WorldWideScience

Sample records for canine vector-borne diseases

  1. Canine vector-borne diseases in Brazil

    Directory of Open Access Journals (Sweden)

    Dantas-Torres Filipe

    2008-08-01

    Full Text Available Abstract Canine vector-borne diseases (CVBDs are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi, bacteria (e.g., Anaplasma platys and Ehrlichia canis, and helminths (e.g., Dirofilaria immitis and Dipylidium caninum that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance of CVBDs in Brazil and discusses research gaps to be addressed in future studies.

  2. Vector-borne diseases.

    Science.gov (United States)

    Gubler, D J

    2009-08-01

    Vector-borne diseases have been the scourge of man and animals since the beginning of time. Historically, these are the diseases that caused the great plagues such as the 'Black Death' in Europe in the 14th Century and the epidemics of yellow fever that plagued the development of the New World. Others, such as Nagana, contributed to the lack of development in Africa for many years. At the turn of the 20th Century, vector-borne diseases were among the most serious public and animal health problems in the world. For the most part, these diseases were controlled by the middle of the 20th Century through the application of knowledge about their natural history along with the judicious use of DDT (dichlorodiphenyltrichloroethane) and other residual insecticides to interrupt the transmission cycle between arthropod and vertebrate host. However, this success initiated a period of complacency in the 1960s and 1970s, which resulted in the redirection of resources away from prevention and control of vector-borne diseases. The 1970s was also a time in which there were major changes to public health policy. Global trends, combined with changes in animal husbandry, urbanisation, modern transportation and globalisation, have resulted in a global re-emergence of epidemic vector-borne diseases affecting both humans and animals over the past 30 years. PMID:20128467

  3. Molecular survey of canine vector-borne diseases in stray dogs in Thailand.

    Science.gov (United States)

    Liu, Mingming; Ruttayaporn, Ngasaman; Saechan, Vannarat; Jirapattharasate, Charoonluk; Vudriko, Patrick; Moumouni, Paul Franck Adjou; Cao, Shinuo; Inpankaew, Tawin; Ybañez, Adrian P; Suzuki, Hiroshi; Xuan, Xuenan

    2016-08-01

    Despite the large population of stray dogs in Thailand, there is limited information on the prevalence of canine vector-borne diseases (CVBDs). In this study, a molecular survey was conducted to determine the prevalence of Babesia spp., Ehrlichia canis, Hepatozoon spp., Anaplasma platys and Mycoplasma spp. in dogs in Thailand. Of the 181 dog blood samples tested by PCR, 78/181 (43.1%) were found to be infected with one or more pathogens. The overall prevalence rates of Mycoplasma spp., Hepatozoon spp., Babesia spp., A. platys and E. canis infections were 19.9%, 18.8%, 9.4%, 4.4% and 3.9%, respectively. To the authors' knowledge, this is the first report of Mycoplasma infection in Thailand in dogs. The current findings are important for future surveillance of CVBDs and designing appropriate approaches for diagnosis and control for the diseases in Thailand. PMID:27143604

  4. Canine vector-borne diseases in India: a review of the literature and identification of existing knowledge gaps

    Directory of Open Access Journals (Sweden)

    Coleman Glen T

    2010-04-01

    Full Text Available Abstract Despite the combination of favourable climate for parasites and vectors, and large populations of stray dogs, information concerning the epidemiology, diagnosis and management of canine vector-borne diseases in India is limited. However, with the country's expanding economy and adaptation to western culture, higher expectations and demands are being placed on veterinary surgeons for improved knowledge of diseases and control. This review aims to provide an overview of the current state of knowledge of these diseases in India and identify existing knowledge gaps in the literature which need to be addressed. The available literature on this subject, although limited, suggests that a number of canine vector-borne diseases such as filariasis, babesiosis and ehrlichiosis are endemic throughout India, as diagnosed mostly by morphological methods. Detailed investigations of the epidemiology and zoonotic potential of these pathogens has been neglected. Further study is essential to develop a better understanding of the diversity of canine vector-borne diseases in India, and their significance for veterinary and public health.

  5. [Conflicts and vector-borne diseases

    DEFF Research Database (Denmark)

    Bygbjerg, Ib Christian

    2010-01-01

    Based on literature and personal experiences, vector-borne diseases and conflicts are reviewed. Simple rapid diagnostic tests for three important parasitoses are available. Resort is often made to case definitions and to presumptive treatment. Resistance is an emerging problem. Vaccines are still...... not available for most diseases. Promising preventive methods, including long-lasting impregnated bed-nets and tents, are available. War has been an impetus for disclosing life-cycles of vector-borne diseases and for control methods; peace, reconciliation and poverty reduction are required to achieve...

  6. Emerging vector borne diseases – incidence through vectors

    Directory of Open Access Journals (Sweden)

    Sara eSavic

    2014-12-01

    Full Text Available Vector borne diseases use to be a major public health concern only in tropical and subtropical areas, but today they are an emerging threat for the continental and developed countries also. Nowdays, in intercontinetal countries, there is a struggle with emerging diseases which have found their way to appear through vectors. Vector borne zoonotic diseases occur when vectors, animal hosts, climate conditions, pathogens and susceptible human population exist at the same time, at the same place. Global climate change is predicted to lead to an increase in vector borne infectious diseases and disease outbreaks. It could affect the range and popultion of pathogens, host and vectors, transmission season, etc. Reliable surveilance for diseases that are most likely to emerge is required. Canine vector borne diseases represent a complex group of diseases including anaplasmosis, babesiosis, bartonellosis, borreliosis, dirofilariosis, erlichiosis, leishmaniosis. Some of these diseases cause serious clinical symptoms in dogs and some of them have a zoonotic potential with an effect to public health. It is expected from veterinarians in coordination with medical doctors to play a fudamental role at primeraly prevention and then treatment of vector borne diseases in dogs. The One Health concept has to be integrated into the struggle against emerging diseases.During a four year period, from 2009-2013, a total number of 551 dog samples were analysed for vector borne diseases (borreliosis, babesiosis, erlichiosis, anaplasmosis, dirofilariosis and leishmaniasis in routine laboratory work. The analysis were done by serological tests – ELISA for borreliosis, dirofilariosis and leishmaniasis, modified Knott test for dirofilariosis and blood smear for babesiosis, erlichiosis and anaplasmosis. This number of samples represented 75% of total number of samples that were sent for analysis for different diseases in dogs. Annually, on avarege more then half of the samples

  7. Comparison of selected canine vector-borne diseases between urban animal shelter and rural hunting dogs in Korea

    Directory of Open Access Journals (Sweden)

    Ahn KyuSung

    2010-04-01

    Full Text Available Abstract A serological survey for Dirofilaria immitis, Anaplasma phagocytophilum, Ehrlichia canis, and Borrelia burgdorferi infections in rural hunting and urban shelter dogs mainly from southwestern regions of the Republic of Korea (South Korea was conducted. From a total of 229 wild boar or pheasant hunting dogs, the number of serologically positive dogs for any of the four pathogens was 93 (40.6%. The highest prevalence observed was D. immitis (22.3%, followed by A. phagocytophilum (18.8%, E. canis (6.1% and the lowest prevalence was B. burgdorferi (2.2%. In contrast, stray dogs found within the city limits of Gwangju showed seropositivity only to D. immitis (14.6%, and none of the 692 dogs responded positive for A. phagocytophilum, E. canis or B. burgdorferi antibodies. This study indicates that the risk of exposure to vector-borne diseases in rural hunting dogs can be quite high in Korea, while the urban environment may not be suitable for tick infestation on dogs, as evidenced by the low infection status of tick-borne pathogens in stray dogs.

  8. [Climate- and vector-borne diseases

    DEFF Research Database (Denmark)

    Bygbjerg, I.C.; Schioler, K.L.; Konradsen, F.

    2009-01-01

    The predicted changes in climate have raised concerns that vector-borne diseases may emerge or expand in tempered regions. Malaria, leishmaniasis and tick-borne illnesses are discussed in terms of climate change and their endemic potential, especially in Denmark. While climate may play an important...

  9. Vector-borne disease surveillance in puerto rico: pathogen prevalence rates in canines ? Implications for public health and the u.s. Military ? Applying the one health concept.

    Science.gov (United States)

    McCown, Michael E; Opel, Taylor; Grzeszak, Benjamin

    2013-01-01

    Vector-borne diseases (VBDs) make up a large number of emerging infectious and zoonotic diseases. Vectors such as ticks, fleas, and mosquitoes parasitize dogs, thus making canine populations adequate reservoirs for infectious disease and zoonoses. The U.S. military deploys its personnel and Military Working Dogs (MWDs) throughout the world with possible risk of exposure to VBDs. Canine VBDs continue to have veterinary and public health significance for the host nations as well as for deployed U.S. personnel and MWDs. Thus, ongoing and consistent disease surveillance is an essential component to preserve health. The purpose of this study was to survey dogs from multiple cities and varying regions throughout Puerto Rico to determine the prevalence of ehrlichiosis (Ehrlichia canis), anaplasmosis (Anaplasma phagocytophilum), Lyme disease (Borrelia burgdorferi), and heartworm disease (Dirofilaria immitis) from May to July 2012. Canine blood samples (1?3 ml) from the cities of San Juan (n = 629), Guaynabo (n = 50), Ponce (n = 20) and Vieques Island (n = 53) were obtained and tested on-site using an IDEXX SNAP? 4Dx? (enzyme-linked immunosorbent assay) test kit. Prevalence for single or multiple disease status was calculated for each site. The overall period prevalence of VBD in Puerto Rico in the shelter population was 57.7% (71/123). In Guaynabo, the VBD prevalence was 30% (15/50); 2 (13%) of these positive dogs had VBD co-infection. In the coastal port city of Ponce, it was 60% (12/20); 6 (50%) dogs were infected by two or more VBDs. On Vieques Island, it was 83% (44/53); 27 (61%) dogs were coinfected. Conversely, samples collected at the Fort Buchanan Veterinary Clinic in the capitol city of San Juan resulted in a VBD prevalence of 8.9% (56/629). Lyme disease was not detected in any sample. This study showed the presence of D. immitis, E. canis, and A. phagocytophilum in all four sites of Puerto Rico, emphasizing the value of surveillance for VBDs to determine disease

  10. Risk based surveillance for vector borne diseases

    DEFF Research Database (Denmark)

    Bødker, Rene

    and new exotic diseases like Usutu and West Nile Virus may lead to outbreaks in the region. In the worst case the combined effect of climate change and globalization may potentially lead to European outbreaks of important zoonotic mosquito borne infections like Rift Valley Fever in cattle and Japanese...... Encephalitis in swine. Being able to model the impact of climate and environmental change on the transmission intensity of vector borne diseases is potentially a powerful tool to both monitor and prevent outbreaks in a cost effective way. The recent unexpected outbreaks of bluetongue and Schmallenberg virus...... is the direct result of climate change. The potential for virus transmission by biting midges was here modeled monthly for the Baltic See Region and the rest of Europe. The results showed that Baltic See Region has a lower transmission potential than most other areas in Europe. And the model identified...

  11. Paratransgenic Control of Vector Borne Diseases

    Directory of Open Access Journals (Sweden)

    Ivy Hurwitz, Annabeth Fieck, Amber Read, Heidi Hillesland, Nichole Klein, Angray Kang, Ravi Durvasula

    2011-01-01

    Full Text Available Conventional methodologies to control vector borne diseases with chemical pesticides are often associated with environmental toxicity, adverse effects on human health and the emergence of insect resistance. In the paratransgenic strategy, symbiotic or commensal microbes of host insects are transformed to express gene products that interfere with pathogen transmission. These genetically altered microbes are re-introduced back to the insect where expression of the engineered molecules decreases the host's ability to transmit the pathogen. We have successfully utilized this strategy to reduce carriage rates of Trypanosoma cruzi, the causative agent of Chagas disease, in the triatomine bug, Rhodnius prolixus, and are currently developing this methodology to control the transmission of Leishmania donovani by the sand fly Phlebotomus argentipes. Several effector molecules, including antimicrobial peptides and highly specific single chain antibodies, are currently being explored for their anti-parasite activities in these two systems. In preparation for eventual field use, we are actively engaged in risk assessment studies addressing the issue of horizontal gene transfer from the modified bacteria to environmental microbes.

  12. Emerging Vector-Borne Diseases – Incidence through Vectors

    OpenAIRE

    Savić, Sara; Vidić, Branka; Grgić, Zivoslav; Potkonjak, Aleksandar; Spasojevic, Ljubica

    2014-01-01

    Vector-borne diseases use to be a major public health concern only in tropical and subtropical areas, but today they are an emerging threat for the continental and developed countries also. Nowadays, in intercontinental countries, there is a struggle with emerging diseases, which have found their way to appear through vectors. Vector-borne zoonotic diseases occur when vectors, animal hosts, climate conditions, pathogens, and susceptible human population exist at the same time, at the same pla...

  13. Air travel and vector-borne disease movement.

    Science.gov (United States)

    Tatem, A J; Huang, Z; Das, A; Qi, Q; Roth, J; Qiu, Y

    2012-12-01

    Recent decades have seen substantial expansions in the global air travel network and rapid increases in traffic volumes. The effects of this are well studied in terms of the spread of directly transmitted infections, but the role of air travel in the movement of vector-borne diseases is less well understood. Increasingly however, wider reaching surveillance for vector-borne diseases and our improving abilities to map the distributions of vectors and the diseases they carry, are providing opportunities to better our understanding of the impact of increasing air travel. Here we examine global trends in the continued expansion of air transport and its impact upon epidemiology. Novel malaria and chikungunya examples are presented, detailing how geospatial data in combination with information on air traffic can be used to predict the risks of vector-borne disease importation and establishment. Finally, we describe the development of an online tool, the Vector-Borne Disease Airline Importation Risk (VBD-Air) tool, which brings together spatial data on air traffic and vector-borne disease distributions to quantify the seasonally changing risks for importation to non-endemic regions. Such a framework provides the first steps towards an ultimate goal of adaptive management based on near real time flight data and vector-borne disease surveillance. PMID:22444826

  14. Nordic climate change: data for modeling vector borne diseases

    DEFF Research Database (Denmark)

    Kristensen, Birgit; Bødker, Rene

    derivatives were calculated in order to assess the geographical and seasonal variation in the area. In order to evaluate the response of vector borne diseases to possible future climate changes and the subsequent potential spread into new areas, daily temperature predictions (mean, min and max) for three 20......The distribution of vector species is generally restricted by a range of different climatic and geographical factors, while the development and spread of the vector-borne diseases (veterinary and zoonotic) is often primarily temperature driven. Thus temperature and its derivatives are key factors...... in the modelling of vector-borne diseases. This puts a high demand on the quality and accuracy of the temperature data to be used as input in such models. In order to best capture the local temporal and spatial variation in the temperature surfaces, accurate daily temperature data were used in the present project...

  15. Climate change and vector-borne diseases: a regional analysis.

    OpenAIRE

    Githeko, A. K.; Lindsay, S. W.; U. E. Confalonieri; Patz, J A

    2000-01-01

    Current evidence suggests that inter-annual and inter-decadal climate variability have a direct influence on the epidemiology of vector-borne diseases. This evidence has been assessed at the continental level in order to determine the possible consequences of the expected future climate change. By 2100 it is estimated that average global temperatures will have risen by 1.0-3.5 degrees C, increasing the likelihood of many vector-borne diseases in new areas. The greatest effect of climate chang...

  16. Impact of climate variability on vector-borne disease transmission

    Science.gov (United States)

    We will discuss the impact of climate variability on vector borne diseases and demonstrate that global climate teleconnections can be used to anticipate and forecast, in the case of Rift Valley fever, epidemics and epizootics. In this context we will examine significant worldwide weather anomalies t...

  17. COMMUNITY LEVEL ANALYSIS OF VECTOR-BORNE DISEASE

    Science.gov (United States)

    Ecological community structure is particularly important in vector-borne zoonotic diseases with complex life cycles. Single population models, such as the so-called Ross-Macdonald model (Baily, 1982), have been important in developing and characterizing our current understanding...

  18. Emerging Vector-borne Diseases in a Changing Environment

    OpenAIRE

    ÖZER, Nurdan

    2005-01-01

    Vector-borne infectious diseases are emerging or resurging as a result of changes in public health policy, demographic and societal changes, insecticide and drug resistance, shift in emphasis from prevention to emergency response, genetic changes in pathogens in the last two decades of the twentieth century. Climate changes also can influence the emergence and reemergence of these diseases which are malaria, dengue, yellow fever, plague, filariasis, louse-borne typhus, lyme disease, trypanoso...

  19. Elimination of vector-borne transmission of Chagas disease

    OpenAIRE

    AC Silveira; MC Vinhaes

    1999-01-01

    The control of the vector-borne transmission of Chagas disease in Brazil was organized as a national program in 1975, when two large entomological and sero-epidemiological surveys were conducted in the country in order to identify areas at highest risk of transmission and to guide inerventions regarding the chemical treatment of domestic vectors of the disease. The authors present the baseline data gathered through these studies and compare them with more recent data. The evaluation performed...

  20. Review of vector-borne diseases in Hong Kong.

    Science.gov (United States)

    Ma, Siu-keung Edmond; Wong, Wang Christine; Leung, Chi-wah Ryan; Lai, Sik-to Thomas; Lo, Yee-chi Janice; Wong, Kai-hay Howard; Chan, Man-chung; Que, Tak-lun; Chow, Ka-wai Mary; Yuen, Ming-chi; Lau, Tin-wai Winnie; Simon, John

    2011-05-01

    The epidemiology of vector-borne diseases in Hong Kong has changed over the past decade but still poses a significant public health risk. We provided a comprehensive review of the epidemiological information and analysed the trends of major vector-borne diseases, including the vector situation in Hong Kong. The incidence of malaria has dropped dramatically in the past few decades and is now mainly an imported disease acquired from malaria endemic countries. Locally acquired dengue fever occurred in 2002 and 2003, and thereafter all cases were imported, mainly from Southeast Asia areas. Only a few local cases of Japanese encephalitis were reported in the past decade. In contrast, there is a notable increase in scrub typhus and spotted fever cases. The emergence of chikungunya fever in Asia and Indian Ocean countries also resulted in importation of human cases. Given the heavy traffic between this international city and other parts of the world, as well as the presence of vectors in this densely populated area, vigilance should be maintained against these infections. Comprehensive public health measures encompassing disease surveillance, vector surveillance and control measures with support from all sectors of the community are required to combat the old and newly emerging vector-borne diseases in Hong Kong. PMID:21679886

  1. Global Change and Human Vulnerability to Vector-Borne Diseases

    OpenAIRE

    Sutherst, Robert W.

    2004-01-01

    Global change includes climate change and climate variability, land use, water storage and irrigation, human population growth and urbanization, trade and travel, and chemical pollution. Impacts on vector-borne diseases, including malaria, dengue fever, infections by other arboviruses, schistosomiasis, trypanosomiasis, onchocerciasis, and leishmaniasis are reviewed. While climate change is global in nature and poses unknown future risks to humans and natural ecosystems, other local changes ar...

  2. The epidemic threshold of vector-borne diseases with seasonality

    OpenAIRE

    Bacaër, Nicolas; Guernaoui, S.

    2006-01-01

    Cutaneous leishmaniasis is a vector-borne disease transmitted to humans by sandflies. In this paper, we develop a mathematical model which takes into account the seasonality of the vector population and the distribution of the latent period from infection to symptoms in humans. Parameters are fitted to real data from the province of Chichaoua, Morocco. We also introduce a generalization of the definition of the basic reproduction number R-0 which is adapted to periodic environments. This R-0 ...

  3. Resurgent vector-borne diseases as a global health problem.

    OpenAIRE

    Gubler, D. J.

    1998-01-01

    Vector-borne infectious diseases are emerging or resurging as a result of changes in public health policy, insecticide and drug resistance, shift in emphasis from prevention to emergency response, demographic and societal changes, and genetic changes in pathogens. Effective prevention strategies can reverse this trend. Research on vaccines, environmentally safe insecticides, alternative approaches to vector control, and training programs for health-care workers are needed.

  4. Urbanization, land tenure security and vector-borne Chagas disease

    Science.gov (United States)

    Levy, Michael Z.; Barbu, Corentin M.; Castillo-Neyra, Ricardo; Quispe-Machaca, Victor R.; Ancca-Juarez, Jenny; Escalante-Mejia, Patricia; Borrini-Mayori, Katty; Niemierko, Malwina; Mabud, Tarub S.; Behrman, Jere R.; Naquira-Velarde, Cesar

    2014-01-01

    Modern cities represent one of the fastest growing ecosystems on the planet. Urbanization occurs in stages; each stage characterized by a distinct habitat that may be more or less susceptible to the establishment of disease vector populations and the transmission of vector-borne pathogens. We performed longitudinal entomological and epidemiological surveys in households along a 1900 × 125 m transect of Arequipa, Peru, a major city of nearly one million inhabitants, in which the transmission of Trypanosoma cruzi, the aetiological agent of Chagas disease, by the insect vector Triatoma infestans, is an ongoing problem. The transect spans a cline of urban development from established communities to land invasions. We find that the vector is tracking the development of the city, and the parasite, in turn, is tracking the dispersal of the vector. New urbanizations are free of vector infestation for decades. T. cruzi transmission is very recent and concentrated in more established communities. The increase in land tenure security during the course of urbanization, if not accompanied by reasonable and enforceable zoning codes, initiates an influx of construction materials, people and animals that creates fertile conditions for epidemics of some vector-borne diseases. PMID:24990681

  5. A confusing case of canine vector-borne disease: clinical signs and progression in a dog co-infected with Ehrlichia canis and Bartonella vinsonii ssp. berkhoffii

    OpenAIRE

    Maggi Ricardo G; Breitschwerdt Edward B

    2009-01-01

    Abstract Bartonella spp. are important pathogens in human and veterinary medicine, and bartonellosis is considered as an emerging zoonosis that is being reported with increasing frequency. Of 22 known species and subspecies of Bartonella, seven have been isolated from dogs, causing disease manifestations similar to those seen in human beings. The wide variety of clinical signs and the possible chronic progression of disease manifestations are illustrated in the case of an infected Labrador re...

  6. The Effects of Human Movement on the Persistence of Vector-Borne Diseases*

    OpenAIRE

    C. Cosner; Beier, J. C.; Cantrell, R. S.; Impoinvil, D.; Kapitanski, L.; Potts, M. D.; Troyo, A.; S. Ruan

    2009-01-01

    With the recent resurgence of vector-borne diseases due to urbanization and development there is an urgent need to understand the dynamics of vector-borne diseases in rapidly changing urban environments. For example, many empirical studies have produced the disturbing finding that diseases continue to persist in modern city centers with zero or low rates of transmission. We develop spatial models of vector-borne disease dynamics on a network of patches to examine how the movement of humans in...

  7. Vector-borne disease intelligence: strategies to deal with disease burden and threats

    Czech Academy of Sciences Publication Activity Database

    Braks, M.; Medlock, J. M.; Hubálek, Zdeněk; Hjertqvist, M.; Perrin, Y.; Lancelot, R.; Duchyene, E.; Hendrickx, G.; Stroo, A.; Heyman, P.; Sprong, H.

    2014-01-01

    Roč. 2, č. 280 (2014), s. 280. ISSN 2296-2565 Institutional support: RVO:68081766 Keywords : disease burden * emerging diseases * one health * surveillance * threat * vector-borne diseases Subject RIV: FN - Epidemiology, Contagious Diseases ; Clinical Immunology

  8. Vector-borne diseases: the basic reproduction number R0 and risk maps

    NARCIS (Netherlands)

    Hartemink, N.A.

    2009-01-01

    This thesis deals with the derivation of the basic reproduction number (R0) for vector-borne diseases, in the context of studying the effect of climate change on the risk of emergence diseases. Vector-borne diseases are transmitted from an infected individual to another individual by vectors, usuall

  9. Will integrated surveillance systems for vectors and vector-borne diseases be the future of controlling vector-borne diseases? A practical example from China.

    Science.gov (United States)

    Wu, Y; Ling, F; Hou, J; Guo, S; Wang, J; Gong, Z

    2016-07-01

    Vector-borne diseases are one of the world's major public health threats and annually responsible for 30-50% of deaths reported to the national notifiable disease system in China. To control vector-borne diseases, a unified, effective and economic surveillance system is urgently needed; all of the current surveillance systems in China waste resources and/or information. Here, we review some current surveillance systems and present a concept for an integrated surveillance system combining existing vector and vector-borne disease monitoring systems. The integrated surveillance system has been tested in pilot programmes in China and led to a 21·6% cost saving in rodent-borne disease surveillance. We share some experiences gained from these programmes. PMID:26899818

  10. Spatial distribution of vector borne disease agents in dogs in Aegean region, Turkey

    Directory of Open Access Journals (Sweden)

    Kerem Ural

    2014-06-01

    Full Text Available Objective. Assess the spatial distribution of seroprevalence of infection with or exposure to 4 vector-borne pathogens Ehrlichia canis, Anaplasma phagocytophilum, Borrelia burgdorferi and Dirofilaria immitis, across the coastal states of the Aegean region with special reference to clinical signs and haematological variances related to disease condition. Materials and methods. A convenience sample, targeting blood from at least 10 pet dogs from İzmir, Aydin, Denizli, Mugla and Manisa cities involved was evaluated using a canine point-of-care ELISA kit. Results. Out of 307 dogs tested the overall seroprevalence was highest for E. canis (24.42%, followed by E. canis + A. phagocytophilum co-infection (10.42%, A. phagocytophilum (7.49% and D. immitis (2.28%. Only 2 cases were seropositive to B. burgdorferi albeit 10 dogs were co-infected with more than 2 agents. For both dogs infected with E. canis and co-infected with E. canis and A. phagocytophilum, anemia, thrombocytopenia and leukocytosis, were more commonly detected, whereas thrombocytopenia and leukocytosis were significant finding in dogs infected with A. phagocytophilum or D. immitis, respectively. Variance analysis showed significant differences for mean RBC, Hb, PCV and PLT values (p<0.01 among control group and other groups. Conclusions. Seropositivity for vector-borne pathogens other than B. burgdorferi, is moderately to widely distributed in dogs residing in the Aegean region in Turkey.

  11. Spatially explicit multi-criteria decision analysis for managing vector-borne diseases

    OpenAIRE

    Hongoh Valerie; Hoen Anne; Aenishaenslin Cécile; Waaub Jean-Philippe; Bélanger Denise; Michel Pascal

    2011-01-01

    Abstract The complex epidemiology of vector-borne diseases creates significant challenges in the design and delivery of prevention and control strategies, especially in light of rapid social and environmental changes. Spatial models for predicting disease risk based on environmental factors such as climate and landscape have been developed for a number of important vector-borne diseases. The resulting risk maps have proven value for highlighting areas for targeting public health programs. How...

  12. Drivers, dynamics, and control of emerging vector-borne zoonotic diseases

    OpenAIRE

    Kilpatrick, A. Marm; Randolph, Sarah E.

    2012-01-01

    Emerging vector-borne diseases represent an important issue for global health. Many vector-borne pathogens have appeared in new regions in the past two decades, and many endemic diseases have increased in incidence. Although introductions and local emergence are frequently considered distinct processes, many emerging endemic pathogens are in fact invading at a local scale coincident with habitat change. We highlight key differences in the dynamics and disease burden that result from increased...

  13. Using the Gravity Model to Estimate the Spatial Spread of Vector-Borne Diseases

    OpenAIRE

    Jean-Marie Aerts; Jamshid Farifteh; Piet Maes; Verstraeten, Willem W.; José Miguel Barrios; Pol Coppin

    2012-01-01

    The gravity models are commonly used spatial interaction models. They have been widely applied in a large set of domains dealing with interactions amongst spatial entities. The spread of vector-borne diseases is also related to the intensity of interaction between spatial entities, namely, the physical habitat of pathogens’ vectors and/or hosts, and urban areas, thus humans. This study implements the concept behind gravity models in the spatial spread of two vector-borne diseases, n...

  14. Reducing vector-borne disease by empowering farmers in integrated vector management

    OpenAIRE

    Henk van den Berg; Alexander von Hildebrand; Vaithilingam Ragunathan; Das, Pradeep K

    2007-01-01

    PROBLEM: Irrigated agriculture exposes rural people to health risks associated with vector-borne diseases and pesticides used in agriculture and for public health protection. Most developing countries lack collaboration between the agricultural and health sectors to jointly address these problems. APPROACH: We present an evaluation of a project that uses the "farmer field school" method to teach farmers how to manage vector-borne diseases and how to improve rice yields. Teaching farmers about...

  15. Web-based GIS: the vector-borne disease airline importation risk (VBD-AIR) tool

    OpenAIRE

    Huang Zhuojie; Das Anirrudha; Qiu Youliang; Tatem Andrew J

    2012-01-01

    Abstract Background Over the past century, the size and complexity of the air travel network has increased dramatically. Nowadays, there are 29.6 million scheduled flights per year and around 2.7 billion passengers are transported annually. The rapid expansion of the network increasingly connects regions of endemic vector-borne disease with the rest of the world, resulting in challenges to health systems worldwide in terms of vector-borne pathogen importation and disease vector invasion event...

  16. Possible impact of rising sea levels on vector-borne infectious diseases

    OpenAIRE

    Surendran Sinnathamby N; Ramasamy Ranjan

    2011-01-01

    Abstract Background Vector-borne infectious diseases are a significant cause of human and animal mortality and morbidity. Modeling studies predict that changes in climate that accompany global warming will alter the transmission risk of many vector-borne infectious diseases in different parts of the world. Global warming will also raise sea levels, which will lead to an increase in saline and brackish water bodies in coastal areas. The potential impact of rising sea levels, as opposed to clim...

  17. Web-based GIS: the vector-borne disease airline importation risk (VBD-AIR tool

    Directory of Open Access Journals (Sweden)

    Huang Zhuojie

    2012-08-01

    Full Text Available Abstract Background Over the past century, the size and complexity of the air travel network has increased dramatically. Nowadays, there are 29.6 million scheduled flights per year and around 2.7 billion passengers are transported annually. The rapid expansion of the network increasingly connects regions of endemic vector-borne disease with the rest of the world, resulting in challenges to health systems worldwide in terms of vector-borne pathogen importation and disease vector invasion events. Here we describe the development of a user-friendly Web-based GIS tool: the Vector-Borne Disease Airline Importation Risk Tool (VBD-AIR, to help better define the roles of airports and airlines in the transmission and spread of vector-borne diseases. Methods Spatial datasets on modeled global disease and vector distributions, as well as climatic and air network traffic data were assembled. These were combined to derive relative risk metrics via air travel for imported infections, imported vectors and onward transmission, and incorporated into a three-tier server architecture in a Model-View-Controller framework with distributed GIS components. A user-friendly web-portal was built that enables dynamic querying of the spatial databases to provide relevant information. Results The VBD-AIR tool constructed enables the user to explore the interrelationships among modeled global distributions of vector-borne infectious diseases (malaria. dengue, yellow fever and chikungunya and international air service routes to quantify seasonally changing risks of vector and vector-borne disease importation and spread by air travel, forming an evidence base to help plan mitigation strategies. The VBD-AIR tool is available at http://www.vbd-air.com. Conclusions VBD-AIR supports a data flow that generates analytical results from disparate but complementary datasets into an organized cartographical presentation on a web map for the assessment of vector-borne disease movements

  18. Assessment of changes of vector borne diseases with wetland characteristics using multivariate analysis.

    Science.gov (United States)

    Sheela, A M; Sarun, S; Justus, J; Vineetha, P; Sheeja, R V

    2015-04-01

    Vector borne diseases are a threat to human health. Little attention has been paid to the prevention of these diseases. We attempted to identify the significant wetland characteristics associated with the spread of chikungunya, dengue fever and malaria in Kerala, a tropical region of South West India using multivariate analyses (hierarchical cluster analysis, factor analysis and multiple regression). High/medium turbid coastal lagoons and inland water-logged wetlands with aquatic vegetation have significant effect on the incidence of chikungunya while dengue influenced by high turbid coastal beaches and malaria by medium turbid coastal beaches. The high turbidity in water is due to the urban waste discharge namely sewage, sullage and garbage from the densely populated cities and towns. The large extent of wetland is low land area favours the occurrence of vector borne diseases. Hence the provision of pollution control measures at source including soil erosion control measures is vital. The identification of vulnerable zones favouring the vector borne diseases will help the authorities to control pollution especially from urban areas and prevent these vector borne diseases. Future research should cover land use cover changes, climatic factors, seasonal variations in weather and pollution factors favouring the occurrence of vector borne diseases. PMID:25412801

  19. The role of Remote Sensing and GIS for spatial prediction of vector-borne diseases transmission: A systematic review

    OpenAIRE

    M. Palaniyandi

    2012-01-01

    There have been several attemps made to the appreciation of remote sensing and GIS for the study of vectors,biodiversity, vector presence, vector abundance and the vector-borne diseases with respect to space and time.This study was made for reviewing and appraising the potential use of remote sensing and GIS applications forspatial prediction of vector-borne diseases transmission. The nature of the presence and the abundance of vectorsand vector-borne diseases, disease infection and the disea...

  20. Vector-Borne Diseases - constant challenge for practicing veterinarians: recommendations from the CVBD World Forum

    Directory of Open Access Journals (Sweden)

    Baneth Gad

    2012-03-01

    Full Text Available Abstract The human-animal bond has been a fundamental feature of mankind's history for millennia. The first, and strongest of these, man's relationship with the dog, is believed to pre-date even agriculture, going back as far as 30,000 years. It remains at least as powerful today. Fed by the changing nature of the interactions between people and their dogs worldwide and the increasing tendency towards close domesticity, the health of dogs has never played a more important role in family life. Thanks to developments in scientific understanding and diagnostic techniques, as well as changing priorities of pet owners, veterinarians are now able, and indeed expected, to play a fundamental role in the prevention and treatment of canine disease, including canine vector-borne diseases (CVBDs. The CVBDs represent a varied and complex group of diseases, including anaplasmosis, babesiosis, bartonellosis, borreliosis, dirofilariosis, ehrlichiosis, leishmaniosis, rickettsiosis and thelaziosis, with new syndromes being uncovered every year. Many of these diseases can cause serious, even life-threatening clinical conditions in dogs, with a number having zoonotic potential, affecting the human population. Today, CVBDs pose a growing global threat as they continue their spread far from their traditional geographical and temporal restraints as a result of changes in both climatic conditions and pet dog travel patterns, exposing new populations to previously unknown infectious agents and posing unprecedented challenges to veterinarians. In response to this growing threat, the CVBD World Forum, a multidisciplinary group of experts in CVBDs from around the world which meets on an annual basis, gathered in Nice (France in 2011 to share the latest research on CVBDs and discuss the best approaches to managing these diseases around the world. As a result of these discussions, we, the members of the CVBD Forum have developed the following recommendations to veterinarians

  1. One health: the importance of companion animal vector-borne diseases

    Directory of Open Access Journals (Sweden)

    Day Michael J

    2011-04-01

    Full Text Available Abstract The international prominence accorded the 'One Health' concept of co-ordinated activity of those involved in human and animal health is a modern incarnation of a long tradition of comparative medicine, with roots in the ancient civilizations and a golden era during the 19th century explosion of knowledge in the field of infectious disease research. Modern One Health tends to focus on zoonotic pathogens emerging from wildlife and production animal species, but one of the most significant One Health challenges is rabies for which there is a canine reservoir. This review considers the role of small companion animals in One Health and specifically addresses the major vector-borne infectious diseases that are shared by man, dogs and cats. The most significant of these are leishmaniosis, borreliosis, bartonellosis, ehrlichiosis, rickettsiosis and anaplasmosis. The challenges that lie ahead in this field of One Health are discussed, together with the role of the newly formed World Small Animal Veterinary Association One Health Committee.

  2. A novel tool for classification of epidemiological data of vector-borne diseases

    Directory of Open Access Journals (Sweden)

    Sree Hari Rao Vadrevu

    2010-01-01

    Full Text Available In this article we present a novel tool that renders efficient classification of epidemiological data of vector-borne diseases. This algorithm has been applied on the data of the Filariasis disease and the results are compared with the well-known k-nearest neighbor algorithm.

  3. A Novel Tool for Classification of Epidemiological Data of Vector-Borne Diseases

    OpenAIRE

    Sree Hari Rao Vadrevu; Suryanarayana U Murty

    2010-01-01

    In this article we present a novel tool that renders efficient classification of epidemiological data of vector-borne diseases. This algorithm has been applied on the data of the Filariasis disease and the results are compared with the well-known k-nearest neighbor algorithm.

  4. Seven challenges for modelling indirect transmission: Vector-borne diseases, macroparasites and neglected tropical diseases

    Directory of Open Access Journals (Sweden)

    T. Déirdre Hollingsworth

    2015-03-01

    Full Text Available Many of the challenges which face modellers of directly transmitted pathogens also arise when modelling the epidemiology of pathogens with indirect transmission – whether through environmental stages, vectors, intermediate hosts or multiple hosts. In particular, understanding the roles of different hosts, how to measure contact and infection patterns, heterogeneities in contact rates, and the dynamics close to elimination are all relevant challenges, regardless of the mode of transmission. However, there remain a number of challenges that are specific and unique to modelling vector-borne diseases and macroparasites. Moreover, many of the neglected tropical diseases which are currently targeted for control and elimination are vector-borne, macroparasitic, or both, and so this article includes challenges which will assist in accelerating the control of these high-burden diseases. Here, we discuss the challenges of indirect measures of infection in humans, whether through vectors or transmission life stages and in estimating the contribution of different host groups to transmission. We also discuss the issues of “evolution-proof” interventions against vector-borne disease.

  5. Legal aspects of public health: difficulties in controlling vector-borne and zoonotic diseases in Brazil.

    Science.gov (United States)

    Mendes, Marcílio S; de Moraes, Josué

    2014-11-01

    In recent years, vector-borne and zoonotic diseases have become a major challenge for public health. Dengue fever and leptospirosis are the most important communicable diseases in Brazil based on their prevalence and the healthy life years lost from disability. The primary strategy for preventing human exposure to these diseases is effective insect and rodent control in and around the home. However, health authorities have difficulties in controlling vector-borne and zoonotic diseases because residents often refuse access to their homes. This study discusses aspects related to the activities performed by Brazilian health authorities to combat vector-borne and zoonotic diseases, particularly difficulties in relation to the legal aspect, which often impede the quick and effective actions of these professionals. How might it be possible to reconcile the need to preserve public health and the rule on the inviolability of the home, especially in the case of abandoned properties or illegal residents and the refusal of residents to allow the health authority access? Do residents have the right to hinder the performance of health workers even in the face of a significant and visible focus of disease transmission? This paper argues that a comprehensive legal plan aimed at the control of invasive vector-borne and zoonotic diseases including synanthropic animals of public health importance should be considered. In addition, this paper aims to bridge the gap between lawyers and public health professionals and to facilitate communication between them. PMID:25051187

  6. Vector-Borne Disease Intelligence: Strategies to Deal with Disease Burden and Threats

    OpenAIRE

    Braks, Marieta; Medlock, Jolyon M; Hubalek, Zdenek; Hjertqvist, Marika; Perrin, Yvon; Lancelot, Renaud; Duchyene, Els; Hendrickx, Guy; Stroo, Arjan; Heyman, Paul; Sprong, Hein

    2014-01-01

    Owing to the complex nature of vector-borne diseases (VBDs), whereby monitoring of human case patients does not suffice, public health authorities experience challenges in surveillance and control of VBDs. Knowledge on the presence and distribution of vectors and the pathogens that they transmit is vital to the risk assessment process to permit effective early warning, surveillance, and control of VBDs. Upon accepting this reality, public health authorities face an ever-increasing range of po...

  7. Genetic manipulation of endosymbionts to control vector and vector borne diseases

    Directory of Open Access Journals (Sweden)

    Jay Prakash Gupta

    Full Text Available Vector borne diseases (VBD are on the rise because of failure of the existing methods of control of vector and vector borne diseases and the climate change. A steep rise of VBDs are due to several factors like selection of insecticide resistant vector population, drug resistant parasite population and lack of effective vaccines against the VBDs. Environmental pollution, public health hazard and insecticide resistant vector population indicate that the insecticides are no longer a sustainable control method of vector and vector-borne diseases. Amongst the various alternative control strategies, symbiont based approach utilizing endosymbionts of arthropod vectors could be explored to control the vector and vector borne diseases. The endosymbiont population of arthropod vectors could be exploited in different ways viz., as a chemotherapeutic target, vaccine target for the control of vectors. Expression of molecules with antiparasitic activity by genetically transformed symbiotic bacteria of disease-transmitting arthropods may serve as a powerful approach to control certain arthropod-borne diseases. Genetic transformation of symbiotic bacteria of the arthropod vector to alter the vector’s ability to transmit pathogen is an alternative means of blocking the transmission of VBDs. In Indian scenario, where dengue, chikungunya, malaria and filariosis are prevalent, paratransgenic based approach can be used effectively. [Vet World 2012; 5(9.000: 571-576

  8. Surveillance of arthropod vector-borne infectious diseases using remote sensing techniques: a review.

    Directory of Open Access Journals (Sweden)

    Satya Kalluri

    2007-10-01

    Full Text Available Epidemiologists are adopting new remote sensing techniques to study a variety of vector-borne diseases. Associations between satellite-derived environmental variables such as temperature, humidity, and land cover type and vector density are used to identify and characterize vector habitats. The convergence of factors such as the availability of multi-temporal satellite data and georeferenced epidemiological data, collaboration between remote sensing scientists and biologists, and the availability of sophisticated, statistical geographic information system and image processing algorithms in a desktop environment creates a fertile research environment. The use of remote sensing techniques to map vector-borne diseases has evolved significantly over the past 25 years. In this paper, we review the status of remote sensing studies of arthropod vector-borne diseases due to mosquitoes, ticks, blackflies, tsetse flies, and sandflies, which are responsible for the majority of vector-borne diseases in the world. Examples of simple image classification techniques that associate land use and land cover types with vector habitats, as well as complex statistical models that link satellite-derived multi-temporal meteorological observations with vector biology and abundance, are discussed here. Future improvements in remote sensing applications in epidemiology are also discussed.

  9. Global Climate Teleconnections to Forecast Increased Risk of Vector-Borne Animal and Human Disease Transmission

    Science.gov (United States)

    We willexamine how climate teleconnect ions and variability impact vector biology and vector borne disease ecology, and demonstrate that global climate monitoring can be used to anticipate and forecast epidemics and epizootics. In this context we willexamine significant worldwide weather anomalies t...

  10. Possible impact of rising sea levels on vector-borne infectious diseases

    Directory of Open Access Journals (Sweden)

    Surendran Sinnathamby N

    2011-01-01

    Full Text Available Abstract Background Vector-borne infectious diseases are a significant cause of human and animal mortality and morbidity. Modeling studies predict that changes in climate that accompany global warming will alter the transmission risk of many vector-borne infectious diseases in different parts of the world. Global warming will also raise sea levels, which will lead to an increase in saline and brackish water bodies in coastal areas. The potential impact of rising sea levels, as opposed to climate change, on the prevalence of vector-borne infectious diseases has hitherto been unrecognised. Presentation of the hypothesis Mosquito species possessing salinity-tolerant larvae and pupae, and capable of transmitting arboviruses and parasites are found in many parts of the world. An expansion of brackish and saline water bodies in coastal areas, associated with rising sea levels, can increase densities of salinity-tolerant vector mosquitoes and lead to the adaptation of freshwater vectors to breed in brackish and saline waters. The breeding of non-mosquito vectors may also be influenced by salinity changes in coastal habitats. Higher vector densities can increase transmission of vector-borne infectious diseases in coastal localities, which can then spread to other areas. Testing the hypothesis The demonstration of increases in vector populations and disease prevalence that is related to an expansion of brackish/saline water bodies in coastal areas will provide the necessary supportive evidence. However the implementation of specific vector and disease control measures to counter the threat will confound the expected findings. Implications of the hypothesis Rising sea levels can act synergistically with climate change and then interact in a complex manner with other environmental and socio-economic factors to generate a greater potential for the transmission of vector-borne infectious diseases. The resulting health impacts are likely to be particularly

  11. Effect of climate change on vector-borne disease risk in the UK.

    Science.gov (United States)

    Medlock, Jolyon M; Leach, Steve A

    2015-06-01

    During the early part of the 21st century, an unprecedented change in the status of vector-borne disease in Europe has occurred. Invasive mosquitoes have become widely established across Europe, with subsequent transmission and outbreaks of dengue and chikungunya virus. Malaria has re-emerged in Greece, and West Nile virus has emerged throughout parts of eastern Europe. Tick-borne diseases, such as Lyme disease, continue to increase, or, in the case of tick-borne encephalitis and Crimean-Congo haemorrhagic fever viruses, have changed their geographical distribution. From a veterinary perspective, the emergence of Bluetongue and Schmallenberg viruses show that northern Europe is equally susceptible to transmission of vector-borne disease. These changes are in part due to increased globalisation, with intercontinental air travel and global shipping transport creating new opportunities for invasive vectors and pathogens. However, changes in vector distributions are being driven by climatic changes and changes in land use, infrastructure, and the environment. In this Review, we summarise the risks posed by vector-borne diseases in the present and the future from a UK perspective, and assess the likely effects of climate change and, where appropriate, climate-change adaptation strategies on vector-borne disease risk in the UK. Lessons from the outbreaks of West Nile virus in North America and chikungunya in the Caribbean emphasise the need to assess future vector-borne disease risks and prepare contingencies for future outbreaks. Ensuring that adaptation strategies for climate change do not inadvertently exacerbate risks should be a primary focus for decision makers. PMID:25808458

  12. Global dynamics of a vector-borne disease model with latency and saturating incidence rate

    OpenAIRE

    Ashrafur Rahman

    2014-01-01

    This paper deals with a vector-borne disease model containing latency and nonlinear incidence rates. Global analysis is completely determined by suitable Lyapunov functionals. We explicitely determine the basic reproduction number and find that if this number is less than one then disease dies out, but if the number is larger than one, the disease causing strain become endemic. The study shows that the latency delay explicitely in°uence the disease persistence. Keywords: Latency, saturating i...

  13. Stability Analysis of a Vector-Borne Disease with Variable Human Population

    OpenAIRE

    Ozair, Muhammad; Lashari, Abid Ali; Jung, Il Hyo; Seo, Young Il; Kim, Byul Nim

    2013-01-01

    A mathematical model of a vector-borne disease involving variable human population is analyzed. The varying population size includes a term for disease-related deaths. Equilibria and stability are determined for the system of ordinary differential equations. If ${R}_{0}\\le 1$ , the disease-“free” equilibrium is globally asymptotically stable and the disease always dies out. If ${R}_{0}>1$ , a unique “endemic” equilibrium is globally asymptotically stable in the interior of feas...

  14. Vector-borne diseases and the basic reproduction number: a case study of African horse sickness

    OpenAIRE

    Lord, C.C.; Woolhouse, M. E. J.; Heesterbeek, J.A.P.; Mellor, P.S.

    1996-01-01

    The basic reproduction number, R0, can be used to determine factors important in the ability of a disease to invade or persist. We show how this number can be derived or estimated for vector-borne diseases with different complicating factors. African horse sickness is a viral disease transmitted mainly by the midge Culicoides imicola. We use this as an example of such a vector-transmitted disease where latent periods, seasonality in vector populations, and multiple host types may be important...

  15. Global climate change and vector-borne diseases

    Science.gov (United States)

    Ginsberg, H.S.

    2002-01-01

    Global warming will have different effects on different diseases because of the complex and idiosynchratic interactions between vectors, hosts, and pathogens that influence transmission dynamics of each pathogen. Human activities, including urbanization, rapid global travel, and vector management, have profound effects on disease transmission that can operate on more rapid time scales than does global climate change. The general concern about global warming encouraging the spread of tropical diseases is legitimate, but the effects vary among diseases, and the ecological implications are difficult to predict.

  16. An Environmental Data Set for Vector-Borne Disease Modeling and Epidemiology

    OpenAIRE

    Chabot-Couture, Guillaume; Nigmatulina, Karima; Eckhoff, Philip

    2014-01-01

    Understanding the environmental conditions of disease transmission is important in the study of vector-borne diseases. Low- and middle-income countries bear a significant portion of the disease burden; but data about weather conditions in those countries can be sparse and difficult to reconstruct. Here, we describe methods to assemble high-resolution gridded time series data sets of air temperature, relative humidity, land temperature, and rainfall for such areas; and we test these methods on...

  17. Towards a resource-based habitat approach for spatial modelling of vector-borne disease risks

    OpenAIRE

    Hartemink, Nienke; Vanwambeke, Sophie O; Purse, Bethan V.; Gilbert, Marius; Van Dyck, Hans

    2015-01-01

    Given the veterinary and public health impact of vector-borne diseases, there is a clear need to assess the suitability of landscapes for the emergence and spread of these diseases. Current approaches for predicting disease risks neglect key features of the landscape as components of the functional habitat of vectors or hosts, and hence of the pathogen. Empirical-statistical methods do not explicitly incorporate biological mechanisms, whereas current mechanistic models are rarely spatially ex...

  18. Remote Sensing Proxies for Vector-borne Disease Risk Assessment (Invited)

    Science.gov (United States)

    Anyamba, A.

    2010-12-01

    The spread of re-emerging vector-borne diseases such Rift Valley fever (RVF) and Chikungunya (CHIK) is a major issue of global public health concern. This combined with a variable climate regime has opened an avenue for satellite remote sensing to contribute towards a comprehensive understanding of some of the drivers influencing such vector-borne disease outbreaks. Satellite derived measurements such as vegetation indices, rainfall estimates, and land-surface temperature; can be used to infer the complex mosaic of factors that influence ecology and habitat suitability, emergence and population dynamics of disease vectors. However, there are still some gaps in application including appropriate temporal resolution of remote sensing measurements, the complexity of the virus-vector-disease-ecology system and human components that contribute to disease risk that need to be addressed. Geographic Distribution of Recent Rift Valley fever oubreaks

  19. Imported and travelling dogs as carriers of canine vector-borne pathogens in Germany

    Directory of Open Access Journals (Sweden)

    Lorentz Susanne

    2010-04-01

    Full Text Available Abstract Background With the import of pets and pets taken abroad, arthropod-borne diseases have increased in frequency in German veterinary practices. This is reflected by 4,681 dogs that have been either travelled to or relocated from endemic areas to Germany. The case history of these dogs and the laboratory findings have been compared with samples collected from 331 dogs living in an endemic area in Portugal. The various pathogens and the seroprevalences were examined to determine the occurrence of, and thus infection risk, for vector-borne pathogens in popular travel destinations. Results 4,681 dogs were examined serological for Leishmania infantum, Babesia canis and Ehrlichia canis. Buffy coats were detected for Hepatozoon canis and blood samples were examined for microfilariae via the Knott's test. The samples were sent in from animal welfare organizations or private persons via veterinary clinics. Upon individual requests, dogs were additionally examined serological for Anaplasma phagocytophilum, Borrelia burgdorferi and Rickettsia conorii. Overall B. canis was the most prevalent pathogen detected by antibody titers (23.4%, followed by L. infantum (12.2% and E. canis (10.1%. Microfilariae were detected in 7.7% and H. canis in 2.7% of the examined dogs. In 332/1862 dogs A. phagocytophilum, in 64/212 B. burgdorferi and in 20/58 R. conorii was detected. Of the 4,681 dogs, in total 4,226 were imported to Germany from endemic areas. Eighty seven dogs joined their owners for a vacation abroad. In comparison to the laboratory data from Germany, we examined 331 dogs from Portugal. The prevalence of antibodies/pathogens we detected was: 62.8% to R. conorii, 58% to B. canis, 30.5% to A. phagocytophilum, 24.8% to E. canis, 21.1% to H. canis (via PCR, 9.1% to L. infantum and 5.3% to microfilariae. Conclusions The examination of 4,681 dogs living in Germany showed pathogens like L. infantum that are non-endemic in Germany. Furthermore, the German

  20. Modeling and Optimal Control applied to a vector borne disease

    OpenAIRE

    Rodrigues, Helena Sofia; Monteiro, M. Teresa T.; Torres, Delfim F. M.

    2012-01-01

    A model with six mutually-exclusive compartments related to Dengue disease is presented. In this model there are three vector control tools: insecticides (larvicide and adulticide) and mechanical control. The problem is studied using an Optimal Control (OC) approach. The human data for the model is based on the Cape Verde Dengue outbreak. Some control measures are simulated and their consequences analyzed.

  1. Effects of Climate and Climate Change on Vectors and Vector-Borne Diseases: Ticks Are Different.

    Science.gov (United States)

    Ogden, Nick H; Lindsay, L Robbin

    2016-08-01

    There has been considerable debate as to whether global risk from vector-borne diseases will be impacted by climate change. This has focussed on important mosquito-borne diseases that are transmitted by the vectors from infected to uninfected humans. However, this debate has mostly ignored the biological diversity of vectors and vector-borne diseases. Here, we review how climate and climate change may impact those most divergent of arthropod disease vector groups: multivoltine insects and hard-bodied (ixodid) ticks. We contrast features of the life cycles and behaviour of these arthropods, and how weather, climate, and climate change may have very different impacts on the spatiotemporal occurrence and abundance of vectors, and the pathogens they transmit. PMID:27260548

  2. Remote Sensing, GIS, and Vector-Borne Disease

    Science.gov (United States)

    Beck, Louisa R.

    2001-01-01

    The concept of global climate change encompasses more than merely an alteration in temperature; it also includes spatial and temporal covariations in precipitation and humidity, and more frequent occurrence of extreme weather events. The impact of these variations, which can occur at a variety of temporal and spatial scales, could have a direct impact on disease transmission through their environmental consequences for pathogen, vector, and host survival, as well as indirectly through human demographic and behavioral responses. New and future sensor systems will allow scientists to investigate the relationships between climate change and environmental risk factors at multiple spatial, temporal and spectral scales. Higher spatial resolution will provide better opportunities for mapping urban features previously only possible with high resolution aerial photography. These opportunities include housing quality (e.g., Chagas'disease, leishmaniasis) and urban mosquito habitats (e.g., dengue fever, filariasis, LaCrosse encephalitis). There are or will be many new sensors that have higher spectral resolution, enabling scientists to acquire more information about parameters such as soil moisture, soil type, better vegetation discrimination, and ocean color, to name a few. Although soil moisture content is now detectable using Landsat, the new thermal, shortwave infrared, and radar sensors will be able to provide this information at a variety of scales not achievable using Landsat. Soil moisture could become a key component in transmission risk models for Lyme disease (tick survival), helminthiases (worm habitat), malaria (vector-breeding habitat), and schistosomiasis (snail habitat).

  3. Dynamical behavior of an epidemic model for a vector-borne disease with direct transmission

    International Nuclear Information System (INIS)

    An epidemic model of a vector-borne disease with direct transmission is investigated. The reproduction number (R0) of the model is obtained. Rigorous qualitative analysis of the model reveals the presence of the phenomenon of backward bifurcation (where the stable disease-free equilibrium (DFE) coexists with a stable endemic equilibrium when the reproduction number of the disease is less than unity) in the standard incidence model. The phenomenon shows that the classical epidemiological requirement of having the reproduction number less than unity is no longer sufficient, although necessary, for effectively controlling the spread of some vector-borne diseases in a community. The backward bifurcation phenomenon can be removed by substituting the standard incidence with a bilinear mass action incidence. By using Lyapunov function theory and LaSalle invariance principle, it is shown that the unique endemic equilibrium for the model with a mass action incidence is globally stable if the reproduction number Rmass is greater than one in feasible region. This suggests that the use of standard incidence in modelling some vector-borne diseases with direct transmission results in the presence of backward bifurcation. Numerical simulations analyze the effect of the direct transmission and the disease-induced death rate on dynamics of the disease transmission, and also verify our analyzed results.

  4. A surface hydrology model for regional vector borne disease models

    Science.gov (United States)

    Tompkins, Adrian; Asare, Ernest; Bomblies, Arne; Amekudzi, Leonard

    2016-04-01

    Small, sun-lit temporary pools that form during the rainy season are important breeding sites for many key mosquito vectors responsible for the transmission of malaria and other diseases. The representation of this surface hydrology in mathematical disease models is challenging, due to their small-scale, dependence on the terrain and the difficulty of setting soil parameters. Here we introduce a model that represents the temporal evolution of the aggregate statistics of breeding sites in a single pond fractional coverage parameter. The model is based on a simple, geometrical assumption concerning the terrain, and accounts for the processes of surface runoff, pond overflow, infiltration and evaporation. Soil moisture, soil properties and large-scale terrain slope are accounted for using a calibration parameter that sets the equivalent catchment fraction. The model is calibrated and then evaluated using in situ pond measurements in Ghana and ultra-high (10m) resolution explicit simulations for a village in Niger. Despite the model's simplicity, it is shown to reproduce the variability and mean of the pond aggregate water coverage well for both locations and validation techniques. Example malaria simulations for Uganda will be shown using this new scheme with a generic calibration setting, evaluated using district malaria case data. Possible methods for implementing regional calibration will be briefly discussed.

  5. Some vector borne diseases with structured host populations: extinction and spatial spread

    OpenAIRE

    Gourley, Stephen A.; Liu, Rongsong; Wu, Jianhong

    2007-01-01

    We derive from a structured population model a system of delay differential equations describing the interaction of five subpopulations, namely susceptible and infected adult and juvenile reservoirs and infected adult vectors, for a vector borne disease with particular reference to West Nile virus, and we also incorporate spatial movements by considering the analogue reaction diffusion systems with nonlocal delayed terms. Specific conditions for the disease eradication and sharp conditions fo...

  6. Towards an integrated approach in surveillance of vector-borne diseases in Europe

    OpenAIRE

    Reusken Chantal; Scholte Ernst-Jan; van Pelt Wifrid; Kretzschmar Mirjam; van der Giessen Joke; Braks Marieta; Zeller Hervé; Van Bortel Wim; Sprong Hein

    2011-01-01

    Abstract Vector borne disease (VBD) emergence is a complex and dynamic process. Interactions between multiple disciplines and responsible health and environmental authorities are often needed for an effective early warning, surveillance and control of vectors and the diseases they transmit. To fully appreciate this complexity, integrated knowledge about the human and the vector population is desirable. In the current paper, important parameters and terms of both public health and medical ento...

  7. Bayesian data assimilation provides rapid decision support for vector-borne diseases

    OpenAIRE

    Jewell, Chris; Brown, Richard

    2015-01-01

    Predicting the spread of vector-borne diseases in response to incursions requires knowledge of both host and vector demographics in advance of an outbreak. Whereas host population data is typically available, for novel disease introductions there is a high chance of the pathogen utilising a vector for which data is unavailable. This presents a barrier to estimating the parameters of dynamical models representing host-vector-pathogen interaction, and hence limits their ability to provide quant...

  8. Wildlife as reservoirs for vector borne diseases in a warmer Scandinavian climate

    DEFF Research Database (Denmark)

    Bødker, Rene; Kristensen, Birgit

    can be attributed global warming. Some of these new infections have important reservoirs in wild animals and this may affect prevention and control of outbreaks in humans and domestic animals. This may also put wild animals at risk of not just infections but also of control efforts targeted at......The distribution of vector borne diseases is highly determined by environmental and climatic parameters. As the climate becomes warmer the potential for spread of exotic vector borne diseases may therefore increase in the Nordic countries. But this does not mean that all new outbreaks of diseases...... eliminating reservoirs. Insect borne Blue tongue, Black tongue, West Nile Virus, Usutu, avian malaria, Dirofilarial worms and Tick Borne Encephalitis are spreading and pose an increasing threat to people and animals in Northern Europe. Climate driven mathematical models may provide quantitative estimates of...

  9. Spatially explicit multi-criteria decision analysis for managing vector-borne diseases

    Directory of Open Access Journals (Sweden)

    Hongoh Valerie

    2011-12-01

    Full Text Available Abstract The complex epidemiology of vector-borne diseases creates significant challenges in the design and delivery of prevention and control strategies, especially in light of rapid social and environmental changes. Spatial models for predicting disease risk based on environmental factors such as climate and landscape have been developed for a number of important vector-borne diseases. The resulting risk maps have proven value for highlighting areas for targeting public health programs. However, these methods generally only offer technical information on the spatial distribution of disease risk itself, which may be incomplete for making decisions in a complex situation. In prioritizing surveillance and intervention strategies, decision-makers often also need to consider spatially explicit information on other important dimensions, such as the regional specificity of public acceptance, population vulnerability, resource availability, intervention effectiveness, and land use. There is a need for a unified strategy for supporting public health decision making that integrates available data for assessing spatially explicit disease risk, with other criteria, to implement effective prevention and control strategies. Multi-criteria decision analysis (MCDA is a decision support tool that allows for the consideration of diverse quantitative and qualitative criteria using both data-driven and qualitative indicators for evaluating alternative strategies with transparency and stakeholder participation. Here we propose a MCDA-based approach to the development of geospatial models and spatially explicit decision support tools for the management of vector-borne diseases. We describe the conceptual framework that MCDA offers as well as technical considerations, approaches to implementation and expected outcomes. We conclude that MCDA is a powerful tool that offers tremendous potential for use in public health decision-making in general and vector-borne

  10. Using the gravity model to estimate the spatial spread of vector-borne diseases.

    Science.gov (United States)

    Barrios, José Miguel; Verstraeten, Willem W; Maes, Piet; Aerts, Jean-Marie; Farifteh, Jamshid; Coppin, Pol

    2012-12-01

    The gravity models are commonly used spatial interaction models. They have been widely applied in a large set of domains dealing with interactions amongst spatial entities. The spread of vector-borne diseases is also related to the intensity of interaction between spatial entities, namely, the physical habitat of pathogens’ vectors and/or hosts, and urban areas, thus humans. This study implements the concept behind gravity models in the spatial spread of two vector-borne diseases, nephropathia epidemica and Lyme borreliosis, based on current knowledge on the transmission mechanism of these diseases. Two sources of information on vegetated systems were tested: the CORINE land cover map and MODIS NDVI. The size of vegetated areas near urban centers and a local indicator of occupation-related exposure were found significant predictors of disease risk. Both the land cover map and the space-borne dataset were suited yet not equivalent input sources to locate and measure vegetated areas of importance for disease spread. The overall results point at the compatibility of the gravity model concept and the spatial spread of vector-borne diseases. PMID:23202882

  11. Using the Gravity Model to Estimate the Spatial Spread of Vector-Borne Diseases

    Directory of Open Access Journals (Sweden)

    Jean-Marie Aerts

    2012-11-01

    Full Text Available The gravity models are commonly used spatial interaction models. They have been widely applied in a large set of domains dealing with interactions amongst spatial entities. The spread of vector-borne diseases is also related to the intensity of interaction between spatial entities, namely, the physical habitat of pathogens’ vectors and/or hosts, and urban areas, thus humans. This study implements the concept behind gravity models in the spatial spread of two vector-borne diseases, nephropathia epidemica and Lyme borreliosis, based on current knowledge on the transmission mechanism of these diseases. Two sources of information on vegetated systems were tested: the CORINE land cover map and MODIS NDVI. The size of vegetated areas near urban centers and a local indicator of occupation-related exposure were found significant predictors of disease risk. Both the land cover map and the space-borne dataset were suited yet not equivalent input sources to locate and measure vegetated areas of importance for disease spread. The overall results point at the compatibility of the gravity model concept and the spatial spread of vector-borne diseases.

  12. Public health and vector-borne diseases - a new concept for risk governance.

    Science.gov (United States)

    Schmidt, K; Dressel, K M; Niedrig, M; Mertens, M; Schüle, S A; Groschup, M H

    2013-12-01

    Public Health is defined as an interdisciplinary multilevel approach that deals with questions of preventing diseases at the population level. In this context, this paper focuses on vector-borne diseases as an important threat with an increasing impact on human and animal health. Emphasis is laid on an integrated health approach ('One-Health' initiative) as it recognizes the interrelated nature of both human and animal health. The importance of vector-borne diseases to new and emerging diseases in Europe was demonstrated, for example, by the recent outbreak of West Nile virus infections in Greece, Northern Italy and Hungary; the spread of Crimean-Congo haemorrhagic fever virus across Turkey, south-western countries of the former USSR and the Balkans; the dramatic increase in hantavirus infections in Germany in 2012; and the dengue virus outbreak in Portugal in the same year. This paper provides a systematic approach for the analysis, assessment and governance of emerging health risks attributed to vector-borne diseases by using a holistic approach developed by the International Risk Governance Council (IRGC), called the 'IRGC Risk Governance Framework'. It can be used by decision-makers and general Public Health authorities in order to evaluate the situation regarding any specific pathogen or Public Health risk and to decide if additional measures should be implemented. PMID:23480672

  13. Surveillance of arthropod vector-borne infectious diseases using remote sensing techniques: a review.

    OpenAIRE

    Satya Kalluri; Peter Gilruth; David Rogers; Martha Szczur

    2007-01-01

    Epidemiologists are adopting new remote sensing techniques to study a variety of vector-borne diseases. Associations between satellite-derived environmental variables such as temperature, humidity, and land cover type and vector density are used to identify and characterize vector habitats. The convergence of factors such as the availability of multi-temporal satellite data and georeferenced epidemiological data, collaboration between remote sensing scientists and biologists, and the availabi...

  14. Bifurcation Analysis in Models for Vector-Borne Diseases with Logistic Growth

    OpenAIRE

    Guihua Li; Zhen Jin

    2014-01-01

    We establish and study vector-borne models with logistic and exponential growth of vector and host populations, respectively. We discuss and analyses the existence and stability of equilibria. The model has backward bifurcation and may have no, one, or two positive equilibria when the basic reproduction number R 0 is less than one and one, two, or three endemic equilibria when R 0 is greater than one under different conditions. Furthermore, we prove that the disease-free equilibrium is stable...

  15. Spatial distribution of vector borne disease agents in dogs in Aegean region, Turkey

    OpenAIRE

    Kerem Ural; Mehmet Gultekin; Abidin Atasoy; Bulent Ulutas

    2015-01-01

    ABSTRACTObjective. Assess the spatial distribution of seroprevalence of infection with or exposure to 4 vector-borne pathogens Ehrlichia canis, Anaplasma phagocytophilum, Borrelia burgdorferi and Dirofilaria immitis, across the coastal states of the Aegean region with special reference to clinical signs and haematological variances related to disease condition. Materials and methods. A convenience sample, targeting blood from at least 10 pet dogs from İzmir, Aydin, Denizli, Mugla and Manisa c...

  16. Integrated vector management: a critical strategy for combating vector-borne diseases in South Sudan

    OpenAIRE

    Chanda, Emmanuel; Govere, John M; Macdonald, Michael B.; Lako, Richard L; Haque, Ubydul; Baba, Samson P; Mnzava, Abraham

    2013-01-01

    Background Integrated vector management (IVM) based vector control is encouraged by the World Health Organization (WHO). However, operational experience with the IVM strategy has mostly come from countries with relatively well-established health systems and with malaria control focused programmes. Little is known about deployment of IVM for combating multiple vector-borne diseases in post-emergency settings, where delivery structures are less developed or absent. This manuscript reports on th...

  17. Stability Analysis of a Vector-Borne Disease with Variable Human Population

    OpenAIRE

    Ozair, Muhammad; Lashari, Abid Ali; Jung, Il Hyo; Seo, Young Il; Kim, Byul Nim

    2013-01-01

    A mathematical model of a vector-borne disease involving variable human population is analyzed. The varying population size includes a term for disease-related deaths. Equilibria and stability are determined for the system of ordinary differential equations. If R0≤1, the disease-“free” equilibrium is globally asymptotically stable and the disease always dies out. If R0>1, a unique “endemic” equilibrium is globally asymptotically stable in the interior of feasible region and the disease persis...

  18. [Important vector-borne infectious diseases among humans in Germany. Epidemiological aspects].

    Science.gov (United States)

    Frank, C; Faber, M; Hellenbrand, W; Wilking, H; Stark, K

    2014-05-01

    Vector-borne infections pathogenic to humans play an important role in Germany. The relevant zoonotic pathogens are either endemic throughout Germany (e.g. Borrelia burgdorferi sensu latu) or only in specific regions, e.g. tick-borne encephalitis (TBE) virus and hantavirus. They cause a substantial burden of disease. Prevention and control largely rely on public advice and the application of personal protective measures (e.g. TBE virus vaccination and protection against vectors). High quality surveillance and targeted epidemiological studies are fundamental for the evaluation of temporal and spatial risks of infection and the effectiveness of preventive measures. Aside from endemic pathogens, vector-borne infections acquired abroad, mostly transmitted by mosquitoes, have to be systematically and intensively monitored as well, to assess the risk of infection for German residents traveling abroad and to adequately evaluate the risk of autochthonous transmission. Related issues, such as invasive species of mosquitoes in Germany and climate change, have to be taken into consideration. Such pathogens include West Nile, dengue and chikungunya viruses, as well as malaria parasites (Plasmodium species). The article presents an overview of the epidemiological situation of selected relevant vector-borne infections in Germany. PMID:24781913

  19. Application of three controls optimally in a vector-borne disease - a mathematical study

    Science.gov (United States)

    Kar, T. K.; Jana, Soovoojeet

    2013-10-01

    We have proposed and analyzed a vector-borne disease model with three types of controls for the eradication of the disease. Four different classes for the human population namely susceptible, infected, recovered and vaccinated and two different classes for the vector populations namely susceptible and infected are considered. In the first part of our analysis the disease dynamics are described for fixed controls and some inferences have been drawn regarding the spread of the disease. Next the optimal control problem is formulated and solved considering control parameters as time dependent. Different possible combination of controls are used and their effectiveness are compared by numerical simulation.

  20. On the dynamics of a class of multi-group models for vector-borne diseases

    OpenAIRE

    Iggidr, Abderrahman; Sallet, Gauthier; Souza, Max O.

    2016-01-01

    The resurgence of vector-borne diseases is an increasing public health concern, and there is a need for a better understanding of their dynamics. For a number of diseases, e.g. dengue and chikungunya, this resurgence occurs mostly in urban environments, which are naturally very heterogeneous, particularly due to population circulation. In this scenario, there is an increasing interest in both multi-patch and multi-group models for such diseases. In this work, we study the dynamics of a vector...

  1. A survey of basic reproductive ratios in vector-borne disease transmission modeling

    Science.gov (United States)

    Soewono, E.; Aldila, D.

    2015-03-01

    Vector-borne diseases are commonly known in tropical and subtropical countries. These diseases have contributed to more than 10% of world infectious disease cases. Among the vectors responsible for transmitting the diseases are mosquitoes, ticks, fleas, flies, bugs and worms. Several of the diseases are known to contribute to the increasing threat to human health such as malaria, dengue, filariasis, chikungunya, west nile fever, yellow fever, encephalistis, and anthrax. It is necessary to understand the real process of infection, factors which contribute to the complication of the transmission in order to come up with a good and sound mathematical model. Although it is not easy to simulate the real transmission process of the infection, we could say that almost all models have been developed from the already long known Host-Vector model. It constitutes the main transmission processes i.e. birth, death, infection and recovery. From this simple model, the basic concepts of Disease Free and Endemic Equilibria and Basic Reproductive Ratio can be well explained and understood. Theoretical, modeling, control and treatment aspects of disease transmission problems have then been developed for various related diseases. General construction as well as specific forms of basic reproductive ratios for vector-borne diseases are discusses here.

  2. Age- and bite-structured models for vector-borne diseases

    OpenAIRE

    K.S. Rock; Wood, D A; Keeling, M J

    2015-01-01

    The biology and behaviour of biting insects is a vitally important aspect in the spread of vector-borne diseases. This paper aims to determine, through the use of mathematical models, what effect incorporating vector senescence and realistic feeding patterns has on disease. A novel model is developed to enable the effects of age- and bite-structure to be examined in detail. This original PDE framework extends previous age-structured models into a further dimension to give a new insight into t...

  3. Climate Change, Public Health, and Decision Support: The New Threat of Vector-borne Disease

    Science.gov (United States)

    Grant, F.; Kumar, S.

    2011-12-01

    Climate change and vector-borne diseases constitute a massive threat to human development. It will not be enough to cut emissions of greenhouse gases-the tide of the future has already been established. Climate change and vector-borne diseases are already undermining the world's efforts to reduce extreme poverty. It is in the best interests of the world leaders to think in terms of concerted global actions, but adaptation and mitigation must be accomplished within the context of local community conditions, resources, and needs. Failure to act will continue to consign developed countries to completely avoidable health risks and significant expense. Failure to act will also reduce poorest of the world's population-some 2.6 billion people-to a future of diminished opportunity. Northrop Grumman has taken significant steps forward to develop the tools needed to assess climate change impacts on public health, collect relevant data for decision making, model projections at regional and local levels; and, deliver information and knowledge to local and regional stakeholders. Supporting these tools is an advanced enterprise architecture consisting of high performance computing, GIS visualization, and standards-based architecture. To address current deficiencies in local planning and decision making with respect to regional climate change and its effect on human health, our research is focused on performing a dynamical downscaling with the Weather Research and Forecasting (WRF) model to develop decision aids that translate the regional climate data into actionable information for users. For the present climate WRF was forced with the Max Planck Institute European Center/Hamburg Model version 5 (ECHAM5) General Circulation Model 20th century simulation. For the 21th century climate, we used an ECHAM5 simulation with the Special Report on Emissions (SRES) A1B emissions scenario. WRF was run in nested mode at spatial resolution of 108 km, 36 km and 12 km and 28 vertical levels

  4. Climate Change and Vector Borne Diseases on NASA Langley Research Center

    Science.gov (United States)

    Cole, Stuart K.; DeYoung, Russell J.; Shepanek, Marc A.; Kamel, Ahmed

    2014-01-01

    Increasing global temperature, weather patterns with above average storm intensities, and higher sea levels have been identified as phenomena associated with global climate change. As a causal system, climate change could contribute to vector borne diseases in humans. Vectors of concern originate from the vicinity of Langley Research Center include mosquitos and ticks that transmit disease that originate regionally, nationwide, or from outside the US. Recognizing changing conditions, vector borne diseases propagate under climate change conditions, and understanding the conditions in which they may exist or propagate, presents opportunities for monitoring their progress and mitigating their potential impacts through communication, continued monitoring, and adaptation. Personnel comprise a direct and fundamental support to NASA mission success, continuous and improved understanding of climatic conditions, and the resulting consequence of disease from these conditions, helps to reduce risk in terrestrial space technologies, ground operations, and space research. This research addresses conditions which are attributed to climatic conditions which promote environmental conditions conducive to the increase of disease vectors. This investigation includes evaluation of local mosquito population count and rainfall data for statistical correlation and identification of planning recommendations unique to LaRC, other NASA Centers to assess adaptation approaches, Center-level planning strategies.

  5. An environmental data set for vector-borne disease modeling and epidemiology.

    Science.gov (United States)

    Chabot-Couture, Guillaume; Nigmatulina, Karima; Eckhoff, Philip

    2014-01-01

    Understanding the environmental conditions of disease transmission is important in the study of vector-borne diseases. Low- and middle-income countries bear a significant portion of the disease burden; but data about weather conditions in those countries can be sparse and difficult to reconstruct. Here, we describe methods to assemble high-resolution gridded time series data sets of air temperature, relative humidity, land temperature, and rainfall for such areas; and we test these methods on the island of Madagascar. Air temperature and relative humidity were constructed using statistical interpolation of weather station measurements; the resulting median 95th percentile absolute errors were 2.75°C and 16.6%. Missing pixels from the MODIS11 remote sensing land temperature product were estimated using Fourier decomposition and time-series analysis; thus providing an alternative to the 8-day and 30-day aggregated products. The RFE 2.0 remote sensing rainfall estimator was characterized by comparing it with multiple interpolated rainfall products, and we observed significant differences in temporal and spatial heterogeneity relevant to vector-borne disease modeling. PMID:24755954

  6. An environmental data set for vector-borne disease modeling and epidemiology.

    Directory of Open Access Journals (Sweden)

    Guillaume Chabot-Couture

    Full Text Available Understanding the environmental conditions of disease transmission is important in the study of vector-borne diseases. Low- and middle-income countries bear a significant portion of the disease burden; but data about weather conditions in those countries can be sparse and difficult to reconstruct. Here, we describe methods to assemble high-resolution gridded time series data sets of air temperature, relative humidity, land temperature, and rainfall for such areas; and we test these methods on the island of Madagascar. Air temperature and relative humidity were constructed using statistical interpolation of weather station measurements; the resulting median 95th percentile absolute errors were 2.75°C and 16.6%. Missing pixels from the MODIS11 remote sensing land temperature product were estimated using Fourier decomposition and time-series analysis; thus providing an alternative to the 8-day and 30-day aggregated products. The RFE 2.0 remote sensing rainfall estimator was characterized by comparing it with multiple interpolated rainfall products, and we observed significant differences in temporal and spatial heterogeneity relevant to vector-borne disease modeling.

  7. Vertebrate reservoirs and secondary epidemiological cycles of vector-borne diseases.

    Science.gov (United States)

    Kock, R A

    2015-04-01

    Vector-borne diseases of importance to human and domestic animal health are listed and the increasing emergence of syndromes, new epidemiological cycles and distributions are highlighted. These diseases involve a multitude of vectors and hosts, frequently for the same pathogen, and involve natural enzootic cycles, wild reservoirs and secondary epidemiological cycles, sometimes affecting humans and domestic animals. On occasions the main reservoir is in the domestic environment. Drivers for secondary cycles are mainly related to human impacts and activities and therefore, for purposes of prevention and control, the focus needs to be on the socioecology of the diseases. Technical and therapeutical solutions exist, and for control there needs to be a clear understanding of the main vertebrate hosts or reservoirs and the main vectors. The targets of interventions are usually the vector and/or secondary epidemiological cycles and, in the case of humans and domestic animals, the spillover or incidental hosts are treated. More attention needs to be given to the importance of the political economy in relation to vector-borne diseases, as many key drivers arise from globalisation, climate change and changes in structural ecologies. Attention to reducing the risk of emergence of new infection cycles through better management of the human-animal-environment interface is urgently needed. PMID:26470455

  8. A GEOSPATIAL ANALYSIS OF THE RELATIONSHIP BETWEEN ENVIRONMENTAL DRIVERS AND VECTOR-BORNE DISEASES

    Directory of Open Access Journals (Sweden)

    MARIA IOANA VLAD-ȘANDRU

    2015-10-01

    Full Text Available A Geospatial Analysis of the Relationship between Environmental Drivers and Vector-Borne Diseases. Human health is profoundly affected by weather and climate. Environmental health is becoming a major preoccupation on a world-wide scale; there is a close correlation between a population’s state of health and the quality of its environment, considering many infectious diseases are at least partly dependent on environmental factors. When we talk about the environment, we realize that it includes and affects fields of action from our daily life. Earth observation from space, with validation from in situ observations, provide a greater understanding of the environment and enable us to monitor and predict key environmental phenomena and events that can affect our livelihoods and health. Even thought, the use of Earth observation is growing in usefulness for a wide variety of uses, it is extremely unlikely that Earth Observation will be able to detect infectious diseases directly. Instead, Earth observation can be used to detect high NDVI index (and possibly attribute the high surface chlorophyll concentration to a particular disease, and help predict the movement of the agents carrying vector-borne disease. Many diseases need certain temperature and moisture conditions to breed. The primary objective of analyzing environmental health risk and vulnerabilities is to support the Development Regions to strengthen their capacity to assess, visualize and analyze health risks and incorporate the results of this analysis in a health risk map for disaster risk reduction, emergency preparedness and response plans. At the same time, such an analysis applied in health, allows starting the collection and homogenization of baseline data, information and maps to help health authorities and decision makers to take informed decisions in times of crises. Informational Health Platform would be used for the integration of data coming from different sources in order to

  9. Global warming and the potential spread of vector-borne diseases

    Energy Technology Data Exchange (ETDEWEB)

    Patz, J. [Johns Hopkins School of Hygiene and Public Health, Baltimore, MD (United States). Dept. of Microbiology and Immunology

    1996-12-31

    Climatic factors influence many vector-borne infectious diseases, in addition to demographic, biological, and ecological determinants. The United Nation`s Intergovernmental Panel on Climate Change (IPCC) estimates an unprecedented global rise of 2.0 C by the year 2100. Of major concern is that these changes can affect the spread of many serious infectious diseases, including malaria and dengue fever. Global warming would directly affect disease transmission by shifting the mosquito`s geographic range, increasing reproductive and biting rates, and shortening pathogen incubation period. Human migration and damage to health infrastructures from the projected increase in climate variability and sea level rise could indirectly contribute to disease transmission. A review of this literature, as well as preliminary data from ongoing studies will be presented.

  10. Modelling spread of Bluetongue and other vector borne diseases in Denmark and evaluation of intervention strategies

    DEFF Research Database (Denmark)

    Græsbøll, Kaare

    The main outcome of this PhD project is a generic model for non-contagious infectious vector-borne disease spread by one vector species between up to two species of hosts distributed on farms and pasture. The model features a within-herd model of disease, combined with a triple movement kernel that...... describes spread of disease using vectors or hosts as agents of the spread. The model is run with bluetongue as the primary case study, and it is demonstrated how an epidemic outbreak of bluetongue 8 in Denmark is sensitive to the use of pasture, climate, vaccination, vector abundance, and flying parameters....... In constructing a more process oriented agent-based approach to spread modeling new parameters describing vector behavior were introduced. When these vector flying parameters have been quantified by experiments, this model can be implemented on areas naïve to the modeled disease with a high...

  11. Vector-borne Infections

    Centers for Disease Control (CDC) Podcasts

    2011-04-18

    This podcast discusses emerging vector-borne pathogens, their role as prominent contributors to emerging infectious diseases, how they're spread, and the ineffectiveness of mosquito control methods.  Created: 4/18/2011 by National Center for Emerging Zoonotic and Infectious Diseases (NCEZID).   Date Released: 4/27/2011.

  12. Modeling the spread of vector-borne diseases on bipartite networks.

    Directory of Open Access Journals (Sweden)

    Donal Bisanzio

    Full Text Available BACKGROUND: Vector-borne diseases for which transmission occurs exclusively between vectors and hosts can be modeled as spreading on a bipartite network. METHODOLOGY/PRINCIPAL FINDINGS: In such models the spreading of the disease strongly depends on the degree distribution of the two classes of nodes. It is sufficient for one of the classes to have a scale-free degree distribution with a slow enough decay for the network to have asymptotically vanishing epidemic threshold. Data on the distribution of Ixodes ricinus ticks on mice and lizards from two independent studies are well described by a scale-free distribution compatible with an asymptotically vanishing epidemic threshold. The commonly used negative binomial, instead, cannot describe the right tail of the empirical distribution. CONCLUSIONS/SIGNIFICANCE: The extreme aggregation of vectors on hosts, described by the power-law decay of the degree distribution, makes the epidemic threshold decrease with the size of the network and vanish asymptotically.

  13. Genetic shifting: a novel approach for controlling vector-borne diseases.

    Science.gov (United States)

    Powell, Jeffrey R; Tabachnick, Walter J

    2014-06-01

    Rendering populations of vectors of diseases incapable of transmitting pathogens through genetic methods has long been a goal of vector geneticists. We outline a method to achieve this goal that does not involve the introduction of any new genetic variants to the target population. Rather we propose that shifting the frequencies of naturally occurring alleles that confer refractoriness to transmission can reduce transmission below a sustainable level. The program employs methods successfully used in plant and animal breeding. Because no artificially constructed genetically modified organisms (GMOs) are introduced into the environment, the method is minimally controversial. We use Aedes aegypti and dengue virus (DENV) for illustrative purposes but point out that the proposed program is generally applicable to vector-borne disease control. PMID:24794113

  14. Climate change and the distribution of vector borne diseases with special reference to African horse sickness virus

    International Nuclear Information System (INIS)

    In the context of climate change, those components of climate that are likely to have major effects upon distribution, seasonal incidence and prevalence of vector borne diseases are described. On the basis of a predicted, mean temperature increase of the order of 1 to 3.5 deg. C., examples are given of the sort of changes that are to be expected by using a range of internationally important human and animal pathogens. Recent dramatic alterations in the epidemiology of the OIE List ''A'' disease, African horse sickness, are drawn upon to put forward the proposition that climate change may already be having a major effect upon some vector borne diseases. (author)

  15. The role of Remote Sensing and GIS for spatial prediction of vector-borne diseases transmission: A systematic review

    Directory of Open Access Journals (Sweden)

    M. Palaniyandi

    2012-12-01

    Full Text Available There have been several attemps made to the appreciation of remote sensing and GIS for the study of vectors,biodiversity, vector presence, vector abundance and the vector-borne diseases with respect to space and time.This study was made for reviewing and appraising the potential use of remote sensing and GIS applications forspatial prediction of vector-borne diseases transmission. The nature of the presence and the abundance of vectorsand vector-borne diseases, disease infection and the disease transmission are not ubiquitous and are confined withgeographical, environmental and climatic factors, and are localized. The presence of vectors and vector-bornediseases is most complex in nature, however, it is confined and fueled by the geographical, climatic andenvironmental factors including man-made factors. The usefulness of the present day availability of the informationderived from the satellite data including vegetation indices of canopy cover and its density, soil types, soil moisture,soil texture, soil depth, etc. is integrating the information in the expert GIS engine for the spatial analysis of othergeoclimatic and geoenvironmental variables. The present study gives the detailed information on the classicalstudies of the past and present, and the future role of remote sensing and GIS for the vector-borne diseasescontrol. The ecological modeling directly gives us the relevant information to understand the spatial variation ofthe vector biodiversity, vector presence, vector abundance and the vector-borne diseases in association withgeoclimatic and the environmental variables. The probability map of the geographical distribution and seasonalvariations of horizontal and vertical distribution of vector abundance and its association with vector-borne diseasescan be obtained with low cost remote sensing and GIS tool with reliable data and speed.

  16. Vector-borne Infections

    OpenAIRE

    Rosenberg, Ronald; Ben Beard, C.

    2011-01-01

    Infections with vector-borne pathogens are a major source of emerging diseases. The ability of vectors to bridge spatial and ecologic gaps between animals and humans increases opportunities for emergence. Small adaptations of a pathogen to a vector can have profound effects on the rate of transmission to humans.

  17. Disease-modeling as a tool for surveillance, foresight and control of exotic vector borne diseases in the Nordic countries

    DEFF Research Database (Denmark)

    Bødker, Rene

    partners to generate a truly risk based surveillance system for insect borne diseases. We have also used the R0 models to predict the potential impact of climate change on four selected vector borne disease: Bluetongue in cattle, African Horse Sickness in horses, Dirofilariasis in dogs and Vivax......Modeling the potential transmission intensity of insect borne diseases with climate driven R0 process models is frequently used to assess the potential for veterinary and human infections to become established in non endemic areas. Models are often based on mean temperatures of an arbitrary time...... and agriculture. The practical impact of climate change on human health and agriculture may therefore be greater than simple distribution maps suggest. This presentation will demonstrate the system for selected vector borne diseases, compare the predicted R0 with the actual spread of bluetongue in Scandinavia i...

  18. Remote Sensing the Patterns of Vector-borne Disease in El Nino and non-El Nino Years

    Science.gov (United States)

    Wood, B. L.; Chang, J.; Lobitz, B.; Beck, L.; DAntoni, Hector (Technical Monitor)

    1997-01-01

    The relationship between El Nino and non-El Nino and the patterns of vector-borne disease can be viewed at a variety of spatial and temporal scales. At one extreme are long term predictions of changing precipitation and temperature patterns at continental and global scales. At the opposite extreme are the local or site specific ecological changes associated with the long term events. In order to understand and address the human health consequences of El Nino events, especially the patterns of vector-borne diseases, it is necessary to combine both scales of observation. At a local or regional scale the patterns of vector-borne diseases are determined by temperature, precipitation, and habitat availability. These factors, as well as disease incidence can be altered by El Nino events. Remote sensing data such as that acquired by the NOAA AVHRR and Landsat TM sensors can be used to characterize and monitor changing ecological conditions and therefore predict vector-borne disease patterns. The authors present the results of preliminary work on the analysis of historical AVHRR and TM data acquired during El Nino and nonfatal Nino years to characterize ecological conditions in Peru on a monthly basis. This information will then be combined with disease data to determine the relationship between changes in ecological conditions and disease incidence. Our goal is to produce a sequence of remotely sensed images which can be used to show the ecological and disease patterns associated with long term El Nino events and predictions.

  19. Socio-economic factors influencing control of vector-borne diseases in the pastoralist system of south western Uganda.

    Science.gov (United States)

    Mugisha, Anthony; McLeod, Anni; Percy, Rachel; Kyewalabye, Elizabeth

    2008-05-01

    Research in control of tick-borne diseases and trypanosomosis, and their vectors, namely, ticks and tsetse flies respectively, has been on going for decades. However, very little attention has been paid to the socio-economic factors that are likely to influence the outcome of the interventions in the control of these diseases. Thus, this study was designed to investigate these factors, mainly the intra-household factors influencing decision-making in the control of Vector-borne diseases in the pastoralist areas of Uganda. These factors included: indigenous technical knowledge, household economic factors, and gender. Both qualitative and quantitative methods were used in the collection and analysis of data. The tools used for data collection included among others, participatory learning and action (PLA), and Case studies. The findings included the following: In pastoralist households, a big proportion of the household budget was allocated to vector-borne diseases control. In the male-headed households, men dominated decision-making on vector-borne diseases control, although the goals and priorities of men and women in these households were not the same. Also, vector-borne disease control was predominantly by use of modern veterinary drugs, and pastoralists treated sick cattle by themselves even in situations where there were veterinary personnel. PMID:18557192

  20. Vector-borne diseases on Fire Island, New York (Fire Island National Seashore Science Synthesis Paper)

    Science.gov (United States)

    Ginsberg, H.S.

    2005-01-01

    This paper discusses eleven tick-borne and five mosquito-borne pathogens that are known to occur at FIlS, or could potentially occur. The potential for future occurrence, and ecological factors that influence occurrence, are assessed for each disease. Lyme disease is the most common vector-borne disease on Fire Island. The Lyme spirochete, Borrelia burgdorferi, is endemic in local tick and wildlife populations. Public education, personal precautions against tick bite, and prompt treatment of early-stage infections can help manage the risk of Lyme disease on Fire Island. The pathogens that cause Human Monocytic Ehrlichiosis and Tularemia have been isolated from ticks or wildlife on Fire Island, and conditions suggest that other tickborne diseases (including Babesiosis, Rocky Mountain Spotted Fever, and Human Granulocytic Ehrlichiosis) might also occur, but these are far less common than Lyme disease, if present. West Nile Virus (WNV) is the primary mosquito- borne human pathogen that is known to occur on Fire Island. Ecological conditions and recent epizootiological events suggest that WNV occurs in foci that can shift from year to year. Therefore, a surveillance program with appropriate responses to increasing epizootic activity can help manage the risk of WNV transmission on Fire Island.

  1. Improving the diagnosis and control of trypanosomiasis and other vector-borne diseases of African livestock using immunoassay methods

    International Nuclear Information System (INIS)

    This publication contains the results presented by the participants of the Co-ordinated Research Programme (CRP) on improving the diagnosis and control of trypanosomiasis and other vector-borne diseases of African livestock using immunoassay methods. The CRP lasted from 1987 until 1992. The individual contributions have been indexed separately. Refs, figs and tabs

  2. Prototype early warning systems for vector-borne diseases in Europe.

    Science.gov (United States)

    Semenza, Jan C

    2015-06-01

    Globalization and environmental change, social and demographic determinants and health system capacity are significant drivers of infectious diseases which can also act as epidemic precursors. Thus, monitoring changes in these drivers can help anticipate, or even forecast, an upsurge of infectious diseases. The European Environment and Epidemiology (E3) Network has been built for this purpose and applied to three early warning case studies: (1) The environmental suitability of malaria transmission in Greece was mapped in order to target epidemiological and entomological surveillance and vector control activities. Malaria transmission in these areas was interrupted in 2013 through such integrated preparedness and response activities. (2) Since 2010, recurrent West Nile fever outbreaks have ensued in South/eastern Europe. Temperature deviations from a thirty year average proved to be associated with the 2010 outbreak. Drivers of subsequent outbreaks were computed through multivariate logistic regression models and included monthly temperature anomalies for July and a normalized water index. (3) Dengue is a tropical disease but sustained transmission has recently emerged in Madeira. Autochthonous transmission has also occurred repeatedly in France and in Croatia mainly due to travel importation. The risk of dengue importation into Europe in 2010 was computed with the volume of international travelers from dengue affected areas worldwide.These prototype early warning systems indicate that monitoring drivers of infectious diseases can help predict vector-borne disease threats. PMID:26042370

  3. Prototype Early Warning Systems for Vector-Borne Diseases in Europe

    Directory of Open Access Journals (Sweden)

    Jan C. Semenza

    2015-06-01

    Full Text Available Globalization and environmental change, social and demographic determinants and health system capacity are significant drivers of infectious diseases which can also act as epidemic precursors. Thus, monitoring changes in these drivers can help anticipate, or even forecast, an upsurge of infectious diseases. The European Environment and Epidemiology (E3 Network has been built for this purpose and applied to three early warning case studies: (1 The environmental suitability of malaria transmission in Greece was mapped in order to target epidemiological and entomological surveillance and vector control activities. Malaria transmission in these areas was interrupted in 2013 through such integrated preparedness and response activities. (2 Since 2010, recurrent West Nile fever outbreaks have ensued in South/eastern Europe. Temperature deviations from a thirty year average proved to be associated with the 2010 outbreak. Drivers of subsequent outbreaks were computed through multivariate logistic regression models and included monthly temperature anomalies for July and a normalized water index. (3 Dengue is a tropical disease but sustained transmission has recently emerged in Madeira. Autochthonous transmission has also occurred repeatedly in France and in Croatia mainly due to travel importation. The risk of dengue importation into Europe in 2010 was computed with the volume of international travelers from dengue affected areas worldwide.These prototype early warning systems indicate that monitoring drivers of infectious diseases can help predict vector-borne disease threats.

  4. Incidence of Vector-borne Disease and Climate Change: A Study in Semi-arid Algeria

    Science.gov (United States)

    Blakey, T.; Bounoua, L.

    2012-12-01

    Leishmaniases are among the most important emerging and resurging vector-borne diseases, second only to malaria in terms of the number of affected people. Leishmaniases are endemic in 88 countries worldwide and threaten about 350 million people (WHO, 2007). Since the first reported case of zoonotic cutaneous leishmaniasis (ZCL) in Saida, Algeria in 1991, 1,275 cases have been recorded (Makhlouf & Houti, 2010) with the vast majority of study-area cases (99%) reported between the years of 2000 and 2009. An investigation of potential climatic indicators for the apparent shift in disease prevalence was conducted by comparing anomalies in the climate data specific to the local pathogen cycle. It was determined that long term climate trends have resulted in conditions that promote the prevalence of ZCL. Increased precipitation have resulted in greater vegetation and promoted host and vector population growth through a trophic cascade. Increased minimum temperatures have lengthened the annual duration of sandfly activity. Short term variations in maximum temperatures, however show a correlation with disease suppression in the subsequent years. These findings indicate a potential to forecast the risk of ZCL infection through models of the trophic cascade and sandfly population growth.

  5. An epidemic model of a vector-borne disease with direct transmission and time delay

    Science.gov (United States)

    Wei, Hui-Ming; Li, Xue-Zhi; Martcheva, Maia

    2008-06-01

    This paper considers an epidemic model of a vector-borne disease which has direct mode of transmission in addition to the vector-mediated transmission. The incidence term is assumed to be of the bilinear mass-action form. We include both a baseline ODE version of the model, and, a differential-delay model with a discrete time delay. The ODE model shows that the dynamics is completely determined by the basic reproduction number R0. If R0[less-than-or-equals, slant]1, the disease-free equilibrium is globally stable and the disease dies out. If R0>1, a unique endemic equilibrium exists and is locally asymptotically stable in the interior of the feasible region. The delay in the differential-delay model accounts for the incubation time the vectors need to become infectious. We study the effect of that delay on the stability of the equilibria. We show that the introduction of a time delay in the host-to-vector transmission term can destabilize the system and periodic solutions can arise through Hopf bifurcation.

  6. Recent Weather Extremes and Impacts on Agricultural Production and Vector-Borne Disease Outbreak Patterns

    Science.gov (United States)

    Anyamba, Assaf; Small, Jennifer L.; Britch, Seth C.; Tucker, Compton J.; Pak, Edwin W.; Reynolds, Curt A.; Crutchfield, James; Linthicum, Kenneth J.

    2014-01-01

    We document significant worldwide weather anomalies that affected agriculture and vector-borne disease outbreaks during the 2010-2012 period. We utilized 2000-2012 vegetation index and land surface temperature data from NASA's satellite-based Moderate Resolution Imaging Spectroradiometer (MODIS) to map the magnitude and extent of these anomalies for diverse regions including the continental United States, Russia, East Africa, Southern Africa, and Australia. We demonstrate that shifts in temperature and/or precipitation have significant impacts on vegetation patterns with attendant consequences for agriculture and public health. Weather extremes resulted in excessive rainfall and flooding as well as severe drought, which caused,10 to 80% variation in major agricultural commodity production (including wheat, corn, cotton, sorghum) and created exceptional conditions for extensive mosquito-borne disease outbreaks of dengue, Rift Valley fever, Murray Valley encephalitis, and West Nile virus disease. Analysis of MODIS data provided a standardized method for quantifying the extreme weather anomalies observed during this period. Assessments of land surface conditions from satellite-based systems such as MODIS can be a valuable tool in national, regional, and global weather impact determinations.

  7. Environmental change and water-related, vector borne diseases in eastern Africa: the HEALTHY FUTURES project

    Science.gov (United States)

    Taylor, David; Kienberger, Stefan; Tompkins, Adrian

    2015-04-01

    Pathogens that spend time outside the human body, and any organisms involved in their transmission, have particular ecological requirements; as environment, including climate, conditions change, then the transmission characteristics of associated pathogens - and the diseases caused - are also likely to vary. Relationships between environment and health in many parts of the world remain poorly studied and are often overlooked, however. This is particularly the case in developing countries, because of budgetary and available expertise constraints. Moreover the relationship is often confounded by other factors. These other factors contribute to human vulnerability, and thus to the overall disease risk due to environmental change. This presentation will highlight the importance of environmental, including climate, change information to a better understanding of the risks to health of projected future environmental changes, and to the more efficient and effective use of scarce health resources in the developing world. The paper will focus on eastern Africa, and in particular the health effects of future projected environmental change impacts on water-related, vector borne diseases in the East African Community region. Moreover the paper will highlight how the EU FP7-funded project HEALTHY FUTURES is, through a broadly-based, integrative approach that distinguishes environmental change-induced health hazard from health risk aims to support the health decisions making process, thereby attempting to help mitigate negative health impacts.

  8. Modeling vector-borne disease risk in migratory animals under climate change.

    Science.gov (United States)

    Hall, Richard J; Brown, Leone M; Altizer, Sonia

    2016-08-01

    Recent theory suggests that animals that migrate to breed at higher latitudes may benefit from reduced pressure from natural enemies, including pathogens ("migratory escape"), and that migration itself weeds out infected individuals and lowers infection prevalence ("migratory culling"). The distribution and activity period of arthropod disease vectors in temperate regions is expected to respond rapidly to climate change, which could reduce the potential for migratory escape. However, climate change could have the opposite effect of reducing transmission if differential responses in the phenology and distribution of migrants and disease vectors reduce their overlap in space and time. Here we outline a simple modeling framework for exploring the influence of climate change on vector-borne disease dynamics in a migratory host. We investigate two scenarios under which pathogen transmission dynamics might be mediated by climate change: (1) vectors respond more rapidly than migrants to advancing phenology at temperate breeding sites, causing peak susceptible host density and vector emergence to diverge ("migratory mismatch") and (2) reduced migratory propensity allows increased nonbreeding survival of infected hosts and larger breeding-site epidemics (loss of migratory culling, here referred to as "sedentary amplification"). Our results highlight the need for continued surveillance of climate-induced changes to migratory behavior and vector activity to predict pathogen prevalence and its impacts on migratory animals. PMID:27252225

  9. Predictiveness of Disease Risk in a Global Outreach Tourist Setting in Thailand Using Meteorological Data and Vector-Borne Disease Incidences

    OpenAIRE

    Suwannapa Ninphanomchai; Chitti Chansang; Yien Ling Hii; Joacim Rocklöv; Pattamaporn Kittayapong

    2014-01-01

    Dengue and malaria are vector-borne diseases and major public health problems worldwide. Changes in climatic factors influence incidences of these diseases. The objective of this study was to investigate the relationship between vector-borne disease incidences and meteorological data, and hence to predict disease risk in a global outreach tourist setting. The retrospective data of dengue and malaria incidences together with local meteorological factors (temperature, rainfall, humidity) regist...

  10. Epidemic dynamics of a vector-borne disease on a village-and-city star network with commuters

    OpenAIRE

    Mpolya, E.A.; Yashima, K; Ohtsuki, H; Sasaki, A.

    2013-01-01

    We develop a star-network of connections between a central city and peripheral villages and analyze the epidemic dynamics of a vector-borne disease as influenced by daily commuters. We obtain an analytical solution for the global basic reproductive number R0 and investigate its dependence on key parameters for disease control. We find that in a star-network topology the central hub is not always the best place to focus disease intervention strategies. Disease control decisions are sensitive t...

  11. Integrated pest management and allocation of control efforts for vector-borne diseases

    Science.gov (United States)

    Ginsberg, H.S.

    2001-01-01

    Applications of various control methods were evaluated to determine how to integrate methods so as to minimize the number of human cases of vector-borne diseases. These diseases can be controlled by lowering the number of vector-human contacts (e.g., by pesticide applications or use of repellents), or by lowering the proportion of vectors infected with pathogens (e.g., by lowering or vaccinating reservoir host populations). Control methods should be combined in such a way as to most efficiently lower the probability of human encounter with an infected vector. Simulations using a simple probabilistic model of pathogen transmission suggest that the most efficient way to integrate different control methods is to combine methods that have the same effect (e.g., combine treatments that lower the vector population; or combine treatments that lower pathogen prevalence in vectors). Combining techniques that have different effects (e.g., a technique that lowers vector populations with a technique that lowers pathogen prevalence in vectors) will be less efficient than combining two techniques that both lower vector populations or combining two techniques that both lower pathogen prevalence, costs being the same. Costs of alternative control methods generally differ, so the efficiency of various combinations at lowering human contact with infected vectors should be estimated at available funding levels. Data should be collected from initial trials to improve the effects of subsequent interventions on the number of human cases.

  12. Vector-borne parasitic diseases--an overview of recent changes.

    Science.gov (United States)

    Molyneux, D H

    1998-06-01

    This paper summarises the impact of different changes (environmental, ecological, developmental) on the one hand, with the impact of control measures on the other. The former group of changes have tended to exacerbate the incidence and prevalence of vector-borne parasitic diseases while the reduced public funds available for the health sector have reduced disease surveillance systems. However, some vector control/eradication programmes have been successful. Vector control in onchocerciasis and Chagas' disease and immediate host control in Guinea worm have reduced the public health importance of these disease. This contrasts, with malaria, where the complexity of different ecological situations and the variable vector ecology have made control difficult and epidemics frequent and unpredictable. Advances in our knowledge of how to implement and sustain insecticide-impregnated bednets which reduce morbidity and mortality in under 5-year olds will be a key issue for the coming years. In African trypanosomiasis and leishmaniasis, where control is dependent on effective diagnosis and surveillance followed by high-cost drug treatment, the health services are faced with major challenges--lack of drug availability and diagnostics no vector control--the diseases in some areas assuming epidemic status yet health services are unable to respond. Human African trypanosomiasis and visceral leishmaniasis are fatal if untreated, and require an emergency response approach. Changing vector distribution of Glossina is related to the ability of riverine flies of Glossina palpalis group to adapt to new vegetation patterns. In leishmaniasis changes have occurred in the distribution of the disease associated with development impact, urbanisation, civil unrest and changed agroforestry practice. PMID:9673871

  13. R0-modeling as a tool for early warning and surveillance of exotic vector borne diseases in Denmark

    DEFF Research Database (Denmark)

    Bødker, Rene

    2011-01-01

    Modeling the potential transmission intensity of insect borne diseases with climate driven R0 process models is frequently used to assess the potential for veterinary and human infections to become established in non endemic areas. Models are often based on mean temperatures of an arbitrary time...... risk assessment of potential local spread of exotic insect borne diseases of veterinary and human importance. R0 models for various vector borne diseases are continuously updated with spatial temperature data to quantify the present risk of autochthonous cases (R0>0) and the present risk of epidemics...... a truly risk based surveillance system for insect borne diseases. R0 models for many vector borne diseases are simple and the available estimates of model parameters like vector densities and survival rates may be uncertain. The quantitative value of R0 estimated from such models is therefore likely...

  14. R0-modeling as a tool for early warning and surveillance of exotic vector borne diseases in Denmark

    DEFF Research Database (Denmark)

    Bødker, Rene; Kristensen, Birgit; Græsbøll, Kaare; Kirkeby, Carsten; Stockmarr, Anders

    local spread of exotic insect borne diseases of veterinary and human importance. R0 models for various vector borne diseases are continuously updated with spatial temperature data to quantify the present risk of autochthonous cases (R0>0) and the present risk of epidemics (R0>1) in case an infected...... system for insect borne diseases. R0 models for many vector borne diseases are simple and the available estimates of model parameters like vector densities and survival rates may be uncertain. The quantitative value of R0 estimated from such models is therefore likely to deviate from the true R0. However......Modelling the potential transmission intensity of insect borne diseases with climate driven R0 process models is frequently used to assess the potential for veterinary and human infections to become established in non endemic areas. Models are often based on mean temperatures of an arbitrary time...

  15. Spatial cognition: a geospatial analysis of vector borne disease transmission and the environment, using remote sensing and GIS

    Directory of Open Access Journals (Sweden)

    M.Palaniyandi

    2014-09-01

    Full Text Available The prevalence of geographical distribution of vector borne diseases has been increasingly public health important and challenging problems in more than 100 tropical countries and it has been affecting more than 50% of the population in the world, especially, it is very big problem in India. The change of vector borne disease epidemic transmission in to the endemic situation in the country has been caused by the land use / land cover changes, regional climate changes, increase of sea change population, urban agglomeration, industrial development and the past development of towns, consequently, the disease epidemics have been steadily increased too, and, besides, it has been found ubiquitous, such diseases known as, malaria, filariasis, JE, dengue and chikungunya, as a result, the increase of both mosquito nuisances and disease transmissions has become public health importance and very big challenging problems in India.

  16. Serological investigation of vector-borne disease in dogs from rural areas of China

    Directory of Open Access Journals (Sweden)

    Shiwen Wang

    2012-02-01

    Conclusions: It can be concluded that IFA method was more sensitive than ELISA rapid diagnostic method. However, we need conduct further and intensive epidemiology survey on tick-born diseases pathogens including A. phagocytophilum, E. canis, D. immitis (canine heartworm, and B. burgdorferi which have public health significance.

  17. Understanding uncertainty in temperature effects on vector-borne disease: a Bayesian approach

    Science.gov (United States)

    Johnson, Leah R.; Ben-Horin, Tal; Lafferty, Kevin D.; McNally, Amy; Mordecai, Erin A.; Paaijmans, Krijn P.; Pawar, Samraat; Ryan, Sadie J.

    2015-01-01

    Extrinsic environmental factors influence the distribution and population dynamics of many organisms, including insects that are of concern for human health and agriculture. This is particularly true for vector-borne infectious diseases like malaria, which is a major source of morbidity and mortality in humans. Understanding the mechanistic links between environment and population processes for these diseases is key to predicting the consequences of climate change on transmission and for developing effective interventions. An important measure of the intensity of disease transmission is the reproductive number R0. However, understanding the mechanisms linking R0 and temperature, an environmental factor driving disease risk, can be challenging because the data available for parameterization are often poor. To address this, we show how a Bayesian approach can help identify critical uncertainties in components of R0 and how this uncertainty is propagated into the estimate of R0. Most notably, we find that different parameters dominate the uncertainty at different temperature regimes: bite rate from 15°C to 25°C; fecundity across all temperatures, but especially ~25–32°C; mortality from 20°C to 30°C; parasite development rate at ~15–16°C and again at ~33–35°C. Focusing empirical studies on these parameters and corresponding temperature ranges would be the most efficient way to improve estimates of R0. While we focus on malaria, our methods apply to improving process-based models more generally, including epidemiological, physiological niche, and species distribution models.

  18. Advanced megaesophagus (Group III) secondary to vector-borne Chagas disease in a 20-month-old infant

    OpenAIRE

    Anis Rassi; Joffre Marcondes de Rezende; Anis Rassi Junior

    2012-01-01

    The authors report the case of a female infant with Group III (or Grade III) megaesophagus secondary to vector-borne Chagas disease, resulting in severe malnutrition that reversed after surgery (Heller technique). The infant was then treated with the antiparasitic drug benznidazole, and the infection was cured, as demonstrated serologically and parasitologically. After follow-up of several years without evidence of disease, with satisfactory weight and height development, the patient had her ...

  19. Stability and Hopf Bifurcation Analysis of a Vector-Borne Disease with Time Delay

    OpenAIRE

    Yuanyuan Chen; Ya-Qing Bi

    2014-01-01

    A delay-differential modelling of vector-borne is investigated. Its dynamics are studied in terms of local analysis and Hopf bifurcation theory, and its linear stability and Hopf bifurcation are demonstrated by studying the characteristic equation. The stability and direction of Hopf bifurcation are determined by applying the normal form theory and the center manifold argument.

  20. Potential for a Second Generation of Emerging Vector Borne Diseases in North America

    Science.gov (United States)

    North America has been dealing with the consequences of the introduction of West Nile virus since it was first discovered in New York City in 1999. Currently there are numerous other vector-borne pathogens that occur in various parts of the world that could be introduced into North America and becom...

  1. Operational vector-borne disease surveillance and control: closing the capabilities gap through research at overseas military laboratories.

    Science.gov (United States)

    Evans, Brian P; Clark, Jeffrey W; Barbara, Kathryn A; Mundal, Kirk D; Furman, Barry D; McAvin, James C; Richardson, Jason H

    2009-01-01

    Malaria, dengue fever, chikungunya virus, leishmaniasis, and a myriad of other vector-borne diseases pose significant threats to the warfighter and to the overall combat effectiveness of units. Military preventive medicine (PM) assets must accurately evaluate the vector-borne disease threat and then implement and/or advise the commander on countermeasures to reduce a particular threat. The success of these measures is contingent upon the biology of the disease vector and on the tools or methods used to conduct vector/pathogen surveillance and vector control. There is a significant gap between the tools available and those required for operational PM assets to provide real-time, effective surveillance and control. A network of US Army and US Navy overseas laboratories is focused on closing the current capabilities gap. Their mission is to develop and field test tools and methods to enhance the combatant commander's ability to identify and mitigate the threat posed by these vector-borne diseases. PMID:20084734

  2. Climate change and spatiotemporal distributions of vector-borne diseases in Nepal : a systematic synthesis of literature

    OpenAIRE

    Dhimal, Meghnath; Ahrens, Bodo; Kuch, Ulrich

    2015-01-01

    Background: Despite its largely mountainous terrain for which this Himalayan country is a popular tourist destination, Nepal is now endemic for five major vector-borne diseases (VBDs), namely malaria, lymphatic filariasis, Japanese encephalitis, visceral leishmaniasis and dengue fever. There is increasing evidence about the impacts of climate change on VBDs especially in tropical highlands and temperate regions. Our aim is to explore whether the observed spatiotemporal distributions of VBDs i...

  3. Climate change could threaten blood supply by altering the distribution of vector-borne disease: an Australian case-study

    OpenAIRE

    Hilary J. Bambrick; Woodruff, Rosalie E.; Hanigan, Ivan C

    2009-01-01

    Background: Climate change is expected to promote more intense and prolonged outbreaks of vector-borne disease, and alter the geographic boundaries of transmission. This has implications for the safety and supply of fresh blood products around the world. In Australia, a recent outbreak of dengue fever caused a prolonged regional shortage in the supply of fresh blood products. Objective: To highlight the potential for climate change to affect the safety and supply of blood globally through its...

  4. Assessing the Effects of Climate and Socioeconomic Factors on Vulnerability to Vector-Borne Diseases in Latin America

    OpenAIRE

    García Ayala, Rodrigo; Estrugo, Andrés

    2014-01-01

    Climate change is imposing a large burden on the most vulnerable populations, particularly in the developing world. Establishing consistent causal relationships, however, is difficult because a multiplicity of climatic, economic and sociodemographic elements are combined to create the conditions for an outbreak of vector-borne disease. Based on a two-step procedure, this paper presents and tests an approach to estimating the effects of epidemic outbreaks on health vulnerability. The model pro...

  5. Behind the scene, something else is pulling the strings : emphasizing parasitic manipulation in vector-borne diseases

    OpenAIRE

    Lefèvre, Thierry; F. Thomas

    2008-01-01

    Merging the field of epidemiology with those of evolutionary and behavioural ecology can generate considerable fundamental knowledge, as well as help to guide public health policies. An attempt is made here to integrate these disciplines by focusing on parasitic manipulation in vector-borne diseases. Parasitic manipulation is a fascinating strategy of transmission which occurs when a parasite alters phenotypic trait(s) of its host in a way that enhances its probability of transmission. Vector...

  6. Climate change could threaten blood supply by altering the distribution of vector-borne disease: an Australian case-study

    OpenAIRE

    Hilary J. Bambrick; Woodruff, Rosalie E.; Hanigan, Ivan C

    2009-01-01

    Background Climate change is expected to promote more intense and prolonged outbreaks of vector-borne disease, and alter the geographic boundaries of transmission. This has implications for the safety and supply of fresh blood products around the world. In Australia, a recent outbreak of dengue fever caused a prolonged regional shortage in the supply of fresh blood products. Objective To highlight the potential for climate change to affect the safety and supply of blood globally through its i...

  7. Predators indirectly control vector-borne disease: linking predator–prey and host–pathogen models

    OpenAIRE

    Moore, Sean M.; Borer, Elizabeth T.; Hosseini, Parviez R.

    2009-01-01

    Pathogens transmitted by arthropod vectors are common in human populations, agricultural systems and natural communities. Transmission of these vector-borne pathogens depends on the population dynamics of the vector species as well as its interactions with other species within the community. In particular, predation may be sufficient to control pathogen prevalence indirectly via the vector. To examine the indirect effect of predators on vectored-pathogen dynamics, we developed a theoretical m...

  8. Serological investigation of vector-borne disease in dogs from rural areas of China

    Institute of Scientific and Technical Information of China (English)

    Shiwen Wang; Jing He; Lijuan Zhang

    2012-01-01

    Objective:To evaluate the Anaplasma phagocytophilum (A. phagocytophilum), Ehrlichia canis (E. canis), Dirofilaria immitis (D. immitis) (canine heartworm), Borrelia burgdorferi (B. burgdorferi) infections in countryside dogs from Yunnan, Hainan and Anhui provinces. Methods: Serum samples were collected from 26 dogs in Yunnan, Hainan and Anhui provinces. The samples were tested using a commercial ELISA rapid diagnostic assay kit (SNAP® 4Dx®; IDEXX Laboratories, Inc. U.S.A.). Meanwhile, indirect immunofluorescence assay (IFA) recommended by WHO was conducted to detect IgG to A. phagocytophilum. Two methods were analyzed and compared. Results: The number of serologically positive dogs for IgG to A. phagocytophilum was only 2 which was from Hainan province and none of the 26 dogs responded positive for E. canis, D. immitis (canine heartworm), and B. burgdorferi by ELISA rapid diagnostic method. The number of serologically positive dogs for IgG to A. phagocytophilum was 13 (50%) by IFA method. Data of the two methods were analyzed by statistical software and the difference was statistically significant (P=0.002). Conclusions: It can be concluded that IFA method was more sensitive than ELISA rapid diagnostic method. However, we need conduct further and intensive epidemiology survey on tick-born diseases pathogens including A. phagocytophilum, E. canis, D. immitis (canine heartworm), and B. burgdorferi which have public health significance.

  9. Advanced megaesophagus (Group III secondary to vector-borne Chagas disease in a 20-month-old infant

    Directory of Open Access Journals (Sweden)

    Anis Rassi

    2012-04-01

    Full Text Available The authors report the case of a female infant with Group III (or Grade III megaesophagus secondary to vector-borne Chagas disease, resulting in severe malnutrition that reversed after surgery (Heller technique. The infant was then treated with the antiparasitic drug benznidazole, and the infection was cured, as demonstrated serologically and parasitologically. After follow-up of several years without evidence of disease, with satisfactory weight and height development, the patient had her first child at age 23, in whom serological tests for Chagas disease yielded negative results. Thirty years after the initial examination, the patient's electrocardiogram, echocardiogram, and chest radiography remained normal.

  10. Pre-travel advice concerning vector-borne diseases received by travelers prior to visiting Cuzco, Peru.

    Science.gov (United States)

    Mejia, Christian R; Centeno, Emperatriz; Cruz, Briggitte; Cvetkovic-Vega, Aleksandar; Delgado, Edison; Rodriguez-Morales, Alfonso J

    2016-01-01

    Peru is an increasingly popular tourist destination that poses a risk to travelers due to endemic vector-borne diseases (VBDs). The objective of our study was to determine which factors are associated with receiving pre-travel advice (PTA) for VBDs among travelers visiting Cuzco, Peru. A cross-sectional secondary analysis based on data from a survey among travelers departing Cuzco at Alejandro Velazco Astete International Airport during the period January-March 2012 was conducted. From the 1819 travelers included in the original study, 1717 were included in secondary data analysis. Of these participants, 42.2% received PTA and 2.9% were informed about vector-borne diseases, including yellow fever (1.8%), malaria (1.6%) and dengue fever (0.1%). Receiving information on VBDs was associated with visiting areas endemic to yellow fever and dengue fever in Peru. The only disease travelers received specific recommendations for before visiting an endemic area for was yellow fever. Only 1 in 30 tourists received information on VBD prevention; few of those who traveled to an endemic area were warned about specific risks for infectious diseases prior to their trip. These important findings show that most tourists who travel to Peru do not receive PTA for the prevention of infectious and VBD, which can affect not only the travelers but their countries of origin as well. PMID:26751818

  11. Prevalence of select vector-borne disease agents in owned dogs of Ghana

    Directory of Open Access Journals (Sweden)

    Lorelei L. Clarke

    2014-02-01

    Full Text Available Ticks, sera and ethylenediaminetetraacetic acid (EDTA blood were collected from dogs evaluated at the Amakom Veterinary Clinic in Kumasi, Ghana. Sera were evaluated for Dirofilaria immitis antigen and antibodies against Borrelia burgdorferi, Anaplasma phagocytophilum and Ehrlichia canis. Conventional polymerase chain reaction assays designed to amplify the deoxyribonucleic acid (DNA ofEhrlichia spp. or Anaplasma spp. or Neorickettsia spp. or Wolbachia spp., Babesia spp., Rickettsia spp., Hepatozoon spp., Bartonella spp. and the haemoplasmas were performed on DNA extracted from EDTA blood and all positive amplicons were sequenced. This small survey shows that the following vector-borne pathogens are present in urban Ghanian dogs: Ehrlichia canis, Hepatozoon canis,Dirofilaria immitis and Anaplasma platys. Bartonella henselae was isolated from ticks but not from the dogs.

  12. Impact of climate change upon vector born diseases in Europe and Africa using ENSEMBLES Regional Climate Models

    Science.gov (United States)

    Caminade, Cyril; Morse, Andy

    2010-05-01

    Climate variability is an important component in determining the incidence of a number of diseases with significant human/animal health and socioeconomic impacts. The most important diseases affecting health are vector-borne, such as malaria, Rift Valley Fever and including those that are tick borne, with over 3 billion of the world population at risk. Malaria alone is responsible for at least one million deaths annually, with 80% of malaria deaths occurring in sub-Saharan Africa. The climate has a large impact upon the incidence of vector-borne diseases; directly via the development rates and survival of both the pathogen and the vector, and indirectly through changes in the environmental conditions. A large ensemble of regional climate model simulations has been produced within the ENSEMBLES project framework for both the European and African continent. This work will present recent progress in human and animal disease modelling, based on high resolution climate observations and regional climate simulations. Preliminary results will be given as an illustration, including the impact of climate change upon bluetongue (disease affecting the cattle) over Europe and upon malaria and Rift Valley Fever over Africa. Malaria scenarios based on RCM ensemble simulations have been produced for West Africa. These simulations have been carried out using the Liverpool Malaria Model. Future projections highlight that the malaria incidence decreases at the northern edge of the Sahel and that the epidemic belt is shifted southward in autumn. This could lead to significant public health problems in the future as the demography is expected to dramatically rise over Africa for the 21st century.

  13. Vector-borne disease surveillance in livestock populations: a critical review of literature recommendations and implemented surveillance (BTV-8) in five European countries

    DEFF Research Database (Denmark)

    Dórea, Fernanda C.; Elbers, Armin R.W.; Hendrikx, Pascal;

    2016-01-01

    Preparedness against vector-borne threats depends on the existence of a long-term, sustainable surveillance of vector-borne disease and their relevant vectors. This work reviewed the availability of such surveillance systems in five European countries (Denmark, France, The Netherlands, Sweden...... and United Kingdom, part of the CoVetLab network). A qualitative assessment was then performed focusing on surveillance directed particularly to BTV-8. Information regarding surveillance activities were reviewed for the years 2008 and 2012. The results were then complemented with a critical scoping review...... of the literature aimed at identifying disease surveillance strategies and methods that are currently suggested as best suited to target vector-borne diseases in order to guide future development of surveillance in the countries in question. Passive surveillance was found to be efficient for early detection...

  14. Development and Validation of Remote Sensing-Based Surface Inundation Products for Vector-Borne Disease Risk in East Africa

    Science.gov (United States)

    Jensen, K.; McDonald, K. C.; Ceccato, P.; Schroeder, R.; Podest, E.

    2014-12-01

    The potential impact of climate variability and change on the spread of infectious disease is of increasingly critical concern to public health. Newly-available remote sensing datasets may be combined with predictive modeling to develop new capabilities to mitigate risks of vector-borne diseases such as malaria, leishmaniasis, and rift valley fever. We have developed improved remote sensing-based products for monitoring water bodies and inundation dynamics that have potential utility for improving risk forecasts of vector-borne disease epidemics. These products include daily and seasonal surface inundation based on the global mappings of inundated area fraction derived at the 25-km scale from active and passive microwave instruments ERS, QuikSCAT, ASCAT, and SSM/I data - the Satellite Water Microwave Product Series (SWAMPS). Focusing on the East African region, we present validation of this product using multi-temporal classification of inundated areas in this region derived from high resolution PALSAR (100m) and Landsat (30m) observations. We assess historical occurrence of malaria in the east African country of Eritrea with respect to the time series SWAMPS datasets, and we aim to construct a framework for use of these new datasets to improve prediction of future malaria risk in this region. This work is supported through funding from the NASA Applied Sciences Program, the NASA Terrestrial Ecology Program, and the NASA Making Earth System Data Records for Use in Research Environments (MEaSUREs) Program. This study is also supported and monitored by National Oceanic and Atmospheric Administration (NOAA) under Grant - CREST Grant # NA11SEC4810004. The statements contained within the manuscript/research article are not the opinions of the funding agency or the U.S. government, but reflect the authors' opinions. This work was conducted in part under the framework of the ALOS Kyoto and Carbon Initiative. ALOS PALSAR data were provided by JAXA EORC.

  15. Spatial Risk Assessments Based on Vector-Borne Disease Epidemiologic Data: Importance of Scale for West Nile Virus Disease in Colorado

    OpenAIRE

    Winters, Anna M.; EISEN, REBECCA J.; Delorey, Mark J.; Fischer, Marc; Roger S. Nasci; Zielinski-Gutierrez, Emily; Moore, Chester G.; Pape, W. John; Eisen, Lars

    2010-01-01

    We used epidemiologic data for human West Nile virus (WNV) disease in Colorado from 2003 and 2007 to determine 1) the degree to which estimates of vector-borne disease occurrence is influenced by spatial scale of data aggregation (county versus census tract), and 2) the extent of concordance between spatial risk patterns based on case counts versus incidence. Statistical analyses showed that county, compared with census tract, accounted for approximately 50% of the overall variance in WNV dis...

  16. Influence of vectors' risk-spreading strategies and environmental stochasticity on the epidemiology and evolution of vector-borne diseases: the example of chagas' disease.

    OpenAIRE

    Pelosse, Perrine; Kribs-Zaleta, Christopher M.; Ginoux, Marine; Rabinovich, Jorge E; Gourbière, Sébastien; Menu, Frédéric

    2013-01-01

    Insects are known to display strategies that spread the risk of encountering unfavorable conditions, thereby decreasing the extinction probability of genetic lineages in unpredictable environments. To what extent these strategies influence the epidemiology and evolution of vector-borne diseases in stochastic environments is largely unknown. In triatomines, the vectors of the parasite Trypanosoma cruzi, the etiological agent of Chagas' disease, juvenile development time varies between individu...

  17. Schools as Potential Risk Sites for Vector-Borne Disease Transmission: Mosquito Vectors in Rural Schools in Two Municipalities in Colombia.

    Science.gov (United States)

    Olano, Víctor Alberto; Matiz, María Inés; Lenhart, Audrey; Cabezas, Laura; Vargas, Sandra Lucía; Jaramillo, Juan Felipe; Sarmiento, Diana; Alexander, Neal; Stenström, Thor Axel; Overgaard, Hans J

    2015-09-01

    Dengue and other vector-borne diseases are of great public health importance in Colombia. Vector surveillance and control activities are often focused at the household level. Little is known about the importance of nonhousehold sites, including schools, in maintaining vector-borne disease transmission. The objectives of this paper were to determine the mosquito species composition in rural schools in 2 municipalities in Colombia and to assess the potential risk of vector-borne disease transmission in school settings. Entomological surveys were carried out in rural schools during the dry and rainy seasons of 2011. A total of 12 mosquito species were found: Aedes aegypti, Anopheles pseudopunctipennis, Culex coronator, Cx. quinquefasciatus, and Limatus durhamii in both immature and adult forms; Ae. fluviatilis, Cx. nigripalpus, Cx. corniger, and Psorophora ferox in immature forms only; and Ae. angustivittatus, Haemagogus equinus, and Trichoprosopon lampropus in adult forms only. The most common mosquito species was Cx. quinquefasciatus. Classrooms contained the greatest abundance of adult female Ae. aegypti and Cx. quinquefasciatus. The most common Ae. aegypti breeding sites were containers classified as "others" (e.g., cans), followed by containers used for water storage. A high level of Ae. aegypti infestation was found during the wet season. Our results suggest that rural schools are potentially important foci for the transmission of dengue and other mosquito-borne diseases. We propose that public health programs should be implemented in rural schools to prevent vector-borne diseases. PMID:26375902

  18. Influence of vectors' risk-spreading strategies and environmental stochasticity on the epidemiology and evolution of vector-borne diseases: the example of Chagas' disease.

    Directory of Open Access Journals (Sweden)

    Perrine Pelosse

    Full Text Available Insects are known to display strategies that spread the risk of encountering unfavorable conditions, thereby decreasing the extinction probability of genetic lineages in unpredictable environments. To what extent these strategies influence the epidemiology and evolution of vector-borne diseases in stochastic environments is largely unknown. In triatomines, the vectors of the parasite Trypanosoma cruzi, the etiological agent of Chagas' disease, juvenile development time varies between individuals and such variation most likely decreases the extinction risk of vector populations in stochastic environments. We developed a simplified multi-stage vector-borne SI epidemiological model to investigate how vector risk-spreading strategies and environmental stochasticity influence the prevalence and evolution of a parasite. This model is based on available knowledge on triatomine biodemography, but its conceptual outcomes apply, to a certain extent, to other vector-borne diseases. Model comparisons between deterministic and stochastic settings led to the conclusion that environmental stochasticity, vector risk-spreading strategies (in particular an increase in the length and variability of development time and their interaction have drastic consequences on vector population dynamics, disease prevalence, and the relative short-term evolution of parasite virulence. Our work shows that stochastic environments and associated risk-spreading strategies can increase the prevalence of vector-borne diseases and favor the invasion of more virulent parasite strains on relatively short evolutionary timescales. This study raises new questions and challenges in a context of increasingly unpredictable environmental variations as a result of global climate change and human interventions such as habitat destruction or vector control.

  19. Influence of vectors' risk-spreading strategies and environmental stochasticity on the epidemiology and evolution of vector-borne diseases: the example of Chagas' disease.

    Science.gov (United States)

    Pelosse, Perrine; Kribs-Zaleta, Christopher M; Ginoux, Marine; Rabinovich, Jorge E; Gourbière, Sébastien; Menu, Frédéric

    2013-01-01

    Insects are known to display strategies that spread the risk of encountering unfavorable conditions, thereby decreasing the extinction probability of genetic lineages in unpredictable environments. To what extent these strategies influence the epidemiology and evolution of vector-borne diseases in stochastic environments is largely unknown. In triatomines, the vectors of the parasite Trypanosoma cruzi, the etiological agent of Chagas' disease, juvenile development time varies between individuals and such variation most likely decreases the extinction risk of vector populations in stochastic environments. We developed a simplified multi-stage vector-borne SI epidemiological model to investigate how vector risk-spreading strategies and environmental stochasticity influence the prevalence and evolution of a parasite. This model is based on available knowledge on triatomine biodemography, but its conceptual outcomes apply, to a certain extent, to other vector-borne diseases. Model comparisons between deterministic and stochastic settings led to the conclusion that environmental stochasticity, vector risk-spreading strategies (in particular an increase in the length and variability of development time) and their interaction have drastic consequences on vector population dynamics, disease prevalence, and the relative short-term evolution of parasite virulence. Our work shows that stochastic environments and associated risk-spreading strategies can increase the prevalence of vector-borne diseases and favor the invasion of more virulent parasite strains on relatively short evolutionary timescales. This study raises new questions and challenges in a context of increasingly unpredictable environmental variations as a result of global climate change and human interventions such as habitat destruction or vector control. PMID:23951018

  20. Influence of Vectors’ Risk-Spreading Strategies and Environmental Stochasticity on the Epidemiology and Evolution of Vector-Borne Diseases: The Example of Chagas’ Disease

    Science.gov (United States)

    Pelosse, Perrine; Kribs-Zaleta, Christopher M.; Ginoux, Marine; Rabinovich, Jorge E.; Gourbière, Sébastien; Menu, Frédéric

    2013-01-01

    Insects are known to display strategies that spread the risk of encountering unfavorable conditions, thereby decreasing the extinction probability of genetic lineages in unpredictable environments. To what extent these strategies influence the epidemiology and evolution of vector-borne diseases in stochastic environments is largely unknown. In triatomines, the vectors of the parasite Trypanosoma cruzi, the etiological agent of Chagas’ disease, juvenile development time varies between individuals and such variation most likely decreases the extinction risk of vector populations in stochastic environments. We developed a simplified multi-stage vector-borne SI epidemiological model to investigate how vector risk-spreading strategies and environmental stochasticity influence the prevalence and evolution of a parasite. This model is based on available knowledge on triatomine biodemography, but its conceptual outcomes apply, to a certain extent, to other vector-borne diseases. Model comparisons between deterministic and stochastic settings led to the conclusion that environmental stochasticity, vector risk-spreading strategies (in particular an increase in the length and variability of development time) and their interaction have drastic consequences on vector population dynamics, disease prevalence, and the relative short-term evolution of parasite virulence. Our work shows that stochastic environments and associated risk-spreading strategies can increase the prevalence of vector-borne diseases and favor the invasion of more virulent parasite strains on relatively short evolutionary timescales. This study raises new questions and challenges in a context of increasingly unpredictable environmental variations as a result of global climate change and human interventions such as habitat destruction or vector control. PMID:23951018

  1. Benefit of insecticide-treated nets, curtains and screening on vector borne diseases, excluding malaria: a systematic review and meta-analysis

    NARCIS (Netherlands)

    Wilson, A.L.; Dhiman, R.C.; Kitron, U.; Scott, T.W.; Berg, van den H.; Lindsay, S.W.

    2014-01-01

    Introduction Insecticide-treated nets (ITNs) are one of the main interventions used for malaria control. However, these nets may also be effective against other vector borne diseases (VBDs). We conducted a systematic review and meta-analysis to estimate the efficacy of ITNs, insecticide-treated curt

  2. International network for capacity building for the control of emerging viral vector-borne zoonotic diseases: ARBO-ZOONET.

    Science.gov (United States)

    Ahmed, J; Bouloy, M; Ergonul, O; Fooks, Ar; Paweska, J; Chevalier, V; Drosten, C; Moormann, R; Tordo, N; Vatansever, Z; Calistri, P; Estrada-Pena, A; Mirazimi, A; Unger, H; Yin, H; Seitzer, U

    2009-03-26

    Arboviruses are arthropod-borne viruses, which include West Nile fever virus (WNFV), a mosquito-borne virus, Rift Valley fever virus (RVFV), a mosquito-borne virus, and Crimean-Congo haemorrhagic fever virus (CCHFV), a tick-borne virus. These arthropod-borne viruses can cause disease in different domestic and wild animals and in humans, posing a threat to public health because of their epidemic and zoonotic potential. In recent decades, the geographical distribution of these diseases has expanded. Outbreaks of WNF have already occurred in Europe, especially in the Mediterranean basin. Moreover, CCHF is endemic in many European countries and serious outbreaks have occurred, particularly in the Balkans, Turkey and Southern Federal Districts of Russia. In 2000, RVF was reported for the first time outside the African continent, with cases being confirmed in Saudi Arabia and Yemen. This spread was probably caused by ruminant trade and highlights that there is a threat of expansion of the virus into other parts of Asia and Europe. In the light of global warming and globalisation of trade and travel, public interest in emerging zoonotic diseases has increased. This is especially evident regarding the geographical spread of vector-borne diseases. A multi-disciplinary approach is now imperative, and groups need to collaborate in an integrated manner that includes vector control, vaccination programmes, improved therapy strategies, diagnostic tools and surveillance, public awareness, capacity building and improvement of infrastructure in endemic regions. PMID:19341603

  3. Impacts of Climate Change on Vector Borne Diseases in the Mediterranean Basin — Implications for Preparedness and Adaptation Policy

    Directory of Open Access Journals (Sweden)

    Maya Negev

    2015-06-01

    Full Text Available The Mediterranean region is vulnerable to climatic changes. A warming trend exists in the basin with changes in rainfall patterns. It is expected that vector-borne diseases (VBD in the region will be influenced by climate change since weather conditions influence their emergence. For some diseases (i.e., West Nile virus the linkage between emergence andclimate change was recently proved; for others (such as dengue the risk for local transmission is real. Consequently, adaptation and preparation for changing patterns of VBD distribution is crucial in the Mediterranean basin. We analyzed six representative Mediterranean countries and found that they have started to prepare for this threat, but the preparation levels among them differ, and policy mechanisms are limited and basic. Furthermore, cross-border cooperation is not stable and depends on international frameworks. The Mediterranean countries should improve their adaptation plans, and develop more cross-sectoral, multidisciplinary and participatory approaches. In addition, based on experience from existing local networks in advancing national legislation and trans-border cooperation, we outline recommendations for a regional cooperation framework. We suggest that a stable and neutral framework is required, and that it should address the characteristics and needs of African, Asian and European countries around the Mediterranean in order to ensure participation. Such a regional framework is essential to reduce the risk of VBD transmission, since the vectors of infectious diseases know no political borders.

  4. Climate change and vector-borne diseases: what are the implications for public health research and policy?

    Science.gov (United States)

    Campbell-Lendrum, Diarmid; Manga, Lucien; Bagayoko, Magaran; Sommerfeld, Johannes

    2015-04-01

    Vector-borne diseases continue to contribute significantly to the global burden of disease, and cause epidemics that disrupt health security and cause wider socioeconomic impacts around the world. All are sensitive in different ways to weather and climate conditions, so that the ongoing trends of increasing temperature and more variable weather threaten to undermine recent global progress against these diseases. Here, we review the current state of the global public health effort to address this challenge, and outline related initiatives by the World Health Organization (WHO) and its partners. Much of the debate to date has centred on attribution of past changes in disease rates to climate change, and the use of scenario-based models to project future changes in risk for specific diseases. While these can give useful indications, the unavoidable uncertainty in such analyses, and contingency on other socioeconomic and public health determinants in the past or future, limit their utility as decision-support tools. For operational health agencies, the most pressing need is the strengthening of current disease control efforts to bring down current disease rates and manage short-term climate risks, which will, in turn, increase resilience to long-term climate change. The WHO and partner agencies are working through a range of programmes to (i) ensure political support and financial investment in preventive and curative interventions to bring down current disease burdens; (ii) promote a comprehensive approach to climate risk management; (iii) support applied research, through definition of global and regional research agendas, and targeted research initiatives on priority diseases and population groups. PMID:25688013

  5. Climate, environmental and socio-economic change: weighing up the balance in vector-borne disease transmission.

    Science.gov (United States)

    Parham, Paul E; Waldock, Joanna; Christophides, George K; Hemming, Deborah; Agusto, Folashade; Evans, Katherine J; Fefferman, Nina; Gaff, Holly; Gumel, Abba; LaDeau, Shannon; Lenhart, Suzanne; Mickens, Ronald E; Naumova, Elena N; Ostfeld, Richard S; Ready, Paul D; Thomas, Matthew B; Velasco-Hernandez, Jorge; Michael, Edwin

    2015-04-01

    Arguably one of the most important effects of climate change is the potential impact on human health. While this is likely to take many forms, the implications for future transmission of vector-borne diseases (VBDs), given their ongoing contribution to global disease burden, are both extremely important and highly uncertain. In part, this is owing not only to data limitations and methodological challenges when integrating climate-driven VBD models and climate change projections, but also, perhaps most crucially, to the multitude of epidemiological, ecological and socio-economic factors that drive VBD transmission, and this complexity has generated considerable debate over the past 10-15 years. In this review, we seek to elucidate current knowledge around this topic, identify key themes and uncertainties, evaluate ongoing challenges and open research questions and, crucially, offer some solutions for the field. Although many of these challenges are ubiquitous across multiple VBDs, more specific issues also arise in different vector-pathogen systems. PMID:25688012

  6. How human practices have affected vector-borne diseases in the past: a study of malaria transmission in Alpine valleys

    Directory of Open Access Journals (Sweden)

    Lemperière Guy

    2007-08-01

    Full Text Available Abstract Background Malaria was endemic in the Rhône-Alpes area of eastern France in the 19th century and life expectancy was particularly shortened in Alpine valleys. This study was designed to determine how the disease affected people in the area and to identify the factors influencing malaria transmission. Methods Demographic data of the 19th century were collected from death registers of eight villages of the flood-plain of the river Isère. Correlations were performed between these demographic data and reconstructed meteorological data. Archive documents from medical practitioners gave information on symptoms of ill people. Engineer reports provided information on the hydraulic project developments in the Isère valley. Results Description of fevers was highly suggestive of endemic malaria transmission in the parishes neighbouring the river Isère. The current status of anopheline mosquitoes in the area supports this hypothesis. Mean temperature and precipitation were poorly correlated with demographic data, whereas the chronology of hydrological events correlated with fluctuations in death rates in the parishes. Conclusion Nowadays, most of the river development projects involve the creation of wet areas, enabling controlled flooding events. Flood-flow risk and the re-emergence of vector-borne diseases would probably be influenced by the climate change. The message is not to forget that human disturbance of any functioning hydrosystem has often been linked to malaria transmission in the past.

  7. Insecticide control of vector-borne diseases : when is insecticide resistance a problem ?

    OpenAIRE

    Rivero, Ana; Vézilier, Julien; Weill, Mylène; Read, Andrew F.; Gandon, Sylvain

    2010-01-01

    Many of the most dangerous human diseases are transmitted by insect vectors. After decades of repeated insecticide use, all of these vector species have demonstrated the capacity to evolve resistance to insecticides. Insecticide resistance is generally considered to undermine control of vector-transmitted diseases because it increases the number of vectors that survive the insecticide treatment. Disease control failure, however, need not follow from vector control failure. Here, we review evi...

  8. MosquitoMap and the Mal-area calculator: new web tools to relate mosquito species distribution with vector borne disease

    OpenAIRE

    Christensen Jamie; Harrison Stanley; Birney Ian; Wilkerson Richard C; Foley Desmond H; Rueda Leopoldo M

    2010-01-01

    Abstract Background Mosquitoes are important vectors of diseases but, in spite of various mosquito faunistic surveys globally, there is a need for a spatial online database of mosquito collection data and distribution summaries. Such a resource could provide entomologists with the results of previous mosquito surveys, and vector disease control workers, preventative medicine practitioners, and health planners with information relating mosquito distribution to vector-borne disease risk. Result...

  9. The Interaction between Vector Life History and Short Vector Life in Vector-Borne Disease Transmission and Control.

    Science.gov (United States)

    Brand, Samuel P C; Rock, Kat S; Keeling, Matt J

    2016-04-01

    Epidemiological modelling has a vital role to play in policy planning and prediction for the control of vectors, and hence the subsequent control of vector-borne diseases. To decide between competing policies requires models that can generate accurate predictions, which in turn requires accurate knowledge of vector natural histories. Here we highlight the importance of the distribution of times between life-history events, using short-lived midge species as an example. In particular we focus on the distribution of the extrinsic incubation period (EIP) which determines the time between infection and becoming infectious, and the distribution of the length of the gonotrophic cycle which determines the time between successful bites. We show how different assumptions for these periods can radically change the basic reproductive ratio (R0) of an infection and additionally the impact of vector control on the infection. These findings highlight the need for detailed entomological data, based on laboratory experiments and field data, to correctly construct the next-generation of policy-informing models. PMID:27128163

  10. Climate and Health Vulnerability to Vector-Borne Diseases: Increasing Resilience under Climate Change Conditions in Africa

    Science.gov (United States)

    Ceccato, P.

    2015-12-01

    The International Research Institute for Climate and Society (IRI), the City University of New York (CUNY) and NASA Jet Propulsion Laboratory (JPL) in collaboration with NASA SERVIR are developing tools to monitor climate variables (precipitation, temperature, vegetation, water bodies, inundation) that help projects in Africa to increase resilience to climate change for vector-borne diseases ( malaria, trypanosomiasis, leishmaniasis, and schistosomiasis). Through the development of new products to monitor precipitation, water bodies and inundation, IRI, CUNY and JPL provide tools and capacity building to research communities; ministries of health; the WMO Global Framework for Climate and Services; and World Health Organization in Africa to: 1) Develop research teams' ability to appropriately use climate data as part of their research 2) Enable research teams and ministries to integrate climate information into social and economic drivers of vulnerability and opportunities for adaptation to climate change 3) Inform better policies and programs for climate change adaptation. This oral presentation will demonstrate how IRI, CUNY, and JPL developed new products, tools and capacity building to achieve the three objectives mentioned above with examples in South Africa, Zimbabwe, Tanzania and Malawi.

  11. The Interaction between Vector Life History and Short Vector Life in Vector-Borne Disease Transmission and Control

    Science.gov (United States)

    Brand, Samuel P. C.; Keeling, Matt J.

    2016-01-01

    Epidemiological modelling has a vital role to play in policy planning and prediction for the control of vectors, and hence the subsequent control of vector-borne diseases. To decide between competing policies requires models that can generate accurate predictions, which in turn requires accurate knowledge of vector natural histories. Here we highlight the importance of the distribution of times between life-history events, using short-lived midge species as an example. In particular we focus on the distribution of the extrinsic incubation period (EIP) which determines the time between infection and becoming infectious, and the distribution of the length of the gonotrophic cycle which determines the time between successful bites. We show how different assumptions for these periods can radically change the basic reproductive ratio (R0) of an infection and additionally the impact of vector control on the infection. These findings highlight the need for detailed entomological data, based on laboratory experiments and field data, to correctly construct the next-generation of policy-informing models. PMID:27128163

  12. Climate and Population Health Vulnerabilities to Vector-Borne Diseases: Increasing Resilience Under Climate Change Conditions in Africa

    Science.gov (United States)

    Ceccato, P.; McDonald, K. C.; Podest, E.; De La Torre Juarez, M.; Kruczkiewicz, A.; Lessel, J.; Jensen, K.; Thomson, M. C.

    2014-12-01

    The International Research Institute for Climate and Society (IRI), the City University of New York (CUNY) and NASA Jet Propulsion Laboratory (JPL) in collaboration with NASA SERVIR are developing tools to monitor climate variables (precipitation, temperature, vegetation, water bodies, inundation) that help projects in Africa to increase resilience to climate change for vector-borne diseases (i.e. malaria, trypanosomiasis, leishmaniasis, and schistosomiasis). Through the development of new products to monitor precipitation, water bodies and inundation, IRI, CUNY and JPL provide tools and capacity building to research communities, ministries of health and World Health Organization in Africa to: 1) Develop research teams' ability to appropriately use climate data as part of their research 2) Enable research teams and ministries to integrate climate information into social and economic drivers of vulnerability and opportunities for adaptation to climate change 3) Inform better policies and programs for climate change adaptation. This oral presentation will demonstrate how IRI, CUNY, and JPL developed new products, tools and capacity building to achieve the three objectives mentioned above.

  13. Kissing Bugs in the United States: Risk for Vector-Borne Disease in Humans

    OpenAIRE

    Stephen A. Klotz; Dorn, Patricia L.; Mark Mosbacher; Schmidt, Justin O.

    2014-01-01

    Eleven species of kissing bugs are found in the United States. Their home ranges may be expanding northward, perhaps as a consequence of climate change. At least eight of the species, perhaps all, are reported to harbor Trypanosoma cruzi, the parasite that causes Chagas disease. Because humans are encroaching on kissing bug habitat, there is concern for vector-transmitted Chagas disease in the United States. To date, documented autochthonous cases of Chagas in humans in the United States are ...

  14. The ecological foundations of transmission potential and vector-borne disease in urban landscapes

    OpenAIRE

    Shannon L LaDeau; Allan, Brian F.; Leisnham, Paul T.; Michael Z Levy

    2015-01-01

    Urban transmission of arthropod-vectored disease has increased in recent decades. Understanding and managing transmission potential in urban landscapes requires integration of sociological and ecological processes that regulate vector population dynamics, feeding behavior, and vector-pathogen interactions in these unique ecosystems. Vectorial capacity is a key metric for generating predictive understanding about transmission potential in systems with obligate vector transmission. This review ...

  15. Ectoparasitism and vector-borne diseases in 930 homeless people from Marseilles.

    Science.gov (United States)

    Brouqui, Philippe; Stein, Andreas; Dupont, Hervé Tissot; Gallian, Pierre; Badiaga, Sekene; Rolain, Jean Marc; Mege, Jean Louis; La Scola, Bernard; Berbis, Philippe; Raoult, Didier

    2005-01-01

    Homeless people are particularly exposed to ectoparasites, but their exposure to arthropod-borne diseases has not been evaluated systematically. A medical team of 27 persons (7 nurses, 6 infectious disease residents or fellows, 2 dermatologists, and 12 infectious disease specialists) visited the 2 shelters in Marseilles, France, for 4 consecutive years. Homeless volunteers were interviewed, examined, and received care; and blood was sampled for cell counts and detection of bacteremia, antibodies to louse-borne (Rickettsia prowazekii, Bartonella quintana, and Borrelia recurrentis), flea-borne (R. typhi, R. felis), mite-borne (R. akari), and tick-borne (R. conorii) bacterial agents. We selected sex- and age-adjusted controls among healthy blood donors. Over 4 years, 930 homeless people were enrolled. Lice were found in 22% and were associated with hypereosinophilia (odds ratio, 5.7; 95% confidence intervals, 1.46-22.15). Twenty-seven patients (3%) with scabies were treated with ivermectin. Bartonella quintana was isolated from blood culture in 50 patients (5.3%), 36 of whom were treated effectively. The number of bacteremic patient increased from 3.4% to 8.4% (p = 0.02) over the 4 years of the study. We detected a higher seroprevalence to Borrelia recurrentis, R. conorii, and R. prowazekii antibodies in the homeless. Our study shows a high prevalence of louse-borne infections in the homeless and a high degree of exposure to tick-borne diseases and scabies. Despite effective treatment for Bartonella quintana bacteremia and the efforts made to delouse this population, Bartonella quintana remains endemic, and we found hallmarks of epidemic typhus and relapsing fever. The uncontrolled louse infestation of this population should alert the community to the possibility of severe re-emerging louse-borne infections. PMID:15643300

  16. Complex ecological dynamics and eradicability of the vector borne macroparasitic disease, lymphatic filariasis.

    Directory of Open Access Journals (Sweden)

    Manoj Gambhir

    Full Text Available BACKGROUND: The current global efforts to control the morbidity and mortality caused by infectious diseases affecting developing countries--such as HIV/AIDS, polio, tuberculosis, malaria and the Neglected Tropical Diseases (NTDs-have led to an increasing focus on the biological controllability or eradicability of disease transmission by management action. Here, we use an age-structured dynamical model of lymphatic filariasis transmission to show how a quantitative understanding of the dynamic processes underlying infection persistence and extinction is key to evaluating the eradicability of this macroparasitic disease. METHODOLOGY/PRINCIPAL FINDINGS: We investigated the persistence and extinction dynamics of lymphatic filariasis by undertaking a numerical equilibrium analysis of a deterministic model of parasite transmission, based on varying values of the initial L3 larval density in the system. The results highlighted the likely occurrence of complex dynamics in parasite transmission with three major outcomes for the eradicability of filariasis. First, both vector biting and worm breakpoint thresholds are shown to be complex dynamic entities with values dependent on the nature and magnitude of vector-and host specific density-dependent processes and the degree of host infection aggregation prevailing in endemic communities. Second, these thresholds as well as the potential size of the attractor domains and hence system resilience are strongly dependent on peculiarities of infection dynamics in different vector species. Finally, the existence of multiple stable states indicates the presence of hysteresis nonlinearity in the filariasis system dynamics in which infection thresholds for infection invasion are lower but occur at higher biting rates than do the corresponding thresholds for parasite elimination. CONCLUSIONS/SIGNIFICANCE: The variable dynamic nature of thresholds and parasite system resilience reflecting both initial conditions and

  17. Implementing Cargo Movement into Climate Based Risk Assessment of Vector-Borne Diseases

    OpenAIRE

    Stephanie Margarete Thomas; Nils Benjamin Tjaden; Sanne van den Bos; Carl Beierkuhnlein

    2014-01-01

    During the last decades the disease vector Aedes albopictus (Asian tiger mosquito) has rapidly spread around the globe. Global shipment of goods contributes to its permanent introduction. Invaded regions are facing novel and serious public health concerns, especially regarding the transmission of formerly non-endemic arboviruses such as dengue and chikungunya. The further development and potential spread to other regions depends largely on their climatic suitability. Here, we have developed a...

  18. Epidemic potential of an emerging vector borne disease in a marginal environment: Schmallenberg in Scotland

    OpenAIRE

    Bessell, Paul R.; Searle, Kate R.; Auty, Harriet K.; Handel, Ian G.; Purse, Bethan V.; Bronsvoort, B. Mark deC

    2013-01-01

    During 2011 Schmallenberg virus (SBV) presented as a novel disease of cattle and sheep that had apparently spread through northern Europe over a relatively short period of time, but has yet to infect Scotland. This paper describes the development of a model of SBV spread applied to Scotland in the event of an incursion. This model shows that SBV spread is very sensitive to the temperature, with relatively little spread and few reproductive losses predicted in years with average temperatures b...

  19. Implementing Cargo Movement into Climate Based Risk Assessment of Vector-Borne Diseases

    Directory of Open Access Journals (Sweden)

    Stephanie Margarete Thomas

    2014-03-01

    Full Text Available During the last decades the disease vector Aedes albopictus (Asian tiger mosquito has rapidly spread around the globe. Global shipment of goods contributes to its permanent introduction. Invaded regions are facing novel and serious public health concerns, especially regarding the transmission of formerly non-endemic arboviruses such as dengue and chikungunya. The further development and potential spread to other regions depends largely on their climatic suitability. Here, we have developed a tool for identifying and prioritizing European areas at risk for the establishment of Aedes albopictus by taking into account, for the first time, the freight imports from this mosquito’s endemic countries and the climate suitability at harbors and their surrounding regions. In a second step we consider the further transport of containers by train and inland waterways because these types of transport can be well controlled. We identify European regions at risk, where a huge amount of transported goods meet climatically suitable conditions for the disease vector. The current and future suitability of the climate for Aedes albopictus was modeled by a correlative niche model approach and the Regional Climate Model COSMO-CLM. This risk assessment combines impacts of globalization and global warming to improve effective and proactive interventions in disease vector surveillance and control actions.

  20. Host population persistence in the face of introduced vector-borne diseases: Hawaii amakihi and avian malaria

    Science.gov (United States)

    Woodworth, B.L.; Atkinson, C.T.; Lapointe, D.A.; Hart, P.J.; Spiegel, C.S.; Tweed, E.J.; Henneman, C.; LeBrun, J.; Denette, T.; DeMots, R.; Kozar, K.L.; Triglia, D.; Lease, D.; Gregor, A.; Smith, T.; Duffy, D.

    2005-01-01

    The past quarter century has seen an unprecedented increase in the number of new and emerging infectious diseases throughout the world, with serious implications for human and wildlife populations. We examined host persistence in the face of introduced vector-borne diseases in Hawaii, where introduced avian malaria and introduced vectors have had a negative impact on most populations of Hawaiian forest birds for nearly a century. We studied birds, parasites, and vectors in nine study areas from 0 to 1,800 m on Mauna Loa Volcano, Hawaii from January to October, 2002. Contrary to predictions of prior work, we found that Hawaii amakihi (Hemignathus virens), a native species susceptible to malaria, comprised from 24.5% to 51.9% of the avian community at three low-elevation forests (55-270 m). Amakihi were more abundant at low elevations than at disease-free high elevations, and were resident and breeding there. Infection rates were 24-40% by microscopy and 55-83% by serology, with most infected individuals experiencing low-intensity, chronic infections. Mosquito trapping and diagnostics provided strong evidence for year-round local transmission. Moreover, we present evidence that Hawaii amakihi have increased in low elevation habitats on south-eastern Hawaii Island over the past decade. The recent emergent phenomenon of recovering amakihi populations at low elevations, despite extremely high prevalence of avian malaria, suggests that ecological or evolutionary processes acting on hosts or parasites have allowed this species to recolonize low-elevation habitats. A better understanding of the mechanisms allowing coexistence of hosts and parasites may ultimately lead to tools for mitigating disease impacts on wildlife and human populations.

  1. Climate Change and Spatiotemporal Distributions of Vector-Borne Diseases in Nepal--A Systematic Synthesis of Literature.

    Directory of Open Access Journals (Sweden)

    Meghnath Dhimal

    Full Text Available Despite its largely mountainous terrain for which this Himalayan country is a popular tourist destination, Nepal is now endemic for five major vector-borne diseases (VBDs, namely malaria, lymphatic filariasis, Japanese encephalitis, visceral leishmaniasis and dengue fever. There is increasing evidence about the impacts of climate change on VBDs especially in tropical highlands and temperate regions. Our aim is to explore whether the observed spatiotemporal distributions of VBDs in Nepal can be related to climate change.A systematic literature search was performed and summarized information on climate change and the spatiotemporal distribution of VBDs in Nepal from the published literature until December 2014 following providing items for systematic review and meta-analysis (PRISMA guidelines.We found 12 studies that analysed the trend of climatic data and are relevant for the study of VBDs, 38 studies that dealt with the spatial and temporal distribution of disease vectors and disease transmission. Among 38 studies, only eight studies assessed the association of VBDs with climatic variables. Our review highlights a pronounced warming in the mountains and an expansion of autochthonous cases of VBDs to non-endemic areas including mountain regions (i.e., at least 2,000 m above sea level. Furthermore, significant relationships between climatic variables and VBDs and their vectors are found in short-term studies.Taking into account the weak health care systems and difficult geographic terrain of Nepal, increasing trade and movements of people, a lack of vector control interventions, observed relationships between climatic variables and VBDs and their vectors and the establishment of relevant disease vectors already at least 2,000 m above sea level, we conclude that climate change can intensify the risk of VBD epidemics in the mountain regions of Nepal if other non-climatic drivers of VBDs remain constant.

  2. Predicting and Mitigating Outbreaks of Vector-Borne Disease Utilizing Satellite Remote Sensing Technology and Models

    Science.gov (United States)

    Estes, Sue M.

    2009-01-01

    The Public Health application area focuses on Earth science applications to public health and safety, particularly regarding infectious disease, emergency preparedness and response, and environmental health issues. The application explores issues of toxic and pathogenic exposure, as well as natural and man-made hazards and their effects, for risk characterization/mitigation and improvements to health and safety. The program elements of the NASA Applied Sciences Program are: Agricultural Efficiency, Air Quality, Climate, Disaster Management, Ecological Forecasting, Water Resources, Weather, and Public Health.

  3. Climate Change and Vector Borne Diseases: Getting A Grip on Control

    Science.gov (United States)

    Glass, G. E.; Ellis, H.

    2011-12-01

    Pathogens that are transmitted by arthropods to humans kill millions of people a year and have long been identified as systems likely affected by climate change. Despite this, there has been a long controversy of how to evaluate the responses of these infectious disease systems to climatic conditions so that meaningful programmatic dcisions can be made. We briefly review the rationale for overall expectations, using them to identify both the temporal and spatial resolution needed for decision making and then discuss progress to date, using the world global malaria eradication program as an example.

  4. Host group formation decreases exposure to vector-borne disease: a field experiment in a 'hotspot' of West Nile virus transmission.

    Science.gov (United States)

    Krebs, Bethany L; Anderson, Tavis K; Goldberg, Tony L; Hamer, Gabriel L; Kitron, Uriel D; Newman, Christina M; Ruiz, Marilyn O; Walker, Edward D; Brawn, Jeffrey D

    2014-12-01

    Animals can decrease their individual risk of predation by forming groups. The encounter-dilution hypothesis extends the potential benefits of gregariousness to biting insects and vector-borne disease by predicting that the per capita number of insect bites should decrease within larger host groups. Although vector-borne diseases are common and can exert strong selective pressures on hosts, there have been few tests of the encounter-dilution effect in natural systems. We conducted an experimental test of the encounter-dilution hypothesis using the American robin (Turdus migratorius), a common host species for the West Nile virus (WNV), a mosquito-borne pathogen. By using sentinel hosts (house sparrows, Passer domesticus) caged in naturally occurring communal roosts in the suburbs of Chicago, we assessed sentinel host risk of WNV exposure inside and outside of roosts. We also estimated per capita host exposure to infected vectors inside roosts and outside of roosts. Sentinel birds caged inside roosts seroconverted to WNV more slowly than those outside of roosts, suggesting that social groups decrease per capita exposure to infected mosquitoes. These results therefore support the encounter-dilution hypothesis in a vector-borne disease system. Our results suggest that disease-related selective pressures on sociality may depend on the mode of disease transmission. PMID:25339722

  5. Status of pesticide management in the practice of vector control: a global survey in countries at risk of malaria or other major vector-borne diseases

    OpenAIRE

    Tan Soo; Ejov Mikhail; Dash Aditya P; Ameneshewa Birkinesh; Mnzava Abraham; Soares Agnes; Hii Jeffrey; van den Berg Henk; Matthews Graham; Yadav Rajpal S; Zaim Morteza

    2011-01-01

    Abstract Background It is critical that vector control pesticides are used for their acceptable purpose without causing adverse effects on health and the environment. This paper provides a global overview of the current status of pesticides management in the practice of vector control. Methods A questionnaire was distributed to WHO member states and completed either by the director of the vector-borne disease control programme or by the national manager for vector control. In all, 113 countri...

  6. The Repellent DEET Potentiates Carbamate Effects via Insect Muscarinic Receptor Interactions: An Alternative Strategy to Control Insect Vector-Borne Diseases

    OpenAIRE

    Abd-Ella, Aly; Stankiewicz, Maria; Mikulska, Karolina; Nowak, Wieslaw; Pennetier, Cédric; Goulu, Mathilde; Fruchart-Gaillard, Carole; Licznar, Patricia; Apaire-Marchais, Véronique; List, Olivier; Corbel, Vincent; Servent, Denis; Lapied, Bruno

    2015-01-01

    Insect vector-borne diseases remain one of the principal causes of human mortality. In addition to conventional measures of insect control, repellents continue to be the mainstay for personal protection. Because of the increasing pyrethroid-resistant mosquito populations, alternative strategies to reconstitute pyrethroid repellency and knock-down effects have been proposed by mixing the repellent DEET (N,N-Diethyl-3-methylbenzamide) with non-pyrethroid insecticide to better control resistant ...

  7. Vector-borne diseases of small companion animals in Namibia: Literature review, knowledge gaps and opportunity for a One Health approach

    Directory of Open Access Journals (Sweden)

    Bruce H. Noden

    2015-03-01

    Full Text Available Namibia has a rich history in veterinary health but little is known about the vector-borne diseases that affect companion dogs and cats. The aim of this review is to summarise the existing published and available unpublished literature, put it into a wider geographical context, and explore some significant knowledge gaps. To date, only two filarial pathogens (Dirofilaria repens and Acanthocheilonema dracunculoides and three tick-borne pathogens (Babesia canis vogeli, Hepatozoon canis and Ehrlichia canis have been reported. Most studies have focused solely on dogs and cats in the urban Windhoek and surrounding areas, with almost nothing reported in rural farming areas, in either the populous northern regions or the low-income urban areas where animal owners have limited access to veterinary services. With the development of several biomedical training programmes in the country, there is now an excellent opportunity to address zoonotic vector-borne diseases through a One Health approach so as to assess the risks to small companion animals as well as diseases of public health importance.

  8. An application of remotely derived climatological fields for risk assessment of vector-borne diseases : a spatial study of filariasis prevalence in the Nile Delta, Egypt.

    Energy Technology Data Exchange (ETDEWEB)

    Crombie, M. K.; Gillies, R. R.; Arvidson, R. E.; Brookmeyer, P.; Weil, G. J.; Sultan, M.; Harb, M.; Environmental Research; Washington Univ.; Utah State Univ.; Egyptian Ministry of Health

    1999-12-01

    This paper applies a relatively straightforward remote sensing method that is commonly used to derive climatological variables. Measurements of surface reflectance and surface radiant temperature derived from Landsat Thematic Mapper data were used to create maps of fractional vegetation and surface soil moisture availability for the southern Nile delta in Egypt. These climatological variables were subsequently used to investigate the spatial distribution of the vector borne disease Bancroftian filariasis in the Nile delta where it is focally endemic and a growing problem. Averaged surface soil moisture values, computed for a 5-km border area around affected villages, were compared to filariasis prevalence rates. Prevalence rates were found to be negligible below a critical soil moisture value of 0.2, presumably because of a lack of appropriate breeding sites for the Culex Pipiens mosquito species. With appropriate modifications to account for local conditions and vector species, this approach should be useful as a means to map, predict, and control insect vector-borne diseases that critically depend on wet areas for propagation. This type of analysis may help governments and health agencies that are involved in filariasis control to better focus limited resources to identifiable high-risk areas.

  9. Vector-borne disease surveillance in livestock populations: A critical review of literature recommendations and implemented surveillance (BTV-8) in five European countries.

    Science.gov (United States)

    Dórea, Fernanda C; Elbers, Armin R W; Hendrikx, Pascal; Enoe, Claes; Kirkeby, Carsten; Hoinville, Linda; Lindberg, Ann

    2016-03-01

    Preparedness against vector-borne threats depends on the existence of a long-term, sustainable surveillance of vector-borne disease and their relevant vectors. This work reviewed the availability of such surveillance systems in five European countries (Denmark, France, The Netherlands, Sweden and United Kingdom, part of the CoVetLab network). A qualitative assessment was then performed focusing on surveillance directed particularly to BTV-8. Information regarding surveillance activities were reviewed for the years 2008 and 2012. The results were then complemented with a critical scoping review of the literature aimed at identifying disease surveillance strategies and methods that are currently suggested as best suited to target vector-borne diseases in order to guide future development of surveillance in the countries in question. Passive surveillance was found to be efficient for early detection of diseases during the early phase of introduction into a free country. However, its value diminished once the disease has been established in a territory. Detection of emerging diseases was found to be very context and area specific, and thus active surveillance designs need to take the available epidemiological, ecological and entomological information into account. This was demonstrated by the effectiveness of the bulk milk surveillance in detecting the first case in Sweden, highlighting the need for output based standards to allow the most effective, context dependent, surveillance strategies to be used. Preparedness was of fundamental importance in determining the timeliness of detection and control in each country and that this in turn was heavily influenced by knowledge of emerging diseases in neighboring countries. Therefore it is crucial to share information on outbreaks between researchers and decision-makers and across borders continuously in order to react timely in case of an outbreak. Furthermore, timely reaction to an outbreak was heavily influenced by

  10. MosquitoMap and the Mal-area calculator: new web tools to relate mosquito species distribution with vector borne disease

    Directory of Open Access Journals (Sweden)

    Christensen Jamie

    2010-02-01

    Full Text Available Abstract Background Mosquitoes are important vectors of diseases but, in spite of various mosquito faunistic surveys globally, there is a need for a spatial online database of mosquito collection data and distribution summaries. Such a resource could provide entomologists with the results of previous mosquito surveys, and vector disease control workers, preventative medicine practitioners, and health planners with information relating mosquito distribution to vector-borne disease risk. Results A web application called MosquitoMap was constructed comprising mosquito collection point data stored in an ArcGIS 9.3 Server/SQL geodatabase that includes administrative area and vector species x country lookup tables. In addition to the layer containing mosquito collection points, other map layers were made available including environmental, and vector and pathogen/disease distribution layers. An application within MosquitoMap called the Mal-area calculator (MAC was constructed to quantify the area of overlap, for any area of interest, of vector, human, and disease distribution models. Data standards for mosquito records were developed for MosquitoMap. Conclusion MosquitoMap is a public domain web resource that maps and compares georeferenced mosquito collection points to other spatial information, in a geographical information system setting. The MAC quantifies the Mal-area, i.e. the area where it is theoretically possible for vector-borne disease transmission to occur, thus providing a useful decision tool where other disease information is limited. The Mal-area approach emphasizes the independent but cumulative contribution to disease risk of the vector species predicted present. MosquitoMap adds value to, and makes accessible, the results of past collecting efforts, as well as providing a template for other arthropod spatial databases.

  11. Study of the climatic change impact on vector-borne diseases in West Africa: the case of tick-borne borreliosis and malaria

    International Nuclear Information System (INIS)

    Malaria and tick-borne borreliosis are the two first causes of morbidity due to vector-borne diseases in a large part of Sudan-sahelian West Africa. They are also the two tropical diseases which have been the most affected by climatic change in recent years. In the case of tick-borne borreliosis it has been shown in Senegal that the persistence of drought since the years 70 has been associated with a considerable extension of the geographic range of diseases and the vector tick A-sonrai, a species that was in the past limited to the Sahara and Sahel. In the case of malaria, drought has strongly reduced in these same regions of Africa the distribution, abundance and infection rate of Anopheline mosquitoes, but without any significant reduction of the burden of malaria for most populations concerned. The emergence and spread of Plasmodium falciparum resistance to antimalarial drugs only explain part of this phenomenon. (A.L.B.)

  12. The Repellent DEET Potentiates Carbamate Effects via Insect Muscarinic Receptor Interactions: An Alternative Strategy to Control Insect Vector-Borne Diseases.

    Directory of Open Access Journals (Sweden)

    Aly Abd-Ella

    Full Text Available Insect vector-borne diseases remain one of the principal causes of human mortality. In addition to conventional measures of insect control, repellents continue to be the mainstay for personal protection. Because of the increasing pyrethroid-resistant mosquito populations, alternative strategies to reconstitute pyrethroid repellency and knock-down effects have been proposed by mixing the repellent DEET (N,N-Diethyl-3-methylbenzamide with non-pyrethroid insecticide to better control resistant insect vector-borne diseases. By using electrophysiological, biochemichal, in vivo toxicological techniques together with calcium imaging, binding studies and in silico docking, we have shown that DEET, at low concentrations, interacts with high affinity with insect M1/M3 mAChR allosteric site potentiating agonist effects on mAChRs coupled to phospholipase C second messenger pathway. This increases the anticholinesterase activity of the carbamate propoxur through calcium-dependent regulation of acetylcholinesterase. At high concentrations, DEET interacts with low affinity on distinct M1/M3 mAChR site, counteracting the potentiation. Similar dose-dependent dual effects of DEET have also been observed at synaptic mAChR level. Additionally, binding and in silico docking studies performed on human M1 and M3 mAChR subtypes indicate that DEET only displays a low affinity antagonist profile on these M1/M3 mAChRs. These results reveal a selective high affinity positive allosteric site for DEET in insect mAChRs. Finally, bioassays conducted on Aedes aegypti confirm the synergistic interaction between DEET and propoxur observed in vitro, resulting in a higher mortality of mosquitoes. Our findings reveal an unusual allosterically potentiating action of the repellent DEET, which involves a selective site in insect. These results open exciting research areas in public health particularly in the control of the pyrethroid-resistant insect-vector borne diseases. Mixing low

  13. Population response to the risk of vector-borne diseases: lessons learned from socio-behavioural research during large-scale outbreaks

    Directory of Open Access Journals (Sweden)

    M Setbon

    2009-01-01

    Full Text Available

    Vector-borne infectious diseases, such as malaria, dengue, chikungunya, and West Nile fevers are increasingly identified as major global human health threats in developing and developed countries. The success or failure of vector control rests mainly on the nature and scale of the behavioural response of exposed populations. Large-scale adoption of recommended protective behaviour represents a critical challenge that cannot be addressed without a better understanding of how individuals perceive and react to the risk of infection. Recently, French overseas territories faced large-scale outbreaks: an epidemic of chikungunya fever in La R|[eacute]|union and Mayotte (2005|[ndash]|2006 and four successive outbreaks of dengue fever in one Caribbean island, Martinique (1995|[ndash]|2007. To assess how these populations perceived and responded to the risk, and how the nature and scale of protection affected their clinical status, socio-epidemiological surveys were conducted on each island during the outbreaks. These surveys address three crucial and interconnected questions relevant to the period after persons infected by the virus were identified: which factors shape the risk of acquiring disease? Which socio-demographic characteristics and living conditions induce a higher likelihood of infection? What is the impact of risk perception on protective behaviours adopted against mosquito bites? Grounded on the results of these surveys, a general framework is proposed to help draw out the knowledge needed to reveal the factors associated with higher probability of infection as an outbreak emerges. The lessons learnt can inform health authorities|[rsquo]| efforts to improve risk communication programmes, both in terms of the target and content of messages, so as to explore new strategies for ensuring sustainable protective behaviour. The authors compare three epidemics of vector-borne diseases to elucidate psychosocial factors that determine how

  14. The effects of host diversity on vector-borne disease: the conditions under which diversity will amplify or dilute the disease risk.

    Directory of Open Access Journals (Sweden)

    Ezer Miller

    Full Text Available Multihost vector-borne infectious diseases form a significant fraction of the global infectious disease burden. In this study we explore the relationship between host diversity, vector behavior, and disease risk. To this end, we have developed a new dynamic model which includes two distinct host species and one vector species with variable preferences. With the aid of the model we were able to compute the basic reproductive rate, R 0, a well-established measure of disease risk that serves as a threshold parameter for disease outbreak. The model analysis reveals that the system has two different qualitative behaviors: (i the well-known dilution effect, where the maximal R0 is obtained in a community which consists a single host (ii a new amplification effect, denoted by us as diversity amplification, where the maximal R0 is attained in a community which consists both hosts. The model analysis extends on previous results by underlining the mechanism of both, diversity amplification and the dilution, and specifies the exact conditions for their occurrence. We have found that diversity amplification occurs where the vector prefers the host with the highest transmission ability, and dilution is obtained when the vector does not show any preference, or it prefers to bite the host with the lower transmission ability. The mechanisms of dilution and diversity amplification are able to account for the different and contradictory patterns often observed in nature (i.e., in some cases disease risk is increased while in other is decreased when the diversity is increased. Implication of the diversity amplification mechanism also challenges current premises about the interaction between biodiversity, climate change, and disease risk and calls for retrospective thinking in planning intervention policies aimed at protecting the preferred host species.

  15. 气候变暖对虫媒传染病影响的研究进展%Research progress on effect of climate warming on vector-borne infectious diseases

    Institute of Scientific and Technical Information of China (English)

    崔维琪; 曾强

    2012-01-01

    The effect of global warming on insect vector mainly includes changing the regional distribution of insect vectors, increasing the reproductive speed and invasiveness of insect vectors, and shortening the external incubation period of pathogens. Many studies show that the distribution of many tropical insects is expanding continually under the effect of global wanning, and the vector-borne infectious diseases which had only occurred in the tropical area in the past have frequently happened in the subtropical area. The incidence rate of vector-borne diseases increases in the global, outbreaks of some old vector-borne infectious diseases occurred again, and the epidemic range of new vector-borne infectious diseases is continuously expanding. The vector-borne infectious diseases that are influenced by climate change include malaria, schistosomiasis, plague, dengue fever and other new vector-borne infectious diseases. In face of global warming, it is important to slow down and control temperature rise, protect natural environment , improve the study of relationship between climate and vector-borne infectious diseases, and implement the prevention and control of vector-borne infectious diseases.%全球气候变暖对虫媒的影响主要表现在改变虫媒的地区分布,增加虫媒繁殖速度与侵袭力和缩短病原体的外潜伏期.大量资料显示,全球气候变暖的趋势使得许多热带生物不断扩大分布范围,过去仅在热带地区出现的虫媒传染病,也频频出现在亚热带地区.媒介生物性疾病近年在全球呈上升趋势,一些原有的虫媒传染病再度暴发,新的虫媒传染病流行范围不断扩大.受气候变化影响较大的虫媒传染病包括疟疾、血吸虫病、鼠疫、登革热和其他及新发虫媒传染病.提示要面对气候变暖的趋势,努力减缓和控制地球气温的上升,保护好自然环境,加强气候与虫媒传染病传播关系的研究,做好虫媒传染疾病的预防控制工作.

  16. Integrated epidemiology for vector-borne zoonoses

    OpenAIRE

    Wardrop, Nicola

    2015-01-01

    The development and application of interventions for the control of vector-borne zoonoses requires broad understanding of epidemiological linkages between vector, animal infection and human infection. However, there are significant gaps in our understanding of these linkages and a lack of appropriate data poses a considerable barrier to addressing this issue. A move towards strengthened surveillance of vectors and disease in both animal and human hosts, in combination with linked human-animal...

  17. Emerging vector-borne diseases and environmental change: The rise of Lyme borreliosis in Western-Europe

    OpenAIRE

    Huitema, Tim

    2013-01-01

    SUMMARY During the last decade several infectious diseases started to emerge in Western-Europe. At the same time numerous environmental factors were changing. One of the diseases that apparently emerged is Lyme borreliosis (LB). This thesis aims to incre

  18. Emerging vector-borne diseases and environmental change : The rise of Lyme borreliosis in Western-Europe

    NARCIS (Netherlands)

    Huitema, Tim

    2013-01-01

    SUMMARY During the last decade several infectious diseases started to emerge in Western-Europe. At the same time numerous environmental factors were changing. One of the diseases that apparently emerged is Lyme borreliosis (LB). This thesis aims to incre

  19. Characterizing Open Water Bodies and Their Color Properties Through Optical Remote Sensing to Identify Areas of Vector-Borne Disease Risk

    Science.gov (United States)

    Podest, E.; De La Torre Juarez, M.; McDonald, K. C.; Jensen, K.; Ceccato, P.

    2014-12-01

    Predicting the risk of vector-borne disease outbreaks is a required step towards their control and eradication. Satellite observations can provide needed data to support agency decisions with respect to deployment of preventative measures and control resources. The coverage and persistence of open water is one of the primary indicators of conditions suitable for mosquito breeding habitats. This is currently a poorly measured variable due to its spatial and temporal variability across landscapes, especially in remote areas. Here we develop a methodology for monitoring these conditions through optical remote sensing images from Landsat. We pansharpen the images and apply a decision tree classification approach using Random Forests to generate 15 meter resolution maps of open water. In addition, since some mosquitos breed in clear water while others in turbid water, we classify water bodies according to their water color properties and we validate the results using field knowledge. We focus in East Africa where we assses the usefulness of these products to improve prediction of malaria outbreaks. Portions of this work were carried out at the Jet Propulsion Laboratory, California Institute of Technology, under contract with the National Aeronautics and Space Administration.

  20. Status of pesticide management in the practice of vector control: a global survey in countries at risk of malaria or other major vector-borne diseases

    Directory of Open Access Journals (Sweden)

    Tan Soo

    2011-05-01

    Full Text Available Abstract Background It is critical that vector control pesticides are used for their acceptable purpose without causing adverse effects on health and the environment. This paper provides a global overview of the current status of pesticides management in the practice of vector control. Methods A questionnaire was distributed to WHO member states and completed either by the director of the vector-borne disease control programme or by the national manager for vector control. In all, 113 countries responded to the questionnaire (80% response rate, representing 94% of the total population of the countries targeted. Results Major gaps were evident in countries in pesticide procurement practices, training on vector control decision making, certification and quality control of pesticide application, monitoring of worker safety, public awareness programmes, and safe disposal of pesticide-related waste. Nevertheless, basic conditions of policy and coordination have been established in many countries through which the management of vector control pesticides could potentially be improved. Most countries responded that they have adopted relevant recommendations by the WHO. Conclusions Given the deficiencies identified in this first global survey on public health pesticide management and the recent rise in pesticide use for malaria control, the effectiveness and safety of pesticide use are being compromised. This highlights the urgent need for countries to strengthen their capacity on pesticide management and evidence-based decision making within the context of an integrated vector management approach.

  1. Use of Remote Sensing Surveillance to Monitor Environmental Parameters Associated with Mosquito Abundance and Vector-borne Diseases

    Science.gov (United States)

    1996-01-01

    Lymphatic filariasis persists as a major cause of clinical morbidity and a significant impediment to socioeconomic development in various parts of the world including Egypt. In Egypt, filariasis has been endemic since time immemorial. Early epidemiologic studies identified Culex pipiens L. as the main vector of the disease and also showed that the geographic distribution of the disease is highly focal and concentrated in lower Egypt. Between 1950 and 1965, a large scale filariasis control program was carried out by the Egyptian Ministry of Health (EMOH) in the endemic areas. Control efforts led to a steady decrease of the disease in areas of the country previously identified as endemic. However, spot surveys conducted in various parts of the Nile Delta during the 1970's and 1980's revealed that the downward trend of the disease had stopped and that the prevalence and intensity of microfilaraemia had increased.

  2. Assessing the Mismatch Between Incubation and Latent Periods for Vector-Borne Diseases: The Case of Sharka.

    Science.gov (United States)

    Rimbaud, Loup; Dallot, Sylvie; Delaunay, Agnès; Borron, Sonia; Soubeyrand, Samuel; Thébaud, Gaël; Jacquot, Emmanuel

    2015-11-01

    The relative durations of the incubation period (the time between inoculation and symptom expression) and of the latent period (the time between inoculation and infectiousness of the host) are poorly documented for plant diseases. However, the extent of asynchrony between the ends of these two periods (i.e., their mismatch) can be a key determinant of the epidemic dynamics for many diseases and consequently it is of primary interest in the design of disease management strategies. In order to assess this mismatch, an experimental approach was developed and applied using sharka, a severe disease caused by Plum pox virus (PPV, genus Potyvirus, family Potyviridae) affecting trees belonging to the genus Prunus. Leaves of infected young peach trees were used individually as viral sources in aphid-mediated transmission tests carried out at different time points postinoculation in order to bracket symptom onset. By fitting a nonlinear logistic model to the obtained transmission rates, we demonstrated that the first symptoms appear on leaves 1 day before they rapidly become infectious. In addition, among symptomatic leaves, symptom intensity and transmission rate are positively correlated. These results strengthen the conclusion that, under our experimental conditions, incubation and latent periods of PPV infection are almost synchronous. PMID:26512749

  3. International Network for Capacity Building for the Control of Emerging Viral Vector-Borne Zoonotic Diseases: Arbo-Zoonet

    NARCIS (Netherlands)

    Ahmed, J.; Bouloy, M.; Ergonul, O.; Fooks, A.R.; Paweska, J.; Chevalier, V.; Drosten, C.; Moormann, R.J.M.; Tordo, N.; Vatansever, Z.; Calistri, P.; Estrada-Pena, A.; Mirazimi, A.; Unger, H.; Yin, H.; Seitzer, U.

    2009-01-01

    Arboviruses are arthropod-borne viruses, which include West Nile fever virus (WNFV), a mosquito-borne virus, Rift Valley fever virus (RVFV), a mosquito-borne virus, and Crimean-Congo haemorrhagic fever virus (CCHFV), a tick-borne virus. These arthropod-borne viruses can cause disease in different do

  4. Geographic and ecologic heterogeneity in elimination thresholds for the major vector-borne helminthic disease, lymphatic filariasis

    OpenAIRE

    Remais Justin; Kazura James; Tisch Daniel; Bockarie Moses; Gambhir Manoj; Spear Robert; Michael Edwin

    2010-01-01

    Abstract Background Large-scale intervention programmes to control or eliminate several infectious diseases are currently underway worldwide. However, a major unresolved question remains: what are reasonable stopping points for these programmes? Recent theoretical work has highlighted how the ecological complexity and heterogeneity inherent in the transmission dynamics of macroparasites can result in elimination thresholds that vary between local communities. Here, we examine the empirical ev...

  5. Vector Borne Infections in Italy: Results of the Integrated Surveillance System for West Nile Disease in 2013

    OpenAIRE

    Christian Napoli; Simona Iannetti; Caterina Rizzo; Antonino Bella; Daria Di Sabatino; Rossana Bruno; Francesca Sauro; Vanessa Martini; Vincenzo Ugo Santucci; Silvia Declich; Paolo Calistri

    2015-01-01

    The epidemiology of West Nile disease (WND) is influenced by multiple ecological factors and, therefore, integrated surveillance systems are needed for early detecting the infection and activating consequent control actions. As different animal species have different importance in the maintenance and in the spread of the infection, a multispecies surveillance approach is required. An integrated and comprehensive surveillance system is in place in Italy aiming at early detecting the virus intr...

  6. Virtual globes and geospatial health: the potential of new tools in the management and control of vector-borne diseases

    Directory of Open Access Journals (Sweden)

    Anna-Sofie Stensgaard

    2009-05-01

    Full Text Available The rapidly growing field of three-dimensional software modeling of the Earth holds promise for applications in the geospatial health sciences. Easy-to-use, intuitive virtual globe technologies such as Google Earth™ enable scientists around the world to share their data and research results in a visually attractive and readily understandable fashion without the need for highly sophisticated geographical information systems (GIS or much technical assistance. This paper discusses the utility of the rapid and simultaneous visualization of how the agents of parasitic diseases are distributed, as well as that of their vectors and/or intermediate hosts together with other spatially-explicit information. The resulting better understanding of the epidemiology of infectious diseases, and the multidimensional environment in which they occur, are highlighted. In particular, the value of Google Earth™, and its web-based pendant Google Maps™, are reviewed from a public health view point, combining results from literature searches and experiences gained thus far from a multidisciplinary project aimed at optimizing schistosomiasis control and transmission surveillance in sub-Saharan Africa. Although the basic analytical capabilities of virtual globe applications are limited, we conclude that they have considerable potential in the support and promotion of the geospatial health sciences as a userfriendly, straightforward GIS tool for the improvement of data collation, visualization and exploration. The potential of these systems for data sharing and broad dissemination of scientific research and results is emphasized.

  7. Two step male release strategy using transgenic mosquito lines to control transmission of vector-borne diseases.

    Science.gov (United States)

    Carvalho, Danilo Oliveira; Costa-da-Silva, André Luis; Lees, Rosemary Susan; Capurro, Margareth Lara

    2014-04-01

    Mosquitoes are responsible for the transmission of pathogens that cause devastating human diseases such as malaria and dengue. The current increase in mean global temperature and changing sea level interfere with precipitation frequency and some other climatic conditions which, in general, influence the rate of development of insects and etiologic agents causing acceleration as the temperature rises. The most common strategy employed to combat target mosquito species is the Integrated Vector Management (IVM), which comprises the use of multiple activities and various approaches to preventing the spread of a vector in infested areas. IVM programmes are becoming ineffective; and the global scenario is threatening, requiring new interventions for vector control and surveillance. Not surprisingly, there is a growing need to find alternative methods to combat the mosquito vectors. The possibility of using transgenic mosquitoes to fight against those diseases has been discussed over the last two decades and this use of transgenic lines to suppress populations or to replace them is still under investigation through field and laboratory trials. As an alternative, the available transgenic strategies could be improved by coupling suppression and substitution strategies. The idea is to first release a suppression line to significantly reduce the wild population, and once the first objective is reached a second release using a substitution line could be then performed. Examples of targeting this approach against vectors of malaria and dengue are discussed. PMID:24513036

  8. Geographic and ecologic heterogeneity in elimination thresholds for the major vector-borne helminthic disease, lymphatic filariasis

    Directory of Open Access Journals (Sweden)

    Remais Justin

    2010-03-01

    Full Text Available Abstract Background Large-scale intervention programmes to control or eliminate several infectious diseases are currently underway worldwide. However, a major unresolved question remains: what are reasonable stopping points for these programmes? Recent theoretical work has highlighted how the ecological complexity and heterogeneity inherent in the transmission dynamics of macroparasites can result in elimination thresholds that vary between local communities. Here, we examine the empirical evidence for this hypothesis and its implications for the global elimination of the major macroparasitic disease, lymphatic filariasis, by applying a novel Bayesian computer simulation procedure to fit a dynamic model of the transmission of this parasitic disease to field data from nine villages with different ecological and geographical characteristics. Baseline lymphatic filariasis microfilarial age-prevalence data from three geographically distinct endemic regions, across which the major vector populations implicated in parasite transmission also differed, were used to fit and calibrate the relevant vector-specific filariasis transmission models. Ensembles of parasite elimination thresholds, generated using the Bayesian fitting procedure, were then examined in order to evaluate site-specific heterogeneity in the values of these thresholds and investigate the ecological factors that may underlie such variability Results We show that parameters of density-dependent functions relating to immunity, parasite establishment, as well as parasite aggregation, varied significantly between the nine different settings, contributing to locally varying filarial elimination thresholds. Parasite elimination thresholds predicted for the settings in which the mosquito vector is anopheline were, however, found to be higher than those in which the mosquito is culicine, substantiating our previous theoretical findings. The results also indicate that the probability that the

  9. The emergence and maintenance of vector-borne diseases in the Khyber Pakhtunkhwa Province (KPK and the Federally Administered Tribal Areas (FATA of Pakistan

    Directory of Open Access Journals (Sweden)

    Nathan Christopher Nieto

    2012-07-01

    Full Text Available Human populations throughout much of the world are experiencing unprecedented changes in their relationship to the environment and their interactions with the animals with which so many humans are intimately dependent upon. These changes result not only from human induced changes in the climate, but also from population demographic changes due to wars, social unrest, behavioral changes resulting from cultural mixing, and large changes in land-use practices. Each of these social shifts can affect the maintenance and emergence of arthropod vectors disease or the pathogenic organisms themselves. A good example is the country of Pakistan, with a large rural population and developing urban economy, it also maintains a wide diversity of entomological disease vectors, including biting flies, mosquitoes, and ticks. Pathogens endemic to the region include the agents of piroplasmosis, rickettsiosis, spirocheteosis, and viral hemorrhagic fevers and encephalitis. The northwestern region of the country, including the Khyber Pakhtunkhwa Province (KPK, formerly the North-West Frontier Provence (NWFP, and the Federally Administered Tribal Areas (FATA are mountainous regions with a high degree of habitat diversity that has recently undergone a massive increase in human population density due to an immigrating refugee population from neighboring war-torn Afghanistan. Vector-borne diseases in people and livestock are common in KPK and FATA regions due to the limited use of vector control measures and access to livestock vaccines. The vast majority of people in this region live in abject poverty with >70% of the population living directly from production gained in animal husbandry. In many instances whole families live directly alongside their animal counterparts. In addition, there is little to no awareness of the threat posed by ticks and transmission of either zoonotic or veterinary pathogens. Recent emergence of Crimean-Congo hemorrhagic fever virus in rural

  10. Vector Borne Infections in Italy: Results of the Integrated Surveillance System for West Nile Disease in 2013

    Directory of Open Access Journals (Sweden)

    Christian Napoli

    2015-01-01

    Full Text Available The epidemiology of West Nile disease (WND is influenced by multiple ecological factors and, therefore, integrated surveillance systems are needed for early detecting the infection and activating consequent control actions. As different animal species have different importance in the maintenance and in the spread of the infection, a multispecies surveillance approach is required. An integrated and comprehensive surveillance system is in place in Italy aiming at early detecting the virus introduction, monitoring the possible infection spread, and implementing preventive measures for human health. This paper describes the integrated surveillance system for WND in Italy, which incorporates data from veterinary and human side in order to evaluate the burden of infection in animals and humans and provide the public health authorities at regional and national levels with the information needed for a fine tune response.

  11. A reduce and replace strategy for suppressing vector-borne diseases: insights from a stochastic, spatial model.

    Directory of Open Access Journals (Sweden)

    Kenichi W Okamoto

    Full Text Available Two basic strategies have been proposed for using transgenic Aedes aegypti mosquitoes to decrease dengue virus transmission: population reduction and population replacement. Here we model releases of a strain of Ae. aegypti carrying both a gene causing conditional adult female mortality and a gene blocking virus transmission into a wild population to assess whether such releases could reduce the number of competent vectors. We find this "reduce and replace" strategy can decrease the frequency of competent vectors below 50% two years after releases end. Therefore, this combined approach appears preferable to releasing a strain carrying only a female-killing gene, which is likely to merely result in temporary population suppression. However, the fixation of anti-pathogen genes in the population is unlikely. Genetic drift at small population sizes and the spatially heterogeneous nature of the population recovery after releases end prevent complete replacement of the competent vector population. Furthermore, releasing more individuals can be counter-productive in the face of immigration by wild-type mosquitoes, as greater population reduction amplifies the impact wild-type migrants have on the long-term frequency of the anti-pathogen gene. We expect the results presented here to give pause to expectations for driving an anti-pathogen construct to fixation by relying on releasing individuals carrying this two-gene construct. Nevertheless, in some dengue-endemic environments, a spatially heterogeneous decrease in competent vectors may still facilitate decreasing disease incidence.

  12. Enhanced vector borne disease surveillance of California Culex mosquito populations reveals spatial and species-specific barriers of infection.

    Energy Technology Data Exchange (ETDEWEB)

    VanderNoot, Victoria A.; Curtis, Deanna Joy; Koh, Chung-Yan; Brodsky, Benjamin H; Lane, Todd

    2014-08-01

    Monitor i ng in f ectio n s in v ect o rs su c h as m osquit o es, s a nd fl i es, tsetse fl i es, a nd ticks to i denti f y hu m a n path o gens m a y s e r v e as a n ear l y w arn i ng det e ction system t o dir e ct loc a l g o v er n ment dise a se pr e v en t i v e m easu r e s . One major hurdle i n de t ection is the abi l i t y to scre e n l arge n u mbers of v e c t ors for h uman patho g ens w i thout t h e u s e of ge n o t y pe - s p ecific m o lecu l ar tec h nique s . N e x t genera t ion s equ e nc i ng (NG S ) pr o v i des a n unbi a sed p latfo r m capab l e of identi f y i ng k n o w n a n d unk n o w n p ath o ge n s circula t ing w i thin a v e ctor p opul a tion, but utili z ing t h is te c h nolo g y i s tim e - con s u ming a n d cos t l y for v ecto r -b o rne disease su r v e illan c e pr o gra m s. T o addr e s s this w e d e v e lop e d cos t -eff e ct i v e Ilumina(r) R NA- S eq l i bra r y p r epara t ion m e thodol o gies i n con j u n ction w i t h an automa t ed c ompu t at i onal a n a l y sis pipel i n e to ch a racter i ze t h e microbial popula t ions c ircula t i n g in Cu l e x m o squit o e s (Cul e x qui n quef a s c iatu s , C ul e x quinq u efasc i atus / pip i ens co m pl e x h y bri d s, and C u l e x ta r salis ) t hroug h out Californ i a. W e assembled 2 0 n o vel a n d w e l l -do c ume n ted a r b o v i ruses repres e nting mem b e rs of B u n y a v ir i da e , F l a v i virid a e, If a virida e , Meson i v i rida e , Nid o v iri d ae, O rtho m y x o virid a e, Pa r v o v iri d ae, Re o virid a e, R h a b d o v i rid a e, T y m o v iri d ae, a s w ell as s e v e r al u n assi g n e d v irus e s . In addit i o n, w e m app e d mRNA s pecies to d i vergent s peci e s of t r y panos o ma a nd pl a s modium eu k a r yotic parasit e s and cha r a c terized t he p r oka r yot i c microb i al c o mposit i on to i d enti f y bacteri a l tran s c r ipts der i v ed from wolba c hia, clo s tridi u m, m y c oplas m a, fusoba c

  13. The emergence and maintenance of vector-borne diseases in the khyber pakhtunkhwa province, and the federally administered tribal areas of pakistan.

    Science.gov (United States)

    Nieto, Nathan C; Khan, Khalid; Uhllah, Ghufran; Teglas, Mike B

    2012-01-01

    Human populations throughout much of the world are experiencing unprecedented changes in their relationship to the environment and their interactions with the animals with which so many humans are intimately dependent upon. These changes result not only from human induced changes in the climate, but also from population demographic changes due to wars, social unrest, behavioral changes resulting from cultural mixing, and large changes in land-use practices. Each of these social shifts can affect the maintenance and emergence of arthropod vectors disease or the pathogenic organisms themselves. A good example is the country of Pakistan, with a large rural population and developing urban economy, it also maintains a wide diversity of entomological disease vectors, including biting flies, mosquitoes, and ticks. Pathogens endemic to the region include the agents of piroplasmosis, rickettsiosis, spirochetosis, and viral hemorrhagic fevers and encephalitis. The northwestern region of the country, including the Khyber Pakhtunkhwa Province (KPK), formerly the North-West Frontier Provence (NWFP), and the Federally Administered Tribal Areas (FATA) are mountainous regions with a high degree of habitat diversity that has recently undergone a massive increase in human population density due to an immigrating refugee population from neighboring war-torn Afghanistan. Vector-borne diseases in people and livestock are common in KPK and FATA regions due to the limited use of vector control measures and access to livestock vaccines. The vast majority of people in this region live in abject poverty with >70% of the population living directly from production gained in animal husbandry. In many instances whole families live directly alongside their animal counterparts. In addition, there is little to no awareness of the threat posed by ticks and transmission of either zoonotic or veterinary pathogens. Recent emergence of Crimean-Congo hemorrhagic fever virus in rural populations

  14. Trends in Malaria in Odisha, India—An Analysis of the 2003–2013 Time-Series Data from the National Vector Borne Disease Control Program

    Science.gov (United States)

    Pradhan, Madan Mohan; AK, Kavitha; Kar, Priyanka; Sahoo, Krushna Chandra; Panigrahi, Pinaki; Dutta, Ambarish

    2016-01-01

    Background Although Odisha is the largest contributor to the malaria burden in India, no systematic study has examined its malaria trends. Hence, the spatio-temporal trends in malaria in Odisha were assessed against the backdrop of the various anti-malaria strategies implemented in the state. Methods Using the district-wise malaria incidence and blood examination data (2003–2013) from the National Vector Borne Disease Control Program, blood examination-adjusted time-trends in malaria incidence were estimated and predicted for 2003–2013 and 2014–2016, respectively. An interrupted time series analysis using segmented regression was conducted to compare the disease trends between the pre (2003–2007) and post-intensification (2009–2013) periods. Key-informant interviews of state stakeholders were used to collect the information on the various anti-malaria strategies adopted in the state. Results The state annual malaria incidence declined from 10.82/1000 to 5.28/1000 during 2003–2013 (adjusted annual decline: -0.54/1000, 95% CI: -0.78 to -0.30). However, the annual blood examination rate remained almost unchanged from 11.25% to 11.77%. The keyinformants revealed that intensification of anti-malaria activities in 2008 led to a more rapid decline in malaria incidence during 2009–2013 as compared to that in 2003–2007 [adjusted decline: -0.83 (-1.30 to -0.37) and -0.27 (-0.41 to -0.13), respectively]. There was a significant difference in the two temporal slopes, i.e., -0.054 (-0.10 to -0.002, p = 0.04) per 1000 population per month, between these two periods, indicating almost a 200% greater decline in the post-intensification period. Although, the seven southern high-burden districts registered the highest decline, they continued to remain in that zone, thereby, making the achievement of malaria elimination (incidence <1/1000) unlikely by 2017. Conclusion The anti-malaria strategies in Odisha, especially their intensification since 2008, have helped

  15. Emerging and re-emerging vector-borne diseases: present status and strategies%新发和重现虫媒病:流行现状及应对策略

    Institute of Scientific and Technical Information of China (English)

    陈海婴; 马红梅; 刘明斌; 蒋洪

    2011-01-01

    Following the warming of climate, globalization, urbanization, insect drug-resistant as well as other social and environmental changing factors, malaria, dengue fever, West Nile fever and other vectorborne diseases emerge and re-emerge continuously. The threats of vectors and vector-borne diseases are increasing. However, owing to the environmental protection policies, more and more pesticides are forbidden, control of vectors and vector-borne diseases are facing with severe challenges. The research development and epidemic status of several important vector-borne diseases were reviewed in this paper. The framework of vector management stratogy,intervention of governments and sustainable vector control technologies were also introduced in the paper.%气候变暖、全球化和城市化推进、媒介昆虫抗药性等因素导致疟疾、登革热、莱姆病、西尼罗热、基孔肯雅热、巴尔通体感染等新出现和再次肆虐的虫媒病流行,全球媒介生物和虫媒病的威胁持续上升.由于环保的要求,可以选择的卫生杀虫剂品种逐渐减少,媒介生物和虫媒病的控制面临严重的挑战.该文综述了近年来全球新发和重现的重要虫媒病的研究进展和流行现状,并阐述了媒介生物综合治理全球策略框架、政府干预措施及媒介生物可持续控制技术等应对策略.

  16. Prevalence of vector-borne pathogens in dogs from Haiti.

    Science.gov (United States)

    Starkey, Lindsay A; Newton, Kassie; Brunker, Jill; Crowdis, Kelly; Edourad, Emile Jean Pierre; Meneus, Pedro; Little, Susan E

    2016-07-15

    Canine vector-borne pathogens are common on some Caribbean islands, but survey data in Haiti are lacking. To determine the prevalence of selected vector-borne pathogens in dogs from Haiti, we tested blood samples collected from 210 owned dogs, 28 (13.3%) of which were infested with Rhipicephalus sanguineus ticks at the time of blood collection. No other tick species were identified on these dogs. A commercially available ELISA identified antibodies to Ehrlichia spp. in 69 (32.9%), antibodies to Anaplasma spp. in 37 (17.6%), and antigen of Dirofilaria immitis in 55 (26.2%); antibodies to Borrelia burgdorferi were not detected in any sample. Molecular assays of whole blood from 207 of the dogs confirmed infection with Ehrlichia canis (15; 7.2%), Anaplasma platys (13; 6.3%), D. immitis (46; 22.2%), Wolbachia spp. (45; 21.7%), Babesia vogeli (16; 7.7%), and Hepatozoon canis (40; 19.3%), but Anaplasma phagocytophilum, Babesia canis, Babesia rossi, Babesia gibsoni, Ehrlichia chaffeensis, Ehrlichia ewingii, or Hepatozoon americanum were not detected. Co-infection with two or more vector-borne pathogens was detected by serology in 42 (20.0%) dogs and by molecular assays in 22 (10.6%) dogs; one dog was co-infected with B. vogeli and E. canis as detected by PCR with D. immitis detected by serology (antigen). Overall, evidence of past or current infection with at least one vector-borne pathogen was identified in 142/210 (67.6%) dogs in this study, underscoring the common nature of these pathogens, some of which are zoonotic, in Haiti. PMID:27270383

  17. Exposure to vector-borne pathogens in candidate blood donor and free-roaming dogs of northeast Italy

    OpenAIRE

    Vascellari, Marta; Ravagnan, Silvia; Carminato, Antonio; Cazzin, Stefania; Carli, Erika; Da Rold, Graziana; Lucchese, Laura; Natale, Alda; Otranto, Domenico; Capelli, Gioia

    2016-01-01

    Background Many vector-borne pathogens including viruses, bacteria, protozoa and nematodes occur in northeast Italy, representing a potential threat to animal and human populations. Little information is available on the circulation of the above vector-borne pathogens in dogs. This work aims to (i) assess exposure to and circulation of pathogens transmitted to dogs in northeast Italy by ticks, sandflies, and mosquitoes, and (ii) drive blood donor screening at the newly established canine bloo...

  18. Differential cell line susceptibility to the emerging Zika virus: implications for disease pathogenesis, non-vector-borne human transmission and animal reservoirs.

    Science.gov (United States)

    Chan, Jasper Fuk-Woo; Yip, Cyril Chik-Yan; Tsang, Jessica Oi-Ling; Tee, Kah-Meng; Cai, Jian-Piao; Chik, Kenn Ka-Heng; Zhu, Zheng; Chan, Chris Chung-Sing; Choi, Garnet Kwan-Yue; Sridhar, Siddharth; Zhang, Anna Jinxia; Lu, Gang; Chiu, Kin; Lo, Amy Cheuk-Yin; Tsao, Sai-Wah; Kok, Kin-Hang; Jin, Dong-Yan; Chan, Kwok-Hung; Yuen, Kwok-Yung

    2016-01-01

    Zika virus (ZIKV) is unique among human-pathogenic flaviviruses by its association with congenital anomalies and trans-placental and sexual human-to-human transmission. Although the pathogenesis of ZIKV-associated neurological complications has been reported in recent studies, key questions on the pathogenesis of the other clinical manifestations, non-vector-borne transmission and potential animal reservoirs of ZIKV remain unanswered. We systematically characterized the differential cell line susceptibility of 18 human and 15 nonhuman cell lines to two ZIKV isolates (human and primate) and dengue virus type 2 (DENV-2). Productive ZIKV replication (⩾2 log increase in viral load, ZIKV nonstructural protein-1 (NS1) protein expression and cytopathic effects (CPE)) was found in the placental (JEG-3), neuronal (SF268), muscle (RD), retinal (ARPE19), pulmonary (Hep-2 and HFL), colonic (Caco-2),and hepatic (Huh-7) cell lines. These findings helped to explain the trans-placental transmission and other clinical manifestations of ZIKV. Notably, the prostatic (LNCaP), testicular (833KE) and renal (HEK) cell lines showed increased ZIKV load and/or NS1 protein expression without inducing CPE, suggesting their potential roles in sexual transmission with persistent viral replication at these anatomical sites. Comparatively, none of the placental and genital tract cell lines allowed efficient DENV-2 replication. Among the nonhuman cell lines, nonhuman primate (Vero and LLC-MK2), pig (PK-15), rabbit (RK-13), hamster (BHK21) and chicken (DF-1) cell lines supported productive ZIKV replication. These animal species may be important reservoirs and/or potential animal models for ZIKV. The findings in our study help to explain the viral shedding pattern, transmission and pathogenesis of the rapidly disseminating ZIKV, and are useful for optimizing laboratory diagnostics and studies on the pathogenesis and counter-measures of ZIKV. PMID:27553173

  19. Canine babesiosis: from molecular taxonomy to control

    Directory of Open Access Journals (Sweden)

    Irwin Peter J

    2009-03-01

    Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

  20. Autochthonous canine leishmaniasis in Romania: neglected or (re)emerging?

    OpenAIRE

    Mircean, Viorica; Dumitrache, Mirabela Oana; MIRCEAN, MIRCEA; Bolfa, Pompei; Györke, Adriana; Mihalca, Andrei Daniel

    2014-01-01

    Canine leishmaniasis is a vector-borne zoonotic disease caused by the protozoan parasite Leishmania infantum. In Romania between 1955 and 2013, no cases of human autochthonous visceral leishmaniasis were reported. Data regarding canine leishmaniasis is similarly scarce. Since the first report of clinical autochthonous canine leishmaniasis in 1935, there were only three sporadic reports of positive dogs all without any clinical signs. Our study reports the first clinical case of autochthonous ...

  1. Antigenic variation in vector-borne pathogens.

    OpenAIRE

    Barbour, A. G.; Restrepo, B I

    2000-01-01

    Several pathogens of humans and domestic animals depend on hematophagous arthropods to transmit them from one vertebrate reservoir host to another and maintain them in an environment. These pathogens use antigenic variation to prolong their circulation in the blood and thus increase the likelihood of transmission. By convergent evolution, bacterial and protozoal vector-borne pathogens have acquired similar genetic mechanisms for successful antigenic variation. Borrelia spp. and Anaplasma marg...

  2. Molecular evidence of vector-borne pathogens in dogs and cats and their ectoparasites in Algiers, Algeria.

    Science.gov (United States)

    Bessas, Amina; Leulmi, Hamza; Bitam, Idir; Zaidi, Sara; Ait-Oudhia, Khatima; Raoult, Didier; Parola, Philippe

    2016-04-01

    In Algeria, only limited information is currently available on the prevalence of emergent canine and feline vector-borne diseases. The aim of the present work was to detect by qPCR vector-associated bacteria in stray dogs and cats and their ectoparasites from Algiers. 18/117 (15.38%) dogs and 2/107 (1.87%) cats were positive for at least one vector-borne agent. Coxiella burnetii and Bartonella henselae were identified in 1/117 (0.85%) dog individually. Ehrlichia canis DNA was detected in 17/117 (14.52%) dogs. 1/107 (0.93%) cat was positive to C. burnetii and another 1/107 (0.93%) to B. henselae. DNA of Rickettsia massiliae, Rickettsia conorii and E. canis was detected in Rhipicephalus sanguineus. Cat fleas were infected with Rickettsia felis, B. henselae and Bartonella clarridgeiae. B. vinsonii subsp. berkhoffii was identified in Xenopsylla cheopis collected from dogs. The findings of this study indicate that dogs and cats from Algeria are exposed to multiple tick and flea-borne pathogens. PMID:27012917

  3. Strengthening public health pesticide management in countries endemic with malaria or other major vector-borne diseases: an evaluation of three strategies

    NARCIS (Netherlands)

    Berg, van den H.; Yadav, R.S.; Zaim, M.

    2014-01-01

    Background Public health pesticides has been the mainstay control of vectors of malaria and other diseases, and public health pests, but there is increasing concern over how these pesticides are being managed. Poor pesticide management could lead to risks to human health and the environment, or dimi

  4. Strengthening public health pesticide management in countries endemic with malaria or other major vector-borne diseases: an evaluation of three strategies

    OpenAIRE

    Berg, van den, W.; Yadav, R. S.; M.Zaim

    2014-01-01

    Background Public health pesticides has been the mainstay control of vectors of malaria and other diseases, and public health pests, but there is increasing concern over how these pesticides are being managed. Poor pesticide management could lead to risks to human health and the environment, or diminish the effectiveness of interventions. Strategies for strengthening the management of public health pesticides, from manufacture to disposal, should be evaluated to propose future directions. Met...

  5. Multi-agent systems in epidemiology : a first step for computational biology in the study of vector-borne disease transmission

    OpenAIRE

    Guégan Jean-François; Roche Benjamin; Bousquet François

    2008-01-01

    Abstract Background Computational biology is often associated with genetic or genomic studies only. However, thanks to the increase of computational resources, computational models are appreciated as useful tools in many other scientific fields. Such modeling systems are particularly relevant for the study of complex systems, like the epidemiology of emerging infectious diseases. So far, mathematical models remain the main tool for the epidemiological and ecological analysis of infectious dis...

  6. Concurrent infections with vector-borne pathogens associated with fatal hemolytic anemia in a cattle herd in Switzerland.

    OpenAIRE

    Hofmann-Lehmann, R.; Meli, M. L.; Dreher, U M; Gönczi, E.; Deplazes, P.; Braun, U.; Engels, M; Schüpbach, J; Jörger, K; Thoma, R; Griot, C; Stärk, K.D.C.; Willi, B; Schmidt, J.; Kocan, K.M.

    2004-01-01

    Bovine anaplasmosis is a vector-borne disease that results in substantial economic losses in other parts of the world but so far not in northern Europe. In August 2002, a fatal disease outbreak was reported in a large dairy herd in the Swiss canton of Grisons. Diseased animals experienced fever, anorexia, agalactia, and depression. Anemia, ectoparasite infestation, and, occasionally, hemoglobinuria were observed. To determine the roles of vector-borne pathogens and to characterize the disease...

  7. Assessing the sustainability of individual behavior change against mosquitoes after the outbreak of a vector-borne disease in Mauritius: a case study

    Directory of Open Access Journals (Sweden)

    Smita Goorah

    2013-01-01

    Full Text Available The island of Mauritius had not experienced any mosquito-borne diseases since the last malaria outbreak in the early 1980s. When the chikungunya fever epidemic affected the island in 2005-2006, the local population was unprepared against this mosquito-borne infection and officially 11, 000 people were affected. Authorities promptly set up public health campaigns and actively encouraged the public to take preventive actions against the mosquito vector. This study has been carried out to investigate whether the individual preventive interventions adopted to combat mosquitoes during the outbreak have been sustained two years following the outbreak in a specific rural locality. Ethical clearance was obtained from the Research Ethics Committee of the University of Mauritius. Data was collected using a door-to-door household survey in a small rural locality of Mauritius in December 2008 and January 2009. One person per household was interviewed and the sample size was 172. Sustainability of individual preventive interventions was determined by assessing the preventive measures adopted by people against mosquitoes prior to, during, and two years following the outbreak. Elimination of mosquito breeding places was the most practiced preventive measure adopted by people in all outbreak periods as compared to preventive measures against mosquito bites within and outside the house. An increase in all individual preventive measures was observed during the outbreak followed by a slow decline two years following the outbreak. An important finding was that all post-outbreak preventive measures were sustained above the pre-outbreak levels, especially so in the case of source reduction interventions. Individual efforts in the inter-epidemic period are important to mitigate the spread of a mosquito-borne infection and it is encouraging to observe in this case study that although individual preventive measures decline with time after an outbreak they are still

  8. Ecological approaches to informing public health policy and risk assessments on emerging vector-borne zoonoses

    OpenAIRE

    Medlock, Jolyon; Jameson, Lisa

    2011-01-01

    Pathogens associated with vector-borne zoonoses occur in enzootic cycles within nature. They are driven by a combination of vertebrate host and invertebrate vector population dynamics, which in turn respond to changes in environmental stimuli. Human involvement in these cycles, and hence the occurrence of human disease, is often to act as incidental host. From a public health perspective our ability to better predict human outbreaks of these diseases and prepare intervention and mitigation st...

  9. Ecological approaches to informing public health policy and risk assessments on emerging vector-borne zoonoses

    OpenAIRE

    Medlock, JM; Jameson, LJ

    2010-01-01

    Pathogens associated with vector-borne zoonoses occur in enzootic cycles within nature. They are driven by a combination of vertebrate host and invertebrate vector population dynamics, which in turn respond to changes in environmental stimuli. Human involvement in these cycles, and hence the occurrence of human disease, is often to act as incidental host. From a public health perspective our ability to better predict human outbreaks of these diseases and prepare intervention and mitigation st...

  10. Surveillance of zoonotic and infectious diseases in Ecuador: implications for special operations forces medical operations, personnel, and canines.

    Science.gov (United States)

    McCown, Michael; Monterroso, Victor H; Grzeszak, Benjamin

    2011-01-01

    Vector-borne diseases (VBD) make up a large number of emerging infectious and zoonotic diseases. Ticks, fleas, and mosquitoes are effective vectors parasitizing canines, making dogs adequate reservoirs for zoonoses. The U.S. military deploys personnel and government-owned animals around the world with possible risk of exposure to VBD. Canine VBD have veterinary and public health significance for the host nations as well as for the U.S. troops and its working animals deployed in the theater of operations. These factors make disease surveillance a great importance. The objective of this work was to survey canines from the cities of Manta and Guayaquil in Ecuador to determine prevalence of heartworm disease (D. immitis), ehrlichi os is (E. canis), Lyme disease (B. burgdorf eri), and anapl asmosis (A. phagocytophilum). Canine blood samples (1-3ml) collected from the cities of Manta (n=50) and Guayaquil (n=50) were tested on site using a SNAPR 4DxR Test Kit. Prevalence for single or multiple disease status was calculated for each city. In the city of Manta the overall prevalence of diseases was 78%; 52% for E. canis alone, and 26% for co-infection with E. canis and A. phagocytophilum. The overall prevalence for the city of Guayaquil was 88%; 40% for E. canis alone, 22% for A. phagocytophilum alone, and 26% for co-infection with E. canis and A. phagocytophilum. Neither heartworm disease nor Lyme disease was detected in any samp le. In conclusion, this study showed the extensive presence of E. canis and A. phagocytophilum in both cities in Ecuador, emphasizing the value of surveillance for zoonotic diseases to determine disease prevalence and risk assessments, as well as to implement control measures. PMID:22173599

  11. Study of the climatic change impact on vector-borne diseases in West Africa: the case of tick-borne borreliosis and malaria; Etude de l'impact du changement climatique sur les maladies a transmission vectorielle en Afrique de l'Ouest: le cas de la borreliose a tiques et du paludisme

    Energy Technology Data Exchange (ETDEWEB)

    Trape, J.F

    2005-04-15

    Malaria and tick-borne borreliosis are the two first causes of morbidity due to vector-borne diseases in a large part of Sudan-sahelian West Africa. They are also the two tropical diseases which have been the most affected by climatic change in recent years. In the case of tick-borne borreliosis it has been shown in Senegal that the persistence of drought since the years 70 has been associated with a considerable extension of the geographic range of diseases and the vector tick A-sonrai, a species that was in the past limited to the Sahara and Sahel. In the case of malaria, drought has strongly reduced in these same regions of Africa the distribution, abundance and infection rate of Anopheline mosquitoes, but without any significant reduction of the burden of malaria for most populations concerned. The emergence and spread of Plasmodium falciparum resistance to antimalarial drugs only explain part of this phenomenon. (A.L.B.)

  12. Molecular study on selected vector-borne infections in urban stray colony cats in northern Italy.

    Science.gov (United States)

    Spada, Eva; Proverbio, Daniela; Galluzzo, Paola; Della Pepa, Alessandra; Perego, Roberta; Bagnagatti De Giorgi, Giada; Ferro, Elisabetta

    2014-08-01

    Feline vector-borne diseases can be caused by a range of pathogens transmitted by arthropods. Many of these infections have zoonotic implications, and stray cats are potential sentinels for human and pet health. This study investigated the prevalence of selected vector-borne infections in stray colony cats in Milan. Blood samples from 260 stray cats were evaluated, using conventional polymerase chain reaction tests (cPCRs), for the presence of DNA associated with Rickettsia species, Anaplasma phagocytophilum and Ehrlichia species. Positive cPCR results occurred in 127/260 subjects (48.9%; 95% confidence interval [CI] = 40.7-58.1), with a prevalence of 31.9% (83/260, 95% CI = 25.4-39.6) for Rickettsia species, 17.7% (46/260, 95% CI= 13.0-23.6) for A phagocytophilum, and 5.4% (14/260, 95% CI = 2.9-9.0) for Ehrlichia species. There was no statistical association between a positive PCR test for vector-borne infections surveyed and colony location, age, gender, body condition score or complete blood count abnormalities, nor feline immunodeficiency virus, feline leukaemia virus or Toxoplasma gondii status. The only variable linked to positive PCR results was detection of signs of ocular infection and PCR positivity for Rickettsia species (P = 0.04, odds ratio [OR] = 2.2, 95% CI = 1.1-4.4, P = 0.02). There is a significant prevalence of vector-borne infections with zoonotic potential in urban stray cats in Milan. Thus, dogs and pet cats with outdoor access should be monitored and treated for ectoparasites on a regular basis to minimise risks of disease and the potential transmission of zoonotic agents to people. PMID:24319060

  13. Diagnosis and management of canine claw diseases.

    Science.gov (United States)

    Mueller, R S

    1999-11-01

    The diagnostic workup for canine claw disease consists of a good history and complete clinical examination which may provide clues for a possible underlying disorder. In dogs with claw disease but no other clinical or historical signs, further recommended diagnostic procedures include cytological evaluation of impression smears or discharge from the claw fold, bacterial culture and sensitivity testing, biopsy of the claw matrix, and an elimination diet for 6 to 8 weeks. If no underlying disease can be identified, trial treatment with essential fatty acid supplementation, vitamin E, or a combination of doxycycline hydrochloride and niacinamide may be useful. In some patients, onychectomy of all claws may be considered. PMID:10563005

  14. Vector-borne pathogens in ticks and EDTA-blood samples collected from client-owned dogs, Kiev, Ukraine.

    Science.gov (United States)

    Hamel, Dietmar; Silaghi, Cornelia; Zapadynska, Svitlana; Kudrin, Anton; Pfister, Kurt

    2013-02-01

    Due to the availability of adequate habitats in urban environments, e.g. city parks and recreational green areas, ticks from such settings may also carry pathogens of veterinary and public health concern. Thus, tick-borne infections may readily be identified in companion animals residing in urbanised areas. To investigate the presence of vector-borne pathogens in Kiev, Ukraine, 52 engorged adult ticks, 33 Dermacentor reticulatus and 19 Ixodes ricinus, were collected from 15 dogs in the spring of 2010, and further 23 canine EDTA-blood samples were obtained in the spring of 2011 from client-owned patients presented in a veterinary clinic in Kiev. DNA of 9 pathogens was detected by PCR in ticks and canine EDTA-blood samples: Babesia canis canis, Anaplasma phagocytophilum, Rickettsia helvetica, Ri. monacensis, Ri. raoultii, and Dirofilaria repens (by proxy) were identified in engorged ticks and B. c. canis, Hepatozoon canis, Di. immitis, Di. repens, and Mycoplasma haemocanis in canine EDTA-blood samples. This is the first description of Ri. raoultii in the Ukraine. This study adds information on the occurrence of vector-borne pathogens of veterinary and public health importance in Kiev, Ukraine. PMID:23069260

  15. Broad patterns in domestic vector-borne Trypanosoma cruzi transmission dynamics: synanthropic animals and vector control

    OpenAIRE

    Peterson, Jennifer K.; Bartsch, Sarah M.; Lee, Bruce Y.; Dobson, Andrew P.

    2015-01-01

    Background Chagas disease (caused by Trypanosoma cruzi) is the most important neglected tropical disease (NTD) in Latin America, infecting an estimated 5.7 million people in the 21 countries where it is endemic. It is one of the NTDs targeted for control and elimination by the 2020 London Declaration goals, with the first goal being to interrupt intra-domiciliary vector-borne T. cruzi transmission. A key question in domestic T. cruzi transmission is the role that synanthropic animals play in ...

  16. Nutraceuticals for canine liver disease: assessing the evidence.

    Science.gov (United States)

    Vandeweerd, Jean-Michel; Cambier, Carole; Gustin, Pascal

    2013-09-01

    Nutraceuticals, or nutritional supplements, have been promoted for the ancillary treatment of liver disease in dogs. However, minimal information is available in the scientific literature about commonly used nutraceuticals, such as S-adenosylmethionine, silymarin, and vitamin E. No strong clinical evidence exists regarding the efficacy of these compounds as hepatoprotectants in canine liver disease. Until this evidence exists, individual veterinarians must assume responsibility for their decision to use nutritional supplements in their canine patients with liver disease. PMID:23890245

  17. Vector-borne pathogens in dogs from Costa Rica: first molecular description of Babesia vogeli and Hepatozoon canis infections with a high prevalence of monocytic ehrlichiosis and the manifestations of co-infection.

    Science.gov (United States)

    Rojas, Alicia; Rojas, Diana; Montenegro, Víctor; Gutiérrez, Ricardo; Yasur-Landau, Daniel; Baneth, Gad

    2014-01-31

    Infection with canine vector-borne pathogens was evaluated in dogs from four different regions of Costa Rica by PCR. Demographic data, clinical signs, packed cell volume values, and the presence of tick infestation were recorded for each dog. Forty seven percent (69/146) of the dogs were infected with at least one pathogen and 12% were co-infected with two pathogens. Ehrlichia canis was detected in 34%, Anaplasma platys in 10%, Babesia vogeli in 8%, and Hepatozoon canis in 7.5% of the blood samples. No infection was detected with Leishmania spp. in blood, skin scrapings or conjunctival swabs. Thirty percent of the dogs presented at least one clinical sign compatible with vector-borne disease, and of those, 66% were infected with a pathogen. Subclinical infections were determined in 58% of the infected dogs including 82% (9/11), 58% (29/50), 42% (5/12) and 36% (5/14) of the dogs with H. canis, E. canis, B. vogeli and A. platys infections, respectively. A distinct relationship was found between infection and anemia. The mean PCV values were 34.4% in dogs with no infection, 31.5% in those who had a single infection and 23% in those with co-infection. Co-infected dogs had significantly lower PCV values compared to non-infected and single-infected dogs (pticks, 82% of them were infested with Rhipicephalus sanguineus sensu lato and 18% with Amblyomma ovale. Dogs infected with A. platys, B. vogeli, or E. canis were significantly associated with R. sanguineus s.l. infestation (pdescription of infections with B. vogeli and H. canis in Costa Rica as well as in Central America. The results of this study indicate that multiple vector-borne pathogens responsible for severe diseases infect dogs in Costa Rica and therefore, increased owner and veterinarian awareness are needed. Moreover, prevention of tick infestation is recommended to decrease the threat of these diseases to the canine population. PMID:24315693

  18. La reforma del sector salud, descentralización, prevención y control de enfermedades transmitidas por vectores Health system, decentralization, and the control of vector-borne diseases

    Directory of Open Access Journals (Sweden)

    Gabriel A. Schmunis

    2000-01-01

    Full Text Available Con las nuevas macropolíticas mundiales, la salud en América Latina ha sufrido importante transición en direción a la decentralización, sin compatibilizar la salud pública con la lógica de las economías de mercado. Con esto, el control decentralizado de las enfermedades endémicas presenta dificultades políticas y operativas. Aunque la decentralización se justifica por los presupuestos teóricos, no hay tradición de este control en los niveles municipales, lo que dificulta la simple o burocrática transferencia de encargos para estos niveles. La falta de expertise, el turn-over político y la corrupción son dificultades adicionales, conllevando a una extinción de varias instituiciones y programas. La falta de efectividad en el enfrentamiento del dengue, de la malaria y de la enfermedad de Chagas son algunos ejemplos. Requierese una modernización con responsabilidad, con una transición compartida entre los niveles y garantizada por acciones continuadas. Sugierese mantener estructuras regionales para referencia, consolidación epidemiológica, normatización, capacitación y supervisión, incluso con reserva técnica para acciones finalísticas supletivas.Economic policies are changing Latin American health programs, particularly promoting decentralization. Numerous difficulties thus arise for the control of endemic diseases, since such activities traditionally depend on vertical, and centralized structures. Theoretical arguments in favor of decentralization notwithstanding, no such tradition exists at the county level. The lack of program expertise at peripheral levels, intensive staff turnover, and even corruption are additional difficulties. Hence, the simple bureaucratic transfer of activities from the Federal to county level is often irresponsible. The loss of priority for control of endemic diseases in Latin America may mean the inexorable extinction of traditional control services. Malaria, dengue fever, and Chagas disease

  19. The role of human movement in the transmission of vector-borne pathogens.

    Directory of Open Access Journals (Sweden)

    Steven T Stoddard

    Full Text Available BACKGROUND: Human movement is a key behavioral factor in many vector-borne disease systems because it influences exposure to vectors and thus the transmission of pathogens. Human movement transcends spatial and temporal scales with different influences on disease dynamics. Here we develop a conceptual model to evaluate the importance of variation in exposure due to individual human movements for pathogen transmission, focusing on mosquito-borne dengue virus. METHODOLOGY AND PRINCIPAL FINDINGS: We develop a model showing that the relevance of human movement at a particular scale depends on vector behavior. Focusing on the day-biting Aedes aegypti, we illustrate how vector biting behavior combined with fine-scale movements of individual humans engaged in their regular daily routine can influence transmission. Using a simple example, we estimate a transmission rate (R(0 of 1.3 when exposure is assumed to occur only in the home versus 3.75 when exposure at multiple locations--e.g., market, friend's--due to movement is considered. Movement also influences for which sites and individuals risk is greatest. For the example considered, intriguingly, our model predicts little correspondence between vector abundance in a site and estimated R(0 for that site when movement is considered. This illustrates the importance of human movement for understanding and predicting the dynamics of a disease like dengue. To encourage investigation of human movement and disease, we review methods currently available to study human movement and, based on our experience studying dengue in Peru, discuss several important questions to address when designing a study. CONCLUSIONS/SIGNIFICANCE: Human movement is a critical, understudied behavioral component underlying the transmission dynamics of many vector-borne pathogens. Understanding movement will facilitate identification of key individuals and sites in the transmission of pathogens such as dengue, which then may provide

  20. Prospects for controlling trypanosomosis : vector-borne diseases : trypanosomosis

    Directory of Open Access Journals (Sweden)

    G.A. Vale

    2009-09-01

    Full Text Available The best technical package for the future comprises trypanocidal drugs for temporary relief and the use of insecticide-treated cattle, artificial baits and aerial spraying to attack the vector, to so give more lasting security. Whether this can speed the previously slow progress will depend on overcoming past hindrances to tsetse control : sporadic support, disputes over its desirability, difficulties of sustaining international operations, and poor planning in some instances. The Pan-African Tsetse and Trypanosomiasis Campaign intends to speed the progress but will fail unless it improves its image by breaking its association with the sterile insect technique and quickly executing some cheap and effective operations in large areas. Even then, there could be severe brakes due to Africa's political and financial instability. Overall, the pace of control is likely to increase, but perhaps only a little.

  1. Taking the Bite Out of Vector-Borne Diseases

    Science.gov (United States)

    ... more than a million species, including insects, shrimp, spiders, mite and tiny worms. It lives and reproduces ... dengue virus. Releasing more Wolbachia into the mosquito population or finding and introducing the Wolbachia genes that ...

  2. Optimal vaccination scenarios against vector-borne diseases

    DEFF Research Database (Denmark)

    Græsbøll, Kaare; Enøe, Claes; Bødker, Rene;

    Using a process oriented semi-agent based model we simulated the spread of Bluetongue virus in Denmark. We evaluated the efficiency and minimum vaccination cover for eight different preventive vaccination strategies in Denmark. The simulation model replicates both passive and active flight....... Results in this presentation were obtained building upon the model presented in: Simulating spread of Bluetongue Virus by flying vectors between hosts on pasture. Kaare Græsbøll et al. Scientific Reports. 2:863 (2012)....... of Culicoides between hosts on pasture and stables in Denmark. Seasonal abundance of midges and temperature dependence on biological processes were included in the model. The eight vaccination scenarios comprised of: All holdings vaccinated to a given percentage, random holdings selected for vaccination, two...

  3. Optimal vaccination strategies against vector-borne diseases

    DEFF Research Database (Denmark)

    Græsbøll, Kaare; Enøe, Claes; Bødker, Rene;

    2014-01-01

    Using a process oriented semi-agent based model, we simulated the spread of Bluetongue virus by Culicoides, biting midges, between cattle in Denmark. We evaluated the minimum vaccination cover and minimum cost for eight different preventive vaccination strategies in Denmark. The simulation model...... replicates both a passive and active flight of midges between cattle distributed on pastures and cattle farms in Denmark. A seasonal abundance of midges and temperature dependence of biological processes were included in the model. The eight vaccination strategies were investigated under four different...

  4. STUDY ON RISK ANALYSIS AND MANAGEMENT FOR IMPORTED VECTOR-BORNE INFECTIOUS DISEASES AND VECTORS ON BORDER PORTS:RISK ANALYSIS%国境口岸输入性虫媒传染病及媒介生物风险分析和风险管理系统研究: 风险分析

    Institute of Scientific and Technical Information of China (English)

    曹鑫; 方志强; 张晓龙; 马立新; 赵彤言

    2012-01-01

    为在口岸传染病防控方面探索新的思路和方法,建立科学的风险评估机制,采用澳大利亚和新西兰联合开发的风险管理标准,对境外的虫媒传染病及其媒介生物传入我国口岸的风险建立评估方法和体系.结果显示,通过对国际国内传染病疫情进行有效评估,分析传染病传播模式和趋势,确定输入输出风险等级和主要防控环节,及时发出预警信息,然后有针对性地在重点地区口岸和重点环节采取措施,能够有效控制媒介生物以及携带病原体的传播.引入风险分析理论,建立风险评估机制,对有效减少传染病疫情所带来的危害,保障我国口岸公共卫生安全十分必要.%To explore the new ideas and methods and establish the scientific risk assessment mechanism using in prevention and control of infectious diseases at the ports, the methods and systems basing on the risk management standards jointly developed by Australia and New Zealand and its application assessing the risk of imported vector-borne infectious diseases and vectors were used. The results showed that according to the effective evaluation of the international and domestic epidemic situation and the analysis of infectious diseases spreading tendency, we determine the input and output risk grade and prevention and control of main parts, publish warning information and take measures in the targeted areas, ports and parts in order to effectively control the vectors and pathogens spreading. It is necessary to introduce the risk analysis theory and build the risk assessment mechanism, which are beneficial in reducing the harm caused by infectious diseases and protecting port safety.

  5. Molecular identification of bacteria associated with canine periodontal disease

    OpenAIRE

    Riggio, Marcello P.; Lennon, Alan; Taylor, David J.; Bennett, David

    2011-01-01

    Abstract Periodontal disease is one of the most common diseases of adult dogs, with up to 80% of animals affected. The aetiology of the disease is poorly studied, although bacteria are known to play a major role. The purpose of this study was to identify the bacteria associated with canine gingivitis and periodontitis and to compare this with the normal oral flora. Swabs were obtained from the gingival margin of three dogs with gingivitis and three orally healthy controls, and subg...

  6. Post-infectious glomerulonephritis presenting as acute renal failure in a patient with Lyme disease

    OpenAIRE

    Rolla, Davide; Conti, Novella; Ansaldo, Francesca; Panaro, Laura; Lusenti, Tiziano

    2013-01-01

    Introduction: We report a case of a patient with acute renal failure in Lyme disease-associated focal proliferative mesangial nephropathy. Lyme disease is a vector-borne disease caused by Borrelia burgdorferi, transmitted by the bite of an infected ixodes tick. Post-infectious glomerulonephritis (GN)secondary to Borrelia burgdorferi infection in man could be fatal, as it is in canine Lyme borreliosis. Case: A 61-year old man with chronic ethanolic hepatitis was admitted to a provincial hospit...

  7. Vector-borne pathogens in dogs and red foxes from the federal state of Brandenburg, Germany.

    Science.gov (United States)

    Liesner, Jana M; Krücken, Jürgen; Schaper, Roland; Pachnicke, Stefan; Kohn, Barbara; Müller, Elisabeth; Schulze, Christoph; von Samson-Himmelstjerna, Georg

    2016-07-15

    Dirofilaria repens is endemic in eastern and southern European regions but was recently found in Germany in dogs, mosquitoes and one human patient. Since some of the positive dog and mosquito samples were collected in Brandenburg, it was aimed to systematically assess the prevalence of D. repens and other canine vector-borne pathogens in Brandenburg. Dog owners also received a questionnaire and were asked to provide more information about the dogs including travel history. In total, 1023 dog blood samples as well as 195 fox spleen and 179 fox blood samples were collected. DNA was analysed by PCR for the presence of filariae, piroplasms, anaplasmataceae and Rickettsia spp. Filariae were detected in six dogs (0.6%), two were positive for DNA from D. repens, two from Dirofilaria immitis and two from Acanthocheilonema reconditum. One of the D. repens positive dogs originated from an animal shelter in Brandenburg, but the origin of the other one remained unknown. Interestingly, both D. repens ITS-1 sequences showed 100% identity to a D. repens sample obtained from a Japanese woman that travelled in Europe and were 97% identical to a newly proposed species Dirofilaria sp. 'hongkongensis' described from Hong Kong. However, identity to other D. repens sequences from Thailand was considerably lower (81%). Identity of 12S rRNA and cytochrome oxidase I to D. repens samples from southern Europe was 99%. Due to the low number of Dirofilaria spp. positive dogs and since the origin of these was unknown, endemic occurrence of Dirofilaria in Brandenburg could not be confirmed. Anaplasma phagocytophilum was found in 15 dogs (1.5%), Candidatus Neoehrlichia mikurensis in three dogs (0.3%) and E. canis in one dog (0.1%), which was co-infected with D. repens. Rickettsia spp. were detected in 8 dogs (0.8%), seven were Rickettsia raoultii and one was Rickettsia felis. To the author's knowledge, R. raoultii DNA was detected for the first time in dogs in Germany in this study and Candidatus

  8. Magnetic resonance imaging of canine degenerative lumbar spine diseases

    International Nuclear Information System (INIS)

    Degenerative lumbar spine diseases, i.e., sacrolumbar stenosis, intervertebral disk degeneration and protrusion and spondylosis deformans of the canine lumbar spine were studied in eleven canine patients and three healthy controls using radiography and 0.02 T and 0.04 T low field magnetic resonance imaging. The T1 and T2 weighted images were obtained in sagittal and transverse planes. The loss of hydration of nucleus pulposus, taken as a sign of degeneration in the intervertebral disks, could be evaluated in both T1 and T2 weighted images. As a noninvasive method magnetic resonance imaging gave more exact information about the condition of intervertebral disks than did radiography. Sacrolumbar stenosis and compression of the spinal cord or cauda equina and surrounding tissue could be evaluated without contrast medium

  9. Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease

    Directory of Open Access Journals (Sweden)

    Andrew Specht

    2011-01-01

    Full Text Available A canine model of Glycogen storage disease type Ia (GSDIa is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size, and longer lifespan compared to other animal models. Use of this model in preclinical trials of gene therapy is described and briefly compared to the murine model. Although the canine model offers a number of advantages for evaluating potential therapies for GSDIa, there are also some significant challenges involved in its use. Despite these challenges, the canine model of GSDIa should continue to provide valuable information about the potential for generating curative therapies for GSDIa as well as other genetic hepatic diseases.

  10. Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease

    OpenAIRE

    Andrew Specht; Laurie Fiske; Kirsten Erger; Travis Cossette; John Verstegen; Martha Campbell-Thompson; Struck, Maggie B.; Young Mok Lee; Chou, Janice Y.; Byrne, Barry J; Correia, Catherine E.; Mah, Cathryn S.; Weinstein, David A.; Conlon, Thomas J.

    2011-01-01

    A canine model of Glycogen storage disease type Ia (GSDIa) is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size,...

  11. Canine Degenerative Valve Disease: A Case Report

    Directory of Open Access Journals (Sweden)

    Carmenza Janneth Benavides Melo

    2014-07-01

    Full Text Available Degenerative valvular disease or endocardiosis is the most common cardiovascular pathology in dogs. It is characterized by regurgitation of blood into the atria with decreased cardiac output, leading to volume overload with eccentric hypertrophy and congestive heart failure. This report describes the clinical and autopsy findings of a dog, suggestive of valvular endocardiosis. The patient was admitted to the outpatient Veterinary Clinic “Carlos Martínez Hoyos” at the University of Nariño (Pasto, Colombia. His owner said the dog was sick for two months, with signs of respiratory disease, weight loss, and decay. Clinical examination showed very pale mucous membranes, inspiratory dyspnea, rale, split S2, grade 4 mid-systolic murmur of regurgitation, and abdominal dilatation with sign of positive shock wave. Necropsy evidenced plenty of translucent watery material in the abdominal, chest and pericardium cavity, severely enlarged and rounded heart with thickened atrioventricular valves, moderate reduction in liver size and signs of lobulation, severely diminished and pale kidneys with irregular surface showing the presence of multiple cystic areas in corticomedullary region. Samples were taken from these tissues and fixed in 10% buffered formalin to be processed for histopathological analysis at the Laboratory of Pathology at the University of Nariño, using hematoxylin and eosin stain. This way, degenerative valvular disease was diagnosed.

  12. 'ANOTHER VECTOR BORNE CHALLENGE TO COMBAT- ZIKA VIRUS OUTBREAKS'.

    Science.gov (United States)

    Shoaib, Maria; Faraz, Ahmad; Ahmed, Syed Ahsanuddin

    2016-01-01

    Zika virus is a single-stranded RNA virus of the Flaviviridae family. It is known to transmit to humans primarily through the bite of an infected Aedes species mosquito which is also known to carry dengue, chikungunya & yellow fever virus. Transmission is anthroponotic (human-to-vector-to-human) during outbreaks, Perinatally in utero, sexually and via infected blood transfusion. It is mild and self-limiting infection lasting for several days to a week. However, it is suspected as a cause of Guillain Barre Syndrome. There is a teratogenic association of Zika virus causing congenital birth defects like microcephaly and neurologic abnormalities. Treatment is generally supportive and for symptomatic relief. No specific antiviral treatment or vaccine is yet available for Zika virus disease. It highlights importance of preventive public health measures at the community level and avoids travelling to the endemic areas. PMID:27323600

  13. Distribution and characterization of canine Chagas disease in Texas.

    Science.gov (United States)

    Kjos, S A; Snowden, K F; Craig, T M; Lewis, B; Ronald, N; Olson, J K

    2008-04-15

    Although acute and chronic cases of canine Chagas disease have been reported from multiple areas in the southern region of the United States, little data are available on current disease occurrence patterns in endemic areas. Therefore, a study to assess frequency, geographic distribution, signalment, and clinical spectrum of Chagas disease in domestic dogs from Texas was conducted. Serology, histopathology, and clinical case records from multiple institutions for the time period 1993-2007 were analyzed. A total of 537 serologically and/or histopathologically confirmed cases were documented. Cases were reported from 48 of 254 counties within Texas, covering all major geographic regions. Forty-eight dog breeds were represented among the cases, primarily in the sporting and working groups. In histopathologically confirmed cases, acute death occurred in 42%, approximately half of which were ecoregions of Texas, affecting a broad range of dog breeds and age groups. PMID:18255233

  14. Molecular surveillance of traditional and emerging pathogens associated with canine infectious respiratory disease.

    Science.gov (United States)

    Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio

    2016-08-30

    A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. PMID:27527760

  15. Using the canine genome to cure cancer and other diseases.

    Science.gov (United States)

    Olson, P N

    2007-08-01

    A high-quality draft genome sequence of the domestic dog (Canis familiaris), together with a dense map of single nucleotide polymorphisms, has been reported. Such new tools offer scientists amazing opportunities to define genetic, nutritional, environmental, and other risk factors for various canine diseases. Because many of the diseases that affect man's best friend also affect us, understanding a dog's disease may lead to new preventions and therapies for diseases that affect both dogs and people. Since a dog's life span is shorter than that for a human, monitoring potential risk factors in a well-controlled population of dogs is possible. Such a population should be one where dogs live in close relationship with their owners. Although longitudinal studies have been previously conducted on animals housed in laboratory environments, the natural environment offers a chance to study dogs in environments shared by their owners. If dogs are carefully monitored, and select exposures defined, considerable information could be collected in a dog's lifetime--the next 10-20 years. Such information could hold the clues for important discoveries, including causes and cures for cancer. PMID:17498794

  16. Epidemiological Survey on Canine Parvovirus Disease in Taizhou Region,Jiangsu Province,China

    Institute of Scientific and Technical Information of China (English)

    Yuan; Weifeng; Liu; Jing; Zhao; Xuegang; Lu; Jiang; Zheng; Xiaoliang; Zhu; Hongfei

    2014-01-01

    The canine parvovirus disease is an acute infectious disease caused by canine parvovirus(CPV). It is clinically characterized by severe vomiting,hemorrhagic enteritis,significant reduction in white blood cells and myocarditis. The disease with high incidence,highly infectious and high mortality has become one of the serious infectious diseases threatening dog raising industry in China. In this research,260 cases of canine parvovirus case from an Aite Pet Clinic in Taizhou City during January 2010 and March 2011 were analyzed. This study discloses the epidemiology of CPV in Taizhou region of Jiangsu Province,i. e.,the incidence of CPV and canine motility are closely correlated with age,breed,immune inoculation and season. This study provides useful guide for the clinical treatment of CPV in the future.

  17. Canine brucellosis: Epizootiological characteristics, therapy and control of the disease

    Directory of Open Access Journals (Sweden)

    Radojičić Sonja

    2006-01-01

    Full Text Available The paper describes different aspects of canine brucellosis caused by Brucella canis. The disease is present in a large number of countries all over the world, where it inflicts severe economic damages, in particular in the commercial breeding and major dog breeding facilities. The disease was discovered in 1966 in the United States of America, but there were no data about its presence or distribution in our country until 1999. It was established, following the initial investigations, that the prevalence of the disease is extremely high, and that it amounted to 4.27% among pet dogs in the territory of Belgrade. Investigations of stray dogs in the territory of Podgorica showed that the seroprevalence (an equal titer or higher than 1/200 was 9.37%, while the prevalence among stray dogs in the territory of Belgrade was 10.87%. Data for other parts of Serbia are mostly lacking, and the seroprevalence for stray dogs in the Municipality of Pozarevac amounted to over 15%, while not a single serologically positive case was found among pet dogs. In addition to the epizootiological specificities of the disease established in our country, isolates of B. canis from the territory of Serbia also indicate digressions in the test of resistance to colors with respect to the referent strain RM6/66. All isolates (SR1-SR-7 are resistant to base fuchsine, and it is probable that this characteristic could also be an important epizootiological marker. Even though the isolation of the cause is the most reliable diagnostic method, it is not possible to achieve this in most cases. That is why one of the most important tasks is to define the most ideal tests for the serological diagnostics of the disease, and the obligation of reporting the disease makes it imperative that wider-scale investigations are conducted and that measures are taken toward reducing the number of positive cases in our country. .

  18. Prevalence of selected zoonotic and vector-borne agents in dogs and cats in Costa Rica.

    Science.gov (United States)

    Scorza, Andrea V; Duncan, Colleen; Miles, Laura; Lappin, Michael R

    2011-12-29

    To estimate the prevalence of enteric parasites and selected vector-borne agents of dogs and cats in San Isidro de El General, Costa Rica, fecal and serum samples were collected from animals voluntarily undergoing sterilization. Each fecal sample was examined for parasites by microscopic examination after fecal flotation and for Giardia and Cryptosporidium using an immunofluorescence assay (IFA). Giardia and Cryptosporidium IFA positive samples were genotyped after PCR amplification of specific DNA if possible. The seroprevalence rates for the vector-borne agents (Dirofilaria immitis, Borrelia burgdorferi, Ehrlichia canis, and Anaplasma phagocytophilum) were estimated based on results from a commercially available ELISA. Enteric parasites were detected in samples from 75% of the dogs; Ancylostoma caninum, Trichuris vulpis, Giardia, and Toxocara canis were detected. Of the cats, 67.5% harbored Giardia spp., Cryptosporidium spp., Ancylostoma tubaeforme, or Toxocara cati. Both Cryptosporidium spp. isolates that could be sequenced were Cryptosporidium parvum (one dog isolate and one cat isolate). Of the Giardia spp. isolates that were successfully sequenced, the 2 cat isolates were assemblage A and the 2 dog isolates were assemblage D. D. immitis antigen and E. canis antibodies were identified in 2.3% and 3.5% of the serum samples, respectively. The prevalence of enteric zoonotic parasites in San Isidro de El General in Costa Rica is high in companion animals and this information should be used to mitigate public health risks. PMID:21846585

  19. Outdoor Workers and Tick-Borne Diseases

    Science.gov (United States)

    ... and Scorpions Poisonous Plants Venomous Spiders Venomous Snakes Vector-Borne Diseases Mosquito-Borne Diseases Tick-Borne Diseases Lyme Disease ... and Scorpions Poisonous Plants Venomous Spiders Venomous Snakes Vector-Borne Diseases Mosquito-Borne Diseases Tick-Borne Diseases Lyme Disease ...

  20. Seven challenges for modelling indirect transmission: Vector-borne diseases, macroparasites and neglected tropical diseases

    OpenAIRE

    T. Déirdre Hollingsworth; Pulliam, Juliet R. C.; Sebastian Funk; Truscott, James E; Valerie Isham; Lloyd, Alun L.

    2015-01-01

    Many of the challenges which face modellers of directly transmitted pathogens also arise when modelling the epidemiology of pathogens with indirect transmission - whether through environmental stages, vectors, intermediate hosts or multiple hosts. In particular, understanding the roles of different hosts, how to measure contact and infection patterns, heterogeneities in contact rates, and the dynamics close to elimination are all relevant challenges, regardless of the mode of transmission. Ho...

  1. Identification of vector-borne pathogens in dogs and cats from Southern Brazil.

    Science.gov (United States)

    Malheiros, J; Costa, M M; do Amaral, R B; de Sousa, K C M; André, M R; Machado, R Z; Vieira, M I B

    2016-07-01

    Dogs and cats are often infected with vector-borne pathogens and play a crucial role as reservoirs and hosts in their life cycles. The aim of the present study was to investigate the occurrence of vector-borne pathogens among dogs and cats in the northwestern region of Rio Grande do Sul (RS) State, Brazil. One hundred and ten blood samples were collected from dogs (n=80) and cats (n=30). Laboratory analysis were carried out through stained blood smears, indirect enzyme-linked immunosorbent assay (ELISA) for Babesia vogeli and Ehrlichia canis (only for dogs) and polymerase chain reaction (PCR) aiming the detection of pathogens. The following pathogens were screened by PCR among dogs and cats: Babesia spp. and Hepatozoon spp. (18S rRNA gene), Anaplasma spp. (16S rRNA gene), and Ehrlichia spp. (dsb gene for dogs and 16S rRNA gene for cats) and Bartonella spp. (nuoG gene only for cats). Using blood smears structures morphologically compatible with piroplasms were found in 5.45% (6/110) of the samples. Anti-B. vogeli and anti-E. canis antibodies were detected in 91% (73/80) and 9% (7/80) of the dogs, respectively. All the seropositive dogs to E. canis were also to B. vogeli. Nineteen (17.3%) animals were positive to hemoparasites by PCR. After sequencing Rangelia vitalii 6/80 (7.5%), B. vogeli 3/80 (4%), Hepatozoon spp. 1/80 (1%), and Anaplasma spp. 1/80 (1%) were found in the dogs, and B. vogeli 2/30 (7%) and Bartonella spp. 6/30 (20%) were detected in the screened cats. No sample was positive for genes dsb and 16S rRNA of Ehrlichia spp. Only those animals which were positive for R. vitalii showed findings compatible with rangeliosis, such as anemia (100%), thrombocytopenia (67%), jaundice (50%), external bleeding (50%), and anorexia (50%). This is the first time that B. vogeli detected among cats in Southern Brazil. PMID:27266811

  2. Molecular detection of vector-borne bacteria and protozoa in healthy hunting dogs from Central Italy

    Institute of Scientific and Technical Information of China (English)

    Valentina; Virginia; Ebani; Simona; Nardoni; Giulia; Fognani; Linda; Mugnaini; Fabrizio; Bertelloni; Guido; Rocchigiani; Roberto; Amerigo; Papini; Francesco; Stefani; Francesca; Mancianti

    2015-01-01

    Objective:To determine the pi’evalence of vector-bome bacteria and protozoa in hunting dogs living in Central Italy.Methods:Molecular testing was executed on DNA which was extracted from blood specimens collected from 117 asymptomatic dogs to detect Anaplasma phagocytophilum,Babesia canis(B.canis),Bartonella spp..Coxiella burnetii(C.burnetii).Ehrlichia canis.Hepatozoon canis.and Leislnnania infantum.Results:A total of 48 dogs(41.0%) were infested by Ixodes ricinus and Rhipicephalus sanguineus ticks.Tick-borne infections were observed in 64(54.7%) animals.More in detail.38 dogs(32.5%) screened positive for Hepatozoon canis,24(20.5%) for Bartonella rinsonii subsp.berkhoffii.20(17.1%) for Leishmania infantum,6(5.1%) for C.burnetii,5(4.3%) for B.canis(3 B.canis vogeli and 2 B.canis canis),3(2.5%) for Anaplasma phagocytophilum,and 2(1.7%) for Ehrlichia canis.Mixed infection by 2 agents occurred in 17(14.5%) subjects,by 3 agents in 7(6.0%) dogs,and by 4 agents in 1(0.9%) animal.Conclusions:The results demonstrated that several vector-borne pathogens were circulating in this region and dogs infected by these agents were usually asymptomatic.A relevant finding was the presence of DNA of C.burnetii,a severe zoonotic agent,in the 5.1% of tested dogs,which can be source of infection for their owners not only through tick bites,but also directly with urine,feces and birth products.

  3. Early effects of climate change: do they include changes in vector-borne disease?

    OpenAIRE

    Kovats, R. S.; Campbell-Lendrum, D H; McMichael, A. J.; Woodward, A; Cox, J. S.

    2001-01-01

    The world's climate appears now to be changing at an unprecedented rate. Shifts in the distribution and behaviour of insect and bird species indicate that biological systems are already responding to this change. It is well established that climate is an important determinant of the spatial and temporal distribution of vectors and pathogens. In theory, a change in climate would be expected to cause changes in the geographical range, seasonality (intra-annual variability), and in the incidence...

  4. Climate Change and Vector-borne Diseases: An Economic Impact Analysis of Malaria in Africa

    Directory of Open Access Journals (Sweden)

    Ximing Wu

    2011-03-01

    Full Text Available A semi-parametric econometric model is used to study the relationship between malaria cases and climatic factors in 25 African countries. Results show that a marginal change in temperature and precipitation levels would lead to a significant change in the number of malaria cases for most countries by the end of the century. Consistent with the existing biophysical malaria model results, the projected effects of climate change are mixed. Our model projects that some countries will see an increase in malaria cases but others will see a decrease. We estimate projected malaria inpatient and outpatient treatment costs as a proportion of annual 2000 health expenditures per 1,000 people. We found that even under minimal climate change scenario, some countries may see their inpatient treatment cost of malaria increase more than 20%.

  5. A Comparison of Dynamics in Two Models for the Spread of a Vector-Borne Disease.

    Science.gov (United States)

    Graesbøll, K; Sumner, T; Enøe, C; Christiansen, L E; Gubbins, S

    2016-04-01

    In 2007, bluetongue virus (BTV) was introduced to both Denmark (DK) and the United Kingdom (UK). For this reason, simulation models were built to predict scenarios for future incursions. The DK and UK models have a common description of within-herd dynamics, but differ greatly in their descriptions of between-herd spread, one using an explicit representation of vector dispersal, the other a transmission kernel. Here, we compare model predictions for the dynamics of bluetongue in the UK, based on the 2007 incursion and vaccination rollout in 2008. We demonstrate how an agent-based model shows greater sensitivity to the level of vaccine uptake and has lower variability compared with a kernel-based model. However, a model using a transmission kernel requires less detailed data and is often faster. PMID:25056842

  6. A Comparison of Dynamics in Two Models for the Spread of a Vector-Borne Disease

    DEFF Research Database (Denmark)

    Græsbøll, Kaare; Sumner, T.; Enøe, Claes;

    2016-01-01

    of between-herd spread, one using an explicit representation of vector dispersal, the other a transmission kernel. Here, we compare model predictions for the dynamics of bluetongue in the UK, based on the 2007 incursion and vaccination rollout in 2008. We demonstrate how an agent-based model shows greater......In 2007, bluetongue virus (BTV) was introduced to both Denmark (DK) and the United Kingdom (UK). For this reason, simulation models were built to predict scenarios for future incursions. The DK and UK models have a common description of within-herd dynamics, but differ greatly in their descriptions...... sensitivity to the level of vaccine uptake and has lower variability compared with a kernel-based model. However, a model using a transmission kernel requires less detailed data and is often faster....

  7. The standardised freight container: vector of vectors and vector-borne diseases.

    Science.gov (United States)

    Reiter, P

    2010-04-01

    The standardised freight container was one of the most important innovations of the 20th Century. Containerised cargoes travel from their point of origin to their destination by ship, road and rail as part of a single journey, without unpacking. This simple concept is the key element in cheap, rapid transport by land and sea, and has led to a phenomenal growth in global trade. Likewise, containerised air cargo has led to a remarkable increase in the inter-continental transportation of goods, particularly perishable items such as flowers, fresh vegetables and live animals. In both cases, containerisation offers great advantages in speed and security, but reduces the opportunity to inspect cargoes in transit. An inevitable consequence is the globalisation of undesirable species of animals, plants and pathogens. Moreover, cheap passenger flights offer worldwide travel for viral and parasitic pathogens in infected humans. The continued emergence of exotic pests, vectors and pathogens throughout the world is an unavoidable consequence of these advances in transportation technology. PMID:20617647

  8. Regulation of the Immune Response to alpha-Gal and Vector-borne Diseases

    Czech Academy of Sciences Publication Activity Database

    Cabezas-Cruz, A.; Mateos-Hernández, L.; Pérez-Cruz, M.; Valdés, James J.; Fernández de Mera, I.G.; Villar, M.; de la Fuente, J.

    2015-01-01

    Roč. 31, č. 10 (2015), s. 470-476. ISSN 1471-4922 R&D Projects: GA MŠk(CZ) EE2.3.30.0032 EU Projects: European Commission(XE) 278976 Institutional support: RVO:60077344 Keywords : red meat allergy * host defenses * tick bites Subject RIV: EI - Biotechnology ; Bionics Impact factor: 6.204, year: 2014

  9. Use of remote sensing for analysis and estimation of vector-borne disease

    Science.gov (United States)

    Rahman, Atiqur

    An epidemiological data of malaria cases were correlated with satellite-based vegetation health (VH) indices to investigate if they can be used as a proxy for monitoring the number of malaria cases. Mosquitoes, which spread malaria in Bangladesh, are very sensitive to environmental conditions, especially to changes in weather. Therefore, VH indices, which characterize weather conditions, were tested as indicators of mosquitoes' activities in the spread of malaria. Satellite data were presented by the following VH indices: Vegetation Condition Index (VCI), Temperature Condition Index (TCI), and Vegetation Health Index (VHI). They were derived from radiances and measured by the Advanced Very High Resolution Radiometer (AVHRR) flown on NOAA afternoon polar orbiting satellites. Assessment of sensitivity of the VH was performed using correlation and regression analysis. Estimation models were validated using of Jackknife Cross-Validation procedure. Results show that the VH indices can be used for detection, and numerical estimate of the number of malaria cases. During the cooler months (January--April) when mosquitoes are less active, the correlation is low and increases considerably during the warm and wet season (April--November), for TCI in early October and for VCI in mid September. All analysis and estimation model developed here are based on data obtained for Bangladesh.

  10. Public health applications of remote sensing of vector borne and parasitic diseases

    Science.gov (United States)

    1976-01-01

    Results of an investigation of the potential application of remote sensing to various fields of public health are presented. Specific topics discussed include: detection of snail habitats in connection with the epidemiology of schistosomiasis; the detection of certain Anopheles breeding sites, and location of transient human populations, both in connection with malaria eradication programs; and detection of overwintering population sites for the primary screwworm (Cochliomyia americana). Emphasis was placed on the determination of ground truth data on the biological, chemical, and physical characteristics of ground waters which would or would not support the growth of significant populations of mosquitoes.

  11. Satellite imaging and vector-borne diseases: the approach of the French National Space Agency (CNES).

    Science.gov (United States)

    Marechal, Fabienne; Ribeiro, Nathalie; Lafaye, Murielle; Güell, Antonio

    2008-11-01

    Tele-epidemiology consists in studying human and animal epidemic, the spread of which is closely tied to environmental factors, using data from earth-orbiting satellites. By combining various data originated from satellites such as SPOT (vegetation indexes), Meteosat (winds and cloud masses) and other Earth observation data from Topex/Poseidon and Envisat (wave height, ocean temperature and colour) with hydrology data (number and distribution of lakes, water levels in rivers and reservoirs) and clinical data from humans and animals (clinical cases and serum use), predictive mathematical models can be constructed. A number of such approaches have been tested in the last three years. In Senegal, for example, Rift Valley fever epidemics are being monitored using a predictive model based on the rate at which water holes dry out after the rainy season, which affects the number of mosquito eggs which carry the virus. PMID:19021103

  12. Controversial results of therapy with mesenchymal stem cells in the acute phase of canine distemper disease.

    Science.gov (United States)

    Pinheiro, A O; Cardoso, M T; Vidane, A S; Casals, J B; Passarelli, D; Alencar, A L F; Sousa, R L M; Fantinato-Neto, P; Oliveira, V C; Lara, V M; Ambrósio, C E

    2016-01-01

    Distemper disease is an infectious disease reported in several species of domestic and wild carnivores. The high mortality rate of animals infected with canine distemper virus (CDV) treated with currently available therapies has driven the study of new efficacious treatments. Mesenchymal stem cell (MSC)-based therapy is a promising therapeutic option for many degenerative, hereditary, and inflammatory diseases. Therefore, the aim of this study was to characterize stem cells derived from the canine fetal olfactory epithelium and to assess the systemic response of animals infected with CDV to symptomatic therapy and treatment with MSCs. Eight domestic mongrel dogs (N = 8) were divided into two groups: support group (SG) (N = 5) and support group + cell therapy (SGCT) (N = 3), which were monitored over 15 days. Blood samples were collected on days 0, 6, 9, 12, and 15 to assess blood count and serum biochemistry (urea, creatinine, alanine transferase, alkaline phosphatase, gamma-glutamyl transferase, total protein, albumin, and globulin), and urine samples were obtained on days 0 and 15 for urinary evaluation (urine I). The results showed a high mortality rate (SG = 4 and SGCT = 2), providing inadequate data on the clinical course of CDV infection. MSC therapy resulted in no significant improvement when administered during the acute phase of canine distemper disease, and a prevalence of animals with high mortality rate was found in both groups due to the severity of symptoms. PMID:27323085

  13. Heterogeneity in the spread and control of infectious disease: consequences for the elimination of canine rabies

    OpenAIRE

    Ferguson, Elaine A.; Katie Hampson; Sarah Cleaveland; Ramona Consunji; Raffy Deray; John Friar; Haydon, Daniel T; Joji Jimenez; Marlon Pancipane; Townsend, Sunny E

    2015-01-01

    Understanding the factors influencing vaccination campaign effectiveness is vital in designing efficient disease elimination programmes. We investigated the importance of spatial heterogeneity in vaccination coverage and human-mediated dog movements for the elimination of endemic canine rabies by mass dog vaccination in Region VI of the Philippines (Western Visayas). Household survey data was used to parameterise a spatially-explicit rabies transmission model with realistic dog movement and v...

  14. Canine breeds at high risk of developing inflammatory bowel disease in the south-eastern UK.

    Science.gov (United States)

    Kathrani, A; Werling, D; Allenspach, K

    2011-12-10

    Genetics are an important factor in the development of human inflammatory bowel disease (IBD); however, there is very little information available regarding the role of genetics in canine IBD. The purpose of this study was to gather information about which canine breeds in the south-eastern UK are at a high risk for developing IBD. Determination of such breeds may help further genetic research in this complex disease. The computer medical records at the Queen Mother Hospital for Animals, Royal Veterinary College dating from August 1, 2003 to December 31, 2009 were retrospectively searched for cases diagnosed with IBD. Five hundred and forty-six dogs with IBD were identified, representing 86 different breeds. The comparison group consisted of all dogs from these same 86 breeds without IBD admitted to the hospital during the same period that amounted to 27,463 dogs. The breeds at significantly higher risk of developing IBD compared with mixed-breed dogs consisted of weimaraner (odds ratio [OR]=3.6797, 95 per cent confidence interval [CI]=2.0167 to 6.7141, Pborder collie (OR=1.9936, 95 per cent CI=1.1655 to 3.4101, P=0.0118) and boxer (OR=1.6961, 95 per cent CI=1.0441 to 2.755, P=0.0328). This study demonstrates for the first time canine breeds in the south-eastern UK that are highly susceptible to developing IBD. Identification of such breeds may allow for a more focused investigation of genetic mutations associated with canine IBD. PMID:21896567

  15. Efficacy of canine influenza virus (H3N8) vaccine to decrease severity of clinical disease after co-challenge with canine influenza virus and Streptococcus equi subsp. Zooepidemicus

    Science.gov (United States)

    Since first emerging into the North American canine population in 2004, canine influenza virus (CIV) subtype H3N8 has shown horizontal transmission among dogs, with a high level of adaptation to this species. Severity of disease is variable, and co-infection by other respiratory pathogens is an impo...

  16. Canine Leishmaniasis, Italy

    OpenAIRE

    Ferroglio, Ezio; Maroli, Michele; Gastaldo, Silvia; Mignone, Walter; Rossi, Luca

    2005-01-01

    We report the results of a survey to determine the prevalence of canine leishmaniasis and the presence of sand flies in northwestern Italy, where autochthonous foci of canine leishmaniasis have not been reported. Active foci of canine leishmaniasis were identified, which suggests that the disease is now also endemic in continental climate areas.

  17. 76 FR 13619 - Disease, Disability, and Injury Prevention and Control Special Emphasis Panel (SEP): Funding...

    Science.gov (United States)

    2011-03-14

    ... Centers for Disease Control and Prevention on Malaria and Vector-Borne Diseases Funding Opportunity... Centers for Disease Control and Prevention on Malaria and Vector-Borne Diseases, FOA GH11-003, and... HUMAN SERVICES Centers for Disease Control and Prevention Disease, Disability, and Injury Prevention...

  18. Regenerative and fibrotic pathways in canine liver disease

    NARCIS (Netherlands)

    Spee, Bart

    2006-01-01

    Liver diseases occur quite frequently in dogs; the overall incidence in dogs has been estimated around 1-2% of the clinical cases. Most liver diseases are, like in humans, chronic and occur through chronic inflammation due to different causes. In all cases the on-going liver cell damage leads to a r

  19. The canine hepatic progenitor cell niche: molecular characterisation in health and disease.

    Science.gov (United States)

    Kruitwagen, H S; Spee, B; Viebahn, C S; Venema, H B; Penning, L C; Grinwis, G C M; Favier, R P; van den Ingh, T S G A M; Rothuizen, J; Schotanus, B A

    2014-09-01

    Hepatic progenitor cells (HPCs) are an adult stem cell compartment in the liver that contributes to liver regeneration when replication of mature hepatocytes is insufficient. In this study, laser microdissection was used to isolate HPC niches from the livers of healthy dogs and dogs with lobular dissecting hepatitis (LDH), in which HPCs are massively activated. Gene expression of HPC, hepatocyte and biliary markers was determined by quantitative reverse transcriptase PCR. Expression and localisation of selected markers were further studied at the protein level by immunohistochemistry and immunofluorescent double staining in samples of normal liver and liver from dogs with LDH, acute and chronic hepatitis, and extrahepatic cholestasis. Activated HPC niches had higher gene expression of the hepatic progenitor markers OPN, FN14, CD29, CD44, CD133, LIF, LIFR and BMI1 compared to HPCs from normal liver. There was lower expression of albumin, but activated HPC niches were positive for the biliary markers SOX9, HNF1β and keratin 19 by immunohistochemistry and immunofluorescence. Laminin, activated stellate cells and macrophages are abundant extracellular matrix and cellular components of the canine HPC niche. This study demonstrates that the molecular and cellular characteristics of canine HPCs are similar to rodent and human HPCs, and that canine HPCs are distinctively activated in different types of liver disease. PMID:24923752

  20. Decision making in the management of canine intervertebral disc disease

    International Nuclear Information System (INIS)

    Intervertebral disc disease is a frequent disorder of dogs; it is only rarely a cause of clinical signs in cats. Most clinicians are familiar with the diagnosis of the condition, but there may be some confusion about the most appropriate methods of treatment. While there is some controversy regarding certain regimens, particularly involving unconventional methods, there is a large amount of data in the veterinary literature concerning the disease. This article draws on this data to present guidelines which can be used in selecting the most appropriate method of treatment for individual patients

  1. Regenerative and fibrotic pathways in canine liver disease

    OpenAIRE

    Spee, Bart

    2006-01-01

    Liver diseases occur quite frequently in dogs; the overall incidence in dogs has been estimated around 1-2% of the clinical cases. Most liver diseases are, like in humans, chronic and occur through chronic inflammation due to different causes. In all cases the on-going liver cell damage leads to a reduction of the functional liver cell mass and progressive deposition of fibrous tissue in the liver. These two phenomena, atrophy and fibrosis, are two sides of one medal and go hand in hand to ca...

  2. Canine stage 1 periodontal disease: a latent pathology.

    Science.gov (United States)

    Whyte, A; Bonastre, C; Monteagudo, L V; Les, F; Obon, J; Whyte, J; Tejedor, M T

    2014-07-01

    To evaluate the potential health issues associated with periodontal disease (PD) in dogs, 1004 teeth from 25 dogs were examined. The dogs were randomly selected, aged 2-14 years, and had at least 95% of their teeth at the first PD stage. Significant positive correlations between plaque grade (PG) and gum inflammation, gingival regression, periodontal pocket, age and serum alanine aminotransferase (ALT) activity were identified. In contrast, PG was negatively correlated to total platelet count. Altogether, these findings suggest that prevention and therapy at the first PD stages can have an important impact on the general health condition of dogs. PMID:24878263

  3. 犬细小病毒病的诊治%Diagnosis and Treatment of Canine Parvovirus Disease

    Institute of Scientific and Technical Information of China (English)

    崔继东; 王权

    2012-01-01

    Infection sources, pathogen characteristics and epidemic situation of canine parvovirus disease were introduced, the diagnosis method was proposed, and then the prevention and treatment measures were put forward, so as to provide references for the control of canine parvovirus disease.%介绍了犬细小病毒病的传染源、病原特点及流行情况,提出其诊断方法,并总结了预防与治疗措施,以期为犬细小病毒病的防治提供参考。

  4. Respiratory disease outbreak in a veterinary hospital associated with canine parainfluenza virus infection

    OpenAIRE

    Weese, J Scott; Stull, Jason

    2013-01-01

    A cluster of canine parainfluenza virus infections was identified in a veterinary referral hospital. While hospital-associated outbreaks of canine parainfluenza virus infection have not been previously reported, veterinary hospitals possess some of the same risk factors that may be present in traditional high-risk sites such as kennels. Hospital-associated transmission of canine respiratory pathogens, therefore, must be considered.

  5. Dimethylnitrosamine-induced hepatotoxicosis in dogs as a model of progressive canine hepatic disease.

    Science.gov (United States)

    Boothe, D M; Jenkins, W L; Green, R A; Corrier, D E; Cullen, J M; Boothe, H W; Weise, D

    1992-03-01

    A model of toxin-induced progressive hepatitis is described in Beagles. The toxin, dimethylnitrosamine, was administered orally to 18 Beagles; 6 dogs comprised a control group. Clinical signs and laboratory test results were monitored as disease progressed and were used to determine the end point of disease. Following euthanasia, histologic lesions were scored and used to derive a total severity score for each dog. Severity scores were then used to allot the 18 dogs to 3 groups of hepatic disease, defined as mild, moderate, or severe. Changes in clinical laboratory test results, including tests of hepatic function, and clinical signs indicative of liver disease were described chronologically for all dogs. Group means of clinical laboratory test results and quantifiable clinical signs (eg, weight loss and ascitic fluid accumulation) were compared. This model offers several advantages, compared with other experimental models of canine hepatic disease. These include hepatospecificity, similarity to natural disease (eg, the development of multiple extrahepatic portosystemic shunts), and the ability to titrate the disease to a desired end point. The major disadvantages of this model were the toxic nature of the drug to human beings and the variation in individual animal response to the toxin, which precludes preassignment of animals into groups. PMID:1595969

  6. Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

    Directory of Open Access Journals (Sweden)

    Jobin Thomas

    2014-11-01

    Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

  7. 犬细小病毒病诊断及防治%Diagnosis, Prevention and Treament of Canine Parvovirus Disease

    Institute of Scientific and Technical Information of China (English)

    孙彦锋; 崔战领

    2014-01-01

    The prevalence characteristics and clinical symptoms of canine parvovirus were analyzed. The pathologic characteristics of canine parvovirus and its diagnosis and treatment methods were discussed. And some concrete measures were proposed for preventing and curing this disease.%通过分析犬细小病毒病的流行特点和临床症状,探讨了犬细小病毒病的病理特征、诊断和治疗方法,并提出了预防和对症治疗的具体措施,以供参考。

  8. Molecular detection of vector-borne pathogens in wild and domestic carnivores and their ticks at the human-wildlife interface.

    Science.gov (United States)

    Millán, Javier; Proboste, Tatiana; Fernández de Mera, Isabel G; Chirife, Andrea D; de la Fuente, José; Altet, Laura

    2016-03-01

    Urbanization of natural areas is considered one of the causes of the current apparent emergence of infectious diseases. Carnivores are among the species that adapt well to urban and periurban environments, facilitating cross-species disease transmission with domestic dogs and cats, and potentially with their owners. The prevalence of vector-borne pathogens (VBP) of zoonotic and veterinary interest was studied in sympatric wild and domestic carnivores into Barcelona Metropolitan Area (NE Spain). Blood or spleen samples from 130 animals, including 34 common genets (Genetta genetta), 12 red foxes (Vulpes vulpes), 10 stone martens (Martes foina), three Eurasian badgers (Meles meles), 34 free-roaming domestic cats and 37 dogs with outdoor access, were collected either in protected or adjacent residential areas. A total of 309 ticks (chiefly Rhipicephalus turanicus) were collected on these animals. The samples were analyzed with a battery of PCR assays targeting the DNA of Rickettsia spp., Anaplasmataceae, Coxiella burnetii, Bartonella spp., and Piroplasmida, and the amplicons were sequenced. The fox showed the highest prevalence (58%) and diversity of VBP (four pathogens), whereas none of the dogs were infected. Bartonella spp. (including B. clarridgeiae, B. henselae, and B. rochalimae) was the most prevalent pathogen. Infection of wild carnivores with Ehrlichia canis, C. burnetii, Theileria annae and Babesia vogeli was also confirmed, with some cases of coinfection observed. The presence of DNA of T. annae and B. vogeli was also confirmed in tick pools from four species of wild carnivores, supporting their role in piroplasmid life-cycle. By the sequencing of several target genes, DNA of Rickettsia massiliae was confirmed in 17 pools of Rh. turanicus, Rh. sanguineous, and Rh. pusillus from five different species, and Rickettsia conorii in one pool of Rh. sanguineous from a dog. None of the hosts from which these ticks were collected was infected by Rickettsia. Although

  9. Emerging vector-borne zoonoses: eco-epidemiology and public health implications in India.

    Science.gov (United States)

    Dhiman, Ramesh C

    2014-01-01

    The diseases originating from animals or associated with man and animals are remerging and have resulted in considerable morbidity and mortality. The present review highlights the re-emergence of emerging mainly zoonotic diseases like chikungunya, scrub typhus, and extension of spatial distribution of cutaneous leishmaniasis from western Rajasthan to Himachal Pradesh, Kerala, and Haryana states; West Nile virus to Assam, and non-endemic areas of Japanese encephalitis (JE) like Maharashtra and JE to Delhi; Crimean-Congo hemorrhagic fever making inroads in Ahmedabad; and reporting fifth parasite of human malaria with possibility of zoonosis have been highlighted, which necessitates further studies for prevention and control. Emphasis has been given on understanding the ecology of reservoir hosts of pathogen, micro niche of vector species, climatic, socioeconomic risk factors, etc. Development of facilities for diagnosis of virus from insects, reservoirs, and human beings (like BSL4, which has been established in NIV, Pune), awareness about symptoms of new emerging viral and other zoonotic diseases, differential diagnosis, risk factors (climatic, ecological, and socioeconomic) and mapping of disease-specific vulnerable areas, and mathematical modeling for projecting epidemiological scenario is needed for preparedness of public health institutes. It is high time to understand the ecological link of zoonotic or anthroponotic diseases for updated risk maps and epidemiological knowledge for effective preventive and control measures. The public health stakeholders in India as well as in Southeast Asia should emphasize on understanding the eco-epidemiology of the discussed zoonotic diseases for taking preventive actions. PMID:25325052

  10. Emerging Vector borne zoonoses: eco-­epidemiology and public health implications in India

    Directory of Open Access Journals (Sweden)

    Ramesh C Dhiman

    2014-09-01

    Full Text Available The diseases originating from animals or associated with man and animals are remerging and have resulted in considerable morbidity and mortality. The present review highlights the re-emergence of emerging mainly zoonotic diseases like chikungunya, scrub typhus, extension of spatial distribution of cutaneous leishmaniasis from Western Rajasthan to Himachal Pradesh, Kerala, and Haryana states; West Nile virus to Assam, and non- endemic areas of JE like Maharashtra and JE to Delhi; Crimean Congo Hemorrhagic Fever making inroads in Ahmedabad; reporting fifth parasite of human malaria with possibility of zoonosis have been highlighted which necessitates further studies for prevention and control. Emphasis has been given on understanding the ecology of reservoir hosts of pathogen, micro niche of vector species, climatic, socioeconomic risk factors etc. Development of facilities for diagnosis of virus from insects, reservoirs and human beings (like BSL4 which has been established in NIV, Pune, awareness about symptoms of new emerging viral and other zoonotic diseases, differential diagnosis, risk factors (Climatic, ecological and socioeconomic and mapping of disease specific vulnerable areas, mathematical modeling for projecting epidemiological scenario, are needed for preparedness of public health institutes. It is high time to understand the ecological link of zoonotic or anthroponotic diseases for updated risk maps and epidemiological knowledge for effective preventive and control measures. The public health stakeholders in India as well as in south East Asia should emphasize on understanding the eco-epidemiology of the discussed zoonotic diseases for taking preventive actions.

  11. Importance of vector-borne infections in different production systems: bovine trypanosomosis and the innovation dynamics of livestock producers in Senegal.

    Science.gov (United States)

    Bouyer, F; Bouyer, J; Seck, M T; Sall, B; Dicko, A H; Lancelot, R; Chia, E

    2015-04-01

    In Senegal, a project has been undertaken to eradicate a population of tsetse flies (Glossina palpalis gambiensis) from a prime area for intensifying livestock production--the coastal region of Niayes. The project is intended to remove the constraint of trypanosomosis and allow the ecological intensification of cattle production. A cross-sectional analysis of ten case studies was the inductive phase of an assessment to gauge the impact of removing trypanosomosis on livestock production strategies. The methodology used was comprehensive analysis, with participatory epidemiology tools to understand farmers' rationales. The authors analysed the strategies of three main types of livestock producer (agro-pastoralists, mixed crop/livestock farmers and intensive dairy farmers). The strategies were in line with the farmers' goals and their ability to mobilise the socio-technical network. The risk management of trypanosomosis has been incorporated into livestock management practices through the use of trypanotolerant breeds, medical prophylaxis or placing livestock in low-risk areas. Removing the risk of disease would therefore have a major impact on decisions about the composition and strategic direction of herds. This change in the animal health environment would steer livestock production along different routes of intensification in a highly competitive environment. The indicators of innovation capacity revealed by this study will be used to quantitatively monitor various change scenarios, taking livestock producers' reasoning into account, in order to assess the socio-economic impact of eradicating the tsetse fly population in this area. The methodology presented in the study can be used to understand the impact of controlling other vector-borne infections on the innovation dynamics of livestock producers. PMID:26470458

  12. First finding of Trypanosoma cruzi II in vampire bats from a district free of domestic vector-borne transmission in Northeastern Argentina.

    Science.gov (United States)

    Argibay, Hernán D; Orozco, M Marcela; Cardinal, M Victoria; Rinas, Miguel A; Arnaiz, María; Mena Segura, Carlos; Gürtler, Ricardo E

    2016-09-01

    Establishing the putative links between sylvatic and domestic transmission cycles of Trypanosoma cruzi, the etiological agent of Chagas disease, is of public health relevance. We conducted three surveys to assess T. cruzi infection in wild mammals from a rural and a preserved area in Misiones Province, Northeastern Argentina, which had recently been declared free of vector- and blood-borne transmission of human T. cruzi infection. A total of 200 wild mammals were examined by xenodiagnosis (XD) and/or polymerase chain reaction (PCR) amplification of the hyper-variable region of kinetoplast DNA minicircles of T. cruzi (kDNA-PCR). The overall prevalence of T. cruzi infection was 8%. Nine (16%) of 57 Didelphis albiventris opossums and two (7%) of 29 Desmodus rotundus vampire bats were positive by both XD and kDNA-PCR. Additionally, one D. rotundus positive for T. cruzi by kDNA-PCR tested positive by satellite-DNA-PCR (SAT-DNA-PCR). The T. cruzi-infected bats were captured indoors and in the yard of a vacant dwelling. All D. albiventris were infected with TcI and both XD-positive D. rotundus by TcII. Fifty-five opossum cubs within the marsupium were negative by XD. The mean infectiousness to the vector was 62% in D. albiventris and 50% in D. rotundus. Mice experimentally infected with a parasite isolate from a vampire bat displayed lesions typically caused by T. cruzi. Our study documents the presence of the genotype TcII in a sylvatic host for the first time in Argentina, and the occurrence of two transmission cycles of T. cruzi in a district free of domestic vector-borne transmission. PMID:27220254

  13. Temporal and spatial scaling of the genetic structure of a vector-borne plant pathogen.

    Science.gov (United States)

    Coletta-Filho, Helvécio D; Francisco, Carolina S; Almeida, Rodrigo P P

    2014-02-01

    The ecology of plant pathogens of perennial crops is affected by the long-lived nature of their immobile hosts. In addition, changes to the genetic structure of pathogen populations may affect disease epidemiology and management practices; examples include local adaptation of more fit genotypes or introduction of novel genotypes from geographically distant areas via human movement of infected plant material or insect vectors. We studied the genetic structure of Xylella fastidiosa populations causing disease in sweet orange plants in Brazil at multiple scales using fast-evolving molecular markers (simple-sequence DNA repeats). Results show that populations of X. fastidiosa were regionally isolated, and that isolation was maintained for populations analyzed a decade apart from each other. However, despite such geographic isolation, local populations present in year 2000 were largely replaced by novel genotypes in 2009 but not as a result of migration. At a smaller spatial scale (individual trees), results suggest that isolates within plants originated from a shared common ancestor. In summary, new insights on the ecology of this economically important plant pathogen were obtained by sampling populations at different spatial scales and two different time points. PMID:24397266

  14. The potential of canine sentinels for reemerging Trypanosoma cruzi transmission

    Science.gov (United States)

    Neyra, Ricardo Castillo; Chu, Lily Chou; Quispe-Machaca, Victor; Ancca-Juarez, Jenny; Malaga Chavez, Fernando S.; Mazuelos, Milagros Bastos; Naquira, Cesar; Bern, Caryn; Gilman, Robert H.; Levy, Michael Z.

    2015-01-01

    Background Chagas disease, a vector-borne disease transmitted by triatomine bugs and caused by the parasite Trypanosoma cruzi, affects millions of people in the Americas. In Arequipa, Peru, indoor residual insecticide spraying campaigns are routinely conducted to eliminate Triatoma infestans, the only vector in this area. Following insecticide spraying, there is risk of vector return and reinitiation of parasite transmission. Dogs are important reservoirs of T. cruzi and may play a role in reinitiating transmission in previously sprayed areas. Dogs may also serve as indicators of reemerging transmission. Methods We conducted a cross-sectional serological screening to detect T. cruzi antibodies in dogs, in conjunction with an entomological vector collection survey at the household level, in a disease endemic area that had been treated with insecticide 13 years prior. Spatial clustering of infected animals and vectors was assessed using Ripley’s K statistic, and the odds of being seropositive for dogs proximate to infected colonies was estimated with multivariate logistic regression. Results There were 106 triatomine-infested houses (41.1%), and 45 houses infested with T. cruzi-infected triatomine insects (17.4%). Canine seroprevalence in the area was 12.3% (n=154); all seropositive dogs were 9 months old or older. We observed clustering of vectors carrying the parasite, but no clustering of seropositive dogs. The age- and sex-adjusted odds ratio between seropositivity to T. cruzi and proximity to an infected triatomine (≤50m) was 5.67 (95% CI: 1.12 – 28.74; p=0.036). Conclusions Targeted control of reemerging transmission can be achieved by improved understanding of T. cruzi in canine populations. Our results suggest that dogs may be useful sentinels to detect re-initiation of transmission following insecticide treatment. Integration of canine T. cruzi blood sampling into existing interventions for zoonotic disease control (e.g. rabies vaccination programs

  15. Canine Detection of the Volatilome: A Review of Implications for Pathogen and Disease Detection

    Science.gov (United States)

    Angle, Craig; Waggoner, Lowell Paul; Ferrando, Arny; Haney, Pamela; Passler, Thomas

    2016-01-01

    The volatilome is the entire set of volatile organic compounds (VOC) produced by an organism. The accumulation of VOC inside and outside of the body reflects the unique metabolic state of an organism. Scientists are developing technologies to non-invasively detect VOC for the purposes of medical diagnosis, therapeutic monitoring, disease outbreak containment, and disease prevention. Detection dogs are proven to be a valuable real-time mobile detection technology for the detection of VOC related to explosives, narcotics, humans, and many other targets of interests. Little is known about what dogs are detecting when searching for biological targets. It is important to understand where biological VOC originates and how dogs might be able to detect biological targets. This review paper discusses the recent scientific literature involving VOC analysis and postulates potential biological targets for canine detection. Dogs have shown their ability to detect pathogen and disease-specific VOC. Future research will determine if dogs can be employed operationally in hospitals, on borders, in underserved areas, on farms, and in other operational environments to give real-time feedback on the presence of a biological target. PMID:27446935

  16. Expression Profiling of Circulating MicroRNAs in Canine Myxomatous Mitral Valve Disease

    Directory of Open Access Journals (Sweden)

    Qinghong Li

    2015-06-01

    Full Text Available MicroRNAs (miRNAs are small non-coding RNAs that have shown promise as noninvasive biomarkers in cardiac disease. This study was undertaken to investigate the miRNA expression profile in dogs with myxomatous mitral valve disease (MMVD. 277 miRNAs were quantified using RT-qPCR from six normal dogs (American College of Veterinary Internal Medicine Stage A, six dogs with MMVD mild to moderate cardiac enlargement (ACVIM Stage B1/B2 and six dogs with MMVD and congestive heart failure (ACVIM Stage C/D. Eleven miRNAs were differentially expressed (False Discovery Rate < 0.05. Dogs in Stage B1/B2 or C/D had four upregulated miRNAs, including three cfa-let-7/cfa-miR-98 family members, while seven others were downregulated, compared to Stage A. Expression of six of the 11 miRNAs also were significantly different between dogs in Stage C/D and those in Stage B1/B2. The expression changes were greater as disease severity increased. These miRNAs may be candidates for novel biomarkers and may provide insights into genetic regulatory pathways in canine MMVD.

  17. WNV infection - an emergent vector borne viral infection in Serbia: Current situation

    Directory of Open Access Journals (Sweden)

    Petrović Tamaš

    2015-01-01

    Full Text Available West Nile virus (WNV is a neurovirulent mosquito-borne Flavivirus with zoonotic potential. Virus is maintained in nature in an enzootic transmission cycle between avian hosts and mosquito vectors, but occasionally infects other vertebrates. The infection in horses and humans can be asymptomatic or it can have different clinical manifestations ranging from light febrile diseases to fatal meningoencephalitis. Recently, the number, frequency and severity of outbreaks with neurological consequences for birds, humans and horses have increased dramatically throughout central and south Europe, including Serbia, posing a serious veterinary and public health problem. The emergency of WNV infections in Serbia is described through the current epidemiology situation based on recent data on the incidence of WNV infection among virus natural hosts and vectors; sentinel (horses and other animal species, and in human population. The results of the WNV serology studies conducted on horse blood samples collected in different occasions during the last six years, and the results of the serology studies conducted among other animal species like pigs, wild boars, roe deer and dogs in Serbia are presented and discussed. Also, the results of the first studies on WNV presence in mosquito vectors and in wild birds as virus natural hosts in Serbia are presented and analyzed. In addition, the data on the WNV serology studies conducted in human population in Serbia in the last few years, and the existing data of WNV outbreaks in 2012 and 2013 are included. Regarding the existing knowledge on WNV epidemiology situation, the crucial role of veterinary service in early detection of WNV presence and ongoing national program of WNV surveillance in sentinel animals, mosquitoes and wild birds are discussed.

  18. Canine muscle cell culture and consecutive patch-clamp measurements - a new approach to characterize muscular diseases in dogs

    OpenAIRE

    Schenk Henning Christian; Krampfl Klaus; Baumgärtner Wolfgang; Tipold Andrea

    2012-01-01

    Abstract Background The recognition of functional muscular disorders, (e.g. channelopathies like Myotonia) is rising in veterinary neurology. Morphologic (e.g. histology) and even genetic based studies in these diseases are not able to elucidate the functional pathomechanism. As there is a deficit of knowledge and skills considering this special task, the aim of the current pilot study was to develop a canine muscle cell culture system derived from muscle biopsies of healthy client-owned dogs...

  19. Evaluation of AAV-mediated Gene Therapy for Central Nervous System Disease in Canine Mucopolysaccharidosis VII.

    Science.gov (United States)

    Gurda, Brittney L; De Guilhem De Lataillade, Adrien; Bell, Peter; Zhu, Yanqing; Yu, Hongwei; Wang, Ping; Bagel, Jessica; Vite, Charles H; Sikora, Tracey; Hinderer, Christian; Calcedo, Roberto; Yox, Alexander D; Steet, Richard A; Ruane, Therese; O'Donnell, Patricia; Gao, Guangping; Wilson, James M; Casal, Margret; Ponder, Katherine P; Haskins, Mark E

    2016-02-01

    Mucopolysaccharidosis VII (MPS VII) is a lysosomal storage disease arising from mutations in β-d-glucuronidase (GUSB), which results in glycosaminoglycan (GAG) accumulation and a variety of clinical manifestations including neurological disease. Herein, MPS VII dogs were injected intravenously (i.v.) and/or intrathecally (i.t.) via the cisterna magna with AAV9 or AAVrh10 vectors carrying the canine GUSB cDNA. Although i.v. injection alone at 3 days of age resulted in normal cerebrospinal fluid (CSF) GUSB activity, brain tissue homogenates had only ~1 to 6% normal GUSB activity and continued to have elevated GAG storage. In contrast, i.t. injection at 3 weeks of age resulted in CSF GUSB activity 44-fold normal while brain tissue homogenates had >100% normal GUSB activity and reduced GAGs compared with untreated dogs. Markers for secondary storage and inflammation were eliminated in i.t.-treated dogs and reduced in i.v.-treated dogs compared with untreated dogs. Given that i.t.-treated dogs expressed higher levels of GUSB in the CNS tissues compared to those treated i.v., we conclude that i.t. injection of AAV9 or AAVrh10 vectors is more effective than i.v. injection alone in the large animal model of MPS VII. PMID:26447927

  20. A Nod to disease vectors: mitigation of pathogen sensing by arthropod saliva

    Czech Academy of Sciences Publication Activity Database

    Sakhon, O. S.; Severo, M. S.; Kotsyfakis, Michalis; Pedra, J. H. F.

    2013-01-01

    Roč. 4, OCT 2013 (2013), a308. ISSN 1664-302X Institutional support: RVO:60077344 Keywords : nod-like receptors * inflammasome * vector-borne pathogens * vector-borne diseases * arthropod saliva * salivary proteins Subject RIV: EC - Immunology Impact factor: 3.941, year: 2013

  1. Heterogeneity in the spread and control of infectious disease: consequences for the elimination of canine rabies

    Science.gov (United States)

    Ferguson, Elaine A.; Hampson, Katie; Cleaveland, Sarah; Consunji, Ramona; Deray, Raffy; Friar, John; Haydon, Daniel T.; Jimenez, Joji; Pancipane, Marlon; Townsend, Sunny E.

    2015-12-01

    Understanding the factors influencing vaccination campaign effectiveness is vital in designing efficient disease elimination programmes. We investigated the importance of spatial heterogeneity in vaccination coverage and human-mediated dog movements for the elimination of endemic canine rabies by mass dog vaccination in Region VI of the Philippines (Western Visayas). Household survey data was used to parameterise a spatially-explicit rabies transmission model with realistic dog movement and vaccination coverage scenarios, assuming a basic reproduction number for rabies drawn from the literature. This showed that heterogeneous vaccination reduces elimination prospects relative to homogeneous vaccination at the same overall level. Had the three vaccination campaigns completed in Region VI in 2010-2012 been homogeneous, they would have eliminated rabies with high probability. However, given the observed heterogeneity, three further campaigns may be required to achieve elimination with probability 0.95. We recommend that heterogeneity be reduced in future campaigns through targeted efforts in low coverage areas, even at the expense of reduced coverage in previously high coverage areas. Reported human-mediated dog movements did not reduce elimination probability, so expending limited resources on restricting dog movements is unnecessary in this endemic setting. Enhanced surveillance will be necessary post-elimination, however, given the reintroduction risk from long-distance dog movements.

  2. Prevention and Treatment of Canine Leptospirosis Disease%犬钩端螺旋体病的防治措施

    Institute of Scientific and Technical Information of China (English)

    王飞; 刘士国

    2015-01-01

    The pathogen,epidemiolo-gy,clinical symptoms,necropsy lesions and diagnosis methods of canine lep-tospirosis disease were elaborated,and some prevention measures were proposed to provide a reference for the prevention and treatment of this disease.%阐述了犬钩端螺旋体病的病原、流行病学、临床症状、病理变化、诊断方法,并提出了相应的防治措施,旨在为该病的防治提供参考。

  3. Integrated control of ticks and fleas on dogs with particular reference to the prevention of vector-borne diseases

    NARCIS (Netherlands)

    Fourie, J.J.

    2015-01-01

    Because dogs are such loved companion animals, their health and wellbeing is of great importance to their human companions. Moreover, controlling ticks and fleas on dogs is also important in respect of the zoonotic risk that some of these parasites pose to their human companions. Numerous products a

  4. Parasites and vector-borne diseases in client-owned dogs in Albania. Intestinal and pulmonary endoparasite infections.

    Science.gov (United States)

    Shukullari, Enstela; Hamel, Dietmar; Rapti, Dhimitër; Pfister, Kurt; Visser, Martin; Winter, Renate; Rehbein, Steffen

    2015-12-01

    From March 2010 to April 2011 inclusive, feces from 602 client-owned dogs visiting four small animal clinics in Tirana, Albania, were examined using standard coproscopical techniques including Giardia coproantigen ELISA and immunofluorescent staining of Giardia cysts. Overall, samples of 245 dogs (40.7 %, 95 % CI 36.6-45.6) tested positive for at least one type of fecal endoparasite (protozoan and/or helminth and/or pentastomid) stage, of which 180 (29.9 %, 95 % CI 26.3-33.7) and 129 (21.9 %, 95 % CI 18.2-24.9) tested positive for protozoan or nematode endoparasites, respectively. Fecal forms of at least 14 endoparasites were identified. The most frequently identified stages were those of Giardia (26.4 %), Trichuris (9.5 %), Toxocara (8.0 %), hookworms (7.1 %), Cystoisospora ohioensis (4.3 %), and Cystoisospora canis (3 %). For the first time for dogs in Albania, fecal examination indicated the occurrence of Hammondia/Neospora-like (0.2 %), Angiostrongylus lungworm (0.3 %), capillariid (2.8 %), and Linguatula (0.2 %) infections. Single and multiple infections with up to seven parasites concurrently were found in 152 (25.2 %, 95 % CI 21.8-28.9) and 93 dogs (15.4 %, 95 % CI 12.7-18.6), respectively. On univariate analysis, the dog's age, the dog's purpose (pet, hunting dog, working dog), the dog's habitat (city, suburban, rural), and environment (mainly indoors, indoors with regular outside walking, yard, kennel/run), presence/absence of other dogs and/or cats, history of anthelmintic use, and season of examination were identified as significant (p dogs to various types of endoparasitism while the variables breed (pure breed dogs vs. mixed-breed dogs), gender, and type of food were not significant predictors. Multivariate logistic regression analysis for factors associated with overall endoparasitism revealed that dogs >1 year of age (odds ratio [OR] = 0.64), dogs dewormed at least once per year (OR = 0.35), and dogs tested during spring, summer, and autumn (OR = 0.51, 0.15, and 0.20, respectively) had a significantly lower risk compared with ≤1 year old dogs, dogs not dewormed, or dogs tested during winter. The odds of a dog to be diagnosed positive for endoparasites was 1.56 times higher for dogs living together with other pets than that for a dog without other dogs or cats. PMID:26350379

  5. Profile of The Chikungunya Infection: A Neglected Vector Borne Disease which is Prevalent In The Rajkot District

    OpenAIRE

    Bhagwati, Chundawat; M, Madhulika; Mehta, Krunal D; Y.S, Goswami

    2013-01-01

    Background: Chikungunya Virus has been responsible for significant human morbidity probably for several hundred years; yet in spite of its prevalence, the Chikungunya Virus epidemiology and the mechanisms of virulence and pathogenesis are still poorly understood and undetermined.

  6. knowledge, attitudes and practices study in relation to entomophobia and its application in vector-borne-diseases

    Institute of Scientific and Technical Information of China (English)

    Faranak Firoozfar; Nahid norjah; Mojgan Baniardalani; Seyed Hassan Moosa-Kazemi

    2012-01-01

    Objective: The study was carried out to determine the knowledge, believe and practice of students about insects for forthcoming research due to tropical medicine. Its application to tropical medicine is acceptable. Methods: The study was conducted among 300 students by pre-trained interviewers using a pre-test questionnaire in secondary, high school, and university in the Tehran city from June 2008 to May 2009. All statistics analysis was carried out the spss ver 11.5 EPI6, stata 80, chi-square and fisher exact test. Results: Significantly, 82.3% of the interviewers had problem when expose to insects (P<0.05). Domestic animals and unhygienic human habitant most importantly incriminate to present of insects. Out of 73.8% of the respondents believed the association between entomophobia and human habitat. Entomophobia was significantly associated with density and size of insects (P<0.05). Out of 37% of the respondents agree with killing of insects pest (P<0.05). Significantly steers was the common sign of entomophobia among the respondents (P<0.05). Out of %49.7 of audiences belived to association between entomophobia and age.Conclusion: In conclusion important the education and communication messages against entomophobia take in to consideration the local practice.

  7. Engaging scientists: An online survey exploring the experience of innovative biotechnological approaches to controlling vector-borne diseases

    OpenAIRE

    Boëte, C.; Beisel, U.; Reis Castro, L.; Césard, N.; Reeves, R

    2015-01-01

    Abstract: Background Pioneering technologies (e.g., nanotechnology, synthetic biology or climate engineering) are often associated with potential new risks and uncertainties that can become sources of controversy. The communication of information during their development and open exchanges between stakeholders is generally considered a key issue in their acceptance. While the attitudes of the public to novel technologies have been widely considered there has been relatively little investigati...

  8. Newcastle Disease Virus: Potential Therapeutic Application for Human and Canine Lymphoma

    Directory of Open Access Journals (Sweden)

    Diana Sánchez

    2015-12-01

    Full Text Available Research on oncolytic viruses has mostly been directed towards the treatment of solid tumors, which has yielded limited information regarding their activity in hematological cancer. It has also been directed towards the treatment of humans, yet veterinary medicine may also benefit. Several strains of the Newcastle disease virus (NDV have been used as oncolytics in vitro and in a number of in vivo experiments. We studied the cytolytic effect of NDV-MLS, a low virulence attenuated lentogenic strain, on a human large B-cell lymphoma cell line (SU-DHL-4, as well as on primary canine-derived B-cell lymphoma cells, and compared them to healthy peripheral blood mononuclear cells (PBMC from both humans and dogs. NDV-MLS reduced cell survival in both human (42% ± 5% and dog (34% ± 12% lymphoma cells as compared to untreated controls. No significant effect on PBMC was seen. Cell death involved apoptosis as documented by flow-cytometry. NDV-MLS infections of malignant lymphoma tumors in vivo in dogs were confirmed by electron microscopy. Early (24 h biodistribution of intravenous injection of 1 × 1012 TCID50 (tissue culture infective dose in a dog with T-cell lymphoma showed viral localization only in the kidney, the salivary gland, the lung and the stomach by immunohistochemistry and/or endpoint PCR. We conclude that NDV-MLS may be a promising agent for the treatment of lymphomas. Future research is needed to elucidate the optimal therapeutic regimen and establish appropriate biosafety measures.

  9. Newcastle Disease Virus: Potential Therapeutic Application for Human and Canine Lymphoma.

    Science.gov (United States)

    Sánchez, Diana; Pelayo, Rosana; Medina, Luis Alberto; Vadillo, Eduardo; Sánchez, Rogelio; Núñez, Luis; Cesarman-Maus, Gabriela; Sarmiento-Silva, Rosa Elena

    2016-01-01

    Research on oncolytic viruses has mostly been directed towards the treatment of solid tumors, which has yielded limited information regarding their activity in hematological cancer. It has also been directed towards the treatment of humans, yet veterinary medicine may also benefit. Several strains of the Newcastle disease virus (NDV) have been used as oncolytics in vitro and in a number of in vivo experiments. We studied the cytolytic effect of NDV-MLS, a low virulence attenuated lentogenic strain, on a human large B-cell lymphoma cell line (SU-DHL-4), as well as on primary canine-derived B-cell lymphoma cells, and compared them to healthy peripheral blood mononuclear cells (PBMC) from both humans and dogs. NDV-MLS reduced cell survival in both human (42% ± 5%) and dog (34% ± 12%) lymphoma cells as compared to untreated controls. No significant effect on PBMC was seen. Cell death involved apoptosis as documented by flow-cytometry. NDV-MLS infections of malignant lymphoma tumors in vivo in dogs were confirmed by electron microscopy. Early (24 h) biodistribution of intravenous injection of 1 × 10(12) TCID50 (tissue culture infective dose) in a dog with T-cell lymphoma showed viral localization only in the kidney, the salivary gland, the lung and the stomach by immunohistochemistry and/or endpoint PCR. We conclude that NDV-MLS may be a promising agent for the treatment of lymphomas. Future research is needed to elucidate the optimal therapeutic regimen and establish appropriate biosafety measures. PMID:26703717

  10. Exploration of Therapy for Coinfection of Canine Distemper and Canine Parvovirus Disease%犬瘟热与犬细小病毒病混合感染的治疗探析

    Institute of Scientific and Technical Information of China (English)

    赵晓莹

    2014-01-01

    犬瘟热(CD)与犬细小病毒病(CP)单独发生率较高,治疗效果也很好。但是目前细小病毒病与犬瘟热混合感染的疾病发生率呈上升趋势,且死亡率很高,给宠物犬造成严重的威胁。笔者针对一例犬的混合感染病例,提出了相应的治疗方案和预防措施。%The breaking out of either canine distemper or canine parvovirus disease solely is a common phenomenon and the therapeutic effect of the sole case is obvious. However, the case of coinfection of canine distemper and canine parvovirus disease is seldom, which caused a huge threat to pet dogs and high mortality. Aiming at a case of mixed infections, the corresponding treatment and preventive measures are put forward.

  11. Canine pulmonary angiostrongylosis

    DEFF Research Database (Denmark)

    Koch, Jørgen; Willesen, Jakob Lundgren

    2009-01-01

    Canine pulmonary angiostrongylosis is an emerging snail-borne disease causing verminous pnemonia and coagulopathy in dogs. The parasite is fund in Europe, North and South America and Africa, covering tropical, subtropical and temperate regions. Its distribution has been characterised by isolated...... larvae may not reflect what happens under field conditions. There is insufficient understanding of the spread of infection and the dynamic consequences of this parasite in the canine population. This review discusses the biology, epidemiology, clinical aspects and management of canine pulmonary...

  12. Canine Distemper

    Science.gov (United States)

    Although this brochure provides basic information about canine distemper, your veterinarian is always your best source of ... Consult your veterinarian for more information about canine distemper and its prevention. And Now A Note On ...

  13. Canine distemper virus from diseased large felids: Biological properties and phylogenetic relationships.

    NARCIS (Netherlands)

    T.C. Harder (Timm); M.J.H. Kenter (Marcel); H. Vos; C.H.J. Siebelink (Kees); W. Huisman (Willem); C. Örvell; T. Barrett (Thomas); M.J.G. Appel (Max); A.D.M.E. Osterhaus (Albert); G. van Amerongen (Geert)

    1996-01-01

    textabstractSpecific pathogen free (SPF) domestic cats were inoculated with tissue homogenate obtained from a Chinese leopard (Panthera pardus japonensis) that had died in a North American zoo from a natural infection with canine distemper virus (CDV). The cats developed a transient cell-associated

  14. Exploiting the potential of vector control for disease prevention.

    OpenAIRE

    H Townson; MB Nathan; Zaim, M.; Guillet, P.; Manga, L.; Bos, R.; M Kindhauser

    2005-01-01

    Although vector control has proven highly effective in preventing disease transmission, it is not being used to its full potential, thereby depriving disadvantaged populations of the benefits of well tried and tested methods. Following the discovery of synthetic residual insecticides in the 1940s, large-scale programmes succeeded in bringing many of the important vector-borne diseases under control. By the late 1960s, most vector-borne diseases - with the exception of malaria in Africa - were...

  15. AAV gene transfer delays disease onset in a TPP1-deficient canine model of the late infantile form of Batten disease

    Science.gov (United States)

    Katz, Martin L.; Tecedor, Luis; Chen, Yonghong; Williamson, Baye G.; Lysenko, Elena; Wininger, Fred A.; Young, Whitney M.; Johnson, Gayle C.; Whiting, Rebecca E. H.; Coates, Joan R.; Davidson, Beverly L.

    2016-01-01

    The most common form of the childhood neurodegenerative disease late infantile neuronal ceroid lipofuscinosis (also called Batten disease) is caused by deficiency of the soluble lysosomal enzyme tripeptidyl peptidase 1 (TPP1) resulting from mutations in the TPP1 gene. We tested whether TPP1 gene transfer to the ependyma, the epithelial lining of the brain ventricular system, in TPP1-deficient dogs would be therapeutically beneficial. A one-time administration of recombinant adeno-associated virus (rAAV) expressing canine TPP1 (rAAV.caTPP1) resulted in high expression of TPP1 predominantly in ependymal cells and secretion of the enzyme into the cerebrospinal fluid leading to clinical benefit. Diseased dogs treated with rAAV.caTPP1 showed delays in onset of clinical signs and disease progression, protection from cognitive decline, and extension of life span. By immunostaining and enzyme assay, recombinant protein was evident throughout the brain and spinal cord, with correction of the neuropathology characteristic of the disease. This study in a naturally occurring canine model of TPP1 deficiency highlights the utility of AAV transduction of ventricular lining cells to accomplish stable secretion of recombinant protein for broad distribution in the central nervous system and therapeutic benefit. PMID:26560358

  16. Molecular Characterization of Three Canine Models of Human Rare Bone Diseases: Caffey, van den Ende-Gupta, and Raine Syndromes

    Science.gov (United States)

    Hytönen, Marjo K.; Arumilli, Meharji; Lappalainen, Anu K.; Owczarek-Lipska, Marta; Jagannathan, Vidhya; Hundi, Sruthi; Salmela, Elina; Venta, Patrick; Sarkiala, Eva; Jokinen, Tarja; Gorgas, Daniela; Kere, Juha; Nieminen, Pekka

    2016-01-01

    One to two percent of all children are born with a developmental disorder requiring pediatric hospital admissions. For many such syndromes, the molecular pathogenesis remains poorly characterized. Parallel developmental disorders in other species could provide complementary models for human rare diseases by uncovering new candidate genes, improving the understanding of the molecular mechanisms and opening possibilities for therapeutic trials. We performed various experiments, e.g. combined genome-wide association and next generation sequencing, to investigate the clinico-pathological features and genetic causes of three developmental syndromes in dogs, including craniomandibular osteopathy (CMO), a previously undescribed skeletal syndrome, and dental hypomineralization, for which we identified pathogenic variants in the canine SLC37A2 (truncating splicing enhancer variant), SCARF2 (truncating 2-bp deletion) and FAM20C (missense variant) genes, respectively. CMO is a clinical equivalent to an infantile cortical hyperostosis (Caffey disease), for which SLC37A2 is a new candidate gene. SLC37A2 is a poorly characterized member of a glucose-phosphate transporter family without previous disease associations. It is expressed in many tissues, including cells of the macrophage lineage, e.g. osteoclasts, and suggests a disease mechanism, in which an impaired glucose homeostasis in osteoclasts compromises their function in the developing bone, leading to hyperostosis. Mutations in SCARF2 and FAM20C have been associated with the human van den Ende-Gupta and Raine syndromes that include numerous features similar to the affected dogs. Given the growing interest in the molecular characterization and treatment of human rare diseases, our study presents three novel physiologically relevant models for further research and therapy approaches, while providing the molecular identity for the canine conditions. PMID:27187611

  17. Molecular Characterization of Three Canine Models of Human Rare Bone Diseases: Caffey, van den Ende-Gupta, and Raine Syndromes.

    Science.gov (United States)

    Hytönen, Marjo K; Arumilli, Meharji; Lappalainen, Anu K; Owczarek-Lipska, Marta; Jagannathan, Vidhya; Hundi, Sruthi; Salmela, Elina; Venta, Patrick; Sarkiala, Eva; Jokinen, Tarja; Gorgas, Daniela; Kere, Juha; Nieminen, Pekka; Drögemüller, Cord; Lohi, Hannes

    2016-05-01

    One to two percent of all children are born with a developmental disorder requiring pediatric hospital admissions. For many such syndromes, the molecular pathogenesis remains poorly characterized. Parallel developmental disorders in other species could provide complementary models for human rare diseases by uncovering new candidate genes, improving the understanding of the molecular mechanisms and opening possibilities for therapeutic trials. We performed various experiments, e.g. combined genome-wide association and next generation sequencing, to investigate the clinico-pathological features and genetic causes of three developmental syndromes in dogs, including craniomandibular osteopathy (CMO), a previously undescribed skeletal syndrome, and dental hypomineralization, for which we identified pathogenic variants in the canine SLC37A2 (truncating splicing enhancer variant), SCARF2 (truncating 2-bp deletion) and FAM20C (missense variant) genes, respectively. CMO is a clinical equivalent to an infantile cortical hyperostosis (Caffey disease), for which SLC37A2 is a new candidate gene. SLC37A2 is a poorly characterized member of a glucose-phosphate transporter family without previous disease associations. It is expressed in many tissues, including cells of the macrophage lineage, e.g. osteoclasts, and suggests a disease mechanism, in which an impaired glucose homeostasis in osteoclasts compromises their function in the developing bone, leading to hyperostosis. Mutations in SCARF2 and FAM20C have been associated with the human van den Ende-Gupta and Raine syndromes that include numerous features similar to the affected dogs. Given the growing interest in the molecular characterization and treatment of human rare diseases, our study presents three novel physiologically relevant models for further research and therapy approaches, while providing the molecular identity for the canine conditions. PMID:27187611

  18. Molecular Characterization of Three Canine Models of Human Rare Bone Diseases: Caffey, van den Ende-Gupta, and Raine Syndromes.

    Directory of Open Access Journals (Sweden)

    Marjo K Hytönen

    2016-05-01

    Full Text Available One to two percent of all children are born with a developmental disorder requiring pediatric hospital admissions. For many such syndromes, the molecular pathogenesis remains poorly characterized. Parallel developmental disorders in other species could provide complementary models for human rare diseases by uncovering new candidate genes, improving the understanding of the molecular mechanisms and opening possibilities for therapeutic trials. We performed various experiments, e.g. combined genome-wide association and next generation sequencing, to investigate the clinico-pathological features and genetic causes of three developmental syndromes in dogs, including craniomandibular osteopathy (CMO, a previously undescribed skeletal syndrome, and dental hypomineralization, for which we identified pathogenic variants in the canine SLC37A2 (truncating splicing enhancer variant, SCARF2 (truncating 2-bp deletion and FAM20C (missense variant genes, respectively. CMO is a clinical equivalent to an infantile cortical hyperostosis (Caffey disease, for which SLC37A2 is a new candidate gene. SLC37A2 is a poorly characterized member of a glucose-phosphate transporter family without previous disease associations. It is expressed in many tissues, including cells of the macrophage lineage, e.g. osteoclasts, and suggests a disease mechanism, in which an impaired glucose homeostasis in osteoclasts compromises their function in the developing bone, leading to hyperostosis. Mutations in SCARF2 and FAM20C have been associated with the human van den Ende-Gupta and Raine syndromes that include numerous features similar to the affected dogs. Given the growing interest in the molecular characterization and treatment of human rare diseases, our study presents three novel physiologically relevant models for further research and therapy approaches, while providing the molecular identity for the canine conditions.

  19. Canine distemper virus from diseased large felids: Biological properties and phylogenetic relationships.

    OpenAIRE

    Harder, Timm; Kenter, Marcel; Vos, H.; Siebelink, Kees; Huisman, Willem; Örvell, C.; Barrett, Thomas,; Appel, Max; Osterhaus, Albert; Amerongen, Geert

    1996-01-01

    textabstractSpecific pathogen free (SPF) domestic cats were inoculated with tissue homogenate obtained from a Chinese leopard (Panthera pardus japonensis) that had died in a North American zoo from a natural infection with canine distemper virus (CDV). The cats developed a transient cell-associated CDV viraemia along with pronounced lymphopenia but did not show any clinical symptoms. Plasma neutralizing-antibody titres against the homologous CDV (A92-27/4, isolated from the Chinese leopard) w...

  20. Recombinant Newcastle disease viral vector expressing hemagglutinin or fusion of canine distemper virus is safe and immunogenic in minks.

    Science.gov (United States)

    Ge, Jinying; Wang, Xijun; Tian, Meijie; Gao, Yuwei; Wen, Zhiyuan; Yu, Guimei; Zhou, Weiwei; Zu, Shulong; Bu, Zhigao

    2015-05-15

    Canine Distemper Virus (CDV) infects many carnivores and cause several high-mortality disease outbreaks. The current CDV live vaccine cannot be safely used in some exotic species, such as mink and ferret. Here, we generated recombinant lentogenic Newcastle disease virus (NDV) LaSota expressing either envelope glycoproyein, heamagglutinine (H) or fusion protein (F), named as rLa-CDVH and rLa-CDVF, respectively. The feasibility of these recombinant NDVs to serve as live virus-vectored CD vaccine was evaluated in minks. rLa-CDVH induced significant neutralization antibodies (NA) to CDV and provided solid protection against virulent CDV challenge. On the contrast, rLa-CDVF induced much lower NA to CDV and fail to protected mink from virulent CDV challenge. Results suggest that recombinant NDV expressing CDV H is safe and efficient candidate vaccine against CDV in mink, and maybe other host species. PMID:25865465

  1. Lyme Disease

    OpenAIRE

    Weil, M L

    1989-01-01

    Lyme disease, caused by spirochete Borrelia burgdorferi, is the most common vector-borne disease in the United States. The clinical presentation varies depending on the stage of the illness: early disease includes erthyma migrans, early disseminated disease includes multiple erythema migrans, meningitis, cranial nerve palsies and carditis; late disease is primarily arthritis. The symptoms and signs of infection resolve in the vast majority of patients after appropriate treatment with antimicr...

  2. Canine Parvovirus Disease Pathology and Clinical Observation%犬细小病毒病的病理观察及临床治疗

    Institute of Scientific and Technical Information of China (English)

    王守山

    2011-01-01

    犬细小病毒病是由犬细小病毒(Canine parvovirus,CPV)引起的一种高度接触性传染病,临床上以剧烈呕吐、排血样粪便或心肌炎为特征.病犬和带毒犬是该病的主要传染源,临床症状表现为两种类型:心肌炎型和肠炎型,造成胃肠、心脏严重的组织病变.其中,肠炎型较为常见.犬细小病毒病在感染的初期,如果能够准确诊断,及早治疗,采取综合性治疗措施,限制病毒血症的程度和持续时间,可取得理想的治疗效果.%Canine parvovirus disease is caused by canine parvovirus(Canine parvovirus,CPV) causes a highly contagious disease,the clinical to severe vomiting,stool or blood discharge is characterized by myocarditis.Infected dogs,and dogs are the main source of infection,disease,clinical symptoms of two types: type myocarditis and enteritis-type,resulting in gastrointestinal,heart,severe tissue lesions.Among them,the more common type of colitis.Canine parvovirus disease in the early stages of infection,if an accurate diagnosis,early treatment,comprehensive treatment measures taken to limit the degree of viremia and duration,can achieve the desired therapeutic effect.

  3. Canine prostatic disease: comparison of radiographic appearance with morphologic and microbiologic findings: 30 cases (1981-1985)

    International Nuclear Information System (INIS)

    A retrospective analysis was made of radiographs from 24 clinically normal young adult male Beagles used in previously reported base-line research on the distal male urinary tract. The ventrodorsal and craniocaudal prostate gland dimensions were measured, as visualized on the lateral radiographic view, and expressed as a ratio of the distance between the cranial aspect of the public bone and the sacral promontory. In 17 of these 24 dogs, there was sufficient image clarity to permit confident measurement of prostatic dimensions. From these data, the largest acceptable prostatic dimension, as visualized on the lateral radiographic view, was 70% of the public-promontory distance. A retrospective analysis was made of 30 cases of canine prostatic disease, with the objective of identifying the radiographic (survey and distention retrograde urethrocystogram) appearance most often associated with the various spontaneous prostatic diseases. Prostatomegaly was not specific for the cause of prostatic disease, except if the apparent parenchymal dimensions were greater than or equal to 90% of the public-promontory distance wherein neoplasia, abscess, and paraprostatic cysts (readily differentiated from diffuse intraparenchymal disease by ultrasonography) were the principle considerations. Multifocal, irregularly shaped, parenchymal mineral densities were observed only in dogs with prostatic carcinoma (4/7 cases) or prostatitis (1 case of chronic prostatitis). Narrowing of the prostatic portion of the urethra was observed only in association with abscess, neoplasm, or noninflammatory nonneoplastic disease (possibly benign hypertrophy/hyperplasia), whereas widening of this part of the urethra was not observed

  4. Malaria and other vector-borne infection surveillance in the U.S. Department of Defense Armed Forces Health Surveillance Center-Global Emerging Infections Surveillance program: review of 2009 accomplishments.

    Science.gov (United States)

    Fukuda, Mark M; Klein, Terry A; Kochel, Tadeusz; Quandelacy, Talia M; Smith, Bryan L; Villinski, Jeff; Bethell, Delia; Tyner, Stuart; Se, Youry; Lon, Chanthap; Saunders, David; Johnson, Jacob; Wagar, Eric; Walsh, Douglas; Kasper, Matthew; Sanchez, Jose L; Witt, Clara J; Cheng, Qin; Waters, Norman; Shrestha, Sanjaya K; Pavlin, Julie A; Lescano, Andres G; Graf, Paul C F; Richardson, Jason H; Durand, Salomon; Rogers, William O; Blazes, David L; Russell, Kevin L; Akala, Hoseah; Gaydos, Joel C; DeFraites, Robert F; Gosi, Panita; Timmermans, Ans; Yasuda, Chad; Brice, Gary; Eyase, Fred; Kronmann, Karl; Sebeny, Peter; Gibbons, Robert; Jarman, Richard; Waitumbi, John; Schnabel, David; Richards, Allen; Shanks, Dennis

    2011-01-01

    Vector-borne infections (VBI) are defined as infectious diseases transmitted by the bite or mechanical transfer of arthropod vectors. They constitute a significant proportion of the global infectious disease burden. United States (U.S.) Department of Defense (DoD) personnel are especially vulnerable to VBIs due to occupational contact with arthropod vectors, immunological naiveté to previously unencountered pathogens, and limited diagnostic and treatment options available in the austere and unstable environments sometimes associated with military operations. In addition to the risk uniquely encountered by military populations, other factors have driven the worldwide emergence of VBIs. Unprecedented levels of global travel, tourism and trade, and blurred lines of demarcation between zoonotic VBI reservoirs and human populations increase vector exposure. Urban growth in previously undeveloped regions and perturbations in global weather patterns also contribute to the rise of VBIs. The Armed Forces Health Surveillance Center-Global Emerging Infections Surveillance and Response System (AFHSC-GEIS) and its partners at DoD overseas laboratories form a network to better characterize the nature, emergence and growth of VBIs globally. In 2009 the network tested 19,730 specimens from 25 sites for Plasmodium species and malaria drug resistance phenotypes and nearly another 10,000 samples to determine the etiologies of non-Plasmodium species VBIs from regions spanning from Oceania to Africa, South America, and northeast, south and Southeast Asia. This review describes recent VBI-related epidemiological studies conducted by AFHSC-GEIS partner laboratories within the OCONUS DoD laboratory network emphasizing their impact on human populations. PMID:21388569

  5. Pathogenic landscape of transboundary zoonotic diseases in the Mexico-U.S. border along the Rio Grande

    Science.gov (United States)

    Transboundary zoonotic diseases, several of which are vector borne, can maintain a dynamic focus and have pathogens circulating in geographic regions encircling multiple geopolitical boundaries. Global change is intensifying transboundary problems, including the spatial variation of the risk and inc...

  6. Intrarenal Distributions and Changes of Angiotensin-Converting Enzyme and Angiotensin-Converting Enzyme 2 in Feline and Canine Chronic Kidney Disease

    OpenAIRE

    MITANI, Sawane; Yabuki, Akira; Sawa, Mariko; Chang, Hye-Sook; YAMATO, Osamu

    2013-01-01

    ABSTRACT Angiotensin-converting enzyme (ACE) is a key enzyme in the renin-angiotensin system (RAS). ACE2 is a newly identified member of the RAS. The present immunohistochemical study focused on changes in intrarenal ACE and ACE2 immunoreactivity in feline and canine chronic kidney disease (CKD). ACE immunoreactivity was predominantly observed in the brush border of the proximal tubules in dogs and cats. ACE immunoreactivity was lower in CKD kidneys than in normal kidneys, and quantitative an...

  7. Thorough investigation of a canine autoinflammatory disease (AID) confirms one main risk locus and suggests a modifier locus for amyloidosis.

    Science.gov (United States)

    Olsson, Mia; Tintle, Linda; Kierczak, Marcin; Perloski, Michele; Tonomura, Noriko; Lundquist, Andrew; Murén, Eva; Fels, Max; Tengvall, Katarina; Pielberg, Gerli; Dufaure de Citres, Caroline; Dorso, Laetitia; Abadie, Jérôme; Hanson, Jeanette; Thomas, Anne; Leegwater, Peter; Hedhammar, Åke; Lindblad-Toh, Kerstin; Meadows, Jennifer R S

    2013-01-01

    Autoinflammatory disease (AID) manifests from the dysregulation of the innate immune system and is characterised by systemic and persistent inflammation. Clinical heterogeneity leads to patients presenting with one or a spectrum of phenotypic signs, leading to difficult diagnoses in the absence of a clear genetic cause. We used separate genome-wide SNP analyses to investigate five signs of AID (recurrent fever, arthritis, breed specific secondary dermatitis, otitis and systemic reactive amyloidosis) in a canine comparative model, the pure bred Chinese Shar-Pei. Analysis of 255 DNA samples revealed a shared locus on chromosome 13 spanning two peaks of association. A three-marker haplotype based on the most significant SNP (pELMO1, HAS2 and IL6). These results illustrate that phenotypic heterogeneity need not be a reflection of genetic heterogeneity, and that genetic modifiers of disease could be masked if syndromes were not first considered as individual clinical signs and then as a sum of their component parts. PMID:24130694

  8. Canine cutaneous leishmaniasis caused by neotropical Leishmania infantum despite of systemic disease: A case report.

    Science.gov (United States)

    Cavalcanti, Amanda; Lobo, Rogério; Cupolillo, Elisa; Bustamante, Fábio; Porrozzi, Renato

    2012-12-01

    Visceral leishmaniasis is an anthropozoonosis caused by a protozoan Leishmania infantum (syn. Leishmania chagasi). Here, we report a typical case of canine cutaneous leishmaniasis due to L. infantum infection without any other systemic symptom in one dog in the city of Rio de Janeiro, Brazil. A mongrel female dog was admitted in a veterinary clinic with reports of chronic wounds in the body. Physical examination revealed erosive lesions in the limbs, nasal ulcers, presence of ectoparasites and seborrheic dermatitis. Blood samples and fragments of healthy and injured skin were collected. The complete hemogram revealed aregenerative normocytic normochromic anemia and erythrocyte rouleaux, and biochemical analysis revealed normal renal and hepatic functions. Cytology of the muzzle and skin lesions suggested pyogranulomatous inflammatory process. The histopathology of a skin fragment was performed and revealed suspicion of protozoa accompanied by necrotizing dermatitis. The diagnosis of leishmaniasis was accomplished by positive serology, isolation of Leishmania from the skin lesion, and also by molecular test (PCR targeting the conserved region of Leishmania kDNA). Culture was positive for damaged skin samples. PCR targeting a fragment of Leishmania hsp70 gene was performed employing DNA extracted from damaged skin. RFLP of the amplified hsp70 fragment identified the parasite as L. infantum, instead of Leishmania braziliensis, the main agent of cutaneous leishmaniasis in Rio de Janeiro. Characterization of isolated promastigotes by five different enzymatic systems confirmed the species identification of the etiological agent. Serology was positive by ELISA and rapid test. This case warns to the suspicion of viscerotropic Leishmania in cases of chronic skin lesions and brings the discussion of the mechanisms involved in the parasite tissue tropism. PMID:22583758

  9. Experimental Model of Gene Transfection in Healthy Canine Myocardium: Perspectives of Gene Therapy for Ischemic Heart Disease

    Directory of Open Access Journals (Sweden)

    Renato A. K. Kalil

    2002-09-01

    Full Text Available OBJECTIVE: To assess the transfection of the gene that encodes green fluorescent protein (GFP through direct intramyocardial injection. METHODS: The pREGFP plasmid vector was used. The EGFP gene was inserted downstream from the constitutive promoter of the Rous sarcoma virus. Five male dogs were used (mean weight 13.5 kg, in which 0.5 mL of saline solution (n=1 or 0.5 mL of plasmid solution containing 0.5 µg of pREGFP/dog (n=4 were injected into the myocardium of the left ventricular lateral wall. The dogs were euthanized 1 week later, and cardiac biopsies were obtained. RESULTS: Fluorescence microscopy showed differences between the cells transfected and not transfected with pREGFP plasmid. Mild fluorescence was observed in the cardiac fibers that received saline solution; however, the myocardial cells transfected with pREGFP had overt EGFP expression. CONCLUSION: Transfection with the EGFP gene in healthy canine myocardium was effective. The reproduction of this efficacy using vascular endothelial growth factor (VEGF instead of EGFP aims at developing gene therapy for ischemic heart disease.

  10. Immunomodulatory drugs and their application to the management of canine immune-mediated disease.

    Science.gov (United States)

    Whitley, N T; Day, M J

    2011-02-01

    This review summarises the current understanding of immune response and T cell subsets in the context of development of autoimmunity in the dog. Mode of action and rational usage in immune-mediated disease in the dog are discussed for the following drugs: glucocorticoids, azathioprine, cyclophosphamide, ciclosporin, tacrolimus, human intravenous immunoglobulin, vincristine, danazol, leflunomide, mycophenolate mofetil and liposome-encapsulated clodronate. Disease mechanisms are discussed and published evidence for drug efficacy is scrutinised for five important immune-mediated diseases: immune-mediated haemolytic anaemia, immune-mediated thrombocytopenia, myasthenia gravis, glomerulonephritis and inflammatory bowel disease. Future strategies for more refined manipulation of adverse immune responses are presented. PMID:21265846

  11. Thorough investigation of a canine autoinflammatory disease (AID confirms one main risk locus and suggests a modifier locus for amyloidosis.

    Directory of Open Access Journals (Sweden)

    Mia Olsson

    Full Text Available Autoinflammatory disease (AID manifests from the dysregulation of the innate immune system and is characterised by systemic and persistent inflammation. Clinical heterogeneity leads to patients presenting with one or a spectrum of phenotypic signs, leading to difficult diagnoses in the absence of a clear genetic cause. We used separate genome-wide SNP analyses to investigate five signs of AID (recurrent fever, arthritis, breed specific secondary dermatitis, otitis and systemic reactive amyloidosis in a canine comparative model, the pure bred Chinese Shar-Pei. Analysis of 255 DNA samples revealed a shared locus on chromosome 13 spanning two peaks of association. A three-marker haplotype based on the most significant SNP (p<2.6×10(-8 from each analysis showed that one haplotypic pair (H13-11 was present in the majority of AID individuals, implicating this as a shared risk factor for all phenotypes. We also noted that a genetic signature (F ST distinguishing the phenotypic extremes of the breed specific Chinese Shar-Pei thick and wrinkled skin, flanked the chromosome 13 AID locus; suggesting that breed development and differentiation has played a parallel role in the genetics of breed fitness. Intriguingly, a potential modifier locus for amyloidosis was revealed on chromosome 14, and an investigation of candidate genes from both this and the chromosome 13 regions revealed significant (p<0.05 renal differential expression in four genes previously implicated in kidney or immune health (AOAH, ELMO1, HAS2 and IL6. These results illustrate that phenotypic heterogeneity need not be a reflection of genetic heterogeneity, and that genetic modifiers of disease could be masked if syndromes were not first considered as individual clinical signs and then as a sum of their component parts.

  12. Chagas Disease: No Longer Exotic

    Centers for Disease Control (CDC) Podcasts

    2008-04-03

    This podcast is designed to inform health care providers about Chagas disease, diagnosis, and treatment and to assist in identifying infected patients.  Created: 4/3/2008 by National Center for Zoonotic, Vector-Borne, and Enteric Diseases (NCZVED).   Date Released: 4/8/2008.

  13. Canine Distemper Virus: an Emerging Disease in Wild Endangered Amur Tigers (Panthera tigris altaica)

    OpenAIRE

    Seimon, Tracie A.; Miquelle, Dale G.; Chang, Tylis Y.; Newton, Alisa L.; Korotkova, Irina; Ivanchuk, Galina; Lyubchenko, Elena; Tupikov, Andre; Slabe, Evgeny; McAloose, Denise

    2013-01-01

    ABSTRACT Fewer than 500 Amur tigers (Panthera tigris altaica) remain in the wild. Due to low numbers and their solitary and reclusive nature, tiger sightings across their range in the Russian Far East and China are rare; sightings of sick tigers are rarer still. Serious neurologic disease observed in several wild tigers since 2001 suggested disease emergence in this endangered species. To investigate this possibility, histology, immunohistochemistry (IHC), in situ hybridization (ISH), and rev...

  14. Characterization of a canine model of glycogen storage disease type IIIa

    OpenAIRE

    Yi, Haiqing; Thurberg, Beth L.; Curtis, Sarah; Austin, Stephanie; Fyfe, John; Koeberl, Dwight D.; Kishnani, Priya S.; Sun, Baodong

    2012-01-01

    SUMMARY Glycogen storage disease type IIIa (GSD IIIa) is an autosomal recessive disease caused by deficiency of glycogen debranching enzyme (GDE) in liver and muscle. The disorder is clinically heterogeneous and progressive, and there is no effective treatment. Previously, a naturally occurring dog model for this condition was identified in curly-coated retrievers (CCR). The affected dogs carry a frame-shift mutation in the GDE gene and have no detectable GDE activity in liver and muscle. We ...

  15. Investigation of Epidemiology,Prevention and Treatment on Canine Parvovirus Disease in Changji of Xinjiang%新疆昌吉市犬细小病毒病流行病学与防治调查

    Institute of Scientific and Technical Information of China (English)

    孙梅; 吴建华

    2014-01-01

    通过对昌吉市犬细小病毒病的流行病学和防治的调查,得出犬细小病毒病的发生与犬的品种、年龄、季节具有明显关系,即纯种犬比杂种犬的发病率高,6月龄以内的犬发病率高,每年4月、9月为高发月份。犬细小病毒病的发病率与疫苗免疫密切相关,因此接种疫苗预防仍然是控制该病流行的最主要途径。%Through the investigation of epidemiology and prevention of canine parvovirus disease in Changji City,the canine parvovirus disease has obvious characteristics in canine breed,age and season.The canine parvovirus disease affects pure bred dogs more than other dogs,The high incidence occurred in less than 6 month dogs,and in April and September.Canine parvovirus disease is closely related with vaccine.So vac-cination prevention is still the most important way to control the disease epidemic.

  16. Lyme Disease and Pregnancy

    OpenAIRE

    Alexander, James M.; Cox, Susan M.

    1995-01-01

    Lyme disease is the most commonly transmitted vector-borne disease in the United States, with many regions of the country at risk. Like other spirochete-borne infections, Lyme disease progresses in stages, making diagnosis in the early stages of the illness and prompt treatment important for cure. An early diagnosis is made difficult by the less-than-ideal serologic tests and the varied clinical presentations of the disease. Although Lyme disease has been reported in pregnancy, the transmissi...

  17. Tick-Associated Diseases: Symptoms, Treatment and Prevention

    Science.gov (United States)

    Anderson, Alice; Chaney, Elizabeth

    2009-01-01

    According to the Centers for Disease Control and Prevention (CDC), there are eleven tick-associated diseases prevalent in the United States. Most commonly diagnosed are Lyme disease, anaplasmosis (ehrlichiosis) and babeisois, with Lyme disease being the most common vector-borne disease in the country. In southeastern states, studies have shown the…

  18. Use of serologic tests to predict resistance to Canine distemper virus-induced disease in vaccinated dogs.

    Science.gov (United States)

    Jensen, Wayne A; Totten, Janet S; Lappin, Michael R; Schultz, Ronald D

    2015-09-01

    The objective of the current study was to determine whether detection of Canine distemper virus (CDV)-specific serum antibodies correlates with resistance to challenge with virulent virus. Virus neutralization (VN) assay results were compared with resistance to viral challenge in 2 unvaccinated Beagle puppies, 9 unvaccinated Beagle dogs (4.4-7.2 years of age), and 9 vaccinated Beagle dogs (3.7-4.7 years of age). Eight of 9 (89%) unvaccinated adult dogs exhibited clinical signs after virus challenge, and 1 (13%) dog died. As compared to adult dogs, the 2 unvaccinated puppies developed more severe clinical signs and either died or were euthanized after challenge. In contrast, no clinical signs were detected after challenge of the 9 adult vaccinated dogs with post-vaccination intervals of up to 4.4 years. In vaccinated dogs, the positive and negative predictive values of VN assay results for resistance to challenge were 100% and 0%, respectively. Results indicate that dogs vaccinated with modified live CDV can be protected from challenge for ≤4.4 years postvaccination and that detection of virus-specific antibodies is predictive of whether dogs are resistant to challenge with virulent virus. Results also indicate that CDV infection in unvaccinated dogs results in age-dependent morbidity and mortality. Knowledge of age-dependent morbidity and mortality, duration of vaccine-induced immunity, and the positive and negative predictive values of detection of virus-specific serum antibodies are useful in development of rational booster vaccination intervals for the prevention of CDV-mediated disease in adult dogs. PMID:26330396

  19. Contrast-enhanced ultrasonographic characteristics of the diseased canine prostate gland.

    Science.gov (United States)

    Troisi, Alessandro; Orlandi, Riccardo; Bargellini, Paolo; Menchetti, Laura; Borges, Paulo; Zelli, Riccardo; Polisca, Angela

    2015-11-01

    The work was carried out on a total of 26 male dogs that on the basis of clinical examination, prostate ultrasound and prostate biopsy, were divided prospectively into four groups: (1) normal dogs (control group; n = 8); (2) dogs with benign prostatic hyperplasia (group BPH; n = 8); (3) dogs suffering from prostatitis (group prostatitis; n = 4); (4) dogs with prostatic tumors (group tumors; n = 6). The examination of the prostate by means of contrast medium and dedicated ultrasound system allowed a detailed qualitative and quantitative analysis of prostatic vessels in normal and diseased conditions, enabling the detection and characterization of different disease states, and quantification of parameters such as peak intensity of perfusion (%), arrival time of the contrast medium to its maximum value of video intensity (time to peak [TTP; seconds]), regional blood volume, regional blood flow, and mean transit time (MTT [seconds]). The hemodynamic indices TTP (P < 0.01) and MTT (P < 0.001) of diseased prostate groups were significantly lower than those in the normal prostate group although there were no differences among diseases. Optimal cutoff values were 31 seconds (Sensitivity: 72%; Specificity: 88%) and 47 seconds (Sensitivity: 100%; Specificity: 88%) while area under receiver operating characteristic curves were 0.86 (P < 0.01) and 0.97 (P < 0.01) for TTP and MTT, respectively. The qualitative evaluation of vascular patterns showed differences between normal and diseased prostate glands. The latter were characterized by an alteration of the normal vascular appearance consisting of loss of the subcapsular arterioles and lack of a centripetal vascular pattern. The qualitative aspect of the study highlighted the different vascular architecture between BPH, prostatitis, adenocarcinoma, and lymphoma. This study shows how contrast-enhanced ultrasound represents a valid and noninvasive method for highlighting and characterizing prostatic vasculature

  20. Demographic characteristics and infectious diseases of a population of American black bears in Humboldt County, California.

    Science.gov (United States)

    Stephenson, Nicole; Higley, J Mark; Sajecki, Jaime L; Chomel, Bruno B; Brown, Richard N; Foley, Janet E

    2015-02-01

    American black bears (Ursus americanus) are common, widely distributed, and broad-ranging omnivorous mammals in northern California forests. Bears may be susceptible to pathogens infecting both domestic animals and humans. Monitoring bear populations, particularly in changing ecosystems, is important to understanding ecological features that could affect bear population health and influence the likelihood that bears may cause adverse impacts on humans. In all, 321 bears were captured between May, 2001, and October, 2003, and blood samples were collected and tested for multiple zoonotic and vector-borne diseases. We found a PCR prevalence of 10% for Anaplasma phagocytophilum, and a seroprevalence of 28% for Toxoplasma gondii, 26% for Borrelia burgdorferi, 26% for A. phagocytophilum, 8% for Trichinella spiralis, 8% for Francisella tularensis and 1% for Yersinia pestis. In addition, we tested bears for pathogens of domestic dogs and found a seroprevalence of 15% for canine distemper virus and 0.6% for canine parvovirus. Our findings show that black bears can become infected with pathogens that are an important public health concern, as well as pathogens that can affect both domestic animals and other wildlife species. PMID:25700042

  1. 犬细小病毒病的临床诊疗效果研究%Experience of Clinical Diagnosis and Treatment on Canine Parvovirus Disease

    Institute of Scientific and Technical Information of China (English)

    邓树义; 田风林

    2012-01-01

    犬细小病毒病是由犬细小病毒(cpv)引起的一种急性传染病,发病率和死亡率比较高,达10%~50%,自愈率〈5%.笔者在近一年中的犬病治疗过程中用犬细小病毒快速诊断试纸条确诊为犬细小病毒病的有16例。经过临床治疗得出,除了采用高免血清和对症治疗外,治愈率的高低在很大程度上取决于输液,此外对病犬的护理正确精细与否也有一定的关系。本文重点介绍了犬细小病毒病的临床症状、剖检变化、鉴别诊断、治疗情况及治疗体会。%Canine parvovirus (CPV) disease is a kind of acute infectious disease caused by canine parvovirus. Rate of incidence and mortality is high, up to 10~50%, self healing rate is lower than 5%. Sixteen cases were diagnosed during about one year's therapy process using fast dignosis test strip. Cure rate relied heavily on the infusion, besides high titer serum and symptomatic treatment as well as right and careful care. In this article, clinical symptom, necropsy, differential diagnosis, cure condition and experience of canine parvovirus disease were introduced.

  2. Newcastle Disease Virus: Potential Therapeutic Application for Human and Canine Lymphoma

    OpenAIRE

    Diana Sánchez; Rosana Pelayo; Luis Alberto Medina; Eduardo Vadillo; Rogelio Sánchez; Luis Núñez; Gabriela Cesarman-Maus; Rosa Elena Sarmiento-Silva

    2015-01-01

    Research on oncolytic viruses has mostly been directed towards the treatment of solid tumors, which has yielded limited information regarding their activity in hematological cancer. It has also been directed towards the treatment of humans, yet veterinary medicine may also benefit. Several strains of the Newcastle disease virus (NDV) have been used as oncolytics in vitro and in a number of in vivo experiments. We studied the cytolytic effect of NDV-MLS, a low virulence attenuated lentogenic s...

  3. Characterization of a canine model of glycogen storage disease type IIIa

    Directory of Open Access Journals (Sweden)

    Haiqing Yi

    2012-11-01

    Glycogen storage disease type IIIa (GSD IIIa is an autosomal recessive disease caused by deficiency of glycogen debranching enzyme (GDE in liver and muscle. The disorder is clinically heterogeneous and progressive, and there is no effective treatment. Previously, a naturally occurring dog model for this condition was identified in curly-coated retrievers (CCR. The affected dogs carry a frame-shift mutation in the GDE gene and have no detectable GDE activity in liver and muscle. We characterized in detail the disease expression and progression in eight dogs from age 2 to 16 months. Monthly blood biochemistry revealed elevated and gradually increasing serum alanine transaminase (ALT, aspartate transaminase (AST and alkaline phosphatase (ALP activities; serum creatine phosphokinase (CPK activity exceeded normal range after 12 months. Analysis of tissue biopsy specimens at 4, 12 and 16 months revealed abnormally high glycogen contents in liver and muscle of all dogs. Fasting liver glycogen content increased from 4 months to 12 months, but dropped at 16 months possibly caused by extended fibrosis; muscle glycogen content continually increased with age. Light microscopy revealed significant glycogen accumulation in hepatocytes at all ages. Liver histology showed progressive, age-related fibrosis. In muscle, scattered cytoplasmic glycogen deposits were present in most cells at 4 months, but large, lake-like accumulation developed by 12 and 16 months. Disruption of the contractile apparatus and fraying of myofibrils was observed in muscle at 12 and 16 months by electron microscopy. In conclusion, the CCR dogs are an accurate model of GSD IIIa that will improve our understanding of the disease progression and allow opportunities to investigate treatment interventions.

  4. Characterization of a canine model of glycogen storage disease type IIIa.

    Science.gov (United States)

    Yi, Haiqing; Thurberg, Beth L; Curtis, Sarah; Austin, Stephanie; Fyfe, John; Koeberl, Dwight D; Kishnani, Priya S; Sun, Baodong

    2012-11-01

    Glycogen storage disease type IIIa (GSD IIIa) is an autosomal recessive disease caused by deficiency of glycogen debranching enzyme (GDE) in liver and muscle. The disorder is clinically heterogeneous and progressive, and there is no effective treatment. Previously, a naturally occurring dog model for this condition was identified in curly-coated retrievers (CCR). The affected dogs carry a frame-shift mutation in the GDE gene and have no detectable GDE activity in liver and muscle. We characterized in detail the disease expression and progression in eight dogs from age 2 to 16 months. Monthly blood biochemistry revealed elevated and gradually increasing serum alanine transaminase (ALT), aspartate transaminase (AST) and alkaline phosphatase (ALP) activities; serum creatine phosphokinase (CPK) activity exceeded normal range after 12 months. Analysis of tissue biopsy specimens at 4, 12 and 16 months revealed abnormally high glycogen contents in liver and muscle of all dogs. Fasting liver glycogen content increased from 4 months to 12 months, but dropped at 16 months possibly caused by extended fibrosis; muscle glycogen content continually increased with age. Light microscopy revealed significant glycogen accumulation in hepatocytes at all ages. Liver histology showed progressive, age-related fibrosis. In muscle, scattered cytoplasmic glycogen deposits were present in most cells at 4 months, but large, lake-like accumulation developed by 12 and 16 months. Disruption of the contractile apparatus and fraying of myofibrils was observed in muscle at 12 and 16 months by electron microscopy. In conclusion, the CCR dogs are an accurate model of GSD IIIa that will improve our understanding of the disease progression and allow opportunities to investigate treatment interventions. PMID:22736456

  5. Mapping of the disease locus and identification of ADAMTS10 as a candidate gene in a canine model of primary open angle glaucoma.

    Directory of Open Access Journals (Sweden)

    John Kuchtey

    2011-02-01

    Full Text Available Primary open angle glaucoma (POAG is a leading cause of blindness worldwide, with elevated intraocular pressure as an important risk factor. Increased resistance to outflow of aqueous humor through the trabecular meshwork causes elevated intraocular pressure, but the specific mechanisms are unknown. In this study, we used genome-wide SNP arrays to map the disease gene in a colony of Beagle dogs with inherited POAG to within a single 4 Mb locus on canine chromosome 20. The Beagle POAG locus is syntenic to a previously mapped human quantitative trait locus for intraocular pressure on human chromosome 19. Sequence capture and next-generation sequencing of the entire canine POAG locus revealed a total of 2,692 SNPs segregating with disease. Of the disease-segregating SNPs, 54 were within exons, 8 of which result in amino acid substitutions. The strongest candidate variant causes a glycine to arginine substitution in a highly conserved region of the metalloproteinase ADAMTS10. Western blotting revealed ADAMTS10 protein is preferentially expressed in the trabecular meshwork, supporting an effect of the variant specific to aqueous humor outflow. The Gly661Arg variant in ADAMTS10 found in the POAG Beagles suggests that altered processing of extracellular matrix and/or defects in microfibril structure or function may be involved in raising intraocular pressure, offering specific biochemical targets for future research and treatment strategies.

  6. What Teachers Need to Know about Lyme Disease

    Science.gov (United States)

    Cook, Lysandra

    2009-01-01

    Although widely misunderstood, Lyme disease is the most prevalent vector borne disease in the United States. Children are the most at-risk group for Lyme disease, which can impact every system in the body. It can produce the musculo-skeletal, neurologic, psychiatric, opthalmologic, and cardiac symptoms. The symptoms of Lyme disease can have a…

  7. Canine mastocytosis

    OpenAIRE

    Paiva, D.; Mendonça, A; Vala, Helena

    2013-01-01

    Mastocytosis is a mast cell disorder in which its exaggerated proliferation can occur in two forms: systemic and cutaneous (Davis et al., 1992). Because canine mastocytosis is a rare situation of controversial and difficult diagnosis, the goal of this study consists in a current revision of this subject, in order to sensitize the veterinary staff to its severity, with particular focus on the information the veterinary nurse must hold to better apply a specialized nursing care with the hig...

  8. Integrating vector control across diseases

    OpenAIRE

    Golding, N.; Wilson, AL; Moyes, CL; Cano, J.; Pigott, DM; Velayudhan, R; Brooker, SJ; Smith, DL; Hay, SI; Lindsay, SW

    2015-01-01

    Background Vector-borne diseases cause a significant proportion of the overall burden of disease across the globe, accounting for over 10 % of the burden of infectious diseases. Despite the availability of effective interventions for many of these diseases, a lack of resources prevents their effective control. Many existing vector control interventions are known to be effective against multiple diseases, so combining vector control programmes to simultaneously tackle several diseases could of...

  9. 19例犬细小病毒病的诊疗报告%The Diagnosis and Treatment of Nineteen Cases of Canine Parvovirus Disease

    Institute of Scientific and Technical Information of China (English)

    李博岩; 陆曼

    2015-01-01

    Nineteen cases of enteritis type canine parvovirus disease in an animal hospital were diagnosed based on the analysis of the treatment protocol and experience. Among the cases, two of them were mixed infection with parasite, four of them were mixed infection with coronavirus, and other 13 cases were simple infection of parvovirus. The sufficient and prompt employment of antiviral drugs combining with anti-inflammation, fluid infusion and correcting the unbalance between acid and alkali were effective treatment measures for canine parvovirus disease.%对某动物医院确诊的19例犬细小病毒病患犬的治疗方法和经验进行汇总、归纳和分析,发现19例均为肠炎型。其中,与寄生虫混合感染的有2例,与冠状病毒感染的有4例,其余13例为单纯犬细小病毒感染。对于细小病毒病患犬要尽早、足量使用抗病毒药物治疗,并配合采取消炎、补液、纠正酸碱失衡等措施是保证疗效的关键。

  10. APPLICATION OF LOTS QUALITY ASSURANCE SAMPLING & EVALUATION IN NATIONAL VECTOR BORNE DISEASE CONTROL SUPPORT PROJECT IN NINE DISTRICT OF MADHYA PRADESH, INDIA

    Directory of Open Access Journals (Sweden)

    Paliwal

    2014-01-01

    Full Text Available Lo t s Q u a l i t y A ss ur a nce ( L Q A S S a mpling is a r a p id s ur ve y u s e d b y V e c t or B orne Di s e as e O ff ic e r t o d e t e rmine w h e t h e r C ommuni t y H e a l t h C e n t e r s ( C H C s a re r e a chi ng pr e - e s t a bli s h e d t a r ge t s f or k e y pro j e ct indic a t or s . T he a d v a n t a g e of L Q AS o ve r t he u s u a l clu s t e r s ur ve y m e t hods is we ll e s t a bl i s h e d. L Q AS is e s t a b l i s h e d in e a ch pro j e ct di s t rict by u t ilizing i t s o w n d e dic a t e d M a l a r i a T e chnic a l S up e r v i s ors ( M T S t o t r a ck u s e of R a pid D i a g no s t ic T e s t s ( R D T a nd A r t i s un a t e C om b in a t ion T h e r a pi e s ( A C T , co ve r a g e a nd u s e o f Long L a s t ing In s e c t icide N e t s ( L LIN a nd t o ass e s s In s e c t icid a l Re s idu a l S pr a y ( I RS co ve r a g e a t t he v ill a g e l eve l. L Q AS a n a l y s is i s done a t t he C HC l eve l a nd it m e as ur e s k e y pro j e ct indi c a t ors u s ing f ocu s e d min i - qu e s t ionn a ir e s . Modul e s f or u s e of L Q AS include b e n e f ici a ry in t e r v i ew s , A S HA i n t e r v i ew s a nd ob s e r v a t i on of t he f a c i li t i e s a cro s s dim e n s ions including f eve r m a n a ge m e nt a nd t r e a t m e n t s ee ki ng b e h a v ior modul e , a n I T N / LLIN c o ve r a g e a nd u s e modul e , a n A S HA Q u e s tionn a ire a nd in v ol ve m e nt of M P W in t he pro g r a mm e . Nine di s t ric t s a re includ e d in “ N a t ion a l V e c t or B orne Di s e as e C o n t rol S upport pro j e c t ” in M a dh y a P r a d e s h s ince ye a r 2009. T he f our rounds of L Q AS h a ve b ee n conclud e d s ince t hird q u a r t e r of ye a r 2010 t o 2011 . It i s f ound t h a t , L Q AS h as incr e as e d commun i t y a w a r e n e s s r eg a rding di a g no s t ic a nd t r e a t m e nt f a cil i t i e s of m a l a r i a a v a i l a ble w i t h A S HA. T h is p a p e r brin g s o u t t he a n a l y t ics v i s - à - v i s t he corr e c t i v e a c t i on s ini t i a t e d.

  11. Spatial Analysis of West Nile Virus: Predictive Risk Modeling of a Vector-borne Infectious Disease in Illinois by Means of NASA Earth Observation Systems

    Science.gov (United States)

    Renneboog, Nathan; Gathings, David; Hemmings, Sarah; Makasa, Emmanuel; Omer, Wigdan; Tipre, Meghan; Wright, Catherine; McAllister, Marilyn; Luvall, Jeffrey C.

    2009-01-01

    West Nile Virus is a mosquito-borne virus of the family Flaviviridae. It infects birds and various mammals, including humans, and can cause encephalitis that may prove fatal, notably among vulnerable populations. Since its identification in New York City in 1999, WNV has become established in a broad range of ecological settings throughout North America, infecting more than 25,300 people and killing 1133 as of 2008 (CDC,2009). WNV is transmitted by mosquitoes that feed on infected birds. As a result, the degree of human infection depends on local ecology and human exposure. This study hypothesizes that remote sensing and GIS can be used to analyze environmental determinants of WNV transmission, such as climate, elevation, land cover, and vegetation densities, to map areas of WNV risk for surveillance and intervention.

  12. Status of pesticide management in the practice of vector control: a global survey in countries at risk of malaria or other major vector-borne diseases

    NARCIS (Netherlands)

    Berg, van den H.; Hii, J.; Soares, A.; Mnzava, A.; Ameneshewa, B.; Dash, A.P.; Ejov, M.; Tan, S.H.; Matthews, G.; Yadav, R.S.; Zaim, M.

    2011-01-01

    Background: It is critical that vector control pesticides are used for their acceptable purpose without causing adverse effects on health and the environment. This paper provides a global overview of the current status of pesticides management in the practice of vector control. Methods: A questionna

  13. Status of Legislation and Regulatory Control of Public Health Pesticides in Countries Endemic with or at Risk of Major Vector-Borne Diseases

    OpenAIRE

    Matthews, G.; M.Zaim; Yadav, R. S.; Soares, A.; Hii, J.; Ameneshewa, B.; Mnzava, A.; A.P. Dash; Ejov, M.; S. H. Tan; Berg, van den, W.

    2011-01-01

    Background: Legislation and regulation of pesticides used in public health are essential for reducing risks to human health and the environment. Objective: We assessed the global situation on legislation and regulatory control of public health pesticides. Methods: A peer-reviewed and field-tested questionnaire was distributed to 142 member states of the World Health Organization (WHO); 113 states completed the questionnaire. Results: Legislation on public health pesticides was absent in 25% o...

  14. Intrarenal distributions and changes of Angiotensin-converting enzyme and Angiotensin-converting enzyme 2 in feline and canine chronic kidney disease.

    Science.gov (United States)

    Mitani, Sawane; Yabuki, Akira; Sawa, Mariko; Chang, Hye-Sook; Yamato, Osamu

    2014-01-01

    Angiotensin-converting enzyme (ACE) is a key enzyme in the renin-angiotensin system (RAS). ACE2 is a newly identified member of the RAS. The present immunohistochemical study focused on changes in intrarenal ACE and ACE2 immunoreactivity in feline and canine chronic kidney disease (CKD). ACE immunoreactivity was predominantly observed in the brush border of the proximal tubules in dogs and cats. ACE immunoreactivity was lower in CKD kidneys than in normal kidneys, and quantitative analysis demonstrated negative correlations between ACE and renal tissue damage in dogs. ACE2 immunoreactivity was also detected in the proximal tubules; it increased or decreased with CKD in dogs, depending on the renal region assessed. The changes in ACE and ACE2 in CKD were associated with the plasma creatinine concentration in dogs. Findings from dogs with glomerulonephritis were similar to those from dogs with non-glomerulonephritis. The present study suggests that changes in the intrarenal expression of ACE and ACE2 contribute to the pathological mechanisms of canine CKD, but not to the mechanisms of feline CKD. PMID:24004970

  15. Prognostic markers of canine pyometra

    OpenAIRE

    M.C. Sant'Anna; L.G.P. Giordano; K.K.M.C. Flaiban; E.E. Muller; M.I.M. Martins

    2014-01-01

    The pyometra is a disease that affects middle age and elderly female dogs during diestrus. Hormonal, microbiological, biochemical and hematological aspects are well described. However, few studies have evaluated the role of each in the prognosis of canine pyometra. The aim of this study was to identify markers associated with clinical worsening of dogs with pyometra. We prospectively evaluated 80 dogs with pyometra tre...

  16. Métodos de diagnóstico para detecção de prostatopatias caninas Canine prostatic disease: diagnosis methods

    Directory of Open Access Journals (Sweden)

    Ceres Mussel

    2010-12-01

    Full Text Available As doenças prostáticas são comuns em cães, desenvolvendo-se após a maturidade sexual. Entre as afecções que acometem a próstata desses animais, a mais frequente é a hiperplasia prostática benigna (HPB. As neoplasias prostáticas, apesar de menos frequentes, são altamente malignas e um diagnóstico tardio está associado a um prognóstico ruim. Os principais métodos de diagnóstico das enfermidades prostáticas em cães incluem um exame clínico detalhado, ultrassonografia, punção aspirativa e biópsia. A utilização de biomarcadores séricos vem sendo estudada como uma maneira de se detectar a doença precocemente, evitando possíveis complicações no quadro clínico dos pacientes. Assim, estudos visando ao diagnóstico precoce de prostatopatias caninas, especialmente o câncer prostático, são cruciais para um tratamento eficaz e melhora da qualidade de vida do animal acometido.Prostatic diseases are common in older dogs, developing after sexual maturity. The most common affecting canine prostate is benign prostatic hyperplasia (BPH. Although less frequent, prostatic neoplasias are highly malignant, and a late diagnosis is closely associated with a poor prognosis. The main methods of diagnosis of the canine prostatic disease include a detailed clinical exam, ultrasound, prostatic fine-needle aspirate and biopsy. Studies towards early diagnosis of this condition are crucial for effective treatment and improvement of quality of life of affected animals. The use of biomarkers has been studied for early detection of the disease, avoiding possible complications in clinical patients.

  17. 中西结合治疗216例犬细小病毒病疗效观察%Clinical Observation of 216 Cases of Canine Parvovirus Disease by Treatment of Combining TCM and WM

    Institute of Scientific and Technical Information of China (English)

    宋洋铭; 叶得河

    2012-01-01

    通过临床症状、流行病学特点和犬细小病毒抗原试剂盒对疑似细小病毒感染的216例病犬进行确诊,并对确诊为细小病毒感染的部分病例进行抗体水平检测,以判断其预后,采用中西结合的综合措施治疗发病犬,治愈率达到70%,提出了有效的预防措施.%Author confirmed 216 cases of suspected canine parvovirus disease through the clinical signs, epidemiological characteristics and antigen rapid canine parvovirus test kit, to determine its prognosis, author detected antibody level of some cases of confirmed canine parvovirus disease, in addition, author achieved cure rate of 70% by comprehensive measures of treatment of combining TCM and WM, at last author propose effective prevention measures for canine parvovirus disease.

  18. Clinical investigation on canine parvovirus diseases%犬细小病毒病的临床调查

    Institute of Scientific and Technical Information of China (English)

    谢子茂; 陈广宏

    2007-01-01

    犬细小病毒病是由犬细小病毒(Canine parvovirus,CPV)引起的一种急性接触性传染病,临床上以发生出血性肠炎的病例多见。广州市怡友动物医院自2005年1月至2006年12月两年间接诊CPV感染犬317例,笔者对此进行了临床调查和分析。

  19. Tickborne Rickettsial Diseases: Epidemiological studies in China

    NARCIS (Netherlands)

    W.C. Cao (Wu Chun)

    2010-01-01

    textabstractRickettsial diseases are vector-borne zoonoses caused by obligate intracellular bacteria within the order Rickettsiales, which was previously described as short, Gram-negative rod bacteria that retained basic fuchsin when stained by the method of Gimenez. As development in molecular tech

  20. Systemic inflammarory response in canine pyometra

    OpenAIRE

    Fransson, Boel

    2003-01-01

    Research efforts have focused mainly on the hormonal aspects of canine pyometra for more than 6 decades. However, this disease is often manifested as systemic illness in response to the bacterial uterine infection. Studies I-II were undertaken to clarify bacteriological aspects of canine pyometra; i.e. the origin of the infecting bacteria, the infecting bacteria’s impact on severity of the systemic illness and the presence of bacterial endotoxin in the systemic circulation. Study I, a bacteri...

  1. 78 FR 732 - Disease, Disability, and Injury Prevention and Control Special Emphasis Panel (SEP): Initial Review

    Science.gov (United States)

    2013-01-04

    ... HUMAN SERVICES Centers for Disease Control and Prevention Disease, Disability, and Injury Prevention and Control Special Emphasis Panel (SEP): Initial Review The meeting announced below concerns Identification, Surveillance, and Control of Vector-Borne and Zoonotic Infectious Diseases in Uganda, Funding...

  2. Emerging Arboviral Disease%新出现的虫媒病毒病

    Institute of Scientific and Technical Information of China (English)

    John S Mackenzie

    2002-01-01

    @@ Emerging Vector-Borne and Zoonotic Viruses Laboratory, School of Molecular and Microbial Sciences, The University of Queens land, Brisbane, Qld 4072, Australia Emerging diseases are usually defined as either new, previously unrecognized diseases that have appeared for the first time, or diseases known to exist but which are increasing in geographic range and/or incidence.

  3. [Assessment of disease severity and outcome of dietary, antibiotic, and immunosuppressive interventions by use of the canine IBD activity index in 21 dogs with chronic inflammatory bowel disease].

    Science.gov (United States)

    Münster, Michael; Hörauf, Angelika; Bilzer, Thomas

    2006-01-01

    Recently, the canine IBD activity index (CIBDAI) was developed for evaluation of the severity of illness, therapeutic strategies, and efficacy of therapy. The aim of the present study was to assess the severity of illness and the therapeutic strategy in dogs with IBD by the use of CIBDAI, serum albumin concentration, and histologic score (HPEG). Furthermore the use of CIBDAI and the efficacy of therapy in a prospective study during a 3 month treatment period were evaluated. Twentyone dogs with inflammatory bowel disease (lymphocytic-plasmacytic enteritis and enterocolitis) were examined in this study. In 11 dogs with IBD the severity of illness was assessed as low, according to CIBDAI and HPEG (CIBDAI score 4 or between 5 and 10 with HPEG score between 1 and 1.5). Six dogs were treated with hypoallergenic diet (Group D), five dogs were treated with hypoallergenic diet and metronidazole (15.6-22,3 mg/kg/day) (Group M). In 10 dogs with IBD the severity of illness was assessed as high (CIBDAI azathioprine (n=5; 0.9-2.3 mg/kg/day), sulfasalazine (n=4; 18.2-25 mg/kg/day) and hypoallergenic diet (n=10). Efficacy of therapy was evaluated prospectively 3 times in a 12 weeks treatment period. Remission (CIBDAI score or =4) indicated poor therapeutic response. Age, CIBDAI score and HPEG score were significantly different in IBD dogs with low severity of illness (age: median 60 months; CIBDAI score: median 5; HPEG score: median (1) and IBD dogs with high severity of illness (age: median 90 months; CIBDAI score: median 9.5; HPEG score: median 2.25) (p = 0.0101 and p = 0.0099, respectively). The presence of hypoalbuminemia was not significantly different between these two groups (p = 0.3108). There was no significant correlation between CIBDAI score and serum albumin concentration (r = 0.0394; p = 0.0802) or between CIBDAI score and HPEG score (r = 0.2587; p = 0.2574). In the treatment groups, HPEG score was only significantly different between D-group and group I (p 0.05). All

  4. Canine mammary tumours, an overview.

    Science.gov (United States)

    Sleeckx, N; de Rooster, H; Veldhuis Kroeze, E J B; Van Ginneken, C; Van Brantegem, L

    2011-12-01

    Canine mammary tumours (CMTs) are the most common neoplasms in intact female dogs. Although the prevalence of these tumours decreases in regions where preventive ovari(ohyster)ectomy is performed, it remains an important disease entity in veterinary medicine. Moreover, treatment options are limited in comparison with human breast cancer. Nevertheless, recent human treatment protocols might have potential in bitches suffering from CMTs. PMID:21645126

  5. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

    Directory of Open Access Journals (Sweden)

    Anna McRee

    2014-02-01

    Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  6. Genome-wide mRNA sequencing of a single canine cerebellar cortical degeneration case leads to the identification of a disease associated SPTBN2 mutation

    Directory of Open Access Journals (Sweden)

    Forman Oliver P

    2012-07-01

    Full Text Available Abstract Background Neonatal cerebellar cortical degeneration is a neurodegenerative disease described in several canine breeds including the Beagle. Affected Beagles are unable to ambulate normally from the onset of walking and the main pathological findings include Purkinje cell loss with swollen dendritic processes. Previous reports suggest an autosomal recessive mode of inheritance. The development of massively parallel sequencing techniques has presented the opportunity to investigate individual clinical cases using genome-wide sequencing approaches. We used genome-wide mRNA sequencing (mRNA-seq of cerebellum tissue from a single Beagle with neonatal cerebellar cortical degeneration as a method of candidate gene sequencing, with the aim of identifying the causal mutation. Results A four-week old Beagle dog presented with progressive signs of cerebellar ataxia and the owner elected euthanasia. Histopathology revealed findings consistent with cerebellar cortical degeneration. Genome-wide mRNA sequencing (mRNA-seq of RNA from cerebellum tissue was used as a method of candidate gene sequencing. After analysis of the canine orthologues of human spinocerebellar ataxia associated genes, we identified a homozygous 8 bp deletion in the β-III spectrin gene, SPTBN2, associated with spinocerebellar type 5 in humans. Genotype analysis of the sire, dam, ten clinically unaffected siblings, and an affected sibling from a previous litter, showed the mutation to fully segregate with the disorder. Previous studies have shown that β-III spectrin is critical for Purkinje cell development, and the absence of this protein can lead to cell damage through excitotoxicity, consistent with the observed Purkinje cell loss, degeneration of dendritic processes and associated neurological dysfunction in this Beagle. Conclusions An 8 bp deletion in the SPTBN2 gene encoding β-III spectrin is associated with neonatal cerebellar cortical degeneration in Beagle dogs

  7. Beneficial Effect of a Cellulose-Containing Chew Treat on Canine Periodontal Disease in a Double-Blind, Placebo-Controlled Trial

    Directory of Open Access Journals (Sweden)

    A. C. Beynen

    2010-01-01

    Full Text Available Problem statement: There are indications that appropriate chew treats can contribute to the control of canine periodontal disease. It was reasoned that the incorporation of a cellulose fiber network into the treat may improve the efficacy, but for proof experimental data were required. Approach: A double-blind, placebo-controlled trial with privately owned dogs was carried out to assess the efficacy of a cellulose preparation (Arbocel BWW40® in the treatment of periodontal disease. With the use of a questionnaire, the clinical signs were evaluated by the owners. There were 10 clinical signs: extent and severity of dental plaque and calculus, extent of gingivitis, redness, swelling, bleeding and firmness of gingivae and halitosis. For a period of 8 weeks, the test dogs daily received a chew treat to which 4% of the cellulose preparation was added. The control dogs were given a chew treat with identical formula, but without added cellulose. During the trial, all dogs were fed the same, complete dry food. There were 16 test dogs and 15 control dogs. Results: When compared with the baseline values, the administration of the test chew significantly improved 8 out of the 10 clinical signs. In the placebo group there was a significant improvement for 6 clinical signs. When the improvements over time for the two groups were compared, there were no statistically significant differences. When the score changes for all 10 clinical signs were added up as an overall index of improvement of periodontal disease, the test group showed a 17% greater amelioration than did the control group. Conclusion: The addition of the cellulose preparation had further enhanced the efficacy of the treat, possibly through an increase in mechanical cleansing and chewing time. This study indicates that a cellulose-containing treat is beneficial for dogs with periodontal disease and it is suggested that it may also impair its development.

  8. A retrospective investigation of canine adenovirus (CAV) infection in adult dogs in Turkey : article

    OpenAIRE

    Gur, S; A. Acar

    2009-01-01

    Canine adenovirus (CAV) type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11), and Akbash dogs (n = 17) and Turkish Greyhounds (n=15) in Es...

  9. First report of canine visceral leishmaniasis in Bulgaria

    OpenAIRE

    TSATCHEV, Illia; KYRIAZIS, Ioannis D.; BOUTSINI, Sofia; Karagouni, Evdokia; Dotsika, Eleni

    2010-01-01

    Seroepidemiological studies on canine leishmaniasis in Bulgaria, even in areas where human leishmaniasis has been detected, are controversial. This report describes 2 clinical cases of canine visceral leishmaniasis. The disease was confirmed by microscopical, serological, and molecular methods. It is, therefore, suggested that infected dogs could constitute the reservoir for human leishmaniasis in the country.

  10. Molecular entomology: analyzing tiny molecules to answer big questions about disease vectors and their biology

    Science.gov (United States)

    The entomologists at the Arthropod-Borne Animal Diseases Research Unit at USDA-Agricultural Research Service are tasked with protecting the nation’s livestock from domestic, foreign and emerging vector-borne diseases. To accomplish this task, a vast array of molecular techniques are being used in pr...

  11. Historical Compilation and Georeferencing of Dengue and Chikungunya outbreak data for Disease Modeling

    Science.gov (United States)

    The risk of vector-borne disease spread is increasing due to significant changes and variability in the global climate and increasing global travel and trade. Understanding the relationships between climate variability and disease outbreak patterns are critical to the design and construction of pred...

  12. The Effect of Global Warming on Infectious Diseases

    OpenAIRE

    Kurane, Ichiro

    2010-01-01

    Global warming has various effects on human health. The main indirect effects are on infectious diseases. Although the effects on infectious diseases will be detected worldwide, the degree and types of the effect are different, depending on the location of the respective countries and socioeconomical situations. Among infectious diseases, water- and foodborne infectious diseases and vector-borne infectious diseases are two main categories that are forecasted to be most affected. The effect on...

  13. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    OpenAIRE

    Otávio Valério Carvalho; Clarisse Vieira Botelho; Caroline Gracielle Torres Ferreira; Paulo Oldemar Scherer; Jamária Adriana Pinheiro Soares-Martins; Márcia Rogéria de Almeida; Abelardo Silva Júnior

    2012-01-01

    Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availabilit...

  14. Recent developments in Canine Cognitive Dysfunction Syndrome

    OpenAIRE

    Seisdedos Benzal, Alejandro; Galán Rodríguez, Alba

    2016-01-01

    Canine Cognitive Dysfunction Syndrome (CCD) is a neurodegenerative disease affecting aging dogs. CCD is an underdiagnosed disease that involves at least 14% of geriatric dogs, but apparently less than 2% of diseased dogs are diagnosed. There are several physiopathological similarities between Alzheimer disease (AD) and CCD, developing amyloid-β deposits in brain parenchyma and blood vessels, brain atrophy and neuronal loss. The clinical signs lead to behavioural changes. They are ...

  15. The Menkes and Wilson disease genes counteract in copper toxicosis in Labrador retrievers: a new canine model for copper-metabolism disorders

    Directory of Open Access Journals (Sweden)

    Hille Fieten

    2016-01-01

    Full Text Available The deleterious effects of a disrupted copper metabolism are illustrated by hereditary diseases caused by mutations in the genes coding for the copper transporters ATP7A and ATP7B. Menkes disease, involving ATP7A, is a fatal neurodegenerative disorder of copper deficiency. Mutations in ATP7B lead to Wilson disease, which is characterized by a predominantly hepatic copper accumulation. The low incidence and the phenotypic variability of human copper toxicosis hamper identification of causal genes or modifier genes involved in the disease pathogenesis. The Labrador retriever was recently characterized as a new canine model for copper toxicosis. Purebred dogs have reduced genetic variability, which facilitates identification of genes involved in complex heritable traits that might influence phenotype in both humans and dogs. We performed a genome-wide association study in 235 Labrador retrievers and identified two chromosome regions containing ATP7A and ATP7B that were associated with variation in hepatic copper levels. DNA sequence analysis identified missense mutations in each gene. The amino acid substitution ATP7B:p.Arg1453Gln was associated with copper accumulation, whereas the amino acid substitution ATP7A:p.Thr327Ile partly protected against copper accumulation. Confocal microscopy indicated that aberrant copper metabolism upon expression of the ATP7B variant occurred because of mis-localization of the protein in the endoplasmic reticulum. Dermal fibroblasts derived from ATP7A:p.Thr327Ile dogs showed copper accumulation and delayed excretion. We identified the Labrador retriever as the first natural, non-rodent model for ATP7B-associated copper toxicosis. Attenuation of copper accumulation by the ATP7A mutation sheds an interesting light on the interplay of copper transporters in body copper homeostasis and warrants a thorough investigation of ATP7A as a modifier gene in copper-metabolism disorders. The identification of two new functional

  16. Distribution of tick-borne diseases in China

    OpenAIRE

    Wu, Xian-Bo; Na, Ren-Hua; Wei, Shan-Shan; Zhu, Jin-Song; Peng, Hong-Juan

    2013-01-01

    Abstract As an important contributor to vector-borne diseases in China, in recent years, tick-borne diseases have attracted much attention because of their increasing incidence and consequent significant harm to livestock and human health. The most commonly observed human tick-borne diseases in China include Lyme borreliosis (known as Lyme disease in China), tick-borne encephalitis (known as Forest encephalitis in China), Crimean-Congo hemorrhagic fever (known as Xinjiang hemorrhagic fever in...

  17. Symbiotic control of mosquito borne disease

    OpenAIRE

    Ricci, Irene; Valzano, Matteo; Ulissi, Ulisse; Epis, Sara; Cappelli, Alessia; Favia, Guido

    2012-01-01

    It is well accepted that the symbiotic relationships insects have established with several microorganisms have had a key role in their evolutionary success. Bacterial symbiosis is also prevalent in insects that are efficient disease vectors, and numerous studies have sought to decrypt the basic mechanisms of the host–symbiont relationships and develop ways to control vector borne diseases. ‘Symbiotic control’, a new multifaceted approach that uses symbiotic microorganisms to control insect pe...

  18. Canine Distemper Outbreak in Rhesus Monkeys, China

    OpenAIRE

    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang; Hu, Rongliang

    2011-01-01

    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People’s Republic of China. Approximately 10,000 animals were infected (25%–60% disease incidence); 5%–30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain.

  19. Molecular Characterization of Three Canine Models of Human Rare Bone Diseases: Caffey, van den Ende-Gupta, and Raine Syndromes

    OpenAIRE

    Hytönen, Marjo K.; Meharji Arumilli; Lappalainen, Anu K; Marta Owczarek-Lipska; Vidhya Jagannathan; Sruthi Hundi; Elina Salmela; Patrick Venta; Eva Sarkiala; Tarja Jokinen; Daniela Gorgas; Juha Kere; Pekka Nieminen; Cord Drögemüller; Hannes Lohi

    2016-01-01

    One to two percent of all children are born with a developmental disorder requiring pediatric hospital admissions. For many such syndromes, the molecular pathogenesis remains poorly characterized. Parallel developmental disorders in other species could provide complementary models for human rare diseases by uncovering new candidate genes, improving the understanding of the molecular mechanisms and opening possibilities for therapeutic trials. We performed various experiments, e.g. combined ge...

  20. Molecular Characterization of Three Canine Models of Human Rare Bone Diseases: Caffey, van den Ende-Gupta, and Raine Syndromes.

    OpenAIRE

    Hytönen, Marjo K.; Arumilli, Meharji; Lappalainen, Anu K; Owczarek, Marta; Jagannathan, Vidhya; Hundi, Sruthi; Salmela, Elina; Venta, Patrick; Sarkiala, Eva; Jokinen, Tarja; Gorgas, Daniela; Kere, Juha; Nieminen, Pekka; Drögemüller, Cord; Lohi, Hannes

    2016-01-01

    One to two percent of all children are born with a developmental disorder requiring pediatric hospital admissions. For many such syndromes, the molecular pathogenesis remains poorly characterized. Parallel developmental disorders in other species could provide complementary models for human rare diseases by uncovering new candidate genes, improving the understanding of the molecular mechanisms and opening possibilities for therapeutic trials. We performed various experiments, e.g. combined ge...

  1. Thorough Investigation of a Canine Autoinflammatory Disease (AID) Confirms One Main Risk Locus and Suggests a Modifier Locus for Amyloidosis

    OpenAIRE

    Olsson, Mia; Tintle, Linda; Kierczak, Marcin; Perloski, Michele; Tonomura, Noriko; Lundquist, Andrew; Murén, Eva; Fels, Max; Tengvall, Katarina; Pielberg, Gerli; Dufaure De Citres, Caroline; Dorso, Laetitia; Abadie, Jérôme; Hanson, Jeanette; Thomas, Anne

    2013-01-01

    Autoinflammatory disease (AID) manifests from the dysregulation of the innate immune system and is characterised by systemic and persistent inflammation. Clinical heterogeneity leads to patients presenting with one or a spectrum of phenotypic signs, leading to difficult diagnoses in the absence of a clear genetic cause. We used separate genome-wide SNP analyses to investigate five signs of AID (recurrent fever, arthritis, breed specific secondary dermatitis, otitis and systemic reactive amylo...

  2. Oncolytic Virotherapy of Canine and Feline Cancer

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    2014-05-01

    Full Text Available Cancer is the leading cause of disease-related death in companion animals such as dogs and cats. Despite recent progress in the diagnosis and treatment of advanced canine and feline cancer, overall patient treatment outcome has not been substantially improved. Virotherapy using oncolytic viruses is one promising new strategy for cancer therapy. Oncolytic viruses (OVs preferentially infect and lyse cancer cells, without causing excessive damage to surrounding healthy tissue, and initiate tumor-specific immunity. The current review describes the use of different oncolytic viruses for cancer therapy and their application to canine and feline cancer.

  3. Tooth fractures in canine clinical practice

    International Nuclear Information System (INIS)

    Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients

  4. Early eruption of permanent canines

    Directory of Open Access Journals (Sweden)

    S Madhu

    2012-01-01

    Full Text Available Systemic and local factors can modify the eruption time of teeth. Generalized eruption time changes could be due to some systemic diseases like hyperthyroidism, hypophosphatasia, precocious puberty, Proteus syndrome, etc. Localized early eruption of permanent teeth could be due to early extraction of deciduous teeth. Presented here is an extremely rare case of early eruption of permanent canines in a 7-year old female child. Though the number of such cases is very limited, the clinician should poses adequate knowledge and keeps an open eye to identify such cases.

  5. The Canine Oral Microbiome

    OpenAIRE

    Dewhirst, Floyd E.; Klein, Erin A.; Thompson, Emily C.; Blanton, Jessica M.; Chen, Tsute; Milella, Lisa; Buckley, Catherine M. F.; Davis, Ian J.; Bennett, Marie-Lousie; Marshall-Jones, Zoe V.

    2012-01-01

    Determining the bacterial composition of the canine oral microbiome is of interest for two primary reasons. First, while the human oral microbiome has been well studied using molecular techniques, the oral microbiomes of other mammals have not been studied in equal depth using culture independent methods. This study allows a comparison of the number of bacterial taxa, based on 16S rRNA-gene sequence comparison, shared between humans and dogs, two divergent mammalian species. Second, canine or...

  6. Canine pluripotent stem cells: Are they ready for clinical applications?

    Directory of Open Access Journals (Sweden)

    Dean Harvey Betts

    2015-10-01

    Full Text Available The derivation of canine embryonic stem cells and generation of canine induced pluripotent stem cells are significant achievements that have unlocked the potential for developing novel cell-based disease models, drug discovery platforms and transplantation therapies in the dog. A progression from concept to cure in this clinically relevant companion animal will not only help our canine patients but also help advance human regenerative medicine. Nevertheless, many issues remain to be resolved before pluripotent cells can be used clinically in a safe and reproducible manner.

  7. Prognostic markers of canine pyometra

    Directory of Open Access Journals (Sweden)

    M.C. Sant'Anna

    2014-12-01

    Full Text Available The pyometra is a disease that affects middle age and elderly female dogs during diestrus. Hormonal, microbiological, biochemical and hematological aspects are well described. However, few studies have evaluated the role of each in the prognosis of canine pyometra. The aim of this study was to identify markers associated with clinical worsening of dogs with pyometra. We prospectively evaluated 80 dogs with pyometra treated surgically. Group 1 consisted of dogs that were discharged within 48 hours after surgery and Group 2 consisted of those who required prolonged hospitalization or died. The findings of hematological, biochemical and blood lactate levels were compared between groups and variables such as bacterial multidrug resistance, systemic inflammatory response syndrome (SIRS, hyperlactatemia and increased creatinine were analyzed through the dispersion of frequencies between groups. Among the variables studied, the presence of SIRS and elevated serum creatinine >2.5mg/mL were effective in predicting the worsening of the disease and can be used as prognostic markers of canine pyometra.

  8. Characterization of a Canine Homolog of Human Aichivirus

    OpenAIRE

    Kapoor, A.; Simmonds, P.; Dubovi, E. J.; Qaisar, N.; Henriquez, J.A.; Medina, J.; Shields, S.; Lipkin, W. I.

    2011-01-01

    Many of our fatal "civilization" infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5' and 3' untranslated regions...

  9. Characterization of a Canine Homolog of Human Aichivirus▿

    OpenAIRE

    Kapoor, Amit; Simmonds, Peter; Dubovi, Edward J.; Qaisar, Natasha; Henriquez, Jose A.; Medina, Jan; Shields, Shelly; Lipkin, W. Ian

    2011-01-01

    Many of our fatal “civilization” infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5′ and 3′ untranslated regions...

  10. Characterization of a Canine Homolog of Human Aichivirus▿

    OpenAIRE

    Kapoor, A; Simmonds, P.; Dubovi, E J; Qaisar, N.; Henriquez, J. A.; J. Medina; S Shields; Lipkin, W. I.

    2011-01-01

    Many of our fatal "civilization" infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5' and 3' untranslated regions...

  11. Delays reducing waterborne and water-related infectious diseases in China under climate change

    OpenAIRE

    Hodges, Maggie; Belle, Jessica H.; Carlton, Elizabeth J; Liang, Song; Li, Huazhong; Luo, Wei; Freeman, Matthew C.; Liu, Yang; Gao, Yang; Hess, Jeremy J.; Justin V. Remais

    2014-01-01

    Despite China’s rapid progress improving water, sanitation and hygiene (WSH) access, in 2011, 471 million people lacked access to improved sanitation and 401 million to household piped water. Because certain infectious diseases are sensitive to changes in both climate and WSH conditions, we projected impacts of climate change on WSH-attributable diseases in China in 2020 and 2030 by coupling estimates of the temperature sensitivity of diarrheal diseases and three vector-borne diseases, temper...

  12. Avian-origin H3N2 canine influenza A viruses in Southern China

    OpenAIRE

    Li, Shoujun; Shi, Zhihai; Jiao, Peirong; Zhang, Guihong; Zhong, Zhiwen; Tian, Wenru; Long, Li-Ping; Cai, Zhipeng; Zhu, Xingquan; Liao, Ming; Wan, Xiu-Feng

    2010-01-01

    This study reports four sporadic cases of H3N2 canine influenza in southern China, which were identified from sick dogs from May 2006 to October 2007. The evolutionary analysis showed that all eight segments of these four viruses are avian-origin and phylogenetically close to the H3N2 canine influenza viruses reported earlier in South Korea. Systematic surveillance is required to monitor the disease and evolutionary behavior of this virus in canine populations in China.

  13. Evidence-based control of canine rabies: a critical review of population density reduction

    OpenAIRE

    Morters, M.K.; Restif, O.; Hampson, K.; Cleaveland, S.; Wood, J.L.N.; Conlan, A J K; Boots, M.

    2013-01-01

    Control measures for canine rabies include vaccination and reducing population density through culling or sterilization. Despite the evidence that culling fails to control canine rabies, efforts to reduce canine population density continue in many parts of the world. The rationale for reducing population density is that rabies transmission is density-dependent, with disease incidence increasing directly with host density. This may be based, in part, on an incomplete interpretation of historic...

  14. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    Directory of Open Access Journals (Sweden)

    Otávio Valério Carvalho

    2012-01-01

    Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.

  15. Vaccines for Canine Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Faeze Foroughi-Parvar

    2014-01-01

    Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

  16. 9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Hepatitis and Canine Adenovirus...; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus. Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed...

  17. Canine epilepsy as a translational model?

    Science.gov (United States)

    Potschka, Heidrun; Fischer, Andrea; von Rüden, Eva-Lotta; Hülsmeyer, Velia; Baumgärtner, Wolfgang

    2013-04-01

    Dogs with spontaneous diseases can exhibit a striking similarity in etiology, clinical manifestation, and disease course when compared to human patients. Therefore, dogs are intensely discussed as a translational model of human disease. In particular, genetic studies in selected dog breeds serve as an excellent tool to identify epilepsy disease genes. In addition, canine epilepsy is discussed as a translational platform for drug testing. On one hand, epileptic dogs might serve as an interesting model by allowing the evaluation of drug efficacy and potency under clinical conditions with a focus on chronic seizures resistant to standard medication, preventive strategies, or status epilepticus. On the other hand, several limitations need to be considered including owner-based seizure monitoring, species differences in pharmacokinetics and drug interactions, as well as cost-intensiveness. The review gives an overview on the current state of knowledge regarding the etiology, clinical manifestation, pathology, and drug response of canine epilepsy, also pointing out the urgent need for further research on specific aspects. Moreover, the putative advantages, the disadvantages, and limitations of antiepileptic drug testing in canine epilepsy are critically discussed. PMID:23506100

  18. Severe canine distemper outbreak in unvaccinated dogs in Mozambique

    Directory of Open Access Journals (Sweden)

    Julieta Zacarias

    2016-02-01

    Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

  19. Transgenesis and paratransgenesis to control insect-borne diseases: Current status and future challenges

    OpenAIRE

    Coutinho-Abreu, Iliano V.; Zhu, Kun Yan; Ramalho-Ortigao, Marcelo

    2009-01-01

    Insect-borne diseases cause significant human morbidity and mortality. Current control and preventive methods against vector-borne diseases rely mainly on insecticides. The emergence of insecticide resistance in many disease vectors highlights the necessity to develop new strategies to control these insects. Vector transgenesis and paratransgenesis are novel strategies that aim at reducing insect vectorial capacity, or seek to eliminate transmission of pathogens such as Plasmodium sp., Trypan...

  20. Microbiological and histopathological aspects of canine pyometra

    OpenAIRE

    Coggan, Jennifer Anne; Melville, Priscilla Anne; de Oliveira, Clair Motos; Faustino, Marcelo; Moreno, Andréa Micke; Benites, Nilson Roberti

    2008-01-01

    As pyometra is recognized as one of the main causes of disease and death in the bitch the purposes of this study were to evaluate microbiological and histopathological aspects of canine pyometra and to research the virulence factors of the E. coli isolates identifying possible risks to human health. The microbiological isolation from the intrauterine contents of 100 dogs with pyometra was carried out and the virulence factors in the E. coli strains were identified using PCR method. This study...

  1. Sequencing and G-quadruplex folding of the canine proto-oncogene KIT promoter region: might dog be used as a model for human disease?

    Directory of Open Access Journals (Sweden)

    Silvia Da Ros

    Full Text Available Downregulation of gene expression by induction of non-canonical DNA structures at promotorial level is a novel attractive anticancer strategy. In human, two guanine-rich sequences (h_kit1 and h_kit2 were identified in the promotorial region of oncogene KIT. Their stabilization into G-quadruplex structures can find applications in the treatment of leukemias, mastocytosis, gastrointestinal stromal tumor, and lung carcinomas which are often associated to c-kit mis-regulation. Also the most common skin cancer in domestic dog, mast cell tumor, is linked to a mutation and/or to an over-expression of c-kit, thus supporting dog as an excellent animal model. In order to assess if the G-quadruplex mediated mechanism of regulation of c-kit expression is conserved among the two species, herein we cloned and sequenced the canine KIT promoter region and we compared it with the human one in terms of sequence and conformational equilibria in physiologically relevant conditions. Our results evidenced a general conserved promotorial sequence between the two species. As experimentally confirmed, this grants that the conformational features of the canine kit1 sequence are substantially shared with the human one. Conversely, two isoforms of the kit2 sequences were identified in the analyzed dog population. In comparison with the human counterpart, both of them showed an altered distribution among several folded conformations.

  2. Pneumocystosis associated with canine distemper virus infection in a mink.

    OpenAIRE

    Dyer, N W; Schamber, G J

    1999-01-01

    An adult mink from a farm experiencing 100% mortality in affected animals was submitted for diagnostic examination. Clinical history included signs of respiratory disease, oculonasal discharge, and thickening of footpads. Canine distemper virus and Pneumocystis carinii were identified in lung tissue, suggesting immunosuppresion and secondary infection due to morbillivirus disease.

  3. Yellow fever in China is still an imported disease.

    Science.gov (United States)

    Chen, Jun; Lu, Hongzhou

    2016-05-23

    Yellow fever is a vector-borne disease endemic to tropical regions of Africa and South America. A recent outbreak in Angola caused hundreds of deaths. Six cases of yellow fever imported from Angola were reported recently in China. This raised the question of whether it will spread in China and how it can be prevented. This article discusses the possibility of yellow fever transmission in China and the strategies to counter it. PMID:27052094

  4. Wetland cover dynamics drive hemorrhagic disease patterns in white-tailed deer in the United States.

    Science.gov (United States)

    Berry, Brett S; Magori, Krisztian; Perofsky, Amanda C; Stallknecht, David E; Park, Andrew W

    2013-07-01

    While vector-borne diseases are known to be particularly influenced by environmental factors, the impact of land-cover change on vector-borne wildlife disease patterns is poorly understood, largely due to the paucity of data on disease occurrence at extensive spatial and temporal scales. Widespread and rapid anthropogenic land-cover change, especially urbanization, has transformed the US landscape during the last century. Epizootic hemorrhagic disease virus and blue tongue virus, vectored by Culicoides biting midges, are two RNA viruses in the Orbivirus genus that cause severe hemorrhagic disease (HD) in white-tailed deer (Odocoileus virginianus). We examine the spatial dynamics of HD affecting white-tailed deer in the contiguous United States in two periods covering 1980 to 2007 in connection with land-cover change over the same time. Using spatial statistical modeling, wetland cover emerges as a critical driver of HD morbidity, whereas the drivers of mortality patterns are more complex. Increasing wetland cover is positively associated with HD morbidity, which is consistent with the ecologic requirements of the Culicoides vector. Wetland cover is inherently dynamic due to its importance to biodiversity and water quality as well as its utility for other purposes when drained. Accordingly this analysis helps in understanding the consequences of changing wetlands on vector-borne disease patterns, to identify disease hotspots in a large landscape, and to forecast the spatial spread of HD and related diseases. PMID:23778598

  5. Increasing Incidence of Canine Leptospirosis in Switzerland

    Directory of Open Access Journals (Sweden)

    Andrea Major

    2014-07-01

    Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.

  6. How effective is integrated vector management against malaria and lymphatic filariasis where the diseases are transmitted by the same vector?

    OpenAIRE

    Christopher M Stone; Lindsay, Steve W; Nakul Chitnis

    2014-01-01

    Background: The opportunity to integrate vector management across multiple vector-borne diseases is particularly plausible for malaria and lymphatic filariasis (LF) control where both diseases are transmitted by the same vector. To date most examples of integrated control targeting these diseases have been unanticipated consequences of malaria vector control, rather than planned strategies that aim to maximize the efficacy and take the complex ecological and biological interactions between th...

  7. Production of antibodies to canine IL-1beta and canine TNF to assess the role of proinflammatory cytokines.

    Science.gov (United States)

    Baggio, Vannozza; Ott, Fabienne; Fischer, René W; Gram, Hermann; Peele, John; Spreng, David; Schmökel, Hugo; Jungi, Thomas W

    2005-08-15

    IL-1 and TNF are important proinflammatory cytokines implicated in both antimicrobial host defense and pathogenesis of diseases with an immune-mediated and/or inflammatory component. Respective studies in the dog have been hampered by the unavailability of reagents allowing the specific measurement of canine cytokine proteins and the effect of canine cytokine neutralization by Ab. Starting with recombinant canine (rcan) IL-1beta and rcanTNF, four polyclonal antisera and 22 mAb specific for rcanIL-1beta and rcanTNF were generated. Their usefulness in neutralization assays was determined. Using cytokine-containing supernatants of canine cells in bioassays, polyclonal antisera neutralized either canine IL-1beta or TNF. TNF was also neutralized by three antibodies developed in this study and one commercial mAb. The usefulness of monoclonal and polyclonal Ab in canine cytokine-specific Ab capture ELISA's was assessed. This resulted in the identification of a commercial mAb combination and one pair developed in this study allowing low levels of TNF to be detected by antibody capture ELISA. The detection limit was 141 pg/ml rcanTNF for both combinations. Using rcanIL-1beta as an antigen allowed the detection of lower concentrations of rcanIL-1beta (20 pg/ml, on the average) by a pair of polyclonal antisera than when monoclonals were used. By using such IL-1beta-specific and TNF-specific ELISA's, the respective cytokines were detected in supernatants of canine PBMC stimulated with LPS or heat-killed Listeria monocytogenes and interferon-gamma combined. Thus, monoclonal and polyclonal reagents were identified allowing the quantitation of canine IL-1beta and TNF production in vitro, and the neutralization of these cytokines. PMID:15982477

  8. Ultrasonographic characteristics of canine renal lymphoma.

    Science.gov (United States)

    Taylor, Angela J; Lara-Garcia, Ana; Benigni, Livia

    2014-01-01

    There is little published information on the ultrasonographic appearance of canine renal lymphoma. The purpose of this retrospective study was to provide additional information regarding the ultrasonographic characteristics of canine renal lymphoma, suggest ultrasonographic description criteria, and evaluate the role of fine-needle aspirate cytology in the diagnosis of this disease. The ultrasonographic features of confirmed renal lymphoma were reviewed in ten dogs. Pyelectasia was found in all dogs. Other ultrasonographic findings were loss of corticomedullary distinction (9/10 dogs), renomegaly (8/10 dogs), renal deformity (6/10 dogs), hypoechoic lesion(s) (6/10 dogs), and hyperechoic lesion(s) (2/10 dogs). Hypoechoic lesions were described as masses, nodules, and indistinct areas. In 30% of the cases (3/10 dogs) ultrasound revealed only minor abnormalities, including grade 1 pyelectasia, mild renomegaly, and focal loss of corticomedullary definition. Bilateral lesions were seen in nine dogs (90%). Renal fine-needle aspirates were performed in 9/10 dogs, yielding a diagnosis in seven on first attempt (78%). Two dogs had been given a provisional cytological diagnosis of round cell neoplasia; in one dog lymphoma was confirmed by second aspirate and by tissue core biopsy in the other. In 1/10 dogs, lymphoma was found at necropsy. Findings indicated that ultrasonographic signs of canine renal lymphoma may be subtle, canine renal lymphoma should be included in the differential diagnosis when the above ultrasonographic features are observed, and fine-needle aspirate cytology is a useful method for diagnosing this disease. PMID:24629062

  9. The canine vomeronasal organ.

    OpenAIRE

    Adams, D. R.; Wiekamp, M D

    1984-01-01

    The vomeronasal organ was studied in mature dogs with the optical, transmission electron, and scanning electron microscopes. The canine vomeronasal complex is structurally well developed. Large blood vessels are present deep to both the lateral, 'non-receptor' and medial, 'receptor' epithelia. In addition to the unmyelinated vomeronasal nerves in the lamina propria deep to the 'receptor' epithelium, numerous nerves containing both myelinated and unmyelinated fibres are present deep to the 'no...

  10. Climate change & infectious diseases in India: Implications for health care providers

    OpenAIRE

    Dhara, V. Ramana; Schramm, Paul J.; Luber, George

    2013-01-01

    Climate change has the potential to influence the earth's biological systems, however, its effects on human health are not well defined. Developing nations with limited resources are expected to face a host of health effects due to climate change, including vector-borne and water-borne diseases such as malaria, cholera, and dengue. This article reviews common and prevalent infectious diseases in India, their links to climate change, and how health care providers might discuss preventive healt...

  11. Improvement of Disease Prediction and Modeling through the Use of Meteorological Ensembles: Human Plague in Uganda

    OpenAIRE

    Moore, Sean M.; Monaghan, Andrew; Griffith, Kevin S.; Apangu, Titus; Mead, Paul S.; EISEN, REBECCA J.

    2012-01-01

    Climate and weather influence the occurrence, distribution, and incidence of infectious diseases, particularly those caused by vector-borne or zoonotic pathogens. Thus, models based on meteorological data have helped predict when and where human cases are most likely to occur. Such knowledge aids in targeting limited prevention and control resources and may ultimately reduce the burden of diseases. Paradoxically, localities where such models could yield the greatest benefits, such as tropical...

  12. Climate, deer, rodents, and acorns as determinants of variation in lyme-disease risk.

    OpenAIRE

    Ostfeld, Richard S.; Canham, Charles D.; Kelly Oggenfuss; Winchcombe, Raymond J; Felicia Keesing

    2006-01-01

    Risk of human exposure to vector-borne zoonotic pathogens is a function of the abundance and infection prevalence of vectors. We assessed the determinants of Lyme-disease risk (density and Borrelia burgdorferi-infection prevalence of nymphal Ixodes scapularis ticks) over 13 y on several field plots within eastern deciduous forests in the epicenter of US Lyme disease (Dutchess County, New York). We used a model comparison approach to simultaneously test the importance of ambient growing-season...

  13. Pathogenic Landscape of Transboundary Zoonotic Diseases in the Mexico–US Border Along the Rio Grande

    OpenAIRE

    Esteve-Gassent, Maria Dolores; Pérez de León, Adalberto A.; Romero-Salas, Dora; Feria-Arroyo, Teresa P; Patino, Ramiro; Castro-Arellano, Ivan; Gordillo-Pérez, Guadalupe; Auclair, Allan; Goolsby, John; Rodriguez-Vivas, Roger Ivan; Estrada-Franco, Jose Guillermo

    2014-01-01

    Transboundary zoonotic diseases, several of which are vector borne, can maintain a dynamic focus and have pathogens circulating in geographic regions encircling multiple geopolitical boundaries. Global change is intensifying transboundary problems, including the spatial variation of the risk and incidence of zoonotic diseases. The complexity of these challenges can be greater in areas where rivers delineate international boundaries and encompass transitions between ecozones. The Rio Grande se...

  14. Definition, Classification, and Pathophysiology of Canine Glaucoma.

    Science.gov (United States)

    Pizzirani, Stefano

    2015-11-01

    Glaucoma is a common ocular condition in humans and dogs leading to optic nerve degeneration and irreversible blindness. Primary glaucoma is a group of spontaneous heterogeneous diseases. Multiple factors are involved in its pathogenesis and these factors vary across human ethnic groups and canine breeds, so the clinical phenotypes are numerous and their classification can be challenging and remain superficial. Aging and oxidative stress are major triggers for the manifestation of disease. Multiple, intertwined inflammatory and biochemical cascades eventually alter cellular and extracellular physiology in the optic nerve and trabecular meshwork and lead to vision loss. PMID:26456751

  15. Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features

    Directory of Open Access Journals (Sweden)

    Sophie Le Poder

    2011-01-01

    Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

  16. Increasing incidence of canine leptospirosis in Switzerland.

    Science.gov (United States)

    Major, Andrea; Schweighauser, Ariane; Francey, Thierry

    2014-07-01

    A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes 90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25) or rainy days (r2 0.38). Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%), pulmonary (76.7%), hepatic (26.0%), and hemorrhagic syndromes (18.2%), leading to a high mortality rate (43.3%). Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3). Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species. PMID:25032740

  17. Increasing Incidence of Canine Leptospirosis in Switzerland

    Science.gov (United States)

    Major, Andrea; Schweighauser, Ariane; Francey, Thierry

    2014-01-01

    A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes 90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25) or rainy days (r2 0.38). Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%), pulmonary (76.7%), hepatic (26.0%), and hemorrhagic syndromes (18.2%), leading to a high mortality rate (43.3%). Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3). Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species. PMID:25032740

  18. Spatial analysis of visceral leishmaniasis in the municipality of Rondonópolis, in the Brazilian State of Mato Grosso, from 2003 to 2012: human, canine and vector distribution in areas of disease transmission

    Directory of Open Access Journals (Sweden)

    Alexander Gonçalves Ferreira Guimarães

    2015-06-01

    Full Text Available INTRODUCTION: Visceral leishmaniasis (VL is a zoonosis of great importance to public health and is considered a neglected disease by the World Health Organization. The disease has expanded and become more prevalent in urban areas in Brazil. METHODS: Geospatial analyses were performed and thematic maps of the triad of the disease were produced for the study period (2003-2012 in the urban area of the municipality of Rondonópolis in the midwestern State of Mato Grosso (MT, Brazil, TerraView 4.2.2 software was used for the analyses. RESULTS: A total of 87.9% of the 186 confirmed human cases of VL were cured. Children between the ages of 1 and 4 were the most affected. Registered deaths were predominant among adults aged 60 years or older. The urban area of the municipality consists of eight strata and 12 census districts include 237 neighborhoods. All sectors had confirmed cases of VL. During the study period, human cases of the disease were recorded in 90 neighborhoods. The 23 deaths from the disease were distributed in 21 neighborhoods. Sandflies carrying the parasite were captured in 192 out of 200 neighborhoods evaluated for the presence of the VL vector. The presence of dogs carrying the parasite was confirmed in, 140 out of 154 surveyed neighborhoods. CONCLUSIONS: The data demonstrated the endemic nature of VL, with a high percentage of infected children, a high distribution of canine infection, and a wide adaptation and dispersal of the vectors in the urban environment. These results, illustrate the process of urbanization of VL in the municipality of Rondonópolis, MT, Brazil.

  19. Associations between neurologic dysfunction and lesions in canine fucosidosis.

    Science.gov (United States)

    Fletcher, J L; Taylor, R M

    2016-04-01

    Canine fucosidosis in English Springer spaniels is the only animal model of the neurovisceral lysosomal storage disease fucosidosis available for preclinical therapeutic trials. For this reason, it is crucial to identify critical time points in disease progression, and if there are particular lesions associated with specific aspects of neurologic dysfunction. Historical records of 53 canine fucosidosis cases from 1979 to 2009 containing a neurologic dysfunction score assessing motor, behavioral and sensory dysfunction were interrogated by statistical analysis. Motor and behavioral dysfunction scores assessing gait deficits and apprehensive behavior first significantly increased at 12-17 months, and increased at each 6-month interval thereafter. Sensory dysfunction scores, assessing hearing loss, balance and vision deterioration, did not significantly increase until 18-23 months, and coincided with a rapid decline in neurologic function. Regression analysis incorporating published neuropathology data, measured by image analysis, identified neuroinflammation and apoptotic cell death as significant informative predictors of increasing neurologic dysfunction. These findings indicate that the level of neuropathology required to induce consistent and conspicuous clinical signs in canine fucosidosis is reached by approximately 12 months of age in the absence of other disease processes. Significant association between neuroinflammation and apoptotic cell death also suggests that specifically targeting these lesions combined with enzyme replacement in future studies may reduce disease burden in fucosidosis. Overall, examining this historical clinical data to identify associations between the extent of neuropathology and degree of clinical dysfunction provides a useful reference tool for monitoring disease and evaluating therapeutic trials conducted in canine fucosidosis. PMID:26711085

  20. A canine model of multiple portosystemic shunting.

    Science.gov (United States)

    Howe, L M; Boothe, H W; Miller, M W; Boothe, D M

    2000-01-01

    The objective of this study was to develop and describe an experimental canine model of multiple acquired portosystemic shunts (PSS) similar in nature to spontaneously occurring PSS. Sixteen dogs were used and were divided into a control (n = 6) and a diseased group (n = 10). Dogs of the diseased group were administered dimethylnitrosamine (2 mg/kg of body weight, po) twice weekly, and clinicopathologic, ultrasonographic, and hepatic scintigraphic findings were recorded during the development of hepatic disease and PSS. Surgery was then performed to permit visual verification of multiple shunts, catheter placement for portography examination, and biopsy of the liver. All diseased dogs developed severe hepatic disease and multiple PSS as documented visually at surgery and on portography. Based on this study, dimethylnitrosamine-induced portosystemic shunting appears to be an appropriate model for spontaneously occurring multiple PSS secondary to portal hypertension. PMID:10741951

  1. Diagnostic imaging of the male canine reproductive organs: methods and limitations

    International Nuclear Information System (INIS)

    Survey radiographic, contrast radiographic, and ultrasonographic techniques for evaluation of the male canine reproductive organs are reviewed. The applications and limitations of these technique as they apply to reproductive diseases involving the prostate gland and testicles are illustrated

  2. Species composition, seasonal occurrence, habitat preference and altitudinal distribution of malaria and other disease vectors in eastern Nepal

    OpenAIRE

    Dhimal, Meghnath; Ahrens, Bodo; Kuch, Ulrich

    2014-01-01

    Background It is increasingly recognized that climate change can alter the geographical distribution of vector-borne diseases (VBDs) with shifts of disease vectors to higher altitudes and latitudes. In particular, an increasing risk of malaria and dengue fever epidemics in tropical highlands and temperate regions has been predicted in different climate change scenarios. The aim of this paper is to expand the current knowledge on the seasonal occurrence and altitudinal distribution of malaria ...

  3. Opportunities for Improved Chagas Disease Vector Control Based on Knowledge, Attitudes and Practices of Communities in the Yucatan Peninsula, Mexico

    OpenAIRE

    Kathryn Rosecrans; Gabriela Cruz-Martin; Ashley King; Eric Dumonteil

    2014-01-01

    BACKGROUND: Chagas disease is a vector-borne parasitic disease of major public health importance. Current prevention efforts are based on triatomine vector control to reduce transmission to humans. Success of vector control interventions depends on their acceptability and value to affected communities. We aimed to identify opportunities for and barriers to improved vector control strategies in the Yucatan peninsula, Mexico. METHODOLOGY/PRINCIPAL FINDINGS: We employed a sequence of qualitative...

  4. Canine mast cell tumors.

    Science.gov (United States)

    Macy, D W

    1985-07-01

    Despite the fact that the mast cell tumor is a common neoplasm of the dog, we still have only a meager understanding of its etiology and biologic behavior. Many of the published recommendations for treatment are based on opinion rather than facts derived from careful studies and should be viewed with some skepticism. Because of the infrequent occurrence of this tumor in man, only a limited amount of help can be expected from human oncologists; therefore, burden of responsibility for progress in predicting behavior and developing treatment effective for canine mast cell tumors must fall on the shoulders of the veterinary profession. PMID:3929444

  5. Brazilian canine hepatozoonosis.

    Science.gov (United States)

    O'Dwyer, Lucia Helena

    2011-01-01

    The genus Hepatozoon includes hundreds of species that infect birds, reptiles, amphibians and mammals, in all continents with tropical and subtropical climates. Two species have been described in domestic dogs: H. canis, reported in Europe, Asia, Africa, South America and the United States; and H. americanum, which so far has only been diagnosed in the United States. In Brazil, the only species found infecting dogs is H. canis. The objective of this review was to detail some aspects of canine hepatozoonosis, caused by H. canis, and the main points of its biology, transmission, pathogenicity, symptoms, epidemiology and diagnostic methods, with emphasis on research developed in Brazil. PMID:21961746

  6. Antiviral effect of lithium chloride on infection of cells by canine parvovirus.

    Science.gov (United States)

    Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun

    2015-11-01

    Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies. PMID:26315688

  7. Canine hypothyroidism. A diagnostic challenge?

    International Nuclear Information System (INIS)

    Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen registered) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high interobserver

  8. Canine distemper virus - a morbillivirus in search of new hosts?

    OpenAIRE

    Harder, Timm; Osterhaus, Albert

    1997-01-01

    textabstractCanine distemper morbillivirus (CDV) induces a multisystemic, often fatal disease in a wide and seemingly expanding host range among the Carnivora. Several genotypes of an otherwise monotypic virus species co-circulate in a geographically restricted pattern. Interspecies transmissions frequently occur, often leading to devastating epizootics in highly susceptible or immunologically naive populations.

  9. Canine brachycephalic airway syndrome: pathophysiology, diagnosis, and nonsurgical management.

    Science.gov (United States)

    Trappler, Michelle; Moore, Kenneth

    2011-05-01

    Canine brachycephalic airway syndrome is a progressive disease that affects many brachycephalic dogs. This article describes the components of this syndrome and focuses on acute emergency management and long-term conservative management of these patients. Surgical management is described in a companion article. PMID:21870353

  10. Prognosis in canine idiopathic immune-mediated haemolytic anaemia

    NARCIS (Netherlands)

    Piek, C.J.

    2011-01-01

    Canine idiopathic immune-mediated haemolytic anaemia (iIMHA) is one of the most frequently occurring immune-mediated diseases in dogs. A gel-based Coombs' test was shown to perform equally well as a classical Coombs' test. Since the gel-based Coombs' test can be commercially produced and is easy and

  11. Canine distemper virus - a morbillivirus in search of new hosts?

    NARCIS (Netherlands)

    T.C. Harder (Timm); A.D.M.E. Osterhaus (Albert)

    1997-01-01

    textabstractCanine distemper morbillivirus (CDV) induces a multisystemic, often fatal disease in a wide and seemingly expanding host range among the Carnivora. Several genotypes of an otherwise monotypic virus species co-circulate in a geographically restricted pattern. Interspecies transmissions fr

  12. Canine hypertrophic osteopathy associated with extra-thoracic lesions

    OpenAIRE

    Headley Selwyn Arlington; Ribeiro Eduardo Alcântara; Santos Gustavo José Von G. dos; Bettini Carlos Maia; Mattos Júnior Ewaldo

    2005-01-01

    Canine hypertrophic osteopathy is described in a dog that presented extra-thoracic lesions, mainly in the liver. Hepatic lesions were characterized by necrosis, hemorrhage, severe hydropic degeneration of centrolobular hepatocytes, proliferation of epithelial cells of bile ducts, and mild biliary stasis. The disease syndrome was diagnosed based on clinical signs, radiological evaluation, and inspection of macerated bones.

  13. Canine distemper spillover in domestic dogs from urban wildlife.

    Science.gov (United States)

    Kapil, Sanjay; Yeary, Teresa J

    2011-11-01

    Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing. PMID:22041204

  14. Survey of Canine Dirofilaria immitis Infection in New Caledonia

    OpenAIRE

    Watier-Grillot, S.; J.-L. Marié; Cabre, O.; Davoust, B

    2011-01-01

    Canine dirofilariosis is a frequent parasitic disease in New-Caledonia. A survey of canine heartworm (Dirofilaria immitis) infection among dogs from the cities of Tontouta, Nandaï and Nouméa, was performed in March 2009 using two antigen test kits; the microwell ELISA test: DiroCHE (Synbiotics Europe) and the Rapid Immuno Migration ( R I M ) test: WITNESS DIROFILARIA (Synbiotics Europe). Blood samples were collected from 64 dogs: 49 strays and 15 military working dogs. The military dogs recei...

  15. Canine dysautonomia in a litter of Havanese puppies.

    Science.gov (United States)

    Hull, Noah C; O'Toole, Donal; Miller, Myrna M; Shoults, Hannah; Deck, Robin; Jones, Warren; Johnson, Gayle C; Shaw, Daniel P; Schumaker, Brant A

    2015-09-01

    Canine dysautonomia is a sporadic, generally fatal disease that rarely affects groups of related animals. Four 10-week-old Havanese puppies from a litter of 5 developed clinical signs of canine dysautonomia. The 4 affected dogs were exposed to an outdoor environment, whereas the fifth littermate was not exposed to the outdoors and remained clinically healthy. Clinical signs of dysautonomia developed 10-16 days after going outside the house. An unrelated dog also developed dysautonomia after exposure to 1 of the affected Havanese littermates. All 5 dogs had morphological changes consistent with dysautonomia (widespread neuronal degeneration in autonomic ganglia, select brainstem nuclei, and ventral horn motor neurons). Differential diagnoses were excluded through negative toxicological evaluation, fecal parasite screening, negative Canine distemper virus reverse transcription polymerase chain reaction, fluorescent antibody testing, attempted virus isolation, and electron microscopy. The 5 affected dogs were in the Kansas City, Missouri area, where there is a high incidence of dysautonomia. PMID:26179098

  16. Severe canine distemper outbreak in unvaccinated dogs in Mozambique.

    Science.gov (United States)

    Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G

    2016-01-01

    Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. PMID:27543040

  17. Increasing Incidence of Canine Leptospirosis in Switzerland

    OpenAIRE

    Andrea Major; Ariane Schweighauser; Thierry Francey

    2014-01-01

    A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73) and rainfall (r2 0.39), >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of ...

  18. Clinical and Epidemiological Characterization of Laboratory-Confirmed Autochthonous Cases of Zika Virus Disease in Mexico

    OpenAIRE

    Jimenez Corona, Maria Eugenia; De la Garza Barroso, Ana Lucía; Rodriguez Martínez, Jose Cruz; Luna Guzmán, Norma Irene; Ruiz Matus, Cuitláhuac; Díaz Quiñonez, José Alberto; Lopez Martinez, Irma; Kuri Morales, Pablo A.

    2016-01-01

    Introduction: Since 2014, autochthonous circulation of Zika virus (ZIKV) in the Americas was detected (Easter Island, Chile). In May 2015, Brazil confirmed autochthonous ­­transmission and in October of that year Colombia reported their first  cases. Now more than 52 countries have reported cases, including Mexico. To deal with this contingency in Mexico, several surveillance systems, in addition to systems for vector-borne diseases were strengthened with the participation of all health insti...

  19. Can non-human primates serve as models for investigating dengue disease pathogenesis?

    OpenAIRE

    KristinaClark; NattawatOnlamoon; GueyPerng

    2013-01-01

    Dengue Virus (DV) infects between 50 and 100 million people globally, with public health costs totaling in the billions. It is the causative agent of dengue fever (DF) and dengue hemorrhagic fever/dengue shock syndrome (DHF/DSS), vector-borne diseases that initially predominated in the tropics. Due to the expansion of its mosquito vector, Aedes spp., DV is increasingly becoming a global problem. Infected individuals may present with a wide spectrum of symptoms, spanning from a mild febrile to...

  20. Social Representations and Practices Towards Triatomines and Chagas Disease in Calakmul, México

    OpenAIRE

    Alba Valdez-Tah; Laura Huicochea-Gómez; Judith Ortega-Canto; Austreberta Nazar-Beutelspacher; Ramsey, Janine M.

    2015-01-01

    Vector-borne transmission of Trypanosoma cruzi (VBTTc) is dependent on the concomitant interaction between biological and environmental hazard over the entire landscape, and human vulnerability. Representations and practices of health-disease-care-seeking and territorial appropriation and use were analyzed for VBTTc in a qualitative ethnographic study in the Zoh-Laguna landscape, Campeche, Mexico. In-depth interviews and participatory observation explored representations and practices regardi...

  1. Agriculture, malaria, and water-associated diseases: understanding the links between agriculture and health

    OpenAIRE

    Mutero, Clifford M; McCartney, Matthew; Boelee, Eline

    2006-01-01

    "Malaria, schistosomiasis (bilharzia), and Japanese encephalitis are the major vector-borne diseases whose increase or decrease can be attributed to agricultural water development (see table). Others include dengue fever, yellow fever, and filariasis. Young children in poor communities are particularly affected: malaria is among the top five causes of death among under-fives in Sub-Saharan Africa; schistosomiasis among children affects growth, nutritional status, and cognitive development; an...

  2. Transplacental transmission of Leishmania infantum as a means for continued disease incidence in North America.

    Directory of Open Access Journals (Sweden)

    Paola Mercedes Boggiatto

    areas are largely focused on vector-borne transmission between canines and people. Determining frequency of vertical transmission and incorporating canine sterilization with vector control may have a more significant impact on ZVL transmission to people in endemic areas than current control efforts.

  3. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus

    DEFF Research Database (Denmark)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter;

    2009-01-01

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is...

  4. Novel canine bocavirus strain associated with severe enteritis in a dog litter.

    Science.gov (United States)

    Bodewes, Rogier; Lapp, Stefanie; Hahn, Kerstin; Habierski, André; Förster, Christine; König, Matthias; Wohlsein, Peter; Osterhaus, Albert D M E; Baumgärtner, Wolfgang

    2014-11-01

    Bocaviruses are small non-enveloped viruses with a linear ssDNA genome, that belong to the genus Bocaparvovirus of the subfamiliy Parvovirinae. Bocavirus infections are associated with a wide spectrum of disease in humans and various mammalian species. Here we describe a fatal enteritis associated with infection with a novel strain of canine bocavirus 2 (CaBoV-2), that occurred in a litter of German wirehaired pointers. Necropsy performed on three puppies revealed an enteritis reminiscent of canine parvovirus associated enteritis, accompanied with signs of lymphocytolytic disease in bone marrow, spleen, lymph nodes and thymus. While other major causes of enteritis of young dogs, including canine parvovirus, were excluded, by random PCR in combination with next-generation sequencing, a novel CaBoV-2 strain was detected. Phylogenetic analysis of the genome of this novel canine bocavirus strain indicated that this virus was indeed most closely related to group 2 canine bocaviruses. Infection with canine bocavirus was confirmed by in situ hybridization, which revealed the presence of CaBoV-2 nucleic acid in the intestinal tract and lymphoid tissues of the dogs. In a small-scale retrospective analysis concerning the role of CaBoV-2 no additional cases were identified. The findings of this study provide novel insights into the pathogenicity of canine bocaviruses. PMID:25263495

  5. 9 CFR 113.305 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine.

    Science.gov (United States)

    2010-01-01

    ... STANDARD REQUIREMENTS Live Virus Vaccines § 113.305 Canine Hepatitis and Canine Adenovirus Type 2 Vaccine. Canine Hepatitis Vaccine and Canine Adenovirus Type 2 Vaccine shall be prepared from virus-bearing cell... hepatitis, the test is inconclusive and may be repeated. (B) If at least 19 of the 20 vaccinates do...

  6. Morphologic and biochemical studies of canine mucopolysaccharidosis I.

    OpenAIRE

    Shull, R M; Helman, R. G.; Spellacy, E.; Constantopoulos, G.; Munger, R. J.; Neufeld, E F

    1984-01-01

    This report presents the necropsy and biochemical findings on the first dog to die with alpha-L-iduronidase deficiency (mucopolysaccharidosis I, MPS I). Gross pathologic features, light- and electron-microscopic findings, and tissue enzyme, glycosaminoglycan (GAG), and sphingolipid levels are compared with the human disease counterpart and the previously described feline model. Results lend further support for the similarities of the canine disease and human MPS I.

  7. Feline and canine coronaviruses : common genetic and pathobiological features

    OpenAIRE

    Sophie Le Poder

    2011-01-01

    A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious ...

  8. Characteristics, immunological events, and diagnostics of Babesia spp. infection, with emphasis on Babesia canis

    Directory of Open Access Journals (Sweden)

    Kostro Krzysztof

    2015-12-01

    Full Text Available Vector-borne infection constitutes a significant health issue in dogs worldwide. Recent reports point to an increasing number of canine vector-borne disease cases in European countries, including Poland. Canine babesiosis caused by various Babesia species is a protozoal tick-borne disease with worldwide distribution and significant veterinary importance. The development and application of molecular methods have increased our knowledge about canine babesiosis, its prevalence, and clinical and pathological aspects of the infection. Parasitologists and veterinary surgeons need an accurate description of the species responsible for canine babesiosis to improve diagnostic and therapeutic methods, as well as predictions for the course of the disease. Therefore, we decided to summarise recent knowledge concerning Babesia species and B. canis.

  9. FLT3 mutations in canine acute lymphocytic leukemia

    International Nuclear Information System (INIS)

    FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias

  10. Canine babesiosis treatment with three different medicines

    Directory of Open Access Journals (Sweden)

    Torbica G.

    2013-01-01

    Full Text Available Canine babesiosis is a relatively frequent disease in Croatia. Elevated body temperature, anemia and haemoglobinuria are the most common signs. Diagnosis is rapidly obtained by employing blood smears, as B. canis is present in the red blood cells of affected dogs. Treatment is favourable and without consequences. Blood work was performed initialy, prior to treatment, and on the 1st and the 7th day following treatment. Following history and examination of the dogs blood and urine samples were taken. After confirmation of B. canis in the red blood cells, alltogether 226 dogs were tretated. Out of them 80 were tretaed with Berenil® (diminazen aceturate, Hoechst, 72 were tretated with Imizol® (imidocarb dipropionate, Schering-Plough-Animal-Health and 74 with Oxopirvedin® (fenamidine dizetionate, Merial. Clinical findings, haematological analysis and urine analysis are given and statistically assesed. After tretment with Berenil®, symptoms of babesiosis regressed within 24 hours. Health improved more slowly in the group treated with Oxopirvedin® in comparioson with the group treated with Berenil®. Contrary to the above, Imizol® displayed the slowest regression of the disease and reinfestation with B. canis within 30 days was not noted. That is not the case if treatment was provided by Berenil® and Oxopirvedin®. In all 226 cases of canine babesiosis side effects were not noted, except topically inflammed tissue at the site of subcutaneous application.

  11. Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia

    Directory of Open Access Journals (Sweden)

    Víctor Acero P

    2015-09-01

    Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.

  12. Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman

    2011-01-01

    Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.

  13. Recent advances in canine leptospirosis: focus on vaccine development

    Directory of Open Access Journals (Sweden)

    Klaasen HLBM

    2015-06-01

    Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis

  14. Three cases of Parafilaria bovicola infection in Belgium, and a few recent epidemiological observations on this emergent disease

    OpenAIRE

    Caron, Yannick; Groignet, Stéphanie; Saegerman, Claude; Losson, Bertrand

    2013-01-01

    Parafilariosis is a vector borne parasitic disease caused by the development of the nematode Parafilaria bovicola in the subcutaneous and intermuscular connective tissues of cattle. On February 28th 2012, the so-called bleeding spots were observed in two heifers and one bull in a cattle herd close to Namur (Belgium). The animals had been treated in December with an injectable ivermectin/closantel solution (Closamectin pour on®, Norbrook Lab) at the recommended dosage. Samples of serohaemorrha...

  15. Current state of knowledge: the canine gastrointestinal microbiome.

    Science.gov (United States)

    Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S

    2012-06-01

    Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome. PMID:22647637

  16. Canine distemper virus infection in a lesser grison (Galictis cuja): first report and virus phylogeny

    OpenAIRE

    Jane Megid; Teixeira, Carlos R; Adriana Cortez; Heinemann, Marcos B; Antunes, João M.A.P.; Felipe Fornazari; Fabricio B. Rassy; Richtzenhain, Leonardo J

    2013-01-01

    Infectious diseases in wild animals have been increasing as a result of their habitat alterations and closer contact with domestic animals. Canine distemper virus (CDV) has been reported in several species of wild carnivores, presenting a threat to wildlife conservation. We described the first case of canine distemper virus infection in lesser grison (Galictis cuja). A free-ranging individual, with no visible clinical sigs, presented sudden death after one day in captivity. Molecular diagnosi...

  17. Canine faecal contamination and parasitic risk in the city of Naples (southern Italy)

    OpenAIRE

    Veneziano Vincenzo; Catelan Dolores; Musella Vincenzo; Biggeri Annibale; Carbone Sabrina; Rinaldi Laura; Cringoli Giuseppe

    2006-01-01

    Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts) by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks,...

  18. Major HGF-mediated regenerative pathways are similarly affected in human and canine cirrhosis

    OpenAIRE

    Spee, Bart; Arends, Brigitte; van den Ingh, Ted SGAM; Roskams, Tania; Rothuizen, Jan; Penning, Louis C

    2007-01-01

    Background The availability of non-rodent animal models for human cirrhosis is limited. We investigated whether privately-owned dogs (Canis familiaris) are potential model animals for liver disease focusing on regenerative pathways. Several forms of canine hepatitis were examined: Acute Hepatitis (AH), Chronic Hepatitis (CH), Lobular Dissecting Hepatitis (LDH, a specific form of micronodulair cirrhosis), and Cirrhosis (CIRR). Canine cirrhotic samples were compared to human liver samples from ...

  19. Canine babesiosis in Slovenia: Molecular evidence of Babesia canis canis and Babesia canis vogeli

    OpenAIRE

    Duh, Darja; Tozon, Nataša; Petrovec, Miroslav; StraŠek, Katja; AvŠic-Županc, Tatjana

    2004-01-01

    Canine babesiosis, caused by intraerythrocytic Babesia spp., is a tick-borne disease of worldwide importance. No information on canine babesiosis has been documented in Slovenia. Therefore, 238 dogs admitted to the Small animal clinic in Ljubljana from the years 2000 to 2002 were tested for the presence of babesial parasites in the blood. Based on clinical, microscopic and molecular investigations, 14 dogs (5.9%) were determined as being infected with babesiae. Clinical signs relating to acut...

  20. Heterogeneity within the hemagglutinin genes of canine distemper virus (CDV) strains detected in Italy

    DEFF Research Database (Denmark)

    Martella, V.; Cirone, F.; Elia, G.;

    2006-01-01

    Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause of...... lineage. These results suggest that at least three different CDV lineages are present in Italy. Keywords: Canine distemper virus; Dogs; Lineages; H gene...

  1. The feasibility of canine rabies elimination in Africa: dispelling doubts with data

    OpenAIRE

    Lembo, T.; Hampson, K.; Kaare, M.T.; Ernest, E.; Knobel, D.; Kazwala, R.R.; Haydon, D. T.; Cleaveland, S.

    2010-01-01

    Background: Canine rabies causes many thousands of human deaths every year in Africa, and continues to increase throughout much of the continent. Methodology/Principal Findings: This paper identifies four common reasons given for the lack of effective canine rabies control in Africa: (a) a low priority given for disease control as a result of lack of awareness of the rabies burden; (b) epidemiological constraints such as uncertainties about the required levels of vaccination coverage and...

  2. Emerging perspectives on hereditary glomerulopathies in canines

    Directory of Open Access Journals (Sweden)

    Littman MP

    2015-04-01

    Full Text Available Meryl P LittmanDepartment of Clinical Studies – Philadelphia, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA, USAAbstract: Familial glomerulopathies have been described in more than two dozen dog breeds. These canine spontaneous cases of glomerular disease are good models for their human counterparts. The dogs present clinically with protein-losing nephropathy and variable signs of hypertension, thromboembolic events, edema/effusions/nephrotic syndrome, or eventually with signs of renal disease such as anorexia, vomiting, weight loss, and/or polyuria/polydipsia. Laboratory changes include proteinuria, hypoalbuminemia, hypercholesterolemia, and eventually azotemia, hyperphosphatemia, anemia, and isosthenuria. Renal biopsies examined with transmission electron microscopy, immunofluorescence, and thin section light microscopy may show ultrastructural glomerular basement membrane abnormalities, glomerulosclerosis, amyloidosis, non-amyloid fibrillary deposition, or breed-associated predispositions for immune-complex glomerulonephritis. Genome-wide association studies and fine sequencing of candidate genes have led to the discovery of variant alleles associated with disease in some breeds; eg, 1 glomerular basement membrane ultrastructural abnormalities due to defective collagen type IV, caused by different premature stop codons in each of four breeds; ie, in COL4A5 in Samoyeds and Navasota mix breed dogs (X-linked, and in COL4A4 in English Cocker Spaniels and English Springer Spaniels (autosomal recessive; and 2 glomerulosclerosis-related podocytopathy with slit diaphragm protein anomalies of both nephrin and Neph3/filtrin due to non-synonymous single nucleotide polymorphisms in conserved regions of their encoding genes, NPHS1 and KIRREL2, in Soft Coated Wheaten Terriers and Airedale Terriers, with a complex mode of inheritance. Age at onset and progression to end-stage renal disease vary depending on the model. Genetic

  3. An Update on Therapeutic Management of Canine Demodicosis

    Directory of Open Access Journals (Sweden)

    S. K. Singh

    2011-02-01

    Full Text Available Canine demodicosis is a common noncontagious parasitic dermatosis caused by different spp of Demodex mites including Demodex canis, Demodex injai and D. cornei. Generalized demodicosis can be one of the most frustrating skin diseases, one will ever treat. Conventional and newer miticidal therapies are available to veterinarian to treat this frustrating skin disease. All recognized Demodex mites in dogs appear to respond similarly to mite targeted therapy. Treatment for canine demodicosis includes amitraz, ivermectin, milbemicin oxime, moxidectin, and doramectin. The use of any glucocorticoid-containing products is contraindicated and could favour disease generalization. Conventional treatments will often appear to work however, but it relies heavily on a highly toxic method of treatment. Using natural remedies for mange, on the other hand, can enhance the dog’s immune system, so that the body can fight off the mange mite infection by itself. [Veterinary World 2011; 4(1.000: 41-44

  4. Analyses of critical target cell responses during preclinical phases of evolving chronic radiation-induced myeloproliferative disease-exploitation of a unique canine model

    Energy Technology Data Exchange (ETDEWEB)

    Seed, T.M.; Kaspar, L.V.; Tolle, D.V.; Fritz, T.E.; Frazier, M.E.

    1988-01-01

    This document briefly summarizes and highlights ongoing studies on the cellular and molecular processes involved in the induction and progression of myeloid leukemia in dogs chronically exposed to low daily doses of wholebody gamma irradiation. Under such conditions, select groups of dogs exhibit extremely high frequencies of myeloproliferative disease (MPD) (i.e., /congruent/50%) of which myeloid leukemia is most prominent. 2 figs.

  5. Guidelines for the diagnosis and antimicrobial therapy of canine superficial bacterial folliculitis (Antimicrobial Guidelines Working Group of the International Society for Companion Animal Infectious Diseases)

    DEFF Research Database (Denmark)

    Hillier, Andrew; Lloyd, David H.; Weese, J. Scott;

    2014-01-01

    of an internationally available resource guiding practitioners in the diagnosis, treatment and prevention of SBF. DEVELOPMENT OF THE GUIDELINES: The guidelines were developed by the Antimicrobial Guidelines Working Group of the International Society for Companion Animal Infectious Diseases, with consultation and advice...

  6. Analyses of critical target cell responses during preclinical phases of evolving chronic radiation-induced myeloproliferative disease-exploitation of a unique canine model

    International Nuclear Information System (INIS)

    This document briefly summarizes and highlights ongoing studies on the cellular and molecular processes involved in the induction and progression of myeloid leukemia in dogs chronically exposed to low daily doses of wholebody gamma irradiation. Under such conditions, select groups of dogs exhibit extremely high frequencies of myeloproliferative disease (MPD) (i.e., /congruent/50%) of which myeloid leukemia is most prominent. 2 figs

  7. Characterization of canine dendritic cells in healthy, atopic, and non-allergic inflamed skin.

    Science.gov (United States)

    Ricklin, Meret Elisabeth; Roosje, Petra; Summerfield, Artur

    2010-11-01

    Atopic dermatitis in humans and dogs is a chronic relapsing allergic skin disease. Dogs show a spontaneous disease similar to the human counterpart and represent a model to improve our understanding of the immunological mechanisms, the pathogenesis of the disease, and new therapy development. The aim of the study was to determine the frequency and phenotype of dendritic cells (DC) in the epidermis and dermis of healthy, canine atopic dermatitis lesional, and non-allergic inflammatory skin to further validate the model and to obtain insights into the contribution of DC to the pathogenesis of skin diseases in dogs. We first characterized canine skin DC using flow-cytometric analysis of isolated skin DC combined with an immunohistochemical approach. A major population of canine skin dendritic cells was identified as CD1c(+)CD11c(+)CD14(-)CD80(+)MHCII(+)MAC387(-) cells, with dermal DC but not Langerhans cells expressing CD11b. In the epidermis of lesional canine atopic dermatitis and non-allergic inflammatory skin, we found significantly more dendritic cells compared with nonlesional and control skin. Only in canine atopic dermatitis skin did we find a subset of dendritic cells positive for IgE, in the epidermis and the dermis. Under all inflammatory conditions, dermal dendritic cells expressed more CD14 and CD206. MAC387(+) putative macrophages were absent in healthy but present in inflamed skin, in particular during non-allergic diseases. This study permits a phenotypic identification and differentiation of canine skin dendritic cells and has identified markers and changes in dendritic cells and macrophage populations related to allergic and non-allergic inflammatory conditions. Our data suggest the participation of dendritic cells in the pathogenesis of canine atopic dermatitis similar to human atopic dermatitis and further validate the only non-murine spontaneous animal model for this disease. PMID:20676740

  8. Seroepidemiology of Canine parvovirus infection in dogs

    Directory of Open Access Journals (Sweden)

    Indrawati Sendow

    2004-10-01

    Full Text Available Canine parvovirus is an acute and fatal viral disease in dogs. A total of 209 local, cross breed and breed dogs sera from Kodya Bogor, Kabupaten Bogor, Sukabumi, and Jakarta, had been tested using Haemagglutination Inhibition Test (HI with pig red blood cells. A total of 64 breed and cross breed dogs from Sukabumi and Kodya Bogor, were used as a sentinel dogs to study the epidemiology of Canine parvovirus (CPV infection and its immunological responses caused by vaccination. The results indicated that 78% (95 breed and cross bred dogs and 59% (51 local dogs had antibody to CPV. Sentinel dogs results indicated that dogs had been vaccinated showed antibody response with the varied titre dependant upon prevaccination titre. Low prevaccinated titre gave better response than protective level titre. From 19 puppies observed, Maternal antibodi were still detected until 5 weeks old puppies. First vaccination given at less than 3 months old, should be boosted after 3 months old puppied. Antibodi titre produced by natural infection will keep untill 2 years. These data concluded that the dog condition and time of vaccination will affect the optimum antibody response.

  9. Canine neosporosis: perspectives on pathogenesis and management

    Directory of Open Access Journals (Sweden)

    Silva RC

    2016-04-01

    Full Text Available Rodrigo C Silva,1 Gustavo P Machado2 1Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Starkville, MS, USA; 2Department of Internal Medicine and Surgery of Small Animals, Dr Munhoz Veterinary Hospital, Itápolis, Brazil Abstract: Canine neosporosis is a worldwide disease caused by the obligate intracellular parasite protozoan Neospora caninum, manifesting mainly neurological symptoms. N. caninum has a heteroxenous life cycle and affects a wide range of warm-blooded animals. The domestic and wild canids are the definitive host of the parasite. They shed oocysts after ingestion of tissue cysts from infected intermediate hosts (ovine, equine, bovine, canine, and many other species, containing bradyzoites, or oocyst-contaminated water and food. The presence of dogs in farms is considered a risk factor for production animals. A wide range of diagnostic methods are currently available, but the most used is serology, ie, indirect fluorescent antibody test specific to the antibody detection in blood serum samples. No vaccine is available, but control strategies should be focused on the vertical and horizontal transmission of the parasite, ie, avoid feeding dogs with raw or undercooked meat, and taking care with water for human and animal consumption. No medicines to control the transplacental transmission are available yet. Keywords: neosporosis, Neospora caninum, pathogenesis, management, dogs

  10. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    International Nuclear Information System (INIS)

    Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs

  11. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    Directory of Open Access Journals (Sweden)

    Kiupel Matti

    2006-04-01

    Full Text Available Abstract Background Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. Methods In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. Results No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. Conclusion In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs.

  12. Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.

    Directory of Open Access Journals (Sweden)

    Emily J Shields

    Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.

  13. A Nod to disease vectors: mitigation of pathogen sensing by arthropod saliva

    Directory of Open Access Journals (Sweden)

    JoaoPedra

    2013-10-01

    Full Text Available Arthropod saliva possesses anti-hemostatic, anesthetic, and anti-inflammatory properties that facilitate feeding and, inadvertently, dissemination of pathogens. Vector-borne diseases caused by these pathogens affect millions of people each year. Many studies address the impact of arthropod salivary proteins on various immunological components. However, whether and how arthropod saliva counters Nod-like (NLR sensing remains elusive. NLRs are innate immune pattern recognition molecules involved in detecting microbial molecules and danger signals. Nod1/2 signaling results in activation of the nuclear factor (NF-kB and the mitogen-activated protein kinase (MAPK pathways. Caspase-1 NLRs regulate the inflammasome – a protein scaffold that governs the maturation of interleukin (IL-1β and IL-18. Recently, several vector-borne pathogens have been shown to induce NLR activation in immune cells. Here, we provide a brief overview of NLR signaling and discuss clinically relevant vector-borne pathogens recognized by NLR pathways. We also elaborate on possible anti-inflammatory effects of arthropod saliva on NLR signaling and microbial pathogenesis for the purpose of exchanging research perspectives.

  14. Dengue Fever: An Emerging Infectious Disease in The Bahamas

    OpenAIRE

    Bain, Sherrie Valarie

    2011-01-01

    Dengue fever is an emerging infectious disease that is increasing in prevalence in many geographic regions, including the Caribbean. It is the most common arboviral (vector-borne) disease in the world, and infects more that 50 million people annually worldwide. The etiological agent of dengue fever is one of four serotypes of the Dengue virus (DENV1 – DENV4). The infection is transmitted via a human-mosquito-human route, when one or more species of the Aedes mosquito takes a blood meal from a...

  15. Disease vectors in the era of next generation sequencing.

    Science.gov (United States)

    Rinker, David C; Pitts, R Jason; Zwiebel, Laurence J

    2016-01-01

    Almost 20 % of all infectious human diseases are vector borne and, together, are responsible for over one million deaths per annum. Over the past decade, the decreasing costs of massively parallel sequencing technologies have facilitated the agnostic interrogation of insect vector genomes, giving medical entomologists access to an ever-expanding volume of high-quality genomic and transcriptomic data. In this review, we highlight how genomics resources have provided new insights into the physiology, behavior, and evolution of human disease vectors within the context of the global health landscape. PMID:27154554

  16. The Importance of Age Dependent Mortality and the Extrinsic Incubation Period in Models of Mosquito-Borne Disease Transmission and Control

    OpenAIRE

    Bellan, Steve E.

    2010-01-01

    Nearly all mathematical models of vector-borne diseases have assumed that vectors die at constant rates. However, recent empirical research suggests that mosquito mortality rates are frequently age dependent. This work develops a simple mathematical model to assess how relaxing the classical assumption of constant mortality affects the predicted effectiveness of anti-vectorial interventions. The effectiveness of mosquito control when mosquitoes die at age dependent rates was also compared acr...

  17. A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article

    Directory of Open Access Journals (Sweden)

    S. Gur

    2009-05-01

    Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.

  18. A retrospective investigation of canine adenovirus (CAV) infection in adult dogs in Turkey.

    Science.gov (United States)

    Gür, S; Acar, A

    2009-06-01

    Canine adenovirus (CAV) type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serum samples were collected from native pure-bred Kangal(n = 11), and Akbash dogs (n = 17) and Turkish Greyhounds (n = 15) in Eskişehir and Konya provinces. None of the dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2%, 93.3% and 100% prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51) were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3%) were detected as seropositive. In total, 82 of 94 dogs (87.2%) were found to be positive for CAV serum antibodies. PMID:19831268

  19. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  20. Health status, infection and disease in California sea lions (Zalophus californianus) studied using a canine microarray platform and machine-learning approaches.

    Science.gov (United States)

    Mancia, Annalaura; Ryan, James C; Chapman, Robert W; Wu, Qingzhong; Warr, Gregory W; Gulland, Frances M D; Van Dolah, Frances M

    2012-04-01

    Conservation biologists face many challenges in assessing health, immune status and infectious diseases in protected species. These challenges include unpredictable sample populations, diverse genetic and environmental backgrounds of the animals, as well as the practical, legal and ethical issues involved in experimentation. The use of whole genome scale transcriptomics with animal samples obtained in a minimally invasive manner is an approach that shows promise for health assessment. In this study we assessed the utility of a microarray to identify changes in gene expression predictive of health status by interrogating blood samples from California sea lions (Zalophus californianus) in rehabilitation. A custom microarray was developed from the commercially available dog microarray (Canis familiaris) by selecting probes that demonstrated reliable cross-hybridization with RNA in sea lion blood. This custom microarray was used for the analysis of RNA from 73 sea lion blood samples, from animals with a broad spectrum of health changes. Both traditional classifying techniques and newer artificial neural network approaches correctly classified sea lions with respect to health status, primarily distinguishing between leptospirosis infection and domoic acid exposure. Real time PCR validation for a small set of genes, followed by sequencing, showed good correlation with array results and high identity (96-98%) between the dog and sea lion sequences. This approach to health status classification shows promise for disease identification in a clinical setting, and assessment of health status of wildlife. PMID:22067742

  1. A canine orthologue of the human GFAP c.716G>A (p.Arg239His) variant causes Alexander disease in a Labrador retriever.

    Science.gov (United States)

    Van Poucke, Mario; Martlé, Valentine; Van Brantegem, Leen; Ducatelle, Richard; Van Ham, Luc; Bhatti, Sofie; Peelman, Luc J

    2016-06-01

    Alexander disease (AxD) is a fatal neurodegenerative disorder of astrocyte dysfunction in man, for which already a number of causal variants are described, mostly de novo dominant missense variants in the glial fibrillary acidic protein (GFAP). A similar disorder was already phenotypically described in animals but without the identification of causal variants. We diagnosed a Labrador retriever with a juvenile form of AxD based on clinical (tetraparesis with spastic front limbs mimicking 'swimming puppy syndrome') and pathological (the detection of GFAP containing Rosenthal fibers in astrocytes) features. In order to identify a causal variant, the coding sequences of the four detected GFAP transcript variants (orthologues from human transcript variants α, γ, δ/ɛ and κ) were sequenced. From the five detected variants, a heterozygous c.719G>A nucleotide substitution resulting in a p.Arg240His substitution was considered to be causal, because it is orthologous to the heterozygous de novo dominant c.716G>A (p.Arg239His) hotspot variant in man, proven to cause a severe phenotype. In addition, the variant was not found in 50 unrelated healthy Labrador retrievers. Because the condition in dogs is morphologically similar to man, it could be a promising animal model for further elucidating the genotype/phenotype correlation in order to treat or prevent this disease. PMID:26486469

  2. Survey of Canine Dirofilaria immitis Infection in New Caledonia.

    Science.gov (United States)

    Watier-Grillot, S; Marié, J-L; Cabre, O; Davoust, B

    2011-01-01

    Canine dirofilariosis is a frequent parasitic disease in New-Caledonia. A survey of canine heartworm (Dirofilaria immitis) infection among dogs from the cities of Tontouta, Nandaï and Nouméa, was performed in March 2009 using two antigen test kits; the microwell ELISA test: DiroCHE (Synbiotics Europe) and the Rapid Immuno Migration (RIM) test: WITNESS DIROFILARIA (Synbiotics Europe). Blood samples were collected from 64 dogs: 49 strays and 15 military working dogs. The military dogs received a permanent chemoprophylaxis (moxidectin). In 11 stray dogs, both tests were positive (22.4%). All the military dogs were negative, showing efficiency of chemoprophaxis. Results were discrepant in 6 dogs, negative with one test and doubtful with the other. Antigen heartworm test kits are available and reliable diagnostic tools. They are useful to evaluate the efficiency of chemoprophylaxis and to detect infected animals in order to treat them and to prevent the spreading of the disease. PMID:21547264

  3. Survey of Canine Dirofilaria immitis Infection in New Caledonia

    Directory of Open Access Journals (Sweden)

    S. Watier-Grillot

    2011-01-01

    Full Text Available Canine dirofilariosis is a frequent parasitic disease in New-Caledonia. A survey of canine heartworm (Dirofilaria immitis infection among dogs from the cities of Tontouta, Nandaï and Nouméa, was performed in March 2009 using two antigen test kits; the microwell ELISA test: DiroCHE (Synbiotics Europe and the Rapid Immuno Migration (RIM test: WITNESS DIROFILARIA (Synbiotics Europe. Blood samples were collected from 64 dogs: 49 strays and 15 military working dogs. The military dogs received a permanent chemoprophylaxis (moxidectin. In 11 stray dogs, both tests were positive (22.4%. All the military dogs were negative, showing efficiency of chemoprophaxis. Results were discrepant in 6 dogs, negative with one test and doubtful with the other. Antigen heartworm test kits are available and reliable diagnostic tools. They are useful to evaluate the efficiency of chemoprophylaxis and to detect infected animals in order to treat them and to prevent the spreading of the disease.

  4. Identification of new genovariants of canine distemper virus in dogs from the State of Mexico by analyzing the nucleocapsid gene

    OpenAIRE

    CE Gámiz-Mejía; J Simón-Martínez; RC Fajardo-Muñoz

    2012-01-01

    Globally, Canine Distemper Disease is one of the most important viral diseases in dogs due to its high mortality and morbidity. It is caused by an RNA canine paramyxovirus with an elevated genetic diversity. We previously reported the presence of an apparently exclusive genovariant in the State of Mexico, but we do not have data on molecular epidemiology of this virus. In order to determine his genetic diversity in this State, samples collected from dogs showing clinical signs of ...

  5. Canine distemper infections, with special reference to South Africa, with a review of the literature : review article

    OpenAIRE

    A.L. Leisewitz; Carter, A; M. Van Vuuren; van Blerk, L

    2001-01-01

    Canine distemper virus is a member of the genus Morbillivirus of the family Paramyxoviridaethat causes severe disease in dogs and a range of wild mammals. The clinical signs relate essentially to the respiratory, gastrointestinal and central nervous systems. In South Africa, infection with Ehrlichia canis and canine parvovirus may present similarly. Many dogs will initially present with a wide range of central nervous system signs without any history of systemic disease. A recent South Africa...

  6. Canine faecal contamination and parasitic risk in the city of Naples (southern Italy

    Directory of Open Access Journals (Sweden)

    Veneziano Vincenzo

    2006-09-01

    Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between

  7. Antioxidants in the Canine Model of Human Aging

    OpenAIRE

    Dowling, Amy L. S.; Head, Elizabeth

    2011-01-01

    Oxidative damage can lead to neuronal dysfunction in the brain due to modifications to proteins, lipids and DNA/RNA. In both human and canine brain, oxidative damage progressively increases with age. In the Alzheimer’s disease (AD) brain, oxidative damage is further exacerbated, possibly due to increased deposition of beta-amyloid (Aβ) peptide in senile plaques. These observations have led to the hypothesis that antioxidants may be beneficial for brain aging and AD. Aged dogs naturally develo...

  8. Canine parvovirus effect on wolf population change and pup survival

    Science.gov (United States)

    Mech, L.D.; Goyal, S.M.

    1993-01-01

    Canine parvovirus infected wild canids more than a decade ago, but no population effect has been documented. In wild Minnesota wolves (Canis lupus) over a 12-yr period, the annual percent population increase and proportion of pups each were inversely related to the percentage of wolves serologically positive to the disease. Although these effects did not seem to retard this large extant population, similar relationships in more isolated wolf populations might hinder recovery of this endangered and threatened species.

  9. Surgical innovations in canine gonadectomy

    NARCIS (Netherlands)

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated n

  10. The relationship between the Southern Oscillation Index, rainfall and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia.

    Science.gov (United States)

    Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P

    2015-07-01

    The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. PMID:25841899

  11. Establishment of Canine-Derived Giardia duodenalis Isolates in Culture.

    Science.gov (United States)

    Tysnes, Kristoffer R; Robertson, Lucy J

    2016-06-01

    Researchers continue to rely on axenic cultivation of Giardia duodenalis trophozoites in vitro to study the life cycle and host-parasite interactions of G. duodenalis and to develop vaccines and drugs to prevent and treat giardiasis. The majority of in vitro studies of G. duodenalis have used a small subset of isolates, mostly of assemblage A, and these isolates are usually originally isolated from humans. The most commonly used isolate for lab studies is known as WB. Canine giardiasis is a disease of veterinary importance, but it may also be of relevance in zoonotic transmission. Few G. duodenalis isolates from dogs have been adapted to in vitro culture, probably because the methods used are not suitable for the canine-specific genotypes that tend to dominate in most dog populations. In the current study, an experimental approach to cultivating canine-derived isolates of G. duodenalis was attempted by modification of the standard protocol based on physiological differences between the human and canine digestive system. An adapted method is described for improving the rate of in vitro excystation of cysts isolated from dogs by chemically weakening the cyst wall. A new canine-derived assemblage A G. duodenalis isolate was successfully adapted to axenic culture by using this method; the dog apparently had a mixed infection of assemblages A and D, but the assemblage A successfully outcompeted the assemblage D under conditions of in vitro culture. Based on the results, reasons regarding why humans do not seem to be suitable hosts for G. duodenalis in assemblages C and D are discussed. PMID:26835750

  12. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    Directory of Open Access Journals (Sweden)

    Helen L. Del Puerto

    2010-02-01

    Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

  13. Pathophysiology, diagnosis, and treatment of canine hip dysplasia

    International Nuclear Information System (INIS)

    Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education

  14. European surveillance for pantropic canine coronavirus.

    Science.gov (United States)

    Decaro, Nicola; Cordonnier, Nathalie; Demeter, Zoltan; Egberink, Herman; Elia, Gabriella; Grellet, Aurélien; Le Poder, Sophie; Mari, Viviana; Martella, Vito; Ntafis, Vasileios; von Reitzenstein, Marcela; Rottier, Peter J; Rusvai, Miklos; Shields, Shelly; Xylouri, Eftychia; Xu, Zach; Buonavoglia, Canio

    2013-01-01

    Highly virulent pantropic canine coronavirus (CCoV) strains belonging to subtype IIa were recently identified in dogs. To assess the distribution of such strains in Europe, tissue samples were collected from 354 dogs that had died after displaying systemic disease in France (n = 92), Hungary (n = 75), Italy (n = 69), Greece (n = 87), The Netherlands (n = 27), Belgium (n = 4), and Bulgaria (n = 1). A total of 124 animals tested positive for CCoV, with 33 of them displaying the virus in extraintestinal tissues. Twenty-four CCoV strains (19.35% of the CCoV-positive dogs) detected in internal organs were characterized as subtype IIa and consequently assumed to be pantropic CCoVs. Sequence and phylogenetic analyses of the 5' end of the spike protein gene showed that pantropic CCoV strains are closely related to each other, with the exception of two divergent French viruses that clustered with enteric strains. PMID:23100349

  15. Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.

    Science.gov (United States)

    Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D

    2014-12-01

    Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis. PMID:25320495

  16. The importance of emerging and re-emerging zoonotic diseases: recognition, monitoring and control

    International Nuclear Information System (INIS)

    Whilst communicable diseases mainly affect the developing world, new and emerging diseases have re-awakened the developed countries to the importance of these infections. Concern has been raised that climate change and other man-made changes to the environment could provide conditions for diseases to increase their range and affect countries where they have not normally been a problem. The zoonoses, infections naturally transmitted between vertebrate animals and humans, present considerable difficulties because eradication is almost impossible and control is problematic. However, control of many zoonoses can be affordable and reduction in human morbidity needs to become a priority task in many countries and regions. Many global, regional or locally occurring emerging or re-emerging infectious diseases are caused by zoonoses, including both vector-borne and non-vector borne diseases. Molecular biology has been instrumental in providing an understanding of zoonotic infections in relation to their transmission, epidemiology, clinical and pathological effects, treatment, development of vaccines and diagnosis and control. Examples of zoonoses in which molecular tools have helped decisively are mentioned in this review and examples are given on how molecular markers may help in the assessment and control of zoonotic diseases as illustrated in the insect vector-borne protozoan zoonosis, Chagas' disease and a snail-borne helminthic zoonosis, fascioliasis. Finally, emphasis is placed on the need to increase studies on animal reservoirs, to improve teaching and understanding of 'old-fashioned' disciplines such as medical malacology and entomology, as well as training and technology transfer and to actively pursue field work. Only by investing in these disciplines will we be in a position to go to the field, perform surveys, and acquire the data that will enable us to determine the presence of emerging or re-emerging infectious diseases. (author)

  17. 犬瘟热的诊治%Diagnosis and Treatment of Canine Distemper

    Institute of Scientific and Technical Information of China (English)

    罗厚强; 段龙川; 王清艳; 涂宜强; 涂国众

    2012-01-01

    Canine distemper is an acute infectious disease caused by the canine distemper virus in Canidae. Many symptoms were characterized by infected dogs, such as biphasic fever, rhinitis, severe inflammation of the digestive tract and respiratory inflammation. The pathogen, epidemiology, clinical symptoms and pathological changes of canine distemper were introduced in the paper. Though a typical case of canine distemper, a series of effective measures to treat canine distemper were introduced in order to provide reference for the control of canine distemper.%犬瘟热是一种由犬瘟热病毒引起的犬科动物急性传染病,病犬以双相热、鼻炎、严重的消化障碍和呼吸道炎症为特征。主要对该病的病原、流行病学、临床症状及病理变化等作一阐述,并以一例犬瘟热典型病例的诊治为例,介绍了治疗该病的有效措施,以期为有效防治犬瘟热提供参考。

  18. Maxillary canine with two root canals

    OpenAIRE

    Nagesh Bolla; Sarath Raj Kavuri

    2011-01-01

    To report a rare case of maxillary canine with two root canals. The case describes the treatment of a maxillary canine with two root canals which was referred from department of prosthodontia for intentional root canal treatment for prosthetic rehabilitation. Clinical examination revealed a maxillary canine with carious lesion and responded within normal limits to electric pulp test. Radiographic examination revealed a distal carious lesion (close proximity to pulp) and also appeared to be an...

  19. Canine specific ELISA for coagulation factor VII

    DEFF Research Database (Denmark)

    Knudsen, Tom; Kjelgaard-Hansen, Mads; Tranholm, Mikael; Wiinberg, Bo; Clausen, Jes T.; Hansen, Jens Jacob; Nichols, Timothy C.; Kjalke, Marianne; Jensen, Asger Lundorff; Kristensen, Annemarie Thuri

    2011-01-01

    Canine coagulation factor VII (FVII) deficiency can be hereditary or acquired and may cause life threatening bleeding episodes if untreated. FVII procoagulant activity can be measured by FVII activity (FVII:C), but assays for measurement of canine specific FVII antigen (FVII:Ag) have not been...... available to date. In this study, a canine specific ELISA for measurement of FVII:Ag in plasma was developed and validated. The FVII:Ag ELISA correctly diagnosed homozygous and heterozygous hereditary FVII deficiency. Together with activity based assays, such as FVII:C, the FVII:Ag ELISA should be valuable...... in the diagnosis of hereditary canine FVII deficiency....

  20. The effect of nematode administration on canine atopic dermatitis.

    Science.gov (United States)

    Mueller, R S; Specht, L; Helmer, M; Epe, C; Wolken, S; Denk, D; Majzoub, M; Sauter-Luis, C

    2011-09-27

    Canine atopic dermatitis is a common disease and is considered as an animal model of the human disease. Immunomodulation by helminths is reported in several species. The aim of this study was to determine whether nematodes have an immunomodulatory effect on atopic dermatitis in dogs. In the pilot study, 12 atopic dogs were infected with either embryonated eggs of Trichuris vulpis (500 and 2500 eggs in 3 dogs each) or L3 larvae of Uncinaria stenocephala (100, 500 and 2500 eggs in 2 dogs each), respectively, for 3 months. Pruritus was evaluated with visual analogue scales and clinical lesions with the canine atopic dermatitis extent and severity index (CADESI). Skin biopsies were obtained for histopathology at the beginning and end of the study. In the subsequent placebo-controlled, double-blinded, randomised study, 21 dogs received either 2500 embryonated T. vulpis eggs or placebo and were evaluated similarly. In addition, allergen-specific serum IgE concentrations were determined. All dogs in the pilot study improved in their lesion scores, most in their pruritus scores. The cutaneous inflammatory infiltrate did not change significantly. In the subsequent randomised study, there was no significant difference between placebo and Trichuris administration in regard to pruritus or CADESI. IgE concentrations also did not change significantly. Infection with T. vulpis did not significantly change clinical signs of canine atopic dermatitis. PMID:21621922

  1. Canine IgA nephropathy: a case report.

    Science.gov (United States)

    Yabuki, Akira; Shimokawa Miyama, Takako; Kohyama, Moeko; Yamato, Osamu

    2016-04-01

    Immunoglobulin (Ig) A nephropathy is a rare form of canine glomerular disease. This report describes a case of canine IgA nephropathy showing characteristics typical of human IgA nephropathy. An 8-year-old, spayed female Miniature Dachshund showed persistent severe proteinuria without azotemia. She was receiving long-term glucocorticoid therapy due to chronic gastritis and an intra-abdominal suture granuloma. A renal biopsy demonstrated mesangial proliferative glomerulonephritis with predominantly mesangial IgA deposition and electron-dense deposits in the paramesangium. These findings closely resembled those of human IgA nephropathy. Glucocorticoid treatment was discontinued, and the angiotensin-converting enzyme inhibitor enalapril was administrated as an antiproteinuric agent. The proteinuria subsequently went into remission, and the patient has maintained good condition without recurrence. PMID:26596464

  2. Stimulation with Concanavalin-A Induces IL-17 Production by Canine Peripheral T Cells

    Directory of Open Access Journals (Sweden)

    Michelle G. Ritt

    2015-04-01

    Full Text Available The characteristics of canine IL-17-producing cells are incompletely understood. Expression of mRNA encoding orthologs of IL-17 and the IL-17 receptor has been documented in tissues from dogs with arthritis, inflammatory bowel disease, and lymphoma; however, no associations have been found between IL-17 gene expression and disease phenotype in these conditions. Robust assessment of the role of IL-17-producing cells in dogs will require measuring the frequency of these cells in health and disease in balance with other lymphocyte subsets. The aim of this study was to confirm that the T-cell IL-17 response in dogs is evolutionarily conserved. Canine peripheral blood mononuclear cells were stimulated with Concanavalin A with or without polarizing cytokines. We used a canine specific IL-17 ELISA and flow cytometry to identify IL-17-producing T cells. Accumulation of intracellular IL-17 was observed in stimulated CD4 and CD8 T cells. The addition of pro-inflammatory cytokines appeared to enhance polarization of canine CD4 T cells to the Th17 phenotype. Conversely, the addition of IL-2 in the presence of TGF-β resulted in expansion of Treg cells. We conclude that canine IL-17-producing cells behave similarly to those from humans and mice when stimulated with mitogens and polarized with pro-inflammatory or immune regulatory cytokines.

  3. Sewage surveillance reveals the presence of canine GVII norovirus and canine astrovirus in Uruguay.

    Science.gov (United States)

    Lizasoain, A; Tort, L F L; García, M; Gómez, M M; Leite, J P G; Miagostovich, M P; Cristina, J; Berois, M; Colina, R; Victoria, Matías

    2015-11-01

    Canine norovirus (NoV) and astrovirus (AstV) were studied in 20 domestic sewage samples collected in two cities in Uruguay. Four samples were characterized as canine AstV after phylogenetic analysis clustering with strains detected in Italy and Brazil in 2008 and 2012, respectively. One sample was characterized as canine NoV and clustered with a strain detected in Hong Kong and recently classified as GVII. This study shows the occurrence of a canine NoV GVII strain for the first time in the American continent and also warns about possible zoonotic infection, since canine strains were detected in domestic sewage. PMID:26280526

  4. Canine mammary tumors - clinical survey

    OpenAIRE

    Elena Atanaskova Petrov; Ksenija Ilievska; Plamen Trojacanec; Irena Celeska; Goran Nikolovski; Ivica Gjurovski; Toni Dovenski

    2014-01-01

    Mammary tumours are the second most frequent neoplasia in dogs, mainly affecting older female patients. Approximately 50% of the mammary tumours are malignant with high percentage of mortality if not treated in time. The aim of this study was to analyze the data of canine patients with mammary tumours, to evaluate the type of tumours, as well as the relationship between tumour incidence and dogs’ age, reproductive cycle and sterilization. The survey was used to retrieve the information in the...

  5. Surgical innovations in canine gonadectomy

    OpenAIRE

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated negative consequences (lengthy placement, impaired wound healing around bulky knots, and the effect of unsightly knots on cosmetics). A study in 9 dogs found that celiotomy closure was easily achiev...

  6. Impact of canine control on the epidemiology of canine and human visceral leishmaniasis in Brazil.

    Science.gov (United States)

    Palatnik-de-Sousa, C B; dos Santos, W R; França-Silva, J C; da Costa, R T; Reis, A B; Palatnik, M; Mayrink, W; Genaro, O

    2001-11-01

    Brazil is the only country endemic for zoonotic visceral leishmaniasis (ZVL) that regularly conducts epidemiologic and prophylactic control programs that involve the treatment of human cases, insect vector control, and the removal of seropositive infected dogs. This report reviews 60 studies reporting data on the efficacy of these recommended control tools and concludes that in Brazil 1) eradication of the disease in Minas Gerais was achieved by the concomitant use of the three control methods, 2) although seropositivity by an immunofluorescent assay is not completely related to infectiousness, the removal of seropositive dogs leads to a significant reduction of canine and human incidence, 3) improvement of the sensitivity of the diagnostic tool used for canine control should optimize the efficacy of control, and 4) although difficult and expensive, the public health dog control campaigns performed in Brazil reduced the incidence of ZVL and should be maintained since treatment of dogs is an unrealistic intervention, both because of its prohibitive cost and relatively poor effectiveness. PMID:11716106

  7. Effect of simulated stages of the canine oestrous cycle on Escherichia coli binding to canine endometrium.

    Science.gov (United States)

    Krekeler, N; Lodge, K M; Anderson, G A; Browning, G F; Charles, J A; Wright, P J

    2012-12-01

    Pyometra, a prevalent infectious uterine disease that affects intact middle-aged bitches, is typically associated with Escherichia coli. Our hypotheses were (i) that bacterial adhesion to canine endometrium differs between different stages of the oestrous cycle and (ii) that the adhesin FimH facilitates this adhesion. Twelve post-pubertal, ovariectomized greyhound bitches were treated with exogenous hormones to simulate different stages of the oestrous cycle. Tissue samples from each uterus were incubated with a pathogenic E. coli strain carrying the fimH gene, but no other adhesin genes (P4-wt)--or an E. coli strain in which fimH was insertionally inactivated (P4-∆fimH::kan)--or with phosphate-buffered saline as a negative control. After washing, tissue samples were homogenized for quantification of adherent bacteria. The differences in binding to canine endometrium at different stages of the oestrous cycle were not significant. However, the mean difference in binding of the P4-wt and the P4-∆fimH::kan across all stages of the simulated oestrous cycle was significant (p < 0.001 by paired t-test on geometric means). Individual differences in numbers of P4-wt bacteria bound between dogs might suggest genetic variations or epigenetic differences in FimH receptor expression by the endometrium, unrelated to the stage of the oestrous cycle. PMID:23279531

  8. Canine adenovirus based rabies vaccines.

    Science.gov (United States)

    Tordo, N; Foumier, A; Jallet, C; Szelechowski, M; Klonjkowski, B; Eloit, M

    2008-01-01

    Adenovirus based vectors are very attractive candidates for vaccination purposes as they induce in mammalian hosts potent humoral, mucosal and cellular immune responses to antigens encoded by the inserted genes. We have generated E1-deleted and replication-competent recombinant canine type-2 adenoviruses expressing the rabies virus glycoprotein (G). The effectiveness of both vectors to express a native G protein has been characterized in vitro in permissive cell lines. We compared the humoral and cellular immune responses induced in mice by intramuscular injection of the recombinant canine adenovirus vectors with those induced by a human (Ad5) E1-deleted virus expressing the same rabies G protein. Humoral responses specific to the adenoviruses or the rabies glycoprotein antigens were studied. The influence of the mouse strain was observed using replication-competent canine adenovirus. A high level of rabies neutralizing antibody was observed upon i.m. inoculation, and 100% of mice survived lethal challenge. These results are very promising in the perspective of oral vaccine for dog rabies control. PMID:18634509

  9. Genetic Control of Canine Leishmaniasis: Genome-Wide Association Study and Genomic Selection Analysis

    OpenAIRE

    Quilez, Javier; Martínez, Verónica; Woolliams, John A.; Sanchez, Armand; Pong-Wong, Ricardo; Kennedy, Lorna J.; Quinnell, Rupert J.; William E. R. Ollier; Roura, Xavier; Ferrer, Lluís; Altet, Laura; Francino, Olga

    2012-01-01

    Background: the current disease model for leishmaniasis suggests that only a proportion of infected individuals develop clinical disease, while others are asymptomatically infected due to immune control of infection. The factors that determine whether individuals progress to clinical disease following Leishmania infection are unclear, although previous studies suggest a role for host genetics. Our hypothesis was that canine leishmaniasis is a complex disease with multiple loci responsible for...

  10. Genetic control of canine leishmaniasis: genome-wide association study and genomic selection analysis

    OpenAIRE

    Javier Quilez; Verónica Martínez; Woolliams, John A.; Armand Sanchez; Ricardo Pong-Wong; Kennedy, Lorna J.; Quinnell, Rupert J; Ollier, William E.R.; Xavier Roura; Lluís Ferrer; Laura Altet; Olga Francino

    2012-01-01

    BACKGROUND: The current disease model for leishmaniasis suggests that only a proportion of infected individuals develop clinical disease, while others are asymptomatically infected due to immune control of infection. The factors that determine whether individuals progress to clinical disease following Leishmania infection are unclear, although previous studies suggest a role for host genetics. Our hypothesis was that canine leishmaniasis is a complex disease with multiple loci responsible for...

  11. [Diagnostic tools for canine parvovirus infection].

    Science.gov (United States)

    Proksch, A L; Hartmann, K

    2015-01-01

    Canine parvovirus (CPV) infection is one of the most important and common infectious diseases in dogs, in particular affecting young puppies when maternal antibodies have waned and vaccine-induced antibodies have not yet developed. The mortality rate remains high. Therefore, a rapid and safe diagnostic tool is essential to diagnose the disease to 1) provide intensive care treatment and 2) to identify virus-shedding animals and thus prevent virus spread. Whilst the detection of antibodies against CPV is considered unsuitable to diagnose the disease, there are several different methods to directly detect complete virus, virus antigen or DNA. Additionally, to test in commercial laboratories, rapid in-house tests based on ELISA are available worldwide. The specificity of the ELISA rapid in-house tests is reported to be excellent. However, results on sensitivity vary and high numbers of false-negative results are commonly reported, which potentially leads to misdiagnosis. Polymerase chain reaction (PCR) is a very sensitive and specific diagnostic tool. It also provides the opportunity to differentiate vaccine strains from natural infection when sequencing is performed after PCR. PMID:26403490

  12. Improvement of disease prediction and modeling through the use of meteorological ensembles: human plague in Uganda.

    Science.gov (United States)

    Moore, Sean M; Monaghan, Andrew; Griffith, Kevin S; Apangu, Titus; Mead, Paul S; Eisen, Rebecca J

    2012-01-01

    Climate and weather influence the occurrence, distribution, and incidence of infectious diseases, particularly those caused by vector-borne or zoonotic pathogens. Thus, models based on meteorological data have helped predict when and where human cases are most likely to occur. Such knowledge aids in targeting limited prevention and control resources and may ultimately reduce the burden of diseases. Paradoxically, localities where such models could yield the greatest benefits, such as tropical regions where morbidity and mortality caused by vector-borne diseases is greatest, often lack high-quality in situ local meteorological data. Satellite- and model-based gridded climate datasets can be used to approximate local meteorological conditions in data-sparse regions, however their accuracy varies. Here we investigate how the selection of a particular dataset can influence the outcomes of disease forecasting models. Our model system focuses on plague (Yersinia pestis infection) in the West Nile region of Uganda. The majority of recent human cases have been reported from East Africa and Madagascar, where meteorological observations are sparse and topography yields complex weather patterns. Using an ensemble of meteorological datasets and model-averaging techniques we find that the number of suspected cases in the West Nile region was negatively associated with dry season rainfall (December-February) and positively with rainfall prior to the plague season. We demonstrate that ensembles of available meteorological datasets can be used to quantify climatic uncertainty and minimize its impacts on infectious disease models. These methods are particularly valuable in regions with sparse observational networks and high morbidity and mortality from vector-borne diseases. PMID:23024750

  13. Disaggregating Tropical Disease Prevalence by Climatic and Vegetative Zones within Tropical West Africa

    Science.gov (United States)

    Beckley, Carl S.; Shaban, Salisu; Palmer, Guy H.; Hudak, Andrew T.; Noh, Susan M.; Futse, James E.

    2016-01-01

    Tropical infectious disease prevalence is dependent on many socio-cultural determinants. However, rainfall and temperature frequently underlie overall prevalence, particularly for vector-borne diseases. As a result these diseases have increased prevalence in tropical as compared to temperate regions. Specific to tropical Africa, the tendency to incorrectly infer that tropical diseases are uniformly prevalent has been partially overcome with solid epidemiologic data. This finer resolution data is important in multiple contexts, including understanding risk, predictive value in disease diagnosis, and population immunity. We hypothesized that within the context of a tropical climate, vector-borne pathogen prevalence would significantly differ according to zonal differences in rainfall, temperature, relative humidity and vegetation condition. We then determined if these environmental data were predictive of pathogen prevalence. First we determined the prevalence of three major pathogens of cattle, Anaplasma marginale, Babesia bigemina and Theileria spp, in the three vegetation zones where cattle are predominantly raised in Ghana: Guinea savannah, semi-deciduous forest, and coastal savannah. The prevalence of A. marginale was 63%, 26% for Theileria spp and 2% for B. bigemina. A. marginale and Theileria spp. were significantly more prevalent in the coastal savannah as compared to either the Guinea savanna or the semi-deciduous forest, supporting acceptance of the first hypothesis. To test the predictive power of environmental variables, the data over a three year period were considered in best subsets multiple linear regression models predicting prevalence of each pathogen. Corrected Akaike Information Criteria (AICc) were assigned to the alternative models to compare their utility. Competitive models for each response were averaged using AICc weights. Rainfall was most predictive of pathogen prevalence, and EVI also contributed to A. marginale and B. bigemina prevalence

  14. Improvement of disease prediction and modeling through the use of meteorological ensembles: human plague in Uganda.

    Directory of Open Access Journals (Sweden)

    Sean M Moore

    Full Text Available Climate and weather influence the occurrence, distribution, and incidence of infectious diseases, particularly those caused by vector-borne or zoonotic pathogens. Thus, models based on meteorological data have helped predict when and where human cases are most likely to occur. Such knowledge aids in targeting limited prevention and control resources and may ultimately reduce the burden of diseases. Paradoxically, localities where such models could yield the greatest benefits, such as tropical regions where morbidity and mortality caused by vector-borne diseases is greatest, often lack high-quality in situ local meteorological data. Satellite- and model-based gridded climate datasets can be used to approximate local meteorological conditions in data-sparse regions, however their accuracy varies. Here we investigate how the selection of a particular dataset can influence the outcomes of disease forecasting models. Our model system focuses on plague (Yersinia pestis infection in the West Nile region of Uganda. The majority of recent human cases have been reported from East Africa and Madagascar, where meteorological observations are sparse and topography yields complex weather patterns. Using an ensemble of meteorological datasets and model-averaging techniques we find that the number of suspected cases in the West Nile region was negatively associated with dry season rainfall (December-February and positively with rainfall prior to the plague season. We demonstrate that ensembles of available meteorological datasets can be used to quantify climatic uncertainty and minimize its impacts on infectious disease models. These methods are particularly valuable in regions with sparse observational networks and high morbidity and mortality from vector-borne diseases.

  15. Disaggregating Tropical Disease Prevalence by Climatic and Vegetative Zones within Tropical West Africa.

    Directory of Open Access Journals (Sweden)

    Carl S Beckley

    Full Text Available Tropical infectious disease prevalence is dependent on many socio-cultural determinants. However, rainfall and temperature frequently underlie overall prevalence, particularly for vector-borne diseases. As a result these diseases have increased prevalence in tropical as compared to temperate regions. Specific to tropical Africa, the tendency to incorrectly infer that tropical diseases are uniformly prevalent has been partially overcome with solid epidemiologic data. This finer resolution data is important in multiple contexts, including understanding risk, predictive value in disease diagnosis, and population immunity. We hypothesized that within the context of a tropical climate, vector-borne pathogen prevalence would significantly differ according to zonal differences in rainfall, temperature, relative humidity and vegetation condition. We then determined if these environmental data were predictive of pathogen prevalence. First we determined the prevalence of three major pathogens of cattle, Anaplasma marginale, Babesia bigemina and Theileria spp, in the three vegetation zones where cattle are predominantly raised in Ghana: Guinea savannah, semi-deciduous forest, and coastal savannah. The prevalence of A. marginale was 63%, 26% for Theileria spp and 2% for B. bigemina. A. marginale and Theileria spp. were significantly more prevalent in the coastal savannah as compared to either the Guinea savanna or the semi-deciduous forest, supporting acceptance of the first hypothesis. To test the predictive power of environmental variables, the data over a three year period were considered in best subsets multiple linear regression models predicting prevalence of each pathogen. Corrected Akaike Information Criteria (AICc were assigned to the alternative models to compare their utility. Competitive models for each response were averaged using AICc weights. Rainfall was most predictive of pathogen prevalence, and EVI also contributed to A. marginale and B

  16. Detection of the prototype of a potential novel genus in the family Papillomaviridae in association with canine epidermodysplasia verruciformis

    OpenAIRE

    Tobler, K.; Favrot, C; Nespeca, G; Ackermann, M.

    2006-01-01

    Epidermodysplasia verruciformis (EV) is a rare human genetic predisposition to develop flat warts, some of which subsequently undergo cancer transformation. Some human papillomaviruses (HPVs), i.e. HPV 5 and 8, have been associated with cancer development as a sequela of EV. As similar diseases have been observed in dogs, it was hypothesized that unknown canine papillomaviruses (CPVs) may exist and that they may be present in cases of canine EV. Consequently, DNA was extracted from a ma...

  17. Thai generic-brand dry canine foods: mutagenicity and the effects of feeding in vivo and in vitro

    OpenAIRE

    Khuntamoon, Tanyalak; Thepouyporn, Apanchanid; Kaewprasert, Sarunya; Prangthip, Pattaneeya; Pooudoung, Somchai; Chaisri, Urai; Maneesai, Phudit; Kwanbunjan, Karunee

    2016-01-01

    Background The commercial pet-food industry and the market value of the pet industry have increased. Most owners are concerned about their pets’ health, and prefer commercial pet foods as their regular diet. This study thus aimed to determine whether a selection of local generic-brand dry canine foods had any potential to promote chronic disease. Methods Five local, generic-brand, dry canine foods were studied for potential mutagenicity; the effects of long-term consumption were also observed...

  18. Complete Genome Sequence of an H3N2 Canine Influenza Virus from Dogs in Jiangsu, China

    OpenAIRE

    Lin, Yan; Zhao, Yan-bing; Zeng, Xu-Jian; Lu, Cheng-Ping; Liu, Yong-jie

    2012-01-01

    A canine influenza virus (CIV) strain of avian origin designated A/Canine/Jiangsu/06/2010 (H3N2) was isolated from dogs exhibiting severe respiratory disease in Jiangsu, China. We announce the complete genome sequence of this viral strain and report major findings from the genomic analysis. This sequence will help us understand the molecular characteristics and evolutionary of H3N2 CIV in China.

  19. Canine and feline megaesophagus

    International Nuclear Information System (INIS)

    Megaesophagus is rare in cats and occurs as a congenital or secondary acquired disorder. In dogs, megaesophagus can occur as a congenital disorder, as a secondary acquired disorder, or as an adult-onset idiopathic disease. This article reviews the anatomy, pathogenesis, causes, clinical signs, diagnosis, and management of megaesophagus. Pathogenesis includes experimental evidence that evaluates the neural pathway of affected patients. The many disease that can cause megaesophagus are delineated. Discussion focuses on the most common causes-myasthenia gravis, hypoadrenocorticism and possibly hypothyroidism, and the obstructive lesions of the esophagus (vascular ring anomalies, tumors, granulomas, strictures, and foreign bodies). The most common clinical sign associated with megaesophagus is regurgitation. Traditional as well as newer techniques (i.e., manometry and nuclear scintigraphy) for evaluating esophageal motility are presented. Definitive diagnosis requires identification of a dilated esophagus on survey thoracic radiographs or a barium esophagogram. Medical management, including alternative feeding methods and the role of prokinetic drugs, is discussed

  20. 9 CFR 113.306 - Canine Distemper Vaccine.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of...