macrophages contributes to T-cell anergy. In canine subclinical infections cutaneous lymphocytic infiltrate and parasites are absent, as opposed to dogs with clinical leishmaniosis. CD8+ cells constitute a significant population of cellular immunity in CanL since they outnumber CD4+ cells in the dermis, producing IFN-γ in sub clinically infected dogs and high levels of IL-4 in dogs with clinical leishmaniosis. Numerous B-lymphocytes have been shown to heavily infiltrate the dermis at least in exfoliative dermatitis in CanL. A mixed Th1/Th2 cytokine profile has been found in the dermis of naturally infected with L. infantum dogs. In the skin of dogs with clinical leishmaniosis, where plasma cells outnumber T

  8. Emerging insights into the genetic basis of canine hip dysplasia

    Directory of Open Access Journals (Sweden)

    Ginja M


    Full Text Available Mário Ginja,1 Ana Rita Gaspar,1 Catarina Ginja,2,3 1Department of Veterinary Sciences-CITAB, University of Trás-os-Montes and Alto Douro, Vila Real, Portugal; 2Ce3C – Centro de Ecologia, Evolução e Alterações Ambientais, Faculdade de Ciências, Universidade de Lisboa, Lisboa, Portugal; 3CIBIO-InBIO – Centro de Investigação em Biodiversidade e Recursos Genéticos, Universidade do Porto, Vairão, Portugal Abstract: Canine hip dysplasia (CHD is the most common inherited polygenic orthopedic trait in dogs with the phenotype influenced also by environmental factors. This trait was described in the dog in 1935 and leads to a debilitating secondary hip osteoarthritis. The diagnosis is confirmed radiographically by evaluating signs of degenerative joint disease, incongruence, and/or passive hip joint laxity. There is no ideal medical or surgical treatment so prevention based on controlled breeding is the optimal approach. The definitive CHD diagnosis based on radiographic examination involves the exposure to ionizing radiation under general anesthesia or heavy sedation but the image does not reveal the underlying genetic quality of the dog. Phenotypic expression of CHD is modified by environmental factors and dogs with a normal phenotype can be carriers of some mutations and transmit these genes to their offspring. Programs based on selection of dogs with better individual phenotypes for breeding are effective when strictly applied but remain inferior to the selection of dogs based on estimation of breeding values. Molecular studies for dissecting the genetic basis of CHD are ongoing, but progress has been slow. In the future, the recommended method to improve hip quality in controlled breeding schemes, which will allow higher selection pressure, would be based on the estimation of the genomic breeding value. Since 2012, a commercial DNA test has been available for Labrador Retrievers using a blood sample and provides a probability for

  9. Heterogeneity in stabilization phenomena in FLT PET images of canines (United States)

    Simoncic, Urban; Jeraj, Robert


    3ʹ-(18F)fluoro-3ʹ-deoxy-L-thymidine (FLT) is a PET marker of cellular proliferation. Its tissue uptake rate is often quantified with a Standardized Uptake Value (SUV), although kinetic analysis provides a more accurate quantification. The purpose of this study is to investigate the heterogeneity in FLT stabilization phenomena. The study was done on 15 canines with spontaneously occurring sinonasal tumours. They were imaged dynamically for 90 min with FLT PET/CT twice; before and during the radiotherapy. Images were analyzed for kinetics on a voxel basis through compartmental analysis. Stabilization curves were calculated as a time-dependant correlation between the time-dependant SUV and the kinetic parameters (voxel values within the tumour were correlated). Stabilization curves were analyzed for stabilization speed, maximal correlation and correlation decrease following the maximal correlation. These stabilization parameters were correlated with the region-averaged kinetic parameters. The FLT SUV was highly correlated with vasculature fraction immediately post-injection, followed by maximum in correlation with the perfusion/permeability. At later times post-injection the FLT SUV was highly correlated (Pearson correlation coefficient above 0.95) with the FLT influx parameter for cases with tumour-averaged SUV30-50 min above 2, while others were indeterminate (correlation coefficients from 0.1 to 0.97). All cases with highly correlated SUV and FLT influx parameter had correlation coefficient within 0.5% of its maximum in the period of 30-50 min post-injection. Stabilization time was inversely proportional to the FLT influx rate. Correlation between the FLT SUV and FLT influx parameter dropped at later times post-injection with drop being proportional to the dephosphorylation rate. The FLT was found to be metabolically stable in canines. FLT PET imaging protocol should define minimal and maximal FLT uptake period, which would be 30-50 min for our patients

  10. Panoramic radiological study to identify locally displaced maxillary canines in Bangladeshi population

    Energy Technology Data Exchange (ETDEWEB)

    Alif, Sheikh Mohammad [Northern University, Dhaka (Bangladesh); Haque, Sejuty [Bangladesh Dental College, Dhaka (Bangladesh); Nimmi, Naima; Ashraf, Ali [AIKO Dental Clinic and Implant Centre, Dhaka (Bangladesh); Khan, Saeed Hossain; Khan, Mahfujul Haq [WHO Collaborating Centre and Ibrahim Medical College, Dhaka (Bangladesh)


    This study was performed to determine the prevalence of maxillary canine impaction on a basis of a single panoramic radiograph in Bangladeshi population. A random sample of seven hundred panoramic radiographs was collected from the patient record of a dental clinic. All the selected panoramic radiographs were taken from January 2009 to August 2010 by a single panoramic radiograph machine with the same exposure time (19 seconds) for all radiographs. One hundred and twenty panoramic radiographs were excluded to minimize the selection bias. In a dim lit room, an observer assessed the radiographs on a standard radiographic light box. The position of the impacted maxillary canine was recorded in line with the longitudinal axis of a tooth using the edge of a metal ruler. Data were subsequently put on SPSS 11.5 software and chi-square (x{sup 2}) tests were applied to find out the association. Among 580 panoramic radiographs it was found that impacted maxillary canines were present in only 7 (1.2%) radiographs. A statistical significant difference was found between the age of the patients and the vertical position of the impacted canines (p=0.000) and between the age of the patients and the horizontal position of the impacted canines (p=0.003). The prevalence was found to be low compared with the present study from the limitation of panoramic image. Further study needs to include three-dimensional imaging modality.

  11. Characterization and Comparison of Cancer Stem Cells in Human and Canine Glioma Cell Lines

    Directory of Open Access Journals (Sweden)

    Thomas Clements


    Full Text Available Gliomas are among the most common and malignantforms of primary brain tumors that occur naturally inhumans. They represent about 33% of brain tumorsand 80% of malignant brain tumors. Gliomas alsospontaneously arise in specific breeds in the canine family.Canine gliomas are histologically similar to human gliomaand have similar presentation and response to treatmentin the clinic. A comparison of canine and human gliomascould prove to be invaluable, because the acceptedrodent model has limitations when testing therapies andidentifying targets. Our goal is to obtain global proteinexpression and metabolic profiles of different classificationand grades of human and canine glioma, in order toidentify and compare the tumor survival strategies in bothsystems. Toward this end, we harvested and cultured cellsfrom a naturally occurring grade-3 oligodendrogliomatumor that was isolated from a canine patient at the PurdueUniversity Veterinary Teaching Hospital. Similar to cellsfrom human glioma, these cells formed neurosphereswhen cultured in serum free media in the presence of FGFand EGF. The cells were also sensitive to plating densityand oxygen concentrations.This work was supported by the National Institutes ofHealth, National Cancer Institute R25CA128770 CancerPrevention Internship Program administered by theOncological Sciences Center and the Discovery LearningResearch Center at Purdue University. This work wasalso supported by Showalter Research Foundation and aCollege of Technology Seed Grant.

  12. Genetic characterization of canine rotavirus isolated from a puppy in Korea and experimental reproduction of disease. (United States)

    Kang, Bo Kyu; Song, Dae Sub; Jung, Kwon Il; Lee, Chul Seung; Park, Sung Jun; Oh, Jin Sik; An, Dong Jun; Yang, Jeong Sun; Moon, Hyoung Joon; Lee, Sang Sun; Yoon, Young Dhuk; Park, Bong Kyun


    Canine rotavirus was isolated from feces of a Korean Jindo dog with mild diarrhea, and the isolate was genetically characterized. Rotaviral antigen was detected in the feces using a commercial rotavirus antigen detection kit and cytopathic effects were observed in a cell line inoculated with the feces. The virus isolate (GC/KS05) was identified as subtype G3P[3] using reverse transcription polymerase chain reaction (RT-PCR). The strain displayed 98% and 90% identity with the VP7 genes of a canine rotavirus isolate (RV52/96) from Italy and the simian rotavirus strain (RRV) respectively. However, the GC/KS05 isolate exhibited only 83% and 82% identity, respectively, with the G3 serotype canine strains, RV198/95 and K9. Phylogenetic analysis of the VP7 and VP4 genes of GC/KS05 strain led to the classification of VP7 in a different cluster than other canine rotavirus VP7 genes, and VP4 within the cluster of canine rotavirus VP4 genes. The Korean isolate was thus more closely related to the RV52/96 isolate than the other isolates for which sequence data is available. Detailed analysis of the VP7 region revealed 6 amino acid variations between the new isolate and RV52/96. After 5 passages in cell culture, the GC/KS05 strain remained pathogenic for young pups, in which inoculation resulted in diarrhea and virus shedding in the feces. PMID:17459836

  13. Molecular epidemiology of canine norovirus in dogs from Portugal, 2007–2011

    Directory of Open Access Journals (Sweden)

    Mesquita João


    Full Text Available Abstract Background Canine noroviruses (NoVs have been recently described in south European countries and associated with outbreaks of diarrhea in kennels. Unlike human NoV which are known as an important cause of acute gastroenteritis, little is known about the role of canine NoV as pathogens in dogs as well as its epidemiological features. Results From 2007–2011, 256 stool samples were collected from dogs across Portugal and tested by RT-PCR for canine NoV. Viral fecal shedding was found to be 23% (60/256. All sequences contained the GLPSG amino acid motif characteristic of the RNA-dependent RNA-polymerase gene of NoVs and had a high nucleotide identity (range 98%–100% to the canine NoV first described in Portugal. The highest shedding rate was detected during the winter months. Conclusions This study shows that canine NoV infection is endemic in the dog population of Portugal. Peak shedding was detected in the winter months, a well-known epidemiologic feature of human NoV infections.

  14. Stimulation with Concanavalin-A Induces IL-17 Production by Canine Peripheral T Cells

    Directory of Open Access Journals (Sweden)

    Michelle G. Ritt


    Full Text Available The characteristics of canine IL-17-producing cells are incompletely understood. Expression of mRNA encoding orthologs of IL-17 and the IL-17 receptor has been documented in tissues from dogs with arthritis, inflammatory bowel disease, and lymphoma; however, no associations have been found between IL-17 gene expression and disease phenotype in these conditions. Robust assessment of the role of IL-17-producing cells in dogs will require measuring the frequency of these cells in health and disease in balance with other lymphocyte subsets. The aim of this study was to confirm that the T-cell IL-17 response in dogs is evolutionarily conserved. Canine peripheral blood mononuclear cells were stimulated with Concanavalin A with or without polarizing cytokines. We used a canine specific IL-17 ELISA and flow cytometry to identify IL-17-producing T cells. Accumulation of intracellular IL-17 was observed in stimulated CD4 and CD8 T cells. The addition of pro-inflammatory cytokines appeared to enhance polarization of canine CD4 T cells to the Th17 phenotype. Conversely, the addition of IL-2 in the presence of TGF-β resulted in expansion of Treg cells. We conclude that canine IL-17-producing cells behave similarly to those from humans and mice when stimulated with mitogens and polarized with pro-inflammatory or immune regulatory cytokines.

  15. The Role of c-KIT in Tumorigenesis: Evaluation in Canine Cutaneous Mast Cell Tumors

    Directory of Open Access Journals (Sweden)

    Joshua D. Webster


    Full Text Available The c-KIT proto-oncogene has been implicated in the pathogenesis of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and mast cell tumors (MCTs in canines. Cutaneous MCTs are common neoplasms in dogs and have a variable biologic behavior. The goal of this study was to define the prognostic significance of c-KIT mutations identified in canine MCTs and the associations between c-KIT mutations, KIT localization, and KIT expression levels. Microdissection and polymerase chain reaction were performed on 60 MCTs to identify c-KIT mutations. Anti-KIT antibodies were used for immunohistochemical evaluation of KIT localization. Forty-two MCTs were included in a tissue microarray, and KIT expression was quantified using immunofluorescence. Canine MCTs with c-KIT mutations were significantly associated with an increased incidence of recurrent disease and death. c-KIT mutations were also significantly associated with aberrant protein localization; however, the level of KIT expression did not correlate with either c-KIT mutations or changes in protein localization. Considering the high prevalence of canine MCTs and the central role of c-KIT in the tumorigenesis of certain tumors, canine MCTs are an excellent model for characterizing the role of c-KIT in neoplastic diseases and is a potential target for novel therapeutic agents in clinical trials.

  16. Geographical Information Systems and canine faecal contamination: the experience in the city of Naples (southern Italy). (United States)

    Veneziano, V; Rinaldi, L; Carbone, S; Biggeri, A; Cringoli, G


    Geographical Information Systems (GIS) can be used to make transect sampling when non-moving objects are to be counted, involving choosing a line or series of lines along which the counts are to take place. This approach has been used by us in order to study canine faecal contamination in the city of Naples (southern Italy), and to evaluate the consequent presence of canine parasitic elements. A GIS was constructed utilizing the geo-referenced digital photographs and the cadastral maps of Naples. In order to uniformly evaluate the canine faecal contamination throughout the city, a grid representing sub-areas of 1 km x 700 m was overlaid on the city map within the GIS. The territory of Naples was divided in 218 equal, rectangular sub-areas. In each sub-area a 1 km transect was drawn, and digitalized on-screen in the GIS. Canine faeces (copros in Greek) were counted along the transects in 143 sub-areas. In these sub-areas, 415 copros were collected and examined. Out of the 143 sub-areas, 141 contained canine copros. The results of the negative binomial regression model showed a positive association between the number of copros and the human population density. Out of the total of 415 copros, 70 (16.9%) were positive for parasitic elements; eggs of Toxocara canis, Toxascaris leonina, Ancylostoma caninum and Trichuris vulpis were found, as well as oocysts of Isospora canis. PMID:16881413

  17. Alkylation and Carbamylation Effects of Lomustine and Its Major Metabolites and MGMT Expression in Canine Cells

    Directory of Open Access Journals (Sweden)

    Thushara Chakkath


    Full Text Available DNA Alkylation is thought to be the reason for the efficacy of lomustine while carbamylation has been implicated as the cause for the side effects seen with lomustine treatment such as hepatotoxicity. In the alkylation study we show that lomustine and its metabolites form similar levels of the DNA adducts N7 hydroxyethylguanine and O6 hydroxyethyldeoxyguanosine. In terms of carbamylation, lomustine showed greater extent of carbamylation in the canine hepatocytes and lymphoma cell lines. The DNA repair enzyme O6 methylguanine DNA methyltransferase (MGMT causes resistance of tumor cells to bifunctional nitrosourea, like lomustine. There is no data available regarding MGMT expression/activity in canine cells or tissues. Our study shows that there is low MGMT activity in the canine lymphoid cell line 17–71 while the GL-1 cells did not show any detectable enzyme activity or mRNA expression. The MGMT enzyme activity measured in canine hepatocytes is about 250–350 fmol/mg protein as compared to about 90 fmol/mg protein in 17–71 cells. We also show that MGMT mRNA expression in 17–71 cells and canine hepatocytes positively correlates with its enzyme activity in these cells.

  18. Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

    International Nuclear Information System (INIS)

    Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology

  19. Functional Characterization of the Canine Heme-Regulated eIF2α Kinase: Regulation of Protein Synthesis

    Directory of Open Access Journals (Sweden)

    Kimon C. Kanelakis


    Full Text Available The heme-regulated inhibitor (HRI negatively regulates protein synthesis by phosphorylating eukaryotic initiation factor-2α (eIF2α thereby inhibiting protein translation. The importance of HRI in regulating hemoglobin synthesis in erythroid cells makes it an attractive molecular target in need of further characterization. In this work, we have cloned and expressed the canine form of the HRI kinase. The canine nucleotide sequence has 86%, 82%, and 81% identity to the human, mouse, and rat HRI, respectively. It was noted that an isoleucine residue in the ATP binding site of human, rat, and mouse HRI is replaced by a valine in the canine kinase. The expression of canine HRI protein by in vitro translation using wheat germ lysate or in Sf9 cells using a baculovirus expression system was increased by the addition of hemin. Following purification, the canine protein was found to be 72 kD and showed kinase activity determined by its ability to phosphorylate a synthetic peptide substrate. Quercetin, a kinase inhibitor known to inhibit mouse and human HRI, inhibits canine HRI in a concentration-dependent manner. Additionally, quercetin is able to increase de novo protein synthesis in canine reticulocytes. We conclude that the canine is a suitable model species for studying the role of HRI in erythropoiesis.

  20. Differences between dentitions with palatally and labially located maxillary canines observed in incisor width, dental morphology and space conditions

    DEFF Research Database (Denmark)

    Artmann, L; Larsen, H J; Sørensen, H B;


    To analyze the interrelationship between incisor width, deviations in the dentition and available space in the dental arch in palatally and labially located maxillary ectopic canine cases.......To analyze the interrelationship between incisor width, deviations in the dentition and available space in the dental arch in palatally and labially located maxillary ectopic canine cases....

  1. Comparative in vitro fermentation activity in the canine distal gastrointestinal tract and fermentation kinetics of fiber sources

    NARCIS (Netherlands)

    Bosch, G.; Pellikaan, W.F.; Rutten, P.G.P.; Poel, van der A.F.B.; Verstegen, M.W.A.; Hendriks, W.H.


    The current study aimed to evaluate the variation in fermentation activity along the distal canine gastrointestinal tract (GIT, Exp. 1). It also aimed to assess fermentation kinetics and end product profiles of 16 dietary fibers for dog foods using canine fecal inoculum (Exp. 2). For Exp. 1, digesta

  2. Altered pulmonary epithelial permeability in canine radiation lung injury

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, I.H.; el-Khatib, E.; Logus, J.W.; Man, G.C.; Jacques, J.; Man, S.F.


    A radioaerosol scanning technique measuring regional clearance of sodium pertechnetate (99mTcO-4) and 99mTc-labeled diethylenetriaminepentaacetate (99mTc-DTPA) was used to assess changes in canine pulmonary epithelial permeability following lung irradiation. Doses of 2000 cGy (11 dogs), 1000 cGy (2 dogs), and 500 cGy (2 dogs) were given in one fraction to either the entire right hemithorax (500 cGy) or the right lower lung (1000 and 2000 cGy). Radioaerosol scans, chest roentgenograms, and computerized tomograms (CT) were obtained before and serially after irradiation. A dose of 2000 cGy resulted in a decrease in regional pulmonary epithelial permeability to both 99mTcO4- and 99mTc-DTPA; both showed significant decreases from the 2nd wk postirradiation onward. In comparison, CT and chest roentgenogram did not become abnormal until 7.1 +/- 2.8 (SD) and 8.2 +/- 2.6 wk, respectively. Doses of 1,000 and 500 cGy produced reversible decreases in 99mTcO4- clearance. Lung morphology showed definite changes of radiation pneumonitis after 2000 and 1000 cGy but not after 500 cGy at approximately 9, 17, and 12 wk postirradiation, respectively. These results suggest that dose-dependent changes in pulmonary physiology may precede obvious structural alterations in radiation lung injury.

  3. Functional subtyping of muscarinic receptors on canine esophageal mucosa. (United States)

    Lad, R; Donoff, B; Rangachari, P K


    Serosal addition of muscarinic agonists elicited rapid changes in electrical parameters across the isolated canine esophageal epithelium set up in vitro. Both carbachol and the M1-selective agonist, McNeil A343 (McN), increased transmucosal potential differences (PDs), decreased transmucosal resistances (R), and increased short-circuit currents (Isc). Carbachol was more potent and more effective than McN. Muscarinic antagonists were used to define the muscarinic receptor involved. The pA2 values obtained with Schild plots were as follows: atropine 9.14, 4-DAMP 8.98, AFDX-116 6.71, and pirenzepine 7.12. Low concentrations of pirenzepine (10(-8) M), produced a rightward shift in the dose-response curve to McN, without inhibiting responses to carbachol. Thus the receptor subtype is clearly not an M2. As in other glandular systems, M3 receptors are present. Whether M1 receptors also exist requires better definition of receptor densities-reserves in this tissue. Carbachol induced net secretion of Na and Cl and converted a predominantly absorptive tissue to a secretory one. PMID:1716057

  4. Canine leishmaniasis surveillance program in a San Marino Republic kennel

    Directory of Open Access Journals (Sweden)

    Daniela Salvatore


    Full Text Available The Republic of San Marino is an autonomous State that, in view of its geographical and environmental features, can be considered a part of the Northern Italian territory, where the canine leishmaniasis (CanL is endemic. In the past, a CanL focus in the Republic's kennel was described. As a consequence of this epidemiological situation, a surveillance program was carried-out covering a 6-year period (2006-2012. A total of 1,094 sera were collected from 420 kennel dogs and examined for antibodies to Leishmania infantum by the indirect fluorescent antibody test (IFAT. Eighty-eight (21% dogs resulted IFAT positive (antibody titre ≥1/40. The overall seroprevalence increased in the first 4 years (2006-2010, going from 5.5% to 26.8% and then decreased in the 2 following years going to 17.9% (2011 and 3.9% (2012. The cumulative incidence constantly increased from 0.6% to 2.6%. This trend could be attributed to a changed infection pressure due to the dog turnover in the kennels. According to the observed incidence values, the CanL focus seems to be stable, supported by autochthonous transmission, new case introduction and Leishmania spp. circulation in owned dogs in the same area.

  5. Acute pancreatitis : a newly recognised potential complication of canine babesiosis

    Directory of Open Access Journals (Sweden)

    A.J. Möhr


    Full Text Available This retrospective study describes 4 cases of canine babesiosis with histologically confirmed acute pancreatitis. In addition, 16 dogs with babesiosis are reported with serum amylase (>3500 U/l and/or lipase (>650 U/l activity elevations of a magnitude that would support a diagnosis of probable acute pancreatitis, although extra-pancreatic sources of the enzymes could not be excluded in these cases. Median time of pancreatitis diagnosis was 2.5 days post-admission, with primarily young (median age 3 years, sexually intact dogs affected. The development of pancreatitis was unrelated to the degree of anaemia at time of admission. In addition to pancreatitis, 80 % of cases suffered from other babesial complications, namely icterus (13, acute respiratory distress syndrome (6, immune-mediated haemolytic anaemia (6, renal failure (3, haemoconcentration (2 and cerebral syndrome (2. Acute respiratory distress syndrome, renal failure and cerebral syndrome were associated with a poor prognosis, with 4 of the 5 dogs included in the overall 26 % mortality rate having at least 1 of these complications. Haemolytic anaemia with ischaemia-reperfusion injury to the pancreas is proposed as a possible primary pathophysiological mechanism in babesial pancreatitis. Hypotensive shock, immune-mediated haemolytic anaemia, haemoconcentration and possibly altered lipid metabolism in babesiosis may also be involved. The previously postulated pro-inflammatory cytokine milieu of complicated babesiosis may underlie the progression, if not the primary initiation, of pancreatic pathology. Acute pancreatitis may represent the previously reported 'gut' form of babesiosis.

  6. Seroprevalence of Canine Parvovirus in Dogs in Lusaka District, Zambia (United States)


    Canine parvovirus (CPV) enteritis is a highly contagious enteric disease of young dogs. Limited studies have been done in Zambia to investigate the prevalence of CPV in dogs. Blood was collected from dogs from three veterinary clinics (clinic samples, n = 174) and one township of Lusaka (field samples, n = 56). Each dog's age, sex, breed, and vaccination status were recorded. A haemagglutination assay using pig erythrocytes and modified live parvovirus vaccine as the antigen was used. Antibodies to CPV were detected in 100% of dogs (unvaccinated or vaccinated). The titres ranged from 160 to 10240 with a median of 1280. Vaccinated dogs had significantly higher antibody titres compared to unvaccinated (p < 0.001). There was a significant difference in titres of clinic samples compared to field samples (p < 0.0001) but not within breed (p = 0.098) or sex (p = 0.572). Multiple regression analysis showed that only age and vaccination status were significant predictors of antibody titres. The presence of antibody in all dogs suggests that the CPV infection is ubiquitous and the disease is endemic, hence the need for research to determine the protection conferred by vaccination and natural exposure to the virus under local conditions. PMID:27699205

  7. Molecular epidemiology of canine parvovirus in southern India

    Directory of Open Access Journals (Sweden)

    V. M. Vivek Srinivas,


    Full Text Available Aim: The present study was conducted to isolate and characterize canine parvovirus circulating in Southern India by genetic analysis of VP2 capsid protein gene.Materials and Methods: In this study, 128 samples were collected from nine different locations covering five Southern Indian states (Pondicherry, Tamil Nadu, Kerala, Andhra Pradesh and Karnataka . Out of 128 samples, 69 samples were found to be positive by PCR assay. Out of 69 positive samples, 36 were randomly selected and processed for virus isolation. Twenty viruses could be isolated successfully and 18 randomly selected isolate were subjected to VP2 gene sequence analysis along with 6 random clinical samples.Result: Seventeen isolates and 5 clinical samples were characterized as New CPV-2a (CPV2a with 297-Ser→Ala. But one isolate and one clinical sample had amino acids variations which were characteristics of New CPV-2b. The phylogenetic analysis revealed that one of the field isolates was found to be phylogenetically closely related to New CPV-2b strains of India; rest other sequences was found to share ancestral origins with New CPV-2a reference strains of Japan, China, Thailand and India.Conclusion: The present study revealed that the predominant CPV strain circulating in Southern India is New CPV-2a. There is also enough indication of New CPV-2b strain from different states of Southern India.

  8. Effects of canine parvovirus on gray wolves in Minnesota (United States)

    Mech, L.D.; Goyal, S.M.


    Long-term effects of disease on wild animal population demography is not well documented. We studied a gray wolf (Canis lupus) population in a 2,060km2 area of Minnesota for 15 years to determine its response to canine parvovirus (CPV). The CPV had little effect (P gt 0.05) on wolf population size while epizootic during 1979-83. However, after CPV became enzootic, percentage of pups captured during summer-fall 1984-93 and changes in subsequent winter wolf numbers were each inversely related to the serological prevalence of CPV in wolves captured during July-November (r2 = 0.39 and 0.72, P = 0.05 and lt 0.01, respectively). The CPV antibody prevalence in adult wolves increased to 87% in 1993 (r2 = 0.28, P = 0.05). However, because population level remained stable, CPV-induced mortality appeared to compensate for other mortality factors such as starvation. We -predict that the winter wolf population will decline when CPV prevalence in adults consistently exceeds 76%. The CPV may become important in limiting wolf populations.

  9. Canine Distemper Virus in Wild Felids of Costa Rica. (United States)

    Avendaño, Roberto; Barrueta, Flor; Soto-Fournier, Sofía; Chavarría, Max; Monge, Otto; Gutiérrez-Espeleta, Gustavo A; Chaves, Andrea


    Several highly infectious diseases can be transmitted through feces and cause elevated mortality among carnivore species. One such infectious agent, canine distemper virus (CDV; Paramyxoviridae: Morbillivirus), has been reported to affect wild carnivores, among them several felid species. We screened free-ranging and captive wild carnivores in Costa Rica for CDV. Between 2006 and 2012, we collected 306 fecal samples from 70 jaguars (Panther onca), 71 ocelots ( Leopardus pardalis ), five jaguarundis (Puma yaguaroundi), 105 pumas ( Puma concolor ), five margays ( Leopardus wiedii ), 23 coyotes ( Canis latrans ), and 27 undetermined Leopardus spp. We found CDV in six individuals: one captive jaguarundi (rescued in 2009), three free-ranging ocelots (samples collected in 2012), and two free-ranging pumas (samples collected in 2007). Phylogenetic analyses were performed using sequences of the phosphoprotein (P) gene. We provide evidence of CDV in wild carnivores in Costa Rica and sequence data from a Costa Rican CDV isolate, adding to the very few sequence data available for CDV isolates from wild Central American carnivores. PMID:26967127

  10. Tongue nodules in canine leishmaniosis — a case report

    Directory of Open Access Journals (Sweden)

    Viegas Carlos


    Full Text Available Abstract Background Canine leishmaniosis (CanL caused by Leishmania infantum is an endemic zoonosis in southern European countries. Infected dogs can present rare or atypical forms of the disease and diagnosis can be challenging. The present report describes a case of tongue nodules in a 3-year-old neutered female Labrador Retriever dog with leishmaniosis. Findings A fine needle aspiration of the lingual nodules revealed amastigote forms of Leishmania inside macrophages. Differential diagnosis ruled out neoplasia, calcinosis circumscripta, solar glossitis, vasculitis, amyloidosis, eosinophilic granulomas, chemical and electrical burns, uremic glossitis and autoimmune diseases. Combined therapy with antimoniate meglumine and allopurinol for 30 days resulted in the normalization of hematological and biochemical parameters. Two months after diagnosis and the beginning of treatment, a mild inflammatory infiltrate was observed by histopathology, but an anti-Leishmania immunofluorescence antibody test (IFAT was negative as well as a PCR on both tongue lesions and a bone marrow aspirate. Seven months after diagnosis, the dog’s general condition appeared good, there were no tongue lesions and a new IFAT was negative. Fifteen months after diagnosis this clinically favourable outcome continued. Conclusions The dog could have suffered a relapsing episode of CanL, but a new systemic or local infection cannot be excluded. Regular clinical re-evaluation should be maintained, as a future relapse can potentially occur. In conclusion, CanL should be considered in the differential diagnosis of nodular glossitis in dogs.

  11. Canine and Human Dirofilariosis in the Rostov Region (Southern Russia

    Directory of Open Access Journals (Sweden)

    Vladimir Kartashev


    Full Text Available Epidemiological data on canine and human dirofilariosis in the Rostov Region (Southern Russia are presented. Prevalence of Dirofilaria spp. infections in 795 autochthonous dogs, assessed by the Knott test, was 20.25%. The highest prevalence was found in Novocherkassk (38.3% and Rostov-on-Don (18.5%, while prevalences were lower in other points of the region. Prevalence of D. repens was 44.7%, prevalence of D. immitis was 30.3%, and coinfections were observed in 25.0% of the dog population. A case finding study carried out during 9 years (2000–2009 revealed 131 cases of human dirofilariosis in the Rostov Region, 129 of subcutaneous dirofilariosis and 2 of pulmonary dirofilariosis. Seroprevalence among 317 healthy blood donors from the Rostov Region was 10.4%, while seroprevalence in policemen living in Rostov city and working in training dogs was 19%. These data show high infection rates of Dirofilaria spp. in both human and dog populations of Rostov, probably because of the existence of favorable conditions for the transmission in this region.

  12. Mandibulo-Canine index value for sex identification

    Directory of Open Access Journals (Sweden)

    Akhlaghi M.


    Full Text Available Background: The value of the mandibulo-canine index (MCI in gender identification has been proved in some studies in various countries. The goal of our study was to determine the utility of MCI in gender identification in Iran.Methods: This descriptional survey was performed on a group of 18- to 25-year-old Iranian students at the Tehran University of Medical Science. We included 50 males and 50 females that were selected using a single sampling method. Data were statistically analyzed by SPSS (v. 13 and t-test.Results: No statistically significant difference was found between the mean ages of the two groups. Among men, the MCI ranged from 0.209 to 0.293, with a mean of 0.252. Among women, the MCI ranged from 0.202 to 0.276, with a mean of 0.245. There was significant statistical difference between the two means, (0.007; P value = 0.04. The standard MCI of 0.247 was compared to that of each gender, after which no significant statistical difference was found between the two genders (P value = 0.8. Conclusions: Despite some studies performed in other countries displaying the usefulness of MCI in sex determination, our data did not support this conclusion. Perhaps this difference can be explained because of the variety ethnic groups from various cities of Iran represented in this research had some influence on the results.

  13. Therapeutic efficacy of different Hemodialysis prescriptions in canine azotemia

    Directory of Open Access Journals (Sweden)

    Ekta Atul Thakkar


    Full Text Available Aim: The aim was to determine therapeutic efficacy of different Hemodialysis prescriptions in canine azotemia. Materials and Methods: Patients (n=9 with acute onset of renal dysfunction or chronic patients with superimposed acute factor (component or patients with known chronic nature of the disease were dialyzed with Fresenius 4008S hemodialysis machine after jugular catheterization. Patients were randomly divided into two groups, one group (n=3 was dialyzed every day and second (n=4 was dialyzed on alternate days. The patients were evaluated for following parameters to compare the efficacy of the dialysis prescription: Urea reduction ratio (URR, creatinine reduction ratio (CRR, Kt/V, time averaged concentration of urea (TAC urea. Result and Discussion: Increasing both dialysis frequency and duration is the superior dialysis schedule. Patient dialyzed every day with total processed blood volume 1.79 L/Kg for 4 h 26 min/session had the lowest TAC of 36.82 mg/dl, thereby was considered it as a better prescription.

  14. Canine experimental infection: intradermal inoculation of Leishmania infantum promastigotes

    Directory of Open Access Journals (Sweden)

    Gabriela M Santos-Gomes


    Full Text Available Five mixed breed dogs were inoculated intradermally (ID with cultured virulent stationary phase promastigotes of Leishmania infantum Nicole, 1908 stocks recently isolated. Parasite transformations in the skin of ID infected dogs were monitored from the moment of inoculation and for 48 h, by skin biopsies. Anti-Leishmania antibody levels were measured by indirect immunofluorescence assay, counterimmunoelectrophoresis and direct agglutination test, and clinical conditions were examined. Thirty minutes after ID inoculation the first amastigotes were visualised and 3 to 4 h after inoculation the promastigotes were phagocyted by neutrophils and by a few macrophages. These cells parasitised by amastigotes progressively disappeared from the skin and 24 h after inoculation parasites were no longer observed. Local granulomes were not observed, however, serological conversion for antibodies anti-Leishmania was achieved in all dogs. Direct agglutination test was the only technique positive in all inoculated dogs. Amastigotes were found in the popliteal lymph node in one dog three months after inoculation. This work demonstrates that, with this inoculum, the promastigotes were transformed into amastigotes and were up taken by neutrophils and macrophages. The surviving parasites may have been disseminated in the canine organism, eliciting a humoral response in all cases.

  15. [Canine and human rabies in Conakry: epidemiology and preventive aspects]. (United States)

    Youla, A S; Traore, F A; Sako, F B; Feda, R M; Emeric, M A


    In Guinea, stray dogs are present in large numbers in public places and around landfills. The objectives of this study were to determine the frequency of human exposure to rabies risk, the cases of human and canine rabies and to describe the epidemiological profile of the cases. This retrospective and descriptive study was conducted in health and veterinarian facilities within the city of Conakry. All records of patients admitted in these facilities because of animal bites and veterinary records for aggression by domestic animals from 2002 to 2012, so, during an 11-year period, were collected. During the study period, 7 994 people were concerned by domestic animal bites. Males were the most affected with 60.4% of all cases. Students represented the higher class with 36.0%, followed by workers (18%). The majority of injuries were to the lower limbs (54.4%). The dog has been implicated in the attacks in 98.8% of cases. Among the 2 916 biting dogs which were placed under observation, 14 developed clinical rabies. Among those assaulted, 11 cases of rabies were reported. From 7 994 victims of domestic animal bites, 2 634 received post-exposure prophylaxis and the dropout rate was 51%. Rabies is a real risk in Conakry. Provisions in terms of public health strategy must be taken to minimize it. PMID:24363015

  16. Canine gastric emptying of polycarbophil: an indigestible, particulate substance. (United States)

    Russell, J; Bass, P


    We tested whether indigestible solids could empty from the canine stomach independently of gastric burst motor activity. Test meals contained polycarbophil, an indigestible particulate (1-3 mm diameter) substance. Test meals were slurries of 30 or 90 g of radiolabeled polycarbophil particles in saline. Meals were administered via an oral gastric tube. After 4 h, the stomach was drained via a gastric cannula, and the percentage of meal that had emptied into the duodenum was calculated. Antroduodenal motor responses to the meals were monitored with strain-gage force transducers. The motor responses to polycarbophil meals were compared with those after canned food and saline meals. Fifty percent of the 90-g polycarbophil meal emptied by 4 h; this occurred independently of gastric burst motor activity. Both polycarbophil and canned food elicited similar indexed motor responses and both delayed the postprandial reappearance of gastric burst motor activity. We conclude that small indigestible particles can stimulate fed state-like motility and empty from the stomach independently of gastric burst activity.

  17. Fatal canine distemper virus infection of giant pandas in China. (United States)

    Feng, Na; Yu, Yicong; Wang, Tiecheng; Wilker, Peter; Wang, Jianzhong; Li, Yuanguo; Sun, Zhe; Gao, Yuwei; Xia, Xianzhu


    We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possessed the substitutions V26M, T213A, K281R, S300N, P340Q, and Y549H. The presence of the Y549H substitution is notable as it is found at the signaling lymphocytic activation molecule (SLAM) receptor-binding site and has been implicated in the emergence of highly pathogenic CDV and host switching. These findings demonstrate that giant pandas are susceptible to CDV and suggest that surveillance and vaccination among all captive giant pandas are warranted to support conservation efforts for this endangered species. PMID:27310722

  18. Morphological characterisation of vesicular structures in the canine ejaculate

    DEFF Research Database (Denmark)

    Goericke-Pesch, Sandra Kathrin; Hauck, S; Bergmann, M;


    Membrane vesicles (MV) have been identified in seminal plasma from various species and they are thought to have a significant impact on semen quality and fertilisation. Although recently presence of MV has been also described in the canine ejaculate, detailed knowledge on their morphology...... different MV types were identified based on diameter, structure, contents and electron density of contents as well as presence, number and size of smaller MV inside the MV itself. In normospermic males, secondary vesicles (type i, H, K1/2) included smaller vesicles and had a weighted mean diameter of 409.......46nm; hereof types i, H and K1 were smaller (mean: 287.55nm, range: 51.25-994.86nm) and type K2 was larger (mean: 1746.43nm, range: 1003.66-3289.34nm). Primary vesicles (mean diameter: 135.29nm) - without vesicles inside - were differentiated into larger MV (A, B, C1/2) with a mean diameter of 219.63nm...

  19. Breed- and age-related differences in canine mammary tumors. (United States)

    Kim, Hyun-Woo; Lim, Ha-Young; Shin, Jong-Il; Seung, Byung-Joon; Ju, Jung-Hyung; Sur, Jung-Hyang


    Triple-negative breast cancer is a type of breast cancer that does not express the genes for estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor-2 (HER-2). It is an important and clinically relevant condition as it has a poor prognosis and is difficult to treat. Basal-like triple-negative cancer is highly prevalent in both African-Americans and adolescents. We therefore examined whether such a cancer likewise occurs in specific breeds and age groups in dogs, focusing on basal-like triple-negative cancer in particular. In this study, 181 samples from dogs with malignant mammary carcinoma from the 5 most common breeds and 2 age groups in Korea were analyzed. Histological classification and molecular subtyping, including assessment of immunohistochemical findings, were carried out. Twenty-five of 28 (89.3%) triple-negative carcinomas were identified as basal-like triple-negative carcinomas. Analysis of associations of classified factors revealed that the shih tzu breed (9/25, 36.0%) and advanced-age (19/25, 76.0%) groups were characterized by higher prevalence of basal-like triple-negative tumors with diverse histological types and of a higher grade. These results suggest that breed- and age-related differences can be identified in canine mammary carcinoma and, notably, in the shih tzu breed and at older ages. Further investigation of these distinguishing characteristics of the shih tzu breed is warranted. PMID:27127342

  20. Canine detection odor signatures for mine-related explosives (United States)

    Johnston, James M.; Williams, Marc; Waggoner, L. Paul; Edge, Cindy C.; Dugan, Regina E.; Hallowell, Susan F.


    Dogs are capable of detecting and discriminating a number of compounds constituting a complex odor. However, they use only a few of these to recognize a substance. The focus of this research is to determine the compounds dogs learn to use in recognizing explosives used in land mines. This is accomplished by training dogs under behavioral laboratory conditions to respond differentially on separate levers to (1) blank air, (2) a target odor such as an explosive, and (3) all other odors (non-target odors). Vapor samples are generated by a serial dilution vapor generator whose operation and output is characterized by GC/MS. Once dogs learn this three-lever discrimination, testing sessions are conducted containing a number of probe trials in which vapor from constituent compounds is presented. Which lever the dogs respond to on these probe trials indicates whether they can smell the compound at all (blank lever) or whether it smells like the target odor (e.g., the explosive) or like something else. This method was conducted using TNT and C-4. The data show the dogs' reactions to each of the constituent compounds tested for each explosive. Analysis of these data reveal the canine detection odor signature for these explosives.

  1. Expression and significance of CHIP in canine mammary gland tumors. (United States)

    Wang, Huanan; Yang, Xu; Jin, Yipeng; Pei, Shimin; Zhang, Di; Ma, Wen; Huang, Jian; Qiu, Hengbin; Zhang, Xinke; Jiang, Qiuyue; Sun, Weidong; Zhang, Hong; Lin, Degui


    CHIP (Carboxy terminus of Hsc70 Interacting Protein) is an E3 ubiquitin ligase that can induce ubiquitination and degradation of several oncogenic proteins. The expression of CHIP is frequently lower in human breast cancer than in normal breast tissue. However, the expression and role of CHIP in the canine mammary gland tumor (CMGT) remain unclear. We investigated the potential correlation between CHIP expression and mammary gland tumor prognosis in female dogs. CHIP expression was measured in 54 dogs by immunohistochemistry and real-time RT-PCR. CHIP protein expression was significantly correlated with the histopathological diagnosis, outcome of disease and tumor classification. The transcriptional level of CHIP was significantly higher in normal tissues (P=0.001) and benign tumors (P=0.009) than it in malignant tumors. CHIP protein expression was significantly correlated with the transcriptional level of CHIP (P=0.0102). The log-rank test survival curves indicated that patients with low expression of CHIP had shorter overall periods of survival than those with higher CHIP protein expression (P=0.050). Our data suggest that CHIP may play an important role in the formation and development of CMGTs and serve as a valuable prognostic marker and potential target for genetic therapy.

  2. Effect of blood transfusions on canine renal allograft survival

    Energy Technology Data Exchange (ETDEWEB)

    Van Der Linden, C.J.; Buurman, W.A.; Vegt, P.A.; Greep, J.M.; Jeekel, J.


    In this study significantly prolonged canine renal allograft survival has been demonstrated after transfusion of 100 ml of third-party whole blood given peroperatively. Peroperative transfusions of third-party leukocyte-free blood or pure lymphocyte cell suspensions did not influence graft survival. Futhermore, no improvement in graft survival has been found after a peroperative transfuson of irradiated whole blood (2500 rad). These data suggest that delayed graft rejection after blood transfusions can only be expected after the administration of whole blood. The role of competent lymphocytes in whole blood is questionable, since a transfusion of irradiated whole blood in combination with nonirradiated lymphocytes did not lead to prolonged graft survival. Immunosuppression of the recipient directly after transfusion seems to be essential to induce the beneficial effect of blood transfusions. This has been demonstrated for a transfusion of whole blood 14 days before transplantation. A single transfusion of 100 ml of whole blood 14 days before transplantation could effectively prolong graft survival if immunosuppression with azathioprine and prednisone was started on the day of transfusion. No improvement in graft survival has been found with such a transfusion if preoperative immunosuppression has been omitted.

  3. Effect of blood transfusions on canine renal allograft survival

    Energy Technology Data Exchange (ETDEWEB)

    van der Linden, C.J.; Buurman, W.A.; Vegt, P.A.; Greep, J.M.; Jeekel, J.


    In this study significantly prolonged canine renal allograft survival has been demonstrated after transfusion of 100 ml of third-party whole blood given peroperatively. Peroperative transfusions of third-party leukocyte-free blood or pure lymphocyte cell suspensions did not influence graft survival. Furthermore, no improvement in graft survival has been found after a peroperative transfusion of irradiated whole blood (2500 rad). These data suggest that delayed graft rejection after blood transfusions can only be expected after the administration of whole blood. The role of competent lymphocytes in whole blood is questionable, since a transfusion or irradiated whole blood in combination with nonirradiated lymphocytes did not lead to prolonged graft survival. Immunosuppression of the recipient directly after transfusion seems to be essential to induce the beneficial effect of blood transfusions. This has been demonstrated for a transfusion of whole blood 14 days before transplantation. A single transfusion of 100 ml of whole blood 14 days before transplantation could effectively prolong graft survival if immunosuppression with azathioprine and prednisone was started on the day of transfusion. No improvement in graft survival has been found with such a transfusion if preoperative immunosuppression has been omitted.

  4. Microbiota and probiotics in canine and feline welfare. (United States)

    Grześkowiak, Łukasz; Endo, Akihito; Beasley, Shea; Salminen, Seppo


    Dogs and cats have been cohabiting with us for thousands of years. They are the major human companions. Today, dogs and cats live in urban areas. Cats and most dogs are on high carbohydrate diets and face similar life-style challenges as the human beings. The health and well-being of companion animals, just as their owners, depends on the gut microbes. Providing a proper care and nutritionally balanced diet to companion animals is recognised as a part of our responsibility to maintain the health and well being of our pet. However, as microbiota differences may facilitate exposure to pathogens and harmful environmental influences, it is prudent to search for novel tools to protect dogs and cats and at the same time the human owners from pathogens. Specific probiotic strains and/or their defined combinations may be useful in the canine and feline nutrition, therapy, and care. Probiotic supplementations have been successful in the prevention and treatment of acute gastroenteritis, treatment of IBD, and prevention of allergy in companion animals. New challenges for probiotic applications include maintenance of obesity and overweight, urogenital tract infections, Helicobacter gastritis and parasitic infections. The probiotics of human origin appear to be among the new promising tools for the maintenance of pets' health. However, the host-derived microorganisms might be the most appropriate probiotic source. Therefore, more controlled trials are needed to characterise new and safe probiotic preparations with an impact on general health and well being as well as health maintenance in dogs and cats.

  5. Histamine concentration is involved in canine valvular disease

    Directory of Open Access Journals (Sweden)

    Mitsuhiro Isaka


    Full Text Available It has been known since many years that there are histamine receptors (H in the heart. Histamines display chronotropic and inotropic activity, cardiovascular diseases, and are thought to be a systemic inflammatory disease. During heart failure, the histamine concentration is elevated. In addition, H2 blockers prolonged the survival period for human patients with heart failure. The aim of this study was to evaluate whether blood concentration of histamine is associated with canine valvular disease (CVD. The histamine concentrations of dogs with CVD are significantly higher than those of healthy dogs. The histamine concentration gradually increases during CVD and is highly correlated with the grade of heart murmur. In conclusion, the histamine concentration was higher in the population of dogs with CVD compared with the healthy controls. Although the etiopathogenesis of CVD is complex and incompletely understood, it likely involves histamine. Ultimately additional studies are required to determine whether histamine blockers might be useful for the management of dogs with cardiac valvular disease.

  6. Using the canine genome to cure cancer and other diseases. (United States)

    Olson, P N


    A high-quality draft genome sequence of the domestic dog (Canis familiaris), together with a dense map of single nucleotide polymorphisms, has been reported. Such new tools offer scientists amazing opportunities to define genetic, nutritional, environmental, and other risk factors for various canine diseases. Because many of the diseases that affect man's best friend also affect us, understanding a dog's disease may lead to new preventions and therapies for diseases that affect both dogs and people. Since a dog's life span is shorter than that for a human, monitoring potential risk factors in a well-controlled population of dogs is possible. Such a population should be one where dogs live in close relationship with their owners. Although longitudinal studies have been previously conducted on animals housed in laboratory environments, the natural environment offers a chance to study dogs in environments shared by their owners. If dogs are carefully monitored, and select exposures defined, considerable information could be collected in a dog's lifetime--the next 10-20 years. Such information could hold the clues for important discoveries, including causes and cures for cancer. PMID:17498794

  7. Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012-2013

    DEFF Research Database (Denmark)

    Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted;


    farms, indicating that the control farms had a better biosecurity or were not equally exposed to canine distemper virus. Generally, all farms had very few specific precautions at the gate entrance in respect to human visitors as well as animals. The use of biosecurity measures was very variable in both...... case and control farms. Not using plastic boot covers, presence of dogs and cats, presence of demarcated area for changing clothes when entering and leaving the farm area and presence of hand washing facilities significantly lowered the odds of the farm having a canine distemper virus outbreak....... The results of the study indicate that consistent use of correct vaccination strategies, implementation of biosecurity measures and limiting human and animal access to the mink farm can be important factors in reducing the risk for canine distemper outbreaks....

  8. Putative canine origin of rotavirus strain detected in a child with diarrhea, Taiwan. (United States)

    Wu, Fang-Tzy; Bányai, Krisztián; Lin, Jen-Shiou; Wu, Ho-Sheng; Hsiung, Chao Agnes; Huang, Yhu-Chering; Hwang, Kao-Pin; Jiang, Baoming; Gentsch, Jon R


    Rotavirus G3P[3] strains have been reported from a variety of species including humans, cats, dogs, monkeys, goats, and cows. Here, we report the characterization of the first human G3P[3] rotavirus from East Asia identified in a 2-year-old child who was treated in a hospital's emergency ward in Taiwan in February 2005. Sequence and phylogenetic analysis demonstrated a close genetic relationship between the VP4, VP6, VP7, and NSP4 genes of Taiwanese G3P[3] strain 04-94s51 and an Italian canine strain isolated a decade ago, suggesting a canine origin for the Taiwanese strain. In contrast, the Taiwanese strain was only moderately related to well-characterized canine-origin human G3P[3] strains Ro1845 and HCR3, suggesting a distinct origin for the rotavirus strain from Taiwan. PMID:22022813

  9. Maxillary canine-first premolar transposition in the permanent dentition: treatment considerations and a case report.

    LENUS (Irish Health Repository)

    Synodinos, Philippos N


    Transposition is defined as the interchange of position between two adjacent teeth within the same quadrant of the dental arch. Permanent maxillary canine-premolar transposition is the most commonly observed transposition in the human dentition. Its prevalence is relatively low and its aetiology remains unclear, although it has been associated with genetic factors. It may also be related to a combination of localised factors such as malformation of adjacent teeth, tooth agenesis, retention of the deciduous canine and a history of local trauma. Treatment is selected on an individual case basis after thoroughly considering the overall facial and dental characteristics, duration of treatment, cost, patient preference and the orthodontist\\'s experience. This article provides a case report of maxillary canine transposition in the permanent dentition, successfully managed with orthodontic treatment.

  10. Diagnostic evaluation of canine serum alkaline phosphatase by immunochemical means and interpretation of results. (United States)

    Saini, P K; Peavy, G M; Hauser, D E; Saini, S K


    Sera of several canine patients contained an isoenzyme of alkaline phosphatase (ALP) that resembled intestinal ALP with respect to heat inactivation, L-phenylalanine inhibition, and sensitivity to anti-canine intestinal ALP antibody, but differed with regard to the electrophoretic migration. The electrophoretic mobility of the isoenzyme was slightly cathodal than that of hepatic ALP, and its migration was reduced, similar to that of hepatic isoenzyme after neuraminidase treatment. This isoenzyme, which could be corticosteroid induced, was in the sera of numerous dogs with hepatobiliary disorders and was different from the hepatic isoenzyme that appeared in the sera of dogs with acute hepatitis, based on anti-canine intestinal ALP antibody interaction, heat inactivation, and electrophoretic migration. PMID:358873

  11. Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis. (United States)

    Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D


    Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis. PMID:25320495

  12. Analysis of EGFR and HER-2 expressions in ductal carcinomas in situ in canine mammary glands

    Directory of Open Access Journals (Sweden)

    I.L.D. Silva


    Full Text Available Biomolecular evidence has shown that ductal carcinoma in situ (DCIS may develop into invasive carcinoma of the canine mammary gland, and mutations in proto-oncogenes HER2 and EGFR; two members of the family of epidermal growth factor receptors, may be involved in this process. The purpose of this study was the characterization of the immunohistochemical expression of the EGFR and HER2 proteins in the process of neoplastic transformation, supposedly present in ductal carcinomas in situ in canine mammary glands. Fifteen cases of DCIS were evaluated, with a higher expression of HER2 and EGFR being observed in low-grade carcinomas when compared with high-grade neoplasms, and with a high positive statistical correlation in the latter. Results suggest that aggressive tumors tend to lose the expression of EGFR and HER2 simultaneously. The loss of the expression of these markers may be related to the process of neoplastic progression in canine mammary tumors.

  13. Peripheral canine CD4(+)CD8(+) double-positive T cells - unique amongst others. (United States)

    von Buttlar, Heiner; Bismarck, Doris; Alber, Gottfried


    T lymphocytes co-expressing CD4 and CD8 ("double-positive T cells") are commonly associated with a thymic developmental stage of T cells. Their first description in humans and pigs as extrathymic T cells with a memory phenotype almost 30 years ago came as a surprise. Meanwhile peripheral double-positive T cells have been described in a growing number of different species. In this review we highlight novel data from our very recent studies on canine peripheral double-positive T cells which point to unique features of double-positive T cells in the dog. In contrast to porcine CD4(+)CD8(+) T cells forming a homogenous cellular population based on their expression of CD4 and CD8α, canine CD4(+)CD8(+) T cells can be divided into three different cellular subsets with distinct expression levels of CD4 and CD8α. Double-positive T cells expressing CD8β are present in humans and dogs but absent in swine. Moreover, canine CD4(+)CD8(+) T cells can not only develop from CD4(+) single-positive T cells but also from CD8(+) single-positive T cells. Together, this places canine CD4(+)CD8(+) T cells closer to their human than porcine counterparts since human double-positive T cells also appear to be heterogeneous in their CD4 and CD8α expression and have both CD4(+) and CD8(+) T cells as progenitor cells. However, CD4(+) single-positive T cells are the more potent progenitors for canine double-positive T cells, whereas CD8(+) single-positive T cells are more potent progenitors for human double-positive T cells. Canine double-positive T cells have an activated phenotype and may have as yet unrecognized roles in vivo in immunity to infection or in inflammatory diseases such as chronic infection, autoimmunity, allergy, or cancer.

  14. Cartilage integrity and proteoglycan turnover are comparable in canine experimentally induced and human joint degeneration

    Directory of Open Access Journals (Sweden)

    Femke Intema


    Full Text Available The value of experimental models of osteoarthritis (OA largely depends on the ability to translate observations to human OA. Surprisingly, direct comparison of characteristics of human and experimental OA is scarce. In the present study, cartilage integrity and matrix turnover in a canine model of joint degeneration were compared to human clinical OA. In 23 Beagle dogs, joint degeneration was induced in one knee, the contra-lateral knee served as a control. For comparison, human osteoarthritic and healthy knee cartilage were obtained at arthroplasty (n=14 and post-mortem (n=13. Cartilage was analyzed by histology and biochemistry. Values for cartilage integrity and proteoglycan (PG synthesis showed species specific differences; GAG content of healthy cartilage was 2-fold higher in canine cartilage and PG synthesis even 8-fold. However, the relative decrease in PG content between healthy and OA cartilage was similar for humans and canines (-17% vs. -15%, respectively, as was the histological damage (+7.0 vs. +6.1, respectively and the increase of PG synthesis (+100% vs. +70%, respectively. Remarkably, the percentage release of total and of newly formed PGs in human and canine controls was similar, as was the increase due to degeneration (+65% vs. +81% and +91% vs. +52%, respectively. Despite differences in control conditions, the observed changes in characteristics of cartilage integrity and matrix turnover are similar in a canine model of joint degeneration and human clinical OA. The canine Groove model shows that its characteristics reflect those of human OA which makes the model appropriate for studying human OA.

  15. Epidemiological aspects of canine visceral leishmaniosis in the Islamic Republic of Iran. (United States)

    Mohebali, Mehdi; Hajjaran, Homa; Hamzavi, Yazdan; Mobedi, Iraj; Arshi, Shahnam; Zarei, Zabih; Akhoundi, Behnaz; Naeini, Koroush Manouchehri; Avizeh, Reza; Fakhar, Mehdi


    An epidemiological study to examine the sero-prevalence of zoonotic visceral leishmaniosis (ZVL) among domestic and wild canines in endemic foci of Iran was carried out during 1999-2003 to assess the distribution of the disease and the possible association between infection in dogs, wild canines and people. Anti-leishmanial antibodies were detected by the direct agglutination test (DAT). Parasitological study was performed for all captured wild canines and were detected in some of the seropositive dogs with specific clinical signs (n=107). Serum samples (n=1568) were collected from domestic dogs in villages that are known endemic foci of human visceral leishmaniosis (HVL). Wild canine sera were collected from jackals (Canis aureus, n=10), foxes (Vulpes vulpes, n=10) and wolves (Canis lupus, n=10). Of the 1568 serum sampled collected from domestic dogs, 222 (14.2%) were positive by DAT (1:320 and above). No statistically significant difference was found between male (15.2%) and female (11.8%) sero-prevalence (P=0.083). Dogs of 8 years and above showed the highest sero-prevalence (40.6%). Only 23.9% of the seropositive domestic dogs had clinical signs. Parasitology and serology tests that were performed in 30 wild canines showed 10% these animals were infected by Leishmania infantum. Ten out of 11 Leishmania spp. isolated from the dogs and wild canines were identified as L. infantum and one other as L. tropica by molecular and biochemical techniques. For the first time in Iran, L. infantum and L. tropica were isolated from viscera of both a wolf and a domestic dog. PMID:15845279

  16. Masculinization of the eruption pattern of permanent mandibular canines in opposite sex twin girls. (United States)

    Heikkinen, Tuomo; Harila, Virpi; Tapanainen, Juha S; Alvesalo, Lassi


    The aim of this study is to explore the effect of prenatal androgenization on the clinical eruption of permanent teeth expressing dimorphism and bimaturism. The eruption curves of permanent teeth (except third molars), including those that make up the canine complex (permanent canines, lower first premolars), are compared among opposite sex twins (OS twins) relative to single-born boys and girls. The comparisons are made with regard to three phases of eruption (pierced mucosa, half- erupted, and completely erupted) from a cross-sectional sample of dental casts, using Kaplan-Meier survival and Cox regression analyzes. The casts were collected from 2159 school children from the US Collaborative Perinatal Project, including 39 pairs of OS-twins, of which 12 pairs (30.8%) were Euro-Americans and 27 pairs (69.2%) were of African-American ancestry. The eruption patterns of the incisors, upper first molars, and lower canines were found to be significantly masculinized (delayed) among OS twin girls. The differences in most other teeth were either not significant, or the number of observations of active eruption phases were too few, such as in the upper first molars and incisors, to yield strong evidence and meaningful results. The masculinization of the tooth eruption pattern in OS twin girls is intriguing because of the lower canine responses during puberty, as well as canine primordial formation during early fetal androgenization of their co-twin during the 8th to 14th gestational weeks. The present results offer a challenge for future research exploring tooth eruption mechanisms, and may also highlight some cases of delayed or ectopic canines, which are biased toward females. PMID:23754587

  17. What is living on your dog's skin? Characterization of the canine cutaneous mycobiota and fungal dysbiosis in canine allergic dermatitis. (United States)

    Meason-Smith, Courtney; Diesel, Alison; Patterson, Adam P; Older, Caitlin E; Mansell, Joanne M; Suchodolski, Jan S; Rodrigues Hoffmann, Aline


    To characterize the skin-associated fungal microbiota (mycobiota) in dogs, and to evaluate the influence of body site, individual dog or health status on the distribution of fungi, next-generation sequencing was performed targeting the internal transcribed spacer region. A total of 10 dogs with no history of skin disease were sampled at 10 distinct body sites consisting of haired and mucosal skin, and 8 dogs with diagnosed skin allergies were sampled at six body sites commonly affected by allergic disease. Analysis of similarities revealed that body site was not an influencing factor on membership or structure of fungal communities in healthy skin; however, the mucosal sites were significantly reduced in fungal richness. The mycobiota from body sites in healthy dogs tended to be similar within a dog, which was visualized in principle coordinates analysis (PCoA) by clustering of all sites from one dog separate from other dogs. The mycobiota of allergic skin was significantly less rich than that of healthy skin, and all sites sampled clustered by health status in PCoA. Interestingly, the most abundant fungi present on canine skin, across all body sites and health statuses, were Alternaria and Cladosporium--two of the most common fungal allergens in human environmental allergies.



    I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini


    A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTAC...

  19. Preparation, characterization and immunological evaluation: canine parvovirus synthetic peptide loaded PLGA nanoparticles


    Derman, Serap; Mustafaeva, Zeynep Akdeste; Abamor, Emrah Sefik; Bagirova, Melahat; Allahverdiyev, Adil


    Background Canine parvovirus 2 (CPV-2) remains a significant worldwide canine pathogen and the most common cause of viral enteritis in dogs. The 1 L15 and 7 L15 peptides overlap each other with QPDGGQPAV residues (7-15 of VP2 capsid protein of CPV) is shown to produce high immune response. PLGA nanoparticles were demonstrated to have special properties such as; controlled antigen release, protection from degradation, elimination of booster-dose and enhancing the cellular uptake by antigen pre...

  20. The relationship of maxillary canines to the facial anatomical landmarks in a group of Thai people


    Sinavarat, Potchaman; Anunmana, Chuchai; Hossain, Sharafat


    PURPOSE The objective was to evaluate canine positions, intercanine tip width (ICTW) and width of distal surface of canine (WDC), related to facial landmarks including interalar width (IAW), intercommissural width (ICoW), and distance between left and right projection lines drawn from inner canthus of eyes to alae of the nose (DPICa) in a group of Thai. MATERIALS AND METHODS One hundred Thai subjects aged 18-35 years were selected. IAW and ICoW were measured on subject's face using digital ve...

  1. Prevalence of the Prefoldin Subunit 5 Gene Deletion in Canine Mammary Tumors


    Silvia Hennecke; Julia Beck; Kirsten Bornemann-Kolatzki; Stephan Neumann; Hugo Murua Escobar; Ingo Nolte; Susanne Conradine Hammer; Marion Hewicker-Trautwein; Johannes Junginger; Franz-Josef Kaup; Bertram Brenig; Ekkehard Schütz


    Background A somatic deletion at the proximal end of canine chromosome 27 (CFA27) was recently reported in 50% of malignant mammary tumors. This region harbours the tumor suppressor gene prefoldin subunit 5 (PFDN5) and the deletion correlated with a higher Ki-67 score. PFDN5 has been described to repress c-MYC and is, therefore, a candidate tumor-suppressor and cancer-driver gene in canine mammary cancer. Aim of this study was to confirm the recurrent deletion in a larger number of tumors. Me...

  2. Canine distemper virus infection in a lesser grison (Galictis cuja: first report and virus phylogeny

    Directory of Open Access Journals (Sweden)

    Jane Megid


    Full Text Available Infectious diseases in wild animals have been increasing as a result of their habitat alterations and closer contact with domestic animals. Canine distemper virus (CDV has been reported in several species of wild carnivores, presenting a threat to wildlife conservation. We described the first case of canine distemper virus infection in lesser grison (Galictis cuja. A free-ranging individual, with no visible clinical sigs, presented sudden death after one day in captivity. Molecular diagnosis for CDV infection was performed using whole blood collected by postmortem intracardiac puncture, which resulted positive. The virus phylogeny indicated that domestic dogs were the probable source of infection.

  3. Downregulation of ATM Gene and Protein Expression in Canine Mammary Tumors

    DEFF Research Database (Denmark)

    Raposo-Ferreira, T M M; Bueno, R C; Terra, E M;


    The ataxia telangiectasia mutated (ATM) gene encodes a protein associated with DNA damage repair and maintenance of genomic integrity. In women, ATM transcript and protein downregulation have been reported in sporadic breast carcinomas, and the absence of ATM protein expression has been associated...... with poor prognosis. The aim of this study was to evaluate ATM gene and protein expression in canine mammary tumors and their association with clinical outcome. ATM gene and protein expression was evaluated by reverse transcription-quantitative polymerase chain reaction and immunohistochemistry...... downregulation is involved in canine mammary gland tumorigenesis....

  4. First detection of canine parvovirus type 2c in pups with haemorrhagic enteritis in Spain. (United States)

    Decaro, N; Martella, V; Desario, C; Bellacicco, A L; Camero, M; Manna, L; d'Aloja, D; Buonavoglia, C


    Canine parvovirus type 2 (CPV-2), the aetiological agent of haemorrhagic enteritis in dogs, includes three antigenic variants, types 2a, 2b and 2c. CPV-2c has been detected initially in Italy and subsequently in Vietnam. We report the first identification of this novel antigenic variant in Spain, where it caused an outbreak of fatal enteritis in basset hound pups in association with canine coronavirus type I and type II. We suggest that this new antigenic variant of CPV-2 could spread throughout Europe and that there is a subsequent need to update current CPV vaccines. PMID:17123424

  5. Effects of neuropeptide Y on regulation of blood flow rate in canine myocardium

    DEFF Research Database (Denmark)

    Svendsen, Jesper Hastrup; Sheikh, S P; Jørgensen, J;


    The effect of neuropeptide Y (NPY) on tension development was examined in isolated canine coronary arteries, and the effects on local myocardial blood flow rate were studied in open-chest anesthetized dogs by the local 133Xe washout technique. By immunohistochemistry, numerous NPY-like immunoreac......The effect of neuropeptide Y (NPY) on tension development was examined in isolated canine coronary arteries, and the effects on local myocardial blood flow rate were studied in open-chest anesthetized dogs by the local 133Xe washout technique. By immunohistochemistry, numerous NPY...

  6. Serosurvey for canine distemper virus exposure in dogs in communal lands in Zimbabwe

    Directory of Open Access Journals (Sweden)

    P.J. Kelly


    Full Text Available Sera from 173 apparently healthy, unvaccinated dogs from 4 widely separated communal lands in Zimbabwe were tested by ELISA for antibodies against canine distemper virus. Overall, 82 % were positive with high prevalences found in each communal land. The highest seroprevalence was in dogs between 1 and 2 years of age (91 %; 49/54. These results show dogs in the communal lands of Zimbabwe are commonly exposed to canine distemper virus and that a substantial number survive infection. The role that the virus might play in the high mortality rate of the dog population on communal land warrants further investigation.

  7. Evaluation of Cone Beam Computed Tomography in Diagnosis and Treatment Plan of Impacted Maxillary Canines Evaluation of Cone Beam Computed Tomography in Diagnosis and Treatment Plan of Impacted Maxillary Canines

    Directory of Open Access Journals (Sweden)

    Seyed Hossein Hoseini Zarch


    Full Text Available Introduction: Maxillary canines have important roles in facial appearance, development of arch, and functional occlusion. Radiographs are important in evaluating the location and nature of these anomalies. The purpose of this study was to evaluate two types of 2D and 3D imaging technique in diagnosis and treatment of maxillary impacted canines. Methods: Thirty eight patients (50 impacted canines were enrolled. An oral radiologist assessed all of patients’ panoramic radiographs and then cone beam computed tomography (CBCT to determine the presence of adjacent teeth root resorption, root dilacerations before dental extraction, dental rotation, and buccolingual localization ofimpacted canine crown and root contact with sinus and nasal cavity.Then using the patient’s radiographs the treatment plan of each impacted canine was determined by an orthodontist. Results: Differences between panoramic radiography and CBCT in diagnosis of root resorption and dental rotation were significant. There was an agreement between panoramic radiographs and CBCT in localization of impacted teeth crown. Only the treatment plans of 20% of impacted canines were different between panoramic radiographs and CBCT and treatment plan of 80% of impacted teeth was similar. Conclusion: These results showed that 2D and 3D images of impacted maxillary canines can produce different diagnoses and treatment plans.  

  8. Canine brucellosis: Epizootiological characteristics, therapy and control of the disease

    Directory of Open Access Journals (Sweden)

    Radojičić Sonja


    Full Text Available The paper describes different aspects of canine brucellosis caused by Brucella canis. The disease is present in a large number of countries all over the world, where it inflicts severe economic damages, in particular in the commercial breeding and major dog breeding facilities. The disease was discovered in 1966 in the United States of America, but there were no data about its presence or distribution in our country until 1999. It was established, following the initial investigations, that the prevalence of the disease is extremely high, and that it amounted to 4.27% among pet dogs in the territory of Belgrade. Investigations of stray dogs in the territory of Podgorica showed that the seroprevalence (an equal titer or higher than 1/200 was 9.37%, while the prevalence among stray dogs in the territory of Belgrade was 10.87%. Data for other parts of Serbia are mostly lacking, and the seroprevalence for stray dogs in the Municipality of Pozarevac amounted to over 15%, while not a single serologically positive case was found among pet dogs. In addition to the epizootiological specificities of the disease established in our country, isolates of B. canis from the territory of Serbia also indicate digressions in the test of resistance to colors with respect to the referent strain RM6/66. All isolates (SR1-SR-7 are resistant to base fuchsine, and it is probable that this characteristic could also be an important epizootiological marker. Even though the isolation of the cause is the most reliable diagnostic method, it is not possible to achieve this in most cases. That is why one of the most important tasks is to define the most ideal tests for the serological diagnostics of the disease, and the obligation of reporting the disease makes it imperative that wider-scale investigations are conducted and that measures are taken toward reducing the number of positive cases in our country. .

  9. Aglepristone efficiency with and without the canine pyometra cloprostenol

    Directory of Open Access Journals (Sweden)

    Víctor Molina D


    Full Text Available ABSTRACT Objective. Evaluate the effectiveness of aglepristone with and without cloprostenol for treating canine pyometra. Materials and methods. Ten female French Bulldogs between 3-8 years of age diagnosed with pyometra were divided into two groups, one receiving a 10 mg/kg dose of aglepristone subcutaneously on days 1, 2, 8, 14 and 28, and the other an equal dose on days 1, 3, 8 and 15, as well as a 1 µg/kg dose of cloprostenol subcutaneously on days 3 and 8. Both groups received 5 mg/kg of enrofloxacin orally every 12 hours for 28 days. Hematic profiles were generated on days 1 and 28 and counted days until the next heat, expelling purulent material and of clinical recuperation. Results. There was no statistical difference in the variables of the line red blood cells between times and protocols. The line of white blood cells showed a statistical difference between days of treatment but not between the two groups. Both treatments were effective resulting in complete clinical recuperation. The combination of aglepristone with cloprostenol acted more quickly, decreasing the number of days of secretion, abdominal pain, and the recuperation of normal activity and appetite. All 10 females were bred during their first heat. Three females from the aglepristone group and one from the combined aglepristone with cloprostenol group were impregnated. Conclusions. Both protocols, combined with enrofloxacin, produced complete clinical recuperation in bitches with pyometra, but it was achieved more rapidly when given the combination of both aglepristone and cloprostenol.

  10. Application of biodynamic imaging for personalized chemotherapy in canine lymphoma (United States)

    Custead, Michelle R.

    Biodynamic imaging (BDI) is a novel phenotypic cancer profiling technology which characterizes changes in cellular and subcellular motion in living tumor tissue samples following in vitro or ex vivo treatment with chemotherapeutics. The ability of BDI to predict clinical response to single-agent doxorubicin chemotherapy was tested in ten dogs with naturally-occurring non-Hodgkin's lymphomas (NHL). Pre-treatment tumor biopsy samples were obtained from all dogs and treated with doxorubicin (10 muM) ex vivo. BDI captured cellular and subcellular motility measures on all biopsy samples at baseline and at regular intervals for 9 hours following drug application. All dogs subsequently received treatment with a standard single-agent doxorubicin protocol. Objective response (OR) to doxorubicin and progression-free survival time (PFST) following chemotherapy were recorded for all dogs. The dynamic biomarkers measured by BDI were entered into a multivariate logistic model to determine the extent to which BDI predicted OR and PFST following doxorubicin therapy. The model showed that the sensitivity, specificity, and accuracy of BDI for predicting treatment outcome were 95%, 91%, and 93%, respectively. To account for possible over-fitting of data to the predictive model, cross-validation with a one-left-out analysis was performed, and the adjusted sensitivity, specificity, and accuracy following this analysis were 93%, 87%, and 91%, respectively. These findings suggest that BDI can predict, with high accuracy, treatment outcome following single-agent doxorubicin chemotherapy in a relevant spontaneous canine cancer model, and is a promising novel technology for advancing personalized cancer medicine.

  11. Impact of facial conformation on canine health: corneal ulceration.

    Directory of Open Access Journals (Sweden)

    Rowena M A Packer

    Full Text Available Concern has arisen in recent years that selection for extreme facial morphology in the domestic dog may be leading to an increased frequency of eye disorders. Corneal ulcers are a common and painful eye problem in domestic dogs that can lead to scarring and/or perforation of the cornea, potentially causing blindness. Exaggerated juvenile-like craniofacial conformations and wide eyes have been suspected as risk factors for corneal ulceration. This study aimed to quantify the relationship between corneal ulceration risk and conformational factors including relative eyelid aperture width, brachycephalic (short-muzzled skull shape, the presence of a nasal fold (wrinkle, and exposed eye-white. A 14 month cross-sectional study of dogs entering a large UK based small animal referral hospital for both corneal ulcers and unrelated disorders was carried out. Dogs were classed as affected if they were diagnosed with a corneal ulcer using fluorescein dye while at the hospital (whether referred for this disorder or not, or if a previous diagnosis of corneal ulcer(s was documented in the dogs' histories. Of 700 dogs recruited, measured and clinically examined, 31 were affected by corneal ulcers. Most cases were male (71%, small breed dogs (mean± SE weight: 11.4±1.1 kg, with the most commonly diagnosed breed being the Pug. Dogs with nasal folds were nearly five times more likely to be affected by corneal ulcers than those without, and brachycephalic dogs (craniofacial ratio <0.5 were twenty times more likely to be affected than non-brachycephalic dogs. A 10% increase in relative eyelid aperture width more than tripled the ulcer risk. Exposed eye-white was associated with a nearly three times increased risk. The results demonstrate that artificially selecting for these facial characteristics greatly heightens the risk of corneal ulcers, and such selection should thus be discouraged to improve canine welfare.

  12. Canine treatment with SnET2 for photodynamic therapy (United States)

    Frazier, Donita L.; Milligan, Andrew J.; Vo-Dinh, Tuan; Morgan, Alan R.; Overholt, Bergein F.


    Photodynamic therapy is a treatment technique that utilizes the photoactived species of a drug to destroy tumor tissue. To be successful, the drug must localize in tumor tissue preferentially over normal tissue and must be activated by light of a specific wavelength. Currently the only drug to be approved for clinical use is Heinatoporphyrin Derivative (HpD) although a series of new drugs are being developed for use in the near future. One of the drugs belongs to a class called purpurins which display absorp-' tions between 630-711 nm. Along with several other investigators, we are currently exploring the characteristics of a specific purpurin (SnET2) in normal and tumorous canine tissue. The use of this compound has demonstrated increased tumor control rates in spontaneous dog tumors. Preliminary pharmacokinetic studies have been performed on 6 normal beagle dogs. SnET2 (2 mg/kg) was injected intravenously over 10 minutes and blood was collected at 5, 15, 30, 45 minutes and at 1, 2, 4, 8, 12 and 24 hours following administration for determination of drug concentration and calculation of pharinacokinetic parameters. Skin biopsies were collected at 1, 4, 8, 12 and 24 hours. Dogs were euthanized at 24 hours and tissues (liver, kidney muscle, esophagus, stomach, duodenum, jejunum, ileura, colon, adrenal gland, thyroid, heart, lung, urinary bladder, prostate, pancreas, eye, brain) were collected for drug raeasurement. Drug was shown to persist in liver and kidney for a prolonged period of time coiapared to other tissues. Knowledge of the pharmacokinetic properties of the drug will greatly add to the ability to treat patients with effective protocols.

  13. Vagal postganglionic innervation of the canine sinoatrial node. (United States)

    Randall, W C; Ardell, J L; Wurster, R D; Milosavljevic, M


    Differential, selective distribution of parasympathetic, postganglionic innervation to the atrioventricular nodal (AVN) region of the canine heart was recently described. Ablation of parasympathetic pathways to the AVN by disruption of the epicardial fat pad at the junction of the inferior vena cava and inferior left atrium did not interfere with normal vagal control of the sinoatrial node (SAN) function. In sharp contrast, surgical dissection of the fat pad overlying the right pulmonary vein-left atrial junction interrupted the major right and left vagal inputs to the SAN region. The pulmonary vein fat pad (PVFP) in the dog heart is triangular in shape with roughly equilateral dimensions of approximately 1 cm, its base extending from superior to inferior veins, and its apex extending nearly to the sinus nodal artery as it courses rostrally in the sulcus terminalis. Careful dissection of smaller fat pads around the circumference of the pulmonary veins and particularly over the rostral-dorsal surfaces of the right superior pulmonary vein and adjacent right atrium, completed SAN parasympathetic denervation. Care in making these dissections left the vagal supply to the AVN region essentially intact, and preserved the sympathetic supplies to both SAN and AVN regions. Autonomic ganglia, varying in size from 1 or 2 cells to 80-100 cells, were found scattered throughout the ventral PVFP (overlying and surrounding the right pulmonary vein-left atrial junction). The ganglia were generally imbedded in fatty connective tissue, although they commonly rested very close to, or were loosely surrounded by epicardial muscle. Ganglia were also found in smaller fat pads on the dorsal surfaces of the atrium between the azygos and the right superior pulmonary vein. PMID:3655182

  14. Periventricular lucency on computed tomography in experimental canine hydrocephalus

    Energy Technology Data Exchange (ETDEWEB)

    Murata, T.; Mori, K.; Handa, H.; Nakano, Y. (Kyoto Univ. (Japan). Faculty of Medicine)


    We investigated chronological CT scans and epidural pressure monitorings in experimental canine hydrocephalus (Kaolin-induced hydrocephalus). We also investigated Metrizamide ventriculography, contrast enhancement study, and the observations before and after the ventriculo-peritoneal shunting operation. Here, we discuss the pathogenesis of periventricular lucency (PVL) in hydrocephalus. An EMI head scanner model 1010 was used throughout the examinations. We investigated the ventricular size by ''volume index of ventricles'', which was calculated from the printout CT numbers. The epidural pressure was monitored by means of a Ladd intracranial pressure monitoring apparatus. In Metrizamide ventriculography, we discussed the pathogenesis of PVL in the acute stage of hydrocephalus. According to the study of the printout CT number, the activity of transependymal CSF egress in PVL was regarded as more marked than that in the other periventricular white matter. In contrast enhancement study, in both the acute and chronic stages, PVL were only slightly enhanced in spite of the marked enhancement in the other perventricular areas. In observations before and after ventriculo-peritoneal shunting operation in both the acute and chronic stages, PVL immediately disappeared after the operation, while the epidual pressure (EDP) decreased with a reduction in the ventricular size. There was a tendency for the degree of PVL reduction to be correlated with the rate of ventricular contraction. Thereafter, all dogs became hydrocephaltic again because of shunt malfunctions, with EDP increasing and PVL reappearing. These sudden and reversible changes on CT scans were impossible to explain in terms of the loss and restoration of lipids and proteins, but were considered to be a result of a change in water content.

  15. Irradiation inhibits vascular anastomotic stenosis in a canine model

    International Nuclear Information System (INIS)

    The graft patency rate after coronary artery bypass grafting (CABG) correlates with anastomotic stenosis. Intracoronary radiation therapy is effective for preventing restenosis after percutaneous coronary intervention (PCI). We postulated that intracoronary radiation therapy could prevent anastomotic stenosis and tested this hypothesis in an animal model. Femoral arteries and veins of beagle dogs were harvested, and composite arterioarterial and arteriovenous grafts were prepared. After external irradiation of the anastomotic sites, these composite grafts were transplanted into femoral arteries. Histomorphometric and immunohistological analyses of the anastomotic sites were performed. The study groups consisted of controls and animals exposed to 10 Gy, 20 Gy, and 30 Gy (n=5, in each group). In the artery graft model, the ratio of negative remodeling was significantly increased in all groups exposed to ≥10 Gy. The ratio of neointimal hyperplasia was significantly decreased in all groups exposed to ≥10 Gy. Cell density of anti-α-actin antibody-positive cells and anti-proliferating cell nuclear antigen (PCNA) antibody-positive cells was highest in the adventitial layer, and the density decreased as the dosage increased. Experimental results were almost the same in the vein graft models as in the artery graft models. With double immunohistostaining, the anti-PCNA antibody-positive cells expressed α-actin. Irradiation can inhibit anastomotic stenosis in a canine model. Adventitia is a factor in the creation of stenosis, and irradiation appears to target the adventitia. We speculate that there might be a possible role for intracoronary irradiation in the future to prevent anastomotic stenosis. (author)

  16. Contrast-enhanced ultrasonography of the normal canine adrenal gland. (United States)

    Pey, Pascaline; Vignoli, Massimo; Haers, Hendrik; Duchateau, Luc; Rossi, Federica; Saunders, Jimmy H


    Contrast-enhanced ultrasonography is useful in differentiating adrenal gland adenomas from nonadenomatous lesions in human patients. The purposes of this study were to evaluate the feasibility and to describe contrast-enhanced ultrasonography of the normal canine adrenal gland. Six healthy female Beagles were injected with an intravenous bolus of a lipid-shelled contrast agent (SonoVue(®) ). The aorta enhanced immediately followed by the renal artery and then the adrenal gland. Adrenal gland enhancement was uniform, centrifugal, and rapid from the medulla to the cortex. When maximum enhancement was reached, a gradual homogeneous decrease in echogenicity of the adrenal gland began and simultaneously enhancement of the phrenicoabdominal vessels was observed. While enhancement kept decreasing in the adrenal parenchyma, the renal vein, caudal vena cava, and phrenicoabdominal vein were characterized by persistent enhancement until the end of the study. A second contrast enhancement was observed, corresponding to the refilling time. Objective measurements were performed storing the images for off-line image analysis using Image J (ImageJ(©) ). The shape of the time-intensity curve reflecting adrenal perfusion was similar in all dogs. Ratios of the values of the cortex and the medulla to the values of the renal artery were characterized by significant differences from initial upslope to the peak allowing differentiation between the cortex and the medulla for both adrenal glands only in this time period. Contrast-enhanced ultrasonography of the adrenal glands is feasible in dogs and the optimal time for adrenal imaging is between 5 and 90 s after injection. PMID:21521396

  17. Estimating the global burden of endemic canine rabies.

    Directory of Open Access Journals (Sweden)

    Katie Hampson


    Full Text Available Rabies is a notoriously underreported and neglected disease of low-income countries. This study aims to estimate the public health and economic burden of rabies circulating in domestic dog populations, globally and on a country-by-country basis, allowing an objective assessment of how much this preventable disease costs endemic countries.We established relationships between rabies mortality and rabies prevention and control measures, which we incorporated into a model framework. We used data derived from extensive literature searches and questionnaires on disease incidence, control interventions and preventative measures within this framework to estimate the disease burden. The burden of rabies impacts on public health sector budgets, local communities and livestock economies, with the highest risk of rabies in the poorest regions of the world. This study estimates that globally canine rabies causes approximately 59,000 (95% Confidence Intervals: 25-159,000 human deaths, over 3.7 million (95% CIs: 1.6-10.4 million disability-adjusted life years (DALYs and 8.6 billion USD (95% CIs: 2.9-21.5 billion economic losses annually. The largest component of the economic burden is due to premature death (55%, followed by direct costs of post-exposure prophylaxis (PEP, 20% and lost income whilst seeking PEP (15.5%, with only limited costs to the veterinary sector due to dog vaccination (1.5%, and additional costs to communities from livestock losses (6%.This study demonstrates that investment in dog vaccination, the single most effective way of reducing the disease burden, has been inadequate and that the availability and affordability of PEP needs improving. Collaborative investments by medical and veterinary sectors could dramatically reduce the current large, and unnecessary, burden of rabies on affected communities. Improved surveillance is needed to reduce uncertainty in burden estimates and to monitor the impacts of control efforts.

  18. Esporotricose canina: relato de caso Canine sporotrichosis: case report

    Directory of Open Access Journals (Sweden)

    N.T. Souza


    Full Text Available Relata-se um caso de esporotricose em um cão da raça Boxer, macho, com seis anos, encaminhado para uma consulta por causa de massa na região nasal e de dispneia. Após o exame físico, o animal foi internado para a realização de citologia, histologia e radiografia. Nos exames citológico e radiográfico, não foram constatadas alterações que justificassem a massa e a dispneia. Na histologia, observou-se a presença de um granuloma contendo dois esporos de Sporothrix schenckii. Foi realizado tratamento com itraconazol 5mg/kg BID por 60 dias. Após esse período, a massa desapareceu e a respiração do animal melhorou, tendo sido recomendada a manutenção da terapia por mais 30 dias, para evitar recidiva.A case of canine sporotrichosis was reported in a six-year-old male Boxer, referred to a veterinary hospital because of a mass in the region of the nose and dyspnea. After physical examination, the animal was submitted to cytological, histological, and radiographic exams. The cytological and radiographic exams showed no alterations that could justify the mass and the dyspnea. The histological exam showed the presence of a granuloma with two Sporothrix schenckii spores. The dog was treated with itraconazol 5mg/kg BID during 60 days. After this period, the mass disappeared and breathing improved. The therapy was maintained for 30 other days to avoid relapse.

  19. Two potential recombinant rabies vaccines expressing canine parvovirus virion protein 2 induce immunogenicity to canine parvovirus and rabies virus. (United States)

    Luo, Jun; Shi, Hehe; Tan, Yeping; Niu, Xuefeng; Long, Teng; Zhao, Jing; Tian, Qin; Wang, Yifei; Chen, Hao; Guo, Xiaofeng


    Both rabies virus (RABV) and canine parvovirus (CPV) cause lethal diseases in dogs. In this study, both high egg passage Flury (HEP-Flury) strains of RABV and recombinant RABV carrying double RABV glycoprotein (G) gene were used to express the CPV virion protein 2 (VP2) gene, and were designated rHEP-VP2 and, rHEP-dG-VP2 respectively. The two recombinant RABVs maintained optimal virus titration according to their viral growth kinetics assay compared with the parental strain HEP-Flury. Western blotting indicated that G protein and VP2 were expressed in vitro. The expression of VP2 in Crandell feline kidney cells post-infection by rHEP-VP2 and rHEP-dG-VP2 was confirmed by indirect immunofluorescence assay with antibody against VP2. Immunogenicity of recombinant rabies viruses was tested in Kunming mice. Both rHEP-VP2 and rHEP-dG-VP2 induced high levels of rabies antibody compared with HEP-Flury. Mice immunized with rHEP-VP2 and rHEP-dG-VP2 both had a high level of antibodies against VP2, which can protect against CPV infection. A challenge experiment indicated that more than 80% mice immunized with recombinant RABVs survived after infection of challenge virus standard 24 (CVS-24). Together, this study showed that recombinant RABVs expressing VP2 induced protective immune responses to RABV and CPV. Therefore, rHEP-VP2 and rHEP-dG-VP2 might be potential combined vaccines for RABV and CPV. PMID:27449079

  20. Two potential recombinant rabies vaccines expressing canine parvovirus virion protein 2 induce immunogenicity to canine parvovirus and rabies virus. (United States)

    Luo, Jun; Shi, Hehe; Tan, Yeping; Niu, Xuefeng; Long, Teng; Zhao, Jing; Tian, Qin; Wang, Yifei; Chen, Hao; Guo, Xiaofeng


    Both rabies virus (RABV) and canine parvovirus (CPV) cause lethal diseases in dogs. In this study, both high egg passage Flury (HEP-Flury) strains of RABV and recombinant RABV carrying double RABV glycoprotein (G) gene were used to express the CPV virion protein 2 (VP2) gene, and were designated rHEP-VP2 and, rHEP-dG-VP2 respectively. The two recombinant RABVs maintained optimal virus titration according to their viral growth kinetics assay compared with the parental strain HEP-Flury. Western blotting indicated that G protein and VP2 were expressed in vitro. The expression of VP2 in Crandell feline kidney cells post-infection by rHEP-VP2 and rHEP-dG-VP2 was confirmed by indirect immunofluorescence assay with antibody against VP2. Immunogenicity of recombinant rabies viruses was tested in Kunming mice. Both rHEP-VP2 and rHEP-dG-VP2 induced high levels of rabies antibody compared with HEP-Flury. Mice immunized with rHEP-VP2 and rHEP-dG-VP2 both had a high level of antibodies against VP2, which can protect against CPV infection. A challenge experiment indicated that more than 80% mice immunized with recombinant RABVs survived after infection of challenge virus standard 24 (CVS-24). Together, this study showed that recombinant RABVs expressing VP2 induced protective immune responses to RABV and CPV. Therefore, rHEP-VP2 and rHEP-dG-VP2 might be potential combined vaccines for RABV and CPV.

  1. Treatment of canine atopic dermatitis: 2010 clinical practice guidelines from the International Task Force on Canine Atopic Dermatitis. (United States)

    Olivry, Thierry; DeBoer, Douglas J; Favrot, Claude; Jackson, Hilary A; Mueller, Ralf S; Nuttall, Tim; Prélaud, Pascal


    Atopic dermatitis (AD) is a common chronic relapsing pruritic skin disease of dogs for which treatment has varied over time and geographical location. Recent high quality randomized controlled trials and systematic reviews have established which drugs are likely to offer consistent benefit. The International Task Force for Canine AD currently recommends a multi-faceted approach to treat dogs with AD. Acute flares should be treated with a combination of nonirritating baths and topical glucocorticoids, once an attempt has been made to identify and remove the suspected causes of the flare. Oral glucocorticoids and antimicrobial therapy must be added when needed. In dogs with chronic AD, a combination of interventions should be considered. Again, factors that trigger flares of AD must be identified and, if possible, avoided. Currently recognized flare factors include food, flea and environmental allergens, Staphylococcus bacteria and Malassezia yeast. Skin and coat hygiene and care must be improved by bathing with nonirritating shampoos and dietary supplementation with essential fatty acids. The severity of pruritus and skin lesions can be reduced with a combination of anti-inflammatory drugs. Currently, medications with good evidence of high efficacy include topical and oral glucocorticoids, and calcineurin inhibitors such as oral ciclosporin and topical tacrolimus. The dose and frequency of administration of these drugs should be tailored to each patient considering each drug's efficacy, adverse effects and cost. Allergen-specific immunotherapy should be offered, whenever feasible, in an attempt to prevent recurrence of clinical signs upon further exposure to environmental allergens to which the patient is hypersensitive. PMID:20456716

  2. Application of an Improved Enzyme-Linked Immunosorbent Assay Method for Serological Diagnosis of Canine Leishmaniasis

    NARCIS (Netherlands)

    N. Santarem; R. Silvestre; L. Cardoso; H. Schallig; S.G. Reed; A. Cordeiro-da-Silva


    Accurate diagnosis of canine leishmaniasis (CanL) is essential toward a more efficient control of this zoonosis, but it remains problematic due to the high incidence of asymptomatic infections. In this study, we present data on the development of enzyme-linked immunosorbent assay (ELISA)-based techn

  3. Comparison of mandibular premolars and canines with respect to their resistance to vertical root fracture

    NARCIS (Netherlands)

    Wu, MK; van der Sluis, LWM; Wesselink, PR


    Objective. To compare the force required to vertically fracture uninstrumented and instrumented mandibular premolars and canines. I : Methods. Two groups of single round-canal mandibular premolars and two groups of single oval-canal mandibular premolars were selected after radiographs indicated an i

  4. Serologic survey of selected canine pathogens among free-ranging jackals in Kenya. (United States)

    Alexander, K A; Kat, P W; Wayne, R K; Fuller, T K


    Serum samples from 76 free-ranging adult jackals of three species from four localities in Kenya were examined for circulating antibodies against four canine pathogens: rabies virus, canine parvovirus (CPV-2), canine distemper virus (CDV), and Ehrlichia canis. Samples were collected between April 1987 and January 1988. Among black-backed jackals (Canis mesomelas), the most sampled species, the mean prevalence of antibodies to CPV-2, CDV, rabies virus, and E. canis was 34% (14 positive/55 sampled), 9% (4/55), 3% (1/28), and 2% (1/36), respectively. There were no significantly differences among sampling locations. In one area, antibody prevalence of CPV-2 was significantly higher for golden jackals (C. aureus; 9/16) than for C. mesomelas (5/26). Only three side-striped jackals (C. adustus) were sampled, but antibodies to CPV-2 and CDV were present. As jackals often are the most abundant wild carnivore in African ecosystems, they could serve as an important indicator species to monitor the potential of exposure of rare and endangered canids to specific canine diseases. PMID:7760476

  5. Renal T-cell lymphoma with cerebral metastasis in a dog with chronic canine ehrlichiosis

    Directory of Open Access Journals (Sweden)

    E.P. Lane


    Full Text Available A renal T-cell lymphoma with exclusive cerebral metastasis was diagnosed in a 5-year-old Staffordshire bull terrier bitch euthanased for aggression. This is the first recorded case of primary renal lymphoma in a dog. Immune suppression, due to chronic canine monocytic ehrlichiosis, mayaccount for the unusual primary site and metastatic patternof the tumour.

  6. Clinical and hematological study of canine Ehrlichiosis with other hemoprotozoan parasites in Kolkata, West Bengal, India

    Directory of Open Access Journals (Sweden)

    Mousam Das


    Conclusions: The results of this study stated that clinical and haematological changes occurred in canine ehrlichiosis with babesiosis and hepatozoonosis due to parasitemia. In mixed infection, the disease more severe, and also it depended on immunity of animals. Babesia gibsoni and Hepatozoon canis with Ehrlichia sp. were first reported from West Bengal state of India by this study.

  7. Mortality in virulent canine babesiosis is associated with a consumptive coagulopathy

    DEFF Research Database (Denmark)

    Goddard, Amelia; Wiinberg, Bo; Schoeman, Johan P.;


    coagulopathy in dogs with Babesia rossi infection is related to mortality. Seventy-two client-owned dogs diagnosed with canine babesiosis were included. Diagnosis was confirmed by polymerase chain reaction and reverse line blot and dogs co-infected with Babesia vogeli or Ehrlichia canis were excluded. Blood...

  8. Inactivated recombinant plant virus protects dogs from a lethal challenge with canine parvovirus

    DEFF Research Database (Denmark)

    Langeveld, J.P.M.; Brennan, F.R.; Martinez-Torrecuadrada, J.L.;


    A vaccine based upon a recombinant plant virus (CPMV-PARVO1), displaying a peptide derived from the VP2 capsid protein of canine parvovirus (CPV), has previously been described. To date, studies with the vaccine have utilized viable plant chimaeric particles (CVPs). In this study, CPMV-PARVO1...

  9. Preclinical evaluation of oncolytic vaccinia virus for therapy of canine soft tissue sarcoma.

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    Full Text Available Virotherapy using oncolytic vaccinia virus (VACV strains is one promising new strategy for canine cancer therapy. In this study we describe the establishment of an in vivo model of canine soft tissue sarcoma (CSTS using the new isolated cell line STSA-1 and the analysis of the virus-mediated oncolytic and immunological effects of two different Lister VACV LIVP1.1.1 and GLV-1h68 strains against CSTS. Cell culture data demonstrated that both tested VACV strains efficiently infected and destroyed cells of the canine soft tissue sarcoma line STSA-1. In addition, in our new canine sarcoma tumor xenograft mouse model, systemic administration of LIVP1.1.1 or GLV-1h68 viruses led to significant inhibition of tumor growth compared to control mice. Furthermore, LIVP1.1.1 mediated therapy resulted in almost complete tumor regression and resulted in long-term survival of sarcoma-bearing mice. The replication of the tested VACV strains in tumor tissues led to strong oncolytic effects accompanied by an intense intratumoral infiltration of host immune cells, mainly neutrophils. These findings suggest that the direct viral oncolysis of tumor cells and the virus-dependent activation of tumor-associated host immune cells could be crucial parts of anti-tumor mechanism in STSA-1 xenografts. In summary, the data showed that both tested vaccinia virus strains and especially LIVP1.1.1 have great potential for effective treatment of CSTS.

  10. Optic neuritis caused by canine distemper virus in a Jack Russell terrier. (United States)

    Richards, Tara R; Whelan, Nick C; Pinard, Chantale L; Alcala, Fernanda Castillo; Wolfe, Katheryn C


    An atypical case of canine distemper (CD) was diagnosed in a vaccinated healthy adult dog. The patient was presented circling, seizuring, and blind. Postmortem examination resulted in a diagnosis of CD. Optic neuritis was diagnosed, a finding not previously described in the context of CD virus infection presenting solely with neurological signs.

  11. Complete Nucleotide Sequence of Canine Distemper Virus HLJ1-06, Isolated from Foxes in China


    Jiang, Qian; Hu, Xiaoliang; Ge, Yanhua; Lin, Huan; Jiang, Yong; Liu, Jiasen; Guo, Dongchun; Si, Changde; Qu, Liandong


    A new strain of canine distemper virus, HLJ1-06, has been isolated from foxes in China, and its complete genome has been sequenced and analyzed. The phylogenetic analysis suggests that HLJ1-06 belongs to the Asia-1 cluster and has low identity to the vaccine strain.

  12. Uncommon acute neurologic presentation of canine distemper in 4 adult dogs


    Galán, Alba; Gamito, Araceli; Carletti, Beatrice E.; Guisado, Alicia; de las Mulas, Juana Martín; Pérez, José; Martín, Eva M.


    Four uncommon cases of canine distemper (CD) were diagnosed in vaccinated adult dogs. All dogs had acute onset of neurologic signs, including seizures, abnormal mentation, ataxia, and proprioceptive deficits. Polymerase chain reaction for CD virus was positive on cerebrospinal fluid in 2 cases. Due to rapid deterioration the dogs were euthanized and CD was confirmed by postmortem examination.

  13. Fatal vaccine-induced canine distemper virus infection in black-footed ferrets (United States)

    Carpenter, J.W.; Appel, M.J.G.; Erickson, R.C.; Novilla, M.N.


    Four black-footed ferrets that were live-trapped in South Dakota and transported to the Patuxent Wildlife Research Center died within 21 days after vaccination with modified live canine distemper virus. Immunofluorescence, European ferret inoculation, virus isolation attempts, and serum-neutralization tests indicated insufficient attenuation of the vaccine for this species.

  14. First Genome Sequence of a Canine Distemper Virus Strain from South America


    Sarute, Nicolás; Delgado, María V.; Carrau, Lucía; Benech, Alejandro; Francia, Lourdes; Pérez, Ruben; Panzera, Yanina


    Canine distemper virus causes a severe infectious disease in carnivores worldwide. Herein, we sequenced and analyzed the genome of a new strain (Uy251/2012) isolated from a dog in Uruguay. The Uy251/2012 strain belongs to the Europe1/South America1 lineage, and constitutes the first report of a genomic sequence in South America.

  15. Optic neuritis caused by canine distemper virus in a Jack Russell terrier


    Richards, Tara R.; Whelan, Nick C.; Pinard, Chantale L.; Alcala, Fernanda Castillo; Wolfe, Katheryn C.


    An atypical case of canine distemper (CD) was diagnosed in a vaccinated healthy adult dog. The patient was presented circling, seizuring, and blind. Postmortem examination resulted in a diagnosis of CD. Optic neuritis was diagnosed, a finding not previously described in the context of CD virus infection presenting solely with neurological signs.

  16. Complete Nucleotide Sequence of Canine Distemper Virus CDV-PS, Isolated from Dogs in China


    Yi, Li; Xu, Hongli; Wang, Jianke; Cheng, Yuening; Zhang, Hailing; Yan, Xijun; Cheng, Shipeng


    A new strain of canine distemper virus, CDV-PS, has been isolated from dogs in China, and its complete genome has been sequenced and analyzed. The phylogenetic analysis suggests that CDV-PS belongs to the Asia-1 cluster and has low identity to the vaccine strain.

  17. Canine distemper virus from diseased large felids: Biological properties and phylogenetic relationships.

    NARCIS (Netherlands)

    T.C. Harder (Timm); M.J.H. Kenter (Marcel); H. Vos; C.H.J. Siebelink (Kees); W. Huisman (Willem); C. Örvell; T. Barrett (Thomas); M.J.G. Appel (Max); A.D.M.E. Osterhaus (Albert); G. van Amerongen (Geert)


    textabstractSpecific pathogen free (SPF) domestic cats were inoculated with tissue homogenate obtained from a Chinese leopard (Panthera pardus japonensis) that had died in a North American zoo from a natural infection with canine distemper virus (CDV). The cats developed a transient cell-associated

  18. Canine-origin G3P[3] rotavirus strain in child with acute gastroenteritis. (United States)

    De Grazia, Simona; Martella, Vito; Giammanco, Giovanni M; Gòmara, Miren Iturriza; Ramirez, Stefania; Cascio, Antonio; Colomba, Claudia; Arista, Serenella


    Infection by an animal-like strain of rotavirus (PA260/97) was diagnosed in a child with gastroenteritis in Palermo, Italy, in 1997. Sequence analysis of VP7, VP4, VP6, and NSP4 genes showed resemblance to a G3P[3] canine strain identified in Italy in 1996. Dogs are a potential source of human viral pathogens. PMID:18214189

  19. Excessive Pro-Inflammatory Serum Cytokine Concentrations in Virulent Canine Babesiosis

    DEFF Research Database (Denmark)

    Goddard, Amelia; Leisewitz, Andrew L; Kjelgaard-Hansen, Mads;


    admission, prior to any treatment. Cytokine concentrations were assessed using a canine-specific multiplex assay on an automated analyser. Serum concentrations of interleukin (IL)-2, IL-6, IL-8, IL-10, IL-18, granulocyte-macrophage colony stimulating factor (GM-CSF) and monocyte chemotactic protein-1 (MCP-1...

  20. Phenotypic, functional, and quantitative characterization of canine peripheral blood monocyte-derived macrophages

    Directory of Open Access Journals (Sweden)

    R Bueno


    Full Text Available The yield as well as phenotypic and functional parameters of canine peripheral blood monocyte-derived macrophages were analyzed. The cells that remained adherent to Teflon after 10 days of culture had high phagocytic activity when inoculated with Leishmania chagasi. Flow cytometric analysis demonstrated that more than 80% of cultured cells were positive for the monocyte/macrophage marker CD14.

  1. Mandibular Canine Dimorphism in Establishing Sex Identity in the Lebanese Population

    Directory of Open Access Journals (Sweden)

    Fouad Ayoub


    Full Text Available Background and Objective. In forensic investigations, mandibular canines provide excellent materials to identify gender since they are more likely to survive disasters. The objective of this study was to investigate gender dimorphism by comparing the mesiodistal width of mandibular permanent canines and intercanine distance in a group of Lebanese population. Methods. Participants consisted of undergraduate students from the School of Dentistry, Lebanese University, for two academic years who fulfilled the inclusion criteria. Canine widths and intercanine distance were measured by one operator directly on dental casts using a digital caliper. Results. One hundred thirty-three Lebanese dental students (54 males and 69 females aged 18–25 were included in the study. The intercanine distance was significantly greater in males (P value 0.05 and females (P value > 0.05. The mean width of canine was greater than 7.188 mm for males. Conclusion. The parameters measured in the present study are of great help in sex identification in forensic investigations in the Lebanese adult population.

  2. Inhibition of P-glycoprotein by psychotherapeutic drugs in a canine cell model

    NARCIS (Netherlands)

    Schrickx, J A; Fink-Gremmels, J


    Drug-drug interactions related to long-term therapies are of increasing concern. Psychotherapeutic drugs, licensed for the use in dogs for the management of separation anxiety and other behavioural disorders, are examples of drugs used in long-term therapies. In an in vitro system with canine P-glyc

  3. Forensic Analysis of Canine DNA Samples in the Undergraduate Biochemistry Laboratory (United States)

    Carson, Tobin M.; Bradley, Sharonda Q.; Fekete, Brenda L.; Millard, Julie T.; LaRiviere, Frederick J.


    Recent advances in canine genomics have allowed the development of highly distinguishing methods of analysis for both nuclear and mitochondrial DNA. We describe a laboratory exercise suitable for an undergraduate biochemistry course in which the polymerase chain reaction is used to amplify hypervariable regions of DNA from dog hair and saliva…

  4. Canine-Origin G3P[3] Rotavirus Strain in Child with Acute Gastroenteritis


    De Grazia, Simona; Martella, Vito; Giammanco, Giovanni M; Gòmara, Miren Iturriza; Ramirez, Stefania; Cascio, Antonio; Colomba, Claudia; Arista, Serenella


    Infection by an animal-like strain of rotavirus (PA260/97) was diagnosed in a child with gastroenteritis in Palermo, Italy, in 1997. Sequence analysis of VP7, VP4, VP6, and NSP4 genes showed resemblance to a G3P[3] canine strain identified in Italy in 1996. Dogs are a potential source of human viral pathogens.

  5. Genomic organization and expression of the 3' end of the canine and feline enteric coronaviruses

    NARCIS (Netherlands)

    Vennema, H; Rossen, J W; Wesseling, J; Horzinek, M C; Rottier, P J


    The genomic organization at the 3' end of canine coronavirus (CCV) and feline enteric coronavirus (FECV) was determined by sequence analysis and compared to that of feline infectious peritonitis virus (FIPV) and transmissible gastroenteritis virus (TGEV) of swine. Comparison of the latter two has pr

  6. Treatment of patent ductus arteriosus by the use of an Amplatz canine ductal occluder device. (United States)

    White, Pam


    A 7-month-old female, spayed border collie was referred to the Ontario Veterinary College due to a continuous murmur noted by the referring veterinarian prior to ovariohysterectomy. Auscultation confirmed a grade VI/VI continuous murmur. An echocardiogram confirmed patent ductus arteriosus (PDA). An Amplatz canine ductal occluder device was successfully placed for occlusion of blood flow though the ductus. PMID:19436449

  7. Uncommon acute neurologic presentation of canine distemper in 4 adult dogs. (United States)

    Galán, Alba; Gamito, Araceli; Carletti, Beatrice E; Guisado, Alicia; de las Mulas, Juana Martín; Pérez, José; Martín, Eva M


    Four uncommon cases of canine distemper (CD) were diagnosed in vaccinated adult dogs. All dogs had acute onset of neurologic signs, including seizures, abnormal mentation, ataxia, and proprioceptive deficits. Polymerase chain reaction for CD virus was positive on cerebrospinal fluid in 2 cases. Due to rapid deterioration the dogs were euthanized and CD was confirmed by postmortem examination. PMID:24688139

  8. Characterization of the novel indolylmaleimides' PDA-66 and PDA-377 effect on canine lymphoma cells (United States)

    Schmidt, Laura C.; Roolf, Catrin; Pews-Davtyan, Anahit; Rütgen, Barbara C.; Hammer, Sabine; Willenbrock, Saskia; Sekora, Anett; Rolfs, Arndt; Beller, Matthias; Brenig, Bertram; Nolte, Ingo; Junghanss, Christian


    Protein kinase inhibitors are widely used in chemotherapeutic cancer regimens. Maleimide derivatives such as SB-216763 act as GSK-3 inhibitor targeting cell proliferation, cell death and cell cycle progression. Herein, the two arylindolylmaleimide derivatives PDA-66 and PDA-377 were evaluated as potential chemotherapeutic agents on canine B-cell lymphoma cell lines. Canine lymphoma represents a naturally occurring model closely resembling the human high-grade non-Hodgkin's lymphoma (NHL). PDA-66 showed more pronounced effects on both cell lines. Application of 2.5μM PDA-66 resulted in a significant induction of apoptosis (approx. 11 %), decrease of the metabolic activity (approx. 95 %), anti-proliferative effect (approx. 85 %) and cell death within 48h. Agent induced mode of action was characterized by whole transcriptome sequencing, 12 h and 24 h post-agent exposure. Key PDA-66-modulated pathways identified were cell cycle, DNA replication and p53 signaling. Expression analyses indicated that the drug acting mechanism is mediated through DNA replication and cycle arrest involving the spindle assembly checkpoint. In conclusion, both PDA derivatives displayed strong anti-proliferation activity in canine B-cell lymphoma cells. The cell and molecular PDA-induced effect characterization and the molecular characterization of the agent acting mechanism provides the basis for further evaluation of a potential drug for canine lymphoma serving as model for human NHL. PMID:27177088

  9. The effect of neuromuscular blockade on canine laparoscopic ovariectomy: A double-blinded, prospective clinical trial

    NARCIS (Netherlands)

    van Goethem, B.; van Nimwegen, S.A.; Akkerdaas, L.C.; Murrell, J.C.; Kirpensteijn, J.


    The Effect of Neuromuscular Blockade on Canine Laparoscopic Ovariectomy: A Double-Blinded, Prospective Clinical Trial Bart Van Goethem, Diplomate ECVS, Sebastiaan Alexander van Nimwegen, PhD, Ies Akkerdaas, DVM, Joanna Claire Murrell, BVSc., PhD, Diplomate ECVAA, and Jolle Kirpensteijn, PhD, Diploma

  10. Sequence-independent VIDISCA-454 technique to discover new viruses in canine livers. (United States)

    van der Heijden, Mitzi; de Vries, Michel; van Steenbeek, Frank G; Favier, Robert P; Deijs, Martin; Brinkhof, Bas; Rothuizen, Jan; van der Hoek, Lia; Penning, Louis C


    In many mammals, viruses cause hepatitis. Despite many efforts a specific virus responsible for canine idiopathic hepatitis has not been identified. The discovery of a viral etiology in canine hepatitis will promote the development of specific drugs and vaccines for the treatment of idiopathic hepatitis in dogs. The objective of this study was the application of the sequence-independent Virus Discovery cDNA-amplified fragment length polymorphism (VIDISCA) technique combined with high through-put sequencing on a Roche-454 sequencer to identify unknown viruses. Liver tissue of a dog with idiopathic acute hepatitis was cultured on a canine liver cell line and the cell culture medium was submitted to the VIDISCA-454 technique. Without prior knowledge of the viral species involved, this technique identified Canine adenovirus type 1 (CAV-1) as the infecting agent. This demonstrates the power of VIDISCA-454 to identify viruses, independent of preliminary information about the genomic sequence. Consequently, the strategy of propagation in this cell line followed by the VIDISCA-454 technique is valuable to identify the viral etiology of idiopathic hepatitis in dogs. PMID:22664180

  11. Anti-influenza neuraminidase inhibitor oseltamivir phosphate induces canine mammary cancer cell aggressiveness. (United States)

    de Oliveira, Joana T; Santos, Ana L; Gomes, Catarina; Barros, Rita; Ribeiro, Cláudia; Mendes, Nuno; de Matos, Augusto J; Vasconcelos, M Helena; Oliveira, Maria José; Reis, Celso A; Gärtner, Fátima


    Oseltamivir phosphate is a widely used anti-influenza sialidase inhibitor. Sialylation, governed by sialyltransferases and sialidases, is strongly implicated in the oncogenesis and progression of breast cancer. In this study we evaluated the biological behavior of canine mammary tumor cells upon oseltamivir phosphate treatment (a sialidase inhibitor) in vitro and in vivo. Our in vitro results showed that oseltamivir phosphate impairs sialidase activity leading to increased sialylation in CMA07 and CMT-U27 canine mammary cancer cells. Surprisingly, oseltamivir phosphate stimulated, CMT-U27 cell migration and invasion capacity in vitro, in a dose-dependent manner. CMT-U27 tumors xenograft of oseltamivir phosphate-treated nude mice showed increased sialylation, namely α2,6 terminal structures and SLe(x) expression. Remarkably, a trend towards increased lung metastases was observed in oseltamivir phosphate-treated nude mice. Taken together, our findings revealed that oseltamivir impairs canine mammary cancer cell sialidase activity, altering the sialylation pattern of canine mammary tumors, and leading, surprisingly, to in vitro and in vivo increased mammary tumor aggressiveness. PMID:25850034

  12. Anti-influenza neuraminidase inhibitor oseltamivir phosphate induces canine mammary cancer cell aggressiveness.

    Directory of Open Access Journals (Sweden)

    Joana T de Oliveira

    Full Text Available Oseltamivir phosphate is a widely used anti-influenza sialidase inhibitor. Sialylation, governed by sialyltransferases and sialidases, is strongly implicated in the oncogenesis and progression of breast cancer. In this study we evaluated the biological behavior of canine mammary tumor cells upon oseltamivir phosphate treatment (a sialidase inhibitor in vitro and in vivo. Our in vitro results showed that oseltamivir phosphate impairs sialidase activity leading to increased sialylation in CMA07 and CMT-U27 canine mammary cancer cells. Surprisingly, oseltamivir phosphate stimulated, CMT-U27 cell migration and invasion capacity in vitro, in a dose-dependent manner. CMT-U27 tumors xenograft of oseltamivir phosphate-treated nude mice showed increased sialylation, namely α2,6 terminal structures and SLe(x expression. Remarkably, a trend towards increased lung metastases was observed in oseltamivir phosphate-treated nude mice. Taken together, our findings revealed that oseltamivir impairs canine mammary cancer cell sialidase activity, altering the sialylation pattern of canine mammary tumors, and leading, surprisingly, to in vitro and in vivo increased mammary tumor aggressiveness.

  13. Genomic organization and expression of the 3' end of the canine and feline enteric coronaviruses

    NARCIS (Netherlands)

    Vennema, H; Rossen, J W; Wesseling, J; Horzinek, M C; Rottier, P J


    The genomic organization at the 3' end of canine coronavirus (CCV) and feline enteric coronavirus (FECV) was determined by sequence analysis and compared to that of feline infectious peritonitis virus (FIPV) and transmissible gastroenteritis virus (TGEV) of swine. Comparison of the latter two has pr

  14. Seroprevalence of antibodies to canine influenza virus in dogs in Ontario


    Kruth, Steven A.; Carman, Susy; Weese, J. Scott


    A cross-sectional study evaluating the seroprevalence of antibodies to canine influenza virus in dogs in Ontario was performed. The prevalence was 0.4% (1/225), and the only seropositive dog was a greyhound that originated in Florida.

  15. Prevalence of antibodies against canine distemper virus among red foxes in Luxembourg.

    NARCIS (Netherlands)

    B.C. Damien; B.E.E. Martina (Byron); S. Losch; A.D.M.E. Osterhaus (Albert); C.P. Muller (Claude)


    textabstractCanine distemper virus (CDV) has a wide host spectrum, and during the past years, distemper has been observed in species that were previously not considered to be susceptible. In this study, we investigated the prevalence of CDV-specific antibodies in red foxes (Vulpes vulpes) sampled be

  16. 犬瘟热的诊断%Diagnosis of Canine Distemper Virus from Dog

    Institute of Scientific and Technical Information of China (English)

    梅胜尧; 孙宝海


    犬瘟热是危害犬、狐、貂最严重的烈性传染病之一.作者对某试验动物犬饲养厂的病死犬进行临床症状观察,病理剖检及实验室诊断,通过病毒的分离培养及间接免疫荧光鉴定,确诊为犬瘟热病毒感染.鉴于该病的危害程度,建议加强对犬瘟热病的诊断及监控.%Canine distemper is one of the most serious deadly infectious diseases to dog. fox and mink. The paper introduced a dog farm. The clinical symptoms and pathological lesions and laboratory diagnosis were observed, and canine distemper was detected by virus isolation culture and indirect immunofluorescence. the final diagnosis result was canine distemper. Because the existence of the disease and the harm fulness to the experimental animals industry, the diagnosis and monitoring of canine distemper should be strengthening.

  17. Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies

    DEFF Research Database (Denmark)

    Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent;


    Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits...

  18. Prevalence of antibodies against canine distemper virus among red foxes in Luxembourg

    NARCIS (Netherlands)

    B.C. Damien; S. Losch; J. Mossong; C.P. Muller (Claude); A.D.M.E. Osterhaus (Albert); B.E.E. Martina (Byron)


    textabstractCanine distemper virus (CDV) has a wide host spectrum, and during the past years, distemper has been observed in species that were previously not considered to be susceptible. In this study, we investigated the prevalence of CDV-specific antibodies in red foxes (Vulpes vulpes) sampled be

  19. Purification of infectious canine parvovirus from cell culture by affinity chromatography with monoclonal antibodies.

    NARCIS (Netherlands)

    J. Groen (Jan); N. Juntti; J.S. Teppema; F.G.C.M. Uytdehaag (Fons); A.D.M.E. Osterhaus (Ab); G.F. Rimmelzwaan (Guus)


    textabstractImmuno affinity chromatography with virus neutralizing monoclonal antibodies, directed to the haemagglutinating protein of canine parvovirus (CPV) was used to purify and concentrate CPV from infected cell culture. The procedure was monitored by testing the respective fractions in an infe

  20. Increased expression of C5a receptor (CD88) mRNA in canine mammary tumors. (United States)

    Hezmee, Mohd Noor Mohd; Kyaw-Tanner, Myat; Lee, Jia Yu Peppermint; Shiels, Ian A; Rolfe, Barbara; Woodruff, Trent; Mills, Paul C


    Mammary tumors are among the most common neoplastic conditions in dogs, and there is evidence that inflammation plays a role in the development of some tumor types in dogs. The complement system is a major participant in the inflammatory process and the complement activation component, C5a, is a potent inflammatory peptide. This study investigated the mRNA expression of the major receptor for C5a (C5aR; CD88) in histopathological samples of canine mammary tumors by quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) using canine-specific primers for CD88. A total of seven canine mammary tumors (four malignant carcinomas, two benign mixed mammary tumors, and one myoepithelioma) and eight normal mammary glands were analysed. All the tumor samples expressed low levels of CD88 mRNA, while none of the normal mammary tissues showed any detectable expression. These preliminary results suggest that C5a-CD88 interaction may play a contributory role in the inflammatory response associated with mammary tumor development in dogs. Further studies investigating the mechanisms behind complement activation and C5a receptor expression in canine mammary tumors are warranted. PMID:20846729

  1. Leukocyte count affects expression of reference genes in canine whole blood samples

    NARCIS (Netherlands)

    Piek, C.J.; Brinkhof, B.; Rothuizen, J.; Dekker, A.; Penning, L.C.


    Background The dog is frequently used as a model for hematologic human diseases. In this study the suitability of nine potential reference genes for quantitative RT-PCR studies in canine whole blood was investigated. Findings The expression of these genes was measured in whole blood samples of 263 i

  2. Magnetic resonance and computed tomographic features of 4 cases of canine congenital thoracic vertebral anomalies. (United States)

    Berlanda, Michele; Zotti, Alessandro; Brandazza, Giada; Poser, Helen; Calò, Pietro; Bernardini, Marco


    Magnetic resonance and computed tomography features of 4 cases of canine congenital vertebral anomalies (CVAs) are discussed. Two of the cases represent unusual presentations for such anomalies that commonly affect screw-tail or toy breeds. Moreover, the combination of CVAs and a congenital peritoneo-pericardial diaphragmatic hernia has never before been imaged. PMID:22654139

  3. Magnetic resonance and computed tomographic features of 4 cases of canine congenital thoracic vertebral anomalies


    Berlanda, Michele; Zotti, Alessandro; Brandazza, Giada; Poser, Helen; Calò, Pietro; Bernardini, Marco


    Magnetic resonance and computed tomography features of 4 cases of canine congenital vertebral anomalies (CVAs) are discussed. Two of the cases represent unusual presentations for such anomalies that commonly affect screw-tail or toy breeds. Moreover, the combination of CVAs and a congenital peritoneo-pericardial diaphragmatic hernia has never before been imaged.

  4. Identification of a new genotype of canine distemper virus circulating in America. (United States)

    Gámiz, César; Martella, Vito; Ulloa, Raúl; Fajardo, Raúl; Quijano-Hernandéz, Israel; Martínez, Simón


    Canine Distemper is a highly contagious viral systemic disease that affects a wide variety of terrestrial carnivores. Canine Distemper virus (CDV) appears genetically heterogeneous, markedly in the hemagglutinin protein (H), showing geographic patterns of diversification that are useful to monitor CDV molecular epidemiology. In Mexico the activity of canine distemper remains high in dogs, likely because vaccine prophylaxis coverage in canine population is under the levels required to control effectively the disease. By phylogenetic analysis based on the nucleoprotein (N) and on the H genes, Mexican CDV strains collected between 2007 and 2010 were distinguished into several genovariants, all which constituted a unique group, clearly distinct from field and vaccine strains circulating worldwide, but resembling a CDV strain, 19876, identified in Missouri, USA, 2004, that was genetically unrelated to other North-American CDV strains. Gathering information on the genetic heterogeneity of CDV on a global scale appears pivotal in order to investigate the origin and modalities of introduction of unusual/novel CDV strains, as well as to understand if vaccine breakthroughs or disease epidemics may be somewhat related to genetic/antigenic or biological differences between field and vaccine strains.


    Directory of Open Access Journals (Sweden)

    Mariana Rodrigues Faleiro


    Full Text Available Prostatic lesions such as prostatic intraepithelial neoplasia (PIN and proliferative inflammatory atrophy (PIA are studied in human and canine species due to their malignance potential. The plasminogen activator (PA system has been suggested to play a central role in cell adhesion, angiogenesis, inflammation, and tumor invasion. The urokinase-type plasminogen activator receptor (uPAR is a component of the PA, with a range of expression in tumor and stromal cells. In this study, uPAR expression in both canine normal prostates and with proliferative disorders (benign prostatic hyperplasia-BPH, proliferative inflammatory atrophy-PIA, prostatic intraepithelial neoplasia-PIN, and carcinoma-PC was evaluated by immunohistochemistry in a tissue microarray (TMA slide to establish the role of this enzyme in extracellular matrix (ECM remodeling and in the processes of tissue invasion. A total of 298 cores and 355 diagnoses were obtained, with 36 (10.1% normal prostates, 46 (13.0% with BPH, 128 (36.1% with PIA, 74 (20.8% with PIN and 71 (20.0% with PC. There is variation in the expression of uPAR in canine prostate according to the lesion, with lower expression in normal tissue and with BPH, and higher expression in tissue with PIA, PIN and PC. The high expression of uPAR in inflammatory and neoplastic microenvironment indicates increased proteolytic activity in canine prostates with PIA, PIN, and PC.

  6. Canine Polydactyl Mutations With Heterogeneous Origin in the Conserved Intronic Sequence of LMBR1 (United States)

    Park, Kiyun; Kang, Joohyun; Subedi, Krishna Pd.; Ha, Ji-Hong; Park, Chankyu


    Canine preaxial polydactyly (PPD) in the hind limb is a developmental trait that restores the first digit lost during canine evolution. Using a linkage analysis, we previously demonstrated that the affected gene in a Korean breed is located on canine chromosome 16. The candidate locus was further limited to a linkage disequilibrium (LD) block of <213 kb composing the single gene, LMBR1, by LD mapping with single nucleotide polymorphisms (SNPs) for affected individuals from both Korean and Western breeds. The ZPA regulatory sequence (ZRS) in intron 5 of LMBR1 was implicated in mammalian polydactyly. An analysis of the LD haplotypes around the ZRS for various dog breeds revealed that only a subset is assigned to Western breeds. Furthermore, two distinct affected haplotypes for Asian and Western breeds were found, each containing different single-base changes in the upstream sequence (pZRS) of the ZRS. Unlike the previously characterized cases of PPD identified in the mouse and human ZRS regions, the canine mutations in pZRS lacked the ectopic expression of sonic hedgehog in the anterior limb bud, distinguishing its role in limb development from that of the ZRS. PMID:18689889

  7. Dental and Maxillofacial Abnormalities in Children with Premature Loss of Primary Canines

    Directory of Open Access Journals (Sweden)

    Amarelys Morera Pérez


    Full Text Available Background: since primary canines are among the last teeth to be replaced by permanent ones, they are critical to maintain the space in the dental arch and proper occlusion. Their premature loss has a greater impact on the anterior region, but it can also affect the posterior region. Objective: to describe dental and maxillofacial abnormalities in children who prematurely lost the primary canines. Methods: a cross-sectional study was conducted in children aged 5 to 9 years attending the Guerrillero Heroico Elementary School located within the health area number 2 of Cienfuegos municipality, from November 2014 through April 2015. Variables analyzed were: age, sex, cause of tooth loss, dental and maxillofacial abnormalities (linguoversion of lower or upper incisors, mesial occlusion, crowding, hyperocclusion, and increased or decreased overjet. Results: the premature loss of primary canines was more frequently observed in children aged 5 and 6 years and in most cases, it resulted from indicated extractions (66.7%. Linguoversion of lower incisors and increased overjet were the most common abnormalities. Conclusion: all children showed dental and maxillofacial abnormalities related to the premature loss of primary canines. This demonstrates the importance of avoiding their early loss whenever possible, as it is a key factor for the development of malocclusion.

  8. International veterinary epilepsy task force consensus proposal : outcome of therapeutic interventions in canine and feline epilepsy

    NARCIS (Netherlands)

    Potschka, Heidrun; Fischer, Andrea; Löscher, Wolfgang; Patterson, Ned; Bhatti, Sofie; Berendt, Mette; De Risio, Luisa; Farquhar, Robyn; Long, Sam; Mandigers, Paul; Matiasek, Kaspar; Muñana, Karen; Pakozdy, Akos; Penderis, Jacques; Platt, Simon; Podell, Michael; Rusbridge, Clare; Stein, Veronika; Tipold, Andrea; Volk, Holger A


    Common criteria for the diagnosis of drug resistance and the assessment of outcome are needed urgently as a prerequisite for standardized evaluation and reporting of individual therapeutic responses in canine epilepsy. Thus, we provide a proposal for the definition of drug resistance and partial the

  9. Evaluation of an additive solution for preservation of canine red blood cells. (United States)

    Wardrop, K J; Owen, T J; Meyers, K M


    The effect of an additive preservative solution on canine red blood cell posttransfusion viability (PTV) and on selected canine red blood cell biochemical parameters was studied. One unit (450 mL) of blood was collected from 6 clinically normal dogs into the anticoagulant citrate phosphate dextrose, centrifuged, and the plasma removed. The red blood cells were then suspended in 100 mL of a saline, adenine, dextrose, and mannitol solution and stored at 4 degrees C. Aliquots were removed for study at 1, 10, 20, 30, 37, and 44 days. The 24-hour PTV of autologous red blood cells was determined using a sodium chromate (51Cr) label. Red blood cell concentrations of 2,3-diphosphoglycerate (2,3-DPG), adenosine-5'-triphosphate (ATP), and pH were also determined. Canine red blood cell PTV, pH, ATP, and 2,3-DPG concentrations decreased during storage (P Food and Drug Administration (FDA) minimum standard for human red blood cells, the PTV was substandard in 75% of the day 44 units. The FDA standard was exceeded in 83% of the day 37 units. It was concluded that 37-day-old canine red blood cells preserved with a saline, adenine, dextrose, and mannitol solution are of acceptable quality for transfusion.

  10. Identification of a new genotype of canine distemper virus circulating in America. (United States)

    Gámiz, César; Martella, Vito; Ulloa, Raúl; Fajardo, Raúl; Quijano-Hernandéz, Israel; Martínez, Simón


    Canine Distemper is a highly contagious viral systemic disease that affects a wide variety of terrestrial carnivores. Canine Distemper virus (CDV) appears genetically heterogeneous, markedly in the hemagglutinin protein (H), showing geographic patterns of diversification that are useful to monitor CDV molecular epidemiology. In Mexico the activity of canine distemper remains high in dogs, likely because vaccine prophylaxis coverage in canine population is under the levels required to control effectively the disease. By phylogenetic analysis based on the nucleoprotein (N) and on the H genes, Mexican CDV strains collected between 2007 and 2010 were distinguished into several genovariants, all which constituted a unique group, clearly distinct from field and vaccine strains circulating worldwide, but resembling a CDV strain, 19876, identified in Missouri, USA, 2004, that was genetically unrelated to other North-American CDV strains. Gathering information on the genetic heterogeneity of CDV on a global scale appears pivotal in order to investigate the origin and modalities of introduction of unusual/novel CDV strains, as well as to understand if vaccine breakthroughs or disease epidemics may be somewhat related to genetic/antigenic or biological differences between field and vaccine strains. PMID:21713437

  11. Enhanced stability of uncemented canine femoral components by bone ingrowth into the porous coatings. (United States)

    Jasty, M; Bragdon, C R; Zalenski, E; O'Connor, D; Page, A; Harris, W H


    The following questions were answered in this study: (1) What is the initial stability of proximally porous-coated canine femoral components? (2) Does bone ingrowth occur under these conditions? (3) Is the stability enhanced by tissue ingrowth in vivo? The stability of proximally porous-coated femoral components of canine total hip arthroplasties after 6 months to 2 years of in vivo service in dogs was measured in vitro using displacement transducers under loads simulating canine midstance. This was compared with the stability of identical components under the same loading conditions immediately after implantation in vitro in the contralateral femurs. The femurs were then sectioned and bone ingrowth into the porous coatings was quantified. The results showed that immediately after implantation the implants can move as much as 50 microns, but that the bone ingrowth into porous coatings of canine femoral components can occur even under such conditions. These data also suggested that the relative motion existing at the time of insertion can be reduced to very small amounts (< 10 microns) by bone ingrowth. PMID:9021510

  12. Lateral incisor agenesis, canine impaction and characteristics of supernumerary teeth in a South European male population

    NARCIS (Netherlands)

    Delli, Konstantina; Livas, Christos; Bornstein, Michael M


    OBJECTIVE: To assess the prevalence of lateral incisor agenesis impacted canines and supernumerary teeth in a young adult male population. MATERIALS AND METHODS: The panoramic radiographs of 1745 military students (mean age: 18.6 ± 0.52 years) who attended the Center of Aviation Medicine of the Arme

  13. Urine neutrophil gelatinase-associated lipocalin (NGAL as a biomarker for acute canine kidney injury

    Directory of Open Access Journals (Sweden)

    Lee Ya-Jane


    Full Text Available Abstract Background Biomarkers for the early prediction of canine acute kidney injury (AKI are clinically important. Recently, neutrophil gelatinase-associated lipocalin (NGAL was found to be a sensitive biomarker for the prediction of human AKI at a very early stage and the development of AKI after surgery. However, NGAL has not yet been studied with respect to dog kidney diseases. The application of NGAL canine AKI was investigated in this study. Results The canine NGAL gene was successfully cloned and expressed. Polyclonal antibodies against canine NGAL were generated and used to develop an ELISA for measuring NGAL protein in serum and urine samples that were collected from 39 dogs at different time points after surgery. AKI was defined by the standard method, namely a serum creatinine increase of greater than or equal to 26.5 μmol/L from baseline within 48 h. At 12 h after surgery, compared to the group without AKI (12 dogs, the NGAL level in the urine of seven dogs with AKI was significantly increased (median 178.4 pg/mL vs. 88.0 pg/mL, and this difference was sustained to 72 h. Conclusion As the increase in NGAL occurred much earlier than the increase in serum creatinine, urine NGAL seems to be able to serve as a sensitive and specific biomarker for the prediction of AKI in dogs.

  14. Canine human scent identifications with post-blast debris collected from improvised explosive devices. (United States)

    Curran, Allison M; Prada, Paola A; Furton, Kenneth G


    In this study it is demonstrated that human odor collected from items recovered at a post-blast scene can be evaluated using human scent specific canine teams to locate and identify individuals who have been in contact with the improvised explosive device (IED) components and/or the delivery vehicle. The purpose of the experiments presented here was to document human scent survivability in both peroxide-based explosions as well as simulated roadside IEDs utilizing double-blind field trials. Human odor was collected from post-blast device and vehicle components. Human scent specific canine teams were then deployed at the blast scene and in locations removed from the blast scene to validate that human odor remains in sufficient quantities for reliable canine detection and identification. Human scent specific canines have shown the ability to identify individuals who have been in contact with IEDs using post-blast debris with an average success from site response of 82.2% verifying that this technology has great potential in criminal, investigative, and military applications.

  15. Extensive expression of craniofacial related homeobox genes in canine mammary sarcomas

    NARCIS (Netherlands)

    Wensman, H.; Goransson, H.; Leuchowius, K.J.; Stromberg, S.; Ponten, F.; Isaksson, A.; Rutteman, G.R.; Heldin, N.; Pejler, G.; Hellmen, E.


    Extensive expression of craniofacial related homeobox genes in canine mammary sarcomas Journal Breast Cancer Research and Treatment Publisher Springer Netherlands ISSN 0167-6806 (Print) 1573-7217 (Online) Issue Volume 118, Number 2 / November, 2009 Category Preclinical Study DOI 10.1007/s10549-008-0

  16. Targeting VEGF in canine oxygen-induced retinopathy - a model for human retinopathy of prematurity

    Directory of Open Access Journals (Sweden)

    McLeod DS


    Full Text Available D Scott McLeod, Gerard A Lutty Department of Ophthalmology, Wilmer Ophthalmological Institute, Johns Hopkins Hospital, Baltimore, MD, USA Abstract: Development of the dog superficial retinal vasculature is similar to the mechanism of human retinal vasculature development; they both develop by vasculogenesis, differentiation, and assembly of vascular precursors called angioblasts. Canine oxygen-induced retinopathy (OIR was first developed by Arnall Patz in an effort to experimentally determine the effects of hyperoxia on the development of the retinal vasculature. The canine OIR model has many characteristics in common with human retinopathy of prematurity. Exposure of 1-day-old dogs to hyperoxia for 4 days causes a vaso-obliteration throughout the retina. Vasoproliferation, after the animals have returned to room air, is robust. The initial small preretinal neovascular formations anastomose to form large preretinal membranes that eventually cause tractional retinal folds. The end-stage pathology of the canine model is similar to stage IV human retinopathy of prematurity. Therefore, canine OIR is an excellent forum to evaluate the response to drugs targeting VEGF and its receptors. Evaluation of an antibody to VEGF-R2 and the VEGF-Trap demonstrated that doses should be titered down so that preretinal neovascularization is inhibited but retinal revascularization is able to proceed, vascularizing peripheral retina and preventing it from being a source of VEGF. Keywords: angioblasts, blood vessels, endothelial cells, oxygen, retinopathy, retina, vascular endothelial cell growth factor

  17. Unilateral canine crossbite correction in adults using the Invisalign method: a case report. (United States)

    Giancotti, Aldo; Mampieri, Gianluca


    The aim of this paper is to present and debate the treatment of a unilateral canine crossbite using clear aligners (Invisalign). The possibility of combining partial fixed appliances with removable elastics to optimize the final outcome is also described. The advantages of protected movement, due to the presence of the aligners, to jump the occlusion during crossbite correction is also highlighted.

  18. The feasibility of canine rabies elimination in Africa: dispelling doubts with data.

    Directory of Open Access Journals (Sweden)

    Tiziana Lembo

    Full Text Available BACKGROUND: Canine rabies causes many thousands of human deaths every year in Africa, and continues to increase throughout much of the continent. METHODOLOGY/PRINCIPAL FINDINGS: This paper identifies four common reasons given for the lack of effective canine rabies control in Africa: (a a low priority given for disease control as a result of lack of awareness of the rabies burden; (b epidemiological constraints such as uncertainties about the required levels of vaccination coverage and the possibility of sustained cycles of infection in wildlife; (c operational constraints including accessibility of dogs for vaccination and insufficient knowledge of dog population sizes for planning of vaccination campaigns; and (d limited resources for implementation of rabies surveillance and control. We address each of these issues in turn, presenting data from field studies and modelling approaches used in Tanzania, including burden of disease evaluations, detailed epidemiological studies, operational data from vaccination campaigns in different demographic and ecological settings, and economic analyses of the cost-effectiveness of dog vaccination for human rabies prevention. CONCLUSIONS/SIGNIFICANCE: We conclude that there are no insurmountable problems to canine rabies control in most of Africa; that elimination of canine rabies is epidemiologically and practically feasible through mass vaccination of domestic dogs; and that domestic dog vaccination provides a cost-effective approach to the prevention and elimination of human rabies deaths.

  19. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein.


    Rozenblatt, S; Eizenberg, O; Englund, G.; Bellini, W J


    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-...

  20. New agents for targeting of IL-13RA2 expressed in primary human and canine brain tumors.

    Directory of Open Access Journals (Sweden)

    Waldemar Debinski

    Full Text Available Interleukin 13 receptor alpha 2 (IL-13RA2 is over-expressed in a vast majority of human patients with high-grade astrocytomas like glioblastoma. Spontaneous astrocytomas in dogs resemble human disease and have been proposed as translational model system for investigation of novel therapeutic strategies for brain tumors. We have generated reagents for both detection and therapeutic targeting of IL-13RA2 in human and canine brain tumors. Peptides from three different regions of IL-13RA2 with 100% sequence identity between human and canine receptors were used as immunogens for generation of monoclonal antibodies. Recombinant canine mutant IL-13 (canIL-13.E13K and canIL-13.E13K based cytotoxin were also produced. The antibodies were examined for their immunoreactivities in western blots, immunohistochemistry, immunofluorescence and cell binding assays using human and canine tumor specimen sections, tissue lysates and established cell lines; the cytotoxin was tested for specific cell killing. Several isolated MAbs were immunoreactive to IL-13RA2 in western blots of cell and tissue lysates from glioblastomas from both human and canine patients. Human and canine astrocytomas and oligodendrogliomas were also positive for IL-13RA2 to various degrees. Interestingly, both human and canine meningiomas also exhibited strong reactivity. Normal human and canine brain samples were virtually negative for IL-13RA2 using the newly generated MAbs. MAb 1E10B9 uniquely worked on tissue specimens and western blots, bound live cells and was internalized in GBM cells over-expressing IL-13RA2. The canIL-13.E13K cytotoxin was very potent and specific in killing canine GBM cell lines. Thus, we have obtained several monoclonal antibodies against IL-13RA2 cross-reacting with human and canine receptors. In addition to GBM, other brain tumors, such as high grade oligodendrogliomas, meningiomas and canine choroid plexus papillomas, appear to express the receptor at high levels

  1. [Surgical-orthodontic correction of unerupted upper canine teeth and motivation for the procedure from the patient's viewpoint]. (United States)

    Razouk, G; Roykó, A; Dénes, J


    The surgical correction of the retention of upper canines is made easier by the direct bonding method, furthermore it increases the chances of successful treatment. At the same time at teen-age the treatment is usually missing, since the persistent milk-teeth in the place of impacted canines are ensuring the aesthetic effect. The late treatment is motivated by aesthetic aspects also by loosing the milk-canines. Thus the indication of the treatment is a cure only from the orthodontist's aspect, from the patient's view it's only the aesthetics.

  2. Relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction

    Directory of Open Access Journals (Sweden)

    Anísio Bueno de Carvalho


    Full Text Available OBJECTIVE: The purpose was to obtain information about the relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction. METHODS: Seventy-three patients with canine impaction and 73 control patients, without canine impaction, were evaluated. The mesiodistal distances of the maxillary lateral incisors adjacent to the impacted canines and the correspondent mandibular lateral incisors were measured. The adjacent lateral incisors were classified in: 1 - absent, 2 - small, 3 - peg-shaped, 4 - standard. RESULTS: The results showed that among the patients with impacted canines, there were 21 anomalous teeth (small and peg-shaped and among the control patients there were only three small and peg-shaped teeth, with a statistically significant difference (p = 0.001. No patients were found with impacted canines and absent lateral incisors. CONCLUSION: It was concluded that in patients with anomalous lateral incisors (small and peg-shaped there is a probability to present impacted canines and this must be considered.OBJETIVO: o objetivo foi obter informação sobre a relação existente entre a agenesia e/ou anomalia de forma de incisivos laterais superiores e impacção de caninos. MÉTODOS: foram avaliados 73 pacientes com impacção de caninos e 73 pacientes controle, sem impacção de caninos. Foram medidas as distâncias mesiodistais dos incisivos laterais superiores adjacentes aos caninos impactados e os incisivos laterais correspondentes inferiores. Os incisivos laterais adjacentes foram classificados em: 1 - ausentes; 2 - pequenos; 3 - conoides; 4 - normais. RESULTADOS: os resultados mostraram que no grupo de pacientes com caninos impactados foram encontrados 22 dentes anômalos (pequenos e conoides, e no grupo controle apenas três dentes pequenos e conoides, sendo uma diferença estatisticamente significativa (p=0,001. Não foram encontrados pacientes com canino impactado e incisivo lateral ausente. CONCLUS

  3. High-dose antibiotic therapy is superior to a 3-drug combination of prostanoids and lipid A derivative in protecting irradiated canines

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, K.S.; Srinivasan, V.; Toles, R.E.; Miner, V.L.; Jackson, W.E.; Seed, T.M. [Armed Forces Radiobiology Research Inst., Bethesda, MD (United States)


    There is an urgent need to develop non-toxic radioprotectors. We tested the efficacy of a 3-drug combination (3-DC) of iloprost, misoprostol, and 3D-MPL (3-deacylated monophosphoryl lipid A) and the effects of postirradiation clinical support with high doses of antibiotics and blood transfusion. Canines were given 3-DC or the vehicle and exposed to 3.4 Gy or 4.1 Gy of {sup 60}Co radiation. Canines irradiated at 4.1 Gy were also given clinical support, which consisted of blood transfusion and antibiotics (gentamicin, and cefoxitin or cephalexin). Peripheral blood cell profile and 60-day survival were used as indices of protection. At 3.4 Gy, 3-DC- or vehicle-treated canines without postirradiation clinical support survived only for 10 to 12 days. Fifty percent of the canines treated with 3-DC or vehicle and provided postirradiation clinical support survived 4.1-Gy irradiation. Survival of canines treated with vehicle before irradiation significantly correlated with postirradiation antibiotic treatments, but not with blood transfusion. The recovery profile of peripheral blood cells in 4.1 Gy-irradiated canines treated with vehicle and antibiotics was better than drug-treated canines. These results indicate that therapy with high doses of intramuscular aminoglycoside antibiotic (gentamicin) and an oral cephalosporin (cephalexin) enhanced survival of irradiated canines. Although blood transfusion correlated with survival of 3-DC treated canines, there were no additional survivors with 3-DC treated canines than the controls. (author)

  4. Expression of PD-L1 on canine tumor cells and enhancement of IFN-γ production from tumor-infiltrating cells by PD-L1 blockade.

    Directory of Open Access Journals (Sweden)

    Naoya Maekawa

    Full Text Available Programmed death 1 (PD-1, an immunoinhibitory receptor, and programmed death ligand 1 (PD-L1, its ligand, together induce the "exhausted" status in antigen-specific lymphocytes and are thus involved in the immune evasion of tumor cells. In this study, canine PD-1 and PD-L1 were molecularly characterized, and their potential as therapeutic targets for canine tumors was discussed. The canine PD-1 and PD-L1 genes were conserved among canine breeds. Based on the sequence information obtained, the recombinant canine PD-1 and PD-L1 proteins were constructed; they were confirmed to bind each other. Antibovine PD-L1 monoclonal antibody effectively blocked the binding of recombinant PD-1 with PD-L1-expressing cells in a dose-dependent manner. Canine melanoma, mastocytoma, renal cell carcinoma, and other types of tumors examined expressed PD-L1, whereas some did not. Interestingly, anti-PD-L1 antibody treatment enhanced IFN-γ production from tumor-infiltrating cells. These results showed that the canine PD-1/PD-L1 pathway is also associated with T-cell exhaustion in canine tumors and that its blockade with antibody could be a new therapeutic strategy for canine tumors. Further investigations are needed to confirm the ability of anti-PD-L1 antibody to reactivate canine antitumor immunity in vivo, and its therapeutic potential has to be further discussed.

  5. Patterns of Exposure of Iberian Wolves (Canis lupus) to Canine Viruses in Human-Dominated Landscapes. (United States)

    Millán, Javier; López-Bao, José Vicente; García, Emilio J; Oleaga, Álvaro; Llaneza, Luis; Palacios, Vicente; de la Torre, Ana; Rodríguez, Alejandro; Dubovi, Edward J; Esperón, Fernando


    Wildlife inhabiting human-dominated landscapes is at risk of pathogen spill-over from domestic species. With the aim of gaining knowledge in the dynamics of viral infections in Iberian wolves (Canis lupus) living in anthropized landscapes of northern Spain, we analysed between 2010 and 2013 the samples of 54 wolves by serology and polymerase chain reaction (PCR) for exposure to four pathogenic canine viruses: canine distemper virus (CDV), canine parvovirus-2 (CPV), canine adenovirus 1 and 2 (CAV-1 and CAV-2) and canine herpesvirus. Overall, 76% of the studied wolves presented evidence of exposure to CPV (96% by HI, 66% by PCR) and 75% to CAV (75% by virus neutralization (VN), 76% by PCR, of which 70% CAV-1 and 6% CAV-2). This represents the first detection of CAV-2 infection in a wild carnivore. CPV/CAV-1 co-infection occurred in 51% of the wolves. The probability of wolf exposure to CPV was positively and significantly correlated with farm density in a buffer zone around the place where the wolf was found, indicating that rural dogs might be the origin of CPV infecting wolves. CPV and CAV-1 appear to be enzootic in the Iberian wolf population, which is supported by the absence of seasonal and inter-annual variations in the proportion of positive samples detected. However, while CPV may depend on periodical introductions by dogs, CAV-1 may be maintained within the wolf population. All wolves were negative for exposure to CDV (by VN and PCR) and CHV (by PCR). The absence of acquired immunity against CDV in this population may predispose it to an elevated rate of mortality in the event of a distemper spill-over via dogs. PMID:26589403

  6. In Vitro Influence of Mycophenolic Acid on Selected Parameters of Stimulated Peripheral Canine Lymphocytes.

    Directory of Open Access Journals (Sweden)

    Maciej Guzera

    Full Text Available Mycophenolic acid (MPA is an active metabolite of mycophenolate mofetil, a new immunosuppressive drug effective in the treatment of canine autoimmune diseases. The impact of MPA on immunity is ambiguous and its influence on the canine immune system is unknown. The aim of the study was to determine markers of changes in stimulated peripheral canine lymphocytes after treatment with MPA in vitro. Twenty nine healthy dogs were studied. Phenotypic and functional analysis of lymphocytes was performed on peripheral blood mononuclear cells cultured with mitogens and different MPA concentrations- 1 μM (10-3 mol/m3, 10 μM or 100 μM. Apoptotic cells were detected by Annexin V and 7-aminoactinomycin D (7-AAD. The expression of antigens (CD3, CD4, CD8, CD21, CD25, forkhead box P3 [FoxP3] and proliferating cell nuclear antigen [PCNA] was assessed with monoclonal antibodies. The proliferation indices were analyzed in carboxyfluorescein diacetate succinimidyl ester (CFSE-labeled cells. All analyses were performed using flow cytometry. The influence of MPA on apoptosis was dependent on the mechanism of cell activation and MPA concentration. MPA caused a decrease in the expression of lymphocyte surface antigens, CD3, CD8 and CD25. Its impact on the expression of CD4 and CD21 was negligible. Its negative influence on the expression of FoxP3 was dependent on cell stimulation. MPA inhibited lymphocyte proliferation. In conclusion, MPA inhibited the activity of stimulated canine lymphocytes by blocking lymphocyte activation and proliferation. The influence of MPA on the development of immune tolerance-expansion of Treg cells and lymphocyte apoptosis-was ambiguous and was dependent on the mechanism of cellular activation. The concentration that MPA reaches in the blood may lead to inhibition of the functions of the canine immune system. The applied panel of markers can be used for evaluation of the effects of immunosuppressive compounds in the dog.

  7. Canine distemper virus detection by different methods of One-Step RT-qPCR

    Directory of Open Access Journals (Sweden)

    Claudia de Camargo Tozato


    Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

  8. Oddi sphincter function after canine auto-pancreas transplantation with bladder drainage

    Institute of Scientific and Technical Information of China (English)

    Gui-Chen Li; Chun-Hui Yuan; Ying Cheng; Yong-Feng Liu


    AIM: Several neural and hormonal factors are known to affect motility of sphincter of Oddi (SO). The major roles of SO are to regulate the flow of bile and pancreatic juice into the duodenum and to prevent the reflux of duodenal contents into the biliary and pancreatic duct. After pancreas transplantation, graft SO was denervated and graft pancreatitis might have relations to SO motility. The motilityof SO after canine pancreas transplantation with bladder drainage was investigated. METHODS: Normal canine SO manometry and pancreas graft SO manometry after pancreas transplantation with bladder drainage were performed in seven dogs respectively before and after cholecystokinin (CCK) administration. Data of SO basal pressure, contraction frequency, amplitude and motility index after transplantation and CCK administration were compared with that in controls and before CCK administration.RESULTS: SO showed regular contractions with a certain basal pressure in control dogs. After transplantation, the graft SO basal pressure and contraction frequency were higher than that in controls, but the amplitude decreased (P<0.01). There was no great difference in SO motility index.CCK administration could relax normal SO but stimulate graft SO after pancreas transplantation with bladder drainage.After CCK administration, SO basal pressure, frequency and motility index were increased significantly (P<0.05), in comparison with that before administration. The amplitude remained unchanged (P>0.05), in comparison with that before CCK administration.CONCLUSION: After auto-pancreas transplantation with bladder drainage, canine SO motility was inhibited. Basal pressure and frequency increased but amplitude decreased.CCK administration after transplantation had an inhibitory effect on canine SO instead of a relaxation effect observed in normal canine SO. This will increase the resistance of SO to the pancreatic juice flow and induce pancreatic juice stagnation and can not prevent

  9. Dimorphic Mandibular canines in gender determination in Moradabad population of western Uttar Pradesh

    Directory of Open Access Journals (Sweden)

    Gadiputi Sreedhar


    Full Text Available Background and Objectives: Among morphological characteristics that differentiate a male from a female, tooth size has also been evaluated in various populations for its applicability in anthropologic and forensic investigations to identify the gender from dental remains. The present study was undertaken to investigate the accuracy of mesio-distal width of the mandibular canines, inter-canine arch width, and Mandibular Canine Index (MCI with which gender can be differentiated in Moradabad population and to correlate the results with other available data. Materials and Methods: A cross-sectional study was conducted on the casts of 30 males and 30 females between the age group of 19-30 years. Results: The mean right and left canine dimension (RCW and LCW for females was between 6.28 mm and 6.54 mm while that of males was 7.06 mm and 7.45 mm. The mean inter-canine arch width (ICW in males was 27.64 mm, whereas in females was 23.42 mm. Area under curve (AUC of ICW, RCW, and LCW had 100%, 98%, and 99.7%. The predicted sensitivity and specificity observed of three criteria was 100% for ICW, 93.3% and 93.3% for RCW, and 96.7% and 100% for LCW, which were found to be highly statistically significant. The mean values of right and left CMI were significantly higher in females as compared to males (P < 0.001. Conclusion: The MCI parameter in the present study was a quick and reliable method for sexual identification and showed sexual dimorphism by both the RMCI and LMCI with greater significance in identifying females by using RMCI.

  10. Evaluation of an in-practice wet-chemistry analyzer using canine and feline serum samples. (United States)

    Irvine, Katherine L; Burt, Kay; Papasouliotis, Kostas


    A wet-chemistry biochemical analyzer was assessed for in-practice veterinary use. Its small size may mean a cost-effective method for low-throughput in-house biochemical analyses for first-opinion practice. The objectives of our study were to determine imprecision, total observed error, and acceptability of the analyzer for measurement of common canine and feline serum analytes, and to compare clinical sample results to those from a commercial reference analyzer. Imprecision was determined by within- and between-run repeatability for canine and feline pooled samples, and manufacturer-supplied quality control material (QCM). Total observed error (TEobs) was determined for pooled samples and QCM. Performance was assessed for canine and feline pooled samples by sigma metric determination. Agreement and errors between the in-practice and reference analyzers were determined for canine and feline clinical samples by Bland-Altman and Deming regression analyses. Within- and between-run precision was high for most analytes, and TEobs(%) was mostly lower than total allowable error. Performance based on sigma metrics was good (σ > 4) for many analytes and marginal (σ > 3) for most of the remainder. Correlation between the analyzers was very high for most canine analytes and high for most feline analytes. Between-analyzer bias was generally attributed to high constant error. The in-practice analyzer showed good overall performance, with only calcium and phosphate analyses identified as significantly problematic. Agreement for most analytes was insufficient for transposition of reference intervals, and we recommend that in-practice-specific reference intervals be established in the laboratory.

  11. Antimicrobial susceptibility of canine and human Staphylococcus aureus collected in Saskatoon, Canada. (United States)

    Rubin, J E; Chirino-Trejo, M


    Staphylococcus aureus is one of the most common causes of infection in people and is increasingly recognized in dogs. The increasing prevalence of methicillin resistant S. aureus (MRSA) is complicating the treatment of these infections. Panton Valentine leukocidin (PVL), a toxin involved in the pathogenesis of necrotic syndromes in people may be partially responsible for the rise of MRSA. Canine and human S. aureus from the same geographic area are genetically similar, indicating a common population and likely transmission. The implications of increasing antimicrobial resistance complicated by interspecies transmission, necessitates including both dogs and humans in S. aureus resistance surveillance studies. A collection of 126 S. aureus isolates from people (n = 99) and dogs (n = 27) were included, minimum inhibitor concentrations to a panel of 33 antimicrobials used in human and veterinary medicine were determined. No resistance to vancomycin, linezolid, daptomycin, quinupristin/dalfopristin or nitrofurantoin was found. A wide range of antibiograms were found; including resistance to 0-12 drugs (0-6 drug classes). Outstanding antibiograms included a canine MRSA resistant to rifampin and a human MRSA resistant to chloramphenicol. Inducible clindamycin resistance was found among 78% and 4% of canine and human MRSA and 17% and 25% of canine colonizing and human methicillin susceptible S. aureus (MSSA), respectively. Resistance to mupirocin was only found among human isolates including 20% of MRSA and 4% of MSSA. While no canine isolates were PVL positive, 39% of human MRSA and 2% of MSSA carried the gene. The bidirectional transmission of S. aureus between people and dogs necessitates the inclusion of isolates from both species in future studies. PMID:21824346

  12. Intrinsic Radiosensitivity and Cellular Characterization of 27 Canine Cancer Cell Lines. (United States)

    Maeda, Junko; Froning, Coral E; Brents, Colleen A; Rose, Barbara J; Thamm, Douglas H; Kato, Takamitsu A


    Canine cancer cell lines have progressively been developed, but are still underused resources for radiation biology research. Measurement of the cellular intrinsic radiosensitivity is important because understanding the difference may provide a framework for further elucidating profiles for prediction of radiation therapy response. Our studies have focused on characterizing diverse canine cancer cell lines in vitro and understanding parameters that might contribute to intrinsic radiosensitivity. First, intrinsic radiosensitivity of 27 canine cancer cell lines derived from ten tumor types was determined using a clonogenic assay. The 27 cell lines had varying radiosensitivities regardless tumor type (survival fraction at 2 Gy, SF2 = 0.19-0.93). In order to understand parameters that might contribute to intrinsic radiosensitivity, we evaluated the relationships of cellular radiosensitivity with basic cellular characteristics of the cell lines. There was no significant correlation of SF2 with S-phase fraction, doubling time, chromosome number, ploidy, or number of metacentric chromosomes, while there was a statistically significant correlation between SF2 and plating efficiency. Next, we selected the five most radiosensitive cell lines as the radiosensitive group and the five most radioresistant cell lines as the radioresistant group. Then, we evaluated known parameters for cell killing by ionizing radiation, including radiation-induced DNA double strand break (DSB) repair and apoptosis, in the radiosensitive group as compared to the radioresistant group. High levels of residual γ-H2AX foci at the sites of DSBs were present in the four out of the five radiosensitive canine cancer cell lines. Our studies suggested that substantial differences in intrinsic radiosensitivity exist in canine cancer cell lines, and radiation-induced DSB repair was related to radiosensitivity, which is consistent with previous human studies. These data may assist further investigations

  13. Development of an Arthroscopic Joint Capsule Injury Model in the Canine Shoulder.

    Directory of Open Access Journals (Sweden)

    David Kovacevic

    Full Text Available The natural history of rotator cuff tears can be unfavorable as patients develop fatty infiltration and muscle atrophy that is often associated with a loss of muscle strength and shoulder function. To facilitate study of possible biologic mechanisms involved in early degenerative changes to rotator cuff muscle and tendon tissues, the objective of this study was to develop a joint capsule injury model in the canine shoulder using arthroscopy.Arthroscopic surgical methods for performing a posterior joint capsulectomy in the canine shoulder were first defined in cadavers. Subsequently, one canine subject underwent bilateral shoulder joint capsulectomy using arthroscopy, arthroscopic surveillance at 2, 4 and 8 weeks, and gross and histologic examination of the joint at 10 weeks.The canine subject was weight-bearing within eight hours after index and follow-up surgeries and had no significant soft tissue swelling of the shoulder girdle or gross lameness. Chronic synovitis and macroscopic and microscopic evidence of pathologic changes to the rotator cuff bony insertions, tendons, myotendinous junctions and muscles were observed.This study demonstrates feasibility and proof-of-concept for a joint capsule injury model in the canine shoulder. Future work is needed to define the observed pathologic changes and their role in the progression of rotator cuff disease. Ultimately, better understanding of the biologic mechanisms of early progression of rotator cuff disease may lead to clinical interventions to halt or slow this process and avoid the more advanced and often irreversible conditions of large tendon tears with muscle fatty atrophy.

  14. Molecular cloning and characterization of three beta-defensins from canine testes. (United States)

    Sang, Yongming; Ortega, M Teresa; Blecha, Frank; Prakash, Om; Melgarejo, Tonatiuh


    Mammalian beta-defensins are small cationic peptides possessing broad antimicrobial and physiological activities. Because dogs are particularly resilient to sexually transmitted diseases, it has been proposed that their antimicrobial peptide repertoire might provide insight into novel antimicrobial therapeutics and treatment regimens. To investigate this proposal, we cloned the full-length cDNA of three canine beta-defensin isoforms (cBD-1, -2, and -3) from canine testicular tissues. Their predicted peptides share identical N-terminal 65-amino-acid residues, including the beta-defensin consensus six-cysteine motif. The two longer isoforms, cBD-2 and -3, possess 4 and 34 additional amino acids, respectively, at the C terminus. To evaluate the antimicrobial activity of cBD, a 34-amino-acid peptide derived from the shared mature peptide region was synthesized. Canine beta-defensin displayed broad antimicrobial activity against gram-positive bacteria (Listeria monocytogenes and Staphylococcus aureus; MICs of 6 and 100 mug/ml, respectively), gram-negative bacteria (Escherichia coli, Klebsiella pneumoniae, and Neisseria gonorrhoeae; MICs of 20 to 50, 20, and 50 mug/ml, respectively), and yeast (Candida albicans; MIC of 5 to 50 mug/ml) and lower activity against Ureaplasma urealyticum and U. canigenitalium (MIC of 200 mug/ml). Antimicrobial potency was significantly reduced at salt concentrations higher than 140 mM. All three canine beta-defensins were highly expressed in testis. In situ hybridization indicated that cBD-1 was expressed primarily in Sertoli cells within the seminiferous tubules. In contrast, cBD-2 was located primarily within Leydig cells. The longest isoform, cBD-3, was detected in Sertoli cells and to a lesser extent in the interstitium. The tissue-specific expression and broad antimicrobial activity suggest that canine beta-defensins play an important role in host defense and other physiological functions of the male reproductive system. PMID:15845463

  15. Different role of COX-2 and angiogenesis in canine inflammatory and non-inflammatory mammary cancer. (United States)

    Clemente, Mónica; Sánchez-Archidona, Ana Rodríguez; Sardón, David; Díez, Lucía; Martín-Ruiz, Asunción; Caceres, Sara; Sassi, Francesco; Dolores Pérez-Alenza, M; Illera, Juan C; Dunner, Susana; Peña, Laura


    Human inflammatory breast cancer (IBC) and canine inflammatory mammary cancer (IMC) are the most aggressive and fatal types of mammary cancer, and both have a very poor prognosis and low survival rate. Human IBC is characterised by exacerbated angiogenesis, lymphangiogenesis, and lymphangiotropism. Lymphangiotropism is also characteristic of IMC, but microvascular density (MVD) and lymphangiogenesis have not been previously studied in canine IMC. In this study immunohistochemical expression of several angiogenesis-related factors (cyclooxygenase [COX]-2, vascular endothelial growth factors A and D [VEGF-A, VEGF-D], and vascular endothelial growth factor receptor 3 [VEGFR-3]), MVD, lymphatic proliferation index (LPI), and Ki-67 tumour proliferation index (PI) were studied in 21 canine IMC samples, 20 canine high-grade malignant non-IMC mammary tumours (MMTs), and four normal mammary gland samples (NMGs). All mammary neoplasms were histologically categorised as grade III. COX-2 values were also analysed by RT-PCR in seven IMCs, six MMTs and four NMGs. The expressions of COX-2, VEGF-A, and VEGF-D were significantly higher in IMC, MVD and LPI tumours, but not PI. In MMTs, COX-2 immunoexpression was significantly associated with VEGF-A, while in IMCs COX-2 was associated with VEGF-D (lymphangiogenic factor), its receptor VEGFR-3, and LPI. These results suggested that lymphangiogenic pathway stimulation isa specific role of COX-2 in IMC angiogenesis, which justifies the use of COX-2-based targeted palliative therapies in dogs. The exacerbated angiogenesis and lymphangiogenesis and the increased expression of angiogenesis-related factors further support canine IMC as a natural model for the study of human IBC.

  16. Prevalence and seasonal variations of canine dirofilariosis in Portugal. (United States)

    Alho, Ana Margarida; Landum, Miguel; Ferreira, Cátia; Meireles, José; Gonçalves, Luzia; de Carvalho, Luís Madeira; Belo, Silvana


    Dirofilariosis is a severe vector-borne emergent disease that is spreading worldwide and becoming a serious threat to human and veterinary public health. Portugal, a Mediterranean country, has favorable climate conditions for mosquito development and survival. At present, accurate data on the prevalence and epidemiological pattern of dirofilariosis in Portugal is scarce and outdated. To study these trends, a project was developed to assess the current prevalence of Dirofilaria immitis infection in shelter dogs as well as the prevalence of Dirofilaria species present in three coastal regions in central Portugal: Coimbra, Santarém, and Setúbal. Blood samples were collected from 696 shelter dogs during three consecutive years: 2011, 2012, and 2013. A rapid immunomigration technique was performed to detect female D. immitis antigens. Concurrently, to detect and identify circulating microfilariae, a modified Knott's technique and acid phosphatase histochemical staining were also performed. Of the 696 dogs sampled, 105 were positive for D. immitis, with an overall prevalence of 15.1%. Forty of the 105 dogs were antigen negative but were positive for D. immitis microfilariae. Three animals were co-infected with D. immitis and Acanthocheilonema dracunculoides, and there was also one dog infected only with A. dracunculoides, all confirmed by polymerase chain reaction. The highest prevalence of canine heartworm during the 3-y period was in Setúbal (24.8%), followed by Coimbra (13.8%), and Santarém (13.2%), with significant inter-district differences. Our results demonstrate a higher prevalence of dirofilariosis compared with findings of previous studies and show an increasing rate of infection in the southern areas of Portugal attributed, at least in part, to bioclimatic and ecological factors. The present study updates the epidemiological situation and correlates the risk of dirofilariosis transmission within each region. These findings are highly relevant to both human

  17. Comparison of the physiological properties of human periodontal-masseteric reflex evoked by incisor and canine stimulation

    Directory of Open Access Journals (Sweden)

    Hiroko eOhmori


    Full Text Available Introduction: The present study was designed to clarify whether the bilateral cooperation in the human periodontal-masseteric reflex (PMR differs between central incisors and canines. Methods: Surface array electrodes were placed on the bilateral masseter muscles to simultaneously record the firing activities of single motor units from both sides in 7 healthy adults. During light clenching, mechanical stimulation was applied to the right maxillary central incisor and canine to evoke the PMR. Unitary activity was plotted with respect to the background activity and firing frequency. The slope of the regression line (sRL and the correlation coefficient (CC between the central incisor and canine and the lateral differences between these values were compared. Results: There were significant differences in the sRL and CC, as well as lateral differences, between the central incisor- and canine-driven PMR. Discussion: These results suggest that the PMR differs depending on both the tooth position and laterality.

  18. Canine Antibodies against Salivary Recombinant Proteins of Phlebotomus perniciosus: A Longitudinal Study in an Endemic Focus of Canine Leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Tatiana Kostalova

    Full Text Available Phlebotomine sand flies are vectors of Leishmania parasites. During blood feeding, sand flies deposit into the host skin immunogenic salivary proteins which elicit specific antibody responses. These anti-saliva antibodies enable an estimate of the host exposure to sand flies and, in leishmaniasis endemic areas, also the risk for Leishmania infections. However, the use of whole salivary gland homogenates as antigen has several limitations, and therefore, recombinant salivary proteins have been tested to replace them in antibody detection assays. In this study, we have used for the first time sand fly salivary recombinant proteins in a longitudinal field study on dogs.Sera from dogs naturally exposed to P. perniciosus bites over two consecutive transmission seasons in a site endemic for canine leishmaniasis (CanL were tested at different time points by ELISA for the antibodies recognizing whole saliva, single salivary 43 kDa yellow-related recombinant protein (rSP03B, and a combination of two salivary recombinant proteins, 43 kDa yellow-related protein and 35.5 kDa apyrase (rSP01. Dogs were also tested for Leishmania infantum positivity by serology, culture, and PCR and the infection status was evaluated prospectively. We found a significant association between active CanL infection and the amount of anti-P. perniciosus saliva antibodies. Importantly, we detected a high correlation between IgG antibodies recognizing rSP03B protein and the whole salivary antigen. The kinetics of antibody response showed for both a whole saliva and rSP03B a similar pattern that was clearly related to the seasonal abundance of P. perniciosus.These results suggest that P. perniciosus rSP03B protein is a valid alternative to whole saliva and could be used in large-scale serological studies. This novel method could be a practical and economically-sound tool to detect the host exposure to sand fly bites in CanL endemic areas.

  19. Global gene expression profiles of canine macrophages and canine mammary cancer cells grown as a co-culture in vitro

    Directory of Open Access Journals (Sweden)

    Król Magdalena


    Full Text Available Abstract Background Solid tumours comprise various cells, including cancer cells, resident stromal cells, migratory haemopoietic cells and other. These cells regulate tumour growth and metastasis. Macrophages constitute probably the most important element of all interactions within the tumour microenvironment. However, the molecular mechanism, that guides tumour environment, still remains unknown. Exploring the underlying molecular mechanisms that orchestrate these phenomena has been the aim of our study. A co-culture of canine mammary cancer cells and macrophages was established and maintained for 72 hrs. Having sorted the cells, gene expression in cancer cells and macrophages, using DNA microarrays, was examined. The results were confirmed using real-time qPCR and confocal microscopy. Moreover, their ability for migration and invasion has been assessed. Results Microarray analysis showed that the up-regulated genes in the cancer cell lines are involved in 15 highly over-manifested pathways. The pathways that drew our diligent attention included: the inflammation pathway mediated by chemokine and cytokine, the Toll receptor signalling pathway and the B cell activation. The up-regulated genes in the macrophages were involved in only 18 significantly over-manifested pathways: the angiogenesis, the p53 pathway feedback loops2 and the Wnt signalling pathway. The microarray analysis revealed that co-culturing of cancer cells with macrophages initiated the myeloid-specific antigen expression in cancer cells, as well as cytokine/chemokine genes expression. This finding was confirmed at mRNA and protein level. Moreover, we showed that macrophages increase cancer migration and invasion. Conclusions The presence of macrophages in the cancer environment induces acquisition of the macrophage phenotype (specific antigens and chemokines/cytokines expression in cancer cells. We presumed that cancer cells also acquire other myeloid features, such as

  20. Establishment of a High Canine Rabies Burden in Haiti through the Implementation of a Novel Surveillance Program [corrected].


    Wallace, Ryan M.; Hannah Reses; Richard Franka; Pierre Dilius; Natael Fenelon; Lillian Orciari; Melissa Etheart; Apollon Destine; Kelly Crowdis; Blanton, Jesse D; Calvin Francisco; Fleurinord Ludder; Victor Del Rio Vilas; Joseph Haim; Max Millien


    The Republic of Haiti is one of only several countries in the Western Hemisphere in which canine rabies is still endemic. Estimation methods have predicted that 130 human deaths occur per year, yet existing surveillance mechanisms have detected few of these rabies cases. Likewise, canine rabies surveillance capacity has had only limited capacity, detecting only two rabid dogs per year, on average. In 2013, Haiti initiated a community-based animal rabies surveillance program comprised of two c...

  1. Antimicrobial resistance trends among canine Escherichia coli isolates obtained from clinical samples in the northeastern USA, 2004–2011


    Cummings, Kevin J.; Aprea, Victor A.; Altier, Craig


    Our objectives were to describe the antimicrobial susceptibility of Escherichia coli isolates from dogs in the northeastern USA and to identify temporal trends in resistance to selected antimicrobial agents. Data were collected retrospectively for all canine E. coli isolates from clinical samples submitted to Cornell University’s Animal Health Diagnostic Center between January 1, 2004 and December 31, 2011. Antimicrobial susceptibility testing was performed on 3519 canine E. coli isolates; fr...

  2. Electropharmacological effects of berberine on canine cardiac Purkinje fibres and ventricular muscle and atrial muscle of the rabbit.


    Riccioppo Neto, F.


    1. Conventional microelectrode techniques were used for intracellular recordings of the transmembrane electrical potentials, the effects of berberine were studied on canine cardiac Purkinje and ventricular muscle fibres and on rabbit atrial fibres. 2. Berberine (3-30 microM) increased in a concentration-dependent manner, the action potential duration (APD) in canine Purkinje and ventricular muscle without affecting other parameters of the action potential. 3. The berberine-induced enlargement...

  3. Identification of new genovariants of canine distemper virus in dogs from the State of Mexico by analyzing the nucleocapsid gene


    CE Gámiz-Mejía; J Simón-Martínez; RC Fajardo-Muñoz


    Globally, Canine Distemper Disease is one of the most important viral diseases in dogs due to its high mortality and morbidity. It is caused by an RNA canine paramyxovirus with an elevated genetic diversity. We previously reported the presence of an apparently exclusive genovariant in the State of Mexico, but we do not have data on molecular epidemiology of this virus. In order to determine his genetic diversity in this State, samples collected from dogs showing clinical signs of ...

  4. Canine distemper infections, with special reference to South Africa, with a review of the literature : review article


    A.L. Leisewitz; Carter, A; M. Van Vuuren; van Blerk, L


    Canine distemper virus is a member of the genus Morbillivirus of the family Paramyxoviridaethat causes severe disease in dogs and a range of wild mammals. The clinical signs relate essentially to the respiratory, gastrointestinal and central nervous systems. In South Africa, infection with Ehrlichia canis and canine parvovirus may present similarly. Many dogs will initially present with a wide range of central nervous system signs without any history of systemic disease. A recent South Africa...

  5. Thai generic-brand dry canine foods: mutagenicity and the effects of feeding in vivo and in vitro


    Khuntamoon, Tanyalak; Thepouyporn, Apanchanid; Kaewprasert, Sarunya; Prangthip, Pattaneeya; Pooudoung, Somchai; Chaisri, Urai; Maneesai, Phudit; Kwanbunjan, Karunee


    Background The commercial pet-food industry and the market value of the pet industry have increased. Most owners are concerned about their pets’ health, and prefer commercial pet foods as their regular diet. This study thus aimed to determine whether a selection of local generic-brand dry canine foods had any potential to promote chronic disease. Methods Five local, generic-brand, dry canine foods were studied for potential mutagenicity; the effects of long-term consumption were also observed...

  6. A new system for assessment of growth using mandibular canine calcification stages and its correlation with modified MP3 stages

    Directory of Open Access Journals (Sweden)

    Gautham Hegde


    Full Text Available Objective: Orthodontic diagnosis and treatment planning for growing children must involve growth prediction, especially in the treatment of skeletal problems. Studies have shown that a strong association exists between skeletal maturity and dental calcification stages. The present study was therefore taken up to provide a simple and practical method for assessing skeletal maturity using a dental periapical film and standard dental X-ray machine, to compare the developmental stages of the mandibular canine with that of developmental stages of modified MP3 and to find out if any correlation exists, to determine if the developmental stages of the mandibular canine alone can be used as a reliable indicator for assessment of skeletal maturity. Materials and Methods: A total of 160 periapical radiographs, of the mandibular right canine and the MP3 region was taken and assessed according to the Dermirjian′s stages of dental calcification and the modified MP3 stages. Results and Discussion: The correlation coefficient between MP3 stages and developmental stages of mandibular canine was found to be significant in both male and female groups. When the canine calcification stages were compared with the MP3 stages it was found that with the exception of the D stage of canine calcification the remaining stages showed a very high correlation with the modified MP3 stages. Conclusion: The correlation between the mandibular canine calcification stages, and the MP3 stages was found to be significant. The canine calcification could be used as a sole indicator for assessment of skeletal maturity.

  7. Presentation of Neurolytic Effect of 10% Lidocaine after Perineural Ultrasound Guided Injection of a Canine Sciatic Nerve: A Pilot Study


    KIM, DAVID D.; Asif, Asma; Kataria, Sandeep


    Background Phenol and alcohol have been used to ablate nerves to treat pain but are not specific for nerves and can damage surrounding soft tissue. Lidocaine at concentrations > 8% injected intrathecal in the animal model has been shown to be neurotoxic. Tests the hypothesis that 10% lidocaine is neurolytic after a peri-neural blockade in an ex vivo experiment on the canine sciatic nerve. Methods Under ultrasound, one canine sciatic nerve was injected peri-neurally with 10 cc saline and anoth...

  8. Serologic survey for antibodies to parvovirus in canines and felines%犬科、猫科动物细小病毒血清抗体调查

    Institute of Scientific and Technical Information of China (English)

    靳小霞; 王化磊; 王珊; 梁萌; 周明; 王玮; 刘丹; 杨松涛; 夏咸柱


    An survey of antibodies to parvovirus was carried out in canines and felines. Three hundred and ninety six serum samples were collected from several domestic or wild canines and felines in different regions of China during 2009 to 2011. Sera from 203 canines samples and from 193 feline samples were tested for antibodies to canine parvovirus virus ( CPV) and feline parvovirus virus ( FPV) respectively using micro-hemagglutination inhibition ( HI) and micro-serum neutralization assays ( SN). The results of the two methods are highly parallel and consistent. The antibody positive rate to CPV is 28. 6% in canines and 42. 5% to FPV in felines. We propose that the canines and felines had been infected by parvovirus in different regions of China.

  9. Compound odontoma associated with impacted maxillary central incisor dictates a need to be vigilant to canine eruption pattern: A 2-year follow-up. (United States)

    Singla, Shilpy; Gupta, Sachin


    Canine deviation from its path of eruption is usually followed by either delayed or impaction of canine. One of the important and not so noticed reasons for canine displacement is formerly impacted central incisor. The difference in age of eruption of these two teeth is 4 years; however, the absence of maxillary incisor should be perceived with utmost conviction about impending canine displacement leading to its impaction as well. This case presents similar picture where composite, compound odontoma with respect to maxillary central incisor led to its impaction resulted in deviated path of eruption for erupting canine. This canine displacement to worsen prognosis ended up getting impacted if not dealt with cautiously in the later stages of occlusal development.

  10. Extraction of primary canine tooth buds: prevalence and associated dental abnormalities in a group of Ethiopian Jewish children. (United States)

    Holan, G; Mamber, E


    Recent publications have described a common belief, held in rural areas in Africa, that unerupted primary canines cause diarrhoea, vomiting and fever in infants. To relieve these symptoms a traditional native healer extracts these tooth buds. The emigration of Ethiopian Jews to Israel in 1991 allowed an investigation of this practice among this community. A group of 59 children (27 boys and 32 girls) aged 3-12 years were examined clinically and radiographically. Evidence was found of extraction of 63 primary canine buds in 35 (59%) of the children. Extraction of one canine was found in 16 children, two in 13 children and three in three children, and three children had all four canines extracted. Forty-six (74%) mandibular compared to only 16 (26%) maxillary canines had been extracted; the extractions were equally divided between both sides of the jaws. Another 19 primary canines had hypoplastic defects, probably the result of unsuccessful extractions. Associated dental abnormalities included hypoplasia of the permanent successors and adjacent primary and permanent teeth, displacement of permanent teeth, midline shift to the extraction side, missing primary lateral incisors (probably accidentally extracted) and distal eruption of permanent lateral incisors, leaving their primary predecessors retained. Parental enquiry revealed that the practice is more common in rural rather than urban areas and still exists in the Ethiopian community in Israel. The findings of this survey should urge the authorities to take steps to stop this practice.

  11. TaqMan probe real-time polymerase chain reaction assay for the quantification of canine DNA in chicken nugget. (United States)

    Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub


    This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated. PMID:26458055

  12. Isolation, genetic manipulation, and transplantation of canine spermatogonial stem cells: progress toward transgenesis through the male germ-line. (United States)

    Harkey, Michael A; Asano, Atsushi; Zoulas, Mary Ellen; Torok-Storb, Beverly; Nagashima, Jennifer; Travis, Alexander


    The dog is recognized as a highly predictive model for preclinical research. Its size, life span, physiology, and genetics more closely match human parameters than do those of the mouse model. Investigations of the genetic basis of disease and of new regenerative treatments have frequently taken advantage of canine models. However, full utility of this model has not been realized because of the lack of easy transgenesis. Blastocyst-mediated transgenic technology developed in mice has been very slow to translate to larger animals, and somatic cell nuclear transfer remains technically challenging, expensive, and low yield. Spermatogonial stem cell (SSC) transplantation, which does not involve manipulation of ova or blastocysts, has proven to be an effective alternative approach for generating transgenic offspring in rodents and in some large animals. Our recent demonstration that canine testis cells can engraft in a host testis, and generate donor-derived sperm, suggests that SSC transplantation may offer a similar avenue to transgenesis in the canine model. Here, we explore the potential of SSC transplantation in dogs as a means of generating canine transgenic models for preclinical models of genetic diseases. Specifically, we i) established markers for identification and tracking canine spermatogonial cells; ii) established methods for enrichment and genetic manipulation of these cells; iii) described their behavior in culture; and iv) demonstrated engraftment of genetically manipulated SSC and production of transgenic sperm. These findings help to set the stage for generation of transgenic canine models via SSC transplantation.

  13. Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jong-Hyuk, E-mail: [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Robinson, Sally [Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Sharkey, Leslie C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); O' Brien, Timothy D. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Dickerson, Erin B. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Modiano, Jaime F., E-mail: [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States)


    Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

  14. Mesenchymal stem cells with rhBMP-2 inhibits the growth of canine osteosarcoma cells

    Directory of Open Access Journals (Sweden)

    Grassi Rici Rose


    Full Text Available Abstract Background The bone morphogenetic proteins (BMPs belong to a unique group of proteins that includes the growth factor TGF-β. BMPs play important roles in cell differentiation, cell proliferation, and inhibition of cell growth. They also participate in the maturation of several cell types, depending on the microenvironment and interactions with other regulatory factors. Depending on their concentration gradient, the BMPs can attract various types of cells and act as chemotactic, mitogenic, or differentiation agents. BMPs can interfere with cell proliferation and the formation of cartilage and bone. In addition, BMPs can induce the differentiation of mesenchymal progenitor cells into various cell types, including chondroblasts and osteoblasts. The aim of this study was to analyze the effects of treatment with rhBMP-2 on the proliferation of canine mesenchymal stem cells (cMSCs and the tumor suppression properties of rhBMP-2 in canine osteocarcoma (OST cells. Osteosarcoma cell lines were isolated from biopsies and excisions of animals with osteosarcoma and were characterized by the Laboratory of Biochemistry and Biophysics, Butantan Institute. The mesenchymal stem cells were derived from the bone marrow of canine fetuses (cMSCs and belong to the University of São Paulo, College of Veterinary Medicine (FMVZ-USP stem cell bank. After expansion, the cells were cultured in a 12-well Transwell system; cells were treated with bone marrow mesenchymal stem cells associated with rhBMP2. Expression of the intracytoplasmic and nuclear markers such as Caspase-3, Bax, Bad, Bcl-2, Ki-67, p53, Oct3/4, Nanog, Stro-1 were performed by flow citometry. Results We evaluated the regenerative potential of in vitro treatment with rhBMP-2 and found that both osteogenic induction and tumor regression occur in stem cells from canine bone marrow. rhBMP-2 inhibits the proliferation capacity of OST cells by mechanisms of apoptosis and tumor suppression mediated by p

  15. Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

    International Nuclear Information System (INIS)

    Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

  16. Canine and human gastrointestinal stromal tumors display similar mutations in c-KIT exon 11

    International Nuclear Information System (INIS)

    Gastrointestinal stromal tumors (GISTs) are common mesenchymal neoplasms in the gastrointestinal tract of humans and dogs. Little is known about the pathogenesis of these tumors. This study evaluated the role of c-KIT in canine GISTs; specifically, we investigated activating mutations in exons 8, 9, 11, 13, and 17 of c-KIT and exons 12, 14, and 18 of platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), all of which have been implicated in human GISTs. Seventeen canine GISTs all confirmed to be positive for KIT immunostaining were studied. Exons 8, 9, 11, 13 and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA, were amplified from DNA isolated from formalin-fixed paraffin-embedded samples. Of these seventeen cases, six amplicons of exon 11 of c-KIT showed aberrant bands on gel electrophoresis. Sequencing of these amplicons revealed heterozygous in-frame deletions in six cases. The mutations include two different but overlapping six base pair deletions. Exons 8, 9, 13, and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA had no abnormalities detected by electrophoresis and sequencing did not reveal any mutations, other than synonymous single nucleotide polymorphisms (SNPs) found in exon 11 of c-KIT and exons 12 and 14 of PDGFRA. The deletion mutations detected in canine GISTs are similar to those previously found in the juxtamembrane domain of c-KIT in canine cutaneous mast cell tumors in our laboratory as well as to those reported in human GISTs. Interestingly, none of the other c-KIT or PDGFRA exons showed any abnormalities in our cases. This finding underlines the critical importance of c-KIT in the pathophysiology of canine GISTs. The expression of KIT and the identification of these activating mutations in c-KIT implicate KIT in the pathogenesis of these tumors. Our results indicate that mutations in c-KIT may be of prognostic significance and that targeting KIT may be a rational approach to treatment of these malignant tumors. This study further

  17. Canine pleural mesothelioma as an indicator of environmental exposure to asbestos; Il mesotelioma pleurico del cane come indicatore di esposizione ambientale ad amianto

    Energy Technology Data Exchange (ETDEWEB)

    De Nardo, P. [Istituto Superiore di Sanita`, Rome (Italy). Lab. di Medicina Veterinaria


    Canine pleural mesothelioma represents a `sentinel health event` because of the role of asbestos exposure in its etiology and pathogenesis. The observation of such event may thus trigger prevention-oriented remedial actions. This is especially due to the relatively short induction-latency time of canine mesothelioma, i.e. eight-nine years, versus the corresponding induction-latency time in humans (on average about thirty years). The observation of cases of canine mesothelioma may concur to the detection of previously unrecognized hazardous exposures to asbestos. On this ground, the epidemiologic surveillance of canine mesothelioma in Italy is suggested.

  18. The role of the canine spleen in cardiovascular homeostasis during halothane anesthesia. (United States)

    Merin, R G; Hoffman, W L; Kraus, A L


    Barbiturate anesthesia is known to increase canine splenic sequestration of red blood cells. In our laboratory, high halothane concentrations have produced a decreased arterial hematocrit in the dog. In order to assess the role of the spleen in this phenomenon, central hematocrit, plasma volume, and ventricular hemodynamics were studied at low and high halothane concentrations before and after splenectomy in the same group of dogs. Although the hematocrit difference was less after splenectomy, it was not abolished. In addition, there was more cardiovascular depression by equivalent or lower halothane doses after splenectomy. It appears that the dog has other areas of red cell sequestration than the spleen accounting for the persistently lower hematocrit with high halothane concentrations after splenectomy. The modifying effect of the canine spleen on the circulatory depression produced by halothane should be taken into account when the drug is used in the dog. PMID:923020

  19. Force of infection and evolution of lesions of canine tegumentary leishmaniasis in Northwestern Argentina

    Directory of Open Access Journals (Sweden)

    Jorge Diego Marco


    Full Text Available A clinical-serological follow-up was carried out in a canine population in endemic foci of Leishmania braziliensis spread in northwestern Argentina. Each dog was studied in at least two visits, 309±15 days (X±SE apart. Some initially healthy dogs (n=52 developed seroconversion or lesions. The clinical evolution of the disease in dogs resembles in many aspects the human disease. Similarities include the long duration of most ulcers with occasional healing or appearance of new ones and the late appearance of erosive snout lesions in some animals. Yearly incidence rates of 22.7% for seroconversion and of 13.5% for disease were calculated as indicators of the force of infection by this parasite upon the canine population.

  20. Disease Modeling and Gene Therapy of Copper Storage Disease in Canine Hepatic Organoids (United States)

    Nantasanti, Sathidpak; Spee, Bart; Kruitwagen, Hedwig S.; Chen, Chen; Geijsen, Niels; Oosterhoff, Loes A.; van Wolferen, Monique E.; Pelaez, Nicolas; Fieten, Hille; Wubbolts, Richard W.; Grinwis, Guy C.; Chan, Jefferson; Huch, Meritxell; Vries, Robert R.G.; Clevers, Hans; de Bruin, Alain; Rothuizen, Jan; Penning, Louis C.; Schotanus, Baukje A.


    Summary The recent development of 3D-liver stem cell cultures (hepatic organoids) opens up new avenues for gene and/or stem cell therapy to treat liver disease. To test safety and efficacy, a relevant large animal model is essential but not yet established. Because of its shared pathologies and disease pathways, the dog is considered the best model for human liver disease. Here we report the establishment of a long-term canine hepatic organoid culture allowing undifferentiated expansion of progenitor cells that can be differentiated toward functional hepatocytes. We show that cultures can be initiated from fresh and frozen liver tissues using Tru-Cut or fine-needle biopsies. The use of Wnt agonists proved important for canine organoid proliferation and inhibition of differentiation. Finally, we demonstrate that successful gene supplementation in hepatic organoids of COMMD1-deficient dogs restores function and can be an effective means to cure copper storage disease. PMID:26455412