WorldWideScience

Sample records for canine vector-borne diseases

  1. Canine vector-borne diseases in Brazil

    Science.gov (United States)

    Dantas-Torres, Filipe

    2008-01-01

    Canine vector-borne diseases (CVBDs) are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi), bacteria (e.g., Anaplasma platys and Ehrlichia canis), and helminths (e.g., Dirofilaria immitis and Dipylidium caninum) that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance) of CVBDs in Brazil and discusses research gaps to be addressed in future studies. PMID:18691408

  2. Canine vector-borne diseases in Brazil

    Directory of Open Access Journals (Sweden)

    Dantas-Torres Filipe

    2008-08-01

    Full Text Available Abstract Canine vector-borne diseases (CVBDs are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi, bacteria (e.g., Anaplasma platys and Ehrlichia canis, and helminths (e.g., Dirofilaria immitis and Dipylidium caninum that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance of CVBDs in Brazil and discusses research gaps to be addressed in future studies.

  3. Canine and feline vector-borne diseases in Italy: current situation and perspectives

    Directory of Open Access Journals (Sweden)

    Dantas-Torres Filipe

    2010-01-01

    Full Text Available Abstract In Italy, dogs and cats are at risk of becoming infected by different vector-borne pathogens, including protozoa, bacteria, and helminths. Ticks, fleas, phlebotomine sand flies, and mosquitoes are recognized vectors of pathogens affecting cats and dogs, some of which (e.g., Anaplasma phagocytophilum, Borrelia burgdorferi, Dipylidium caninum, Leishmania infantum, Dirofilaria immitis, and Dirofilaria repens are of zoonotic concern. Recent studies have highlighted the potential of fleas as vectors of pathogens of zoonotic relevance (e.g., Rickettsia felis in this country. While some arthropod vectors (e.g., ticks and fleas are present in certain Italian regions throughout the year, others (e.g., phlebotomine sand flies are most active during the summer season. Accordingly, control strategies, such as those relying on the systematic use of acaricides and insecticides, should be planned on the basis of the ecology of both vectors and pathogens in different geographical areas in order to improve their effectiveness in reducing the risk of infection by vector-borne pathogens. This article reviews the current situation and perspectives of canine and feline vector-borne diseases in Italy.

  4. Vector borne diseases

    OpenAIRE

    Melillo Fenech, Tanya

    2010-01-01

    A vector-borne disease is one in which the pathogenic microorganism is transmitted from an infected individual to another individual by an arthropod or other agent. The transmission depends upon the attributes and requirements of at least three different Iiving organisms : the pathologic agent which is either a virus, protozoa, bacteria or helminth (worm); the vector, which is commonly an arthropod such as ticks or mosquitoes; and the human host.

  5. Vector-borne diseases

    DEFF Research Database (Denmark)

    More, Simon J.; Bicout, Dominique; Bøtner, Anette

    2017-01-01

    After a request from the Europea n Commission, EFSA’s Panel on Animal Health and Welfaresummarised the main characteristics of 36 vector-borne disease s (VBDs) in 36 web-based storymaps.The risk of introduction in the EU through movement of livestock or pets was assessed for eac h of the36 VBDs......-agents for which the rate of introduction wasestimated to be very low, no further asse ssments were made. Due to the uncertainty related to someparameters used for the risk assessment or the instable or unpredictability disease situation in some ofthe source regions, it is recommended to update the assessment when...

  6. [Climate change - a pioneer for the expansion of canine vector-borne diseases?].

    Science.gov (United States)

    Krämer, F; Mencke, N

    2011-01-01

    Vector-transmitted diseases are one of the major contributors to the global burden of disease in humans and animals. Climate change is consistently held responsible for the spread of parasitic acarid and insect vectors such as ticks, fleas, sand flies and mosquitoes, and their transmitted pathogens (in the case of the dog the so-called canine vector-borne diseases [CVBD]). Currently, there is only insufficient data available to prove whether climate change is a major driving force for vector and disease expansion, but the evidence is growing. Other reasons, such as ecological, demographic and socio-economic factors, e.g. pet travel into and pet import from endemic areas, also play a role in this development. Apart from all the controversial discussion of the factors leading to vector and disease expansion, preventative measures should include dog owners' education as they are responsible for individual parasite protection as well as for the minimisation of adverse risk behaviour, e.g. regarding pet travel. Broad-spectrum vector control should be practised by using parasiticides that repel and kill blood feeders in order to minimize the risk of CVBD-pathogen transmission.

  7. Canine vector-borne diseases in India: a review of the literature and identification of existing knowledge gaps

    Directory of Open Access Journals (Sweden)

    Coleman Glen T

    2010-04-01

    Full Text Available Abstract Despite the combination of favourable climate for parasites and vectors, and large populations of stray dogs, information concerning the epidemiology, diagnosis and management of canine vector-borne diseases in India is limited. However, with the country's expanding economy and adaptation to western culture, higher expectations and demands are being placed on veterinary surgeons for improved knowledge of diseases and control. This review aims to provide an overview of the current state of knowledge of these diseases in India and identify existing knowledge gaps in the literature which need to be addressed. The available literature on this subject, although limited, suggests that a number of canine vector-borne diseases such as filariasis, babesiosis and ehrlichiosis are endemic throughout India, as diagnosed mostly by morphological methods. Detailed investigations of the epidemiology and zoonotic potential of these pathogens has been neglected. Further study is essential to develop a better understanding of the diversity of canine vector-borne diseases in India, and their significance for veterinary and public health.

  8. Emerging Vector-Borne Diseases.

    Science.gov (United States)

    Huntington, Mark K; Allison, Jay; Nair, Dilip

    2016-10-01

    Several mosquito-borne viral infections have recently emerged in North America; West Nile virus is the most common in the United States. Although West Nile virus generally causes a self-limited, flulike febrile illness, a serious neuroinvasive form may occur. Dengue is the most common vector-borne viral disease worldwide, and it has been a significant public health threat in the United States since 2009. Known as breakbone fever for its severe myalgias and arthralgias, dengue may cause a hemorrhagic syndrome. Chikungunya also causes flulike febrile illness and disabling arthralgias. Although meningoencephalitis may occur with chikungunya, bleeding is uncommon. Symptoms of Zika virus infection are similar to those of dengue, but milder. Zika virus increases the risk of fetal brain abnormalities, including microcephaly, if a pregnant woman is infected. Zika virus is spread through Aedes albopictus mosquito bites, is transmitted sexually, and may rarely spread nonsexually from person to person. Diagnosis of these vectorborne infections is clinical and serologic, and treatment is supportive. Other, well-established vector-borne diseases are also important. Ehrlichiosis is a tick-borne bacterial disease that presents as a nonspecific syndrome of fever, headache, malaise, and myalgias. It is diagnosed via blood smear testing, with confirmatory serology. Ehrlichiosis is treated with doxycycline. Rickettsial infections are transmitted by fleas, mites, and ticks, and severity ranges from mild to life threatening. Rocky Mountain spotted fever, the most significant rickettsial infection, is primarily a clinical diagnosis that presents as fever, headache, myalgias, petechial rash, and tick exposure. Doxycycline is effective for rickettsial infections if administered promptly. Vector avoidance strategies are critical to the prevention of all of these infections.

  9. [Conflicts and vector-borne diseases

    DEFF Research Database (Denmark)

    Bygbjerg, Ib Christian

    2010-01-01

    Based on literature and personal experiences, vector-borne diseases and conflicts are reviewed. Simple rapid diagnostic tests for three important parasitoses are available. Resort is often made to case definitions and to presumptive treatment. Resistance is an emerging problem. Vaccines are still...... not available for most diseases. Promising preventive methods, including long-lasting impregnated bed-nets and tents, are available. War has been an impetus for disclosing life-cycles of vector-borne diseases and for control methods; peace, reconciliation and poverty reduction are required to achieve lasting...

  10. Emerging vector borne diseases – incidence through vectors

    Directory of Open Access Journals (Sweden)

    Sara eSavic

    2014-12-01

    Full Text Available Vector borne diseases use to be a major public health concern only in tropical and subtropical areas, but today they are an emerging threat for the continental and developed countries also. Nowdays, in intercontinetal countries, there is a struggle with emerging diseases which have found their way to appear through vectors. Vector borne zoonotic diseases occur when vectors, animal hosts, climate conditions, pathogens and susceptible human population exist at the same time, at the same place. Global climate change is predicted to lead to an increase in vector borne infectious diseases and disease outbreaks. It could affect the range and popultion of pathogens, host and vectors, transmission season, etc. Reliable surveilance for diseases that are most likely to emerge is required. Canine vector borne diseases represent a complex group of diseases including anaplasmosis, babesiosis, bartonellosis, borreliosis, dirofilariosis, erlichiosis, leishmaniosis. Some of these diseases cause serious clinical symptoms in dogs and some of them have a zoonotic potential with an effect to public health. It is expected from veterinarians in coordination with medical doctors to play a fudamental role at primeraly prevention and then treatment of vector borne diseases in dogs. The One Health concept has to be integrated into the struggle against emerging diseases.During a four year period, from 2009-2013, a total number of 551 dog samples were analysed for vector borne diseases (borreliosis, babesiosis, erlichiosis, anaplasmosis, dirofilariosis and leishmaniasis in routine laboratory work. The analysis were done by serological tests – ELISA for borreliosis, dirofilariosis and leishmaniasis, modified Knott test for dirofilariosis and blood smear for babesiosis, erlichiosis and anaplasmosis. This number of samples represented 75% of total number of samples that were sent for analysis for different diseases in dogs. Annually, on avarege more then half of the samples

  11. [Conflicts and vector-borne diseases

    DEFF Research Database (Denmark)

    Bygbjerg, Ib Christian

    2010-01-01

    Based on literature and personal experiences, vector-borne diseases and conflicts are reviewed. Simple rapid diagnostic tests for three important parasitoses are available. Resort is often made to case definitions and to presumptive treatment. Resistance is an emerging problem. Vaccines are still...

  12. [Climate- and vector-borne diseases

    DEFF Research Database (Denmark)

    Bygbjerg, I.C.; Schioler, K.L.; Konradsen, F.

    2009-01-01

    The predicted changes in climate have raised concerns that vector-borne diseases may emerge or expand in tempered regions. Malaria, leishmaniasis and tick-borne illnesses are discussed in terms of climate change and their endemic potential, especially in Denmark. While climate may play an important...

  13. Emerging Vector-Borne Diseases - Incidence through Vectors.

    Science.gov (United States)

    Savić, Sara; Vidić, Branka; Grgić, Zivoslav; Potkonjak, Aleksandar; Spasojevic, Ljubica

    2014-01-01

    Vector-borne diseases use to be a major public health concern only in tropical and subtropical areas, but today they are an emerging threat for the continental and developed countries also. Nowadays, in intercontinental countries, there is a struggle with emerging diseases, which have found their way to appear through vectors. Vector-borne zoonotic diseases occur when vectors, animal hosts, climate conditions, pathogens, and susceptible human population exist at the same time, at the same place. Global climate change is predicted to lead to an increase in vector-borne infectious diseases and disease outbreaks. It could affect the range and population of pathogens, host and vectors, transmission season, etc. Reliable surveillance for diseases that are most likely to emerge is required. Canine vector-borne diseases represent a complex group of diseases including anaplasmosis, babesiosis, bartonellosis, borreliosis, dirofilariosis, ehrlichiosis, and leishmaniosis. Some of these diseases cause serious clinical symptoms in dogs and some of them have a zoonotic potential with an effect to public health. It is expected from veterinarians in coordination with medical doctors to play a fundamental role at primarily prevention and then treatment of vector-borne diseases in dogs. The One Health concept has to be integrated into the struggle against emerging diseases. During a 4-year period, from 2009 to 2013, a total number of 551 dog samples were analyzed for vector-borne diseases (borreliosis, babesiosis, ehrlichiosis, anaplasmosis, dirofilariosis, and leishmaniasis) in routine laboratory work. The analysis was done by serological tests - ELISA for borreliosis, dirofilariosis, and leishmaniasis, modified Knott test for dirofilariosis, and blood smear for babesiosis, ehrlichiosis, and anaplasmosis. This number of samples represented 75% of total number of samples that were sent for analysis for different diseases in dogs. Annually, on average more then half of the samples

  14. [Climate- and vector-borne diseases

    DEFF Research Database (Denmark)

    Bygbjerg, I.C.; Schioler, K.L.; Konradsen, F.

    2009-01-01

    The predicted changes in climate have raised concerns that vector-borne diseases may emerge or expand in tempered regions. Malaria, leishmaniasis and tick-borne illnesses are discussed in terms of climate change and their endemic potential, especially in Denmark. While climate may play an important...... role in disease patterns, it is evident that transmission potential is governed by a complex of factors, including socio-economy, health-care capacity and ecology. In Denmark, malaria and leishmaniasis are unlikely to become public health problems, whereas the potential for tick-borne illnesses may...

  15. Risk based surveillance for vector borne diseases

    DEFF Research Database (Denmark)

    Bødker, Rene

    of samples and hence early detection of outbreaks. Models for vector borne diseases in Denmark have demonstrated dramatic variation in outbreak risk during the season and between years. The Danish VetMap project aims to make these risk based surveillance estimates available on the veterinarians smart phones...... in Northern Europe. This model approach may be used as a basis for risk based surveillance. In risk based surveillance limited resources for surveillance are targeted at geographical areas most at risk and only when the risk is high. This makes risk based surveillance a cost effective alternative...... sample to a diagnostic laboratory. Risk based surveillance models may reduce this delay. An important feature of risk based surveillance models is their ability to continuously communicate the level of risk to veterinarians and hence increase awareness when risk is high. This is essential for submission...

  16. Survey of spatial distribution of vector-borne disease in ...

    African Journals Online (AJOL)

    Neighborhood dogs may act as reservoirs and disseminators of vector-borne diseases in urban areas. Accordingly, the aim of this study was to ascertain the health status and the vector-borne pathogens infecting dogs living in public areas with high levels of human movement in the city of Curitiba, southern Brazil.

  17. Air travel and vector-borne disease movement.

    Science.gov (United States)

    Tatem, A J; Huang, Z; Das, A; Qi, Q; Roth, J; Qiu, Y

    2012-12-01

    Recent decades have seen substantial expansions in the global air travel network and rapid increases in traffic volumes. The effects of this are well studied in terms of the spread of directly transmitted infections, but the role of air travel in the movement of vector-borne diseases is less well understood. Increasingly however, wider reaching surveillance for vector-borne diseases and our improving abilities to map the distributions of vectors and the diseases they carry, are providing opportunities to better our understanding of the impact of increasing air travel. Here we examine global trends in the continued expansion of air transport and its impact upon epidemiology. Novel malaria and chikungunya examples are presented, detailing how geospatial data in combination with information on air traffic can be used to predict the risks of vector-borne disease importation and establishment. Finally, we describe the development of an online tool, the Vector-Borne Disease Airline Importation Risk (VBD-Air) tool, which brings together spatial data on air traffic and vector-borne disease distributions to quantify the seasonally changing risks for importation to non-endemic regions. Such a framework provides the first steps towards an ultimate goal of adaptive management based on near real time flight data and vector-borne disease surveillance.

  18. Canine babesiosis in northern Portugal and molecular characterization of vector-borne co-infections

    Science.gov (United States)

    2010-01-01

    Background Protozoa and bacteria transmitted by arthropods, including ticks and phlebotomine sand flies, may cause a wide range of canine vector-borne diseases. Dogs can be simultaneously or sequentially infected with multiple pathogens. Canine babesiosis caused by Babesia canis canis and Babesia canis vogeli is known to occur in Portugal. This study assessed, by means of blood smear examination, PCR and DNA nucleotide sequencing, the presence of Babesia spp. and co-infecting agents Leishmania, Anaplasma/Ehrlichia and Hepatozoon in 45 dogs from northern Portugal clinically suspected of babesiosis. Results Forty-four dogs (98%) had infection with B. canis canis and one with B. canis vogeli. Co-infections were detected in nine animals (20%). Eight dogs were found infected with two vector-borne agents: six with B. canis canis and Leishmania infantum; one with B. canis canis and Ehrlichia canis; and one with B. canis canis and Hepatozoon canis. Another dog was infected with three vector-borne pathogens: B. canis vogeli, E. canis and L. infantum. Overall, L. infantum was found in seven (16%), E. canis in two (4%), and H. canis in one (2%) out of the 45 dogs with babesiosis. Almost 90% of the 45 cases of canine babesiosis were diagnosed in the colder months of October (18%), November (27%), December (20%), February (13%) and March (9%). Co-infections were detected in February, March, April, May, October and November. Twenty-two (50%) out of 44 dogs infected with B. canis were found infested by ticks including Dermacentor spp., Ixodes spp. and Rhipicephalus sanguineus. Mortality (9%) included two co-infected dogs that died spontaneously and two with single infections that were euthanized. Conclusions Babesia canis canis is the main etiological agent of canine babesiosis in northern Portugal. A higher sensitivity of Babesia spp. detection was obtained with PCR assays, compared to the observation of blood smears. Twenty percent of the dogs were co-infected with L. infantum

  19. Canine babesiosis in northern Portugal and molecular characterization of vector-borne co-infections

    Directory of Open Access Journals (Sweden)

    Machado João

    2010-04-01

    Full Text Available Abstract Background Protozoa and bacteria transmitted by arthropods, including ticks and phlebotomine sand flies, may cause a wide range of canine vector-borne diseases. Dogs can be simultaneously or sequentially infected with multiple pathogens. Canine babesiosis caused by Babesia canis canis and Babesia canis vogeli is known to occur in Portugal. This study assessed, by means of blood smear examination, PCR and DNA nucleotide sequencing, the presence of Babesia spp. and co-infecting agents Leishmania, Anaplasma/Ehrlichia and Hepatozoon in 45 dogs from northern Portugal clinically suspected of babesiosis. Results Forty-four dogs (98% had infection with B. canis canis and one with B. canis vogeli. Co-infections were detected in nine animals (20%. Eight dogs were found infected with two vector-borne agents: six with B. canis canis and Leishmania infantum; one with B. canis canis and Ehrlichia canis; and one with B. canis canis and Hepatozoon canis. Another dog was infected with three vector-borne pathogens: B. canis vogeli, E. canis and L. infantum. Overall, L. infantum was found in seven (16%, E. canis in two (4%, and H. canis in one (2% out of the 45 dogs with babesiosis. Almost 90% of the 45 cases of canine babesiosis were diagnosed in the colder months of October (18%, November (27%, December (20%, February (13% and March (9%. Co-infections were detected in February, March, April, May, October and November. Twenty-two (50% out of 44 dogs infected with B. canis were found infested by ticks including Dermacentor spp., Ixodes spp. and Rhipicephalus sanguineus. Mortality (9% included two co-infected dogs that died spontaneously and two with single infections that were euthanized. Conclusions Babesia canis canis is the main etiological agent of canine babesiosis in northern Portugal. A higher sensitivity of Babesia spp. detection was obtained with PCR assays, compared to the observation of blood smears. Twenty percent of the dogs were co

  20. Eurasian golden jackal as host of canine vector-borne protists.

    Science.gov (United States)

    Mitková, Barbora; Hrazdilová, Kristýna; D'Amico, Gianluca; Duscher, Georg Gerhard; Suchentrunk, Franz; Forejtek, Pavel; Gherman, Călin Mircea; Matei, Ioana Adriana; Ionică, Angela Monica; Daskalaki, Aikaterini Alexandra; Mihalca, Andrei Daniel; Votýpka, Jan; Hulva, Pavel; Modrý, David

    2017-04-14

    Jackals are medium-sized canids from the wolf-like clade, exhibiting a unique combination of ancestral morphotypes, broad trophic niches, and close phylogenetic relationships with the wolf and dog. Thus, they represent a potential host of several pathogens with diverse transmission routes. Recently, populations of the Eurasian golden jackal Canis aureus have expanded into the Western Palaearctic, including most of Europe. The aim of our study was to examine Eurasian golden jackals from Romania, Czech Republic and Austria for a wide spectrum of vector-borne protists and to evaluate the role of this species as a reservoir of disease for domestic dogs and/or humans. Diagnostic polymerase chain reaction (PCR) DNA amplifications revealed 70% of jackals to be positive for Hepatozoon, 12.5% positive for piroplasms, and one individual positive for Leishmania infantum. Phylogenetic analyses of partial 18S rDNA sequences invariably placed sequenced isolates of Hepatozoon into the H. canis clade. For piroplasms, both the 18S and cox1 sequences obtained confirmed the presence of Babesia canis and "Theileria annae" in 5 and 2 individuals, respectively, providing the first records of these two piroplasmids in Eurasian golden jackals. A single animal from Dolj County (Romania) was PCR-positive for L. infantum, as confirmed also by sequencing of ITS1-5.8S. Apparently, expanding populations of jackals can play a significant role in spreading and maintaining new Babesia canis foci in Central Europe. The role of jackals in the epidemiology of "Theileria annae" and H. canis is probably similar to that of red foxes and should be taken into account in further research on these parasites. Also the presence of L. infantum deserves attention. Our study confirms that once established, the populations of Eurasian golden jackals constitute natural reservoirs for many canine vector-borne diseases, analogous to the role of the coyotes in North America.

  1. Urbanization, land tenure security and vector-borne Chagas disease

    Science.gov (United States)

    Levy, Michael Z.; Barbu, Corentin M.; Castillo-Neyra, Ricardo; Quispe-Machaca, Victor R.; Ancca-Juarez, Jenny; Escalante-Mejia, Patricia; Borrini-Mayori, Katty; Niemierko, Malwina; Mabud, Tarub S.; Behrman, Jere R.; Naquira-Velarde, Cesar

    2014-01-01

    Modern cities represent one of the fastest growing ecosystems on the planet. Urbanization occurs in stages; each stage characterized by a distinct habitat that may be more or less susceptible to the establishment of disease vector populations and the transmission of vector-borne pathogens. We performed longitudinal entomological and epidemiological surveys in households along a 1900 × 125 m transect of Arequipa, Peru, a major city of nearly one million inhabitants, in which the transmission of Trypanosoma cruzi, the aetiological agent of Chagas disease, by the insect vector Triatoma infestans, is an ongoing problem. The transect spans a cline of urban development from established communities to land invasions. We find that the vector is tracking the development of the city, and the parasite, in turn, is tracking the dispersal of the vector. New urbanizations are free of vector infestation for decades. T. cruzi transmission is very recent and concentrated in more established communities. The increase in land tenure security during the course of urbanization, if not accompanied by reasonable and enforceable zoning codes, initiates an influx of construction materials, people and animals that creates fertile conditions for epidemics of some vector-borne diseases. PMID:24990681

  2. Vector-borne disease intelligence: strategies to deal with disease burden and threats

    Czech Academy of Sciences Publication Activity Database

    Braks, M.; Medlock, J. M.; Hubálek, Zdeněk; Hjertqvist, M.; Perrin, Y.; Lancelot, R.; Duchyene, E.; Hendrickx, G.; Stroo, A.; Heyman, P.; Sprong, H.

    2014-01-01

    Roč. 2, č. 280 (2014), s. 280 ISSN 2296-2565 Institutional support: RVO:68081766 Keywords : disease burden * emerging diseases * one health * surveillance * threat * vector-borne diseases Subject RIV: EE - Microbiology, Virology

  3. Vector-borne diseases: the basic reproduction number R0 and risk maps

    NARCIS (Netherlands)

    Hartemink, N.A.|info:eu-repo/dai/nl/304836699

    2009-01-01

    This thesis deals with the derivation of the basic reproduction number (R0) for vector-borne diseases, in the context of studying the effect of climate change on the risk of emergence diseases. Vector-borne diseases are transmitted from an infected individual to another individual by vectors,

  4. Assessment of Climate Change and Vector-borne Diseases in the United States

    Science.gov (United States)

    Monaghan, A. J.; Beard, C. B.; Eisen, R. J.; Barker, C. M.; Garofalo, J.; Hahn, M.; Hayden, M.; Ogden, N.; Schramm, P.

    2016-12-01

    Vector-borne diseases are illnesses that are transmitted by vectors, which include mosquitoes, ticks, and fleas. The seasonality, distribution, and prevalence of vector-borne diseases are influenced significantly by climate factors, primarily high and low temperature extremes and precipitation patterns. In this presentation we summarize key findings from Chapter 5 ("Vector-borne Diseases") of the recently published USGCRP Scientific Assessment of the Impacts of Climate Change on Human Health in the United States. Climate change is expected to alter geographic and seasonal distributions of vectors and vector-borne diseases, leading to earlier activity and northward range expansion of ticks capable of carrying the bacteria that cause Lyme disease and other pathogens, and influencing the distribution, abundance and prevalence of infection in mosquitoes that transmit West Nile virus and other pathogens. The emergence or reemergence of vector-borne pathogens is also likely.

  5. Vector-borne disease risk indexes in spatially structured populations.

    Directory of Open Access Journals (Sweden)

    Jorge Velázquez-Castro

    2018-02-01

    Full Text Available There are economic and physical limitations when applying prevention and control strategies for urban vector borne diseases. Consequently, there are increasing concerns and interest in designing efficient strategies and regulations that health agencies can follow in order to reduce the imminent impact of viruses like Dengue, Zika and Chikungunya. That includes fumigation, abatization, reducing the hatcheries, picking up trash, information campaigns. A basic question that arise when designing control strategies is about which and where these ones should focus. In other words, one would like to know whether preventing the contagion or decrease vector population, and in which area of the city, is more efficient. In this work, we propose risk indexes based on the idea of secondary cases from patch to patch. Thus, they take into account human mobility and indicate which patch has more chance to be a corridor for the spread of the disease and which is more vulnerable, i.e. more likely to have cases?. They can also indicate the neighborhood where hatchery control will reduce more the number of potential cases. In order to illustrate the usefulness of these indexes, we run a set of numerical simulations in a mathematical model that takes into account the urban mobility and the differences in population density among the areas of a city. If we label by i a particular neighborhood, the transmission risk index (TRi measures the potential secondary cases caused by a host in that neighborhood. The vector transmission risk index (VTRi measures the potential secondary cases caused by a vector. Finally, the vulnerability risk index (VRi measures the potential secondary cases in the neighborhood. Transmission indexes can be used to give geographical priority to some neighborhoods when applying prevention and control measures. On the other hand, the vulnerability index can be useful to implement monitoring campaigns or public health investment.

  6. Vector-borne disease intelligence: Strategies to deal with disease burden and threats

    Directory of Open Access Journals (Sweden)

    Marieta eBraks

    2014-12-01

    Full Text Available Owing to the complex nature of vector-borne diseases, whereby monitoring of human case patients does not suffice, public health authorities experience challenges in surveillance and control of vector-borne diseases. Knowledge on the presence and distribution of vectors and the pathogens they transmit is vital to a risk assessment process to permit effective early warning, surveillance and control of vector-borne diseases. Upon accepting this reality, public health authorities face the phenomenon of an exponential rise in the number of possible surveillance targets and how to decide which are essential. Here, . we propose a comprehensive approach that integrates three surveillance strategies: population-based surveillance, disease-based surveillance and context-based surveillance for EU member states to tailor the best surveillance strategy for control of vector-borne diseases in their geographic region. By classifying the surveillance structure into 5 different contexts, we hope to provide guidance in optimizing surveillance efforts. Contextual surveillance strategies for vector-borne diseases entail combining organization and data collection approaches that result in disease intelligence rather than a preset static structure.

  7. Climate change and vector-borne diseases of public health significance.

    Science.gov (United States)

    Ogden, Nicholas H

    2017-10-16

    There has been much debate as to whether or not climate change will have, or has had, any significant effect on risk from vector-borne diseases. The debate on the former has focused on the degree to which occurrence and levels of risk of vector-borne diseases are determined by climate-dependent or independent factors, while the debate on the latter has focused on whether changes in disease incidence are due to climate at all, and/or are attributable to recent climate change. Here I review possible effects of climate change on vector-borne diseases, methods used to predict these effects and the evidence to date of changes in vector-borne disease risks that can be attributed to recent climate change. Predictions have both over- and underestimated the effects of climate change. Mostly under-estimations of effects are due to a focus only on direct effects of climate on disease ecology while more distal effects on society's capacity to control and prevent vector-borne disease are ignored. There is increasing evidence for possible impacts of recent climate change on some vector-borne diseases but for the most part, observed data series are too short (or non-existent), and impacts of climate-independent factors too great, to confidently attribute changing risk to climate change. © Crown copyright 2017.

  8. Gray wolf exposure to emerging vector-borne diseases in Wisconsin with comparison to domestic dogs and humans

    Science.gov (United States)

    Jara, Rocio F.; Wydeven, Adrian P.; Samuel, Michael D.

    2016-01-01

    World-wide concern over emerging vector-borne diseases has increased in recent years for both animal and human health. In the United Sates, concern about vector-borne diseases in canines has focused on Lyme disease, anaplasmosis, ehrlichiosis, and heartworm which infect domestic and wild canids. Of these diseases, Lyme and anaplasmosis are also frequently diagnosed in humans. Gray wolves (Canis lupus) recolonized Wisconsin in the 1970s, and we evaluated their temporal and geographic patterns of exposure to these four vector-borne diseases in Wisconsin as the population expanded between 1985 and 2011. A high proportion of the Wisconsin wolves were exposed to the agents that cause Lyme (65.6%) and anaplasma (47.7%), and a smaller proportion to ehrlichiosis (5.7%) and infected with heartworm (9.2%). Wolf exposure to tick borne diseases was consistently higher in older animals. Wolf exposure was markedly higher than domestic dog (Canis familiaris) exposure for all 4 disease agents during 2001–2013. We found a cluster of wolf exposure to Borrelia burgdorferi in northwestern Wisconsin, which overlaps human and domestic dog clusters for the same pathogen. In addition, wolf exposure to Lyme disease in Wisconsin has increased, corresponding with the increasing human incidence of Lyme disease in a similar time period. Despite generally high prevalence of exposure none of these diseases appear to have slowed the growth of the Wisconsin wolf population.

  9. Gray Wolf Exposure to Emerging Vector-Borne Diseases in Wisconsin with Comparison to Domestic Dogs and Humans.

    Directory of Open Access Journals (Sweden)

    Rocio F Jara

    Full Text Available World-wide concern over emerging vector-borne diseases has increased in recent years for both animal and human health. In the United Sates, concern about vector-borne diseases in canines has focused on Lyme disease, anaplasmosis, ehrlichiosis, and heartworm which infect domestic and wild canids. Of these diseases, Lyme and anaplasmosis are also frequently diagnosed in humans. Gray wolves (Canis lupus recolonized Wisconsin in the 1970s, and we evaluated their temporal and geographic patterns of exposure to these four vector-borne diseases in Wisconsin as the population expanded between 1985 and 2011. A high proportion of the Wisconsin wolves were exposed to the agents that cause Lyme (65.6% and anaplasma (47.7%, and a smaller proportion to ehrlichiosis (5.7% and infected with heartworm (9.2%. Wolf exposure to tick borne diseases was consistently higher in older animals. Wolf exposure was markedly higher than domestic dog (Canis familiaris exposure for all 4 disease agents during 2001-2013. We found a cluster of wolf exposure to Borrelia burgdorferi in northwestern Wisconsin, which overlaps human and domestic dog clusters for the same pathogen. In addition, wolf exposure to Lyme disease in Wisconsin has increased, corresponding with the increasing human incidence of Lyme disease in a similar time period. Despite generally high prevalence of exposure none of these diseases appear to have slowed the growth of the Wisconsin wolf population.

  10. Web-based GIS: the vector-borne disease airline importation risk (VBD-AIR) tool.

    Science.gov (United States)

    Huang, Zhuojie; Das, Anirrudha; Qiu, Youliang; Tatem, Andrew J

    2012-08-14

    Over the past century, the size and complexity of the air travel network has increased dramatically. Nowadays, there are 29.6 million scheduled flights per year and around 2.7 billion passengers are transported annually. The rapid expansion of the network increasingly connects regions of endemic vector-borne disease with the rest of the world, resulting in challenges to health systems worldwide in terms of vector-borne pathogen importation and disease vector invasion events. Here we describe the development of a user-friendly Web-based GIS tool: the Vector-Borne Disease Airline Importation Risk Tool (VBD-AIR), to help better define the roles of airports and airlines in the transmission and spread of vector-borne diseases. Spatial datasets on modeled global disease and vector distributions, as well as climatic and air network traffic data were assembled. These were combined to derive relative risk metrics via air travel for imported infections, imported vectors and onward transmission, and incorporated into a three-tier server architecture in a Model-View-Controller framework with distributed GIS components. A user-friendly web-portal was built that enables dynamic querying of the spatial databases to provide relevant information. The VBD-AIR tool constructed enables the user to explore the interrelationships among modeled global distributions of vector-borne infectious diseases (malaria. dengue, yellow fever and chikungunya) and international air service routes to quantify seasonally changing risks of vector and vector-borne disease importation and spread by air travel, forming an evidence base to help plan mitigation strategies. The VBD-AIR tool is available at http://www.vbd-air.com. VBD-AIR supports a data flow that generates analytical results from disparate but complementary datasets into an organized cartographical presentation on a web map for the assessment of vector-borne disease movements on the air travel network. The framework built provides a flexible

  11. Drivers for the emergence and re-emergence of vector-borne protozoal and bacterial diseases.

    Science.gov (United States)

    Harrus, S; Baneth, G

    2005-10-01

    In recent years, vector-borne parasitic and bacterial diseases have emerged or re-emerged in many geographical regions causing global health and economic problems that involve humans, livestock, companion animals and wild life. The ecology and epidemiology of vector-borne diseases are affected by the interrelations between three major factors comprising the pathogen, the host (human, animal or vector) and the environment. Important drivers for the emergence and spread of vector-borne parasites include habitat changes, alterations in water storage and irrigation habits, atmospheric and climate changes, immunosuppression by HIV, pollution, development of insecticide and drug resistance, globalization and the significant increase in international trade, tourism and travel. War and civil unrest, and governmental or global management failure are also major contributors to the spread of infectious diseases. The improvement of epidemic understanding and planning together with the development of new diagnostic molecular techniques in the last few decades have allowed researchers to better diagnose and trace pathogens, their origin and routes of infection, and to develop preventive public health and intervention programs. Health care workers, physicians, veterinarians and biosecurity officers should play a key role in future prevention of vector-borne diseases. A coordinated global approach for the prevention of vector-borne diseases should be implemented by international organizations and governmental agencies in collaboration with research institutions.

  12. Spatial analysis of vector-borne infectious diseases and ecological indicators using GIS and remote sensing

    Science.gov (United States)

    Anh, N. K.; Liou, Y. A.

    2017-12-01

    Ecological and climate indicators play a vital role in defining patterns of human activities and behaviors, such as seasonal features, migration, winter-summer lifestyles, which in turn might be associated with vector-borne disease habitats and transmission risks. Remote sensing has been instrumental in deriving environmental variables and indicators. GIS is shown to be a powerful tool in spatiotemporal visualization and distribution of vector-borne diseases and for analysis of associations between environmental conditions and characteristics of vector-borne habitats. Vietnam is in the sub-tropical climate zone with high humidity and abundant precipitation, while the distribution of precipitation is uneven leading to frequently annual occurrence of drought and flood disasters. Moreover, urban heat island effect is significantly enhanced in urbanized areas in recent years. The increase in the frequency and magnitude of severity of weather extremes that are potentially linked to climate change and anthropogenic processes have highlighted the demand of research into health risk assessment and adaptive capacity. This research focuses on the analysis of physical features of environmental indicators and its association with vector-borne diseases as well as adaptive capacity. The study illustrates how remotely sensed data has been utilized in geohealth applications, surveillance, and health risk mapping. In addition, promising possibilities of allowing disease early-warning systems with citizen participation platform will be proposed. Keywords: Vector-borne diseases; environmental indicators; remote sensing; GIS; Vietnam.

  13. Vector-Borne Diseases - constant challenge for practicing veterinarians: recommendations from the CVBD World Forum

    Directory of Open Access Journals (Sweden)

    Baneth Gad

    2012-03-01

    Full Text Available Abstract The human-animal bond has been a fundamental feature of mankind's history for millennia. The first, and strongest of these, man's relationship with the dog, is believed to pre-date even agriculture, going back as far as 30,000 years. It remains at least as powerful today. Fed by the changing nature of the interactions between people and their dogs worldwide and the increasing tendency towards close domesticity, the health of dogs has never played a more important role in family life. Thanks to developments in scientific understanding and diagnostic techniques, as well as changing priorities of pet owners, veterinarians are now able, and indeed expected, to play a fundamental role in the prevention and treatment of canine disease, including canine vector-borne diseases (CVBDs. The CVBDs represent a varied and complex group of diseases, including anaplasmosis, babesiosis, bartonellosis, borreliosis, dirofilariosis, ehrlichiosis, leishmaniosis, rickettsiosis and thelaziosis, with new syndromes being uncovered every year. Many of these diseases can cause serious, even life-threatening clinical conditions in dogs, with a number having zoonotic potential, affecting the human population. Today, CVBDs pose a growing global threat as they continue their spread far from their traditional geographical and temporal restraints as a result of changes in both climatic conditions and pet dog travel patterns, exposing new populations to previously unknown infectious agents and posing unprecedented challenges to veterinarians. In response to this growing threat, the CVBD World Forum, a multidisciplinary group of experts in CVBDs from around the world which meets on an annual basis, gathered in Nice (France in 2011 to share the latest research on CVBDs and discuss the best approaches to managing these diseases around the world. As a result of these discussions, we, the members of the CVBD Forum have developed the following recommendations to veterinarians

  14. Towards a resource-based habitat approach for spatial modelling of vector-borne disease risks

    NARCIS (Netherlands)

    Hartemink, N.; Vanwambeke, S.O.; Purse, B.V.; Gilbert, M.; Van Dyck, H.

    2015-01-01

    Given the veterinary and public health impact of vector-borne diseases, there is a clear need to assess the suitability of landscapes for the emergence and spread of these diseases. Current approaches for predicting disease risks neglect key features of the landscape as components of the functional

  15. Vector-borne diseases and the basic reproduction number: a case study of African horse sickness

    NARCIS (Netherlands)

    Lord, C.C.; Woolhouse, M.E.J.; Heesterbeek, J.A.P.; Mellor, P.S.

    1996-01-01

    The basic reproduction number, R0, can be used to determine factors important in the ability of a disease to invade or persist. We show how this number can be derived or estimated for vector-borne diseases with different complicating factors. African horse sickness is a viral disease transmitted

  16. Transmission scenarios of major vector-borne diseases in Colombia, 1990-2016

    Directory of Open Access Journals (Sweden)

    Julio César Padilla

    2017-03-01

    Conclusions: Persistent epidemic and endemic transmission of vector-borne diseases in urban and rural settings in Colombia was observed mainly in the case of malaria, dengue, leishmaniasis and Chagas disease. Such transmission was focused and had variable intensity patterns. On the other hand, the conditions that have favored the emergence of new arboviruses persist.

  17. Control of vector-borne infectious diseases by human immunity against α-Gal

    Czech Academy of Sciences Publication Activity Database

    Cabezas-Cruz, A.; Valdés, James J.; de la Fuente, J.

    2016-01-01

    Roč. 15, č. 8 (2016), s. 953-955 ISSN 1476-0584 EU Projects: European Commission(XE) 278976 - ANTIGONE Institutional support: RVO:60077344 Keywords : microbiota * probiotics * vaccine * α-Gal * vector-borne diseases Subject RIV: FN - Epidemiology, Contagious Diseases ; Clinical Immunology Impact factor: 3.555, year: 2016

  18. Legal aspects of public health: difficulties in controlling vector-borne and zoonotic diseases in Brazil.

    Science.gov (United States)

    Mendes, Marcílio S; de Moraes, Josué

    2014-11-01

    In recent years, vector-borne and zoonotic diseases have become a major challenge for public health. Dengue fever and leptospirosis are the most important communicable diseases in Brazil based on their prevalence and the healthy life years lost from disability. The primary strategy for preventing human exposure to these diseases is effective insect and rodent control in and around the home. However, health authorities have difficulties in controlling vector-borne and zoonotic diseases because residents often refuse access to their homes. This study discusses aspects related to the activities performed by Brazilian health authorities to combat vector-borne and zoonotic diseases, particularly difficulties in relation to the legal aspect, which often impede the quick and effective actions of these professionals. How might it be possible to reconcile the need to preserve public health and the rule on the inviolability of the home, especially in the case of abandoned properties or illegal residents and the refusal of residents to allow the health authority access? Do residents have the right to hinder the performance of health workers even in the face of a significant and visible focus of disease transmission? This paper argues that a comprehensive legal plan aimed at the control of invasive vector-borne and zoonotic diseases including synanthropic animals of public health importance should be considered. In addition, this paper aims to bridge the gap between lawyers and public health professionals and to facilitate communication between them. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Seven challenges for modelling indirect transmission: Vector-borne diseases, macroparasites and neglected tropical diseases

    Directory of Open Access Journals (Sweden)

    T. Déirdre Hollingsworth

    2015-03-01

    Full Text Available Many of the challenges which face modellers of directly transmitted pathogens also arise when modelling the epidemiology of pathogens with indirect transmission – whether through environmental stages, vectors, intermediate hosts or multiple hosts. In particular, understanding the roles of different hosts, how to measure contact and infection patterns, heterogeneities in contact rates, and the dynamics close to elimination are all relevant challenges, regardless of the mode of transmission. However, there remain a number of challenges that are specific and unique to modelling vector-borne diseases and macroparasites. Moreover, many of the neglected tropical diseases which are currently targeted for control and elimination are vector-borne, macroparasitic, or both, and so this article includes challenges which will assist in accelerating the control of these high-burden diseases. Here, we discuss the challenges of indirect measures of infection in humans, whether through vectors or transmission life stages and in estimating the contribution of different host groups to transmission. We also discuss the issues of “evolution-proof” interventions against vector-borne disease.

  20. Seven challenges for modelling indirect transmission: vector-borne diseases, macroparasites and neglected tropical diseases.

    Science.gov (United States)

    Hollingsworth, T Déirdre; Pulliam, Juliet R C; Funk, Sebastian; Truscott, James E; Isham, Valerie; Lloyd, Alun L

    2015-03-01

    Many of the challenges which face modellers of directly transmitted pathogens also arise when modelling the epidemiology of pathogens with indirect transmission--whether through environmental stages, vectors, intermediate hosts or multiple hosts. In particular, understanding the roles of different hosts, how to measure contact and infection patterns, heterogeneities in contact rates, and the dynamics close to elimination are all relevant challenges, regardless of the mode of transmission. However, there remain a number of challenges that are specific and unique to modelling vector-borne diseases and macroparasites. Moreover, many of the neglected tropical diseases which are currently targeted for control and elimination are vector-borne, macroparasitic, or both, and so this article includes challenges which will assist in accelerating the control of these high-burden diseases. Here, we discuss the challenges of indirect measures of infection in humans, whether through vectors or transmission life stages and in estimating the contribution of different host groups to transmission. We also discuss the issues of "evolution-proof" interventions against vector-borne disease. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  1. Major emerging vector-borne zoonotic diseases of public health importance in Canada.

    Science.gov (United States)

    Kulkarni, Manisha A; Berrang-Ford, Lea; Buck, Peter A; Drebot, Michael A; Lindsay, L Robbin; Ogden, Nicholas H

    2015-06-10

    In Canada, the emergence of vector-borne diseases may occur via international movement and subsequent establishment of vectors and pathogens, or via northward spread from endemic areas in the USA. Re-emergence of endemic vector-borne diseases may occur due to climate-driven changes to their geographic range and ecology. Lyme disease, West Nile virus (WNV), and other vector-borne diseases were identified as priority emerging non-enteric zoonoses in Canada in a prioritization exercise conducted by public health stakeholders in 2013. We review and present the state of knowledge on the public health importance of these high priority emerging vector-borne diseases in Canada. Lyme disease is emerging in Canada due to range expansion of the tick vector, which also signals concern for the emergence of human granulocytic anaplasmosis, babesiosis, and Powassan virus. WNV has been established in Canada since 2001, with epidemics of varying intensity in following years linked to climatic drivers. Eastern equine encephalitis virus, Jamestown Canyon virus, snowshoe hare virus, and Cache Valley virus are other mosquito-borne viruses endemic to Canada with the potential for human health impact. Increased surveillance for emerging pathogens and vectors and coordinated efforts among sectors and jurisdictions will aid in early detection and timely public health response.

  2. Genetic manipulation of endosymbionts to control vector and vector borne diseases

    Directory of Open Access Journals (Sweden)

    Jay Prakash Gupta

    Full Text Available Vector borne diseases (VBD are on the rise because of failure of the existing methods of control of vector and vector borne diseases and the climate change. A steep rise of VBDs are due to several factors like selection of insecticide resistant vector population, drug resistant parasite population and lack of effective vaccines against the VBDs. Environmental pollution, public health hazard and insecticide resistant vector population indicate that the insecticides are no longer a sustainable control method of vector and vector-borne diseases. Amongst the various alternative control strategies, symbiont based approach utilizing endosymbionts of arthropod vectors could be explored to control the vector and vector borne diseases. The endosymbiont population of arthropod vectors could be exploited in different ways viz., as a chemotherapeutic target, vaccine target for the control of vectors. Expression of molecules with antiparasitic activity by genetically transformed symbiotic bacteria of disease-transmitting arthropods may serve as a powerful approach to control certain arthropod-borne diseases. Genetic transformation of symbiotic bacteria of the arthropod vector to alter the vector’s ability to transmit pathogen is an alternative means of blocking the transmission of VBDs. In Indian scenario, where dengue, chikungunya, malaria and filariosis are prevalent, paratransgenic based approach can be used effectively. [Vet World 2012; 5(9.000: 571-576

  3. Using the gravity model to estimate the spatial spread of vector-borne diseases

    NARCIS (Netherlands)

    Barrios, J.M.; Verstraeten, W.W.; Maes, P.; Aerts, J.; Farifteh, J.; Coppin, P.

    2012-01-01

    The gravity models are commonly used spatial interaction models. They have been widely applied in a large set of domains dealing with interactions amongst spatial entities. The spread of vector-borne diseases is also related to the intensity of interaction between spatial entities, namely, the

  4. Reducing vector-borne disease by empowering farmers in integrated vector management

    NARCIS (Netherlands)

    Berg, van den H.; Hildebrand, von A.; Ragunathan, V.; Das, P.K.

    2007-01-01

    PROBLEM: Irrigated agriculture exposes rural people to health risks associated with vector-borne diseases and pesticides used in agriculture and for public health protection. Most developing countries lack collaboration between the agricultural and health sectors to jointly address these problems.

  5. Surveillance of arthropod vector-borne infectious diseases using remote sensing techniques: a review.

    Directory of Open Access Journals (Sweden)

    Satya Kalluri

    2007-10-01

    Full Text Available Epidemiologists are adopting new remote sensing techniques to study a variety of vector-borne diseases. Associations between satellite-derived environmental variables such as temperature, humidity, and land cover type and vector density are used to identify and characterize vector habitats. The convergence of factors such as the availability of multi-temporal satellite data and georeferenced epidemiological data, collaboration between remote sensing scientists and biologists, and the availability of sophisticated, statistical geographic information system and image processing algorithms in a desktop environment creates a fertile research environment. The use of remote sensing techniques to map vector-borne diseases has evolved significantly over the past 25 years. In this paper, we review the status of remote sensing studies of arthropod vector-borne diseases due to mosquitoes, ticks, blackflies, tsetse flies, and sandflies, which are responsible for the majority of vector-borne diseases in the world. Examples of simple image classification techniques that associate land use and land cover types with vector habitats, as well as complex statistical models that link satellite-derived multi-temporal meteorological observations with vector biology and abundance, are discussed here. Future improvements in remote sensing applications in epidemiology are also discussed.

  6. Possible impact of rising sea levels on vector-borne infectious diseases

    Directory of Open Access Journals (Sweden)

    Surendran Sinnathamby N

    2011-01-01

    Full Text Available Abstract Background Vector-borne infectious diseases are a significant cause of human and animal mortality and morbidity. Modeling studies predict that changes in climate that accompany global warming will alter the transmission risk of many vector-borne infectious diseases in different parts of the world. Global warming will also raise sea levels, which will lead to an increase in saline and brackish water bodies in coastal areas. The potential impact of rising sea levels, as opposed to climate change, on the prevalence of vector-borne infectious diseases has hitherto been unrecognised. Presentation of the hypothesis Mosquito species possessing salinity-tolerant larvae and pupae, and capable of transmitting arboviruses and parasites are found in many parts of the world. An expansion of brackish and saline water bodies in coastal areas, associated with rising sea levels, can increase densities of salinity-tolerant vector mosquitoes and lead to the adaptation of freshwater vectors to breed in brackish and saline waters. The breeding of non-mosquito vectors may also be influenced by salinity changes in coastal habitats. Higher vector densities can increase transmission of vector-borne infectious diseases in coastal localities, which can then spread to other areas. Testing the hypothesis The demonstration of increases in vector populations and disease prevalence that is related to an expansion of brackish/saline water bodies in coastal areas will provide the necessary supportive evidence. However the implementation of specific vector and disease control measures to counter the threat will confound the expected findings. Implications of the hypothesis Rising sea levels can act synergistically with climate change and then interact in a complex manner with other environmental and socio-economic factors to generate a greater potential for the transmission of vector-borne infectious diseases. The resulting health impacts are likely to be particularly

  7. Integrated mapping of establishment risk for emerging vector-borne infections: a case study of canine leishmaniasis in southwest France.

    Directory of Open Access Journals (Sweden)

    Nienke Hartemink

    Full Text Available BACKGROUND: Zoonotic visceral leishmaniasis is endemic in the Mediterranean Basin, where the dog is the main reservoir host. The disease's causative agent, Leishmania infantum, is transmitted by blood-feeding female sandflies. This paper reports an integrative study of canine leishmaniasis in a region of France spanning the southwest Massif Central and the northeast Pyrenees, where the vectors are the sandflies Phlebotomus ariasi and P. perniciosus. METHODS: Sandflies were sampled in 2005 using sticky traps placed uniformly over an area of approximately 100 by 150 km. High- and low-resolution satellite data for the area were combined to construct a model of the sandfly data, which was then used to predict sandfly abundance throughout the area on a pixel by pixel basis (resolution of c. 1 km. Using literature- and expert-derived estimates of other variables and parameters, a spatially explicit R(0 map for leishmaniasis was constructed within a Geographical Information System. R(0 is a measure of the risk of establishment of a disease in an area, and it also correlates with the amount of control needed to stop transmission. CONCLUSIONS: To our knowledge, this is the first analysis that combines a vector abundance prediction model, based on remotely-sensed variables measured at different levels of spatial resolution, with a fully mechanistic process-based temperature-dependent R(0 model. The resulting maps should be considered as proofs-of-principle rather than as ready-to-use risk maps, since validation is currently not possible. The described approach, based on integrating several modeling methods, provides a useful new set of tools for the study of the risk of outbreaks of vector-borne diseases.

  8. Taking the Bite Out of Vector-Borne Diseases

    Science.gov (United States)

    ... with implications for how diseases spread. Disease Control Elephantiasis caused by parasitic worms (top) affects more than ... inflammatory responses that lead to river blindness and elephantiasis. In an ironic twist, researchers are actually using ...

  9. Global climate change and vector-borne diseases

    Science.gov (United States)

    Ginsberg, H.S.

    2002-01-01

    Global warming will have different effects on different diseases because of the complex and idiosynchratic interactions between vectors, hosts, and pathogens that influence transmission dynamics of each pathogen. Human activities, including urbanization, rapid global travel, and vector management, have profound effects on disease transmission that can operate on more rapid time scales than does global climate change. The general concern about global warming encouraging the spread of tropical diseases is legitimate, but the effects vary among diseases, and the ecological implications are difficult to predict.

  10. Arthropod Innate Immune Systems and Vector-Borne Diseases

    OpenAIRE

    Baxter, Richard H. G.; Contet, Alicia; Krueger, Kathryn

    2017-01-01

    Arthropods, especially ticks and mosquitoes, are the vectors for a number of parasitic and viral human diseases, including malaria, sleeping sickness, Dengue, and Zika, yet arthropods show tremendous individual variation in their capacity to transmit disease. A key factor in this capacity is the group of genetically encoded immune factors that counteract infection by the pathogen. Arthropod-specific pattern recognition receptors and protease cascades detect and respond to infection. Proteins ...

  11. Optimal vaccination scenarios against vector-borne diseases

    DEFF Research Database (Denmark)

    Græsbøll, Kaare; Enøe, Claes; Bødker, Rene

    that would increase distance between infectious and susceptible hosts. This can be done very efficiently on a regional scale if the incursion route is well specified. However as the long-range spread of midge borne disease is still poorly quantified, more robust national vaccination schemes seems preferable...

  12. Best Practices for Preventing Vector-Borne Diseases in Dogs and Humans.

    Science.gov (United States)

    Dantas-Torres, Filipe; Otranto, Domenico

    2016-01-01

    Vector-borne diseases constitute a diversified group of illnesses, which are caused by a multitude of pathogens transmitted by arthropod vectors, such as mosquitoes, fleas, ticks, and sand flies. Proper management of these diseases is important from both human and veterinary medicine standpoints, given that many of these pathogens are transmissible to humans and dogs, which often live in close contact. In this review, we summarize the most important vector-borne diseases of dogs and humans and the best practices for their prevention. The control of these diseases would ultimately improve animal and human health and wellbeing, particularly in developing countries in the tropics, where the risk of these diseases is high and access to health care is poor. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Imported and travelling dogs as carriers of canine vector-borne pathogens in Germany

    Directory of Open Access Journals (Sweden)

    Lorentz Susanne

    2010-04-01

    Full Text Available Abstract Background With the import of pets and pets taken abroad, arthropod-borne diseases have increased in frequency in German veterinary practices. This is reflected by 4,681 dogs that have been either travelled to or relocated from endemic areas to Germany. The case history of these dogs and the laboratory findings have been compared with samples collected from 331 dogs living in an endemic area in Portugal. The various pathogens and the seroprevalences were examined to determine the occurrence of, and thus infection risk, for vector-borne pathogens in popular travel destinations. Results 4,681 dogs were examined serological for Leishmania infantum, Babesia canis and Ehrlichia canis. Buffy coats were detected for Hepatozoon canis and blood samples were examined for microfilariae via the Knott's test. The samples were sent in from animal welfare organizations or private persons via veterinary clinics. Upon individual requests, dogs were additionally examined serological for Anaplasma phagocytophilum, Borrelia burgdorferi and Rickettsia conorii. Overall B. canis was the most prevalent pathogen detected by antibody titers (23.4%, followed by L. infantum (12.2% and E. canis (10.1%. Microfilariae were detected in 7.7% and H. canis in 2.7% of the examined dogs. In 332/1862 dogs A. phagocytophilum, in 64/212 B. burgdorferi and in 20/58 R. conorii was detected. Of the 4,681 dogs, in total 4,226 were imported to Germany from endemic areas. Eighty seven dogs joined their owners for a vacation abroad. In comparison to the laboratory data from Germany, we examined 331 dogs from Portugal. The prevalence of antibodies/pathogens we detected was: 62.8% to R. conorii, 58% to B. canis, 30.5% to A. phagocytophilum, 24.8% to E. canis, 21.1% to H. canis (via PCR, 9.1% to L. infantum and 5.3% to microfilariae. Conclusions The examination of 4,681 dogs living in Germany showed pathogens like L. infantum that are non-endemic in Germany. Furthermore, the German

  14. Optimal vaccination strategies against vector-borne diseases

    DEFF Research Database (Denmark)

    Græsbøll, Kaare; Enøe, Claes; Bødker, Rene

    2014-01-01

    Using a process oriented semi-agent based model, we simulated the spread of Bluetongue virus by Culicoides, biting midges, between cattle in Denmark. We evaluated the minimum vaccination cover and minimum cost for eight different preventive vaccination strategies in Denmark. The simulation model ...... results when index cases were in the vaccinated areas. However, given that the long-range spread of midge borne disease is still poorly quantified, more robust national vaccination schemes seem preferable....

  15. Venezuela and its rising vector-borne neglected diseases

    OpenAIRE

    Hotez, Peter J.; Bas??ez, Mar?a-Gloria; Acosta-Serrano, Alvaro; Grillet, Maria Eugenia

    2017-01-01

    Poverty remains the overriding social determinant for the neglected tropical diseases (NTDs), but over the last several decades, we have also seen how political destabilization or even outright conflict can hasten economic declines and promote a substantial uptick in NTD incidence and prevalence [1]. Recent examples include the emergence of Ebola virus infection in West Africa [2], visceral leishmaniasis and other NTDs in East Africa [3, 4], and cutaneous leishmaniasis in the Middle East and ...

  16. Major vectors and vector-borne diseases in small ruminants in Ethiopia: A systematic review.

    Science.gov (United States)

    Asmare, Kassahun; Abayneh, Takele; Sibhat, Berhanu; Shiferaw, Dessie; Szonyi, Barbara; Krontveit, Randi I; Skjerve, Eystein; Wieland, Barbara

    2017-06-01

    Vector-borne diseases are among major health constraints of small ruminant in Ethiopia. While various studies on single vector-borne diseases or presence of vectors have been conducted, no summarized evidence is available on the occurrence of these diseases and the related vectors. This systematic literature review provides a comprehensive summary on major vectors and vector-borne diseases in small ruminants in Ethiopia. Search for published and unpublished literature was conducted between 8th of January and 25th of June 2015. The search was both manual and electronic. The databases used in electronic search were PubMed, Web of Science, CAB Direct and AJOL. For most of the vector-borne diseases, the summary was limited to narrative synthesis due to lack of sufficient data. Meta-analysis was computed for trypanosomosis and dermatophilosis while meta-regression and sensitivity analysis was done only for trypanososmosis due to lack of sufficient reports on dermatophilosis. Owing emphasis to their vector role, ticks and flies were summarized narratively at genera/species level. In line with inclusion criteria, out of 106 initially identified research reports 43 peer-reviewed articles passed the quality assessment. Data on 7 vector-borne diseases were extracted at species and region level from each source. Accordingly, the pooled prevalence estimate of trypanosomosis was 3.7% with 95% confidence interval (CI) 2.8, 4.9), while that of dermatophilosis was 3.1% (95% CI: 1.6, 6.0). The in-between study variance noted for trypanosomosis was statistically significant (pparasitic presence in blood was documented for babesiosis (3.7% in goats); and anaplasmosis (3.9% in sheep). Serological evidence was retrieved for bluetongue ranging from 34.1% to 46.67% in sheep, and coxiellosis was 10.4% in goats. There was also molecular evidence on the presence of theileriosis in sheep (93%, n=160) and goats (1.9%, n=265). Regarding vectors of veterinary importance, 14 species of ticks in

  17. A surface hydrology model for regional vector borne disease models

    Science.gov (United States)

    Tompkins, Adrian; Asare, Ernest; Bomblies, Arne; Amekudzi, Leonard

    2016-04-01

    Small, sun-lit temporary pools that form during the rainy season are important breeding sites for many key mosquito vectors responsible for the transmission of malaria and other diseases. The representation of this surface hydrology in mathematical disease models is challenging, due to their small-scale, dependence on the terrain and the difficulty of setting soil parameters. Here we introduce a model that represents the temporal evolution of the aggregate statistics of breeding sites in a single pond fractional coverage parameter. The model is based on a simple, geometrical assumption concerning the terrain, and accounts for the processes of surface runoff, pond overflow, infiltration and evaporation. Soil moisture, soil properties and large-scale terrain slope are accounted for using a calibration parameter that sets the equivalent catchment fraction. The model is calibrated and then evaluated using in situ pond measurements in Ghana and ultra-high (10m) resolution explicit simulations for a village in Niger. Despite the model's simplicity, it is shown to reproduce the variability and mean of the pond aggregate water coverage well for both locations and validation techniques. Example malaria simulations for Uganda will be shown using this new scheme with a generic calibration setting, evaluated using district malaria case data. Possible methods for implementing regional calibration will be briefly discussed.

  18. Arthropod Innate Immune Systems and Vector-Borne Diseases.

    Science.gov (United States)

    Baxter, Richard H G; Contet, Alicia; Krueger, Kathryn

    2017-02-21

    Arthropods, especially ticks and mosquitoes, are the vectors for a number of parasitic and viral human diseases, including malaria, sleeping sickness, Dengue, and Zika, yet arthropods show tremendous individual variation in their capacity to transmit disease. A key factor in this capacity is the group of genetically encoded immune factors that counteract infection by the pathogen. Arthropod-specific pattern recognition receptors and protease cascades detect and respond to infection. Proteins such as antimicrobial peptides, thioester-containing proteins, and transglutaminases effect responses such as lysis, phagocytosis, melanization, and agglutination. Effector responses are initiated by damage signals such as reactive oxygen species signaling from epithelial cells and recognized by cell surface receptors on hemocytes. Antiviral immunity is primarily mediated by siRNA pathways but coupled with interferon-like signaling, antimicrobial peptides, and thioester-containing proteins. Molecular mechanisms of immunity are closely linked to related traits of longevity and fertility, and arthropods have the capacity for innate immunological memory. Advances in understanding vector immunity can be leveraged to develop novel control strategies for reducing the rate of transmission of both ancient and emerging threats to global health.

  19. Effects of Climate and Climate Change on Vectors and Vector-Borne Diseases: Ticks Are Different.

    Science.gov (United States)

    Ogden, Nick H; Lindsay, L Robbin

    2016-08-01

    There has been considerable debate as to whether global risk from vector-borne diseases will be impacted by climate change. This has focussed on important mosquito-borne diseases that are transmitted by the vectors from infected to uninfected humans. However, this debate has mostly ignored the biological diversity of vectors and vector-borne diseases. Here, we review how climate and climate change may impact those most divergent of arthropod disease vector groups: multivoltine insects and hard-bodied (ixodid) ticks. We contrast features of the life cycles and behaviour of these arthropods, and how weather, climate, and climate change may have very different impacts on the spatiotemporal occurrence and abundance of vectors, and the pathogens they transmit. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.

  20. Dynamical behavior of an epidemic model for a vector-borne disease with direct transmission

    International Nuclear Information System (INIS)

    Cai Liming; Li Xuezhi; Li Zhaoqiang

    2013-01-01

    An epidemic model of a vector-borne disease with direct transmission is investigated. The reproduction number (R 0 ) of the model is obtained. Rigorous qualitative analysis of the model reveals the presence of the phenomenon of backward bifurcation (where the stable disease-free equilibrium (DFE) coexists with a stable endemic equilibrium when the reproduction number of the disease is less than unity) in the standard incidence model. The phenomenon shows that the classical epidemiological requirement of having the reproduction number less than unity is no longer sufficient, although necessary, for effectively controlling the spread of some vector-borne diseases in a community. The backward bifurcation phenomenon can be removed by substituting the standard incidence with a bilinear mass action incidence. By using Lyapunov function theory and LaSalle invariance principle, it is shown that the unique endemic equilibrium for the model with a mass action incidence is globally stable if the reproduction number R mass is greater than one in feasible region. This suggests that the use of standard incidence in modelling some vector-borne diseases with direct transmission results in the presence of backward bifurcation. Numerical simulations analyze the effect of the direct transmission and the disease-induced death rate on dynamics of the disease transmission, and also verify our analyzed results.

  1. Clinical and molecular investigation of a canine distemper outbreak and vector-borne infections in a group of rescue dogs imported from Hungary to Switzerland.

    Science.gov (United States)

    Willi, Barbara; Spiri, Andrea M; Meli, Marina L; Grimm, Felix; Beatrice, Laura; Riond, Barbara; Bley, Tim; Jordi, Rolf; Dennler, Matthias; Hofmann-Lehmann, Regina

    2015-07-16

    Canine distemper virus (CDV) is a major pathogen of dogs and wild carnivores worldwide. In Switzerland, distemper in domestic dogs is rarely reported. In recent years, the import of dogs from Eastern Europe to Switzerland has steadily increased. In the present study, we describe a distemper outbreak in 15 rescue dogs that were imported from Hungary to Switzerland by an animal welfare organisation. The data on vaccination and medical history were recorded (14 dogs), and the samples were collected to investigate CDV and vector-borne infections (13 dogs) and canine parvovirus infection (12 dogs). The dogs were monitored for six months. One dog was euthanised directly after import. Thirteen dogs showed clinical signs after arrival, i.e., diarrhoea (57 %), coughing (43 %) and nasal and/or ocular discharge (21 %); radiographic findings that were compatible with bronchopneumonia were present in four dogs. CDV infection was diagnosed in 11 dogs (85 %); 10 dogs (91 %) tested PCR-positive in conjunctival swabs. Vector-borne infections (Babesia spp., Leishmania infantum, Dirofilaria immitis) were found in 4 dogs (31 %). Three dogs were hospitalized, and six dogs received ambulatory therapy for up to two months until recovery. None of the dogs developed neurological disease. CDV shedding was detected for a period of up to four months. Because dogs were put under strict quarantine until CDV shedding ceased, CDV did not spread to any other dogs. The CDV isolates showed 99 % sequence identity in the HA gene among each other and belonged to the Arctic-like lineage of CDV. The present study highlights the imminent risks of spreading contagious viral and vector-borne infections through the non-selective import of sick dogs and dogs with incomplete vaccination from Eastern Europe. CDV shedding was detected for several months after the cessation of clinical signs, which emphasised the roles of asymptomatic carriers in CDV epidemiology. A long-term follow-up using sensitive PCR and

  2. Spatially explicit multi-criteria decision analysis for managing vector-borne diseases

    Science.gov (United States)

    2011-01-01

    The complex epidemiology of vector-borne diseases creates significant challenges in the design and delivery of prevention and control strategies, especially in light of rapid social and environmental changes. Spatial models for predicting disease risk based on environmental factors such as climate and landscape have been developed for a number of important vector-borne diseases. The resulting risk maps have proven value for highlighting areas for targeting public health programs. However, these methods generally only offer technical information on the spatial distribution of disease risk itself, which may be incomplete for making decisions in a complex situation. In prioritizing surveillance and intervention strategies, decision-makers often also need to consider spatially explicit information on other important dimensions, such as the regional specificity of public acceptance, population vulnerability, resource availability, intervention effectiveness, and land use. There is a need for a unified strategy for supporting public health decision making that integrates available data for assessing spatially explicit disease risk, with other criteria, to implement effective prevention and control strategies. Multi-criteria decision analysis (MCDA) is a decision support tool that allows for the consideration of diverse quantitative and qualitative criteria using both data-driven and qualitative indicators for evaluating alternative strategies with transparency and stakeholder participation. Here we propose a MCDA-based approach to the development of geospatial models and spatially explicit decision support tools for the management of vector-borne diseases. We describe the conceptual framework that MCDA offers as well as technical considerations, approaches to implementation and expected outcomes. We conclude that MCDA is a powerful tool that offers tremendous potential for use in public health decision-making in general and vector-borne disease management in particular

  3. Spatially explicit multi-criteria decision analysis for managing vector-borne diseases

    Directory of Open Access Journals (Sweden)

    Hongoh Valerie

    2011-12-01

    Full Text Available Abstract The complex epidemiology of vector-borne diseases creates significant challenges in the design and delivery of prevention and control strategies, especially in light of rapid social and environmental changes. Spatial models for predicting disease risk based on environmental factors such as climate and landscape have been developed for a number of important vector-borne diseases. The resulting risk maps have proven value for highlighting areas for targeting public health programs. However, these methods generally only offer technical information on the spatial distribution of disease risk itself, which may be incomplete for making decisions in a complex situation. In prioritizing surveillance and intervention strategies, decision-makers often also need to consider spatially explicit information on other important dimensions, such as the regional specificity of public acceptance, population vulnerability, resource availability, intervention effectiveness, and land use. There is a need for a unified strategy for supporting public health decision making that integrates available data for assessing spatially explicit disease risk, with other criteria, to implement effective prevention and control strategies. Multi-criteria decision analysis (MCDA is a decision support tool that allows for the consideration of diverse quantitative and qualitative criteria using both data-driven and qualitative indicators for evaluating alternative strategies with transparency and stakeholder participation. Here we propose a MCDA-based approach to the development of geospatial models and spatially explicit decision support tools for the management of vector-borne diseases. We describe the conceptual framework that MCDA offers as well as technical considerations, approaches to implementation and expected outcomes. We conclude that MCDA is a powerful tool that offers tremendous potential for use in public health decision-making in general and vector-borne

  4. Using the Gravity Model to Estimate the Spatial Spread of Vector-Borne Diseases

    Directory of Open Access Journals (Sweden)

    Jean-Marie Aerts

    2012-11-01

    Full Text Available The gravity models are commonly used spatial interaction models. They have been widely applied in a large set of domains dealing with interactions amongst spatial entities. The spread of vector-borne diseases is also related to the intensity of interaction between spatial entities, namely, the physical habitat of pathogens’ vectors and/or hosts, and urban areas, thus humans. This study implements the concept behind gravity models in the spatial spread of two vector-borne diseases, nephropathia epidemica and Lyme borreliosis, based on current knowledge on the transmission mechanism of these diseases. Two sources of information on vegetated systems were tested: the CORINE land cover map and MODIS NDVI. The size of vegetated areas near urban centers and a local indicator of occupation-related exposure were found significant predictors of disease risk. Both the land cover map and the space-borne dataset were suited yet not equivalent input sources to locate and measure vegetated areas of importance for disease spread. The overall results point at the compatibility of the gravity model concept and the spatial spread of vector-borne diseases.

  5. Natural Mosquito-Pathogen Hybrid IgG4 Antibodies in Vector Borne Diseases: A Hypothesis

    Directory of Open Access Journals (Sweden)

    Berlin L. Londono-Renteria

    2016-09-01

    Full Text Available Chronic exposure to antigens may favor the production of IgG4 antibodies over other antibody types. Recent studies have shown that up to a 30% of normal human IgG4 is bi-specific and is able to recognize two antigens of different nature. A requirement for this specificity is the presence of both eliciting antigens in the same time and at the same place where the immune response is induced. During transmission of most vector-borne diseases, the pathogen is delivered to the vertebrate host along with the arthropod saliva during blood feeding and previous studies have shown the existence of IgG4 antibodies against mosquito salivary allergens. However, there is very little ongoing research or information available regarding IgG4 bi-specificity with regards to infectious disease, particularly during immune responses to vector-borne diseases such as malaria, filariasis or dengue virus infection. Here, we provide background information and present our hypothesis that IgG4 may not only be a useful tool to measure exposure to infected mosquito bites, but that these bi-specific antibodies may also play an important role in modulation of the immune response against malaria and other vector-borne diseases in endemic settings.

  6. Cross-sectional survey of health management and prevalence of vector-borne diseases, endoparasites and ectoparasites in Samoan dogs.

    Science.gov (United States)

    Carslake, R J; Hill, K E; Sjölander, K; Hii, S F; Prattley, D; Acke, E

    2017-12-01

    To determine the prevalence of selected canine vector-borne diseases (Leishmania infantum, Anaplasma spp., Ehrlichia canis, Borrelia burgdorferi and Dirofilaria immitis) and endo- and ectoparasites in Samoan dogs presenting for surgical sterilisation and to report on the general health management of the dogs. This study was a prospective serological cross-sectional survey. Management data were obtained for 242 dogs by interview with their owners. Blood samples were collected from 237 dogs and screened for the canine vector-borne diseases using point-of-care qualitative ELISA assays. Anaplasma spp. positive samples were screened by PCR and sequenced for species identification. Rectal faecal samples were collected from 204 dogs for faecal flotation and immunofluorescent antibody tests were performed for Giardia and Cryptosporidium spp. on a subset of 93 faecal samples. The skin and coat of 221 dogs were examined for presence of ectoparasites. The D. immitis antigen was detected in 46.8% (111/237) of dogs. Seroprevalence of Anaplasma spp. was 8.4% (20/237); A. platys was confirmed by PCR. Prevalence of hookworm was 92.6% (185/205) and Giardia was 29.0% (27/93). Ectoparasites were detected on 210/221 (95.0%) of dogs examined and 228/242 dogs (94.2%) had previously never received any preventative medication. There was a very high prevalence of D. immitis, hookworm and external parasites in Samoan dogs, and prophylactic medication is rarely administered. This is the first report confirming A. platys in Samoa and the South Pacific islands. The public health implications of poor management of the dogs should be considered and investigated further. © 2017 Australian Veterinary Association.

  7. [Important vector-borne infectious diseases among humans in Germany. Epidemiological aspects].

    Science.gov (United States)

    Frank, C; Faber, M; Hellenbrand, W; Wilking, H; Stark, K

    2014-05-01

    Vector-borne infections pathogenic to humans play an important role in Germany. The relevant zoonotic pathogens are either endemic throughout Germany (e.g. Borrelia burgdorferi sensu latu) or only in specific regions, e.g. tick-borne encephalitis (TBE) virus and hantavirus. They cause a substantial burden of disease. Prevention and control largely rely on public advice and the application of personal protective measures (e.g. TBE virus vaccination and protection against vectors). High quality surveillance and targeted epidemiological studies are fundamental for the evaluation of temporal and spatial risks of infection and the effectiveness of preventive measures. Aside from endemic pathogens, vector-borne infections acquired abroad, mostly transmitted by mosquitoes, have to be systematically and intensively monitored as well, to assess the risk of infection for German residents traveling abroad and to adequately evaluate the risk of autochthonous transmission. Related issues, such as invasive species of mosquitoes in Germany and climate change, have to be taken into consideration. Such pathogens include West Nile, dengue and chikungunya viruses, as well as malaria parasites (Plasmodium species). The article presents an overview of the epidemiological situation of selected relevant vector-borne infections in Germany.

  8. The impact of global environmental change on vector-borne disease risk: a modelling study

    Directory of Open Access Journals (Sweden)

    Rachel Lowe, PhD

    2018-05-01

    Full Text Available Background: Vector-borne diseases, such as dengue virus, Zika virus, and malaria, are highly sensitive to environmental changes, including variations in climate and land-surface characteristics. The emergence and spread of vector-borne diseases is also exacerbated by anthropogenic activities, such as deforestation, mining, urbanisation, and human mobility, which alter the natural habitats of vectors and increase vector–host interactions. Innovative epidemiological modelling tools can help to understand how environmental conditions interact with socioeconomic risk factors to predict the risk of disease transmission. In recent years, climate-health modelling has benefited from computational advances in fitting complex mathematical models; increasing availability of environmental, socioeconomic, and disease surveillance datasets; and improved ability to understand and model the climate system. Climate forecasts at seasonal time scales tend to improve in quality during El Niño-Southern Oscillation events in certain regions of the tropics. Thus, climate forecasts provide an opportunity to anticipate potential outbreaks of vector-borne diseases from several months to a year in advance. The aim of this study was to develop a framework to incorporate seasonal climate forecasts in predictive disease models to understand the future risk of vector-borne diseases, with a focus on dengue fever in Latin America. Methods: A Bayesian spatiotemporal model framework that quantifies the extent to which environmental and socioeconomic indicators can explain variations in disease risk was designed to disentangle the effects of climate from other risk factors using multi-source data and random effects, which account for unknown and unmeasured sources of spatial, seasonal, and inter-annual variation. The model was used to provide probabilistic predictions of monthly dengue incidence and the probability of exceeding outbreak thresholds, which were established in

  9. A survey of basic reproductive ratios in vector-borne disease transmission modeling

    Science.gov (United States)

    Soewono, E.; Aldila, D.

    2015-03-01

    Vector-borne diseases are commonly known in tropical and subtropical countries. These diseases have contributed to more than 10% of world infectious disease cases. Among the vectors responsible for transmitting the diseases are mosquitoes, ticks, fleas, flies, bugs and worms. Several of the diseases are known to contribute to the increasing threat to human health such as malaria, dengue, filariasis, chikungunya, west nile fever, yellow fever, encephalistis, and anthrax. It is necessary to understand the real process of infection, factors which contribute to the complication of the transmission in order to come up with a good and sound mathematical model. Although it is not easy to simulate the real transmission process of the infection, we could say that almost all models have been developed from the already long known Host-Vector model. It constitutes the main transmission processes i.e. birth, death, infection and recovery. From this simple model, the basic concepts of Disease Free and Endemic Equilibria and Basic Reproductive Ratio can be well explained and understood. Theoretical, modeling, control and treatment aspects of disease transmission problems have then been developed for various related diseases. General construction as well as specific forms of basic reproductive ratios for vector-borne diseases are discusses here.

  10. Wildlife as reservoirs for vector borne diseases in a warmer Scandinavian climate

    DEFF Research Database (Denmark)

    Bødker, Rene; Kristensen, Birgit

    can be attributed global warming. Some of these new infections have important reservoirs in wild animals and this may affect prevention and control of outbreaks in humans and domestic animals. This may also put wild animals at risk of not just infections but also of control efforts targeted...... of the future risk of outbreaks in the Nordic countries. DTU Veterinary Institute is developing a system for continuous risk assessment of potential spread of exotic insect borne diseases of veterinary and human importance. Mathematical models for selected vector borne diseases are continuously updated...

  11. Climate Change and Vector Borne Diseases on NASA Langley Research Center

    Science.gov (United States)

    Cole, Stuart K.; DeYoung, Russell J.; Shepanek, Marc A.; Kamel, Ahmed

    2014-01-01

    Increasing global temperature, weather patterns with above average storm intensities, and higher sea levels have been identified as phenomena associated with global climate change. As a causal system, climate change could contribute to vector borne diseases in humans. Vectors of concern originate from the vicinity of Langley Research Center include mosquitos and ticks that transmit disease that originate regionally, nationwide, or from outside the US. Recognizing changing conditions, vector borne diseases propagate under climate change conditions, and understanding the conditions in which they may exist or propagate, presents opportunities for monitoring their progress and mitigating their potential impacts through communication, continued monitoring, and adaptation. Personnel comprise a direct and fundamental support to NASA mission success, continuous and improved understanding of climatic conditions, and the resulting consequence of disease from these conditions, helps to reduce risk in terrestrial space technologies, ground operations, and space research. This research addresses conditions which are attributed to climatic conditions which promote environmental conditions conducive to the increase of disease vectors. This investigation includes evaluation of local mosquito population count and rainfall data for statistical correlation and identification of planning recommendations unique to LaRC, other NASA Centers to assess adaptation approaches, Center-level planning strategies.

  12. Regulation of the Immune Response to α-Gal and Vector-borne Diseases.

    Science.gov (United States)

    Cabezas-Cruz, Alejandro; Mateos-Hernández, Lourdes; Pérez-Cruz, Magdiel; Valdés, James J; Mera, Isabel G Fernández de; Villar, Margarita; de la Fuente, José

    2015-10-01

    Vector-borne diseases (VBD) challenge our understanding of emerging diseases. Recently, arthropod vectors have been involved in emerging anaphylactic diseases. In particular, the immunoglobulin E (IgE) antibody response to the carbohydrate Galα1-3Galβ1-(3)4GlcNAc-R (α-gal) following a tick bite was associated with allergies to red meat, cetuximab, and gelatin. By contrast, an anti-α-gal IgM antibody response was shown to protect against mosquito-borne malaria. Herein, we highlight the interplay between the gut microbiota, vectors, transmitted pathogens, and the regulation of the immune response as a model to understand the protective or allergic effect of α-gal. Establishing the source of α-gal in arthropod vectors and the immune response to vector bites and transmitted pathogens will be essential for diagnosing, treating, and ultimately preventing these emerging anaphylactic and other vector-borne diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. [Knowledge of vector-borne diseases (dengue, rickettsiosis and Chagas disease) in physicians].

    Science.gov (United States)

    Lugo-Caballero, César I; Dzul-Rosado, Karla; Dzul-Tut, Irving; Balam-May, Ángel; Zavala-Castro, Jorge

    2017-01-01

    The ecological conditions of Yucatan made it a suitable region for the acquisition of vector-borne diseases such as dengue, rickettsiosis, and Chagas disease. As the epidemiological burden of these diseases shows an alarming increase of severe cases, the early establishment of diagnosis and therapeutics by first-contact physicians is a critical step that is not being fulfilled due to several reasons, including poor knowledge. To determine the level of knowledge related to dengue, Chagas disease, and rickettsiosis among rural first-contact physicians of Yucatan. A survey was applied to 90 first-contact physicians from rural clinics of Yucatan, which included 32 items related to the diagnosis, treatment, and prevention of dengue, rickettsiosis, and Chagas disease. Answers were analyzed by central tendency statistics. Differences were observed among every category, however; diagnosis and therapeutics showed the lower values. Globally, 62.5% of respondents showed moderate knowledge, 37.5% poor knowledge, and 0% adequate knowledge. Results suggest that a strong campaign for a continuous diffusion of knowledge regarding these diseases is needed. In regions with high prevalence of these kinds of diseases, like Yucatan, the impact of these results on the epidemiological burden of these diseases must be evaluated.

  14. The role of remote sensing and GIS for spatial prediction of vector-borne diseases transmission: a systematic review.

    Science.gov (United States)

    Palaniyandi, M

    2012-12-01

    There have been several attempts made to the appreciation of remote sensing and GIS for the study of vectors, biodiversity, vector presence, vector abundance and the vector-borne diseases with respect to space and time. This study was made for reviewing and appraising the potential use of remote sensing and GIS applications for spatial prediction of vector-borne diseases transmission. The nature of the presence and the abundance of vectors and vector-borne diseases, disease infection and the disease transmission are not ubiquitous and are confined with geographical, environmental and climatic factors, and are localized. The presence of vectors and vector-borne diseases is most complex in nature, however, it is confined and fueled by the geographical, climatic and environmental factors including man-made factors. The usefulness of the present day availability of the information derived from the satellite data including vegetation indices of canopy cover and its density, soil types, soil moisture, soil texture, soil depth, etc. is integrating the information in the expert GIS engine for the spatial analysis of other geoclimatic and geoenvironmental variables. The present study gives the detailed information on the classical studies of the past and present, and the future role of remote sensing and GIS for the vector-borne diseases control. The ecological modeling directly gives us the relevant information to understand the spatial variation of the vector biodiversity, vector presence, vector abundance and the vector-borne diseases in association with geoclimatic and the environmental variables. The probability map of the geographical distribution and seasonal variations of horizontal and vertical distribution of vector abundance and its association with vector -borne diseases can be obtained with low cost remote sensing and GIS tool with reliable data and speed.

  15. Predators indirectly control vector-borne disease: linking predator-prey and host-pathogen models.

    Science.gov (United States)

    Moore, Sean M; Borer, Elizabeth T; Hosseini, Parviez R

    2010-01-06

    Pathogens transmitted by arthropod vectors are common in human populations, agricultural systems and natural communities. Transmission of these vector-borne pathogens depends on the population dynamics of the vector species as well as its interactions with other species within the community. In particular, predation may be sufficient to control pathogen prevalence indirectly via the vector. To examine the indirect effect of predators on vectored-pathogen dynamics, we developed a theoretical model that integrates predator-prey and host-pathogen theory. We used this model to determine whether predation can prevent pathogen persistence or alter the stability of host-pathogen dynamics. We found that, in the absence of predation, pathogen prevalence in the host increases with vector fecundity, whereas predation on the vector causes pathogen prevalence to decline, or even become extinct, with increasing vector fecundity. We also found that predation on a vector may drastically slow the initial spread of a pathogen. The predator can increase host abundance indirectly by reducing or eliminating infection in the host population. These results highlight the importance of studying interactions that, within the greater community, may alter our predictions when studying disease dynamics. From an applied perspective, these results also suggest situations where an introduced predator or the natural enemies of a vector may slow the rate of spread of an emerging vector-borne pathogen.

  16. A GEOSPATIAL ANALYSIS OF THE RELATIONSHIP BETWEEN ENVIRONMENTAL DRIVERS AND VECTOR-BORNE DISEASES

    Directory of Open Access Journals (Sweden)

    MARIA IOANA VLAD-ȘANDRU

    2015-10-01

    Full Text Available A Geospatial Analysis of the Relationship between Environmental Drivers and Vector-Borne Diseases. Human health is profoundly affected by weather and climate. Environmental health is becoming a major preoccupation on a world-wide scale; there is a close correlation between a population’s state of health and the quality of its environment, considering many infectious diseases are at least partly dependent on environmental factors. When we talk about the environment, we realize that it includes and affects fields of action from our daily life. Earth observation from space, with validation from in situ observations, provide a greater understanding of the environment and enable us to monitor and predict key environmental phenomena and events that can affect our livelihoods and health. Even thought, the use of Earth observation is growing in usefulness for a wide variety of uses, it is extremely unlikely that Earth Observation will be able to detect infectious diseases directly. Instead, Earth observation can be used to detect high NDVI index (and possibly attribute the high surface chlorophyll concentration to a particular disease, and help predict the movement of the agents carrying vector-borne disease. Many diseases need certain temperature and moisture conditions to breed. The primary objective of analyzing environmental health risk and vulnerabilities is to support the Development Regions to strengthen their capacity to assess, visualize and analyze health risks and incorporate the results of this analysis in a health risk map for disaster risk reduction, emergency preparedness and response plans. At the same time, such an analysis applied in health, allows starting the collection and homogenization of baseline data, information and maps to help health authorities and decision makers to take informed decisions in times of crises. Informational Health Platform would be used for the integration of data coming from different sources in order to

  17. Modelling spread of Bluetongue and other vector borne diseases in Denmark and evaluation of intervention strategies

    DEFF Research Database (Denmark)

    Græsbøll, Kaare

    that describes spread of disease using vectors or hosts as agents of the spread. The model is run with bluetongue as the primary case study, and it is demonstrated how an epidemic outbreak of bluetongue 8 in Denmark is sensitive to the use of pasture, climate, vaccination, vector abundance, and flying parameters......The main outcome of this PhD project is a generic model for non-contagious infectious vector-borne disease spread by one vector species between up to two species of hosts distributed on farms and pasture. The model features a within-herd model of disease, combined with a triple movement kernel....... In constructing a more process oriented agent-based approach to spread modeling new parameters describing vector behavior were introduced. When these vector flying parameters have been quantified by experiments, this model can be implemented on areas naïve to the modeled disease with a high predictive power...

  18. Towards an integrated approach in surveillance of vector-borne diseases in Europe

    Science.gov (United States)

    2011-01-01

    Vector borne disease (VBD) emergence is a complex and dynamic process. Interactions between multiple disciplines and responsible health and environmental authorities are often needed for an effective early warning, surveillance and control of vectors and the diseases they transmit. To fully appreciate this complexity, integrated knowledge about the human and the vector population is desirable. In the current paper, important parameters and terms of both public health and medical entomology are defined in order to establish a common language that facilitates collaboration between the two disciplines. Special focus is put on the different VBD contexts with respect to the current presence or absence of the disease, the pathogen and the vector in a given location. Depending on the context, whether a VBD is endemic or not, surveillance activities are required to assess disease burden or threat, respectively. Following a decision for action, surveillance activities continue to assess trends. PMID:21967706

  19. Integrating Transgenic Vector Manipulation with Clinical Interventions to Manage Vector-Borne Diseases.

    Directory of Open Access Journals (Sweden)

    Kenichi W Okamoto

    2016-03-01

    Full Text Available Many vector-borne diseases lack effective vaccines and medications, and the limitations of traditional vector control have inspired novel approaches based on using genetic engineering to manipulate vector populations and thereby reduce transmission. Yet both the short- and long-term epidemiological effects of these transgenic strategies are highly uncertain. If neither vaccines, medications, nor transgenic strategies can by themselves suffice for managing vector-borne diseases, integrating these approaches becomes key. Here we develop a framework to evaluate how clinical interventions (i.e., vaccination and medication can be integrated with transgenic vector manipulation strategies to prevent disease invasion and reduce disease incidence. We show that the ability of clinical interventions to accelerate disease suppression can depend on the nature of the transgenic manipulation deployed (e.g., whether vector population reduction or replacement is attempted. We find that making a specific, individual strategy highly effective may not be necessary for attaining public-health objectives, provided suitable combinations can be adopted. However, we show how combining only partially effective antimicrobial drugs or vaccination with transgenic vector manipulations that merely temporarily lower vector competence can amplify disease resurgence following transient suppression. Thus, transgenic vector manipulation that cannot be sustained can have adverse consequences-consequences which ineffective clinical interventions can at best only mitigate, and at worst temporarily exacerbate. This result, which arises from differences between the time scale on which the interventions affect disease dynamics and the time scale of host population dynamics, highlights the importance of accounting for the potential delay in the effects of deploying public health strategies on long-term disease incidence. We find that for systems at the disease-endemic equilibrium, even

  20. Vector-borne Infections

    Centers for Disease Control (CDC) Podcasts

    2011-04-18

    This podcast discusses emerging vector-borne pathogens, their role as prominent contributors to emerging infectious diseases, how they're spread, and the ineffectiveness of mosquito control methods.  Created: 4/18/2011 by National Center for Emerging Zoonotic and Infectious Diseases (NCEZID).   Date Released: 4/27/2011.

  1. Surveillance of vector-borne diseases in Germany: trends and challenges in the view of disease emergence and climate change.

    Science.gov (United States)

    Jansen, Andreas; Frank, Christina; Koch, Judith; Stark, Klaus

    2008-12-01

    The changing epidemiology of vector-borne diseases represents a growing threat to human health. Contemporary surveillance systems have to adapt to these changes. We describe temporal trends and geographic origins of vector-borne diseases in Germany with regard to strengths of existing disease surveillance and to areas marked for improvement. We focused on hantavirus infection (endemic in Germany), chikungunya fever (recently emerging in Europe) and dengue fever (imported from tropical regions), representing important subgroups of vector-borne infections. Routine surveillance data on demographics, origin of infection and the date of reporting were analysed. From 2001 through 2007, 3,005 symptomatic hantavirus infections, and 85 cases of chikungunya fever were reported, similarly 1,048 cases of dengue fever in 2002 through 2007. The geographic origin of hantavirus infection was reported for 95.5% of all cases (dengue virus, 98.4%; chikungunya virus, 100%). Hantavirus infections were acquired in Germany in 97.6% of cases (n = 2800). In 2007, there was a marked increase of hantavirus cases, mainly in areas known to be endemic for hantavirus. In 2006, imported cases of chikungunya fever primarily returned from several islands of the Indian Ocean, while the majority of imported cases in 2007 came from India. The reported number of dengue fever cases have increased since 2004. Thailand contributed the largest proportion of cases (17-43% in individual years), followed by India, Brazil and Indonesia. Surveillance of notifiable vector-borne diseases in Germany is able to timely detect spatial and temporal changes of autochthonous an imported infections. Geographic and temporal data obtained by routine surveillance served as a basis for public health recommendations. In addition to surveillance of vector-borne infections in humans, nationwide monitoring programs and inventory techniques for emerging and reemerging vectors and for wildlife disease are warranted.

  2. Multi-disease data management system platform for vector-borne diseases.

    Directory of Open Access Journals (Sweden)

    Lars Eisen

    2011-03-01

    Full Text Available Emerging information technologies present new opportunities to reduce the burden of malaria, dengue and other infectious diseases. For example, use of a data management system software package can help disease control programs to better manage and analyze their data, and thus enhances their ability to carry out continuous surveillance, monitor interventions and evaluate control program performance.We describe a novel multi-disease data management system platform (hereinafter referred to as the system with current capacity for dengue and malaria that supports data entry, storage and query. It also allows for production of maps and both standardized and customized reports. The system is comprised exclusively of software components that can be distributed without the user incurring licensing costs. It was designed to maximize the ability of the user to adapt the system to local conditions without involvement of software developers. Key points of system adaptability include 1 customizable functionality content by disease, 2 configurable roles and permissions, 3 customizable user interfaces and display labels and 4 configurable information trees including a geographical entity tree and a term tree. The system includes significant portions of functionality that is entirely or in large part re-used across diseases, which provides an economy of scope as new diseases downstream are added to the system at decreased cost.We have developed a system with great potential for aiding disease control programs in their task to reduce the burden of dengue and malaria, including the implementation of integrated vector management programs. Next steps include evaluations of operational implementations of the current system with capacity for dengue and malaria, and the inclusion in the system platform of other important vector-borne diseases.

  3. Medical Entomology: A Reemerging Field of Research to Better Understand Vector-Borne Infectious Diseases.

    Science.gov (United States)

    Laroche, Maureen; Bérenger, Jean-Michel; Delaunay, Pascal; Charrel, Remi; Pradines, Bruno; Berger, Franck; Ranque, Stéphane; Bitam, Idir; Davoust, Bernard; Raoult, Didier; Parola, Philippe

    2017-08-15

    In the last decade, the Chikungunya and Zika virus outbreaks have turned public attention to the possibility of the expansion of vector-borne infectious diseases worldwide. Medical entomology is focused on the study of arthropods involved in human health. We review here some of the research approaches taken by the medical entomology team of the University Hospital Institute (UHI) Méditerranée Infection of Marseille, France, with the support of recent or representative studies. We propose our approaches to technical innovations in arthropod identification and the detection of microorganisms in arthropods, the use of arthropods as epidemiological or diagnostic tools, entomological investigations around clinical cases or within specific populations, and how we have developed experimental models to decipher the interactions between arthropods, microorganisms, and humans. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  4. Genetic shifting: a novel approach for controlling vector-borne diseases.

    Science.gov (United States)

    Powell, Jeffrey R; Tabachnick, Walter J

    2014-06-01

    Rendering populations of vectors of diseases incapable of transmitting pathogens through genetic methods has long been a goal of vector geneticists. We outline a method to achieve this goal that does not involve the introduction of any new genetic variants to the target population. Rather we propose that shifting the frequencies of naturally occurring alleles that confer refractoriness to transmission can reduce transmission below a sustainable level. The program employs methods successfully used in plant and animal breeding. Because no artificially constructed genetically modified organisms (GMOs) are introduced into the environment, the method is minimally controversial. We use Aedes aegypti and dengue virus (DENV) for illustrative purposes but point out that the proposed program is generally applicable to vector-borne disease control. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Modeling the spread of vector-borne diseases on bipartite networks.

    Directory of Open Access Journals (Sweden)

    Donal Bisanzio

    Full Text Available BACKGROUND: Vector-borne diseases for which transmission occurs exclusively between vectors and hosts can be modeled as spreading on a bipartite network. METHODOLOGY/PRINCIPAL FINDINGS: In such models the spreading of the disease strongly depends on the degree distribution of the two classes of nodes. It is sufficient for one of the classes to have a scale-free degree distribution with a slow enough decay for the network to have asymptotically vanishing epidemic threshold. Data on the distribution of Ixodes ricinus ticks on mice and lizards from two independent studies are well described by a scale-free distribution compatible with an asymptotically vanishing epidemic threshold. The commonly used negative binomial, instead, cannot describe the right tail of the empirical distribution. CONCLUSIONS/SIGNIFICANCE: The extreme aggregation of vectors on hosts, described by the power-law decay of the degree distribution, makes the epidemic threshold decrease with the size of the network and vanish asymptotically.

  6. Towards a resource-based habitat approach for spatial modelling of vector-borne disease risks.

    Science.gov (United States)

    Hartemink, Nienke; Vanwambeke, Sophie O; Purse, Bethan V; Gilbert, Marius; Van Dyck, Hans

    2015-11-01

    Given the veterinary and public health impact of vector-borne diseases, there is a clear need to assess the suitability of landscapes for the emergence and spread of these diseases. Current approaches for predicting disease risks neglect key features of the landscape as components of the functional habitat of vectors or hosts, and hence of the pathogen. Empirical-statistical methods do not explicitly incorporate biological mechanisms, whereas current mechanistic models are rarely spatially explicit; both methods ignore the way animals use the landscape (i.e. movement ecology). We argue that applying a functional concept for habitat, i.e. the resource-based habitat concept (RBHC), can solve these issues. The RBHC offers a framework to identify systematically the different ecological resources that are necessary for the completion of the transmission cycle and to relate these resources to (combinations of) landscape features and other environmental factors. The potential of the RBHC as a framework for identifying suitable habitats for vector-borne pathogens is explored and illustrated with the case of bluetongue virus, a midge-transmitted virus affecting ruminants. The concept facilitates the study of functional habitats of the interacting species (vectors as well as hosts) and provides new insight into spatial and temporal variation in transmission opportunities and exposure that ultimately determine disease risks. It may help to identify knowledge gaps and control options arising from changes in the spatial configuration of key resources across the landscape. The RBHC framework may act as a bridge between existing mechanistic and statistical modelling approaches. © 2014 The Authors. Biological Reviews published by John Wiley & Sons Ltd on behalf of Cambridge Philosophical Society.

  7. Risk based surveillance for vector-borne diseases in horses : combining multiple sources of evidence to improve decision making

    NARCIS (Netherlands)

    Faverjon, Céline

    2017-01-01

    Emerging vector-borne diseases are a growing concern, especially for horse populations, which are at particular risk for disease spread. In general, horses travel widely and frequently and, despite the health and economic impacts of equine diseases, effective health regulations and biosecurity

  8. Distribution and prevalence of vector-borne diseases in California chipmunks (Tamias spp..

    Directory of Open Access Journals (Sweden)

    Mary H Straub

    Full Text Available California, with 13 chipmunk (Tamias species, has more than any other state or country, occupying habitats ranging from chaparral to the high peaks of the Sierra Nevada. Chipmunks host zoonotic pathogens including Yersinia pestis, Anaplasma phagocytophilum, relapsing fever (RF Borrelia spp., Borrelia burgdorferi, and spotted fever group (SFG Rickettsia species. Chipmunk species are often not differentiated by public health workers, yet different species utilize different ecological niches and may have intrinsically different capacities for maintaining vector-borne pathogens and infecting vectors. We surveyed over 700 individuals from nine species of chipmunks throughout California for exposure to and infection by Y. pestis, A. phagocytophilum, RF Borrelia spp., Borrelia burgdorferi, and SFG Rickettsia species. DNA of all five pathogens was found and all chipmunks except Merriam's chipmunk (T. merriami were PCR-positive for at least one of the pathogens. Anaplasma phagocytophilum was most common (40.0%, 2/5 in Sonoma chipmunks (T. sonomae from Marin county and B. burgdorferi most common (37.5%, 27/72 in redwood chipmunks (T. ochrogenys from Mendocino county. RF Borrelia spp. was detected in 2% (6/297 of redwood chipmunks in Mendocino county and 10% (1/10 of both least (T. minimus and lodgepole (T. speciosus chipmunks in the western Sierra. Exposure to SFG Rickettsia spp. was found in the Northern Coastal region (Del Norte, Humboldt and Mendocino counties and in the northern and western Sierra in several species of chipmunks. Y. pestis infection was found only in the western Sierra-in a yellow-pine (T. amoenus and a long-eared (T. quadrimaculatus chipmunk. Though more data are needed to thoroughly understand the roles that different chipmunk species play in disease transmission, our findings suggest that some chipmunk species may be more important to the maintenance of vector-borne diseases than others within each geographic area.

  9. Eurasian golden jackal as host of canine vector-borne protists

    Czech Academy of Sciences Publication Activity Database

    Mitková, B.; Hrazdilová, K.; D'Amico, G.; Duscher, G. G.; Suchentrunk, F.; Forejtek, P.; Gherman, C.M.; Matei, I.A.; Ionică, A.M.; Daskalaki, A.A.; Mihalca, A. D.; Votýpka, Jan; Hulva, P.; Modrý, David

    2017-01-01

    Roč. 10, APR 14 (2017), č. článku 183. ISSN 1756-3305 Institutional support: RVO:60077344 Keywords : Eurasian golden jackal * Babesia * Hepatozoon * Theileria annae * Leishmania Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine OBOR OECD: Veterinary science Impact factor: 3.080, year: 2016

  10. Fleas, hosts and habitat: What can we predict about the spread of vector-borne zoonotic diseases?

    Science.gov (United States)

    Megan M. Friggens

    2010-01-01

    Vector-borne diseases of humans and wildlife are experiencing resurgence across the globe. I examine the dynamics of flea borne diseases through a comparative analysis of flea literature and analyses of field data collected from three sites in New Mexico: The Sevilleta National Wildlife Refuge, the Sandia Mountains and the Valles Caldera National Preserve (VCNP). My...

  11. Wildlife reservoirs for vector-borne canine, feline and zoonotic infections in Austria

    Directory of Open Access Journals (Sweden)

    Georg G. Duscher

    2015-04-01

    The role of wild ungulates, especially ruminants, as reservoirs for zoonotic disease on the other hand seems to be negligible, although the deer filaroid Onchocerca jakutensis has been described to infect humans. Deer may also harbour certain Anaplasma phagocytophilum strains with so far unclear potential to infect humans. The major role of deer as reservoirs is for ticks, mainly adults, thus maintaining the life cycle of these vectors and their distribution. Wild boar seem to be an exception among the ungulates as, in their interaction with the fox, they can introduce food-borne zoonotic agents such as Trichinella britovi and Alaria alata into the human food chain.

  12. Wildlife reservoirs for vector-borne canine, feline and zoonotic infections in Austria

    Science.gov (United States)

    Duscher, Georg G.; Leschnik, Michael; Fuehrer, Hans-Peter; Joachim, Anja

    2014-01-01

    Austria's mammalian wildlife comprises a large variety of species, acting and interacting in different ways as reservoir and intermediate and definitive hosts for different pathogens that can be transmitted to pets and/or humans. Foxes and other wild canids are responsible for maintaining zoonotic agents, e.g. Echinococcus multilocularis, as well as pet-relevant pathogens, e.g. Hepatozoon canis. Together with the canids, and less commonly felids, rodents play a major role as intermediate and paratenic hosts. They carry viruses such as tick-borne encephalitis virus (TBEV), bacteria including Borrelia spp., protozoa such as Toxoplasma gondii, and helminths such as Toxocara canis. The role of wild ungulates, especially ruminants, as reservoirs for zoonotic disease on the other hand seems to be negligible, although the deer filaroid Onchocerca jakutensis has been described to infect humans. Deer may also harbour certain Anaplasma phagocytophilum strains with so far unclear potential to infect humans. The major role of deer as reservoirs is for ticks, mainly adults, thus maintaining the life cycle of these vectors and their distribution. Wild boar seem to be an exception among the ungulates as, in their interaction with the fox, they can introduce food-borne zoonotic agents such as Trichinella britovi and Alaria alata into the human food chain. PMID:25830102

  13. Network-level reproduction number and extinction threshold for vector-borne diseases.

    Science.gov (United States)

    Xue, Ling; Scoglio, Caterina

    2015-06-01

    The basic reproduction number of deterministic models is an essential quantity to predict whether an epidemic will spread or not. Thresholds for disease extinction contribute crucial knowledge of disease control, elimination, and mitigation of infectious diseases. Relationships between basic reproduction numbers of two deterministic network-based ordinary differential equation vector-host models, and extinction thresholds of corresponding stochastic continuous-time Markov chain models are derived under some assumptions. Numerical simulation results for malaria and Rift Valley fever transmission on heterogeneous networks are in agreement with analytical results without any assumptions, reinforcing that the relationships may always exist and proposing a mathematical problem for proving existence of the relationships in general. Moreover, numerical simulations show that the basic reproduction number does not monotonically increase or decrease with the extinction threshold. Consistent trends of extinction probability observed through numerical simulations provide novel insights into mitigation strategies to increase the disease extinction probability. Research findings may improve understandings of thresholds for disease persistence in order to control vector-borne diseases.

  14. R0 for vector-borne diseases: impact of the assumption for the duration of the extrinsic incubation period

    NARCIS (Netherlands)

    Hartemink, Nienke; Cianci, Daniela; Reiter, Paul

    2015-01-01

    Mathematical modeling and notably the basic reproduction number R0 have become popular tools for the description of vector-borne disease dynamics. We compare two widely used methods to calculate the probability of a vector to survive the extrinsic incubation period. The two methods are based on

  15. Mapping the basic reproduction number (Ro) for vector-borne diseases: A case study on bluetongue virus.

    NARCIS (Netherlands)

    Hartemink, N.; Purse, B.V.; Meiswinkel, R.; Brown, H.E.; Koeijer, de A.A.; Elbers, A.R.W.; Boender, G.J.; Rogers, D.J.; Heesterbeek, J.A.P.

    2009-01-01

    Geographical maps indicating the value of the basic reproduction number, R0, can be used to identify areas of higher risk for an outbreak after an introduction. We develop a methodology to create R0 maps for vector-borne diseases, using bluetongue virus as a case study. This method provides a tool

  16. Global trends in the production and use of DDT for control of malaria and other vector-borne diseases

    NARCIS (Netherlands)

    Berg, van den Henk; Manuweera, Gamini; Konradsen, Flemming

    2017-01-01

    Background: DDT was among the initial persistent organic pollutants listed under the Stockholm Convention and continues to be used for control of malaria and other vector-borne diseases in accordance with its provisions on acceptable purposes. Trends in the production and use of DDT were

  17. Recent Weather Extremes and Impacts on Agricultural Production and Vector-Borne Disease Outbreak Patterns

    Science.gov (United States)

    Anyamba, Assaf; Small, Jennifer L.; Britch, Seth C.; Tucker, Compton J.; Pak, Edwin W.; Reynolds, Curt A.; Crutchfield, James; Linthicum, Kenneth J.

    2014-01-01

    We document significant worldwide weather anomalies that affected agriculture and vector-borne disease outbreaks during the 2010-2012 period. We utilized 2000-2012 vegetation index and land surface temperature data from NASA's satellite-based Moderate Resolution Imaging Spectroradiometer (MODIS) to map the magnitude and extent of these anomalies for diverse regions including the continental United States, Russia, East Africa, Southern Africa, and Australia. We demonstrate that shifts in temperature and/or precipitation have significant impacts on vegetation patterns with attendant consequences for agriculture and public health. Weather extremes resulted in excessive rainfall and flooding as well as severe drought, which caused,10 to 80% variation in major agricultural commodity production (including wheat, corn, cotton, sorghum) and created exceptional conditions for extensive mosquito-borne disease outbreaks of dengue, Rift Valley fever, Murray Valley encephalitis, and West Nile virus disease. Analysis of MODIS data provided a standardized method for quantifying the extreme weather anomalies observed during this period. Assessments of land surface conditions from satellite-based systems such as MODIS can be a valuable tool in national, regional, and global weather impact determinations.

  18. Recent weather extremes and impacts on agricultural production and vector-borne disease outbreak patterns.

    Directory of Open Access Journals (Sweden)

    Assaf Anyamba

    Full Text Available We document significant worldwide weather anomalies that affected agriculture and vector-borne disease outbreaks during the 2010-2012 period. We utilized 2000-2012 vegetation index and land surface temperature data from NASA's satellite-based Moderate Resolution Imaging Spectroradiometer (MODIS to map the magnitude and extent of these anomalies for diverse regions including the continental United States, Russia, East Africa, Southern Africa, and Australia. We demonstrate that shifts in temperature and/or precipitation have significant impacts on vegetation patterns with attendant consequences for agriculture and public health. Weather extremes resulted in excessive rainfall and flooding as well as severe drought, which caused ∼10 to 80% variation in major agricultural commodity production (including wheat, corn, cotton, sorghum and created exceptional conditions for extensive mosquito-borne disease outbreaks of dengue, Rift Valley fever, Murray Valley encephalitis, and West Nile virus disease. Analysis of MODIS data provided a standardized method for quantifying the extreme weather anomalies observed during this period. Assessments of land surface conditions from satellite-based systems such as MODIS can be a valuable tool in national, regional, and global weather impact determinations.

  19. Incidence of Vector-borne Disease and Climate Change: A Study in Semi-arid Algeria

    Science.gov (United States)

    Blakey, T.; Bounoua, L.

    2012-12-01

    Leishmaniases are among the most important emerging and resurging vector-borne diseases, second only to malaria in terms of the number of affected people. Leishmaniases are endemic in 88 countries worldwide and threaten about 350 million people (WHO, 2007). Since the first reported case of zoonotic cutaneous leishmaniasis (ZCL) in Saida, Algeria in 1991, 1,275 cases have been recorded (Makhlouf & Houti, 2010) with the vast majority of study-area cases (99%) reported between the years of 2000 and 2009. An investigation of potential climatic indicators for the apparent shift in disease prevalence was conducted by comparing anomalies in the climate data specific to the local pathogen cycle. It was determined that long term climate trends have resulted in conditions that promote the prevalence of ZCL. Increased precipitation have resulted in greater vegetation and promoted host and vector population growth through a trophic cascade. Increased minimum temperatures have lengthened the annual duration of sandfly activity. Short term variations in maximum temperatures, however show a correlation with disease suppression in the subsequent years. These findings indicate a potential to forecast the risk of ZCL infection through models of the trophic cascade and sandfly population growth.

  20. Vector-borne parasitic infections in dogs in the Baltic and Nordic countries: A questionnaire study to veterinarians on canine babesiosis and infections with Dirofilaria immitis and Dirofilaria repens.

    Science.gov (United States)

    Tiškina, Valentina; Jokelainen, Pikka

    2017-09-15

    Canine vector-borne diseases have been spreading northwards in Europe, and canine babesiosis and infections with Dirofilaria immitis (heartworm) and Dirofilaria repens have been diagnosed also in the Baltic and the Nordic countries. We used an online questionnaire to survey how large a proportion of veterinarians in the Baltic (Estonia, Latvia, and Lithuania) and the Nordic countries (Denmark, Finland, Iceland, Norway, and Sweden) saw canine babesiosis cases and dogs infected with D. immitis and D. repens in 2016. In addition, questions regarding transmission, zoonotic potential, clinical signs, and treatment of the infections were asked. The questionnaire was completed by 122 veterinarians. In 2016, 23% of them had seen at least one case of canine babesiosis, 15% at least one dog with D. immitis infection, and 9% at least one dog with D. repens infection. A veterinarian working in the Baltic countries had 12.2 times higher odds to have seen a canine babesiosis case and 9.3 times higher odds to have seen a dog with D. repens infection than a veterinarian working in the Nordic countries did. While 48% of the veterinarians knew that canine babesiosis is not considered a zoonosis, 26% knew that D. immitis is zoonotic and 34% knew that D. repens is zoonotic. The results suggested that autochthonous cases of the three vector-borne parasitic infections were seen by veterinarians in the Baltic countries, whereas most cases seen by veterinarians in the Nordic countries appeared to be imported. A substantial proportion of the veterinarians did not know whether the parasites are zoonotic. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Protection of Military Personnel Against Vector-Borne Diseases: A Review of Collaborative Work of the Australian and US Military Over the Last 30 Years.

    Science.gov (United States)

    Frances, Stephen P; Edstein, Michael D; Debboun, Mustapha; Shanks, G Dennis

    2016-01-01

    Australian and US military medical services have collaborated since World War II to minimize vector-borne diseases such as malaria, dengue, and scrub typhus. In this review, collaboration over the last 30 years is discussed. The collaborative projects and exchange scientist programs have resulted in mutually beneficial outcomes in the fields of drug development and personal protection measures against vector-borne diseases.

  2. Integrated pest management and allocation of control efforts for vector-borne diseases

    Science.gov (United States)

    Ginsberg, H.S.

    2001-01-01

    Applications of various control methods were evaluated to determine how to integrate methods so as to minimize the number of human cases of vector-borne diseases. These diseases can be controlled by lowering the number of vector-human contacts (e.g., by pesticide applications or use of repellents), or by lowering the proportion of vectors infected with pathogens (e.g., by lowering or vaccinating reservoir host populations). Control methods should be combined in such a way as to most efficiently lower the probability of human encounter with an infected vector. Simulations using a simple probabilistic model of pathogen transmission suggest that the most efficient way to integrate different control methods is to combine methods that have the same effect (e.g., combine treatments that lower the vector population; or combine treatments that lower pathogen prevalence in vectors). Combining techniques that have different effects (e.g., a technique that lowers vector populations with a technique that lowers pathogen prevalence in vectors) will be less efficient than combining two techniques that both lower vector populations or combining two techniques that both lower pathogen prevalence, costs being the same. Costs of alternative control methods generally differ, so the efficiency of various combinations at lowering human contact with infected vectors should be estimated at available funding levels. Data should be collected from initial trials to improve the effects of subsequent interventions on the number of human cases.

  3. Response to an emerging vector-borne disease: surveillance and preparedness for Schmallenberg virus.

    Science.gov (United States)

    Roberts, H C; Elbers, A R W; Conraths, F J; Holsteg, M; Hoereth-Boentgen, D; Gethmann, J; van Schaik, G

    2014-10-15

    Surveillance for new emerging animal diseases from a European perspective is complicated by the non-harmonised approach across Member States for data capture, recording livestock populations and case definitions. In the summer of 2011, a new vector-borne Orthobunyavirus emerged in Northern Europe and for the first time, a coordinated approach to horizon scanning, risk communication, data and diagnostic test sharing allowed EU Member States to develop early predictions of the disease, its impact and risk management options. There are many different systems in place across the EU for syndromic and scanning surveillance and the differences in these systems have presented epidemiologists and risk assessors with concerns about their combined use in early identification of an emerging disease. The emergence of a new disease always will raise challenging issues around lack of capability and lack of knowledge; however, Schmallenberg virus (SBV) gave veterinary authorities an additional complex problem: the infection caused few clinical signs in adult animals, with no indication of the possible source and little evidence about its spread or means of transmission. This paper documents the different systems in place in some of the countries (Germany and the Netherlands) which detected disease initially and predicted its spread (to the UK) and how information sharing helped to inform early warning and risk assessment for Member States. Microarray technology was used to identify SBV as a new pathogen and data from the automated cattle milking systems coupled with farmer-derived data on reporting non-specific clinical signs gave the first indications of a widespread issue while the UK used meteorological modelling to map disease incursion. The coordinating role of both EFSA and the European Commission were vital as are the opportunities presented by web-based publishing for disseminating information to industry and the public. The future of detecting emerging disease looks more

  4. Climate change and vector-borne diseases: what are the implications for public health research and policy?

    OpenAIRE

    Campbell-Lendrum, Diarmid; Manga, Lucien; Bagayoko, Magaran; Sommerfeld, Johannes

    2015-01-01

    Vector-borne diseases continue to contribute significantly to the global burden of disease, and cause epidemics that disrupt health security and cause wider socioeconomic impacts around the world. All are sensitive in different ways to weather and climate conditions, so that the ongoing trends of increasing temperature and more variable weather threaten to undermine recent global progress against these diseases. Here, we review the current state of the global public health effort to address t...

  5. Vector-borne disease surveillance in livestock populations: a critical review of literature recommendations and implemented surveillance (BTV-8) in five European countries

    DEFF Research Database (Denmark)

    Dórea, Fernanda C.; Elbers, Armin R.W.; Hendrikx, Pascal

    2016-01-01

    Preparedness against vector-borne threats depends on the existence of a long-term, sustainable surveillance of vector-borne disease and their relevant vectors. This work reviewed the availability of such surveillance systems in five European countries (Denmark, France, The Netherlands, Sweden and...

  6. Understanding uncertainty in temperature effects on vector-borne disease: a Bayesian approach

    Science.gov (United States)

    Johnson, Leah R.; Ben-Horin, Tal; Lafferty, Kevin D.; McNally, Amy; Mordecai, Erin A.; Paaijmans, Krijn P.; Pawar, Samraat; Ryan, Sadie J.

    2015-01-01

    Extrinsic environmental factors influence the distribution and population dynamics of many organisms, including insects that are of concern for human health and agriculture. This is particularly true for vector-borne infectious diseases like malaria, which is a major source of morbidity and mortality in humans. Understanding the mechanistic links between environment and population processes for these diseases is key to predicting the consequences of climate change on transmission and for developing effective interventions. An important measure of the intensity of disease transmission is the reproductive number R0. However, understanding the mechanisms linking R0 and temperature, an environmental factor driving disease risk, can be challenging because the data available for parameterization are often poor. To address this, we show how a Bayesian approach can help identify critical uncertainties in components of R0 and how this uncertainty is propagated into the estimate of R0. Most notably, we find that different parameters dominate the uncertainty at different temperature regimes: bite rate from 15°C to 25°C; fecundity across all temperatures, but especially ~25–32°C; mortality from 20°C to 30°C; parasite development rate at ~15–16°C and again at ~33–35°C. Focusing empirical studies on these parameters and corresponding temperature ranges would be the most efficient way to improve estimates of R0. While we focus on malaria, our methods apply to improving process-based models more generally, including epidemiological, physiological niche, and species distribution models.

  7. Internet-based biosurveillance methods for vector-borne diseases: Are they novel public health tools or just novelties?

    Science.gov (United States)

    Pollett, Simon; Althouse, Benjamin M; Forshey, Brett; Rutherford, George W; Jarman, Richard G

    2017-11-01

    Internet-based surveillance methods for vector-borne diseases (VBDs) using "big data" sources such as Google, Twitter, and internet newswire scraping have recently been developed, yet reviews on such "digital disease detection" methods have focused on respiratory pathogens, particularly in high-income regions. Here, we present a narrative review of the literature that has examined the performance of internet-based biosurveillance for diseases caused by vector-borne viruses, parasites, and other pathogens, including Zika, dengue, other arthropod-borne viruses, malaria, leishmaniasis, and Lyme disease across a range of settings, including low- and middle-income countries. The fundamental features, advantages, and drawbacks of each internet big data source are presented for those with varying familiarity of "digital epidemiology." We conclude with some of the challenges and future directions in using internet-based biosurveillance for the surveillance and control of VBD.

  8. Internet-based biosurveillance methods for vector-borne diseases: Are they novel public health tools or just novelties?

    Directory of Open Access Journals (Sweden)

    Simon Pollett

    2017-11-01

    Full Text Available Internet-based surveillance methods for vector-borne diseases (VBDs using "big data" sources such as Google, Twitter, and internet newswire scraping have recently been developed, yet reviews on such "digital disease detection" methods have focused on respiratory pathogens, particularly in high-income regions. Here, we present a narrative review of the literature that has examined the performance of internet-based biosurveillance for diseases caused by vector-borne viruses, parasites, and other pathogens, including Zika, dengue, other arthropod-borne viruses, malaria, leishmaniasis, and Lyme disease across a range of settings, including low- and middle-income countries. The fundamental features, advantages, and drawbacks of each internet big data source are presented for those with varying familiarity of "digital epidemiology." We conclude with some of the challenges and future directions in using internet-based biosurveillance for the surveillance and control of VBD.

  9. Surveillance of vector-borne pathogens under imperfect detection: lessons from Chagas disease risk (mis)measurement.

    Science.gov (United States)

    Minuzzi-Souza, Thaís Tâmara Castro; Nitz, Nadjar; Cuba, César Augusto Cuba; Hagström, Luciana; Hecht, Mariana Machado; Santana, Camila; Ribeiro, Marcelle; Vital, Tamires Emanuele; Santalucia, Marcelo; Knox, Monique; Obara, Marcos Takashi; Abad-Franch, Fernando; Gurgel-Gonçalves, Rodrigo

    2018-01-09

    Vector-borne pathogens threaten human health worldwide. Despite their critical role in disease prevention, routine surveillance systems often rely on low-complexity pathogen detection tests of uncertain accuracy. In Chagas disease surveillance, optical microscopy (OM) is routinely used for detecting Trypanosoma cruzi in its vectors. Here, we use replicate T. cruzi detection data and hierarchical site-occupancy models to assess the reliability of OM-based T. cruzi surveillance while explicitly accounting for false-negative and false-positive results. We investigated 841 triatomines with OM slides (1194 fresh, 1192 Giemsa-stained) plus conventional (cPCR, 841 assays) and quantitative PCR (qPCR, 1682 assays). Detections were considered unambiguous only when parasitologists unmistakably identified T. cruzi in Giemsa-stained slides. qPCR was >99% sensitive and specific, whereas cPCR was ~100% specific but only ~55% sensitive. In routine surveillance, examination of a single OM slide per vector missed ~50-75% of infections and wrongly scored as infected ~7% of the bugs. qPCR-based and model-based infection frequency estimates were nearly three times higher, on average, than OM-based indices. We conclude that the risk of vector-borne Chagas disease may be substantially higher than routine surveillance data suggest. The hierarchical modelling approach we illustrate can help enhance vector-borne disease surveillance systems when pathogen detection is imperfect.

  10. Zoonotic and vector borne agents causing disease in adult patients hospitalized due to fever of unknown origin in Thailand

    Directory of Open Access Journals (Sweden)

    Soawapak Hinjoy

    2017-10-01

    Full Text Available Objective: To determine the etiologic agents of fever of unknown origin among populations in agricultural communities and to assess the possible risk factors for zoonotic infections. Methods: Hospitalized patients with fever of unknown origin under physician care were asked to participate and provide blood samples for laboratory tests and screening for endemic diseases at the hospitals. Samples were stored at –80 °C until they were tested at Chulalongkorn University to identify additional pathogens. Results: We were able to identify the etiologic agents in 24.6% of the 463 enrolled patients. Zoonotic and vector borne agents were confirmed in 59 cases (12.7%. Dengue virus (7.3% was the most frequently detected disease followed by scrub typhus (3.2%. There were two cases of comorbidities of scrub typhus and dengue fever. The other six cases of zoonoses were leptospirosis, melioidosis, and Streptococcus suis infections. Patients with zoonotic/vector borne agents noticed rats in their houses and reported having contact with livestock feces more frequently than those patients without zoonotic/vector borne agents. Conclusions: Dengue virus and scrub typhus were mostly detected in the rainy season. During this specific season, clinicians should raise awareness of those diseases when any patients are admitted to the hospital with fever of an unidentified source.

  11. The ecological foundations of transmission potential and vector-borne disease in urban landscapes.

    Science.gov (United States)

    LaDeau, Shannon L; Allan, Brian F; Leisnham, Paul T; Levy, Michael Z

    2015-07-01

    Urban transmission of arthropod-vectored disease has increased in recent decades. Understanding and managing transmission potential in urban landscapes requires integration of sociological and ecological processes that regulate vector population dynamics, feeding behavior, and vector-pathogen interactions in these unique ecosystems. Vectorial capacity is a key metric for generating predictive understanding about transmission potential in systems with obligate vector transmission. This review evaluates how urban conditions, specifically habitat suitability and local temperature regimes, and the heterogeneity of urban landscapes can influence the biologically-relevant parameters that define vectorial capacity: vector density, survivorship, biting rate, extrinsic incubation period, and vector competence.Urban landscapes represent unique mosaics of habitat. Incidence of vector-borne disease in urban host populations is rarely, if ever, evenly distributed across an urban area. The persistence and quality of vector habitat can vary significantly across socio-economic boundaries to influence vector species composition and abundance, often generating socio-economically distinct gradients of transmission potential across neighborhoods.Urban regions often experience unique temperature regimes, broadly termed urban heat islands (UHI). Arthropod vectors are ectothermic organisms and their growth, survival, and behavior are highly sensitive to environmental temperatures. Vector response to UHI conditions is dependent on regional temperature profiles relative to the vector's thermal performance range. In temperate climates UHI can facilitate increased vector development rates while having countervailing influence on survival and feeding behavior. Understanding how urban heat island (UHI) conditions alter thermal and moisture constraints across the vector life cycle to influence transmission processes is an important direction for both empirical and modeling research.There remain

  12. Challenges in predicting climate and environmental effects on vector-borne disease episystems in a changing world.

    Science.gov (United States)

    Tabachnick, W J

    2010-03-15

    Vector-borne pathogens cause enormous suffering to humans and animals. Many are expanding their range into new areas. Dengue, West Nile and Chikungunya have recently caused substantial human epidemics. Arthropod-borne animal diseases like Bluetongue, Rift Valley fever and African horse sickness pose substantial threats to livestock economies around the world. Climate change can impact the vector-borne disease epidemiology. Changes in climate will influence arthropod vectors, their life cycles and life histories, resulting in changes in both vector and pathogen distribution and changes in the ability of arthropods to transmit pathogens. Climate can affect the way pathogens interact with both the arthropod vector and the human or animal host. Predicting and mitigating the effects of future changes in the environment like climate change on the complex arthropod-pathogen-host epidemiological cycle requires understanding of a variety of complex mechanisms from the molecular to the population level. Although there has been substantial progress on many fronts the challenges to effectively understand and mitigate the impact of potential changes in the environment on vector-borne pathogens are formidable and at an early stage of development. The challenges will be explored using several arthropod-borne pathogen systems as illustration, and potential avenues to meet the challenges will be presented.

  13. Advanced megaesophagus (Group III secondary to vector-borne Chagas disease in a 20-month-old infant

    Directory of Open Access Journals (Sweden)

    Anis Rassi

    2012-04-01

    Full Text Available The authors report the case of a female infant with Group III (or Grade III megaesophagus secondary to vector-borne Chagas disease, resulting in severe malnutrition that reversed after surgery (Heller technique. The infant was then treated with the antiparasitic drug benznidazole, and the infection was cured, as demonstrated serologically and parasitologically. After follow-up of several years without evidence of disease, with satisfactory weight and height development, the patient had her first child at age 23, in whom serological tests for Chagas disease yielded negative results. Thirty years after the initial examination, the patient's electrocardiogram, echocardiogram, and chest radiography remained normal.

  14. Emerging vector-borne diseases in dromedaries in Tunisia: West Nile, bluetongue, epizootic haemorrhagic disease and Rift Valley fever.

    Science.gov (United States)

    Hassine, Thameur B; Amdouni, Jihane; Monaco, Federica; Savini, Giovanni; Sghaier, Soufien; Selimen, Imed B; Chandoul, Walid; Hamida, Khaled B; Hammami, Salah

    2017-03-31

    A total of 118 sera were collected during 2016 from two groups of dromedaries from Kebili and Medenine governorates in the south of Tunisia. The aim of this study was to provide the first serological investigation of four emerging vector-borne diseases in two groups of dromedaries in Tunisia. Sera were tested by ELISA and serum neutralisation test to identify West Nile virus (WNV), bluetongue virus (BTV), epizootic haemorrhagic disease virus (EHDV) and Rift Valley fever virus (RVFV). In the first group, the seroprevalence for BTV was 4.6%, while in the second group, it was 25.8% for WNV and 9.7% for BTV. Only serotype 1 was detected for BTV in the two groups. No evidence for circulation of RVF and EHD viruses was revealed. Results indicated that dromedaries can be infected with BTV and WNV, suggesting that this species might play a significant role in the epizootiology of these viral diseases in Tunisia and neighbouring countries.

  15. Disease-modeling as a tool for surveillance, foresight and control of exotic vector borne diseases in the Nordic countries

    DEFF Research Database (Denmark)

    Bødker, Rene

    period e.g. a monthly temperature mean. Average monthly temperatures are likely to be suitable for predicting permanent establishment of presently exotic diseases. But mean temperatures may not predict the true potential for local spread or limited outbreaks resulting from accidental introductions...... for continuous risk assessment of the potential for local spread of exotic insect borne diseases of veterinary and human importance. In this system R0-models for various vector borne diseases are continuously updated with spatial temperature data to quantify the present risk of autochthonous cases (R0......>0) and the present risk of epidemics (R0>1) should an infected vector or host be introduced to the area. The continuously updated risk assessment maps function as an early warning system allowing authorities and industry to increase awareness and preventive measures when R0 raises above the level of ‗no possible...

  16. Criteria for the prioritization of public health interventions for climate-sensitive vector-borne diseases in Quebec.

    Directory of Open Access Journals (Sweden)

    Valerie Hongoh

    Full Text Available Prioritizing resources for optimal responses to an ever growing list of existing and emerging infectious diseases represents an important challenge to public health. In the context of climate change, there is increasing anticipated variability in the occurrence of infectious diseases, notably climate-sensitive vector-borne diseases. An essential step in prioritizing efforts is to identify what considerations and concerns to take into account to guide decisions and thus set disease priorities. This study was designed to perform a comprehensive review of criteria for vector-borne disease prioritization, assess their applicability in a context of climate change with a diverse cross-section of stakeholders in order to produce a baseline list of considerations to use in this decision-making context. Differences in stakeholder choices were examined with regards to prioritization of these criteria for research, surveillance and disease prevention and control objectives. A preliminary list of criteria was identified following a review of the literature. Discussions with stakeholders were held to consolidate and validate this list of criteria and examine their effects on disease prioritization. After this validation phase, a total of 21 criteria were retained. A pilot vector-borne disease prioritization exercise was conducted using PROMETHEE to examine the effects of the retained criteria on prioritization in different intervention domains. Overall, concerns expressed by stakeholders for prioritization were well aligned with categories of criteria identified in previous prioritization studies. Weighting by category was consistent between stakeholders overall, though some significant differences were found between public health and non-public health stakeholders. From this exercise, a general model for climate-sensitive vector-borne disease prioritization has been developed that can be used as a starting point for further public health prioritization

  17. Criteria for the prioritization of public health interventions for climate-sensitive vector-borne diseases in Quebec.

    Science.gov (United States)

    Hongoh, Valerie; Gosselin, Pierre; Michel, Pascal; Ravel, André; Waaub, Jean-Philippe; Campagna, Céline; Samoura, Karim

    2017-01-01

    Prioritizing resources for optimal responses to an ever growing list of existing and emerging infectious diseases represents an important challenge to public health. In the context of climate change, there is increasing anticipated variability in the occurrence of infectious diseases, notably climate-sensitive vector-borne diseases. An essential step in prioritizing efforts is to identify what considerations and concerns to take into account to guide decisions and thus set disease priorities. This study was designed to perform a comprehensive review of criteria for vector-borne disease prioritization, assess their applicability in a context of climate change with a diverse cross-section of stakeholders in order to produce a baseline list of considerations to use in this decision-making context. Differences in stakeholder choices were examined with regards to prioritization of these criteria for research, surveillance and disease prevention and control objectives. A preliminary list of criteria was identified following a review of the literature. Discussions with stakeholders were held to consolidate and validate this list of criteria and examine their effects on disease prioritization. After this validation phase, a total of 21 criteria were retained. A pilot vector-borne disease prioritization exercise was conducted using PROMETHEE to examine the effects of the retained criteria on prioritization in different intervention domains. Overall, concerns expressed by stakeholders for prioritization were well aligned with categories of criteria identified in previous prioritization studies. Weighting by category was consistent between stakeholders overall, though some significant differences were found between public health and non-public health stakeholders. From this exercise, a general model for climate-sensitive vector-borne disease prioritization has been developed that can be used as a starting point for further public health prioritization exercises relating to

  18. Engaging scientists: An online survey exploring the experience of innovative biotechnological approaches to controlling vector-borne diseases.

    Science.gov (United States)

    Boëte, Christophe; Beisel, Uli; Reis Castro, Luísa; Césard, Nicolas; Reeves, R Guy

    2015-08-10

    Pioneering technologies (e.g., nanotechnology, synthetic biology or climate engineering) are often associated with potential new risks and uncertainties that can become sources of controversy. The communication of information during their development and open exchanges between stakeholders is generally considered a key issue in their acceptance. While the attitudes of the public to novel technologies have been widely considered there has been relatively little investigation of the perceptions and awareness of scientists working on human or animal diseases transmitted by arthropods. Consequently, we conducted a global survey on 1889 scientists working on aspects of vector-borne diseases, exploring, under the light of a variety of demographic and professional factors, their knowledge and awareness of an emerging biotechnology that has the potential to revolutionize the control of pest insect populations. Despite extensive media coverage of key developments (including releases of manipulated mosquitoes into human communities) this has in only one instance resulted in scientist awareness exceeding 50% on a national or regional scale. We document that awareness of pioneering releases significantly relied on private communication sources that were not equally accessible to scientists from countries with endemic vector-borne diseases (dengue and malaria). In addition, we provide quantitative analysis of the perceptions and knowledge of specific biotechnological approaches to controlling vector-borne disease, which are likely to impact the way in which scientists around the world engage in the debate about their value. Our results indicate that there is scope to strengthen already effective methods of communication, in addition to a strong demand by scientists (expressed by 79.9% of respondents) to develop new, creative modes of public engagement.

  19. Priorities and needs for research on urban interventions targeting vector-borne diseases: rapid review of scoping and systematic reviews.

    Science.gov (United States)

    Bermudez-Tamayo, Clara; Mukamana, Olive; Carabali, Mabel; Osorio, Lyda; Fournet, Florence; Dabiré, Kounbobr Roch; Turchi Marteli, Celina; Contreras, Adolfo; Ridde, Valéry

    2016-12-01

    This paper highlights the critical importance of evidence on vector-borne diseases (VBD) prevention and control interventions in urban settings when assessing current and future needs, with a view to setting policy priorities that promote inclusive and equitable urban health services. Research should produce knowledge about policies and interventions that are intended to control and prevent VBDs at the population level and to reduce inequities. Such interventions include policy, program, and resource distribution approaches that address the social determinants of health and exert influence at organizational and system levels.

  20. Pre-travel advice concerning vector-borne diseases received by travelers prior to visiting Cuzco, Peru.

    Science.gov (United States)

    Mejia, Christian R; Centeno, Emperatriz; Cruz, Briggitte; Cvetkovic-Vega, Aleksandar; Delgado, Edison; Rodriguez-Morales, Alfonso J

    2016-01-01

    Peru is an increasingly popular tourist destination that poses a risk to travelers due to endemic vector-borne diseases (VBDs). The objective of our study was to determine which factors are associated with receiving pre-travel advice (PTA) for VBDs among travelers visiting Cuzco, Peru. A cross-sectional secondary analysis based on data from a survey among travelers departing Cuzco at Alejandro Velazco Astete International Airport during the period January-March 2012 was conducted. From the 1819 travelers included in the original study, 1717 were included in secondary data analysis. Of these participants, 42.2% received PTA and 2.9% were informed about vector-borne diseases, including yellow fever (1.8%), malaria (1.6%) and dengue fever (0.1%). Receiving information on VBDs was associated with visiting areas endemic to yellow fever and dengue fever in Peru. The only disease travelers received specific recommendations for before visiting an endemic area for was yellow fever. Only 1 in 30 tourists received information on VBD prevention; few of those who traveled to an endemic area were warned about specific risks for infectious diseases prior to their trip. These important findings show that most tourists who travel to Peru do not receive PTA for the prevention of infectious and VBD, which can affect not only the travelers but their countries of origin as well. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  1. Prevalence of select vector-borne disease agents in owned dogs of Ghana

    Directory of Open Access Journals (Sweden)

    Lorelei L. Clarke

    2014-09-01

    Full Text Available Ticks, sera and ethylenediaminetetraacetic acid (EDTA blood were collected from dogs evaluated at the Amakom Veterinary Clinic in Kumasi, Ghana. Sera were evaluated for Dirofilaria immitis antigen and antibodies against Borrelia burgdorferi, Anaplasma phagocytophilum and Ehrlichia canis. Conventional polymerase chain reaction assays designed to amplify the deoxyribonucleic acid (DNA ofEhrlichia spp. or Anaplasma spp. or Neorickettsia spp. or Wolbachia spp., Babesia spp., Rickettsia spp., Hepatozoon spp., Bartonella spp. and the haemoplasmas were performed on DNA extracted from EDTA blood and all positive amplicons were sequenced. This small survey shows that the following vector-borne pathogens are present in urban Ghanian dogs: Ehrlichia canis, Hepatozoon canis,Dirofilaria immitis and Anaplasma platys. Bartonella henselae was isolated from ticks but not from the dogs.

  2. Reflections on the Anopheles gambiae genome sequence, transgenic mosquitoes and the prospect for controlling malaria and other vector borne diseases.

    Science.gov (United States)

    Tabachnick, Walter J

    2003-09-01

    The completion of the Anopheles gambiae Giles genome sequencing project is a milestone toward developing more effective strategies in reducing the impact of malaria and other vector borne diseases. The successes in developing transgenic approaches using mosquitoes have provided another essential new tool for further progress in basic vector genetics and the goal of disease control. The use of transgenic approaches to develop refractory mosquitoes is also possible. The ability to use genome sequence to identify genes, and transgenic approaches to construct refractory mosquitoes, has provided the opportunity that with the future development of an appropriate genetic drive system, refractory transgenes can be released into vector populations leading to nontransmitting mosquitoes. An. gambiae populations incapable of transmitting malaria. This compelling strategy will be very difficult to achieve and will require a broad substantial research program for success. The fundamental information that is required on genome structure, gene function and environmental effects on genetic expression are largely unknown. The ability to predict gene effects on phenotype is rudimentary, particularly in natural populations. As a result, the release of a refractory transgene into natural mosquito populations is imprecise and there is little ability to predict unintended consequences. The new genetic tools at hand provide opportunities to address an array of important issues, many of which can have immediate impact on the effectiveness of a host of strategies to control vector borne disease. Transgenic release approaches represent only one strategy that should be pursued. A balanced research program is required.

  3. A review of trends in the distribution of vector-borne diseases: is international trade contributing to their spread?

    Science.gov (United States)

    de La Rocque, S; Balenghien, T; Halos, L; Dietze, K; Claes, F; Ferrari, G; Guberti, V; Slingenbergh, J

    2011-04-01

    It is difficult to determine the part that international trade has played in the expansion of vector-borne diseases, because of the multitude of factors that affect the transformation of habitats and the interfaces between vectors and hosts. The introduction of pathogens through trade in live animals or products of animal origin, as well as the arrival of arthropod vectors, is probably quite frequent but the establishment of an efficient transmission system that develops into a disease outbreak remains the exception. In this paper, based on well-documented examples, the authors review the ecological and epidemiological characteristics of vector-borne diseases that may have been affected in their spread and change of distribution by international trade. In addition, they provide a detailed analysis of the risks associated with specific trade routes and recent expansions of vector populations. Finally, the authors highlight the importance, as well as the challenges, of preventive surveillance and regulation. The need for improved monitoring of vector populations and a readiness to face unpredictable epidemiological events are also emphasised, since this will require rapid reaction, not least in the regulatory context.

  4. R0-modeling as a tool for early warning and surveillance of exotic vector borne diseases in Denmark

    DEFF Research Database (Denmark)

    Bødker, Rene

    2011-01-01

    for predicting permanent establishment of presently exotic diseases, mean temperatures may not predict the true potential for local spread and limited outbreaks resulting from accidental introductions in years with temporary periods of warm weather. DTU-Veterinary Institute is developing a system for continuous...... a truly risk based surveillance system for insect borne diseases. R0 models for many vector borne diseases are simple and the available estimates of model parameters like vector densities and survival rates may be uncertain. The quantitative value of R0 estimated from such models is therefore likely......Modeling the potential transmission intensity of insect borne diseases with climate driven R0 process models is frequently used to assess the potential for veterinary and human infections to become established in non endemic areas. Models are often based on mean temperatures of an arbitrary time...

  5. R0-modeling as a tool for early warning and surveillance of exotic vector borne diseases in Denmark

    DEFF Research Database (Denmark)

    Bødker, Rene; Kristensen, Birgit; Græsbøll, Kaare

    2011-01-01

    local spread of exotic insect borne diseases of veterinary and human importance. R0 models for various vector borne diseases are continuously updated with spatial temperature data to quantify the present risk of autochthonous cases (R0>0) and the present risk of epidemics (R0>1) in case an infected...... surveillance to these limited periods of potential risk, thus dramatically reducing the number of samples collected and analysed. The risk estimated from the R0 modelling may be combined with the risk of introduction from neighbouring countries and trading partners to generate a truly risk based surveillance......Modelling the potential transmission intensity of insect borne diseases with climate driven R0 process models is frequently used to assess the potential for veterinary and human infections to become established in non endemic areas. Models are often based on mean temperatures of an arbitrary time...

  6. Emerging vector-borne diseases in dromedaries in Tunisia: West Nile, bluetongue, epizootic haemorrhagic disease and Rift Valley fever

    Directory of Open Access Journals (Sweden)

    Thameur B. Hassine

    2017-03-01

    Full Text Available A total of 118 sera were collected during 2016 from two groups of dromedaries from Kebili and Medenine governorates in the south of Tunisia. The aim of this study was to provide the first serological investigation of four emerging vector-borne diseases in two groups of dromedaries in Tunisia. Sera were tested by ELISA and serum neutralisation test to identify West Nile virus (WNV, bluetongue virus (BTV, epizootic haemorrhagic disease virus (EHDV and Rift Valley fever virus (RVFV. In the first group, the seroprevalence for BTV was 4.6%, while in the second group, it was 25.8% for WNV and 9.7% for BTV. Only serotype 1 was detected for BTV in the two groups. No evidence for circulation of RVF and EHD viruses was revealed. Results indicated that dromedaries can be infected with BTV and WNV, suggesting that this species might play a significant role in the epizootiology of these viral diseases in Tunisia and neighbouring countries.

  7. Canine vector-borne co-infections: Ehrlichia canis and Hepatozoon canis in the same host monocytes.

    Science.gov (United States)

    Baneth, Gad; Harrus, Shimon; Gal, Arnon; Aroch, Itamar

    2015-02-28

    The protozoon Hepatozoon canis and the rickettsia Ehrlichia canis are tick-borne pathogens, transmitted by Rhipicephalus sanguineus, which cause canine hepatozoonosis and canine monocytic ehrlichiosis, respectively. Co-infection of the same host monocytes with H. canis and E. canis confirmed by molecular characterization of the infecting agents and quantitative assessment of co-infected cells is described for the first time in three naturally-infected dogs. Blood smear evaluation indicated that at least 50% of the leukocytes infected with H. canis gamonts contained E. canis morulae. Co-infection of the same host cell demonstrated in this report suggests that infection with one pathogen may permit or enhance invasion or prolonged cellular survival of the other. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Bacterial and protozoal agents of feline vector-borne diseases in domestic and stray cats from southern Portugal

    Science.gov (United States)

    2014-01-01

    Background Feline vector-borne diseases (FVBD) have emerged in recent years, showing a wider geographic distribution and increased global prevalence. In addition to their veterinary importance, domestic cats play a central role in the transmission cycles of some FVBD agents by acting as reservoirs and sentinels, a circumstance that requires a One Health approach. The aim of the present work was to molecularly detect feline vector-borne bacteria and protozoa with veterinary and zoonotic importance, and to assess associated risk factors in cats from southern Portugal. Methods Six hundred and forty-nine cats (320 domestic and 329 stray), from veterinary medical centres and animal shelters in southern Portugal, were studied. Anaplasma spp./Ehrlichia spp., Babesia spp., Bartonella spp., Borrelia burgdorferi sensu lato, Hepatozoon spp. and Leishmania spp. infections were evaluated by polymerase chain reaction (PCR) in blood samples. Results One hundred and ninety-four (29.9%) cats were PCR-positive to at least one of the tested genera or complex of FVBD agents. Sixty-four (9.9%) cats were positive to Leishmania spp., 56 (8.6%) to Hepatozoon spp., 43 (6.6%) to Babesia spp., 35 (5.4%) to Anaplasma spp./Ehrlichia spp., 19 (2.9%) to Bartonella spp. and 14 (2.2%) to B. burgdorferi s.l. Thirty-three (5.1%) cats were positive to two (n = 29) or three (n = 4) genera/complex. Babesia vogeli, Bartonella clarridgeiae, Bartonella henselae, Ehrlichia canis, Hepatozoon felis and Leishmania infantum were identified by DNA sequencing. Conclusions The occurrence of FVBD agents in southern Portugal, some of them with zoonotic character, emphasizes the need to alert the veterinary community, owners and public health authorities for the risk of infection. Control measures should be implemented to prevent the infection of cats, other vertebrate hosts and people. PMID:24655431

  9. Schools as Potential Risk Sites for Vector-Borne Disease Transmission: Mosquito Vectors in Rural Schools in Two Municipalities in Colombia.

    Science.gov (United States)

    Olano, Víctor Alberto; Matiz, María Inés; Lenhart, Audrey; Cabezas, Laura; Vargas, Sandra Lucía; Jaramillo, Juan Felipe; Sarmiento, Diana; Alexander, Neal; Stenström, Thor Axel; Overgaard, Hans J

    2015-09-01

    Dengue and other vector-borne diseases are of great public health importance in Colombia. Vector surveillance and control activities are often focused at the household level. Little is known about the importance of nonhousehold sites, including schools, in maintaining vector-borne disease transmission. The objectives of this paper were to determine the mosquito species composition in rural schools in 2 municipalities in Colombia and to assess the potential risk of vector-borne disease transmission in school settings. Entomological surveys were carried out in rural schools during the dry and rainy seasons of 2011. A total of 12 mosquito species were found: Aedes aegypti, Anopheles pseudopunctipennis, Culex coronator, Cx. quinquefasciatus, and Limatus durhamii in both immature and adult forms; Ae. fluviatilis, Cx. nigripalpus, Cx. corniger, and Psorophora ferox in immature forms only; and Ae. angustivittatus, Haemagogus equinus, and Trichoprosopon lampropus in adult forms only. The most common mosquito species was Cx. quinquefasciatus. Classrooms contained the greatest abundance of adult female Ae. aegypti and Cx. quinquefasciatus. The most common Ae. aegypti breeding sites were containers classified as "others" (e.g., cans), followed by containers used for water storage. A high level of Ae. aegypti infestation was found during the wet season. Our results suggest that rural schools are potentially important foci for the transmission of dengue and other mosquito-borne diseases. We propose that public health programs should be implemented in rural schools to prevent vector-borne diseases.

  10. Benefit of insecticide-treated nets, curtains and screening on vector borne diseases, excluding malaria: a systematic review and meta-analysis

    NARCIS (Netherlands)

    Wilson, A.L.; Dhiman, R.C.; Kitron, U.; Scott, T.W.; Berg, van den H.; Lindsay, S.W.

    2014-01-01

    Introduction Insecticide-treated nets (ITNs) are one of the main interventions used for malaria control. However, these nets may also be effective against other vector borne diseases (VBDs). We conducted a systematic review and meta-analysis to estimate the efficacy of ITNs, insecticide-treated

  11. International network for capacity building for the control of emerging viral vector-borne zoonotic diseases: ARBO-ZOONET.

    Science.gov (United States)

    Ahmed, J; Bouloy, M; Ergonul, O; Fooks, Ar; Paweska, J; Chevalier, V; Drosten, C; Moormann, R; Tordo, N; Vatansever, Z; Calistri, P; Estrada-Pena, A; Mirazimi, A; Unger, H; Yin, H; Seitzer, U

    2009-03-26

    Arboviruses are arthropod-borne viruses, which include West Nile fever virus (WNFV), a mosquito-borne virus, Rift Valley fever virus (RVFV), a mosquito-borne virus, and Crimean-Congo haemorrhagic fever virus (CCHFV), a tick-borne virus. These arthropod-borne viruses can cause disease in different domestic and wild animals and in humans, posing a threat to public health because of their epidemic and zoonotic potential. In recent decades, the geographical distribution of these diseases has expanded. Outbreaks of WNF have already occurred in Europe, especially in the Mediterranean basin. Moreover, CCHF is endemic in many European countries and serious outbreaks have occurred, particularly in the Balkans, Turkey and Southern Federal Districts of Russia. In 2000, RVF was reported for the first time outside the African continent, with cases being confirmed in Saudi Arabia and Yemen. This spread was probably caused by ruminant trade and highlights that there is a threat of expansion of the virus into other parts of Asia and Europe. In the light of global warming and globalisation of trade and travel, public interest in emerging zoonotic diseases has increased. This is especially evident regarding the geographical spread of vector-borne diseases. A multi-disciplinary approach is now imperative, and groups need to collaborate in an integrated manner that includes vector control, vaccination programmes, improved therapy strategies, diagnostic tools and surveillance, public awareness, capacity building and improvement of infrastructure in endemic regions.

  12. Inter-model comparison of the landscape determinants of vector-borne disease: implications for epidemiological and entomological risk modeling.

    Science.gov (United States)

    Lorenz, Alyson; Dhingra, Radhika; Chang, Howard H; Bisanzio, Donal; Liu, Yang; Remais, Justin V

    2014-01-01

    Extrapolating landscape regression models for use in assessing vector-borne disease risk and other applications requires thoughtful evaluation of fundamental model choice issues. To examine implications of such choices, an analysis was conducted to explore the extent to which disparate landscape models agree in their epidemiological and entomological risk predictions when extrapolated to new regions. Agreement between six literature-drawn landscape models was examined by comparing predicted county-level distributions of either Lyme disease or Ixodes scapularis vector using Spearman ranked correlation. AUC analyses and multinomial logistic regression were used to assess the ability of these extrapolated landscape models to predict observed national data. Three models based on measures of vegetation, habitat patch characteristics, and herbaceous landcover emerged as effective predictors of observed disease and vector distribution. An ensemble model containing these three models improved precision and predictive ability over individual models. A priori assessment of qualitative model characteristics effectively identified models that subsequently emerged as better predictors in quantitative analysis. Both a methodology for quantitative model comparison and a checklist for qualitative assessment of candidate models for extrapolation are provided; both tools aim to improve collaboration between those producing models and those interested in applying them to new areas and research questions.

  13. Inter-model comparison of the landscape determinants of vector-borne disease: implications for epidemiological and entomological risk modeling.

    Directory of Open Access Journals (Sweden)

    Alyson Lorenz

    Full Text Available Extrapolating landscape regression models for use in assessing vector-borne disease risk and other applications requires thoughtful evaluation of fundamental model choice issues. To examine implications of such choices, an analysis was conducted to explore the extent to which disparate landscape models agree in their epidemiological and entomological risk predictions when extrapolated to new regions. Agreement between six literature-drawn landscape models was examined by comparing predicted county-level distributions of either Lyme disease or Ixodes scapularis vector using Spearman ranked correlation. AUC analyses and multinomial logistic regression were used to assess the ability of these extrapolated landscape models to predict observed national data. Three models based on measures of vegetation, habitat patch characteristics, and herbaceous landcover emerged as effective predictors of observed disease and vector distribution. An ensemble model containing these three models improved precision and predictive ability over individual models. A priori assessment of qualitative model characteristics effectively identified models that subsequently emerged as better predictors in quantitative analysis. Both a methodology for quantitative model comparison and a checklist for qualitative assessment of candidate models for extrapolation are provided; both tools aim to improve collaboration between those producing models and those interested in applying them to new areas and research questions.

  14. Impacts of Climate Change on Vector Borne Diseases in the Mediterranean Basin - Implications for Preparedness and Adaptation Policy.

    Science.gov (United States)

    Negev, Maya; Paz, Shlomit; Clermont, Alexandra; Pri-Or, Noemie Groag; Shalom, Uri; Yeger, Tamar; Green, Manfred S

    2015-06-15

    The Mediterranean region is vulnerable to climatic changes. A warming trend exists in the basin with changes in rainfall patterns. It is expected that vector-borne diseases (VBD) in the region will be influenced by climate change since weather conditions influence their emergence. For some diseases (i.e., West Nile virus) the linkage between emergence andclimate change was recently proved; for others (such as dengue) the risk for local transmission is real. Consequently, adaptation and preparation for changing patterns of VBD distribution is crucial in the Mediterranean basin. We analyzed six representative Mediterranean countries and found that they have started to prepare for this threat, but the preparation levels among them differ, and policy mechanisms are limited and basic. Furthermore, cross-border cooperation is not stable and depends on international frameworks. The Mediterranean countries should improve their adaptation plans, and develop more cross-sectoral, multidisciplinary and participatory approaches. In addition, based on experience from existing local networks in advancing national legislation and trans-border cooperation, we outline recommendations for a regional cooperation framework. We suggest that a stable and neutral framework is required, and that it should address the characteristics and needs of African, Asian and European countries around the Mediterranean in order to ensure participation. Such a regional framework is essential to reduce the risk of VBD transmission, since the vectors of infectious diseases know no political borders.

  15. Mapping of courses on vector biology and vector-borne diseases systems: time for a worldwide effort

    Science.gov (United States)

    Casas, Jérôme; Lazzari, Claudio; Insausti, Teresita; Launois, Pascal; Fouque, Florence

    2016-01-01

    Major emergency efforts are being mounted for each vector-borne disease epidemiological crisis anew, while knowledge about the biology of arthropods vectors is dwindling slowly but continuously, as is the number of field entomologists. The discrepancy between the rates of production of knowledge and its use and need for solving crises is widening, in particular due to the highly differing time spans of the two concurrent processes. A worldwide web based search using multiple key words and search engines of onsite and online courses in English, Spanish, Portuguese, French, Italian and German concerned with the biology of vectors identified over 140 courses. They are geographically and thematically scattered, the vast majority of them are on-site, with very few courses using the latest massive open online course (MOOC) powerfulness. Over two third of them is given in English and Western Africa is particularity poorly represented. The taxonomic groups covered are highly unbalanced towards mosquitoes. A worldwide unique portal to guide students of all grades and levels of expertise, in particular those in remote locations, is badly needed. This is the objective a new activity supported by the Special Programme for Research and Training in Tropical Diseases (TDR). PMID:27759770

  16. Climate, environmental and socio-economic change: weighing up the balance in vector-borne disease transmission.

    Science.gov (United States)

    Parham, Paul E; Waldock, Joanna; Christophides, George K; Hemming, Deborah; Agusto, Folashade; Evans, Katherine J; Fefferman, Nina; Gaff, Holly; Gumel, Abba; LaDeau, Shannon; Lenhart, Suzanne; Mickens, Ronald E; Naumova, Elena N; Ostfeld, Richard S; Ready, Paul D; Thomas, Matthew B; Velasco-Hernandez, Jorge; Michael, Edwin

    2015-04-05

    Arguably one of the most important effects of climate change is the potential impact on human health. While this is likely to take many forms, the implications for future transmission of vector-borne diseases (VBDs), given their ongoing contribution to global disease burden, are both extremely important and highly uncertain. In part, this is owing not only to data limitations and methodological challenges when integrating climate-driven VBD models and climate change projections, but also, perhaps most crucially, to the multitude of epidemiological, ecological and socio-economic factors that drive VBD transmission, and this complexity has generated considerable debate over the past 10-15 years. In this review, we seek to elucidate current knowledge around this topic, identify key themes and uncertainties, evaluate ongoing challenges and open research questions and, crucially, offer some solutions for the field. Although many of these challenges are ubiquitous across multiple VBDs, more specific issues also arise in different vector-pathogen systems. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  17. Climate, environmental and socio-economic change: weighing up the balance in vector-borne disease transmission

    Science.gov (United States)

    Parham, Paul E.; Waldock, Joanna; Christophides, George K.; Hemming, Deborah; Agusto, Folashade; Evans, Katherine J.; Fefferman, Nina; Gaff, Holly; Gumel, Abba; LaDeau, Shannon; Lenhart, Suzanne; Mickens, Ronald E.; Naumova, Elena N.; Ostfeld, Richard S.; Ready, Paul D.; Thomas, Matthew B.; Velasco-Hernandez, Jorge; Michael, Edwin

    2015-01-01

    Arguably one of the most important effects of climate change is the potential impact on human health. While this is likely to take many forms, the implications for future transmission of vector-borne diseases (VBDs), given their ongoing contribution to global disease burden, are both extremely important and highly uncertain. In part, this is owing not only to data limitations and methodological challenges when integrating climate-driven VBD models and climate change projections, but also, perhaps most crucially, to the multitude of epidemiological, ecological and socio-economic factors that drive VBD transmission, and this complexity has generated considerable debate over the past 10–15 years. In this review, we seek to elucidate current knowledge around this topic, identify key themes and uncertainties, evaluate ongoing challenges and open research questions and, crucially, offer some solutions for the field. Although many of these challenges are ubiquitous across multiple VBDs, more specific issues also arise in different vector–pathogen systems. PMID:25688012

  18. Climate change and vector-borne diseases: what are the implications for public health research and policy?

    Science.gov (United States)

    Campbell-Lendrum, Diarmid; Manga, Lucien; Bagayoko, Magaran; Sommerfeld, Johannes

    2015-01-01

    Vector-borne diseases continue to contribute significantly to the global burden of disease, and cause epidemics that disrupt health security and cause wider socioeconomic impacts around the world. All are sensitive in different ways to weather and climate conditions, so that the ongoing trends of increasing temperature and more variable weather threaten to undermine recent global progress against these diseases. Here, we review the current state of the global public health effort to address this challenge, and outline related initiatives by the World Health Organization (WHO) and its partners. Much of the debate to date has centred on attribution of past changes in disease rates to climate change, and the use of scenario-based models to project future changes in risk for specific diseases. While these can give useful indications, the unavoidable uncertainty in such analyses, and contingency on other socioeconomic and public health determinants in the past or future, limit their utility as decision-support tools. For operational health agencies, the most pressing need is the strengthening of current disease control efforts to bring down current disease rates and manage short-term climate risks, which will, in turn, increase resilience to long-term climate change. The WHO and partner agencies are working through a range of programmes to (i) ensure political support and financial investment in preventive and curative interventions to bring down current disease burdens; (ii) promote a comprehensive approach to climate risk management; (iii) support applied research, through definition of global and regional research agendas, and targeted research initiatives on priority diseases and population groups. PMID:25688013

  19. Climate change and vector-borne diseases: what are the implications for public health research and policy?

    Science.gov (United States)

    Campbell-Lendrum, Diarmid; Manga, Lucien; Bagayoko, Magaran; Sommerfeld, Johannes

    2015-04-05

    Vector-borne diseases continue to contribute significantly to the global burden of disease, and cause epidemics that disrupt health security and cause wider socioeconomic impacts around the world. All are sensitive in different ways to weather and climate conditions, so that the ongoing trends of increasing temperature and more variable weather threaten to undermine recent global progress against these diseases. Here, we review the current state of the global public health effort to address this challenge, and outline related initiatives by the World Health Organization (WHO) and its partners. Much of the debate to date has centred on attribution of past changes in disease rates to climate change, and the use of scenario-based models to project future changes in risk for specific diseases. While these can give useful indications, the unavoidable uncertainty in such analyses, and contingency on other socioeconomic and public health determinants in the past or future, limit their utility as decision-support tools. For operational health agencies, the most pressing need is the strengthening of current disease control efforts to bring down current disease rates and manage short-term climate risks, which will, in turn, increase resilience to long-term climate change. The WHO and partner agencies are working through a range of programmes to (i) ensure political support and financial investment in preventive and curative interventions to bring down current disease burdens; (ii) promote a comprehensive approach to climate risk management; (iii) support applied research, through definition of global and regional research agendas, and targeted research initiatives on priority diseases and population groups. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  20. Climate and Population Health Vulnerabilities to Vector-Borne Diseases: Increasing Resilience Under Climate Change Conditions in Africa

    Science.gov (United States)

    Ceccato, P.; McDonald, K. C.; Podest, E.; De La Torre Juarez, M.; Kruczkiewicz, A.; Lessel, J.; Jensen, K.; Thomson, M. C.

    2014-12-01

    The International Research Institute for Climate and Society (IRI), the City University of New York (CUNY) and NASA Jet Propulsion Laboratory (JPL) in collaboration with NASA SERVIR are developing tools to monitor climate variables (precipitation, temperature, vegetation, water bodies, inundation) that help projects in Africa to increase resilience to climate change for vector-borne diseases (i.e. malaria, trypanosomiasis, leishmaniasis, and schistosomiasis). Through the development of new products to monitor precipitation, water bodies and inundation, IRI, CUNY and JPL provide tools and capacity building to research communities, ministries of health and World Health Organization in Africa to: 1) Develop research teams' ability to appropriately use climate data as part of their research 2) Enable research teams and ministries to integrate climate information into social and economic drivers of vulnerability and opportunities for adaptation to climate change 3) Inform better policies and programs for climate change adaptation. This oral presentation will demonstrate how IRI, CUNY, and JPL developed new products, tools and capacity building to achieve the three objectives mentioned above.

  1. Climate and Health Vulnerability to Vector-Borne Diseases: Increasing Resilience under Climate Change Conditions in Africa

    Science.gov (United States)

    Ceccato, P.

    2015-12-01

    The International Research Institute for Climate and Society (IRI), the City University of New York (CUNY) and NASA Jet Propulsion Laboratory (JPL) in collaboration with NASA SERVIR are developing tools to monitor climate variables (precipitation, temperature, vegetation, water bodies, inundation) that help projects in Africa to increase resilience to climate change for vector-borne diseases ( malaria, trypanosomiasis, leishmaniasis, and schistosomiasis). Through the development of new products to monitor precipitation, water bodies and inundation, IRI, CUNY and JPL provide tools and capacity building to research communities; ministries of health; the WMO Global Framework for Climate and Services; and World Health Organization in Africa to: 1) Develop research teams' ability to appropriately use climate data as part of their research 2) Enable research teams and ministries to integrate climate information into social and economic drivers of vulnerability and opportunities for adaptation to climate change 3) Inform better policies and programs for climate change adaptation. This oral presentation will demonstrate how IRI, CUNY, and JPL developed new products, tools and capacity building to achieve the three objectives mentioned above with examples in South Africa, Zimbabwe, Tanzania and Malawi.

  2. Insecticide control of vector-borne diseases: when is insecticide resistance a problem?

    Directory of Open Access Journals (Sweden)

    Ana Rivero

    Full Text Available Many of the most dangerous human diseases are transmitted by insect vectors. After decades of repeated insecticide use, all of these vector species have demonstrated the capacity to evolve resistance to insecticides. Insecticide resistance is generally considered to undermine control of vector-transmitted diseases because it increases the number of vectors that survive the insecticide treatment. Disease control failure, however, need not follow from vector control failure. Here, we review evidence that insecticide resistance may have an impact on the quality of vectors and, specifically, on three key determinants of parasite transmission: vector longevity, competence, and behaviour. We argue that, in some instances, insecticide resistance is likely to result in a decrease in vector longevity, a decrease in infectiousness, or in a change in behaviour, all of which will reduce the vectorial capacity of the insect. If this effect is sufficiently large, the impact of insecticide resistance on disease management may not be as detrimental as previously thought. In other instances, however, insecticide resistance may have the opposite effect, increasing the insect's vectorial capacity, which may lead to a dramatic increase in the transmission of the disease and even to a higher prevalence than in the absence of insecticides. Either way-and there may be no simple generality-the consequence of the evolution of insecticide resistance for disease ecology deserves additional attention.

  3. Social exclusion modifies climate and deforestation impacts on a vector-borne disease.

    Science.gov (United States)

    Chaves, Luis Fernando; Cohen, Justin M; Pascual, Mercedes; Wilson, Mark L

    2008-02-06

    The emergence of American Cutaneous Leishmaniasis (ACL) has been associated with changes in the relationship between people and forests, leading to the view that forest ecosystems increase infection risk and subsequent proposal that deforestation could reduce re-emergence of this disease. We analyzed county-level incidence rates of ACL in Costa Rica (1996-2000) as a function of social and environmental variables relevant to transmission ecology with statistical models that incorporate breakpoints. Once social marginality was taken into account, the effect of living close to a forest on infection risk was small, and diminished exponentially above a breakpoint. Forest cover was associated with the modulation of temporal effects of El Niño Southern Oscillation (ENSO) at small spatial scales, revealing an additional complex interplay of environmental forces and disease patterns. Social factors, which previously have not been evaluated rigorously together with environmental and climatic factors, appear to play a critical role that may ultimately determine disease risk.

  4. [Health care reform, decentralization, prevention and control of vector-borne diseases].

    Science.gov (United States)

    Schmunis, G A; Dias, J C

    2000-01-01

    Economic policies are changing Latin American health programs, particularly promoting decentralization. Numerous difficulties thus arise for the control of endemic diseases, since such activities traditionally depend on vertical, and centralized structures. Theoretical arguments in favor of decentralization notwithstanding, no such tradition exists at the county level. The lack of program expertise at peripheral levels, intensive staff turnover, and even corruption are additional difficulties. Hence, the simple bureaucratic transfer of activities from the Federal to county level is often irresponsible. The loss of priority for control of endemic diseases in Latin America may mean the inexorable extinction of traditional control services. Malaria, dengue fever, and Chagas disease programs are examples of the loss of expertise and effectiveness in Latin America. A better strategy for responsible decentralization is required. In particular, a shared transition involving all governmental levels is desirable to effectively modernize programs. Maintenance of regional reference centers to ensure supervision, surveillance, and training is suggested.

  5. Impact of Global Climate on Rift Valley Fever and other Vector-borne Disease Outbreaks

    Science.gov (United States)

    Linthicum, K. J.

    2017-12-01

    Rift Valley fever is a viral disease of animals and humans in Africa and the Middle East that is transmitted by mosquitoes. Since the virus was first isolated in Kenya in 1930 it has caused significant impact to animal and human health and national economies, and it is of concern to the international agricultural and public health community. In this presentation we will describe the (1) ecology of disease transmission as it relates to climate, (2) the impact of climate and other environmental conditions on outbreaks, (3) the ability to use global climate information to predict outbreaks, (4) effective response activities, and (4) the potential to mitigate globalization.

  6. Genetic shifting: a novel approach for controlling vector-borne diseases

    OpenAIRE

    Powell, Jeffrey R.; Tabachnick, Walter J.

    2014-01-01

    Rendering populations of vectors of diseases incapable of transmitting pathogens through genetic methods has long been a goal of vector geneticists. We outline a method to achieve this goal that does not involve introduction of any new genetic variants to the target population. Rather we propose that shifting the frequencies of naturally occurring alleles that confer refractoriness to transmission can reduce transmission below a sustainable level. The program employs methods successfully used...

  7. Implementing Cargo Movement into Climate Based Risk Assessment of Vector-Borne Diseases

    Directory of Open Access Journals (Sweden)

    Stephanie Margarete Thomas

    2014-03-01

    Full Text Available During the last decades the disease vector Aedes albopictus (Asian tiger mosquito has rapidly spread around the globe. Global shipment of goods contributes to its permanent introduction. Invaded regions are facing novel and serious public health concerns, especially regarding the transmission of formerly non-endemic arboviruses such as dengue and chikungunya. The further development and potential spread to other regions depends largely on their climatic suitability. Here, we have developed a tool for identifying and prioritizing European areas at risk for the establishment of Aedes albopictus by taking into account, for the first time, the freight imports from this mosquito’s endemic countries and the climate suitability at harbors and their surrounding regions. In a second step we consider the further transport of containers by train and inland waterways because these types of transport can be well controlled. We identify European regions at risk, where a huge amount of transported goods meet climatically suitable conditions for the disease vector. The current and future suitability of the climate for Aedes albopictus was modeled by a correlative niche model approach and the Regional Climate Model COSMO-CLM. This risk assessment combines impacts of globalization and global warming to improve effective and proactive interventions in disease vector surveillance and control actions.

  8. How will climate change pathways and mitigation options alter incidence of vector-borne diseases? A framework for leishmaniasis in South and Meso-America.

    Directory of Open Access Journals (Sweden)

    Bethan V Purse

    Full Text Available The enormous global burden of vector-borne diseases disproportionately affects poor people in tropical, developing countries. Changes in vector-borne disease impacts are often linked to human modification of ecosystems as well as climate change. For tropical ecosystems, the health impacts of future environmental and developmental policy depend on how vector-borne disease risks trade off against other ecosystem services across heterogeneous landscapes. By linking future socio-economic and climate change pathways to dynamic land use models, this study is amongst the first to analyse and project impacts of both land use and climate change on continental-scale patterns in vector-borne diseases. Models were developed for cutaneous and visceral leishmaniasis in the Americas-ecologically complex sand fly borne infections linked to tropical forests and diverse wild and domestic mammal hosts. Both diseases were hypothesised to increase with available interface habitat between forest and agricultural or domestic habitats and with mammal biodiversity. However, landscape edge metrics were not important as predictors of leishmaniasis. Models including mammal richness were similar in accuracy and predicted disease extent to models containing only climate and land use predictors. Overall, climatic factors explained 80% and land use factors only 20% of the variance in past disease patterns. Both diseases, but especially cutaneous leishmaniasis, were associated with low seasonality in temperature and precipitation. Since such seasonality increases under future climate change, particularly under strong climate forcing, both diseases were predicted to contract in geographical extent to 2050, with cutaneous leishmaniasis contracting by between 35% and 50%. Whilst visceral leishmaniasis contracted slightly more under strong than weak management for carbon, biodiversity and ecosystem services, future cutaneous leishmaniasis extent was relatively insensitive to future

  9. Climate Change and Spatiotemporal Distributions of Vector-Borne Diseases in Nepal--A Systematic Synthesis of Literature.

    Directory of Open Access Journals (Sweden)

    Meghnath Dhimal

    Full Text Available Despite its largely mountainous terrain for which this Himalayan country is a popular tourist destination, Nepal is now endemic for five major vector-borne diseases (VBDs, namely malaria, lymphatic filariasis, Japanese encephalitis, visceral leishmaniasis and dengue fever. There is increasing evidence about the impacts of climate change on VBDs especially in tropical highlands and temperate regions. Our aim is to explore whether the observed spatiotemporal distributions of VBDs in Nepal can be related to climate change.A systematic literature search was performed and summarized information on climate change and the spatiotemporal distribution of VBDs in Nepal from the published literature until December 2014 following providing items for systematic review and meta-analysis (PRISMA guidelines.We found 12 studies that analysed the trend of climatic data and are relevant for the study of VBDs, 38 studies that dealt with the spatial and temporal distribution of disease vectors and disease transmission. Among 38 studies, only eight studies assessed the association of VBDs with climatic variables. Our review highlights a pronounced warming in the mountains and an expansion of autochthonous cases of VBDs to non-endemic areas including mountain regions (i.e., at least 2,000 m above sea level. Furthermore, significant relationships between climatic variables and VBDs and their vectors are found in short-term studies.Taking into account the weak health care systems and difficult geographic terrain of Nepal, increasing trade and movements of people, a lack of vector control interventions, observed relationships between climatic variables and VBDs and their vectors and the establishment of relevant disease vectors already at least 2,000 m above sea level, we conclude that climate change can intensify the risk of VBD epidemics in the mountain regions of Nepal if other non-climatic drivers of VBDs remain constant.

  10. Zika virus infection: Past and present of another emerging vector-borne disease.

    Science.gov (United States)

    Sakkas, Hercules; Economou, Vangelis; Papadopoulou, Chrissanthy

    2016-01-01

    Zika virus infection is an emerging mosquito-borne disease, first identified in Uganda in 1947. It is caused by the Zika arbovirus, and transmitted by the bites of infected mosquitoes of the genus Aedes. For almost half a century, the Zika virus was reported as the causative agent of sporadic human infections. In 2007, the Zika virus emerged outside Asia and Africa causing an epidemic on the Island of Yap in Micronesia. The manifestation of the newly acquired human infection varies from asymptomatic to self-limiting acute febrile illness with symptoms and clinical features similar to those caused by the Dengue virus ('Dengue-like syndrome'). The real-time PCR and serological methods have been successfully applied for the diagnosis of the disease. The treatment is symptomatic, since there is no specific antiviral treatment or a vaccine. During the recent outbreaks in French Polynesia and Brazil, incidents of Guillain-Barrι syndrome and microcephaly were associated with Zika virus infection, giving rise to fears of further global spread of the virus. Prevention and vector control strategies have to be urgently implemented by national health authorities in order to contain future outbreaks in vulnerable populations. This review summarizes the existing information on Zika virus characteristics, pathogenesis and epidemiology, the available methods for the diagnosis of Zika virus infection and recent approaches for prevention and control.

  11. Molecular detection of vector-borne pathogens in blood and splenic samples from dogs with splenic disease.

    Science.gov (United States)

    Movilla, Rebeca; Altet, Laura; Serrano, Lorena; Tabar, María-Dolores; Roura, Xavier

    2017-03-13

    The spleen is a highly perfused organ involved in the immunological control and elimination of vector-borne pathogens (VBP), which could have a fundamental role in the pathogenesis of splenic disease. This study aimed to evaluate certain VBP in samples from dogs with splenic lesions. Seventy-seven EDTA-blood and 64 splenic tissue samples were collected from 78 dogs with splenic disease in a Mediterranean area. Babesia spp., Bartonella spp., Ehrlichia/Anaplasma spp., Hepatozoon canis, Leishmania infantum, hemotropic Mycoplasma spp. and Rickettsia spp. were targeted using PCR assays. Sixty EDTA-blood samples from dogs without evidence of splenic lesions were included as a control group. More than half (51.56%) of the biopsies (33/64) were consistent with benign lesions and 48.43% (31/64) with malignancy, mostly hemangiosarcoma (25/31). PCR yielded positive results in 13 dogs with spleen alterations (16.67%), for Babesia canis (n = 3), Babesia gibsoni (n = 2), hemotropic Mycoplasma spp. (n = 2), Rickettsia massiliae (n = 1) and "Babesia vulpes" (n = 1), in blood; and for B. canis, B. gibsoni, Ehrlichia canis and L. infantum (n = 1 each), in spleen. Two control dogs (3.3%) were positive for B. gibsoni and H. canis (n = 1 each). Benign lesions were detected in the 61.54% of infected dogs (8/13); the remaining 38.46% were diagnosed with malignancies (5/13). Infection was significantly associated to the presence of splenic disease (P = 0.013). There was no difference in the prevalence of infection between dogs with benign and malignant splenic lesions (P = 0.69); however B. canis was more prevalent in dogs with hemangiosarcoma (P = 0.006). VBP infection could be involved in the pathogenesis of splenic disease. The immunological role of the spleen could predispose to alterations of this organ in infected dogs. Interestingly, all dogs with B. canis infection were diagnosed with hemangiosarcoma in the present survey. As previously

  12. PCR evaluation of selected vector-borne pathogens in dogs with pericardial effusion.

    Science.gov (United States)

    Tabar, M-D; Movilla, R; Serrano, L; Altet, L; Francino, O; Roura, X

    2018-04-01

    To investigate evidence for selected vector-borne pathogen infections in dogs with pericardial effusion living in a Mediterranean area in which several canine vector-borne diseases are endemic. Archived EDTA blood (n=68) and pericardial fluid samples (n=58) from dogs with pericardial effusion (n=68) were included. Dogs without pericardial effusion examined for other reasons were included as controls (n=60). Pericardial effusion was classified as neoplastic in 40 dogs, idiopathic in 23 dogs and of unknown aetiology in 5 dogs. Real-time PCR was performed for Leishmania infantum, Ehrlichia/Anaplasma species, Hepatozoon canis, Babesia species, Rickettsia species and Bartonella species, and sequencing of PCR products from positive samples was used to confirm species specificity. Vector-borne pathogens were found in 18 dogs: 16 of 68 dogs with pericardial effusion (23·5%) and two of 60 control dogs (3·3%). Positive dogs demonstrated DNA of Leishmania infantum (n=7), Anaplasma platys (n=2, one dog coinfected with Leishmania infantum), Babesia canis (n=5), Babesia gibsoni (n=3) and Hepatozoon canis (n=2). Vector-borne pathogens were more commonly detected among dogs with pericardial effusion than controls (P=0·001). There was no relationship between aetiology of the pericardial effusion and evidence of vector-borne pathogens (P=0·932). Vector-borne pathogens are often detected in dogs with pericardial effusion and require further investigation, especially in dogs with idiopathic pericardial effusion. PCR can provide additional information about the potential role of vector-borne pathogens in dogs with pericardial effusion living in endemic areas. © 2018 British Small Animal Veterinary Association.

  13. Multi-agent systems in epidemiology: a first step for computational biology in the study of vector-borne disease transmission

    Directory of Open Access Journals (Sweden)

    Guégan Jean-François

    2008-10-01

    Full Text Available Abstract Background Computational biology is often associated with genetic or genomic studies only. However, thanks to the increase of computational resources, computational models are appreciated as useful tools in many other scientific fields. Such modeling systems are particularly relevant for the study of complex systems, like the epidemiology of emerging infectious diseases. So far, mathematical models remain the main tool for the epidemiological and ecological analysis of infectious diseases, with SIR models could be seen as an implicit standard in epidemiology. Unfortunately, these models are based on differential equations and, therefore, can become very rapidly unmanageable due to the too many parameters which need to be taken into consideration. For instance, in the case of zoonotic and vector-borne diseases in wildlife many different potential host species could be involved in the life-cycle of disease transmission, and SIR models might not be the most suitable tool to truly capture the overall disease circulation within that environment. This limitation underlines the necessity to develop a standard spatial model that can cope with the transmission of disease in realistic ecosystems. Results Computational biology may prove to be flexible enough to take into account the natural complexity observed in both natural and man-made ecosystems. In this paper, we propose a new computational model to study the transmission of infectious diseases in a spatially explicit context. We developed a multi-agent system model for vector-borne disease transmission in a realistic spatial environment. Conclusion Here we describe in detail the general behavior of this model that we hope will become a standard reference for the study of vector-borne disease transmission in wildlife. To conclude, we show how this simple model could be easily adapted and modified to be used as a common framework for further research developments in this field.

  14. Vector-borne diseases of small companion animals in Namibia: Literature review, knowledge gaps and opportunity for a One Health approach

    Directory of Open Access Journals (Sweden)

    Bruce H. Noden

    2015-11-01

    Full Text Available Namibia has a rich history in veterinary health but little is known about the vector-borne diseases that affect companion dogs and cats. The aim of this review is to summarise the existing published and available unpublished literature, put it into a wider geographical context, and explore some significant knowledge gaps. To date, only two filarial pathogens (Dirofilaria repens and Acanthocheilonema dracunculoides and three tick-borne pathogens (Babesia canis vogeli, Hepatozoon canis and Ehrlichia canis have been reported. Most studies have focused solely on dogs and cats in the urban Windhoek and surrounding areas, with almost nothing reported in rural farming areas, in either the populous northern regions or the low-income urban areas where animal owners have limited access to veterinary services. With the development of several biomedical training programmes in the country, there is now an excellent opportunity to address zoonotic vector-borne diseases through a One Health approach so as to assess the risks to small companion animals as well as diseases of public health importance.

  15. Vector-Borne Infections in Tornado-Displaced and Owner-Relinquished Dogs in Oklahoma, USA.

    Science.gov (United States)

    Barrett, Anne W; Little, Susan E

    2016-06-01

    To determine the prevalence of infection with vector-borne agents in a cross-section of dogs from Oklahoma, where canine vector-borne diseases are common, blood samples were evaluated through serology and molecular analysis. Antibodies reactive to Ehrlichia spp., Rickettsia rickettsii, R. montanensis, and "R. amblyommii" were detected in 10.5% (11/105), 74.3% (78/105), 58.1% (61/105), and 55.2% (58/105) of dogs, respectively. Presence of spotted fever group Rickettsia spp. DNA was identified in 13.1% (8/61) of shelter dogs but not in any pet dogs (0/44). DNA of "R. amblyommii" was confirmed by sequencing, constituting the first report of this agent in a naturally infected dog. Antigen of Dirofilaria immitis was detected in 10.5% (11/105) and 16.2% (17/105) of samples before and after heat treatment, respectively. In total, 87.6% (92/105) of the dogs had evidence of infection with at least one vector-borne disease agent, confirming high risk of exposure to multiple vector-borne disease agents, several of which are zoonotic.

  16. MosquitoMap and the Mal-area calculator: new web tools to relate mosquito species distribution with vector borne disease.

    Science.gov (United States)

    Foley, Desmond H; Wilkerson, Richard C; Birney, Ian; Harrison, Stanley; Christensen, Jamie; Rueda, Leopoldo M

    2010-02-18

    Mosquitoes are important vectors of diseases but, in spite of various mosquito faunistic surveys globally, there is a need for a spatial online database of mosquito collection data and distribution summaries. Such a resource could provide entomologists with the results of previous mosquito surveys, and vector disease control workers, preventative medicine practitioners, and health planners with information relating mosquito distribution to vector-borne disease risk. A web application called MosquitoMap was constructed comprising mosquito collection point data stored in an ArcGIS 9.3 Server/SQL geodatabase that includes administrative area and vector species x country lookup tables. In addition to the layer containing mosquito collection points, other map layers were made available including environmental, and vector and pathogen/disease distribution layers. An application within MosquitoMap called the Mal-area calculator (MAC) was constructed to quantify the area of overlap, for any area of interest, of vector, human, and disease distribution models. Data standards for mosquito records were developed for MosquitoMap. MosquitoMap is a public domain web resource that maps and compares georeferenced mosquito collection points to other spatial information, in a geographical information system setting. The MAC quantifies the Mal-area, i.e. the area where it is theoretically possible for vector-borne disease transmission to occur, thus providing a useful decision tool where other disease information is limited. The Mal-area approach emphasizes the independent but cumulative contribution to disease risk of the vector species predicted present. MosquitoMap adds value to, and makes accessible, the results of past collecting efforts, as well as providing a template for other arthropod spatial databases.

  17. Evaluation of a continuous indicator for syndromic surveillance through simulation. application to vector borne disease emergence detection in cattle using milk yield.

    Directory of Open Access Journals (Sweden)

    Aurélien Madouasse

    Full Text Available Two vector borne diseases, caused by the Bluetongue and Schmallenberg viruses respectively, have emerged in the European ruminant populations since 2006. Several diseases are transmitted by the same vectors and could emerge in the future. Syndromic surveillance, which consists in the routine monitoring of indicators for the detection of adverse health events, may allow an early detection. Milk yield is routinely measured in a large proportion of dairy herds and could be incorporated as an indicator in a surveillance system. However, few studies have evaluated continuous indicators for syndromic surveillance. The aim of this study was to develop a framework for the quantification of both disease characteristics and model predictive abilities that are important for a continuous indicator to be sensitive, timely and specific for the detection of a vector-borne disease emergence. Emergences with a range of spread characteristics and effects on milk production were simulated. Milk yields collected monthly in 48 713 French dairy herds were used to simulate 576 disease emergence scenarios. First, the effect of disease characteristics on the sensitivity and timeliness of detection were assessed: Spatio-temporal clusters of low milk production were detected with a scan statistic using the difference between observed and simulated milk yields as input. In a second step, the system specificity was evaluated by running the scan statistic on the difference between observed and predicted milk yields, in the absence of simulated emergence. The timeliness of detection depended mostly on how easily the disease spread between and within herds. The time and location of the emergence or adding random noise to the simulated effects had a limited impact on the timeliness of detection. The main limitation of the system was the low specificity i.e. the high number of clusters detected from the difference between observed and predicted productions, in the absence of

  18. Study of the climatic change impact on vector-borne diseases in West Africa: the case of tick-borne borreliosis and malaria

    International Nuclear Information System (INIS)

    Trape, J.F.

    2005-04-01

    Malaria and tick-borne borreliosis are the two first causes of morbidity due to vector-borne diseases in a large part of Sudan-sahelian West Africa. They are also the two tropical diseases which have been the most affected by climatic change in recent years. In the case of tick-borne borreliosis it has been shown in Senegal that the persistence of drought since the years 70 has been associated with a considerable extension of the geographic range of diseases and the vector tick A-sonrai, a species that was in the past limited to the Sahara and Sahel. In the case of malaria, drought has strongly reduced in these same regions of Africa the distribution, abundance and infection rate of Anopheline mosquitoes, but without any significant reduction of the burden of malaria for most populations concerned. The emergence and spread of Plasmodium falciparum resistance to antimalarial drugs only explain part of this phenomenon. (A.L.B.)

  19. Knowledge, Attitude and Practices of Vector-Borne Disease Prevention during the Emergence of a New Arbovirus: Implications for the Control of Chikungunya Virus in French Guiana.

    Directory of Open Access Journals (Sweden)

    Camille Fritzell

    2016-11-01

    Full Text Available During the last decade, French Guiana has been affected by major dengue fever outbreaks. Although this arbovirus has been a focus of many awareness campaigns, very little information is available about beliefs, attitudes and behaviors regarding vector-borne diseases among the population of French Guiana. During the first outbreak of the chikungunya virus, a quantitative survey was conducted among high school students to study experiences, practices and perceptions related to mosquito-borne diseases and to identify socio-demographic, cognitive and environmental factors that could be associated with the engagement in protective behaviors.A cross-sectional survey was administered in May 2014, with a total of 1462 students interviewed. Classrooms were randomly selected using a two-stage selection procedure with cluster samples. A multiple correspondence analysis (MCA associated with a hierarchical cluster analysis and with an ordinal logistic regression was performed. Chikungunya was less understood and perceived as a more dreadful disease than dengue fever. The analysis identified three groups of individual protection levels against mosquito-borne diseases: "low" (30%, "moderate" (42% and "high" (28%". Protective health behaviors were found to be performed more frequently among students who were female, had a parent with a higher educational status, lived in an individual house, and had a better understanding of the disease.This study allowed us to estimate the level of protective practices against vector-borne diseases among students after the emergence of a new arbovirus. These results revealed that the adoption of protective behaviors is a multi-factorial process that depends on both sociocultural and cognitive factors. These findings may help public health authorities to strengthen communication and outreach strategies, thereby increasing the adoption of protective health behaviors, particularly in high-risk populations.

  20. VECTOR BORNE TRANSMISSIBLE ZOONOSES IN MONTENEGRO

    Directory of Open Access Journals (Sweden)

    Gordana Mijovic

    2012-02-01

    Full Text Available Vector borne transmissible zoonoses are becoming more and more important in the group of emerging and re-emerging infections. We present the characteristics and actuality of this group of infectious diseases in Montenegro for the period 1998 - 2011. In examinations, standard epidemiological, clinical, serological, pathohistological diagnostic methods are employed. Natural conditions in Montenegro make it an important endemic area for more vector borne transmissible zoonoses. The changes of ecological characteristics, the vectors and infective agents, present the accidence for expansion and increasing importance of these infections in national pathology. According to the fact that it is an international port of nautical, continental and air traffic, Montenegro has responsibility for control and management of diseases belonging to the group of the travel and tropical diseases.

  1. Use of Google Earth to strengthen public health capacity and facilitate management of vector-borne diseases in resource-poor environments.

    Science.gov (United States)

    Lozano-Fuentes, Saul; Elizondo-Quiroga, Darwin; Farfan-Ale, Jose Arturo; Loroño-Pino, Maria Alba; Garcia-Rejon, Julian; Gomez-Carro, Salvador; Lira-Zumbardo, Victor; Najera-Vazquez, Rosario; Fernandez-Salas, Ildefonso; Calderon-Martinez, Joaquin; Dominguez-Galera, Marco; Mis-Avila, Pedro; Morris, Natashia; Coleman, Michael; Moore, Chester G; Beaty, Barry J; Eisen, Lars

    2008-09-01

    Novel, inexpensive solutions are needed for improved management of vector-borne and other diseases in resource-poor environments. Emerging free software providing access to satellite imagery and simple editing tools (e.g. Google Earth) complement existing geographic information system (GIS) software and provide new opportunities for: (i) strengthening overall public health capacity through development of information for city infrastructures; and (ii) display of public health data directly on an image of the physical environment. We used freely accessible satellite imagery and a set of feature-making tools included in the software (allowing for production of polygons, lines and points) to generate information for city infrastructure and to display disease data in a dengue decision support system (DDSS) framework. Two cities in Mexico (Chetumal and Merida) were used to demonstrate that a basic representation of city infrastructure useful as a spatial backbone in a DDSS can be rapidly developed at minimal cost. Data layers generated included labelled polygons representing city blocks, lines representing streets, and points showing the locations of schools and health clinics. City blocks were colour-coded to show presence of dengue cases. The data layers were successfully imported in a format known as shapefile into a GIS software. The combination of Google Earth and free GIS software (e.g. HealthMapper, developed by WHO, and SIGEpi, developed by PAHO) has tremendous potential to strengthen overall public health capacity and facilitate decision support system approaches to prevention and control of vector-borne diseases in resource-poor environments.

  2. Zoonotic aspects of vector-borne infections.

    Science.gov (United States)

    Failloux, A-B; Moutailler, S

    2015-04-01

    Vector-borne diseases are principally zoonotic diseases transmitted to humans by animals. Pathogens such as bacteria, parasites and viruses are primarily maintained within an enzootic cycle between populations of non-human primates or other mammals and largely non-anthropophilic vectors. This 'wild' cycle sometimes spills over in the form of occasional infections of humans and domestic animals. Lifestyle changes, incursions by humans into natural habitats and changes in agropastoral practices create opportunities that make the borders between wildlife and humans more permeable. Some vector-borne diseases have dispensed with the need for amplification in wild or domestic animals and they can now be directly transmitted to humans. This applies to some viruses (dengue and chikungunya) that have caused major epidemics. Bacteria of the genus Bartonella have reduced their transmission cycle to the minimum, with humans acting as reservoir, amplifier and disseminator. The design of control strategies for vector-borne diseases should be guided by research into emergence mechanisms in order to understand how a wild cycle can produce a pathogen that goes on to cause devastating urban epidemics.

  3. The role of the ratio of vector and host densities in the evolution of transmission modes in vector-borne diseases. The example of sylvatic Trypanosoma cruzi.

    Science.gov (United States)

    Pelosse, Perrine; Kribs-Zaleta, Christopher M

    2012-11-07

    Pathogens may use different routes of transmission to maximize their spread among host populations. Theoretical and empirical work conducted on directly transmitted diseases suggest that horizontal (i.e., through host contacts) and vertical (i.e., from mother to offspring) transmission modes trade off, on the ground that highly virulent pathogens, which produce larger parasite loads, are more efficiently transmitted horizontally, and that less virulent pathogens, which impair host fitness less significantly, are better transmitted vertically. Other factors than virulence such as host density could also select for different transmission modes, but they have barely been studied. In vector-borne diseases, pathogen transmission rate is strongly affected by host-vector relative densities and by processes of saturation in contacts between hosts and vectors. The parasite Trypanosoma cruzi which is transmitted by triatomine bugs to several vertebrate hosts is responsible for Chagas' disease in Latin America. It is also widespread in sylvatic cycles in the southeastern U.S. in which it typically induces no mortality costs to its customary hosts. Besides classical transmission via vector bites, alternative ways to generate infections in hosts such as vertical and oral transmission (via the consumption of vectors by hosts) have been reported in these cycles. The two major T. cruzi strains occurring in the U.S. seem to exhibit differential efficiencies at vertical and classical horizontal transmissions. We investigated whether the vector-host ratio affects the outcome of the competition between the two parasite strains using an epidemiological two-strain model considering all possible transmission routes for sylvatic T. cruzi. We were able to show that the vector-host ratio influences the evolution of transmission modes providing that oral transmission is included in the model as a possible transmission mode, that oral and classical transmissions saturate at different vector

  4. Emerging vector-borne diseases and environmental change : The rise of Lyme borreliosis in Western-Europe

    NARCIS (Netherlands)

    Huitema, Tim

    2013-01-01

    SUMMARY During the last decade several infectious diseases started to emerge in Western-Europe. At the same time numerous environmental factors were changing. One of the diseases that apparently emerged is Lyme borreliosis (LB). This thesis aims to incre

  5. Use of Remote Sensing Surveillance to Monitor Environmental Parameters Associated with Mosquito Abundance and Vector-borne Diseases

    Science.gov (United States)

    1996-01-01

    Lymphatic filariasis persists as a major cause of clinical morbidity and a significant impediment to socioeconomic development in various parts of the world including Egypt. In Egypt, filariasis has been endemic since time immemorial. Early epidemiologic studies identified Culex pipiens L. as the main vector of the disease and also showed that the geographic distribution of the disease is highly focal and concentrated in lower Egypt. Between 1950 and 1965, a large scale filariasis control program was carried out by the Egyptian Ministry of Health (EMOH) in the endemic areas. Control efforts led to a steady decrease of the disease in areas of the country previously identified as endemic. However, spot surveys conducted in various parts of the Nile Delta during the 1970's and 1980's revealed that the downward trend of the disease had stopped and that the prevalence and intensity of microfilaraemia had increased.

  6. Status of pesticide management in the practice of vector control: a global survey in countries at risk of malaria or other major vector-borne diseases

    Directory of Open Access Journals (Sweden)

    Tan Soo

    2011-05-01

    Full Text Available Abstract Background It is critical that vector control pesticides are used for their acceptable purpose without causing adverse effects on health and the environment. This paper provides a global overview of the current status of pesticides management in the practice of vector control. Methods A questionnaire was distributed to WHO member states and completed either by the director of the vector-borne disease control programme or by the national manager for vector control. In all, 113 countries responded to the questionnaire (80% response rate, representing 94% of the total population of the countries targeted. Results Major gaps were evident in countries in pesticide procurement practices, training on vector control decision making, certification and quality control of pesticide application, monitoring of worker safety, public awareness programmes, and safe disposal of pesticide-related waste. Nevertheless, basic conditions of policy and coordination have been established in many countries through which the management of vector control pesticides could potentially be improved. Most countries responded that they have adopted relevant recommendations by the WHO. Conclusions Given the deficiencies identified in this first global survey on public health pesticide management and the recent rise in pesticide use for malaria control, the effectiveness and safety of pesticide use are being compromised. This highlights the urgent need for countries to strengthen their capacity on pesticide management and evidence-based decision making within the context of an integrated vector management approach.

  7. Status of pesticide management in the practice of vector control: a global survey in countries at risk of malaria or other major vector-borne diseases.

    Science.gov (United States)

    van den Berg, Henk; Hii, Jeffrey; Soares, Agnes; Mnzava, Abraham; Ameneshewa, Birkinesh; Dash, Aditya P; Ejov, Mikhail; Tan, Soo Hian; Matthews, Graham; Yadav, Rajpal S; Zaim, Morteza

    2011-05-14

    It is critical that vector control pesticides are used for their acceptable purpose without causing adverse effects on health and the environment. This paper provides a global overview of the current status of pesticides management in the practice of vector control. A questionnaire was distributed to WHO member states and completed either by the director of the vector-borne disease control programme or by the national manager for vector control. In all, 113 countries responded to the questionnaire (80% response rate), representing 94% of the total population of the countries targeted. Major gaps were evident in countries in pesticide procurement practices, training on vector control decision making, certification and quality control of pesticide application, monitoring of worker safety, public awareness programmes, and safe disposal of pesticide-related waste. Nevertheless, basic conditions of policy and coordination have been established in many countries through which the management of vector control pesticides could potentially be improved. Most countries responded that they have adopted relevant recommendations by the WHO. Given the deficiencies identified in this first global survey on public health pesticide management and the recent rise in pesticide use for malaria control, the effectiveness and safety of pesticide use are being compromised. This highlights the urgent need for countries to strengthen their capacity on pesticide management and evidence-based decision making within the context of an integrated vector management approach.

  8. Global warming and the possible globalization of vector-borne diseases: a call for increased awareness and action.

    Science.gov (United States)

    Balogun, Emmanuel O; Nok, Andrew J; Kita, Kiyoshi

    2016-01-01

    Human activities such as burning of fossil fuels play a role in upsetting a previously more balanced and harmonious ecosystem. Climate change-a significant variation in the usual pattern of Earth's average weather conditions is a product of this ecosystem imbalance, and the rise in the Earth's average temperature (global warming) is a prominent evidence. There is a correlation between global warming and the ease of transmission of infectious diseases. Therefore, with global health in focus, we herein opine a stepping-up of research activities regarding global warming and infectious diseases globally.

  9. International Network for Capacity Building for the Control of Emerging Viral Vector-Borne Zoonotic Diseases: Arbo-Zoonet

    NARCIS (Netherlands)

    Ahmed, J.; Bouloy, M.; Ergonul, O.; Fooks, A.R.; Paweska, J.; Chevalier, V.; Drosten, C.; Moormann, R.J.M.; Tordo, N.; Vatansever, Z.; Calistri, P.; Estrada-Pena, A.; Mirazimi, A.; Unger, H.; Yin, H.; Seitzer, U.

    2009-01-01

    Arboviruses are arthropod-borne viruses, which include West Nile fever virus (WNFV), a mosquito-borne virus, Rift Valley fever virus (RVFV), a mosquito-borne virus, and Crimean-Congo haemorrhagic fever virus (CCHFV), a tick-borne virus. These arthropod-borne viruses can cause disease in different

  10. RNA Interference: A Promising Tool in the Control of Important Vector Born Diseases Zika, Dengue Fever, and Malaria

    Directory of Open Access Journals (Sweden)

    Jalil Nejati

    2017-05-01

    Full Text Available Background and Objectives: RNA interference is a process, in which a molecule of double-stranded RNA prevents the expression of a particular gene and leads to its silencing. Application of this technology in the control of disease-carrying insects is rising in agriculture and medical sciences. Also, its application in control of insect-borne diseases could be considered as a new, important, and effective approach. In this article, it was attempted to study the mechanisms of RNA interference, routs of its delivery to insects, as well as its application in genetic control of disease vector insects. Methods: In this study, 71 indexed articles in databases, such as Pubmed, SID, Scopus, Science direct, and Google scholar, were used. Results: dsRNA could be delivered to insect body through three routes of oral, injection, and Impregnation. The mechanism of dsRNA entrance into the cells has considerable effect on the success and applicability of this technique. Identification of host-parasite relationship in the insect body is one of the important applications of RNAi in medical entomology. Conclusion: Although, there is a considerable number of researches on RNAi in the agricultural pests field, studies on insect vectors of human diseases have been mostly in-vivo. However, application of RNAi is suggested as a new, safe and applicable approach, alone or along with other methods. Certainly, further researches in this field can pave the way for enforcement measures in the control of disease vectors, especially Zika, dengue fever, and malaria in the not so distant future.

  11. Support for research towards understanding the population health vulnerabilities to vector-borne diseases: increasing resilience under climate change conditions in Africa.

    Science.gov (United States)

    Ramirez, Bernadette

    2017-12-12

    Diseases transmitted to humans by vectors account for 17% of all infectious diseases and remain significant public health problems. Through the years, great strides have been taken towards combatting vector-borne diseases (VBDs), most notably through large scale and coordinated control programmes, which have contributed to the decline of the global mortality attributed to VBDs. However, with environmental changes, including climate change, the impact on VBDs is anticipated to be significant, in terms of VBD-related hazards, vulnerabilities and exposure. While there is growing awareness on the vulnerability of the African continent to VBDs in the context of climate change, there is still a paucity of research being undertaken in this area, and impeding the formulation of evidence-based health policy change. One way in which the gap in knowledge and evidence can be filled is for donor institutions to support research in this area. The collaboration between the WHO Special Programme for Research and Training in Tropical Diseases (TDR) and the International Centre for Research and Development (IDRC) builds on more than 10 years of partnership in research capacity-building in the field of tropical diseases. From this partnership was born yet another research initiative on VBDs and the impact of climate change in the Sahel and sub-Saharan Africa. This paper lists the projects supported under this research initiative and provides a brief on some of the policy and good practice recommendations emerging from the ongoing implementation of the research projects. Data generated from the research initiative are expected to be uptaken by stakeholders (including communities, policy makers, public health practitioners and other relevant partners) to contribute to a better understanding of the impacts of social, environmental and climate change on VBDs(i.e. the nature of the hazard, vulnerabilities, exposure), and improve the ability of African countries to adapt to and reduce the

  12. Ehrlichiosis: A Vector-Borne Disease of Animals and Humans. Current Topics in Veterinary Medicine and Animal Science, Volume 54

    Science.gov (United States)

    1990-01-01

    petechial fever . Vet. Rec. 84:149-150. 25. Stephenson, E. If., A. D. King, R. B. Moeiller, J. C. W~illiam , C. J. Holland, and M. Ristic. 1989...internationally. The same group joined a national eff’ort to decipher another mysterious disease known as Potomac horse fever (PHF). They used the same...an Ehrlichiosis-like syndrome, confusable, but distinct from Rocky Mountain spotted fever (without ; rash) were diagnosed and strongly associated

  13. Climate change and the emergence of vector-borne diseases in Europe: case study of dengue fever.

    Science.gov (United States)

    Bouzid, Maha; Colón-González, Felipe J; Lung, Tobias; Lake, Iain R; Hunter, Paul R

    2014-08-22

    Dengue fever is the most prevalent mosquito-borne viral disease worldwide. Dengue transmission is critically dependent on climatic factors and there is much concern as to whether climate change would spread the disease to areas currently unaffected. The occurrence of autochthonous infections in Croatia and France in 2010 has raised concerns about a potential re-emergence of dengue in Europe. The objective of this study is to estimate dengue risk in Europe under climate change scenarios. We used a Generalized Additive Model (GAM) to estimate dengue fever risk as a function of climatic variables (maximum temperature, minimum temperature, precipitation, humidity) and socioeconomic factors (population density, urbanisation, GDP per capita and population size), under contemporary conditions (1985-2007) in Mexico. We then used our model estimates to project dengue incidence under baseline conditions (1961-1990) and three climate change scenarios: short-term 2011-2040, medium-term 2041-2070 and long-term 2071-2100 across Europe. The model was used to calculate average number of yearly dengue cases at a spatial resolution of 10 × 10 km grid covering all land surface of the currently 27 EU member states. To our knowledge, this is the first attempt to model dengue fever risk in Europe in terms of disease occurrence rather than mosquito presence. The results were presented using Geographical Information System (GIS) and allowed identification of areas at high risk. Dengue fever hot spots were clustered around the coastal areas of the Mediterranean and Adriatic seas and the Po Valley in northern Italy. This risk assessment study is likely to be a valuable tool assisting effective and targeted adaptation responses to reduce the likely increased burden of dengue fever in a warmer world.

  14. Virtual globes and geospatial health: the potential of new tools in the management and control of vector-borne diseases

    Directory of Open Access Journals (Sweden)

    Anna-Sofie Stensgaard

    2009-05-01

    Full Text Available The rapidly growing field of three-dimensional software modeling of the Earth holds promise for applications in the geospatial health sciences. Easy-to-use, intuitive virtual globe technologies such as Google Earth™ enable scientists around the world to share their data and research results in a visually attractive and readily understandable fashion without the need for highly sophisticated geographical information systems (GIS or much technical assistance. This paper discusses the utility of the rapid and simultaneous visualization of how the agents of parasitic diseases are distributed, as well as that of their vectors and/or intermediate hosts together with other spatially-explicit information. The resulting better understanding of the epidemiology of infectious diseases, and the multidimensional environment in which they occur, are highlighted. In particular, the value of Google Earth™, and its web-based pendant Google Maps™, are reviewed from a public health view point, combining results from literature searches and experiences gained thus far from a multidisciplinary project aimed at optimizing schistosomiasis control and transmission surveillance in sub-Saharan Africa. Although the basic analytical capabilities of virtual globe applications are limited, we conclude that they have considerable potential in the support and promotion of the geospatial health sciences as a userfriendly, straightforward GIS tool for the improvement of data collation, visualization and exploration. The potential of these systems for data sharing and broad dissemination of scientific research and results is emphasized.

  15. Vector Borne Infections in Italy: Results of the Integrated Surveillance System for West Nile Disease in 2013

    Directory of Open Access Journals (Sweden)

    Christian Napoli

    2015-01-01

    Full Text Available The epidemiology of West Nile disease (WND is influenced by multiple ecological factors and, therefore, integrated surveillance systems are needed for early detecting the infection and activating consequent control actions. As different animal species have different importance in the maintenance and in the spread of the infection, a multispecies surveillance approach is required. An integrated and comprehensive surveillance system is in place in Italy aiming at early detecting the virus introduction, monitoring the possible infection spread, and implementing preventive measures for human health. This paper describes the integrated surveillance system for WND in Italy, which incorporates data from veterinary and human side in order to evaluate the burden of infection in animals and humans and provide the public health authorities at regional and national levels with the information needed for a fine tune response.

  16. The emergence and maintenance of vector-borne diseases in the Khyber Pakhtunkhwa Province (KPK and the Federally Administered Tribal Areas (FATA of Pakistan

    Directory of Open Access Journals (Sweden)

    Nathan Christopher Nieto

    2012-07-01

    Full Text Available Human populations throughout much of the world are experiencing unprecedented changes in their relationship to the environment and their interactions with the animals with which so many humans are intimately dependent upon. These changes result not only from human induced changes in the climate, but also from population demographic changes due to wars, social unrest, behavioral changes resulting from cultural mixing, and large changes in land-use practices. Each of these social shifts can affect the maintenance and emergence of arthropod vectors disease or the pathogenic organisms themselves. A good example is the country of Pakistan, with a large rural population and developing urban economy, it also maintains a wide diversity of entomological disease vectors, including biting flies, mosquitoes, and ticks. Pathogens endemic to the region include the agents of piroplasmosis, rickettsiosis, spirocheteosis, and viral hemorrhagic fevers and encephalitis. The northwestern region of the country, including the Khyber Pakhtunkhwa Province (KPK, formerly the North-West Frontier Provence (NWFP, and the Federally Administered Tribal Areas (FATA are mountainous regions with a high degree of habitat diversity that has recently undergone a massive increase in human population density due to an immigrating refugee population from neighboring war-torn Afghanistan. Vector-borne diseases in people and livestock are common in KPK and FATA regions due to the limited use of vector control measures and access to livestock vaccines. The vast majority of people in this region live in abject poverty with >70% of the population living directly from production gained in animal husbandry. In many instances whole families live directly alongside their animal counterparts. In addition, there is little to no awareness of the threat posed by ticks and transmission of either zoonotic or veterinary pathogens. Recent emergence of Crimean-Congo hemorrhagic fever virus in rural

  17. A reduce and replace strategy for suppressing vector-borne diseases: insights from a stochastic, spatial model.

    Directory of Open Access Journals (Sweden)

    Kenichi W Okamoto

    Full Text Available Two basic strategies have been proposed for using transgenic Aedes aegypti mosquitoes to decrease dengue virus transmission: population reduction and population replacement. Here we model releases of a strain of Ae. aegypti carrying both a gene causing conditional adult female mortality and a gene blocking virus transmission into a wild population to assess whether such releases could reduce the number of competent vectors. We find this "reduce and replace" strategy can decrease the frequency of competent vectors below 50% two years after releases end. Therefore, this combined approach appears preferable to releasing a strain carrying only a female-killing gene, which is likely to merely result in temporary population suppression. However, the fixation of anti-pathogen genes in the population is unlikely. Genetic drift at small population sizes and the spatially heterogeneous nature of the population recovery after releases end prevent complete replacement of the competent vector population. Furthermore, releasing more individuals can be counter-productive in the face of immigration by wild-type mosquitoes, as greater population reduction amplifies the impact wild-type migrants have on the long-term frequency of the anti-pathogen gene. We expect the results presented here to give pause to expectations for driving an anti-pathogen construct to fixation by relying on releasing individuals carrying this two-gene construct. Nevertheless, in some dengue-endemic environments, a spatially heterogeneous decrease in competent vectors may still facilitate decreasing disease incidence.

  18. Enhanced vector borne disease surveillance of California Culex mosquito populations reveals spatial and species-specific barriers of infection.

    Energy Technology Data Exchange (ETDEWEB)

    VanderNoot, Victoria A.; Curtis, Deanna Joy; Koh, Chung-Yan; Brodsky, Benjamin H; Lane, Todd

    2014-08-01

    Monitor i ng in f ectio n s in v ect o rs su c h as m osquit o es, s a nd fl i es, tsetse fl i es, a nd ticks to i denti f y hu m a n path o gens m a y s e r v e as a n ear l y w arn i ng det e ction system t o dir e ct loc a l g o v er n ment dise a se pr e v en t i v e m easu r e s . One major hurdle i n de t ection is the abi l i t y to scre e n l arge n u mbers of v e c t ors for h uman patho g ens w i thout t h e u s e of ge n o t y pe - s p ecific m o lecu l ar tec h nique s . N e x t genera t ion s equ e nc i ng (NG S ) pr o v i des a n unbi a sed p latfo r m capab l e of identi f y i ng k n o w n a n d unk n o w n p ath o ge n s circula t ing w i thin a v e ctor p opul a tion, but utili z ing t h is te c h nolo g y i s tim e - con s u ming a n d cos t l y for v ecto r -b o rne disease su r v e illan c e pr o gra m s. T o addr e s s this w e d e v e lop e d cos t -eff e ct i v e Ilumina(r) R NA- S eq l i bra r y p r epara t ion m e thodol o gies i n con j u n ction w i t h an automa t ed c ompu t at i onal a n a l y sis pipel i n e to ch a racter i ze t h e microbial popula t ions c ircula t i n g in Cu l e x m o squit o e s (Cul e x qui n quef a s c iatu s , C ul e x quinq u efasc i atus / pip i ens co m pl e x h y bri d s, and C u l e x ta r salis ) t hroug h out Californ i a. W e assembled 2 0 n o vel a n d w e l l -do c ume n ted a r b o v i ruses repres e nting mem b e rs of B u n y a v ir i da e , F l a v i virid a e, If a virida e , Meson i v i rida e , Nid o v iri d ae, O rtho m y x o virid a e, Pa r v o v iri d ae, Re o virid a e, R h a b d o v i rid a e, T y m o v iri d ae, a s w ell as s e v e r al u n assi g n e d v irus e s . In addit i o n, w e m app e d mRNA s pecies to d i vergent s peci e s of t r y panos o ma a nd pl a s modium eu k a r yotic parasit e s and cha r a c terized t he p r oka r yot i c microb i al c o mposit i on to i d enti f y bacteri a l tran s c r ipts der i v ed from wolba c hia, clo s tridi u m, m y c oplas m a, fusoba c

  19. The emergence and maintenance of vector-borne diseases in the khyber pakhtunkhwa province, and the federally administered tribal areas of pakistan.

    Science.gov (United States)

    Nieto, Nathan C; Khan, Khalid; Uhllah, Ghufran; Teglas, Mike B

    2012-01-01

    Human populations throughout much of the world are experiencing unprecedented changes in their relationship to the environment and their interactions with the animals with which so many humans are intimately dependent upon. These changes result not only from human induced changes in the climate, but also from population demographic changes due to wars, social unrest, behavioral changes resulting from cultural mixing, and large changes in land-use practices. Each of these social shifts can affect the maintenance and emergence of arthropod vectors disease or the pathogenic organisms themselves. A good example is the country of Pakistan, with a large rural population and developing urban economy, it also maintains a wide diversity of entomological disease vectors, including biting flies, mosquitoes, and ticks. Pathogens endemic to the region include the agents of piroplasmosis, rickettsiosis, spirochetosis, and viral hemorrhagic fevers and encephalitis. The northwestern region of the country, including the Khyber Pakhtunkhwa Province (KPK), formerly the North-West Frontier Provence (NWFP), and the Federally Administered Tribal Areas (FATA) are mountainous regions with a high degree of habitat diversity that has recently undergone a massive increase in human population density due to an immigrating refugee population from neighboring war-torn Afghanistan. Vector-borne diseases in people and livestock are common in KPK and FATA regions due to the limited use of vector control measures and access to livestock vaccines. The vast majority of people in this region live in abject poverty with >70% of the population living directly from production gained in animal husbandry. In many instances whole families live directly alongside their animal counterparts. In addition, there is little to no awareness of the threat posed by ticks and transmission of either zoonotic or veterinary pathogens. Recent emergence of Crimean-Congo hemorrhagic fever virus in rural populations

  20. Continental-scale, data-driven predictive assessment of eliminating the vector-borne disease, lymphatic filariasis, in sub-Saharan Africa by 2020.

    Science.gov (United States)

    Michael, Edwin; Singh, Brajendra K; Mayala, Benjamin K; Smith, Morgan E; Hampton, Scott; Nabrzyski, Jaroslaw

    2017-09-27

    There are growing demands for predicting the prospects of achieving the global elimination of neglected tropical diseases as a result of the institution of large-scale nation-wide intervention programs by the WHO-set target year of 2020. Such predictions will be uncertain due to the impacts that spatial heterogeneity and scaling effects will have on parasite transmission processes, which will introduce significant aggregation errors into any attempt aiming to predict the outcomes of interventions at the broader spatial levels relevant to policy making. We describe a modeling platform that addresses this problem of upscaling from local settings to facilitate predictions at regional levels by the discovery and use of locality-specific transmission models, and we illustrate the utility of using this approach to evaluate the prospects for eliminating the vector-borne disease, lymphatic filariasis (LF), in sub-Saharan Africa by the WHO target year of 2020 using currently applied or newly proposed intervention strategies. METHODS AND RESULTS: We show how a computational platform that couples site-specific data discovery with model fitting and calibration can allow both learning of local LF transmission models and simulations of the impact of interventions that take a fuller account of the fine-scale heterogeneous transmission of this parasitic disease within endemic countries. We highlight how such a spatially hierarchical modeling tool that incorporates actual data regarding the roll-out of national drug treatment programs and spatial variability in infection patterns into the modeling process can produce more realistic predictions of timelines to LF elimination at coarse spatial scales, ranging from district to country to continental levels. Our results show that when locally applicable extinction thresholds are used, only three countries are likely to meet the goal of LF elimination by 2020 using currently applied mass drug treatments, and that switching to more

  1. A PCR survey of vector-borne pathogens in different dog populations from Turkey.

    Science.gov (United States)

    Guo, Huanping; Sevinc, Ferda; Ceylan, Onur; Sevinc, Mutlu; Ince, Ege; Gao, Yang; Moumouni, Paul Franck Adjou; Liu, Mingming; Efstratiou, Artemis; Wang, Guanbo; Cao, Shinuo; Zhou, Mo; Jirapattharasate, Charoonluk; Ringo, Aaron Edmond; Zheng, Weiqing; Xuan, Xuenan

    2017-09-26

    In the present study, a total of 192 blood samples were collected from pet dogs, kennel dogs and shepherd dogs in Konya district, Turkey, and tested by specific PCR for the presence of vector-borne pathogens. Several pathogens were identified, most of which can cause substantial morbidity in dogs. PCR results revealed that 54 (28.1%) dogs were infected with one or more pathogens. Positive results were obtained for Babesia spp. in 4 dogs (2.1%), Hepatozoon spp. in 8 dogs (4.2%) and Mycoplasma spp. in 46 dogs (24%). Three dogs (1.6%) were infected with two or three pathogens. The sequence analysis of the positive DNA samples revealed the presence of Babesia canis vogeli, Hepatozoon canis, Hepatozoon sp. MF, Mycoplasma haemocanis and Candidatus Mycoplasma haematoparvum. Ehrlichia canis and Anaplasma platys were not detected. Regardless of ownership status, vector-borne diseases were common in these dog populations. There was significant difference of pathogen prevalence among the different dog populations. Mycoplasma spp. was more frequent in the kennel dogs (31.9%) than in the pet (21.4%) and shepherd dogs (13.8%). Additionally, the frequency of Babesia spp. and Hepatozoon spp. was higher in the shepherd dogs which account for three quarters and half of the total number of Babesia spp. and Hepatozoon spp., respectively. To our knowledge, this is the first report of Mycoplasma infection in dogs in Turkey. The results of the present study provide a foundation for understanding the epidemiology of canine vector-borne diseases (CVBDs), and for strategies to control these diseases in Turkey.

  2. Rapid Identification of Vector-Borne Flaviviruses by Mass Spectrometry

    Science.gov (United States)

    2010-02-01

    Eastern, and Siberian subtypes [9]. Several tick-borne flaviviruses can also cause hemorrhagic disease. Important examples of these viruses include...assay. Identical base compositions within a column are the same color. Unique base compositions are shown with white backgrounds. (For interpretation...States, 1999e2005. Vector Borne Zoonotic Dis 2008;8:733e40. [18] Hofstadler SA, Sampath R, Blyn LB, Eshoo MW, Hall TA, Jiang Y, et al. TIGER : the

  3. [The influence of weather conditions on the epidemiology of vector-borne diseases by the example of West Nile fever in Russia].

    Science.gov (United States)

    Platonov, A E

    2006-01-01

    Climate changes must influence the incidence of vector-borne infections, but their effects cannot be revealed due to lack of long-term observations. The impact of short-term weather changes may be used as a model. In Russia the biggest numbers of clinical cases of mosquito-borne West Nile infection were registered in 1999 in Volgograd and Astrakhan regions. The analysis of climatic dataset since 1900 shows that 1999 was the hottest year in Volgograd in the 20th century due to a very mild winter (December-March) and a rather hot summer (June-September). The author of the article puts forward a hypothesis that high winter temperatures favored the survival of over-wintering mosquito vectors, and high summer temperature facilitated the growth of the virus in the mosquitoes, as well as propagation of the mosquitoes themselves. The author assumes that conventional threshold temperatures for "beneficial for WNF conditions" in Russia are > or = 3 degrees C in winter, and > or = 22 degrees C in summer. These conditions coincided only in 1948 and 1999. In Astrakhan the "beneficial for WNF conditions" were registered in 30 out of 147 years of observation, and in 12 years between 1964 and 2003. This is not surprising that Astrakhan region is endemic for WNF in accordance with clinical and epidemiological data collected since the sixties. These findings give some hints on the WNF predisposing factors, as well as possibility of weather surveillance and prediction of WNF outbreaks in temperate climatic zones such as Southern Russia.

  4. Borrelia miyamotoi, Other Vector-Borne Agents in Cat Blood and Ticks in Eastern Maryland.

    Science.gov (United States)

    Shannon, Avery B; Rucinsky, Renee; Gaff, Holly D; Brinkerhoff, R Jory

    2017-12-01

    We collected blood and tick samples in eastern Maryland to quantify vector-borne pathogen exposure and infection in healthy cats and to assess occupational disease risk to veterinary professionals and others who regularly interact with household pets. Thirty-six percent of healthy cats parasitized by ticks at time of examination (9/25) were exposed to, and 14% of bloods (7/49) tested PCR-positive for, at least one vector-borne pathogen including several bloods and ticks with Borrelia miyamotoi, a recently recognized tick-borne zoonotic bacterium. There was no indication that high tick burdens were associated with exposure to vector-borne pathogens. Our results underscore the potential importance of cats to human vector-borne disease risk.

  5. Canine babesiosis: from molecular taxonomy to control

    Directory of Open Access Journals (Sweden)

    Irwin Peter J

    2009-03-01

    Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

  6. Assessing the consequences of an incursion of a vector-borne disease. II. Spread of bluetongue in Scotland and impact of vaccination

    Directory of Open Access Journals (Sweden)

    Camille Szmaragd

    2010-09-01

    Full Text Available Bluetongue is a viral disease of ruminants transmitted by Culicoides biting midges, which has spread across Europe over the past decade. The disease arrived in south-east England in 2007, raising the possibility that it could pose a risk to the valuable Scottish livestock industry. As part of an assessment of the economic consequences of a bluetongue virus incursion into Scotland commissioned by Scottish Government, we investigated a defined set of feasible incursion scenarios under different vaccination strategies. Our epidemiological simulations, based on expert knowledge, highlighted that infection will rarely spread in Scotland after the initial incursion and will be efficiently controlled by vaccination. Keywords: Epidemiology, modelling, disease control

  7. Climate change and the spread of vector-borne diseases: using approximate Bayesian computation to compare invasion scenarios for the bluetongue virus vector Culicoides imicola in Italy

    NARCIS (Netherlands)

    Mardulyn, P.; Goffredo, M.; Conte, A.; Hendrickx, G.; Meiswinkel, R.; Balenghien, T.; Sghaier, S.; Lohr, Y.; Gilbert, M.

    2013-01-01

    Bluetongue (BT) is a commonly cited example of a disease with a distribution believed to have recently expanded in response to global warming. The BT virus is transmitted to ruminants by biting midges of the genus Culicoides, and it has been hypothesized that the emergence of BT in Mediterranean

  8. Support for research towards understanding the population health vulnerabilities to vector-borne diseases: increasing resilience under climate change conditions in Africa

    Institute of Scientific and Technical Information of China (English)

    Bernadette Ramirez

    2017-01-01

    Background:Diseases transmitted to humans by vectors account for 17% of all infectious diseases and remain significant public health problems.Through the years,great strides have been taken towards combatting vectorborne diseases (VBDs),most notably through large scale and coordinated control programmes,which have contributed to the decline of the global mortality attributed to VBDs.However,with environmental changes,including climate change,the impact on VBDs is anticipated to be significant,in terms of VBD-related hazards,vulnerabilities and exposure.While there is growing awareness on the vulnerability of the African continent to VBDs in the context of climate change,there is still a paucity of research being undertaken in this area,and impeding the formulation of evidence-based health policy change.Main body:One way in which the gap in knowledge and evidence can be filled is for donor institutions to support research in this area.The collaboration between the WHO Special Programme for Research and Training in Tropical Diseases (TDR) and the International Centre for Research and Development (IDRC) builds on more than 10 years of partnership in research capacity-building in the field of tropical diseases.From this partnership was born yet another research initiative on VBDs and the impact of climate change in the Sahel and sub-Saharan Africa.This paper lists the projects supported under this research initiative and provides a brief on some of the policy and good practice recommendations emerging from the ongoing implementation of the research projects.Conclusion:Data generated from the research initiative are expected to be uptaken by stakeholders (including communities,policy makers,public health practitioners and other relevant partners) to contribute to a better understanding of the impacts of social,environmental and climate change on VBDs(i.e.the nature of the hazard,vulnerabilities,exposure),and improve the ability of African countries to adapt to and

  9. Aquatic Insect from Iran for Possible Use of Biological Control of Main Vector-Borne Disease of Malaria and Water Indicator of Contamination

    Directory of Open Access Journals (Sweden)

    Zahra Saeidi

    2018-03-01

    Full Text Available Iran has a wide variety of zoogeographical regions and different seasons. Here are some important mosquito-borne diseases. Mosquitoes normally live in waters. Its aquatic insect fauna is highly unexplored. To being resolved this faunal gap, a variety of literature records from previous century in different parts of Iran was reviewed. In some southern and southeastern foci in Iran, Malaria is still a main endemic disease which is unstable with two seasonal spring and autumn peaks even though Iran is lunching Malaria elimination. This review article showed the wide variety of aquatic insects throughout the country. Researchers can discuss water pollutant and its quality by using aquatic insect fauna as well as biological control for vectors. Types of aquatic in­sects and macroinvertebrates sampling can be useful for water quality monitoring as indicators. Looking at aquatic insects’ life in water could be one of the most cost-effective and the easiest method to assess the water contaminations by different pollutants and will provide a guideline for scientific communities and environmental agencies for decision making.

  10. Climate change and the spread of vector-borne diseases: using approximate Bayesian computation to compare invasion scenarios for the bluetongue virus vector Culicoides imicola in Italy.

    Science.gov (United States)

    Mardulyn, Patrick; Goffredo, Maria; Conte, Annamaria; Hendrickx, Guy; Meiswinkel, Rudolf; Balenghien, Thomas; Sghaier, Soufien; Lohr, Youssef; Gilbert, Marius

    2013-05-01

    Bluetongue (BT) is a commonly cited example of a disease with a distribution believed to have recently expanded in response to global warming. The BT virus is transmitted to ruminants by biting midges of the genus Culicoides, and it has been hypothesized that the emergence of BT in Mediterranean Europe during the last two decades is a consequence of the recent colonization of the region by Culicoides imicola and linked to climate change. To better understand the mechanism responsible for the northward spread of BT, we tested the hypothesis of a recent colonization of Italy by C. imicola, by obtaining samples from more than 60 localities across Italy, Corsica, Southern France, and Northern Africa (the hypothesized source point for the recent invasion of C. imicola), and by genotyping them with 10 newly identified microsatellite loci. The patterns of genetic variation within and among the sampled populations were characterized and used in a rigorous approximate Bayesian computation framework to compare three competing historical hypotheses related to the arrival and establishment of C. imicola in Italy. The hypothesis of an ancient presence of the insect vector was strongly favoured by this analysis, with an associated P ≥ 99%, suggesting that causes other than the northward range expansion of C. imicola may have supported the emergence of BT in southern Europe. Overall, this study illustrates the potential of molecular genetic markers for exploring the assumed link between climate change and the spread of diseases. © 2013 Blackwell Publishing Ltd.

  11. The accuracy of the National Equine Database in relation to vector-borne disease risk modelling of horses in Great Britain.

    Science.gov (United States)

    Robin, C A; Lo Iacono, G; Gubbins, S; Wood, J L N; Newton, J R

    2013-05-01

    The National Equine Database (NED) contains information on the size and distribution of the horse population, but the data quality remains unknown. These data could assist with surveillance, research and contingency planning for equine infectious disease outbreaks. 1) To assess the extent of obsolete and missing data from NED, 2) evaluate the extent of spatial separation between horse and owner location and 3) identify relationships between spatial separation and land use. Two questionnaires were used to assess data accuracy in NED utilising local authority passport inspections and distribution of questionnaires to 11,000 horse owners. A subset of 1010 questionnaires was used to assess horse-owner geographic separation. During 2005-2010, 17,048 passports were checked through local authority inspections. Of these, 1558 passports (9.1%; 95% confidence interval [CI] 8.7-9.5%) were noncompliant, with 963 (5.6%; 95% CI 5.3-6.0%) containing inaccurate information and 595 (3.5%; 95% CI 3.2-3.8%) classified as missing. Of 1382 questionnaires completed by horse owners, 380 passports were obsolete (27.5%; 95% CI 25.2-29.9%), with 162 (11.7%; 95% CI 10.0-13.4%) being retained for deceased horses and 218 (15.8%; 95% CI 13.9-17.7%) having incorrect ownership details. Fifty-three per cent (95% CI 49.9-56.1%) of owners kept their horse(s) at home and 92% (95% CI 90.3-93.7%) of horses resided within 10 km of their owners. Data from a small sample survey suggest the majority of data on NED are accurate but a proportion of inaccuracies exist that may cause delay in locating horses and contacting owners during a disease outbreak. The probability that horses are located in the same postcode sector as the owner's home address is larger in rural areas. Appropriate adjustment for population size, horse-owner spatial separation and land usage would facilitate meaningful use of the national horse population derived from NED for risk modelling of incursions of equine diseases into Great

  12. A Multi-Host Agent-Based Model for a Zoonotic, Vector-Borne Disease. A Case Study on Trypanosomiasis in Eastern Province, Zambia.

    Directory of Open Access Journals (Sweden)

    Simon Alderton

    2016-12-01

    Full Text Available This paper presents a new agent-based model (ABM for investigating T. b. rhodesiense human African trypanosomiasis (rHAT disease dynamics, produced to aid a greater understanding of disease transmission, and essential for development of appropriate mitigation strategies.The ABM was developed to model rHAT incidence at a fine spatial scale along a 75 km transect in the Luangwa Valley, Zambia. The method offers a complementary approach to traditional compartmentalised modelling techniques, permitting incorporation of fine scale demographic data such as ethnicity, age and gender into the simulation.Through identification of possible spatial, demographic and behavioural characteristics which may have differing implications for rHAT risk in the region, the ABM produced output that could not be readily generated by other techniques. On average there were 1.99 (S.E. 0.245 human infections and 1.83 (S.E. 0.183 cattle infections per 6 month period. The model output identified that the approximate incidence rate (per 1000 person-years was lower amongst cattle owning households (0.079, S.E. 0.017, than those without cattle (0.134, S.E. 0.017. Immigrant tribes (e.g. Bemba I.R. = 0.353, S.E.0.155 and school-age children (e.g. 5-10 year old I.R. = 0.239, S.E. 0.041 were the most at-risk for acquiring infection. These findings have the potential to aid the targeting of future mitigation strategies.ABMs provide an alternative way of thinking about HAT and NTDs more generally, offering a solution to the investigation of local-scale questions, and which generate results that can be easily disseminated to those affected. The ABM can be used as a tool for scenario testing at an appropriate spatial scale to allow the design of logistically feasible mitigation strategies suggested by model output. This is of particular importance where resources are limited and management strategies are often pushed to the local scale.

  13. Species composition and fauna distribution of mosquitoes (Diptera: Culicidae and its importance for vector-borne diseases in a rural area of Central Western - Mato Grosso, Brazil

    Directory of Open Access Journals (Sweden)

    Fábio Alexandre Leal-Santos

    2017-08-01

    Full Text Available Abstract. This study describes ecological data obtained in a rural area in the State of Mato Grosso, including the insects belonging to the family Culicidae, especially those framed as potential vectors of tropical diseases. In 2015, we collected adult mosquitoes in fragments of forest in a rural area located in Mato Grosso Central West of Brazil. We captured 18,256 mosquitoes of the sub-families Culicinae and Anophelinae and have identified 34 species belonging to 12 genera: Aedes (1 species, Anopheles (8 species, Coquillettidia (1 species, Haemagogus (1 species, Culex (5 species, Psorophora  (5 species, Ochlerotatus (4 species, Deinocerites (1 species,  Mansonia (4 species, Sabethes (2 species, Limatus (1 species, Wyeomyia (1 species. The family Culicidae presented high richness and abundance, established by diversity indexes (Margalef α =3.26; Shannon H' = 2.09; Simpson D = 0.19 with dominance of the species Anopheles (Nyssorhyncus darlingi Root (89.8%. This species has considerable epidemiological value, considered the main vector of malaria in Mato Grosso. Many species of mosquitoes are vectors of pathogens that cause disease in humans and domestic animals, transmitting pathogens including viruses (arboviruses, filaria worms (helminths and protozoa. Composição de espécies e distribuição da fauna de mosquitos (Diptera: Culicidae e sua importância para doenças transmitidas por vetores em uma área rural do centro-ocidental - Mato Grosso, Brasil Resumo. Este estudo descreve dados ecológicos de uma área rural do Estado de Mato Grosso e dos insetos da família Culicidae especialmente aqueles enquadrados como vetores potenciais de doenças tropicais. Em 2015, coletamos mosquitos adultos em fragmentos de floresta em localidades de áreas rurais no Mato Grosso região Centro Oeste do Brasil. Foram capturados 18.256 exemplares alados de mosquitos das subfamílias Culicinae e Anophelinae e identificadas 34 espécies pertencentes a 12 g

  14. Molecular detection of vector-borne pathogens in dogs and cats from Qatar.

    Science.gov (United States)

    Alho, Ana Margarida; Lima, Clara; Latrofa, Maria Stefania; Colella, Vito; Ravagnan, Silvia; Capelli, Gioia; Madeira de Carvalho, Luís; Cardoso, Luís; Otranto, Domenico

    2017-06-20

    Vector-borne diseases (VBDs) have been increasingly reported in dogs and cats worldwide. However, no data are currently available regarding canine and feline VBDs in Qatar and limited information is available from other Persian Gulf countries. Blood samples from 98 client-owned animals (i.e. 64 dogs and 34 cats) living in Doha (Qatar) were collected and the presence of genomic DNA of Anaplasma spp., Babesia spp., Dirofilaria spp., Ehrlichia spp., Hepatozoon spp., Mycoplasma spp. and Rickettsia spp. was assessed by polymerase chain reaction (PCR), real time-PCR (rt-PCR) and sequence analysis. Of the 64 dogs, 12 (18.8%) were infected with at least one pathogen (i.e. 7.8% with Mycoplasma spp., 4.7% with Babesia vogeli, 3.1% with Ehrlichia canis, and 1.6% with Anaplasma platys, Babesia gibsoni and Hepatozoon canis, each). One of the 12 dogs was co-infected with B. vogeli and E. canis. Of the 34 cats, seven (20.6%) animals were infected with at least one pathogen (i.e. 5.9% were positive for Mycoplasma spp., and 2.9% for Babesia felis, B. vogeli, E. canis, "Candidatus Mycoplasma haemominutum" and Mycoplasma haemofelis, each). No dogs or cats were positive for Dirofilaria spp. or Rickettsia spp. Although the sample sizes of dogs and cats herein analysed was moderately small, data from this study report the occurrence of A. platys, B. vogeli, B. gibsoni, E. canis, H. canis and Mycoplasma spp. in domestic dogs and of B. felis, B. vogeli, "Candidatus M. haemominutum", E. canis and M. haemofelis in domestic cats from Qatar. Further investigations along with prophylactic measures are strongly recommended in order to reduce the risk of dogs and cats acquiring VBDs in Qatar.

  15. Vector-borne pathogens in dogs from Costa Rica: first molecular description of Babesia vogeli and Hepatozoon canis infections with a high prevalence of monocytic ehrlichiosis and the manifestations of co-infection.

    Science.gov (United States)

    Rojas, Alicia; Rojas, Diana; Montenegro, Víctor; Gutiérrez, Ricardo; Yasur-Landau, Daniel; Baneth, Gad

    2014-01-31

    Infection with canine vector-borne pathogens was evaluated in dogs from four different regions of Costa Rica by PCR. Demographic data, clinical signs, packed cell volume values, and the presence of tick infestation were recorded for each dog. Forty seven percent (69/146) of the dogs were infected with at least one pathogen and 12% were co-infected with two pathogens. Ehrlichia canis was detected in 34%, Anaplasma platys in 10%, Babesia vogeli in 8%, and Hepatozoon canis in 7.5% of the blood samples. No infection was detected with Leishmania spp. in blood, skin scrapings or conjunctival swabs. Thirty percent of the dogs presented at least one clinical sign compatible with vector-borne disease, and of those, 66% were infected with a pathogen. Subclinical infections were determined in 58% of the infected dogs including 82% (9/11), 58% (29/50), 42% (5/12) and 36% (5/14) of the dogs with H. canis, E. canis, B. vogeli and A. platys infections, respectively. A distinct relationship was found between infection and anemia. The mean PCV values were 34.4% in dogs with no infection, 31.5% in those who had a single infection and 23% in those with co-infection. Co-infected dogs had significantly lower PCV values compared to non-infected and single-infected dogs (pcanis were significantly associated with R. sanguineus s.l. infestation (pcanis in Costa Rica as well as in Central America. The results of this study indicate that multiple vector-borne pathogens responsible for severe diseases infect dogs in Costa Rica and therefore, increased owner and veterinarian awareness are needed. Moreover, prevention of tick infestation is recommended to decrease the threat of these diseases to the canine population. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. New and emerging pathogens in canine infectious respiratory disease.

    Science.gov (United States)

    Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J

    2014-03-01

    Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.

  17. Study of the climatic change impact on vector-borne diseases in West Africa: the case of tick-borne borreliosis and malaria; Etude de l'impact du changement climatique sur les maladies a transmission vectorielle en Afrique de l'Ouest: le cas de la borreliose a tiques et du paludisme

    Energy Technology Data Exchange (ETDEWEB)

    Trape, J.F

    2005-04-15

    Malaria and tick-borne borreliosis are the two first causes of morbidity due to vector-borne diseases in a large part of Sudan-sahelian West Africa. They are also the two tropical diseases which have been the most affected by climatic change in recent years. In the case of tick-borne borreliosis it has been shown in Senegal that the persistence of drought since the years 70 has been associated with a considerable extension of the geographic range of diseases and the vector tick A-sonrai, a species that was in the past limited to the Sahara and Sahel. In the case of malaria, drought has strongly reduced in these same regions of Africa the distribution, abundance and infection rate of Anopheline mosquitoes, but without any significant reduction of the burden of malaria for most populations concerned. The emergence and spread of Plasmodium falciparum resistance to antimalarial drugs only explain part of this phenomenon. (A.L.B.)

  18. Potential impact of climate change on emerging vector-borne and other infections in the UK.

    Science.gov (United States)

    Baylis, Matthew

    2017-12-05

    Climate is one of several causes of disease emergence. Although half or more of infectious diseases are affected by climate it appears to be a relatively infrequent cause of human disease emergence. Climate mostly affects diseases caused by pathogens that spend part of their lifecycle outside of the host, exposed to the environment. The most important routes of transmission of climate sensitive diseases are by arthropod (insect and tick) vectors, in water and in food. Given the sensitivity of many diseases to climate, it is very likely that at least some will respond to future climate change. In the case of vector-borne diseases this response will include spread to new areas. Several vector-borne diseases have emerged in Europe in recent years; these include vivax malaria, West Nile fever, dengue fever, Chikungunya fever, leishmaniasis, Lyme disease and tick-borne encephalitis. The vectors of these diseases are mosquitoes, sand flies and ticks. The UK has endemic mosquito species capable of transmitting malaria and probably other pathogens, and ticks that transmit Lyme disease. The UK is also threatened by invasive mosquito species known to be able to transmit West Nile, dengue, chikungunya and Zika, and sand flies that spread leishmaniasis. Warmer temperatures in the future will increase the suitability of the UK's climate for these invasive species, and increase the risk that they may spread disease. While much attention is on invasive species, it is important to recognize the threat presented by native species too. Proposed actions to reduce the future impact of emerging vector-borne diseases in the UK include insect control activity at points of entry of vehicles and certain goods, wider surveillance for mosquitoes and sand flies, research into the threat posed by native species, increased awareness of the medical profession of the threat posed by specific diseases, regular risk assessments, and increased preparedness for the occurrence of a disease emergency.

  19. Geographic range of vector-borne infections and their vectors: the role of African wildlife.

    Science.gov (United States)

    van Vuuren, M; Penzhorn, B L

    2015-04-01

    The role of African wildlife in the occurrence of vector-borne infections in domestic animals has gained renewed interest as emerging and re-emerging infections occur worldwide at an increasing rate. In Africa, biodiversity conservation and the expansion of livestock production have increased the risk of transmitting vector-borne infections between wildlife and livestock. The indigenous African pathogens with transboundary potential, such as Rift Valley fever virus, African horse sickness virus, bluetongue virus, lumpy skin disease virus, African swine fever virus, and blood-borne parasites have received the most attention. There is no evidence for persistent vector-borne viral infections in African wildlife. For some viral infections, wildlife may act as a reservoir through the inter-epidemic circulation of viruses with mild or subclinical manifestations. Wildlife may also act as introductory or transporting hosts when moved to new regions, e.g. for lumpy skin disease virus, Rift Valley fever virus and West Nile virus. Wildlife may also act as amplifying hosts when exposed to viruses in the early part of the warm season when vectors are active, with spillover to domestic animals later in the season, e.g. with bluetongue and African horse sickness. Some tick species found on domestic animals are more abundant on wildlife hosts; some depend on wildlife hosts to complete their life cycle. Since the endemic stability of a disease depends on a sufficiently large tick population to ensure that domestic animals become infected at an early age, the presence of wildlife hosts that augment tick numbers may be beneficial. Many wild ungulate species are reservoirs of Anaplasma spp., while the role of wildlife in the epidemiology of heartwater (Ehrlichia ruminantium infection) has not been elucidated. Wild ungulates are not usually reservoirs of piroplasms that affect livestock; however, there are two exceptions: zebra, which are reservoirs of Babesia caballi and Theileria

  20. Projected economic losses due to vector and vector-borne parasitic diseases in livestock of India and its significance in implementing the concept of integrated practices for vector management

    Directory of Open Access Journals (Sweden)

    B. W. Narladkar

    2018-02-01

    Full Text Available Broadly, species of arthropods infesting livestock are grouped into flies (biting and non-biting, fleas, lice (biting and sucking, ticks (soft and hard, and mites (burrowing, non-burrowing, and follicular. Among which, biting and non-biting flies and ticks are the potent vectors for many bacterial, viral, rickettsial, and protozoan diseases. Vectors of livestock are having economic significance on three points (1 direct losses from their bite and annoyance, worries, and psychological disturbances produced during the act of biting and feeding, (2 diseases they transmit, and (3 expenditure incurred for their control. Flies such as Culicoides spp. and Musca spp. and various species of hard ticks play important role in disease transmission in addition to their direct effects. For control of vectors, recent concept of integrated pest management (IPM provides the best solution and also addresses the problems related to acaricide resistance and environmental protection from hazardous chemicals. However, to successfully implement the concept of IPM, for each vector species, estimation of two monitory benchmarks, i.e., economic injury level (EIL and economic threshold level (ETL is essential prerequisite. For many vector species and under several circumstances, estimation of EIL and ETL appears to be difficult. Under such scenario, although may not be exact, an approximate estimate can be accrued by taking into account several criteria such as percent prevalence of vectors in a geographical area, percent losses produced, total livestock population, and current prices of livestock products such as milk, meat, and wool. Method for approximate estimation is first time described and elaborated in the present review article.

  1. Projected economic losses due to vector and vector-borne parasitic diseases in livestock of India and its significance in implementing the concept of integrated practices for vector management

    Science.gov (United States)

    Narladkar, B. W.

    2018-01-01

    Broadly, species of arthropods infesting livestock are grouped into flies (biting and non-biting), fleas, lice (biting and sucking), ticks (soft and hard), and mites (burrowing, non-burrowing, and follicular). Among which, biting and non-biting flies and ticks are the potent vectors for many bacterial, viral, rickettsial, and protozoan diseases. Vectors of livestock are having economic significance on three points (1) direct losses from their bite and annoyance, worries, and psychological disturbances produced during the act of biting and feeding, (2) diseases they transmit, and (3) expenditure incurred for their control. Flies such as Culicoides spp. and Musca spp. and various species of hard ticks play important role in disease transmission in addition to their direct effects. For control of vectors, recent concept of integrated pest management (IPM) provides the best solution and also addresses the problems related to acaricide resistance and environmental protection from hazardous chemicals. However, to successfully implement the concept of IPM, for each vector species, estimation of two monitory benchmarks, i.e., economic injury level (EIL) and economic threshold level (ETL) is essential prerequisite. For many vector species and under several circumstances, estimation of EIL and ETL appears to be difficult. Under such scenario, although may not be exact, an approximate estimate can be accrued by taking into account several criteria such as percent prevalence of vectors in a geographical area, percent losses produced, total livestock population, and current prices of livestock products such as milk, meat, and wool. Method for approximate estimation is first time described and elaborated in the present review article. PMID:29657396

  2. La reforma del sector salud, descentralización, prevención y control de enfermedades transmitidas por vectores Health system, decentralization, and the control of vector-borne diseases

    Directory of Open Access Journals (Sweden)

    Gabriel A. Schmunis

    2000-01-01

    Full Text Available Con las nuevas macropolíticas mundiales, la salud en América Latina ha sufrido importante transición en direción a la decentralización, sin compatibilizar la salud pública con la lógica de las economías de mercado. Con esto, el control decentralizado de las enfermedades endémicas presenta dificultades políticas y operativas. Aunque la decentralización se justifica por los presupuestos teóricos, no hay tradición de este control en los niveles municipales, lo que dificulta la simple o burocrática transferencia de encargos para estos niveles. La falta de expertise, el turn-over político y la corrupción son dificultades adicionales, conllevando a una extinción de varias instituiciones y programas. La falta de efectividad en el enfrentamiento del dengue, de la malaria y de la enfermedad de Chagas son algunos ejemplos. Requierese una modernización con responsabilidad, con una transición compartida entre los niveles y garantizada por acciones continuadas. Sugierese mantener estructuras regionales para referencia, consolidación epidemiológica, normatización, capacitación y supervisión, incluso con reserva técnica para acciones finalísticas supletivas.Economic policies are changing Latin American health programs, particularly promoting decentralization. Numerous difficulties thus arise for the control of endemic diseases, since such activities traditionally depend on vertical, and centralized structures. Theoretical arguments in favor of decentralization notwithstanding, no such tradition exists at the county level. The lack of program expertise at peripheral levels, intensive staff turnover, and even corruption are additional difficulties. Hence, the simple bureaucratic transfer of activities from the Federal to county level is often irresponsible. The loss of priority for control of endemic diseases in Latin America may mean the inexorable extinction of traditional control services. Malaria, dengue fever, and Chagas disease

  3. Vaccines for canine leishmaniasis

    Directory of Open Access Journals (Sweden)

    Clarisa B. Palatnik-De-Sousa

    2012-04-01

    Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans

  4. Broad patterns in domestic vector-borne Trypanosoma cruzi transmission dynamics: synanthropic animals and vector control.

    Science.gov (United States)

    Peterson, Jennifer K; Bartsch, Sarah M; Lee, Bruce Y; Dobson, Andrew P

    2015-10-22

    Chagas disease (caused by Trypanosoma cruzi) is the most important neglected tropical disease (NTD) in Latin America, infecting an estimated 5.7 million people in the 21 countries where it is endemic. It is one of the NTDs targeted for control and elimination by the 2020 London Declaration goals, with the first goal being to interrupt intra-domiciliary vector-borne T. cruzi transmission. A key question in domestic T. cruzi transmission is the role that synanthropic animals play in T. cruzi transmission to humans. Here, we ask, (1) do synanthropic animals need to be targeted in Chagas disease prevention policies?, and (2) how does the presence of animals affect the efficacy of vector control? We developed a simple mathematical model to simulate domestic vector-borne T. cruzi transmission and to specifically examine the interaction between the presence of synanthropic animals and effects of vector control. We used the model to explore how the interactions between triatomine bugs, humans and animals impact the number and proportion of T. cruzi-infected bugs and humans. We then examined how T. cruzi dynamics change when control measures targeting vector abundance are introduced into the system. We found that the presence of synanthropic animals slows the speed of T. cruzi transmission to humans, and increases the sensitivity of T. cruzi transmission dynamics to vector control measures at comparable triatomine carrying capacities. However, T. cruzi transmission is amplified when triatomine carrying capacity increases with the abundance of syntathoropic hosts. Our results suggest that in domestic T. cruzi transmission scenarios where no vector control measures are in place, a reduction in synanthropic animals may slow T. cruzi transmission to humans, but it would not completely eliminate transmission. To reach the 2020 goal of interrupting intra-domiciliary T. cruzi transmission, it is critical to target vector populations. Additionally, where vector control measures

  5. An antivector vaccine protects against a lethal vector-borne pathogen.

    Directory of Open Access Journals (Sweden)

    Milan Labuda

    2006-04-01

    Full Text Available Vaccines that target blood-feeding disease vectors, such as mosquitoes and ticks, have the potential to protect against the many diseases caused by vector-borne pathogens. We tested the ability of an anti-tick vaccine derived from a tick cement protein (64TRP of Rhipicephalus appendiculatus to protect mice against tick-borne encephalitis virus (TBEV transmitted by infected Ixodes ricinus ticks. The vaccine has a "dual action" in immunized animals: when infested with ticks, the inflammatory and immune responses first disrupt the skin feeding site, resulting in impaired blood feeding, and then specific anti-64TRP antibodies cross-react with midgut antigenic epitopes, causing rupture of the tick midgut and death of engorged ticks. Three parameters were measured: "transmission," number of uninfected nymphal ticks that became infected when cofeeding with an infected adult female tick; "support," number of mice supporting virus transmission from the infected tick to cofeeding uninfected nymphs; and "survival," number of mice that survived infection by tick bite and subsequent challenge by intraperitoneal inoculation of a lethal dose of TBEV. We show that one dose of the 64TRP vaccine protects mice against lethal challenge by infected ticks; control animals developed a fatal viral encephalitis. The protective effect of the 64TRP vaccine was comparable to that of a single dose of a commercial TBEV vaccine, while the transmission-blocking effect of 64TRP was better than that of the antiviral vaccine in reducing the number of animals supporting virus transmission. By contrast, the commercial antitick vaccine (TickGARD that targets only the tick's midgut showed transmission-blocking activity but was not protective. The 64TRP vaccine demonstrates the potential to control vector-borne disease by interfering with pathogen transmission, apparently by mediating a local cutaneous inflammatory immune response at the tick-feeding site.

  6. Population Health Vulnerabilities to Vector-borne Diseases ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Damming, irrigation and other forms of water management are also creating new habitats ... adaptation, particularly to improve the resilience of vulnerable populations. ... Linking research to urban planning at the ICLEI World Congress 2018.

  7. Ocular dirofilariasis: Ophthalmic implication of climate change on vector-borne parasites

    Directory of Open Access Journals (Sweden)

    Joseph D. Boss, M.D.

    2017-09-01

    Conclusions and importance: With increasing global temperatures, ocular dirofilariasis is being introduced in more northern climates and should be included in the differential diagnosis in areas previously isolated from these vector-borne parasites.

  8. The Re-Emergence and Emergence of Vector-Borne Rickettsioses in Taiwan

    Directory of Open Access Journals (Sweden)

    Nicholas T. Minahan

    2017-12-01

    Full Text Available Rickettsial diseases, particularly vector-borne rickettsioses (VBR, have a long history in Taiwan, with studies on scrub typhus and murine typhus dating back over a century. The climatic and geographic diversity of Taiwan’s main island and its offshore islands provide many ecological niches for the diversification and maintenance of rickettsiae alike. In recent decades, scrub typhus has re-emerged as the most prevalent type of rickettsiosis in Taiwan, particularly in eastern Taiwan and its offshore islands. While murine typhus has also re-emerged on Taiwan’s western coast, it remains neglected. Perhaps more alarming than the re-emergence of these rickettsioses is the emergence of newly described VBR. The first case of human infection with Rickettsia felis was confirmed in 2005, and undetermined spotted fever group rickettsioses have recently been detected. Taiwan is at a unique advantage in terms of detecting and characterizing VBR, as it has universal health coverage and a national communicable disease surveillance system; however, these systems have not been fully utilized for this purpose. Here, we review the existing knowledge on the eco-epidemiology of VBR in Taiwan and recommend future courses of action.

  9. Vector-borne transmission of Trypanosoma cruzi among captive Neotropical primates in a Brazilian zoo.

    Science.gov (United States)

    Minuzzi-Souza, Thaís Tâmara Castro; Nitz, Nadjar; Knox, Monique Britto; Reis, Filipe; Hagström, Luciana; Cuba, César A Cuba; Hecht, Mariana Machado; Gurgel-Gonçalves, Rodrigo

    2016-01-26

    Neotropical primates are important sylvatic hosts of Trypanosoma cruzi, the etiological agent of Chagas disease. Infection is often subclinical, but severe disease has been described in both free-ranging and captive primates. Panstrongylus megistus, a major T. cruzi vector, was found infesting a small-primate unit at Brasília zoo (ZooB), Brazil. ZooB lies close to a gallery-forest patch where T. cruzi circulates naturally. Here, we combine parasitological and molecular methods to investigate a focus of T. cruzi infection involving triatomine bugs and Neotropical primates at a zoo located in the Brazilian Savannah. We assessed T. cruzi infection in vectors using optical microscopy (n = 34) and nested PCR (n = 50). We used quantitative PCR (qPCR) to examine blood samples from 26 primates and necropsy samples from two primates that died during the study. We determined parasite lineages in five vectors and two primates by comparing glucose-6-phosphate isomerase (G6pi) gene sequences. Trypanosoma cruzi was found in 44 vectors and 17 primates (six genera and eight species); one Mico chrysoleucus and one Saguinus niger had high parasitaemias. Trypanosoma cruzi DNA was detected in three primates born to qPCR-negative mothers at ZooB and in the two dead specimens. One Callithrix geoffroyi became qPCR-positive over a two-year follow-up. All G6pi sequences matched T. cruzi lineage TcI. Our findings strongly suggest vector-borne T. cruzi transmission within a small-primate unit at ZooB - with vectors, and perhaps also parasites, presumably coming from nearby gallery forest. Periodic checks for vectors and parasites would help eliminate T. cruzi transmission foci in captive-animal facilities. This should be of special importance for captive-breeding programs involving endangered mammals, and would reduce the risk of accidental T. cruzi transmission to keepers and veterinarians.

  10. Study on coinfecting vector-borne pathogens in dogs and ticks in Rio Grande do Norte, Brazil

    Directory of Open Access Journals (Sweden)

    Luiz Ricardo Gonçalves

    Full Text Available Since dogs presenting several vector borne diseases can show none or nonspecific clinical signs depending on the phase of infection, the assessment of the particular agents involved is mandatory. The present study aimed to investigate the presence of Babesia spp., Ehrlichia spp., Anaplasma spp., Hepatozoon spp. and Leishmania spp. in blood samples and ticks, collected from two dogs from Rio Grande do Norte showing suggestive tick-borne disease by using molecular techniques. DNA of E. canis, H. canis and L. infantum were detected in blood samples and R. sanguineus ticks collected from dogs. Among all samples analyzed, two showed the presence of multiple infections with E. canis, H. canis and L. infantum chagasi. Here we highlighted the need for molecular differential diagnosis in dogs showing nonspecific clinical signs.

  11. Prevalence and Geographic Distribution of Vector-Borne Pathogens in Apparently Healthy Dogs in Croatia.

    Science.gov (United States)

    Mrljak, Vladimir; Kuleš, Josipa; Mihaljević, Željko; Torti, Marin; Gotić, Jelena; Crnogaj, Martina; Živičnjak, Tatjana; Mayer, Iva; Šmit, Iva; Bhide, Mangesh; Barić Rafaj, Renata

    2017-06-01

    Vector-borne pathogens (VBPs) are a group of globally extended and quickly spreading pathogens that are transmitted by various arthropod vectors. The aim of the present study was to investigate the seroprevalence against Babesia canis, Anaplasma phagocytophilum, Borrelia burgdorferi sensu lato, Leishmania infantum, Dirofilaria immitis, and Ehrlichia canis in dogs in Croatia. We investigated 435 randomly selected apparently healthy dogs in 13 different locations of Croatia for antibodies to B. canis by indirect immunofluorescence using a commercial IFA IgG Antibody Kit. All samples were also tested for qualitative detection of D. immitis antigen and for antibodies to A. phagocytophilum, B. burgdorferi sensu lato, L. infantum, and E. canis with two point-of-care assays. Overall, 112 dogs (25.74%, 95% confidence interval [CI] 21.70-30.12) were serologically positive for one or more of the pathogens. B. canis was the most prevalent pathogen (20.00%, 95% CI 16.34-24.07), followed by A. phagocytophilum (6.21%, 95% CI 4.12-8.90), L. infantum, (1.38%, 95% CI 0.51-2.97), and B. burgdorferi sensu lato (0.69%, 95% CI 0.01-2.00). The lowest seroprevalence was for D. immitis and E. canis (0.46%, 95% CI 0.01-1.65). Coinfection was determined in 12 dogs (2.76%, 95% CI 1.43-4.77), of which 10 were positive to two pathogens (7 with B. canis and A. phagocytophilum and 1 B. canis with B. burgdorferi sensu lato or L. infantum or E. canis). One dog was positive to three pathogens and another dog to four pathogens. Seroprevalence for babesia was age, breed, and lifestyle/use dependent. Purebred dogs had almost half the chance of developing disease than crossbred (OR = 0.58, p Croatia. Some of these VBPs are zoonotic and represent a potential risk to public health.

  12. Ecology of genus Porphyromonas in canine periodontal disease.

    Science.gov (United States)

    Isogai, H; Kosako, Y; Benno, Y; Isogai, E

    1999-09-01

    Asaccharolytic pigmented Porphyromonas species, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were isolated from the plaque of adult dogs, but not from any oral sites of puppies and adolescent dogs. With age-dependency, the proportion of Porphyromonas species in the flora of plaque increased. Isolation of the genus Porphyromonas was clearly associated with the progress of periodontol disease. We suggested that Porphyromonas is the exogenous organism and obligate pathogen for canine periodontal diseases.

  13. Zoonotic and Vector-Borne Infections Among Urban Homeless and Marginalized People in the United States and Europe, 1990-2014.

    Science.gov (United States)

    Leibler, Jessica H; Zakhour, Christine M; Gadhoke, Preety; Gaeta, Jessie M

    2016-07-01

    In high-income countries, homeless individuals in urban areas often live in crowded conditions with limited sanitation and personal hygiene. The environment of homelessness in high-income countries may result in intensified exposure to ectoparasites and urban wildlife, which can transmit infections. To date, there have been no systematic evaluations of the published literature to assess vector-borne and zoonotic disease risk to these populations. The primary objectives of this study were to identify diversity, prevalence, and risk factors for vector-borne and zoonotic infections among people experiencing homelessness and extreme poverty in urban areas of high-income countries. We conducted a systematic review and narrative synthesis of published epidemiologic studies of zoonotic and vector-borne infections among urban homeless and very poor people in the United States and Europe from 1990 to 2014. Thirty-one observational studies and 14 case studies were identified (n = 45). Seroprevalence to the human louse-borne pathogen Bartonella quintana (seroprevalence range: 0-37.5%) was identified most frequently, with clinical disease specifically observed among HIV-positive individuals. Seropositivity to Bartonella henselae (range: 0-10.3%) and Rickettsia akari (range: 0-16.2%) was noted in multiple studies. Serological evidence of exposure to Rickettsia typhi, Rickettsia prowazekii, Bartonella elizabethae, West Nile virus, Borellia recurrentis, lymphocytic choriomeningitis virus, Wohlfartiimonas chitiniclastica, Seoul hantavirus (SEOV), and Leptospira species was also identified in published studies, with SEOV associated with chronic renal disease later in life. HIV infection, injection drug use, and heavy drinking were noted across multiple studies as risk factors for infection with vector-borne and zoonotic pathogens. B. quintana was the most frequently reported vector-borne infection identified in our article. Delousing efforts and active surveillance among HIV

  14. Vector independent transmission of the vector-borne bluetongue virus.

    Science.gov (United States)

    van der Sluijs, Mirjam Tineke Willemijn; de Smit, Abraham J; Moormann, Rob J M

    2016-01-01

    Bluetongue is an economically important disease of ruminants. The causative agent, Bluetongue virus (BTV), is mainly transmitted by insect vectors. This review focuses on vector-free BTV transmission, and its epizootic and economic consequences. Vector-free transmission can either be vertical, from dam to fetus, or horizontal via direct contract. For several BTV-serotypes, vertical (transplacental) transmission has been described, resulting in severe congenital malformations. Transplacental transmission had been mainly associated with live vaccine strains. Yet, the European BTV-8 strain demonstrated a high incidence of transplacental transmission in natural circumstances. The relevance of transplacental transmission for the epizootiology is considered limited, especially in enzootic areas. However, transplacental transmission can have a substantial economic impact due to the loss of progeny. Inactivated vaccines have demonstrated to prevent transplacental transmission. Vector-free horizontal transmission has also been demonstrated. Since direct horizontal transmission requires close contact of animals, it is considered only relevant for within-farm spreading of BTV. The genetic determinants which enable vector-free transmission are present in virus strains circulating in the field. More research into the genetic changes which enable vector-free transmission is essential to better evaluate the risks associated with outbreaks of new BTV serotypes and to design more appropriate control measures.

  15. Detection of canine pneumovirus in dogs with canine infectious respiratory disease.

    Science.gov (United States)

    Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe

    2013-12-01

    Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.

  16. First report of canine ocular thelaziosis in the Muntenia Region, Romania.

    Science.gov (United States)

    Tudor, Poliana; Bădicu, Adina; Mateescu, Romaniţa; Tudor, Niculae; Mateescu, Cosmin; Ionaşcu, Iuliana

    2016-04-01

    Ocular thelaziosis by Thelazia callipaeda is a vector-borne disease that infects domestic and wild carnivores as well as humans. In this paper, we present two cases of ocular thelaziosis in dogs that had never traveled outside Romania. Both presented with moderate conjunctivitis and ocular discharge. In total, 41 adult nematodes were removed from the conjunctival sacs of both dogs; these were identified via morphology as T. callipaeda. To the best of our knowledge, this is the first report of canine ocular thelaziosis caused by T. callipaeda from the Muntenia Region of Romania.

  17. Canine osteosarcoma: a naturally occurring disease to inform pediatric oncology.

    Science.gov (United States)

    Fenger, Joelle M; London, Cheryl A; Kisseberth, William C

    2014-01-01

    Osteosarcoma (OSA) is the most common form of malignant bone cancer in children and dogs, although the disease occurs in dogs approximately 10 times more frequently than in people. Multidrug chemotherapy and aggressive surgical techniques have improved survival; however, new therapies for OSA are critical, as little improvement in survival times has been achieved in either dogs or people over the past 15 years, even with significant efforts directed at the incorporation of novel therapeutic approaches. Both clinical and molecular evidence suggests that human and canine OSA share many key features, including tumor location, presence of microscopic metastatic disease at diagnosis, development of chemotherapy-resistant metastases, and altered expression/activation of several proteins (e.g. Met, ezrin, phosphatase and tensin homolog, signal transducer and activator of transcription 3), and p53 mutations, among others. Additionally, canine and pediatric OSA exhibit overlapping transcriptional profiles and shared DNA copy number aberrations, supporting the notion that these diseases are similar at the molecular level. This review will discuss the similarities between pediatric and canine OSA with regard to histology, biologic behavior, and molecular genetic alterations that indicate canine OSA is a relevant, spontaneous, large animal model of the pediatric disease and outline how the study of naturally occurring OSA in dogs will offer additional insights into the biology and future treatment of this disease in both children and dogs. © The Author 2014. Published by Oxford University Press on behalf of the Institute for Laboratory Animal Research. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. The risk of vector-borne infections in sled dogs associated with existing and new endemic areas in Poland. Part 2: Occurrence and control of babesiosis in a sled dog kennel during a 13-year-long period.

    Science.gov (United States)

    Bajer, Anna; Mierzejewska, Ewa J; Rodo, Anna; Welc-Falęciak, Renata

    2014-05-28

    The achievements of sled dogs in competitions depend both on their training and on their health. Vector-borne infections may lead to anemia, affect joints or heart muscles or even cause death. Canine babesiosis is an emerging, quickly spreading tick-borne disease in Central Europe. Over a 13-year period (2000-2012) the occurrence of babesiosis cases was analyzed in one sled dog kennel situated in Kury, a village near Tłuszcz (N 52°24'56.78″, E 21°30'37.55″) in Central Poland. Twenty cases/episodes of babesiosis were noted among the 10-12 dogs living in the kennel. In 2000-2004, no cases of babesiosis were noted; the first two cases were noted in April 2005. Since that time, only one dog remained uninfected; 6 dogs were infected once, 3 dogs demonstrated symptoms of babesiosis twice, one dog was infected three times and one dog had it five times. Babesiosis appeared in Spring and Autumn, despite the application of anti-tick treatment. No fatal cases were recorded, but in one case a splenectomy was performed due to splenomegaly and spleen rupture. Additionally, the abundance of the main Babesia canis vector, the Dermacentor reticulatus tick, was estimated and monitored during a 4-year period (2008-2012) close to the dog kennel. The abundance of questing ticks was high in 2008 and 2009, but dropped by 10-fold between 2010 and 2012, when the abandoned meadow was cut and used as horse pasture by the local farmer. The regular occurrence, typical seasonal pattern and identification of B. canis DNA in questing tick from this locality confirmed the establishment of a new hyper enzootic region for canine babesiosis. The effectiveness and schedule of applied preventive measures were discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Vector-borne pathogens in dogs and red foxes from the federal state of Brandenburg, Germany.

    Science.gov (United States)

    Liesner, Jana M; Krücken, Jürgen; Schaper, Roland; Pachnicke, Stefan; Kohn, Barbara; Müller, Elisabeth; Schulze, Christoph; von Samson-Himmelstjerna, Georg

    2016-07-15

    Dirofilaria repens is endemic in eastern and southern European regions but was recently found in Germany in dogs, mosquitoes and one human patient. Since some of the positive dog and mosquito samples were collected in Brandenburg, it was aimed to systematically assess the prevalence of D. repens and other canine vector-borne pathogens in Brandenburg. Dog owners also received a questionnaire and were asked to provide more information about the dogs including travel history. In total, 1023 dog blood samples as well as 195 fox spleen and 179 fox blood samples were collected. DNA was analysed by PCR for the presence of filariae, piroplasms, anaplasmataceae and Rickettsia spp. Filariae were detected in six dogs (0.6%), two were positive for DNA from D. repens, two from Dirofilaria immitis and two from Acanthocheilonema reconditum. One of the D. repens positive dogs originated from an animal shelter in Brandenburg, but the origin of the other one remained unknown. Interestingly, both D. repens ITS-1 sequences showed 100% identity to a D. repens sample obtained from a Japanese woman that travelled in Europe and were 97% identical to a newly proposed species Dirofilaria sp. 'hongkongensis' described from Hong Kong. However, identity to other D. repens sequences from Thailand was considerably lower (81%). Identity of 12S rRNA and cytochrome oxidase I to D. repens samples from southern Europe was 99%. Due to the low number of Dirofilaria spp. positive dogs and since the origin of these was unknown, endemic occurrence of Dirofilaria in Brandenburg could not be confirmed. Anaplasma phagocytophilum was found in 15 dogs (1.5%), Candidatus Neoehrlichia mikurensis in three dogs (0.3%) and E. canis in one dog (0.1%), which was co-infected with D. repens. Rickettsia spp. were detected in 8 dogs (0.8%), seven were Rickettsia raoultii and one was Rickettsia felis. To the author's knowledge, R. raoultii DNA was detected for the first time in dogs in Germany in this study and Candidatus

  20. Effect of Japanese Green Tea Extract on Canine Periodontal Diseases

    OpenAIRE

    Isogai, E.; Isogai, H.; Kimura, K.; Nishikawa, T.; Fujii, N.; Benno, Y.

    2011-01-01

    Asaccharolytic pigmented Porphyromonas strains were isolated from the plaque of dogs with gingivitis and periodontitis. Various species of Porphyromonas, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were detectable. Canine Porphyromonas were sensitive to Japanese green tea extract (JGTE). We examined the effects of dietary JGTE on periodontal diseases. A special diet was prepared on the basis of the minimum inhibitory concentration (MIC: 0.8 mg/ml) of ...

  1. Molecular detection of vector-borne bacteria and protozoa in healthy hunting dogs from Central Italy

    Directory of Open Access Journals (Sweden)

    Valentina Virginia Ebani

    2015-02-01

    Conclusions:: The results demonstrated that several vector-borne pathogens were circulating in this region and dogs infected by these agents were usually asymptomatic. A relevant finding was the presence of DNA of C. burnetii, a severe zoonotic agent, in the 5.1% of tested dogs, which can be source of infection for their owners not only through tick bites, but also directly with urine, feces and birth products.

  2. Emerging arthropod-borne diseases of companion animals in Europe.

    Science.gov (United States)

    Beugnet, Frederic; Marié, Jean-Lou

    2009-08-26

    Vector-borne diseases are caused by parasites, bacteria or viruses transmitted by the bite of hematophagous arthropods (mainly ticks and mosquitoes). The past few years have seen the emergence of new diseases, or re-emergence of existing ones, usually with changes in their epidemiology (i.e. geographical distribution, prevalence, and pathogenicity). The frequency of some vector-borne diseases of pets is increasing in Europe, i.e. canine babesiosis, granulocytic anaplasmosis, canine monocytic ehrlichiosis, thrombocytic anaplasmosis, and leishmaniosis. Except for the last, these diseases are transmitted by ticks. Both the distribution and abundance of the three main tick species, Rhipicephalus sanguineus, Dermacentor reticulatus and Ixodes ricinus are changing. The conditions for such changes involve primarily human factors, such as travel with pets, changes in human habitats, social and leisure activities, but climate changes also have a direct impact on arthropod vectors (abundance, geographical distribution, and vectorial capacity). Besides the most known diseases, attention should be kept on tick-borne encephalitis, which seems to be increasing in western Europe, as well as flea-borne diseases like the flea-transmitted rickettsiosis. Here, after consideration of the main reasons for changes in tick vector ecology, an overview of each "emerging" vector-borne diseases of pets is presented.

  3. Magnetic resonance imaging of canine degenerative lumbar spine diseases

    International Nuclear Information System (INIS)

    Karkkainen, M.; Punto, L.U.; Tulamo, R.M.

    1993-01-01

    Degenerative lumbar spine diseases, i.e., sacrolumbar stenosis, intervertebral disk degeneration and protrusion and spondylosis deformans of the canine lumbar spine were studied in eleven canine patients and three healthy controls using radiography and 0.02 T and 0.04 T low field magnetic resonance imaging. The T1 and T2 weighted images were obtained in sagittal and transverse planes. The loss of hydration of nucleus pulposus, taken as a sign of degeneration in the intervertebral disks, could be evaluated in both T1 and T2 weighted images. As a noninvasive method magnetic resonance imaging gave more exact information about the condition of intervertebral disks than did radiography. Sacrolumbar stenosis and compression of the spinal cord or cauda equina and surrounding tissue could be evaluated without contrast medium

  4. Glycogen storage disease type Ia in canines: a model for human metabolic and genetic liver disease.

    Science.gov (United States)

    Specht, Andrew; Fiske, Laurie; Erger, Kirsten; Cossette, Travis; Verstegen, John; Campbell-Thompson, Martha; Struck, Maggie B; Lee, Young Mok; Chou, Janice Y; Byrne, Barry J; Correia, Catherine E; Mah, Cathryn S; Weinstein, David A; Conlon, Thomas J

    2011-01-01

    A canine model of Glycogen storage disease type Ia (GSDIa) is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including "lactic acidosis", larger size, and longer lifespan compared to other animal models. Use of this model in preclinical trials of gene therapy is described and briefly compared to the murine model. Although the canine model offers a number of advantages for evaluating potential therapies for GSDIa, there are also some significant challenges involved in its use. Despite these challenges, the canine model of GSDIa should continue to provide valuable information about the potential for generating curative therapies for GSDIa as well as other genetic hepatic diseases.

  5. Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease

    Directory of Open Access Journals (Sweden)

    Andrew Specht

    2011-01-01

    Full Text Available A canine model of Glycogen storage disease type Ia (GSDIa is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size, and longer lifespan compared to other animal models. Use of this model in preclinical trials of gene therapy is described and briefly compared to the murine model. Although the canine model offers a number of advantages for evaluating potential therapies for GSDIa, there are also some significant challenges involved in its use. Despite these challenges, the canine model of GSDIa should continue to provide valuable information about the potential for generating curative therapies for GSDIa as well as other genetic hepatic diseases.

  6. Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease

    OpenAIRE

    Specht, Andrew; Fiske, Laurie; Erger, Kirsten; Cossette, Travis; Verstegen, John; Campbell-Thompson, Martha; Struck, Maggie B.; Lee, Young Mok; Chou, Janice Y.; Byrne, Barry J.; Correia, Catherine E.; Mah, Cathryn S.; Weinstein, David A.; Conlon, Thomas J.

    2011-01-01

    A canine model of Glycogen storage disease type Ia (GSDIa) is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size,...

  7. Study on clinical symptoms in canine cardiac diseases

    Directory of Open Access Journals (Sweden)

    F. Karlette Anne

    Full Text Available Cardiac diseases in canines are an extensively studied phenomenon all over the world but meagre information has been reported in India. Certain problems, including historical, physical, and laboratory abnormalities, are associated with cardiovascular or pulmonary disease. In India however, the recognition of canine cardiac diseases has been delayed, and ignored on account of lack of awareness and knowledge by the owner and inadequate diagnostic facility to a field veterinarian. Considering the above facts, the present study was undertaken in Gujarat to survey the prevalence of common cardiac diseases in hospital population of dogs along with the clinical symptoms which often goes undetected due to lack of proper diagnostic techniques to be implied and the most forms of heart disease may be present for many years before any evidence of failure develops. In the present study most of the clinical cases of cardiac diseases were presented with a history of nocturnal coughing (seven cases; 2.55%, exercise intolerance (five cases; 1.82%, partial or complete anorexia (five cases; 1.82%, swelling in abdominal area (four cases; 1.45%, dullness and depression (two cases; 0.72%, cachexia and hepatojugular pulsation (one case each; 0.36% each at times. [Vet World 2009; 2(8.000: 307-309

  8. Interspecies dynamics among bacteria associated with canine periodontal disease.

    Science.gov (United States)

    Sanguansermsri, P; Nobbs, A H; Jenkinson, H F; Surarit, R

    2018-02-01

    The etiology and pathogenic mechanisms associated with canine periodontal disease are less well understood than the disease in humans. In this study we have reconstructed defined consortia biofilms in vitro of microorganisms identified as prevalent in a same-breed cohort of dogs with or without periodontal disease. Frederiksenia canicola and Neisseria canis were selected as potential early colonizers of salivary pellicle, and Fusobacterium nucleatum and Porphyromonas gulae were included as high incidence canine oral bacteria. N. canis formed a biofilm substratum under aerobic conditions, but was unable to tolerate anaerobic conditions. Fr. canicola exhibited synergistic biofilm growth with Po. gulae under anaerobic conditions, but displayed an antagonistic relationship with Fu. nucleatum. However, strong co-adhesion between Fu. nucleatum and Po. gulae was able to overcome the inhibitory effects of Fr. canicola to facilitate three-species biofilm formation. Parvimonas micra, an anaerobic, asaccharolytic Gram-positive coccus found only under disease conditions in vivo, was able to form biofilms in conjunction with Fr. canicola and Po. gulae. Furthermore, the specific proteolytic activities of biofilms containing Fr. canicola and Po. gulae or Fu. nucleatum and Po. gulae were increased several-fold upon the addition of Pa. micra. This suggests that anaerobic cocci such as Pa. micra might provide a catalyst for progressive tissue destruction, inflammation and alveolar bone loss in canine periodontal disease, in keeping with the keystone-pathogen hypothesis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. A survey of canine tick-borne diseases in India

    Directory of Open Access Journals (Sweden)

    Coleman Glen T

    2011-07-01

    Full Text Available Abstract Background There are few published reports on canine Babesia, Ehrlichia, Anaplasma, Hepatozoon and haemotropic Mycoplasma infections in India and most describe clinical disease in individual dogs, diagnosed by morphological observation of the microorganisms in stained blood smears. This study investigated the occurrence and distribution of canine tick-borne disease (TBD pathogens using a combination of conventional and molecular diagnostic techniques in four cities in India. Results On microscopy examination, only Hepatozoon gamonts were observed in twelve out of 525 (2.3%; 95% CI: 1.2, 4 blood smears. Using polymerase chain reaction (PCR, a total of 261 from 525 dogs (49.7%; 95% CI: 45.4, 54.1 in this study were infected with one or more canine tick-borne pathogen. Hepatozoon canis (30%; 95% CI: 26.0, 34.0 was the most common TBD pathogen found infecting dogs in India followed by Ehrlichia canis (20.6%; 95% CI: 17.2, 24.3, Mycoplasma haemocanis (12.2%; 95% CI: 9.5, 15.3, Anaplasma platys (6.5%; 95% CI: 4.5, 8.9, Babesia vogeli (5.5%, 95% CI: 3.7, 7.8 and Babesia gibsoni (0.2%, 95% CI: 0.01, 1.06. Concurrent infection with more than one TBD pathogen occurred in 39% of cases. Potential tick vectors, Rhipicephalus (most commonly and/or Haemaphysalis ticks were found on 278 (53% of dogs examined. Conclusions At least 6 species of canine tick-borne pathogens are present in India. Hepatozoon canis was the most common pathogen and ticks belonging to the genus Rhipicephalus were encountered most frequently. Polymerase chain reaction was more sensitive in detecting circulating pathogens compared with peripheral blood smear examination. As co-infections with canine TBD pathogens were common, Indian veterinary practitioners should be cognisant that the discovery of one such pathogen raises the potential for multiple infections which may warrant different clinical management strategies.

  10. Canine Degenerative Valve Disease: A Case Report

    Directory of Open Access Journals (Sweden)

    Carmenza Janneth Benavides Melo

    2014-07-01

    Full Text Available Degenerative valvular disease or endocardiosis is the most common cardiovascular pathology in dogs. It is characterized by regurgitation of blood into the atria with decreased cardiac output, leading to volume overload with eccentric hypertrophy and congestive heart failure. This report describes the clinical and autopsy findings of a dog, suggestive of valvular endocardiosis. The patient was admitted to the outpatient Veterinary Clinic “Carlos Martínez Hoyos” at the University of Nariño (Pasto, Colombia. His owner said the dog was sick for two months, with signs of respiratory disease, weight loss, and decay. Clinical examination showed very pale mucous membranes, inspiratory dyspnea, rale, split S2, grade 4 mid-systolic murmur of regurgitation, and abdominal dilatation with sign of positive shock wave. Necropsy evidenced plenty of translucent watery material in the abdominal, chest and pericardium cavity, severely enlarged and rounded heart with thickened atrioventricular valves, moderate reduction in liver size and signs of lobulation, severely diminished and pale kidneys with irregular surface showing the presence of multiple cystic areas in corticomedullary region. Samples were taken from these tissues and fixed in 10% buffered formalin to be processed for histopathological analysis at the Laboratory of Pathology at the University of Nariño, using hematoxylin and eosin stain. This way, degenerative valvular disease was diagnosed.

  11. Prevalence of selected zoonotic and vector-borne agents in dogs and cats in Costa Rica.

    Science.gov (United States)

    Scorza, Andrea V; Duncan, Colleen; Miles, Laura; Lappin, Michael R

    2011-12-29

    To estimate the prevalence of enteric parasites and selected vector-borne agents of dogs and cats in San Isidro de El General, Costa Rica, fecal and serum samples were collected from animals voluntarily undergoing sterilization. Each fecal sample was examined for parasites by microscopic examination after fecal flotation and for Giardia and Cryptosporidium using an immunofluorescence assay (IFA). Giardia and Cryptosporidium IFA positive samples were genotyped after PCR amplification of specific DNA if possible. The seroprevalence rates for the vector-borne agents (Dirofilaria immitis, Borrelia burgdorferi, Ehrlichia canis, and Anaplasma phagocytophilum) were estimated based on results from a commercially available ELISA. Enteric parasites were detected in samples from 75% of the dogs; Ancylostoma caninum, Trichuris vulpis, Giardia, and Toxocara canis were detected. Of the cats, 67.5% harbored Giardia spp., Cryptosporidium spp., Ancylostoma tubaeforme, or Toxocara cati. Both Cryptosporidium spp. isolates that could be sequenced were Cryptosporidium parvum (one dog isolate and one cat isolate). Of the Giardia spp. isolates that were successfully sequenced, the 2 cat isolates were assemblage A and the 2 dog isolates were assemblage D. D. immitis antigen and E. canis antibodies were identified in 2.3% and 3.5% of the serum samples, respectively. The prevalence of enteric zoonotic parasites in San Isidro de El General in Costa Rica is high in companion animals and this information should be used to mitigate public health risks. Copyright © 2011. Published by Elsevier B.V.

  12. Zoonotic intestinal parasites and vector-borne pathogens in Italian shelter and kennel dogs.

    Science.gov (United States)

    Traversa, Donato; Di Cesare, Angela; Simonato, Giulia; Cassini, Rudi; Merola, Carmine; Diakou, Anastasia; Halos, Lénaïg; Beugnet, Frederic; Frangipane di Regalbono, Antonio

    2017-04-01

    This study investigated the presence of zoonotic parasites and vector-borne pathogens in dogs housed in kennels and shelters from four sites of Italy. A total of 150 adoptable dogs was examined with different microscopic, serological and molecular methods. Overall 129 dogs (86%) were positive for one or more parasites and/or pathogens transmitted by ectoparasites. Forty-eight (32%) were positive for one infection, while 81 (54%) for more than one pathogen. The most common zoonotic helminths recorded were hookworms, roundworms and Capillaria aerophila, followed by mosquito-borne Dirofilaria spp. and Dipylidium caninum. One hundred and thirteen (77.9%), 6 (4.1%) and 2 (1.4%) dogs were positive for Rickettsia spp., Leishmania infantum and Anaplasma spp., respectively. The results show that dogs living in rescue facilities from the studied areas may be infected by many zoonotic internal parasites and vector-borne pathogens, and that control measures should be implemented. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Molecular identification of bacteria associated with canine periodontal disease.

    Science.gov (United States)

    Riggio, Marcello P; Lennon, Alan; Taylor, David J; Bennett, David

    2011-06-02

    Periodontal disease is one of the most common diseases of adult dogs, with up to 80% of animals affected. The aetiology of the disease is poorly studied, although bacteria are known to play a major role. The purpose of this study was to identify the bacteria associated with canine gingivitis and periodontitis and to compare this with the normal oral flora. Swabs were obtained from the gingival margin of three dogs with gingivitis and three orally healthy controls, and subgingival plaque was collected from three dogs with periodontitis. Samples were subjected to routine bacterial culture. The prevalent species identified in the normal, gingivitis and periodontitis groups were uncultured bacterium (12.5% of isolates), Bacteroides heparinolyticus/Pasteurella dagmatis (10.0%) and Actinomyces canis (19.4%), respectively. Bacteria were also identified using culture-independent methods (16S rRNA gene sequencing) and the predominant species identified were Pseudomonas sp. (30.9% of clones analysed), Porphyromonas cangingivalis (16.1%) and Desulfomicrobium orale (12.0%) in the normal, gingivitis and periodontitis groups, respectively. Uncultured species accounted for 13.2%, 2.0% and 10.5%, and potentially novel species for 38.2%, 38.3% and 35.3%, of clones in the normal, gingivitis and periodontitis groups, respectively. This is the first study to use utilise culture-independent methods for the identification of bacteria associated with this disease. It is concluded that the canine oral flora in health and disease is highly diverse and also contains a high proportion of uncultured and, in particular, potentially novel species. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Molecular surveillance of traditional and emerging pathogens associated with canine infectious respiratory disease.

    Science.gov (United States)

    Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio

    2016-08-30

    A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Disease Modeling and Gene Therapy of Copper Storage Disease in Canine Hepatic Organoids

    Directory of Open Access Journals (Sweden)

    Sathidpak Nantasanti

    2015-11-01

    Full Text Available The recent development of 3D-liver stem cell cultures (hepatic organoids opens up new avenues for gene and/or stem cell therapy to treat liver disease. To test safety and efficacy, a relevant large animal model is essential but not yet established. Because of its shared pathologies and disease pathways, the dog is considered the best model for human liver disease. Here we report the establishment of a long-term canine hepatic organoid culture allowing undifferentiated expansion of progenitor cells that can be differentiated toward functional hepatocytes. We show that cultures can be initiated from fresh and frozen liver tissues using Tru-Cut or fine-needle biopsies. The use of Wnt agonists proved important for canine organoid proliferation and inhibition of differentiation. Finally, we demonstrate that successful gene supplementation in hepatic organoids of COMMD1-deficient dogs restores function and can be an effective means to cure copper storage disease.

  16. Canine brucellosis: Epizootiological characteristics, therapy and control of the disease

    Directory of Open Access Journals (Sweden)

    Radojičić Sonja

    2006-01-01

    Full Text Available The paper describes different aspects of canine brucellosis caused by Brucella canis. The disease is present in a large number of countries all over the world, where it inflicts severe economic damages, in particular in the commercial breeding and major dog breeding facilities. The disease was discovered in 1966 in the United States of America, but there were no data about its presence or distribution in our country until 1999. It was established, following the initial investigations, that the prevalence of the disease is extremely high, and that it amounted to 4.27% among pet dogs in the territory of Belgrade. Investigations of stray dogs in the territory of Podgorica showed that the seroprevalence (an equal titer or higher than 1/200 was 9.37%, while the prevalence among stray dogs in the territory of Belgrade was 10.87%. Data for other parts of Serbia are mostly lacking, and the seroprevalence for stray dogs in the Municipality of Pozarevac amounted to over 15%, while not a single serologically positive case was found among pet dogs. In addition to the epizootiological specificities of the disease established in our country, isolates of B. canis from the territory of Serbia also indicate digressions in the test of resistance to colors with respect to the referent strain RM6/66. All isolates (SR1-SR-7 are resistant to base fuchsine, and it is probable that this characteristic could also be an important epizootiological marker. Even though the isolation of the cause is the most reliable diagnostic method, it is not possible to achieve this in most cases. That is why one of the most important tasks is to define the most ideal tests for the serological diagnostics of the disease, and the obligation of reporting the disease makes it imperative that wider-scale investigations are conducted and that measures are taken toward reducing the number of positive cases in our country. .

  17. Canine visceral leishmaniasis as a systemic fibrotic disease

    Science.gov (United States)

    Silva, Lucelia C; Castro, Rodrigo S; Figueiredo, Maria M; Michalick, Marilene S M; Tafuri, Washington L; Tafuri, Wagner L

    2013-01-01

    We propose that canine visceral leishmaniasis (CVL) is a systemic fibrotic disease, as evidenced by the wide distribution of fibrosis that we have found in the dogs suffering from chronic condition. The inflammatory cells apparently direct fibrosis formation. Twenty-four cases (symptomatic dogs) were identified from a total of one hundred and five cases that had been naturally infected with Leishmania chagasi and had been documented during an epidemiological survey of CVL carried out by the metropolitan area of the municipality of Belo Horizonte, MG, Brazil. The histological criterion was intralobular liver fibrosis, as has been described previously in dogs with visceral leishmaniasis. In addition to the findings in the liver, here we describe and quantify conspicuous and systemic deposition of collagen in other organs, including spleen, cervical lymph nodes, lung and kidney of all the infected symptomatic dogs. Thus we report that there is a systematic fibrotic picture in these animals, where inflammatory cells appear to direct fibrosis in all organs that have been studied. Therefore we propose that CVL is a systemic fibrotic disease. PMID:23419132

  18. Identification of vector-borne pathogens in dogs and cats from Southern Brazil.

    Science.gov (United States)

    Malheiros, J; Costa, M M; do Amaral, R B; de Sousa, K C M; André, M R; Machado, R Z; Vieira, M I B

    2016-07-01

    Dogs and cats are often infected with vector-borne pathogens and play a crucial role as reservoirs and hosts in their life cycles. The aim of the present study was to investigate the occurrence of vector-borne pathogens among dogs and cats in the northwestern region of Rio Grande do Sul (RS) State, Brazil. One hundred and ten blood samples were collected from dogs (n=80) and cats (n=30). Laboratory analysis were carried out through stained blood smears, indirect enzyme-linked immunosorbent assay (ELISA) for Babesia vogeli and Ehrlichia canis (only for dogs) and polymerase chain reaction (PCR) aiming the detection of pathogens. The following pathogens were screened by PCR among dogs and cats: Babesia spp. and Hepatozoon spp. (18S rRNA gene), Anaplasma spp. (16S rRNA gene), and Ehrlichia spp. (dsb gene for dogs and 16S rRNA gene for cats) and Bartonella spp. (nuoG gene only for cats). Using blood smears structures morphologically compatible with piroplasms were found in 5.45% (6/110) of the samples. Anti-B. vogeli and anti-E. canis antibodies were detected in 91% (73/80) and 9% (7/80) of the dogs, respectively. All the seropositive dogs to E. canis were also to B. vogeli. Nineteen (17.3%) animals were positive to hemoparasites by PCR. After sequencing Rangelia vitalii 6/80 (7.5%), B. vogeli 3/80 (4%), Hepatozoon spp. 1/80 (1%), and Anaplasma spp. 1/80 (1%) were found in the dogs, and B. vogeli 2/30 (7%) and Bartonella spp. 6/30 (20%) were detected in the screened cats. No sample was positive for genes dsb and 16S rRNA of Ehrlichia spp. Only those animals which were positive for R. vitalii showed findings compatible with rangeliosis, such as anemia (100%), thrombocytopenia (67%), jaundice (50%), external bleeding (50%), and anorexia (50%). This is the first time that B. vogeli detected among cats in Southern Brazil. Copyright © 2016 Elsevier GmbH. All rights reserved.

  19. Survey of vector-borne agents in feral cats and first report of Babesia gibsoni in cats on St Kitts, West Indies.

    Science.gov (United States)

    Kelly, Patrick John; Köster, Liza; Li, Jing; Zhang, Jilei; Huang, Ke; Branford, Gillian Carmichael; Marchi, Silvia; Vandenplas, Michel; Wang, Chengming

    2017-11-13

    As there is little data on vector-borne diseases of cats in the Caribbean region and even around the world, we tested feral cats from St Kitts by PCR to detect infections with Babesia, Ehrlichia and spotted fever group Rickettsia (SFGR) and surveyed them for antibodies to Rickettsia rickettsii and Ehrlichia canis. Whole blood was collected from apparently healthy feral cats during spay/ neuter campaigns on St Kitts in 2011 (N = 68) and 2014 (N = 52). Sera from the 52 cats from 2014 were used to detect antibodies to Ehrlichia canis and Rickettsia rickettsii using indirect fluorescent antibody tests and DNA extracted from whole blood of a total of 119 cats (68 from 2011, and 51 from 2014) was used for PCRs for Babesia, Ehrlichia and Rickettsia. We could not amplify DNA of SFG Rickettsia in any of the samples but found DNA of E. canis in 5% (6/119), Babesia vogeli in 13% (15/119), Babesia gibsoni in 4% (5/119), mixed infections with B. gibsoni and B. vogeli in 3% (3/119), and a poorly characterized Babesia sp. in 1% (1/119). Overall, 10% of the 52 cats we tested by IFA for E. canis were positive while 42% we tested by indirect fluorescent antibody (IFA) for R. rickettsii antigens were positive. Our study provides the first evidence that cats can be infected with B. gibsoni and also indicates that cats in the Caribbean may be commonly exposed to other vector-borne agents including SFGR, E. canis and B. vogeli. Animal health workers should be alerted to the possibility of clinical infections in their patients while public health workers should be alerted to the possibility that zoonotic SFGR are likely circulating in the region.

  20. Intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in continental and insular Greece

    Science.gov (United States)

    Diakou, Anastasia; Di Cesare, Angela; Accettura, Paolo Matteo; Barros, Luciano; Iorio, Raffaella; Paoletti, Barbara; Frangipane di Regalbono, Antonio; Halos, Lénaïg; Beugnet, Frederic; Traversa, Donato

    2017-01-01

    This survey investigated the distribution of various intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in four regions of Greece. A total number of one hundred and fifty cats living in three Islands (Crete, Mykonos and Skopelos) and in Athens municipality was established as a realistic aim to be accomplished in the study areas. All cats were examined with different microscopic, serological and molecular assays aiming at evaluating the occurrence of intestinal parasites, and exposure to or presence of vector-borne infections. A total of 135 cats (90%) was positive for one or more parasites and/or pathogens transmitted by ectoparasites. Forty-four (29.3%) cats were positive for one single infection, while 91 (60.7%) for more than one pathogen. A high number of (n. 53) multiple infections caused by feline intestinal and vector-borne agents including at least one zoonotic pathogen was detected. Among them, the most frequently recorded helminths were roundworms (Toxocara cati, 24%) and Dipylidium caninum (2%), while a high number of examined animals (58.8%) had seroreaction for Bartonella spp., followed by Rickettsia spp. (43.2%) and Leishmania infantum (6.1%). DNA-based assays revealed the zoonotic arthropod-borne organisms Bartonella henselae, Bartonella clarridgeiae, Rickettsia spp., and L. infantum. These results show that free-ranging cats living in areas of Greece under examination may be exposed to a plethora of internal parasites and vector-borne pathogens, some of them potentially able to infect humans. Therefore, epidemiological vigilance and appropriate control measures are crucial for the prevention and control of these infections and to minimize the risk of infection for people. PMID:28141857

  1. Intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in continental and insular Greece.

    Directory of Open Access Journals (Sweden)

    Anastasia Diakou

    2017-01-01

    Full Text Available This survey investigated the distribution of various intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in four regions of Greece. A total number of one hundred and fifty cats living in three Islands (Crete, Mykonos and Skopelos and in Athens municipality was established as a realistic aim to be accomplished in the study areas. All cats were examined with different microscopic, serological and molecular assays aiming at evaluating the occurrence of intestinal parasites, and exposure to or presence of vector-borne infections. A total of 135 cats (90% was positive for one or more parasites and/or pathogens transmitted by ectoparasites. Forty-four (29.3% cats were positive for one single infection, while 91 (60.7% for more than one pathogen. A high number of (n. 53 multiple infections caused by feline intestinal and vector-borne agents including at least one zoonotic pathogen was detected. Among them, the most frequently recorded helminths were roundworms (Toxocara cati, 24% and Dipylidium caninum (2%, while a high number of examined animals (58.8% had seroreaction for Bartonella spp., followed by Rickettsia spp. (43.2% and Leishmania infantum (6.1%. DNA-based assays revealed the zoonotic arthropod-borne organisms Bartonella henselae, Bartonella clarridgeiae, Rickettsia spp., and L. infantum. These results show that free-ranging cats living in areas of Greece under examination may be exposed to a plethora of internal parasites and vector-borne pathogens, some of them potentially able to infect humans. Therefore, epidemiological vigilance and appropriate control measures are crucial for the prevention and control of these infections and to minimize the risk of infection for people.

  2. Intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in continental and insular Greece.

    Science.gov (United States)

    Diakou, Anastasia; Di Cesare, Angela; Accettura, Paolo Matteo; Barros, Luciano; Iorio, Raffaella; Paoletti, Barbara; Frangipane di Regalbono, Antonio; Halos, Lénaïg; Beugnet, Frederic; Traversa, Donato

    2017-01-01

    This survey investigated the distribution of various intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in four regions of Greece. A total number of one hundred and fifty cats living in three Islands (Crete, Mykonos and Skopelos) and in Athens municipality was established as a realistic aim to be accomplished in the study areas. All cats were examined with different microscopic, serological and molecular assays aiming at evaluating the occurrence of intestinal parasites, and exposure to or presence of vector-borne infections. A total of 135 cats (90%) was positive for one or more parasites and/or pathogens transmitted by ectoparasites. Forty-four (29.3%) cats were positive for one single infection, while 91 (60.7%) for more than one pathogen. A high number of (n. 53) multiple infections caused by feline intestinal and vector-borne agents including at least one zoonotic pathogen was detected. Among them, the most frequently recorded helminths were roundworms (Toxocara cati, 24%) and Dipylidium caninum (2%), while a high number of examined animals (58.8%) had seroreaction for Bartonella spp., followed by Rickettsia spp. (43.2%) and Leishmania infantum (6.1%). DNA-based assays revealed the zoonotic arthropod-borne organisms Bartonella henselae, Bartonella clarridgeiae, Rickettsia spp., and L. infantum. These results show that free-ranging cats living in areas of Greece under examination may be exposed to a plethora of internal parasites and vector-borne pathogens, some of them potentially able to infect humans. Therefore, epidemiological vigilance and appropriate control measures are crucial for the prevention and control of these infections and to minimize the risk of infection for people.

  3. Electroencephalography as a diagnostic technique for canine neurological diseases

    Directory of Open Access Journals (Sweden)

    Wrzosek Marcin

    2016-06-01

    Full Text Available Electroencephalography (EEG is a non-invasive examination method for the assessment of functional central nervous system (CNS disturbances. In human medicine it has a special importance as a diagnostic tool for epilepsy. Although many studies were done on the use of EEG for diagnostics of canine central nervous system disorders, the technique is still not applied routinely. The purpose of this paper was to review the use of the electroencephalography in canine neurological disorders of central nervous system diagnosis and assess the future perspectives of this technique in veterinary medicine.

  4. Detection of a group 2 coronavirus in dogs with canine infectious respiratory disease

    International Nuclear Information System (INIS)

    Erles, Kerstin; Toomey, Crista; Brooks, Harriet W.; Brownlie, Joe

    2003-01-01

    An investigation into the causes of canine infectious respiratory disease was carried out in a large rehoming kennel. Tissue samples taken from the respiratory tract of diseased dogs were tested for the presence of coronaviruses using RT-PCR with conserved primers for the polymerase gene. Sequence analysis of four positive samples showed the presence of a coronavirus with high similarity to both bovine and human coronavirus (strain OC43) in their polymerase and spike genes, whereas there was a low similarity to comparable genes in the enteric canine coronavirus. This canine respiratory coronavirus (CRCV) was detected by RT-PCR in 32/119 tracheal and 20/119 lung samples, with the highest prevalence being detected in dogs with mild clinical symptoms. Serological analysis showed that the presence of antibodies against CRCV on the day of entry into the kennel decreased the risk of developing respiratory disease

  5. Climate Change and Vector-borne Diseases: An Economic Impact Analysis of Malaria in Africa

    Directory of Open Access Journals (Sweden)

    Ximing Wu

    2011-03-01

    Full Text Available A semi-parametric econometric model is used to study the relationship between malaria cases and climatic factors in 25 African countries. Results show that a marginal change in temperature and precipitation levels would lead to a significant change in the number of malaria cases for most countries by the end of the century. Consistent with the existing biophysical malaria model results, the projected effects of climate change are mixed. Our model projects that some countries will see an increase in malaria cases but others will see a decrease. We estimate projected malaria inpatient and outpatient treatment costs as a proportion of annual 2000 health expenditures per 1,000 people. We found that even under minimal climate change scenario, some countries may see their inpatient treatment cost of malaria increase more than 20%.

  6. Operational Mosquito and Vector-Borne Diseases Surveillance at Incirlik Air Base, Turkey

    Science.gov (United States)

    2017-05-23

    of Biological Diversity , Columbus, OH, or the - cies and tested for arboviruses. Pools ranged from 1-25 mosquitoes depending on submission numbers...Rickettsia felis (Rickett- - phonaptera: Pulicidae) in the Philippines . J Ento- mol Sci. 2012;47:95-96. Mosquito surveillance data from Incirlik Air Base...Taylor SJ, Durden LA, Foley EH, Reeves WK. The bat tick Carios azteci (Acari: Argasidae) from Be- lize, with an endosymbiotic Coxiellaceae. Speleo

  7. Transmission scenarios of major vector-borne diseases in Colombia, 1990-2016.

    Science.gov (United States)

    Padilla, Julio César; Lizarazo, Fredy Eberto; Murillo, Olga Lucía; Mendigaña, Fernando Antonio; Pachón, Edwin; Vera, Mauricio Javier

    2017-03-29

    Introducción. Las enfermedades transmitidas por vectores representan más de 17 % de todas las enfermedades infecciosas y causan anualmente un millón de defunciones a nivel mundial. En Colombia, la malaria, el dengue, la enfermedad de Chagas y las leishmaniasis son condiciones endemoepidémicas persistentes.Objetivo. Determinar el comportamiento epidemiológico de las enfermedades transmitidas por vectores en zonas urbanas y rurales de Colombia entre 1990 y 2016.Materiales y métodos. Se hizo un estudio descriptivo del comportamiento epidemiológico de las principales enfermedades transmitidas por vectores en zonas urbanas y rurales de Colombia entre 1990 y 2016, con la información proveniente de fuentes oficiales secundarias.Resultados. En el periodo estudiado se registraron 5'360.134 casos de enfermedades transmitidas por vectores, de los cuales 54,7 % fueron de malaria y 24,9 % de dengue. Estos casos concentraron el 80 % de la carga acumulada de casos de enfermedades transmitidas por vectores. Las medianas de las tasas de incidencia fueron 1.371 y 188 por 100.00 habitantes para malaria y dengue, respectivamente. Además, los casos de chikungunya fueron 774.831 desde su introducción en el 2014 y, los de Zika, 117.674 desde su aparición en 2015. En las zonas rurales predominaron las enfermedades parasitarias transmitidas por vectores como la malaria, las leishmaniasis y la enfermedad de Chagas. A nivel urbano, predominaron el dengue, el chikungunya y el Zika.Conclusiones. La transmisión en Colombia de estas enfermedades es persistente en las zonas urbanas y en las rurales, y de tipo endemoepidémico en los casos de malaria, dengue, leishmaniasis y enfermedad de Chagas. Dicha transmisión se ha dado de manera focalizada y con patrones variables de intensidad. Asimismo, se mantienen las condiciones que han favorecido la transmisión emergente de nuevas arbovirosis.

  8. Microclimatic temperatures increase the potential for vector-borne disease transmission in the Scandinavian climate

    DEFF Research Database (Denmark)

    Haider, Najmul; Kirkeby, Carsten Thure; Kristensen, Birgit

    2017-01-01

    We quantified the difference between the meteorological temperature recorded by the Danish Meteorological Institute (DMI) weather stations and the actual microclimatic temperatures at two or three different heights at six potential insect habitats. We then compared the impact of the hourly temper...

  9. Characterization and Detection of Vector-borne Diseases in Endemic Transmission Areas

    Science.gov (United States)

    2016-01-18

    Achee NL, Gould F, Perkins TA, Reiner RC, Jr., Morrison AC, et al . 2015. A critical assessment of vector control for dengue prevention. PLoS Negl Trop...Beier JC, Perkins PV, Onyango F, et al . 1988 . Identification of malaria species by ELISA in sporozoite and oocyst infected Anopheles from western...for the detection of low-level parasitemias of a single malaria parasite species, Demas et al . demonstrated that alternative gene targets may be more

  10. Strain improvement of fungal insecticides for controlling insect pests and vector-borne diseases.

    Science.gov (United States)

    Fang, Weiguo; Azimzadeh, Philippe; St Leger, Raymond J

    2012-06-01

    Insect pathogenic fungi play an important natural role in controlling insect pests. However, few have been successfully commercialized due to low virulence and sensitivity to abiotic stresses that produce inconsistent results in field applications. These limitations are inherent in most naturally occurring biological control agents but development of recombinant DNA techniques has made it possible to significantly improve the insecticidal efficacy of fungi and their tolerance to adverse conditions, including UV. These advances have been achieved by combining new knowledge derived from basic studies of the molecular biology of these pathogens, technical developments that enable very precise regulation of gene expression, and genes encoding insecticidal proteins from other organisms, particularly spiders and scorpions. Recent coverage of genomes is helping determine the identity, origin, and evolution of traits needed for diverse lifestyles and host switching. In future, such knowledge combined with the precision and malleability of molecular techniques will allow design of multiple pathogens with different strategies and host ranges to be used for different ecosystems, and that will avoid the possibility of the host developing resistance. With increasing public concern over the continued use of synthetic chemical insecticides, these new types of biological insecticides offer a range of environmental-friendly options for cost-effective control of insect pests. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Regulation of the Immune Response to alpha-Gal and Vector-borne Diseases

    Czech Academy of Sciences Publication Activity Database

    Cabezas-Cruz, A.; Mateos-Hernández, L.; Pérez-Cruz, M.; Valdés, James J.; Fernández de Mera, I.G.; Villar, M.; de la Fuente, J.

    2015-01-01

    Roč. 31, č. 10 (2015), s. 470-476 ISSN 1471-4922 R&D Projects: GA MŠk(CZ) EE2.3.30.0032 EU Projects: European Commission(XE) 278976 Institutional support: RVO:60077344 Keywords : red meat allergy * host defenses * tick bites Subject RIV: EI - Biotechnology ; Bionics Impact factor: 7.295, year: 2015

  12. Recent Weather Extremes and Impacts on Agricultural Production and Vector-Borne Disease Outbreak Patterns

    Science.gov (United States)

    2014-03-21

    extracted from the USDA Production, Supply, and Distribution Online (PSD) electronic database (http://www.fas.usda.gov/psdonline/) for the focal regions...Precipitation Climatology Project [31] (Table 1). Various publicly-available databases were surveyed to develop maps of outbreak locations of dengue, Rift...rates of leaf photosynthesis and severely reduced the development of floral buds thus reducing yields [33]. Direct losses from the drought approached $10

  13. A Comparison of Dynamics in Two Models for the Spread of a Vector-Borne Disease

    DEFF Research Database (Denmark)

    Græsbøll, Kaare; Sumner, T.; Enøe, Claes

    2016-01-01

    In 2007, bluetongue virus (BTV) was introduced to both Denmark (DK) and the United Kingdom (UK). For this reason, simulation models were built to predict scenarios for future incursions. The DK and UK models have a common description of within-herd dynamics, but differ greatly in their descriptio...... sensitivity to the level of vaccine uptake and has lower variability compared with a kernel-based model. However, a model using a transmission kernel requires less detailed data and is often faster....

  14. The standardised freight container: vector of vectors and vector-borne diseases.

    Science.gov (United States)

    Reiter, P

    2010-04-01

    The standardised freight container was one of the most important innovations of the 20th Century. Containerised cargoes travel from their point of origin to their destination by ship, road and rail as part of a single journey, without unpacking. This simple concept is the key element in cheap, rapid transport by land and sea, and has led to a phenomenal growth in global trade. Likewise, containerised air cargo has led to a remarkable increase in the inter-continental transportation of goods, particularly perishable items such as flowers, fresh vegetables and live animals. In both cases, containerisation offers great advantages in speed and security, but reduces the opportunity to inspect cargoes in transit. An inevitable consequence is the globalisation of undesirable species of animals, plants and pathogens. Moreover, cheap passenger flights offer worldwide travel for viral and parasitic pathogens in infected humans. The continued emergence of exotic pests, vectors and pathogens throughout the world is an unavoidable consequence of these advances in transportation technology.

  15. Canine babesiosis: a perspective on clinical complications, biomarkers, and treatment

    Directory of Open Access Journals (Sweden)

    Köster LS

    2015-04-01

    Full Text Available Liza S Köster,1 Remo G Lobetti,2 Patrick Kelly1 1Department of Clinical Sciences, One Health Center for Zoonoses and Tropical Veterinary Medicine, Ross University School of Veterinary Medicine, St Kitts, West Indies; 2Bryanston Veterinary Hospital, Bryanston, South Africa Abstract: Canine babesiosis is a common tick transmitted disease of dogs worldwide. A number of Babesia sp. can infect dogs and the spectrum is increasing as molecular methods are developed to differentiate organisms. Clinical signs are generally attributed to hemolysis caused by the organisms in the erythrocytes but in some animals with some Babesia spp. there can be an immune mediated component to the anemia and/or a severe inflammatory reaction associated. This complicated form of canine babesiosis is associated with high morbidity and mortality. A variety of clinical markers has been investigated to enable clinicians to provide more accurate prognoses and adapt their treatments which vary according to the infecting species. In this review, we discuss the taxonomy, clinical signs, diagnostic imaging, clinical biomarkers, treatment, and prophylaxis of one of the most common and important diseases of dogs worldwide. Keywords: babesiosis, vector-borne disease, dog

  16. European surveillance of emerging pathogens associated with canine infectious respiratory disease.

    Science.gov (United States)

    Mitchell, Judy A; Cardwell, Jacqueline M; Leach, Heather; Walker, Caray A; Le Poder, Sophie; Decaro, Nicola; Rusvai, Miklos; Egberink, Herman; Rottier, Peter; Fernandez, Mireia; Fragkiadaki, Eirini; Shields, Shelly; Brownlie, Joe

    2017-12-01

    Canine infectious respiratory disease (CIRD) is a major cause of morbidity in dogs worldwide, and is associated with a number of new and emerging pathogens. In a large multi-centre European study the prevalences of four key emerging CIRD pathogens; canine respiratory coronavirus (CRCoV), canine pneumovirus (CnPnV), influenza A, and Mycoplasma cynos (M. cynos); were estimated, and risk factors for exposure, infection and clinical disease were investigated. CIRD affected 66% (381/572) of the dogs studied, including both pet and kennelled dogs. Disease occurrence and severity were significantly reduced in dogs vaccinated against classic CIRD agents, canine distemper virus (CDV), canine adenovirus 2 (CAV-2) and canine parainfluenza virus (CPIV), but substantial proportions (65.7%; 201/306) of vaccinated dogs remained affected. CRCoV and CnPnV were highly prevalent across the different dog populations, with overall seropositivity and detection rates of 47% and 7.7% for CRCoV, and 41.7% and 23.4% for CnPnV, respectively, and their presence was associated with increased occurrence and severity of clinical disease. Antibodies to CRCoV had a protective effect against CRCoV infection and more severe clinical signs of CIRD but antibodies to CnPnV did not. Involvement of M. cynos and influenza A in CIRD was less apparent. Despite 45% of dogs being seropositive for M. cynos, only 0.9% were PCR positive for M. cynos. Only 2.7% of dogs were seropositive for Influenza A, and none were positive by PCR. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. A novel method for objective vision testing in canine models of inherited retinal disease.

    Science.gov (United States)

    Gearhart, Patricia M; Gearhart, Chris C; Petersen-Jones, Simon M

    2008-08-01

    The use of canine models of retinal disease in the development of therapeutic strategies for inherited retinal disorders is a growing area of research. To evaluate accurately the success of potential vision-enhancing treatments, reliable methods for objectively assessing visual function in canine models is necessary. A simple vision-testing device was constructed that consisted of a junction box with four exit tunnels. Dogs were placed in the junction box and given one vision-based choice for exit. The first-choice tunnel and time to exit were recorded and analyzed. Two canine models of retinal disease with distinct molecular defects, a null mutation in the gene encoding the alpha subunit of rod cyclic GMP phosphodiesterase (PDE6A), and a null mutation in the gene encoding a retinal pigment epithelium-specific protein (RPE65) were tested and compared to those in unaffected dogs. With the use of bright light versus dim red light, the test differentiated between unaffected dogs and dogs affected with either mutation with a high degree of certainty. The white-light intensity series showed a significantly different performance between the unaffected and affected dogs. A significant difference in performance was detected between the dogs with each mutation. The results indicate that this novel canine vision-testing method is an accurate and sensitive means of distinguishing between unaffected dogs and dogs affected with two different forms of inherited retinal disease and should be useful as a means of assessing response to therapy in future studies.

  18. Echocardiography as an approach for canine cardiac disease diagnosis

    Directory of Open Access Journals (Sweden)

    P. Singh

    2014-11-01

    Full Text Available Aim: The aim of the study was to establish the methods for diagnosis various canine cardiac ailments using echocardiography. Materials and Methods: M-mode, two-dimensional echocardiography and Doppler studies were performed on 10 cases. Dogs showing signs of cardiac ailment either clinically, radiographic or via electrocardiographic examination were selected for study. Right parasternal short axis view was used for echocardiographic measurements. Right parasternal long axis and left parasternal apical views were used for Doppler studies. Doppler studies were performed at the level of aortic valve and atrioventricular valves for semi quantitative diagnosis of regurgitation. Results: Dogs were found affected with dilated cardiomyopathy (DCM (n=5, pericardial effusion (PE (n=1, combined PE and DCM (n=2 and remaining two showed abnormality on radiographic or electrographically evaluation but were found out to be normal echocardiographically (n=2. Conclusion: Echocardiography is an effective tool for diagnosis of various heart ailments.

  19. CANINE VISCERAL LEISHMANIASIS CASE INVESTIGATION IN THE JACARE REGION OF NITEROI, RIO DE JANEIRO, BRAZIL

    Directory of Open Access Journals (Sweden)

    Amanda Codeço de OLIVEIRA

    2015-08-01

    Full Text Available SUMMARY American visceral leishmaniasis is a vector-borne zoonosis in expansion in Brazil. Dogs are the main urban reservoir. Departing from a case of canine visceral leishmaniasis (CVL in Jacaré, Niterói, Rio de Janeiro State, an epidemiological canine and entomological study was performed to assess the extension of the disease at the location. Sample was collected around the case and the dogs identified by serological tests (rapid double platform immunochromatographic exams, immunoenzymatic assay/ELISA, indirect immunofluorescence/IFAT. The parasitological diagnosis was performed in animals positive in at least one of these tests. The entomological study was carried out by using light traps and manual collection. The associations between canine variables and outcome (ELISA and IFAT reagents were assessed by the chi-square test and adjusted by multivariate logistic regression for those associations with p < 0.1 in the bivariate analysis. Seventeen cases of CVL were detected among 110 evaluated dogs (prevalence of 15.5%. Presence of ectoparasites (OR 6.5; 95% CI 1.1-37.4, animals with clinical signs (OR 9.5; 95% CI 1.2-76.6, and previous cases of CVL in the same house (OR 17.9; 95% CI 2.2-147.1 were associated with the outcome. Lutzomyia longipalpiswas not detected. Our results are indicative of an ongoing transmission in the area.

  20. Critical analysis of vector-borne infections in dogs: Babesia vogeli, Babesia gibsoni, Ehrlichia canis and Hepatozoon canis in Punjab, India.

    Science.gov (United States)

    Singla, Lachhman Das; Sumbria, Deepak; Mandhotra, Ajay; Bal, M S; Kaur, Paramjit

    2016-12-01

    There are few published studies on various vector borne diseases of dogs in India and most depict clinical infection in dogs, diagnosed by observation of the haemopathogens in stained blood smears. This study provides the first report regarding molecular confirmation and ancestral relationship analysis of blood smears positive cases of assorted haemopathogens in Punjab province of India. On blood smear examination, haemopathogens were observed in 124 out of 778 (15.95%, 95% CI: 13.53- 18.68) blood smears. Further polymerase chain reactions (PCR) was used on bloods smear positive cases to validate the results. Out of 778 blood samples, Babesia gibsoni was most common parasite infecting dogs (15.04%, 95% CI: 12.7-17.72), followed by Ehrlichia canis (0.39%, 95% CI: 0.0-1.13), infection of Babesia vogeli and Hepatozoon canis was same (0.26%, 95% CI: 0.0-0.9). Among various risk factors studied (age, sex, season), prevalence of infection was non-significantly higher in 1-2 year of age group (19.88%, 95% CI: 14.45-26.71), regarding sex same prevalence was recorded (15.94%), and chances of infection was highest in pre-monsoon i.e. summer (18.26%, 95% CI: 14.49-22.76). Phylogenetic analysis revealed ancestral background of Ludhiana isolates of B. vogeli, B. gibsoni, H. canis, and E. canis with the isolates of Philippines, Mongolia and Tunisia.

  1. Controversial results of therapy with mesenchymal stem cells in the acute phase of canine distemper disease.

    Science.gov (United States)

    Pinheiro, A O; Cardoso, M T; Vidane, A S; Casals, J B; Passarelli, D; Alencar, A L F; Sousa, R L M; Fantinato-Neto, P; Oliveira, V C; Lara, V M; Ambrósio, C E

    2016-05-23

    Distemper disease is an infectious disease reported in several species of domestic and wild carnivores. The high mortality rate of animals infected with canine distemper virus (CDV) treated with currently available therapies has driven the study of new efficacious treatments. Mesenchymal stem cell (MSC)-based therapy is a promising therapeutic option for many degenerative, hereditary, and inflammatory diseases. Therefore, the aim of this study was to characterize stem cells derived from the canine fetal olfactory epithelium and to assess the systemic response of animals infected with CDV to symptomatic therapy and treatment with MSCs. Eight domestic mongrel dogs (N = 8) were divided into two groups: support group (SG) (N = 5) and support group + cell therapy (SGCT) (N = 3), which were monitored over 15 days. Blood samples were collected on days 0, 6, 9, 12, and 15 to assess blood count and serum biochemistry (urea, creatinine, alanine transferase, alkaline phosphatase, gamma-glutamyl transferase, total protein, albumin, and globulin), and urine samples were obtained on days 0 and 15 for urinary evaluation (urine I). The results showed a high mortality rate (SG = 4 and SGCT = 2), providing inadequate data on the clinical course of CDV infection. MSC therapy resulted in no significant improvement when administered during the acute phase of canine distemper disease, and a prevalence of animals with high mortality rate was found in both groups due to the severity of symptoms.

  2. Magnetic resonance findings of the corpus callosum in canine and feline lysosomal storage diseases.

    Science.gov (United States)

    Hasegawa, Daisuke; Tamura, Shinji; Nakamoto, Yuya; Matsuki, Naoaki; Takahashi, Kimimasa; Fujita, Michio; Uchida, Kazuyuki; Yamato, Osamu

    2013-01-01

    Several reports have described magnetic resonance (MR) findings in canine and feline lysosomal storage diseases such as gangliosidoses and neuronal ceroid lipofuscinosis. Although most of those studies described the signal intensities of white matter in the cerebrum, findings of the corpus callosum were not described in detail. A retrospective study was conducted on MR findings of the corpus callosum as well as the rostral commissure and the fornix in 18 cases of canine and feline lysosomal storage diseases. This included 6 Shiba Inu dogs and 2 domestic shorthair cats with GM1 gangliosidosis; 2 domestic shorthair cats, 2 familial toy poodles, and a golden retriever with GM2 gangliosidosis; and 2 border collies and 3 chihuahuas with neuronal ceroid lipofuscinoses, to determine whether changes of the corpus callosum is an imaging indicator of those diseases. The corpus callosum and the rostral commissure were difficult to recognize in all cases of juvenile-onset gangliosidoses (GM1 gangliosidosis in Shiba Inu dogs and domestic shorthair cats and GM2 gangliosidosis in domestic shorthair cats) and GM2 gangliosidosis in toy poodles with late juvenile-onset. In contrast, the corpus callosum and the rostral commissure were confirmed in cases of GM2 gangliosidosis in a golden retriever and canine neuronal ceroid lipofuscinoses with late juvenile- to early adult-onset, but were extremely thin. Abnormal findings of the corpus callosum on midline sagittal images may be a useful imaging indicator for suspecting lysosomal storage diseases, especially hypoplasia (underdevelopment) of the corpus callosum in juvenile-onset gangliosidoses.

  3. Full-genome analysis of a canine pneumovirus causing acute respiratory disease in dogs, Italy.

    Directory of Open Access Journals (Sweden)

    Nicola Decaro

    Full Text Available An outbreak of canine infectious respiratory disease (CIRD associated to canine pneumovirus (CnPnV infection is reported. The outbreak occurred in a shelter of the Apulia region and involved 37 out of 350 dogs that displayed cough and/or nasal discharge with no evidence of fever. The full-genomic characterisation showed that the causative agent (strain Bari/100-12 was closely related to CnPnVs that have been recently isolated in the USA, as well as to murine pneumovirus, which is responsible for respiratory disease in mice. The present study represents a useful contribution to the knowledge of the pathogenic potential of CnPnV and its association with CIRD in dogs. Further studies will elucidate the pathogenicity and epidemiology of this novel pneumovirus, thus addressing the eventual need for specific vaccines.

  4. Declining Prevalence of Disease Vectors Under Climate Change

    DEFF Research Database (Denmark)

    Escobar, Luis E.; Romero-Alvarez, Daniel; Leon, Renato

    2016-01-01

    More than half of the world population is at risk of vector-borne diseases including dengue fever, chikungunya, zika, yellow fever, leishmaniasis, chagas disease, and malaria, with highest incidences in tropical regions. In Ecuador, vector-borne diseases are present from coastal and Amazonian...

  5. Diagnosis and incidence risk of clinical canine monocytic ehrlichiosis under field conditions in Southern Europe.

    Science.gov (United States)

    René-Martellet, Magalie; Lebert, Isabelle; Chêne, Jeanne; Massot, Raphaël; Leon, Marta; Leal, Ana; Badavelli, Stefania; Chalvet-Monfray, Karine; Ducrot, Christian; Abrial, David; Chabanne, Luc; Halos, Lénaïg

    2015-01-06

    Canine Monocytic Ehrlichiosis (CME), due to the bacterium Ehrlichia canis and transmitted by the brown dog tick Rhipicephalus sanguineus, is a major tick-borne disease in southern Europe. In this area, infections with other vector-borne pathogens (VBP) are also described and result in similar clinical expression. The aim of the present study was to evaluate the incidence risk of clinical CME in those endemic areas and to assess the potential involvement of other VBP in the occurrence of clinical and/or biological signs evocative of the disease. The study was conducted from April to November 2011 in veterinary clinics across Italy, Spain and Portugal. Sick animals were included when fitting at least three clinical and/or biological criteria compatible with ehrlichiosis. Serological tests (SNAP®4Dx, SNAP®Leish tests, Idexx, USA) and diagnostic PCR for E. canis, Anaplasma platys, Anaplasma phagocytophilum, Babesia spp, Hepatozoon canis and Leishmania infantum detection were performed to identify the etiological agents. Ehrlichiosis was considered when three clinical and/or biological suggestive signs were associated with at least one positive paraclinical test (serology or PCR). The annual incidence risk was calculated and data were geo-referenced for map construction. The probabilities of CME and other vector-borne diseases when facing clinical and/or biological signs suggestive of CME were then evaluated. A total of 366 dogs from 78 veterinary clinics were enrolled in the survey. Among them, 99 (27%) were confirmed CME cases, which allowed an estimation of the average annual incidence risk of CME amongst the investigated dog population to be 0.08%. Maps showed an increasing gradient of CME incidence risk from northern towards southern areas, in particular in Italy. It also suggested the existence of hot-spots of infections by VBP in Portugal. In addition, the detection of other VBP in the samples was common and the study demonstrated that a dog with clinical signs

  6. Lyme Disease Transmission

    Science.gov (United States)

    ... not known to transmit Lyme disease include Lone star ticks ( Amblyomma americanum ), the American dog tick ( Dermacentor ... of Vector-Borne Diseases (DVBD) Email Recommend Tweet YouTube Instagram Listen Watch RSS ABOUT About CDC Jobs ...

  7. Emerging vector-borne zoonoses: eco-epidemiology and public health implications in India.

    Science.gov (United States)

    Dhiman, Ramesh C

    2014-01-01

    The diseases originating from animals or associated with man and animals are remerging and have resulted in considerable morbidity and mortality. The present review highlights the re-emergence of emerging mainly zoonotic diseases like chikungunya, scrub typhus, and extension of spatial distribution of cutaneous leishmaniasis from western Rajasthan to Himachal Pradesh, Kerala, and Haryana states; West Nile virus to Assam, and non-endemic areas of Japanese encephalitis (JE) like Maharashtra and JE to Delhi; Crimean-Congo hemorrhagic fever making inroads in Ahmedabad; and reporting fifth parasite of human malaria with possibility of zoonosis have been highlighted, which necessitates further studies for prevention and control. Emphasis has been given on understanding the ecology of reservoir hosts of pathogen, micro niche of vector species, climatic, socioeconomic risk factors, etc. Development of facilities for diagnosis of virus from insects, reservoirs, and human beings (like BSL4, which has been established in NIV, Pune), awareness about symptoms of new emerging viral and other zoonotic diseases, differential diagnosis, risk factors (climatic, ecological, and socioeconomic) and mapping of disease-specific vulnerable areas, and mathematical modeling for projecting epidemiological scenario is needed for preparedness of public health institutes. It is high time to understand the ecological link of zoonotic or anthroponotic diseases for updated risk maps and epidemiological knowledge for effective preventive and control measures. The public health stakeholders in India as well as in Southeast Asia should emphasize on understanding the eco-epidemiology of the discussed zoonotic diseases for taking preventive actions.

  8. Emerging Vector borne zoonoses: eco-­epidemiology and public health implications in India

    Directory of Open Access Journals (Sweden)

    Ramesh C Dhiman

    2014-09-01

    Full Text Available The diseases originating from animals or associated with man and animals are remerging and have resulted in considerable morbidity and mortality. The present review highlights the re-emergence of emerging mainly zoonotic diseases like chikungunya, scrub typhus, extension of spatial distribution of cutaneous leishmaniasis from Western Rajasthan to Himachal Pradesh, Kerala, and Haryana states; West Nile virus to Assam, and non- endemic areas of JE like Maharashtra and JE to Delhi; Crimean Congo Hemorrhagic Fever making inroads in Ahmedabad; reporting fifth parasite of human malaria with possibility of zoonosis have been highlighted which necessitates further studies for prevention and control. Emphasis has been given on understanding the ecology of reservoir hosts of pathogen, micro niche of vector species, climatic, socioeconomic risk factors etc. Development of facilities for diagnosis of virus from insects, reservoirs and human beings (like BSL4 which has been established in NIV, Pune, awareness about symptoms of new emerging viral and other zoonotic diseases, differential diagnosis, risk factors (Climatic, ecological and socioeconomic and mapping of disease specific vulnerable areas, mathematical modeling for projecting epidemiological scenario, are needed for preparedness of public health institutes. It is high time to understand the ecological link of zoonotic or anthroponotic diseases for updated risk maps and epidemiological knowledge for effective preventive and control measures. The public health stakeholders in India as well as in south East Asia should emphasize on understanding the eco-epidemiology of the discussed zoonotic diseases for taking preventive actions.

  9. How patient positioning affects radiographic signs of canine lung disease

    International Nuclear Information System (INIS)

    Steyn, P.F.; Green, R.W.

    1990-01-01

    A single radiographic projection risks missing signs of lung disease. Four case reports of dogs are given to emphasize inadequate visualization with just one or two radiographs. It is advisable to take both right and left lateral views along with a dorsoventral view in a patient, that might have lung disease

  10. Prevention approaches in a preclinical canine model of Alzheimer’s disease: Benefits and challenges

    Directory of Open Access Journals (Sweden)

    Paulina R. Davis

    2014-03-01

    Full Text Available Aged dogs spontaneously develop many features of human aging and Alzheimer’s disease (AD including cognitive decline and neuropathology. In this review, we discuss age-dependent learning tasks, memory tasks, and functional measures that can be used in aged dogs for sensitive treatment outcome measures. Neuropathology that is linked to cognitive decline is described along with examples of treatment studies that show reduced neuropathology in aging dogs (dietary manipulations, behavioral enrichment, immunotherapy, and statins. Studies in canine show that multi-targeted approaches may be more beneficial than single pathway manipulations (e.g. antioxidants combined with behavioral enrichment. Aging canine studies show good predictive validity for human clinical trials outcomes (e.g. immunotherapy and several interventions tested in dogs strongly support a prevention approach (e.g. immunotherapy and statins. Further, dogs are ideally suited for prevention studies as they the age because onset of cognitive decline and neuropathology strongly support longitudinal interventions that can be completed within a 3-5 year period. Disadvantages to using the canine model are that they lengthy, use labor-intensive comprehensive cognitive testing, and involve costly housing (almost as high as that of nonhuman primates. However overall, using the dog as a preclinical model for testing preventive approaches for AD may complement work in rodents and nonhuman primates.

  11. Magnetic resonance findings of the corpus callosum in canine and feline lysosomal storage diseases.

    Directory of Open Access Journals (Sweden)

    Daisuke Hasegawa

    Full Text Available Several reports have described magnetic resonance (MR findings in canine and feline lysosomal storage diseases such as gangliosidoses and neuronal ceroid lipofuscinosis. Although most of those studies described the signal intensities of white matter in the cerebrum, findings of the corpus callosum were not described in detail. A retrospective study was conducted on MR findings of the corpus callosum as well as the rostral commissure and the fornix in 18 cases of canine and feline lysosomal storage diseases. This included 6 Shiba Inu dogs and 2 domestic shorthair cats with GM1 gangliosidosis; 2 domestic shorthair cats, 2 familial toy poodles, and a golden retriever with GM2 gangliosidosis; and 2 border collies and 3 chihuahuas with neuronal ceroid lipofuscinoses, to determine whether changes of the corpus callosum is an imaging indicator of those diseases. The corpus callosum and the rostral commissure were difficult to recognize in all cases of juvenile-onset gangliosidoses (GM1 gangliosidosis in Shiba Inu dogs and domestic shorthair cats and GM2 gangliosidosis in domestic shorthair cats and GM2 gangliosidosis in toy poodles with late juvenile-onset. In contrast, the corpus callosum and the rostral commissure were confirmed in cases of GM2 gangliosidosis in a golden retriever and canine neuronal ceroid lipofuscinoses with late juvenile- to early adult-onset, but were extremely thin. Abnormal findings of the corpus callosum on midline sagittal images may be a useful imaging indicator for suspecting lysosomal storage diseases, especially hypoplasia (underdevelopment of the corpus callosum in juvenile-onset gangliosidoses.

  12. Magnetic Resonance Findings of the Corpus Callosum in Canine and Feline Lysosomal Storage Diseases

    Science.gov (United States)

    Hasegawa, Daisuke; Tamura, Shinji; Nakamoto, Yuya; Matsuki, Naoaki; Takahashi, Kimimasa; Fujita, Michio; Uchida, Kazuyuki; Yamato, Osamu

    2013-01-01

    Several reports have described magnetic resonance (MR) findings in canine and feline lysosomal storage diseases such as gangliosidoses and neuronal ceroid lipofuscinosis. Although most of those studies described the signal intensities of white matter in the cerebrum, findings of the corpus callosum were not described in detail. A retrospective study was conducted on MR findings of the corpus callosum as well as the rostral commissure and the fornix in 18 cases of canine and feline lysosomal storage diseases. This included 6 Shiba Inu dogs and 2 domestic shorthair cats with GM1 gangliosidosis; 2 domestic shorthair cats, 2 familial toy poodles, and a golden retriever with GM2 gangliosidosis; and 2 border collies and 3 chihuahuas with neuronal ceroid lipofuscinoses, to determine whether changes of the corpus callosum is an imaging indicator of those diseases. The corpus callosum and the rostral commissure were difficult to recognize in all cases of juvenile-onset gangliosidoses (GM1 gangliosidosis in Shiba Inu dogs and domestic shorthair cats and GM2 gangliosidosis in domestic shorthair cats) and GM2 gangliosidosis in toy poodles with late juvenile-onset. In contrast, the corpus callosum and the rostral commissure were confirmed in cases of GM2 gangliosidosis in a golden retriever and canine neuronal ceroid lipofuscinoses with late juvenile- to early adult-onset, but were extremely thin. Abnormal findings of the corpus callosum on midline sagittal images may be a useful imaging indicator for suspecting lysosomal storage diseases, especially hypoplasia (underdevelopment) of the corpus callosum in juvenile-onset gangliosidoses. PMID:24386203

  13. The Prevalence of Canine Oral Protozoa and Their Association with Periodontal Disease.

    Science.gov (United States)

    Patel, Niran; Colyer, Alison; Harris, Steve; Holcombe, Lucy; Andrew, Peter

    2017-05-01

    Periodontal disease is one of the most important health concerns for companion animals. Research into canine forms of periodontitis has focused on the identification and characterization of the bacterial communities present. However, other microorganisms are known to inhabit the oral cavity and could also influence the disease process. A novel, broad spectrum 18S PCR was developed and used, in conjunction with next-generation sequencing analyses to target the identification of protists. Trichomonas sp. and Entamoeba sp. were identified from 92 samples of canine plaque. The overall prevalence of trichomonads was 56.52% (52/92) and entamoebae was 4.34% (4/92). Next-generation sequencing of pooled healthy, gingivitis, early-stage periodontitis, and severe periodontitis samples revealed the proportion of trichomonad sequences to be 3.51% (health), 2.84% (gingivitis), 6.07% (early periodontitis), and 35.04% (severe periodontitis), respectively, and entamoebae to be 0.01% (health), 0.01% (gingivitis), 0.80% (early-stage periodontitis), and 7.91% (severe periodontitis) respectively. Both genera of protists were statistically associated with plaque from dogs with periodontal disease. These findings provide the first conclusive evidence for the presence of oral protozoa in dog plaque and suggest a possible role for protozoa in the periodontal disease process. © 2016 The Author(s) The Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

  14. Temporal and spatial scaling of the genetic structure of a vector-borne plant pathogen.

    Science.gov (United States)

    Coletta-Filho, Helvécio D; Francisco, Carolina S; Almeida, Rodrigo P P

    2014-02-01

    The ecology of plant pathogens of perennial crops is affected by the long-lived nature of their immobile hosts. In addition, changes to the genetic structure of pathogen populations may affect disease epidemiology and management practices; examples include local adaptation of more fit genotypes or introduction of novel genotypes from geographically distant areas via human movement of infected plant material or insect vectors. We studied the genetic structure of Xylella fastidiosa populations causing disease in sweet orange plants in Brazil at multiple scales using fast-evolving molecular markers (simple-sequence DNA repeats). Results show that populations of X. fastidiosa were regionally isolated, and that isolation was maintained for populations analyzed a decade apart from each other. However, despite such geographic isolation, local populations present in year 2000 were largely replaced by novel genotypes in 2009 but not as a result of migration. At a smaller spatial scale (individual trees), results suggest that isolates within plants originated from a shared common ancestor. In summary, new insights on the ecology of this economically important plant pathogen were obtained by sampling populations at different spatial scales and two different time points.

  15. Assessing the impact of climate change on vector-borne viruses in the EU through the elicitation of expert opinion.

    Science.gov (United States)

    Gale, P; Brouwer, A; Ramnial, V; Kelly, L; Kosmider, R; Fooks, A R; Snary, E L

    2010-02-01

    Expert opinion was elicited to undertake a qualitative risk assessment to estimate the current and future risks to the European Union (EU) from five vector-borne viruses listed by the World Organization for Animal Health. It was predicted that climate change will increase the risk of incursions of African horse sickness virus (AHSV), Crimean-Congo haemorrhagic fever virus (CCHFV) and Rift Valley fever virus (RVFV) into the EU from other parts of the world, with African swine fever virus (ASFV) and West Nile virus (WNV) being less affected. Currently the predicted risks of incursion were lowest for RVFV and highest for ASFV. Risks of incursion were considered for six routes of entry (namely vectors, livestock, meat products, wildlife, pets and people). Climate change was predicted to increase the risk of incursion from entry of vectors for all five viruses to some degree, the strongest effects being predicted for AHSV, CCHFV and WNV. This work will facilitate identification of appropriate risk management options in relation to adaptations to climate change.

  16. Prevalence of Selected Zoonotic and Vector-Borne Agents in Dogs and Cats on the Pine Ridge Reservation

    Directory of Open Access Journals (Sweden)

    A. Valeria Scorza

    2017-09-01

    Full Text Available The prevalence of intestinal parasites and vector-borne agents of dogs and cats in the Pine Ridge Reservation, South Dakota were determined. Fecal samples (84 dogs, 9 cats were examined by centrifugal floatation and by immunofluorescence assay (FA for Giardia and Cryptosporidium. PCR was performed on Giardia [beta-giardin (bg, triose phosphate isomerase (tpi, glutamate dehydrogenase genes (gdh] and Cryptosporidium [heat shock protein-70 gene (hsp] FA positive samples. Cat sera (n = 32 were tested for antibodies against Bartonella spp., Toxoplasma gondii, and FIV, and antigens of FeLV and Dirofilaria immitis. Dog sera (n = 82 were tested for antibodies against T. gondii, Borrelia burgdorferi, Ehrlichia canis, and Anaplasma phagocytophilum and D. immitis antigen. Blood samples (92 dogs, 39 cats were assessed by PCR for amplification of DNA of Bartonella spp., Ehrlichia spp., Anaplasma spp., haemoplasmas, and Babesia spp. (dogs only. The most significant results were Giardia spp. (32% by FA, Taenia spp. (17.8% and Cryptosporidium spp. (7.1%. The Giardia isolates typed as the dog-specific assemblages C or D and four Cryptosporidium isolates typed as C. canis. Antibodies against T. gondii were detected in 15% of the dogs. Antibodies against Bartonella spp. and against T. gondii were detected in 37.5% and 6% of the cats respectively. FeLV antigen was detected in 10% of the cats.

  17. Canine stage 1 periodontal disease: a latent pathology.

    Science.gov (United States)

    Whyte, A; Bonastre, C; Monteagudo, L V; Les, F; Obon, J; Whyte, J; Tejedor, M T

    2014-07-01

    To evaluate the potential health issues associated with periodontal disease (PD) in dogs, 1004 teeth from 25 dogs were examined. The dogs were randomly selected, aged 2-14 years, and had at least 95% of their teeth at the first PD stage. Significant positive correlations between plaque grade (PG) and gum inflammation, gingival regression, periodontal pocket, age and serum alanine aminotransferase (ALT) activity were identified. In contrast, PG was negatively correlated to total platelet count. Altogether, these findings suggest that prevention and therapy at the first PD stages can have an important impact on the general health condition of dogs. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. WNV infection - an emergent vector borne viral infection in Serbia: Current situation

    Directory of Open Access Journals (Sweden)

    Petrović Tamaš

    2015-01-01

    Full Text Available West Nile virus (WNV is a neurovirulent mosquito-borne Flavivirus with zoonotic potential. Virus is maintained in nature in an enzootic transmission cycle between avian hosts and mosquito vectors, but occasionally infects other vertebrates. The infection in horses and humans can be asymptomatic or it can have different clinical manifestations ranging from light febrile diseases to fatal meningoencephalitis. Recently, the number, frequency and severity of outbreaks with neurological consequences for birds, humans and horses have increased dramatically throughout central and south Europe, including Serbia, posing a serious veterinary and public health problem. The emergency of WNV infections in Serbia is described through the current epidemiology situation based on recent data on the incidence of WNV infection among virus natural hosts and vectors; sentinel (horses and other animal species, and in human population. The results of the WNV serology studies conducted on horse blood samples collected in different occasions during the last six years, and the results of the serology studies conducted among other animal species like pigs, wild boars, roe deer and dogs in Serbia are presented and discussed. Also, the results of the first studies on WNV presence in mosquito vectors and in wild birds as virus natural hosts in Serbia are presented and analyzed. In addition, the data on the WNV serology studies conducted in human population in Serbia in the last few years, and the existing data of WNV outbreaks in 2012 and 2013 are included. Regarding the existing knowledge on WNV epidemiology situation, the crucial role of veterinary service in early detection of WNV presence and ongoing national program of WNV surveillance in sentinel animals, mosquitoes and wild birds are discussed.

  19. Investigation of cell-free DNA in canine plasma and its relation to disease.

    Science.gov (United States)

    Burnett, Deborah L; Cave, Nicholas J; Gedye, Kristene R; Bridges, Janis P

    2016-09-01

    DNA is released from dying cells during apoptosis and necrosis. This cell-free DNA (cfDNA) diffuses into the plasma where it can be measured. In humans, an increase in cfDNA correlates with disease severity and prognosis. It was hypothesized that when DNA in canine plasma was measured by emission fluorometry without prior DNA extraction, the concentration of cfDNA would increase with disease severity. The diseased population consisted of 97 client-owned dogs. The clinically normal population consisted of nine client-owned dogs presenting for 'wellness screens', and 15 colony-owned Harrier Hounds. Plasma cfDNA was measured by fluorometry without prior DNA extraction. The effects of ex vivo storage conditions were evaluated in plasma from two clinically normal dogs. In all other dogs, plasma was separated within two hours of collection. The association between the cfDNA concentration in hospitalized dogs and a variety of clinical, clinicopathological and outcome variables was tested. The concentration of cfDNA was reliably measured when plasma was separated within two hours of blood collection. The diseased dogs had significantly higher cfDNA than clinically normal dogs (P Dogs that did not survive to discharge had significantly higher cfDNA concentrations than survivors (P = 0.02). Conclusions/Clinical Importance: The concentration of cfDNA in the plasma of diseased dogs is associated with disease severity and prognosis. Measurement of canine cfDNA could be a useful non-specific disease indicator and prognostic tool.

  20. Canine periodontal disease control using a clindamycin hydrochloride gel.

    Science.gov (United States)

    Johnston, Thomas P; Mondal, Pravakar; Pal, Dhananjay; MacGee, Scott; Stromberg, Arnold J; Alur, Hemant

    2011-01-01

    Stabilizing or reducing periodontal pocket depth can have a positive influence on the retention of teeth in dogs. A topical 2% clindamycin hydrochloride gel (CHgel) was evaluated for the treatment of periodontal disease in dogs. The CHgel formulation provides for the sustained erosion of the matrix, but also flows into the periodontal pocket as a viscous liquid, and then rapidly forms a gel that has mucoadhesive properties and also may function as a physical barrier to the introduction of bacteria. A professional teeth cleaning procedure including scaling and root planing was done in dogs with one group receiving CHgel following treatment. Periodontal health was determined before and after the procedure including measurement of periodontal pocket depth, gingival index, gingival bleeding sites, and number of suppurating sites. There was a statistically significant decrease in periodontal pocket depth (19%), gingival index (16%), and the number of bleeding sites (64%) at 90-days in dogs receiving CHgel. Additionally, the number of suppurating sites was lower (93%) at 90-days for the group receiving CHgel. The addition of CHgel effectively controlled the bacterial burden (e.g, Fusobacterium nucleatum) at both day 14 and 90. Gingival cells in culture were shown to rapidly incorporate clindamycin and attain saturation in approximately 20-minutes. In summary, a professional teeth cleaning procedure including root planning and the addition of CHgel improves the gingival index and reduces periodontal pocket depth.

  1. Histopathological retrospective study of canine renal disease in Korea, 2003~2008

    Science.gov (United States)

    Yhee, Ji-Young; Yu, Chi-Ho; Kim, Jong-Hyuk; Im, Keum-Soon; Chon, Seung-Ki

    2010-01-01

    Renal disease includes conditions affecting the glomeruli, tubules, interstitium, pelvis, and vasculature. Diseases of the kidney include glomerular diseases, diseases of the tubules and interstitium, diseases of renal pelvis, and developmental abnormalities. Renal tissue samples (n = 70) submitted to the Department of Veterinary Pathology of Konkuk University from 2003 to 2008 were included in this study. Tissue histopathology was performed using light microscopy with hematoxylin and eosin stains. Masson's trichrome, Congo Red, and Warthin starry silver staining were applied in several individual cases. Glomerular diseases (22.9%), tubulointerstitial diseases (8.6%), neoplastic diseases (8.6%), conditions secondary to urinary obstruction (24.3%), and other diseases (35.7%) were identified. Glomerulonephritis (GN) cases were classified as acute proliferative GN (5.7%), membranous GN (4.3%), membranoproliferative GN (4.3%), focal segmental GN (2.9%), and other GN (4.2%). The proportion of canine GN cases presently identified was not as high as the proportions identified in human studies. Conversely, urinary obstruction and end-stage renal disease cases were relatively higher in dogs than in human populations. PMID:21113095

  2. Temporal and Spatial Distribution of Tick-Borne Disease Cases among Humans and Canines in Illinois (2000-2009

    Directory of Open Access Journals (Sweden)

    John A. Herrmann

    2014-01-01

    Full Text Available Four tick-borne diseases (TBDs, anaplasmosis, ehrlichiosis, Lyme disease (LD, and Rocky Mountain spotted fever (RMSF, are endemic in Illinois. The prevalence of human and canine cases of all four TBDs rose over the study period with significant differences in geographic distribution within the state. Among human cases, there were associations between cases of RMSF and LD and total forest cover, seasonal precipitation, average mean temperature, racial-ethnic groups, and gender. Estimated annual prevalence of three canine TBDs exceeded human TBD cases significantly in each region. There was concordance in the number of human and canine cases by county of residence, in annual prevalence trends, and in time of year at which they were diagnosed. To account for multiple environmental risk factors and to facilitate early diagnosis of cases, integrated surveillance systems must be developed and communication between veterinarians, physicians, and public health agencies must be improved.

  3. Electrocardiography may be a useful tool in the diagnosis of early mild canine heartworm disease

    Directory of Open Access Journals (Sweden)

    Edward M. Onyango

    2011-01-01

    Full Text Available This study was carried out to determine the usefulness of standard electrocardiography for the diagnosis of early canine heartworm disease. Baseline electrocardiograms were recorded in 12 dogs. Thirty artificial Dirofilaria immitis worms were inserted in the pulmonary artery of each dog. New electrocardiograms were recorded on days 1-4, 7, 14, 21, 28 and 35 after insertion of worms. A significant attenuation of amplitude of Q wave in lead I was recorded on days 1-4, 7, 14, 21, 28 and 35; of R wave in lead II on days 21, 28 and 35; and of S wave in lead aVR on days 7, 14, 21, 28 and 35. Duration of the QRS complex in lead AVF was significantly prolonged on day 14. In 41.6% of the dogs, right axis deviation was recorded. These results suggest that for a dog whose normal baseline standard electrocardiogram is known, a comparison of the QRS complex of the baseline with those of subsequent standard electrocardiograms may suggest early canine heartworm disease when there is an attenuation of amplitude of Q wave in lead I, R wave in lead II and S wave in lead aVR. An additional indication can be right axis deviation.

  4. Characterization of a novel Canine distemper virus causing disease in wildlife.

    Science.gov (United States)

    Pope, Jenny P; Miller, Debra L; Riley, Matthew C; Anis, Eman; Wilkes, Rebecca P

    2016-09-01

    Canine distemper virus (CDV) is a common cause of a multisystemic disease in both domestic dogs and wildlife species, including raccoons and foxes. Outbreaks of CDV in domestic dogs in eastern Tennessee have occurred since 2012, and it was determined that these outbreaks resulted from a novel genotype of CDV. We hypothesized that this virus is also infecting area wildlife and may be a source of the virus for these outbreaks in dogs. From 2013 to 2014, autopsies were performed and tissues collected from raccoons (Procyon lotor; n = 50) and gray foxes (Urocyon cinereoargenteus; n = 8) for CDV testing. A real-time reverse transcription PCR was used to document the presence of CDV in tissue samples, and a portion of the virus was subsequently sequenced for phylogenetic analysis. A high percentage of wildlife, both with (86%) and without (55%) clinical signs, tested positive for CDV, with the majority (77%) testing positive for the novel genotype. Microscopic findings, including syncytia in the lungs and viral inclusion bodies in urothelium, astrocytes, neurons, and bronchiolar epithelium, were also consistent with canine distemper. Minimal inflammation in the central nervous system of affected animals was indicative of the acute neurologic form of the disease. Pneumonia and parasitism were also commonly found in CDV-infected animals. Based on these results, CDV appears to be prevalent in eastern Tennessee wildlife. Subclinical or clinically recovered shedders are a potential source of this novel genotype for domestic dogs, and this genotype is genetically distinct from vaccine strains. © 2016 The Author(s).

  5. Malaria and Other Vector-Borne Infection Surveillance in the U.S. Department of Defense Armed Forces Health Surveillance Center-Global Program: Review of 2009 Accomplishments

    Science.gov (United States)

    2011-03-04

    Vector borne infections (VBIs) such as malaria, dengue fever, yellow fever, scrub typhus , and plague comprise a significant proportion of the global...a VBI: scrub typhus (19), murine typhus (three), Japanese encephalitis (JE) (two), primary dengue infection (12), secondary dengue infection (nine...prioritized by GSRI, half are VBIs (malaria, dengue fever, Rift Valley fever, Chikungunya, CCHF, sandfly fever, O’nyong-nyong, Sindbis virus, scrub typhus

  6. Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

    Directory of Open Access Journals (Sweden)

    Jobin Thomas

    2014-11-01

    Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

  7. Canine olfaction as an alternative to analytical instruments for disease diagnosis: understanding 'dog personality' to achieve reproducible results

    Science.gov (United States)

    Recent literature has touted the use of canine olfaction as a diagnostic tool for identifying pre-clinical disease status, especially cancer and infection from biological media samples. Studies have shown a wide range of outcomes, ranging from almost perfect discrimination, all t...

  8. Canine distemper virus: an emerging disease in wild endangered Amur tigers (Panthera tigris altaica).

    Science.gov (United States)

    Seimon, Tracie A; Miquelle, Dale G; Chang, Tylis Y; Newton, Alisa L; Korotkova, Irina; Ivanchuk, Galina; Lyubchenko, Elena; Tupikov, Andre; Slabe, Evgeny; McAloose, Denise

    2013-08-13

    Fewer than 500 Amur tigers (Panthera tigris altaica) remain in the wild. Due to low numbers and their solitary and reclusive nature, tiger sightings across their range in the Russian Far East and China are rare; sightings of sick tigers are rarer still. Serious neurologic disease observed in several wild tigers since 2001 suggested disease emergence in this endangered species. To investigate this possibility, histology, immunohistochemistry (IHC), in situ hybridization (ISH), and reverse transcription-PCR (RT-PCR) were performed on tissues from 5 affected tigers that died or were destroyed in 2001, 2004, or 2010. Our results reveal canine distemper virus (CDV) infection as the cause of neurologic disease in two tigers and definitively establish infection in a third. Nonsuppurative encephalitis with demyelination, eosinophilic nuclear viral inclusions, and positive immunolabeling for CDV by IHC and ISH were present in the two tigers with available brain tissue. CDV phosphoprotein (P) and hemagglutinin (H) gene products were obtained from brains of these two tigers by RT-PCR, and a short fragment of CDV P gene sequence was detected in lymph node tissue of a third tiger. Phylogenetically, Amur tiger CDV groups with an Arctic-like strain in Baikal seals (Phoca siberica). Our results, which include mapping the location of positive tigers and recognition of a cluster of cases in 2010, coupled with a lack of reported CDV antibodies in Amur tigers prior to 2000 suggest wide geographic distribution of CDV across the tiger range and recent emergence of CDV as a significant infectious disease threat to endangered Amur tigers in the Russian Far East. Recognition of disease emergence in wildlife is a rare occurrence. Here, for the first time, we identify and characterize a canine distemper virus (CDV), the second most common cause of infectious disease death in domestic dogs and a viral disease of global importance in common and endangered carnivores, as the etiology of

  9. Does canine inflammatory bowel disease influence gut microbial profile and host metabolism?

    Science.gov (United States)

    Xu, Jia; Verbrugghe, Adronie; Lourenço, Marta; Janssens, Geert P J; Liu, Daisy J X; Van de Wiele, Tom; Eeckhaut, Venessa; Van Immerseel, Filip; Van de Maele, Isabel; Niu, Yufeng; Bosch, Guido; Junius, Greet; Wuyts, Brigitte; Hesta, Myriam

    2016-06-16

    Inflammatory bowel disease (IBD) refers to a diverse group of chronic gastrointestinal diseases, and gut microbial dysbiosis has been proposed as a modulating factor in its pathogenesis. Several studies have investigated the gut microbial ecology of dogs with IBD but it is yet unclear if this microbial profile can alter the nutrient metabolism of the host. The aim of the present study was to characterize the faecal bacterial profile and functionality as well as to determine host metabolic changes in IBD dogs. Twenty-three dogs diagnosed with IBD and ten healthy control dogs were included. Dogs with IBD were given a clinical score using the canine chronic enteropathy clinical activity index (CCECAI). Faecal short-chain fatty acids (SCFA) and ammonia concentrations were measured and quantitative PCR was performed. The concentration of plasma amino acids, acylcarnitines, serum folate, cobalamin, and indoxyl sulfate was determined. No significant differences in the abundance of a selection of bacterial groups and fermentation metabolites were observed between the IBD and control groups. However, significant negative correlations were found between CCECAI and the faecal proportion of Lactobacillus as well as between CCECAI and total SCFA concentration. Serum folate and plasma citrulline were decreased and plasma valine was increased in IBD compared to control dogs. Increased plasma free carnitine and total acylcarnitines were observed in IBD compared with control dogs, whereas short-chain acylcarnitines (butyrylcarnitine + isobutyrylcarnitine and, methylmalonylcarnitine) to free carnitine ratios decreased. Dogs with IBD had a higher 3-hydroxyisovalerylcarnitine + isovalerylcarnitine to leucine ratio compared to control dogs. Canine IBD induced a wide range of changes in metabolic profile, especially for the plasma concentrations of short-chain acylcarnitines and amino acids, which could have evolved from tissue damage and alteration in host metabolism. In

  10. A Nod to disease vectors: mitigation of pathogen sensing by arthropod saliva

    Czech Academy of Sciences Publication Activity Database

    Sakhon, O. S.; Severo, M. S.; Kotsyfakis, Michalis; Pedra, J. H. F.

    2013-01-01

    Roč. 4, OCT 2013 (2013), a308 ISSN 1664-302X Institutional support: RVO:60077344 Keywords : nod-like receptors * inflammasome * vector-borne pathogens * vector-borne diseases * arthropod saliva * salivary proteins Subject RIV: EC - Immunology Impact factor: 3.941, year: 2013

  11. Parasites and vector-borne diseases in client-owned dogs in Albania: infestation with arthropod ectoparasites.

    Science.gov (United States)

    Shukullari, Enstela; Rapti, Dhimitër; Visser, Martin; Pfister, Kurt; Rehbein, Steffen

    2017-01-01

    To establish the diversity and seasonality of ectoparasite infestation in client-owned dogs in Albania, 602 dogs visiting four small animal clinics in Tirana from March 2010 to April 2011 inclusive were examined for ectoparasites by full body search and total body comb. In addition, ear swab specimens collected from all dogs and scrapings taken from skin lesions suspicious of mite infestation were examined for parasitic mites. Overall, 93 dogs (15.4 %, 95%CI 12.6-18.6) were demonstrated to be infested, and nine species of ectoparasites were identified: Ixodes ricinus, 0.8 %; Rhipicephalus sanguineus s. l., 8.1 %; Demodex canis, 0.2 %; Sarcoptes scabiei, 0.7 %; Otodectes cynotis, 2.8 %; Ctenocephalides canis, 4.8 %; Ctenocephalides felis, 3.0 %; Pulex irritans, 0.2 %; and Trichodectes canis, 0.2 %. Single and multiple infestations with up to four species of ectoparasites concurrently were recorded in 67 (11.1 %, 95%CI 8.7-13.9) and 26 dogs (4.3 %, 95%CI 2.8-6.3), respectively. On univariate analysis, the category of breed (pure breed dogs vs. mixed-breed dogs), the dog's purpose (pet, hunting dog, working dog), the housing environment (mainly indoors/indoors with regular outside walking vs. yard plus kennel/run), the history of ectoparasiticide treatment and the season of examination were identified as significant (p < 0.05) factors predisposing dogs to various ectoparasites, while the variables dog's age, gender, the dog's habitat (city, suburban, rural) and the presence/absence of other pets were not significant predictors. Multivariate logistic regression analysis for factors associated with overall ectoparasitism revealed that dogs treated with ectoparasiticides at least once per year (odds ratio [OR] = 0.24; p < 0.001) had a significantly lower risk of infestation compared with dogs not treated against ectoparasite infestation. Dogs examined during spring, summer and autumn (OR = 7.08, 7.43 and 2.48, respectively; all p < 0.001) had a significantly higher risk of infestation than dogs examined during winter. By providing basic data on the infestation with ectoparasites in client-owned, veterinary-cared-for dogs from Albania for the first time, the results of this survey should emphasize the need of an increase of attention to ectoparasites in dogs by both veterinarians and dog owners.

  12. Global trends in the production and use of DDT for control of malaria and other vector-borne diseases

    DEFF Research Database (Denmark)

    Van Den Berg, Henk; Manuweera, Gamini; Konradsen, Flemming

    2017-01-01

    over the period 2001-2014. Results: Available data on global production of DDT showed a 32% decline over the reporting period, from 5144 to 3491 metric tons of active ingredient p.a. Similarly, global use of DDT, for control of malaria and leishmaniasis, showed a 30% decline over the period 2001...

  13. Integrated control of ticks and fleas on dogs with particular reference to the prevention of vector-borne diseases

    NARCIS (Netherlands)

    Fourie, J.J.

    2015-01-01

    Because dogs are such loved companion animals, their health and wellbeing is of great importance to their human companions. Moreover, controlling ticks and fleas on dogs is also important in respect of the zoonotic risk that some of these parasites pose to their human companions. Numerous products

  14. Parasites and vector-borne diseases in client-owned dogs in Albania. Intestinal and pulmonary endoparasite infections.

    Science.gov (United States)

    Shukullari, Enstela; Hamel, Dietmar; Rapti, Dhimitër; Pfister, Kurt; Visser, Martin; Winter, Renate; Rehbein, Steffen

    2015-12-01

    From March 2010 to April 2011 inclusive, feces from 602 client-owned dogs visiting four small animal clinics in Tirana, Albania, were examined using standard coproscopical techniques including Giardia coproantigen ELISA and immunofluorescent staining of Giardia cysts. Overall, samples of 245 dogs (40.7 %, 95 % CI 36.6-45.6) tested positive for at least one type of fecal endoparasite (protozoan and/or helminth and/or pentastomid) stage, of which 180 (29.9 %, 95 % CI 26.3-33.7) and 129 (21.9 %, 95 % CI 18.2-24.9) tested positive for protozoan or nematode endoparasites, respectively. Fecal forms of at least 14 endoparasites were identified. The most frequently identified stages were those of Giardia (26.4 %), Trichuris (9.5 %), Toxocara (8.0 %), hookworms (7.1 %), Cystoisospora ohioensis (4.3 %), and Cystoisospora canis (3 %). For the first time for dogs in Albania, fecal examination indicated the occurrence of Hammondia/Neospora-like (0.2 %), Angiostrongylus lungworm (0.3 %), capillariid (2.8 %), and Linguatula (0.2 %) infections. Single and multiple infections with up to seven parasites concurrently were found in 152 (25.2 %, 95 % CI 21.8-28.9) and 93 dogs (15.4 %, 95 % CI 12.7-18.6), respectively. On univariate analysis, the dog's age, the dog's purpose (pet, hunting dog, working dog), the dog's habitat (city, suburban, rural), and environment (mainly indoors, indoors with regular outside walking, yard, kennel/run), presence/absence of other dogs and/or cats, history of anthelmintic use, and season of examination were identified as significant (p dogs to various types of endoparasitism while the variables breed (pure breed dogs vs. mixed-breed dogs), gender, and type of food were not significant predictors. Multivariate logistic regression analysis for factors associated with overall endoparasitism revealed that dogs >1 year of age (odds ratio [OR] = 0.64), dogs dewormed at least once per year (OR = 0.35), and dogs tested during spring, summer, and autumn (OR = 0.51, 0.15, and 0.20, respectively) had a significantly lower risk compared with ≤1 year old dogs, dogs not dewormed, or dogs tested during winter. The odds of a dog to be diagnosed positive for endoparasites was 1.56 times higher for dogs living together with other pets than that for a dog without other dogs or cats.

  15. Canine Detection of the Volatilome: A Review of Implications for Pathogen and Disease Detection.

    Science.gov (United States)

    Angle, Craig; Waggoner, Lowell Paul; Ferrando, Arny; Haney, Pamela; Passler, Thomas

    2016-01-01

    The volatilome is the entire set of volatile organic compounds (VOC) produced by an organism. The accumulation of VOC inside and outside of the body reflects the unique metabolic state of an organism. Scientists are developing technologies to non-invasively detect VOC for the purposes of medical diagnosis, therapeutic monitoring, disease outbreak containment, and disease prevention. Detection dogs are proven to be a valuable real-time mobile detection technology for the detection of VOC related to explosives, narcotics, humans, and many other targets of interests. Little is known about what dogs are detecting when searching for biological targets. It is important to understand where biological VOC originates and how dogs might be able to detect biological targets. This review paper discusses the recent scientific literature involving VOC analysis and postulates potential biological targets for canine detection. Dogs have shown their ability to detect pathogen and disease-specific VOC. Future research will determine if dogs can be employed operationally in hospitals, on borders, in underserved areas, on farms, and in other operational environments to give real-time feedback on the presence of a biological target.

  16. Expression Profiling of Circulating MicroRNAs in Canine Myxomatous Mitral Valve Disease

    Directory of Open Access Journals (Sweden)

    Qinghong Li

    2015-06-01

    Full Text Available MicroRNAs (miRNAs are small non-coding RNAs that have shown promise as noninvasive biomarkers in cardiac disease. This study was undertaken to investigate the miRNA expression profile in dogs with myxomatous mitral valve disease (MMVD. 277 miRNAs were quantified using RT-qPCR from six normal dogs (American College of Veterinary Internal Medicine Stage A, six dogs with MMVD mild to moderate cardiac enlargement (ACVIM Stage B1/B2 and six dogs with MMVD and congestive heart failure (ACVIM Stage C/D. Eleven miRNAs were differentially expressed (False Discovery Rate < 0.05. Dogs in Stage B1/B2 or C/D had four upregulated miRNAs, including three cfa-let-7/cfa-miR-98 family members, while seven others were downregulated, compared to Stage A. Expression of six of the 11 miRNAs also were significantly different between dogs in Stage C/D and those in Stage B1/B2. The expression changes were greater as disease severity increased. These miRNAs may be candidates for novel biomarkers and may provide insights into genetic regulatory pathways in canine MMVD.

  17. Adeno-Associated Virus-Mediated Correction of a Canine Model of Glycogen Storage Disease Type Ia

    OpenAIRE

    Weinstein, David A.; Correia, Catherine E.; Conlon, Thomas; Specht, Andrew; Verstegen, John; Onclin-Verstegen, Karine; Campbell-Thompson, Martha; Dhaliwal, Gurmeet; Mirian, Layla; Cossette, Holly; Falk, Darin J.; Germain, Sean; Clement, Nathalie; Porvasnik, Stacy; Fiske, Laurie

    2010-01-01

    This study by the groups of Drs. Barry Byrne and Cathryn Mah at the University of Florida examines the safety and efficacy of AAV-mediated gene delivery in a canine model of glycogen storage disease type Ia (GSDIa). The authors find that intraportal delivery of AAV8 encoding glucose-6-phosphatase-α (G6Pase) followed 20 weeks later by intraportal administration of AAV1 encoding G6Pase led to significant correction of the GSDIa phenotype.

  18. Gaucher disease: Physical, kinetic and immunologic investigations of human and canine acid β-glucosidase

    International Nuclear Information System (INIS)

    Fabbro, D.E.

    1988-01-01

    Kinetic and immunologic techniques were developed to investigate the nature of the acid β-glucosidase (β-Glc) defects which results in human and canine Gaucher disease (GD). Two new affinity columns, using the potent inhibitors of β-Glc (N-alkyl-deoxynojirimycins) as affinity ligands, were synthesized and methods were developed to obtain homogeneous β-Glc from normal human placenta. Polyclonal and monoclonal (representing 14 different epitopes from 18 clones) antibodies were produced to the pure normal β-Glc. Monospecific polyclonal IgG and tritiated-bromo-conduritol B epoxide ([ 3 H]Br-CBE), a specific covalent active site directed inhibitor of β-Glc, were used to quantitate the functional catalytic sites in normal and Type 1 Ashkenazi Jewish GD (AJGD) enzyme preparations: The k cat values for several new substrates with the mutant enzymes from spleen were about 1.5-fold less than the respective normal enzyme, indicating a nearly normal catalytic capacity of the mutant enzymes. Immunoblotting studies with polyclonal or several monoclonal antibodies indicated three molecular forms of β-Glc (M r = 67,000, 62,000 to 65,000 and 58,000) in fibroblast extracts from normals and Type 1 AJGD patients. In comparison, only one form of cross-reacting immunologic material (CRIM) was detected in fibroblast extracts from Types 2 and 3 or several non-Jewish Type 1 GD patients

  19. Heterogeneity in the spread and control of infectious disease: consequences for the elimination of canine rabies

    Science.gov (United States)

    Ferguson, Elaine A.; Hampson, Katie; Cleaveland, Sarah; Consunji, Ramona; Deray, Raffy; Friar, John; Haydon, Daniel T.; Jimenez, Joji; Pancipane, Marlon; Townsend, Sunny E.

    2015-12-01

    Understanding the factors influencing vaccination campaign effectiveness is vital in designing efficient disease elimination programmes. We investigated the importance of spatial heterogeneity in vaccination coverage and human-mediated dog movements for the elimination of endemic canine rabies by mass dog vaccination in Region VI of the Philippines (Western Visayas). Household survey data was used to parameterise a spatially-explicit rabies transmission model with realistic dog movement and vaccination coverage scenarios, assuming a basic reproduction number for rabies drawn from the literature. This showed that heterogeneous vaccination reduces elimination prospects relative to homogeneous vaccination at the same overall level. Had the three vaccination campaigns completed in Region VI in 2010-2012 been homogeneous, they would have eliminated rabies with high probability. However, given the observed heterogeneity, three further campaigns may be required to achieve elimination with probability 0.95. We recommend that heterogeneity be reduced in future campaigns through targeted efforts in low coverage areas, even at the expense of reduced coverage in previously high coverage areas. Reported human-mediated dog movements did not reduce elimination probability, so expending limited resources on restricting dog movements is unnecessary in this endemic setting. Enhanced surveillance will be necessary post-elimination, however, given the reintroduction risk from long-distance dog movements.

  20. A retrospective histopathological survey on canine and feline liver diseases at the University of Tokyo between 2006 and 2012.

    Science.gov (United States)

    Hirose, Naoki; Uchida, Kazuyuki; Kanemoto, Hideyuki; Ohno, Koichi; Chambers, James K; Nakayama, Hiroyuki

    2014-07-01

    To determine the incidence of hepatic diseases in dogs and cats in Japan, a retrospective study was performed using data of 463 canine and 71 feline liver biopsies at the Veterinary Medical Center of the University of Tokyo. The most common canine hepatic disease was microvascular dysplasia (MVD) and occupied 29.4% of all diagnoses. This terminology might contain "real" MVD and primary portal vein hypoplasia, because these two conditions were difficult to be clearly distinguished histopathologically. Parenchymal and interstitial hepatitis and primary hepatic tumors accounted for 23.5% and 21.0% of the diagnoses, respectively. Parenchymal and interstitial hepatitis occupied 34.1% of non-proliferative canine hepatic diseases, while hepatocellular adenoma and carcinoma were 26.6% and 24.5% of proliferative hepatic diseases, respectively. Breed-specificity was seen in MVD for Yorkshire terrier, Papillon and Toy poodle, in hepatitis for Doberman pinscher and Labrador retriever, in cholangiohepatitis for American cocker spaniel, Miniature schnauzer and Pomeranian, in hepatocellular adenoma for Golden retriever and Shiba and in hepatocellular carcinoma for Shih Tzu. The most common feline liver disease was parenchymal and interstitial hepatitis (45.1% of all diagnoses). Among feline hepatitis, neutrophilic cholangiohepatitis (23.9%), lymphocytic cholangiohepatitis (14.1%) and chronic hepatitis (5.6%) were recorded. Adult polycystic liver disease was 5.6%. Among proliferative diseases in the feline liver (11.3% of the all), lymphoma (4.2%) and primary epithelial tumors (4.2%) including hepatocellular carcinoma, cholangiocellular adenoma and cholangiocellular carcinoma were observed. Hepatic degeneration was 14.1%, and MVD was 12.7%, respectively.

  1. High prevalence of small Babesia species in canines of Kerala, South India.

    Science.gov (United States)

    Jain, Kollannur Jose; Lakshmanan, Bindu; Syamala, Karunakaran; Praveena, Jose E; Aravindakshan, Thazhathuveetil

    2017-11-01

    Canine babesiosis is an important vector-borne hemoparasitic disease caused by Babesia canis vogeli and Babesia gibsoni , in India. The communication places on record the salient findings of the study directed to detect and characterize the pathogenic B. gibsoni isolates of Kerala state. A total of 150 dogs were examined for the presence of hemoparasites by light microscopy as well as by PCR targeting the 18S rRNA gene of B. gibsoni . Hematological parameters were also analysed. Phylogenetic tree was constructed based on Tamura kei model adopting ML method. A sensitive and specific polymerase chain reaction assay was developed with newly designed primer pair BAGI-F/BAGI-R for the amplification of 488 bp fragment of 18S rRNA gene of B. gibsoni . Out of the 150 dogs examined, molecular evidence of B. gibsoni was recorded in 47.3% animals, while light microscopy detected the infection in 26.67% cases. The phylogenetic analyses revealed that B. gibsoni , Kerala, isolate was closest and occurred together with Bareilly isolate. Anemia and thrombocytopenia were the significant hematological alterations in chronic B. gibsoni infection. A high prevalence of natural infection of B. gibsoni was detected among the study population. The affected animals showed anaemia and thrombocytopenia. Phylogenetic analysis of this pathogenic isolate from south India revealed the closest similarity with Bareilly isolates.

  2. High prevalence of small Babesia species in canines of Kerala, South India

    Directory of Open Access Journals (Sweden)

    Kollannur Jose Jain

    2017-11-01

    Full Text Available Aim: Canine babesiosis is an important vector-borne hemoparasitic disease caused by Babesia canis vogeli and Babesia gibsoni, in India. The communication places on record the salient findings of the study directed to detect and characterize the pathogenic B. gibsoni isolates of Kerala state. Materials and Methods: A total of 150 dogs were examined for the presence of hemoparasites by light microscopy as well as by PCR targeting the 18S rRNA gene of B. gibsoni. Hematological parameters were also analysed. Phylogenetic tree was constructed based on Tamura kei model adopting ML method. Results: A sensitive and specific polymerase chain reaction assay was developed with newly designed primer pair BAGI-F/ BAGI-R for the amplification of 488 bp fragment of 18S rRNA gene of B. gibsoni. Out of the 150 dogs examined, molecular evidence of B. gibsoni was recorded in 47.3% animals, while light microscopy detected the infection in 26.67% cases. The phylogenetic analyses revealed that B. gibsoni, Kerala, isolate was closest and occurred together with Bareilly isolate. Anemia and thrombocytopenia were the significant hematological alterations in chronic B. gibsoni infection. Conclusion: A high prevalence of natural infection of B. gibsoni was detected among the study population. The affected animals showed anaemia and thrombocytopenia. Phylogenetic analysis of this pathogenic isolate from south India revealed the closest similarity with Bareilly isolates.

  3. Considerations for using minocycline vs doxycycline for treatment of canine heartworm disease.

    Science.gov (United States)

    Papich, Mark G

    2017-11-09

    approximately two times more lipophilic than doxycycline, which may result in better intracellular penetration. More work is needed to document efficacy of minocycline for treating canine heartworm disease.

  4. Disease Modeling and Gene Therapy of Copper Storage Disease in Canine Hepatic Organoids

    NARCIS (Netherlands)

    Nantasanti, Sathidpak; Spee, Bart; Kruitwagen, Hedwig S.; Chen, Chen; Geijsen, Niels; Oosterhoff, Loes A.; van Wolferen, Monique E.; Pelaez, Nicolas; Fieten, Hille; Wubbolts, Richard W.; Grinwis, Guy C.; Chan, Jefferson; Huch, Meritxell; Vries, Robert R. G.; Clevers, Hans; de Bruin, Alain; Rothuizen, Jan; Penning, Louis C.; Schotanus, Baukje A.

    2015-01-01

    The recent development of 3D-liver stem cell cultures (hepatic organoids) opens up new avenues for gene and/or stem cell therapy to treat liver disease. To test safety and efficacy, a relevant large animal model is essential but not yet established. Because of its shared pathologies and disease

  5. Assessing bat droppings and predatory bird pellets for vector-borne bacteria: molecular evidence of bat-associated Neorickettsia sp. in Europe.

    Science.gov (United States)

    Hornok, Sándor; Szőke, Krisztina; Estók, Péter; Krawczyk, Aleksandra; Haarsma, Anne-Jifke; Kováts, Dávid; Boldogh, Sándor A; Morandini, Pál; Szekeres, Sándor; Takács, Nóra; Kontschán, Jenő; Meli, Marina L; Fernández de Mera, Isabel G; de la Fuente, José; Gyuranecz, Miklós; Sulyok, Kinga M; Weibel, Beatrice; Gönczi, Enikő; de Bruin, Arnout; Sprong, Hein; Hofmann-Lehmann, Regina

    2018-02-28

    In Europe, several species of bats, owls and kestrels exemplify highly urbanised, flying vertebrates, which may get close to humans or domestic animals. Bat droppings and bird pellets may have epidemiological, as well as diagnostic significance from the point of view of pathogens. In this work 221 bat faecal and 118 bird pellet samples were screened for a broad range of vector-borne bacteria using PCR-based methods. Rickettsia DNA was detected in 13 bat faecal DNA extracts, including the sequence of a rickettsial insect endosymbiont, a novel Rickettsia genotype and Rickettsia helvetica. Faecal samples of the pond bat (Myotis dasycneme) were positive for a Neorickettsia sp. and for haemoplasmas of the haemofelis group. In addition, two bird pellets (collected from a Long-eared Owl, Asio otus, and from a Common Kestrel, Falco tinnunculus) contained the DNA of a Rickettsia sp. and Anaplasma phagocytophilum, respectively. In both of these bird pellets the bones of Microtus arvalis were identified. All samples were negative for Borrelia burgdorferi s.l., Francisella tularensis, Coxiella burnetii and Chlamydiales. In conclusion, bats were shown to pass rickettsia and haemoplasma DNA in their faeces. Molecular evidence is provided for the presence of Neorickettsia sp. in bat faeces in Europe. In the evaluated regions bat faeces and owl/kestrel pellets do not appear to pose epidemiological risk from the point of view of F. tularensis, C. burnetii and Chlamydiales. Testing of bird pellets may provide an alternative approach to trapping for assessing the local occurrence of vector-borne bacteria in small mammals.

  6. 77 FR 20822 - Disease, Disability, and Injury Prevention and Control Special Emphasis Panel (SEP): Initial Review

    Science.gov (United States)

    2012-04-06

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Centers for Disease Control and Prevention Disease, Disability, and Injury Prevention and Control Special Emphasis Panel (SEP): Initial Review The meeting announced below concerns Detecting Emerging Vector- Borne Zoonotic Pathogens in Indonesia, Funding...

  7. 77 FR 12844 - Disease, Disability, and Injury Prevention and Control Special Emphasis Panel (SEP): Initial Review

    Science.gov (United States)

    2012-03-02

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Centers for Disease Control and Prevention Disease, Disability, and Injury Prevention and Control Special Emphasis Panel (SEP): Initial Review The meeting announced below concerns Detecting Emerging Vector- Borne Zoonotic Pathogens in Indonesia, Funding...

  8. Transcutaneous glomerular filtration rate measurement in a canine animal model of chronic kidney disease.

    Science.gov (United States)

    Mondritzki, Thomas; Steinbach, Sarah M L; Boehme, Philip; Hoffmann, Jessica; Kullmann, Maximilian; Schock-Kusch, Daniel; Vogel, Julia; Kolkhof, Peter; Sandner, Peter; Bischoff, Erwin; Hüser, Jörg; Dinh, Wilfried; Truebel, Hubert

    Quantitative assessment of renal function by measurement of glomerular filtration rate (GFR) is an important part of safety and efficacy evaluation in preclinical drug development. Existing methods are often time consuming, imprecise and associated with animal burden. Here we describe the comparison between GFR determinations with sinistrin (PS-GFR) and fluorescence-labelled sinistrin-application and its transcutaneous detection (TD-GFR) in a large animal model of chronic kidney disease (CKD). TD-GFR measurements compared to a standard method using i.v. sinistrin were performed in a canine model. Animals were treated with one-sided renal wrapping (RW) followed by renal artery occlusion (RO). Biomarker and remote hemodynamic measurements were performed. Plasma sinistrin in comparison to transcutaneous derived GFR data were determined during healthy conditions, after RW and RW+RO. RW alone did not led to any significant changes in renal function, neither with PS-GFR nor TD-GFR. Additional RO showed a rise in blood pressure (+68.0mmHg), plasma urea (+28.8mmol/l), creatinine (+224,4μmol/l) and symmetric dimethylarginine (SDMA™; +12.6μg/dl). Plasma sinistrin derived data confirmed the expected drop (-44.7%, p<0.0001) in GFR. The calculated transcutaneous determined Fluorescein Isothiocyanate (FITC)-sinistrin GFR showed no differences to plasma sinistrin GFR at all times. Both methods were equaly sensitive to diagnose renal dysfunction in the affected animals. Renal function assessment using TD-GFR is a valid method to improve preclinical drug discovery and development. Furthermore, TD-GFR method offers advantages in terms of reduced need for blood sampling and thus decreasing animal burden compared to standard procedures. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Canine distemper virus from diseased large felids: Biological properties and phylogenetic relationships.

    NARCIS (Netherlands)

    T.C. Harder (Timm); M.J.H. Kenter (Marcel); H. Vos; C.H.J. Siebelink (Kees); W. Huisman (Willem); C. Örvell; T. Barrett (Thomas); M.J.G. Appel (Max); A.D.M.E. Osterhaus (Albert); G. van Amerongen (Geert)

    1996-01-01

    textabstractSpecific pathogen free (SPF) domestic cats were inoculated with tissue homogenate obtained from a Chinese leopard (Panthera pardus japonensis) that had died in a North American zoo from a natural infection with canine distemper virus (CDV). The cats developed a transient cell-associated

  10. Adeno-Associated Virus-Mediated Correction of a Canine Model of Glycogen Storage Disease Type Ia

    Science.gov (United States)

    Weinstein, David A.; Correia, Catherine E.; Conlon, Thomas; Specht, Andrew; Verstegen, John; Onclin-Verstegen, Karine; Campbell-Thompson, Martha; Dhaliwal, Gurmeet; Mirian, Layla; Cossette, Holly; Falk, Darin J.; Germain, Sean; Clement, Nathalie; Porvasnik, Stacy; Fiske, Laurie; Struck, Maggie; Ramirez, Harvey E.; Jordan, Juan; Andrutis, Karl; Chou, Janice Y.; Byrne, Barry J.

    2010-01-01

    Abstract Glycogen storage disease type Ia (GSDIa; von Gierke disease; MIM 232200) is caused by a deficiency in glucose-6-phosphatase-α. Patients with GSDIa are unable to maintain glucose homeostasis and suffer from severe hypoglycemia, hepatomegaly, hyperlipidemia, hyperuricemia, and lactic acidosis. The canine model of GSDIa is naturally occurring and recapitulates almost all aspects of the human form of disease. We investigated the potential of recombinant adeno-associated virus (rAAV) vector-based therapy to treat the canine model of GSDIa. After delivery of a therapeutic rAAV2/8 vector to a 1-day-old GSDIa dog, improvement was noted as early as 2 weeks posttreatment. Correction was transient, however, and by 2 months posttreatment the rAAV2/8-treated dog could no longer sustain normal blood glucose levels after 1 hr of fasting. The same animal was then dosed with a therapeutic rAAV2/1 vector delivered via the portal vein. Two months after rAAV2/1 dosing, both blood glucose and lactate levels were normal at 4 hr postfasting. With more prolonged fasting, the dog still maintained near-normal glucose concentrations, but lactate levels were elevated by 9 hr, indicating that partial correction was achieved. Dietary glucose supplementation was discontinued starting 1 month after rAAV2/1 delivery and the dog continues to thrive with minimal laboratory abnormalities at 23 months of age (18 months after rAAV2/1 treatment). These results demonstrate that delivery of rAAV vectors can mediate significant correction of the GSDIa phenotype and that gene transfer may be a promising alternative therapy for this disease and other genetic diseases of the liver. PMID:20163245

  11. Recombinant Newcastle disease viral vector expressing hemagglutinin or fusion of canine distemper virus is safe and immunogenic in minks.

    Science.gov (United States)

    Ge, Jinying; Wang, Xijun; Tian, Meijie; Gao, Yuwei; Wen, Zhiyuan; Yu, Guimei; Zhou, Weiwei; Zu, Shulong; Bu, Zhigao

    2015-05-15

    Canine Distemper Virus (CDV) infects many carnivores and cause several high-mortality disease outbreaks. The current CDV live vaccine cannot be safely used in some exotic species, such as mink and ferret. Here, we generated recombinant lentogenic Newcastle disease virus (NDV) LaSota expressing either envelope glycoproyein, heamagglutinine (H) or fusion protein (F), named as rLa-CDVH and rLa-CDVF, respectively. The feasibility of these recombinant NDVs to serve as live virus-vectored CD vaccine was evaluated in minks. rLa-CDVH induced significant neutralization antibodies (NA) to CDV and provided solid protection against virulent CDV challenge. On the contrast, rLa-CDVF induced much lower NA to CDV and fail to protected mink from virulent CDV challenge. Results suggest that recombinant NDV expressing CDV H is safe and efficient candidate vaccine against CDV in mink, and maybe other host species. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Genome Sequences of Three Vaccine Strains and Two Wild-Type Canine Distemper Virus Strains from a Recent Disease Outbreak in South Africa.

    Science.gov (United States)

    Loots, Angelika K; Du Plessis, Morné; Dalton, Desiré Lee; Mitchell, Emily; Venter, Estelle H

    2017-07-06

    Canine distemper virus causes global multihost infectious disease. This report details complete genome sequences of three vaccine and two new wild-type strains. The wild-type strains belong to the South African lineage, and all three vaccine strains to the America 1 lineage. This constitutes the first genomic sequences of this virus from South Africa. Copyright © 2017 Loots et al.

  13. Improving vector-borne pathogen surveillance: A laboratory-based study exploring the potential to detect dengue virus and malaria parasites in mosquito saliva.

    Science.gov (United States)

    Melanson, Vanessa R; Jochim, Ryan; Yarnell, Michael; Ferlez, Karen Bingham; Shashikumar, Soumya; Richardson, Jason H

    2017-01-01

    Vector-borne pathogen surveillance programmes typically rely on the collection of large numbers of potential vectors followed by screening protocols focused on detecting pathogens in the arthropods. These processes are laborious, time consuming, expensive, and require screening of large numbers of samples. To streamline the surveillance process, increase sample throughput, and improve cost-effectiveness, a method to detect dengue virus and malaria parasites (Plasmodium falciparum) by leveraging the sugar-feeding behaviour of mosquitoes and their habit of expectorating infectious agents in their saliva during feeding was investigated in this study. Dengue virus 2 (DENV-2) infected female Aedes aegypti mosquitoes and P. falciparum infected female Anopheles stephensi mosquitoes were allowed to feed on honey coated Flinders Technical Associates -FTA® cards dyed with blue food colouring. The feeding resulted in deposition of saliva containing either DENV-2 particles or P. falciparum sporozoites onto the FTA card. Nucleic acid was extracted from each card and the appropriate real-time PCR (qPCR) assay was run to detect the pathogen of interest. As little as one plaque forming unit (PFU) of DENV-2 and as few as 60 P. falciparum parasites deposited on FTA cards from infected mosquitoes were detected via qPCR. Hence, their use to collect mosquito saliva for pathogen detection is a relevant technique for vector surveillance. This study provides laboratory confirmation that FTA cards can be used to capture and stabilize expectorated DENV-2 particles and P. falciparum sporozoites from infectious, sugar-feeding mosquitoes in very low numbers. Thus, the FTA card-based mosquito saliva capture method offers promise to overcome current limitations and revolutionize traditional mosquito-based pathogen surveillance programmes. Field testing and further method development are required to optimize this strategy.

  14. Genetics of Human and Canine Dilated Cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Siobhan Simpson

    2015-01-01

    Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

  15. Genetics of Human and Canine Dilated Cardiomyopathy.

    Science.gov (United States)

    Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S

    2015-01-01

    Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

  16. Natural canine infection by Leishmania infantum and Leishmania amazonensis and their implications for disease control

    Directory of Open Access Journals (Sweden)

    Letícia da Cruz Sanches

    Full Text Available Abstract Leishmaniasis is a major public health problem worldwide. Because Leishmania can adapt to new hosts or vectors, knowledge concerning the current etiological agent in dogs is important in endemic areas. This study aimed to identify the Leishmania species detected in 103 samples of peripheral blood from dogs that were naturally infected with these protozoa. The diagnosis of leishmaniasis was determined through parasitological examination, the indirect enzyme-linked immunosorbent assay (ELISA and the polymerase chain reaction (PCR. The Leishmania species were identified by means of PCR-restriction fragment length polymorphism (PCR-RFLP. The samples were subjected to PCR using oligonucleotide primers that amplify the intergenic region ITS1 of the rRNA gene in order to identify the species. The amplified DNA was digested using the restriction enzyme HaeIII. A restriction profile identical to L. amazonensis was shown in 77/103 samples and the profile was similar to L. infantum in 17/103. However, a mixed profile was shown in 9/103 samples, which impeded species identification. In conclusion, the infection in these dogs was predominantly due to L. amazonensis, thus indicating that diagnosing of cases of canine leishmaniasis needs to be reexamined, since the causative agent identified is not restricted to L. infantum.

  17. Canine cutaneous leishmaniasis caused by neotropical Leishmania infantum despite of systemic disease: A case report.

    Science.gov (United States)

    Cavalcanti, Amanda; Lobo, Rogério; Cupolillo, Elisa; Bustamante, Fábio; Porrozzi, Renato

    2012-12-01

    Visceral leishmaniasis is an anthropozoonosis caused by a protozoan Leishmania infantum (syn. Leishmania chagasi). Here, we report a typical case of canine cutaneous leishmaniasis due to L. infantum infection without any other systemic symptom in one dog in the city of Rio de Janeiro, Brazil. A mongrel female dog was admitted in a veterinary clinic with reports of chronic wounds in the body. Physical examination revealed erosive lesions in the limbs, nasal ulcers, presence of ectoparasites and seborrheic dermatitis. Blood samples and fragments of healthy and injured skin were collected. The complete hemogram revealed aregenerative normocytic normochromic anemia and erythrocyte rouleaux, and biochemical analysis revealed normal renal and hepatic functions. Cytology of the muzzle and skin lesions suggested pyogranulomatous inflammatory process. The histopathology of a skin fragment was performed and revealed suspicion of protozoa accompanied by necrotizing dermatitis. The diagnosis of leishmaniasis was accomplished by positive serology, isolation of Leishmania from the skin lesion, and also by molecular test (PCR targeting the conserved region of Leishmania kDNA). Culture was positive for damaged skin samples. PCR targeting a fragment of Leishmania hsp70 gene was performed employing DNA extracted from damaged skin. RFLP of the amplified hsp70 fragment identified the parasite as L. infantum, instead of Leishmania braziliensis, the main agent of cutaneous leishmaniasis in Rio de Janeiro. Characterization of isolated promastigotes by five different enzymatic systems confirmed the species identification of the etiological agent. Serology was positive by ELISA and rapid test. This case warns to the suspicion of viscerotropic Leishmania in cases of chronic skin lesions and brings the discussion of the mechanisms involved in the parasite tissue tropism. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  18. Chagas Disease: No Longer Exotic

    Centers for Disease Control (CDC) Podcasts

    2008-04-03

    This podcast is designed to inform health care providers about Chagas disease, diagnosis, and treatment and to assist in identifying infected patients.  Created: 4/3/2008 by National Center for Zoonotic, Vector-Borne, and Enteric Diseases (NCZVED).   Date Released: 4/8/2008.

  19. Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1 region of small form of canine Babesia spp. from India.

    Science.gov (United States)

    Mandal, M; Banerjee, P S; Garg, Rajat; Ram, Hira; Kundu, K; Kumar, Saroj; Kumar, G V P P S Ravi

    2014-10-01

    Canine babesiosis is a vector borne disease caused by intra-erythrocytic apicomplexan parasites Babesia canis (large form) and Babesia gibsoni (small form), throughout the globe. Apart from few sporadic reports on the occurrence of B. gibsoni infection in dogs, no attempt has been made to characterize Babesia spp. of dogs in India. Fifteen canine blood samples, positive for small form of Babesia, collected from northern to eastern parts of India, were used for amplification of 18S rRNA gene (∼1665bp) of Babesia sp. and partial ITS1 region (∼254bp) of B. gibsoni Asian genotype. Cloning and sequencing of the amplified products of each sample was performed separately. Based on sequences and phylogenetic analysis of 18S rRNA and ITS1 sequences, 13 were considered to be B. gibsoni. These thirteen isolates shared high sequence identity with each other and with B. gibsoni Asian genotype. The other two isolates could not be assigned to any particular species because of the difference(s) in 18S rRNA sequence with B. gibsoni and closer identity with Babesiaoccultans and Babesiaorientalis. In the phylogenetic tree, all the isolates of B. gibsoni Asian genotype formed a separate major clade named as Babesia spp. sensu stricto clade with high bootstrap support. The two unnamed Babesia sp. (Malbazar and Ludhiana isolates) clustered close together with B. orientalis, Babesia sp. (Kashi 1 isolate) and B. occultans of bovines. It can be inferred from this study that 18S rRNA gene and ITS1 region are highly conserved among 13 B. gibsoni isolates from India. It is the maiden attempt of genetic characterization by sequencing of 18S rRNA gene and ITS1 region of B. gibsoni from India and is also the first record on the occurrence of an unknown Babesia sp. of dogs from south and south-east Asia. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Epidemiology and clinical presentation of canine distemper disease in dogs and ferrets in Australia, 2006-2014.

    Science.gov (United States)

    Wyllie, S E; Kelman, M; Ward, M P

    2016-07-01

    To determine the status and distribution of distemper in Australian dogs and ferrets. Retrospective case series. Cases were identified via a national voluntary disease reporting system, veterinarian groups and a national laboratory database. The geographic distribution, seasonal distribution, signalment and clinical presentation of cases were described using maps and frequency distributions. A total of 48 individually affected dogs and ferrets in 27 case groups were identified, including eight confirmed case groups (> one individual). Confirmed cases were more common in summer and on the central coast of New South Wales and southern Victoria, and occurred exclusively in young, unvaccinated dogs. For dogs there was no obvious sex predilection. A mortality rate of 100% in ferrets and up to 77% in dogs was estimated. Neurological, gastrointestinal and respiratory were the most commonly reported systems affected in dogs and ferrets. There was no evidence that any large, unreported outbreaks occurred during the study period. Continuation of vaccination against canine distemper virus is justified within Australia, particularly for younger dogs. Veterinarians should continue to consider distemper in their differential diagnosis of cases with neurological, gastrointestinal and respiratory presentation. © 2016 Australian Veterinary Association.

  1. Experimental Model of Gene Transfection in Healthy Canine Myocardium: Perspectives of Gene Therapy for Ischemic Heart Disease

    Directory of Open Access Journals (Sweden)

    Renato A. K. Kalil

    2002-09-01

    Full Text Available OBJECTIVE: To assess the transfection of the gene that encodes green fluorescent protein (GFP through direct intramyocardial injection. METHODS: The pREGFP plasmid vector was used. The EGFP gene was inserted downstream from the constitutive promoter of the Rous sarcoma virus. Five male dogs were used (mean weight 13.5 kg, in which 0.5 mL of saline solution (n=1 or 0.5 mL of plasmid solution containing 0.5 µg of pREGFP/dog (n=4 were injected into the myocardium of the left ventricular lateral wall. The dogs were euthanized 1 week later, and cardiac biopsies were obtained. RESULTS: Fluorescence microscopy showed differences between the cells transfected and not transfected with pREGFP plasmid. Mild fluorescence was observed in the cardiac fibers that received saline solution; however, the myocardial cells transfected with pREGFP had overt EGFP expression. CONCLUSION: Transfection with the EGFP gene in healthy canine myocardium was effective. The reproduction of this efficacy using vascular endothelial growth factor (VEGF instead of EGFP aims at developing gene therapy for ischemic heart disease.

  2. Canine gastritis.

    Science.gov (United States)

    Webb, Craig; Twedt, David C

    2003-09-01

    Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.

  3. Carrion’s disease: an eradicable illness?

    OpenAIRE

    Gomes, Cláudia; Pons, Maria J.; Del Valle Mendoza, Juana Mercedes; Ruiz, Joaquim

    2016-01-01

    Carrion's disease is a neglected tropical disease caused by Bartonella bacilliformis, a vector-borne pathogen restricted to the Andean valleys of Peru, Ecuador and Colombia. Carrion's disease is a biphasic illness; in the acute phase the case-fatality rate can be as high as 88 %, related to high parasitemia, arriving to almost all erythrocytes, and secondary bacterial infections c...

  4. New therapeutic strategies for canine liver disease; Growth factors and liver progenitor cells

    NARCIS (Netherlands)

    Arends, B.

    2008-01-01

    The liver has the unique capacity to regulate its mass after loss of functional liver cells due to liver disease, injury, and/or toxicity. Unfortunately, in the course of chronic liver disease this meticulously regulated regeneration process is imbalanced resulting in a decreased regenerative

  5. Does canine inflammatory bowel disease influence gut microbial profile and host metabolism?

    NARCIS (Netherlands)

    Xu, Jia; Verbrugghe, Adronie; Lourenço, Marta; Janssens, Geert P.J.; Liu, Daisy J.X.; Wiele, Van de Tom; Eeckhaut, Venessa; Immerseel, Van Filip; Maele, Van de Isabel; Niu, Yufeng; Bosch, Guido; Junius, Greet; Wuyts, Brigitte; Hesta, Myriam

    2016-01-01

    Background: Inflammatory bowel disease (IBD) refers to a diverse group of chronic gastrointestinal diseases, and gut microbial dysbiosis has been proposed as a modulating factor in its pathogenesis. Several studies have investigated the gut microbial ecology of dogs with IBD but it is yet unclear

  6. Demographic characteristics and infectious diseases of a population of American black bears in Humboldt County, California.

    Science.gov (United States)

    Stephenson, Nicole; Higley, J Mark; Sajecki, Jaime L; Chomel, Bruno B; Brown, Richard N; Foley, Janet E

    2015-02-01

    American black bears (Ursus americanus) are common, widely distributed, and broad-ranging omnivorous mammals in northern California forests. Bears may be susceptible to pathogens infecting both domestic animals and humans. Monitoring bear populations, particularly in changing ecosystems, is important to understanding ecological features that could affect bear population health and influence the likelihood that bears may cause adverse impacts on humans. In all, 321 bears were captured between May, 2001, and October, 2003, and blood samples were collected and tested for multiple zoonotic and vector-borne diseases. We found a PCR prevalence of 10% for Anaplasma phagocytophilum, and a seroprevalence of 28% for Toxoplasma gondii, 26% for Borrelia burgdorferi, 26% for A. phagocytophilum, 8% for Trichinella spiralis, 8% for Francisella tularensis and 1% for Yersinia pestis. In addition, we tested bears for pathogens of domestic dogs and found a seroprevalence of 15% for canine distemper virus and 0.6% for canine parvovirus. Our findings show that black bears can become infected with pathogens that are an important public health concern, as well as pathogens that can affect both domestic animals and other wildlife species.

  7. Canine parvovirus: current perspective.

    Science.gov (United States)

    Nandi, S; Kumar, Manoj

    2010-06-01

    Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.

  8. Economics of vector-borne diseases prevention: The case of the Tiger Mosquito control and Chikungunya and Dengue prevention plan in the Emilia-Romagna region (Northern Italy)

    OpenAIRE

    Rivas Morales, Stefano

    2016-01-01

    Aedes albopictus is considered one of the most invasive mosquito species in the world. It has proved capacity for local transmission of Chikungunya and Dengue within Europe. This research evaluated public costs related to the implementation of the plan for Ae. albopictus control and Chikungunya and Dengue prevention set up in Emilia-Romagna region (Northern Italy), where a Chikungunya epidemic outbreak occurred in 2007, with 217 confirmed cases. The management plan started in 2008 by involvin...

  9. Sociocultural factors influencing control and prevention of vector-borne diseases: The case of zika in Santa Marta (Colombia, 2015-2016.

    Directory of Open Access Journals (Sweden)

    Astrid Lorena Perafán Ledezma

    2017-03-01

    Full Text Available Durante el año 2016, el grupo de Investigación en Diversidad Humana (IDHUM de la Universidad del Magdalena inició un proceso de investigación sobre conocimientos, percepciones y prácticas en torno al Zika y su vector en la ciudad de Santa Marta. Dado lo relevante del tema para la salud pública, consideramos pertinente comunicar a través de este medio algunos de nuestros hallazgos antes de terminar la investigación y que esta se publique en su totalidad.

  10. Unit costs for house spraying and bednet impregnation with residual insecticides in Colombia: a management tool for the control of vector-borne disease.

    Science.gov (United States)

    Kroeger, A; Ayala, C; Medina Lara, A

    2002-06-01

    A study of unit costs and cost components of two malaria-control strategies (house spraying and bednet impregnation with residual insecticides) was undertaken in 11 malaria-endemic states (departamentos) of Colombia, using data provided by control staff on self-administered questionnaires. The accuracy of the data was verified by personal visits, telephone conversations and complementary information from 10 other states. Allthe financial-cost components of the malaria-control operations carried out in the previous 6 months and the results of the control operations themselves (including the numbers of houses sprayed and numbers of bednets impregnated/day) were recorded. The information was stratified according to whether the target communities were 'near' or 'far away' from an operational base, the far-away communities being those that needed overnight stays by the control staff. The main variables analysed were unit costs/house treated, and annual cost/person protected. The results show that house spraying was generally more expensive for the health services than bednet impregnation. This is particularly the case in 'nearby' communities, where most of those at-risk live. In such communities, spraying one house was 7.2 times more expensive than impregnating one bednet. Even if only those sleeping under an impregnated net were assumed to be protected, the unit costs/person protected in a 'nearby' community were twice as high for house spraying than for bednet impregnation. In 'nearby' communities, where technicians could return to the operational base each evening, insecticides made up 80% of the total spraying costs and 42% of the costs of bednet impregnation. In 'far-away' communities, however, salaries and 'per diems' were the most important cost components, representing, respectively, 23% and 22% of the costs of spraying, and 34% plus 27% of the costs of impregnation. Insecticide wastage and non-use of discounts on insecticide prices (available through the national Ministry of Health) increased the overall costs considerably. The multiple uses of these cost calculations for district health managers are presented.

  11. Status of pesticide management in the practice of vector control: a global survey in countries at risk of malaria or other major vector-borne diseases

    NARCIS (Netherlands)

    Berg, van den H.; Hii, J.; Soares, A.; Mnzava, A.; Ameneshewa, B.; Dash, A.P.; Ejov, M.; Tan, S.H.; Matthews, G.; Yadav, R.S.; Zaim, M.

    2011-01-01

    Background: It is critical that vector control pesticides are used for their acceptable purpose without causing adverse effects on health and the environment. This paper provides a global overview of the current status of pesticides management in the practice of vector control. Methods: A

  12. Why Did Zika Not Explode in Cuba? The Role of Active Community Participation to Sustain Control of Vector-Borne Diseases.

    Science.gov (United States)

    Castro, Marta; Pérez, Dennis; Guzman, Maria G; Barrington, Clare

    2017-08-01

    As the global public health community develops strategies for sustainable Zika prevention and control, assessment of the Cuban response to Zika provides critical lessons learned. Cuba's early and successful response to Zika, grounded in the country's long-standing dengue prevention and control program, serves as a model of rapid mobilization of intersectoral efforts. Sustaining this response requires applying the evidence generated within the Cuban dengue program that active community participation improves outcomes and is sustainable and cost-effective. There is also a need for implementation science efforts to assess the transferability of lessons learned from Zika prevention and control to other pathogens and from one context to another in addition to how to take these efforts to scale.

  13. Spatial Analysis of West Nile Virus: Predictive Risk Modeling of a Vector-borne Infectious Disease in Illinois by Means of NASA Earth Observation Systems

    Science.gov (United States)

    Renneboog, Nathan; Gathings, David; Hemmings, Sarah; Makasa, Emmanuel; Omer, Wigdan; Tipre, Meghan; Wright, Catherine; McAllister, Marilyn; Luvall, Jeffrey C.

    2009-01-01

    West Nile Virus is a mosquito-borne virus of the family Flaviviridae. It infects birds and various mammals, including humans, and can cause encephalitis that may prove fatal, notably among vulnerable populations. Since its identification in New York City in 1999, WNV has become established in a broad range of ecological settings throughout North America, infecting more than 25,300 people and killing 1133 as of 2008 (CDC,2009). WNV is transmitted by mosquitoes that feed on infected birds. As a result, the degree of human infection depends on local ecology and human exposure. This study hypothesizes that remote sensing and GIS can be used to analyze environmental determinants of WNV transmission, such as climate, elevation, land cover, and vegetation densities, to map areas of WNV risk for surveillance and intervention.

  14. Does canine inflammatory bowel disease influence gut microbial profile and host metabolism?

    OpenAIRE

    Xu, Jia; Verbrugghe, Adronie; Louren?o, Marta; Janssens, Geert P. J.; Liu, Daisy J. X.; Van de Wiele, Tom; Eeckhaut, Venessa; Van Immerseel, Filip; Van de Maele, Isabel; Niu, Yufeng; Bosch, Guido; Junius, Greet; Wuyts, Brigitte; Hesta, Myriam

    2016-01-01

    Background Inflammatory bowel disease (IBD) refers to a diverse group of chronic gastrointestinal diseases, and gut microbial dysbiosis has been proposed as a modulating factor in its pathogenesis. Several studies have investigated the gut microbial ecology of dogs with IBD but it is yet unclear if this microbial profile can alter the nutrient metabolism of the host. The aim of the present study was to characterize the faecal bacterial profile and functionality as well as to determine host me...

  15. American Canine Hepatozoonosis

    Science.gov (United States)

    Ewing, S. A.; Panciera, R. J.

    2003-01-01

    American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294

  16. Sequencing of emerging canine distemper virus strain reveals new distinct genetic lineage in the United States associated with disease in wildlife and domestic canine populations.

    Science.gov (United States)

    Riley, Matthew C; Wilkes, Rebecca P

    2015-12-18

    Recent outbreaks of canine distemper have prompted examination of strains from clinical samples submitted to the University of Tennessee College of Veterinary Medicine (UTCVM) Clinical Virology Lab. We previously described a new strain of CDV that significantly diverged from all genotypes reported to date including America 2, the genotype proposed to be the main lineage currently circulating in the US. The aim of this study was to determine when this new strain appeared and how widespread it is in animal populations, given that it has also been detected in fully vaccinated adult dogs. Additionally, we sequenced complete viral genomes to characterize the strain and determine if variation is confined to known variable regions of the genome or if the changes are also present in more conserved regions. Archived clinical samples were genotyped using real-time RT-PCR amplification and sequencing. The genomes of two unrelated viruses from a dog and fox each from a different state were sequenced and aligned with previously published genomes. Phylogenetic analysis was performed using coding, non-coding and genome-length sequences. Virus neutralization assays were used to evaluate potential antigenic differences between this strain and a vaccine strain and mixed ANOVA test was used to compare the titers. Genotyping revealed this strain first appeared in 2011 and was detected in dogs from multiple states in the Southeast region of the United States. It was the main strain detected among the clinical samples that were typed from 2011-2013, including wildlife submissions. Genome sequencing demonstrated that it is highly conserved within a new lineage and preliminary serologic testing showed significant differences in neutralizing antibody titers between this strain and the strain commonly used in vaccines. This new strain represents an emerging CDV in domestic dogs in the US, may be associated with a stable reservoir in the wildlife population, and could facilitate vaccine

  17. Use of serologic tests to predict resistance to Canine distemper virus-induced disease in vaccinated dogs.

    Science.gov (United States)

    Jensen, Wayne A; Totten, Janet S; Lappin, Michael R; Schultz, Ronald D

    2015-09-01

    The objective of the current study was to determine whether detection of Canine distemper virus (CDV)-specific serum antibodies correlates with resistance to challenge with virulent virus. Virus neutralization (VN) assay results were compared with resistance to viral challenge in 2 unvaccinated Beagle puppies, 9 unvaccinated Beagle dogs (4.4-7.2 years of age), and 9 vaccinated Beagle dogs (3.7-4.7 years of age). Eight of 9 (89%) unvaccinated adult dogs exhibited clinical signs after virus challenge, and 1 (13%) dog died. As compared to adult dogs, the 2 unvaccinated puppies developed more severe clinical signs and either died or were euthanized after challenge. In contrast, no clinical signs were detected after challenge of the 9 adult vaccinated dogs with post-vaccination intervals of up to 4.4 years. In vaccinated dogs, the positive and negative predictive values of VN assay results for resistance to challenge were 100% and 0%, respectively. Results indicate that dogs vaccinated with modified live CDV can be protected from challenge for ≤4.4 years postvaccination and that detection of virus-specific antibodies is predictive of whether dogs are resistant to challenge with virulent virus. Results also indicate that CDV infection in unvaccinated dogs results in age-dependent morbidity and mortality. Knowledge of age-dependent morbidity and mortality, duration of vaccine-induced immunity, and the positive and negative predictive values of detection of virus-specific serum antibodies are useful in development of rational booster vaccination intervals for the prevention of CDV-mediated disease in adult dogs. © 2015 The Author(s).

  18. What Teachers Need to Know about Lyme Disease

    Science.gov (United States)

    Cook, Lysandra

    2009-01-01

    Although widely misunderstood, Lyme disease is the most prevalent vector borne disease in the United States. Children are the most at-risk group for Lyme disease, which can impact every system in the body. It can produce the musculo-skeletal, neurologic, psychiatric, opthalmologic, and cardiac symptoms. The symptoms of Lyme disease can have a…

  19. Characterization of a canine model of glycogen storage disease type IIIa

    Directory of Open Access Journals (Sweden)

    Haiqing Yi

    2012-11-01

    Glycogen storage disease type IIIa (GSD IIIa is an autosomal recessive disease caused by deficiency of glycogen debranching enzyme (GDE in liver and muscle. The disorder is clinically heterogeneous and progressive, and there is no effective treatment. Previously, a naturally occurring dog model for this condition was identified in curly-coated retrievers (CCR. The affected dogs carry a frame-shift mutation in the GDE gene and have no detectable GDE activity in liver and muscle. We characterized in detail the disease expression and progression in eight dogs from age 2 to 16 months. Monthly blood biochemistry revealed elevated and gradually increasing serum alanine transaminase (ALT, aspartate transaminase (AST and alkaline phosphatase (ALP activities; serum creatine phosphokinase (CPK activity exceeded normal range after 12 months. Analysis of tissue biopsy specimens at 4, 12 and 16 months revealed abnormally high glycogen contents in liver and muscle of all dogs. Fasting liver glycogen content increased from 4 months to 12 months, but dropped at 16 months possibly caused by extended fibrosis; muscle glycogen content continually increased with age. Light microscopy revealed significant glycogen accumulation in hepatocytes at all ages. Liver histology showed progressive, age-related fibrosis. In muscle, scattered cytoplasmic glycogen deposits were present in most cells at 4 months, but large, lake-like accumulation developed by 12 and 16 months. Disruption of the contractile apparatus and fraying of myofibrils was observed in muscle at 12 and 16 months by electron microscopy. In conclusion, the CCR dogs are an accurate model of GSD IIIa that will improve our understanding of the disease progression and allow opportunities to investigate treatment interventions.

  20. The owner-animal-environment triad in the treatment of canine periodontal disease.

    Science.gov (United States)

    Hale, Fraser A

    2003-06-01

    In a perfect world, all veterinarians and veterinary dental technicians would understand periodontal disease as well as the dental specialist. They would all be able to recognize the early signs of periodontal disease and recommend treatment to prevent its progression. The owners would have the financial resources, time, and desire to maintain their pet's oral health. The dogs would all be calm and compliant with home care and have no particular anesthetic risks. Unfortunately, this is not a perfect world. Some veterinarians do not understand periodontal disease any better that I understand cosmic string theory. Some owners have limited financial resources and are not particularly committed to their pet's oral health. Some animals will not tolerate any type or manner of home care. Given that animals, their mouths, and their owners come in an infinite variety of shapes and sizes (figuratively and literally), how can we talk about the treatment of periodontal disease as if it is a single condition with a single treatment, or even only a few treatment options? Each owner, animal, and its environment must be assessed on an individual basis to develop a treatment plan that is reasonable and attainable based on the unique circumstances of each case. So, what should be the goal when treating periodontal disease? Is it the preservation of all teeth at all costs? Is it the preservation of important teeth if the costs can be kept reasonable? I would suggest that the overriding goal of periodontal treatment should be the elimination and prevention of oral infection and oral pain. In the domestic environment, dogs have no real need to defend territory. They have no need to prehend and kill live prey animals. In short, the domesticated pet dog does not need teeth at all. This may seem like an odd statement for a veterinary dentist to make, but I feel quite strongly that a dog is far better off having no teeth than having bad teeth. My preference is that a dog should have a full

  1. Serum Ionized Calcium Quantification for Staging Canine Periodontal Disease: A Preliminary Study.

    Science.gov (United States)

    Miguel Carreira, L; Daniela, Dias; Pedro, Azevedo

    2015-06-01

    Periodontal diseases (PD) are infectious, inflammatory, progressive diseases of the oral cavity affecting people and dogs. PD takes 2 forms: gingivitis and periodontitis. Diagnosing or staging PD can be achieved only with dental x-rays and periodontal probing, both of which require the use of general anesthesia in dogs. This study aimed to determine whether serum ionized calcium ([iCa(2+)]) levels can be useful in preliminary PD staging in dogs. A sample of 40 dogs (n = 40) was divided into 4 groups (n = 10 each) based on the following PD stages: G1 (gingivitis), G2 (initial periodontitis), G3 (moderate periodontitis), and G4 (severe periodontitis). The groups were then subjected to [iCa(2+)] quantification. Statistically significant differences were observed between PD stages and [iCa(2+)] for all stages except G3 and G4. Therefore, this parameter can be used as an additional tool to establish and monitor preliminary PD status. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.

    Science.gov (United States)

    Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S

    2017-06-03

    Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.

  3. Mapping of the disease locus and identification of ADAMTS10 as a candidate gene in a canine model of primary open angle glaucoma.

    Directory of Open Access Journals (Sweden)

    John Kuchtey

    2011-02-01

    Full Text Available Primary open angle glaucoma (POAG is a leading cause of blindness worldwide, with elevated intraocular pressure as an important risk factor. Increased resistance to outflow of aqueous humor through the trabecular meshwork causes elevated intraocular pressure, but the specific mechanisms are unknown. In this study, we used genome-wide SNP arrays to map the disease gene in a colony of Beagle dogs with inherited POAG to within a single 4 Mb locus on canine chromosome 20. The Beagle POAG locus is syntenic to a previously mapped human quantitative trait locus for intraocular pressure on human chromosome 19. Sequence capture and next-generation sequencing of the entire canine POAG locus revealed a total of 2,692 SNPs segregating with disease. Of the disease-segregating SNPs, 54 were within exons, 8 of which result in amino acid substitutions. The strongest candidate variant causes a glycine to arginine substitution in a highly conserved region of the metalloproteinase ADAMTS10. Western blotting revealed ADAMTS10 protein is preferentially expressed in the trabecular meshwork, supporting an effect of the variant specific to aqueous humor outflow. The Gly661Arg variant in ADAMTS10 found in the POAG Beagles suggests that altered processing of extracellular matrix and/or defects in microfibril structure or function may be involved in raising intraocular pressure, offering specific biochemical targets for future research and treatment strategies.

  4. Heartworm disease (Dirofilaria immitis and their vectors in Europe. New distribution trends.

    Directory of Open Access Journals (Sweden)

    Rodrigo eMorchón

    2012-06-01

    Full Text Available Cardiopulmonary dirofilariasis is a cosmopolitan disease caused by Dirofilaria immitis, which affects mainly canids and felids. Moreover, it causes zoonotic infections, producing pulmonary dirofilariasis in humans. Heartworm disease is a vector-borne transmitted disease, thus transmission depends on the presence of competent mosquito species, which is directly related to favorable climate conditions for its development and survival. Cardiopulmonary dirofilariasis is mainly located in countries with temperate and tropical climates. Europe is one of the continents where animal dirofilariasis has been studied more extensively. In this article we review the current prevalence of canine and feline cardiopulmonary dirofilariasis in the European continent, the transmission vectors, the current changes in the distribution and the possible causes, though the analysis of the epidemiological studies carried out until 2001 and between 2002-2011. The highest prevalences have been observed in the southern European countries, which are considered historically endemic/hyperendemic countries. Studies carried out in the last 10 years suggest an expansion of cardiopulmonary dirofilariasis in dogs towards central and northern Europe. Several factors can exert an influence on the spreading of the disease, such as movement of infected animals, the introduction of new species of mosquitoes able to act as vectors, the climate change caused by the global warming, and development of human activity in new areas. Veterinary controls to prevent the spreading of this disease, programs of control of vectors, and adequate protocols of prevention of dirofilariasis in the susceptible species should be carried out.

  5. Immunity to canine adenovirus respiratory disease: a comparison of attenuated CAV-1 and CAV-2 vaccines.

    Science.gov (United States)

    Cornwell, H J; Koptopoulos, G; Thompson, H; McCandlish, I A; Wright, N G

    1982-01-09

    Four litters of puppies were divided into three groups. One group was vaccinated with a live CAV-1 vaccine and another with a live CAV-2 vaccine. Throat swabs were collected from two dogs in each of these groups to monitor the possible excretion of vaccine virus, but none was found. Both groups, together with the third group of unvaccinated controls, were challenged 17 days later with an aerosol of virulent CAV-2. One dog from each group was killed on the third, fourth, seventh, ninth, 11th and 14th days after challenge. The unvaccinated dogs developed a clinical disease characterised by anorexia, dullness, coughing and tachypnoea. The lungs were consolidated and histological examination revealed the main lesion to be a severe necrotising bronchiolitis. Large amounts of virus were present in the respiratory tissues of these dogs and high titres of virus were isolated from throat swabs. In contrast, both groups of vaccinated dogs remained clinically almost normal with minimal lesions, present for a much shorter period of time. Virus was found on day 4 in the respiratory tissues of one dog vaccinated with CAV-1 but the other vaccinated animals contained little or no virus. In general, the degree of protection afforded by CAV-1 vaccine seemed similar to that provided by CAV-2 vaccine.

  6. Adjuvant effects of recombinant giant panda (Ailuropoda melanoleuca) IL-18 on the canine distemper disease vaccine in mice

    OpenAIRE

    YAN, Yue; NIU, Lili; DENG, Jiabo; WANG, Qiang; YU, Jianqiu; ZHANG, Yizheng; WANG, Jianxi; CHEN, Jiao; WEI, Changhe; TAN, Xuemei

    2014-01-01

    Canine distemper virus (CDV) is a morbillivirus known to cause morbidity and mortality in a broad range of animals. Giant pandas (Ailuropoda melanoleuca), especially captive ones, are susceptible to natural infection with CDV. Interleukin-18 (IL-18) is a powerful adjuvant molecule that can enhance the development of antigen-specific immunity and vaccine efficacy. In this study, a giant panda IL-18 gene eukaryotic expression plasmid (pcAmIL-18) was constructed. Female BALB/c mice were muscular...

  7. Population dynamics and infectious diseases in Asia

    National Research Council Canada - National Science Library

    Sleigh, Adrian

    2006-01-01

    ... such as SARS. David J BRADLEY is Ross Professor of Tropical Hygiene Emeritus at the London School of Hygiene and Tropical Medicine and Leverhulme Emeritus Fellow in the Department of Zoology, Oxford University. He has worked on the epidemiology and control of vector-borne and infectious diseases, water in relation to health, and concepts in international h...

  8. Tickborne Rickettsial Diseases: Epidemiological studies in China

    NARCIS (Netherlands)

    W.-C. Cao (Wu-Chun)

    2010-01-01

    textabstractRickettsial diseases are vector-borne zoonoses caused by obligate intracellular bacteria within the order Rickettsiales, which was previously described as short, Gram-negative rod bacteria that retained basic fuchsin when stained by the method of Gimenez. As development in molecular

  9. Assessment of metabolic changes in the striatum of a MPTP-intoxicated canine model: in vivo ¹H-MRS study of an animal model for Parkinson's disease.

    Science.gov (United States)

    Choi, Chi-Bong; Kim, Sang-Young; Lee, Sung-Ho; Jahng, Geon-Ho; Kim, Hwi-Yool; Choe, Bo-Young; Ryu, Kyung-Nam; Yang, Dal-Mo; Yim, Sung-Vin; Choi, Woo-Suk

    2011-01-01

    Parkinson's disease (PD) is a neurodegenerative disorder characterized by the progressive loss of the dopaminergic neurons in the substantia nigra pars compacta, which projects to the striatum. We induced a selective loss of nigrostriatal dopamine neurons, by infusing the mitochondrial complex 1 inhibitor 1-methyl 4-phenyl 1,2,3,6-tetrahydropyridine (MPTP) into adult beagle dogs (N=5). Single voxel ¹H water suppressed magnetic resonance spectroscopy (¹H-MRS) at 3 T was used to assess the metabolic changes in the striatum of canine before and after MPTP intoxication. The metabolite spectra obtained from the striatum (voxel size: 2 cm³) showed a lower N-acetyl aspartate to total creatine (creatine+phosphocreatine) ratio after MPTP intoxication. There were no significant differences in other metabolite ratios such as glutamate+glutamine, choline-containing compounds (glycerophosphocholine+phophorylcholine and myo-inositol). Our findings indicated that ¹H-MRS is a sensitive, noninvasive measure of neural toxicity and biochemical alterations of the striatum in a canine model of PD, and further studies are needed to confirm brain metabolic changes in association with progression of MPTP-intoxication. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Characterization of the canine urinary proteome.

    Science.gov (United States)

    Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E

    2014-06-01

    Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.

  11. Approaches to canine health surveillance.

    Science.gov (United States)

    O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C

    2014-01-01

    Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.

  12. Declining Prevalence of Disease Vectors Under Climate Change

    Science.gov (United States)

    Escobar, Luis E.; Romero-Alvarez, Daniel; Leon, Renato; Lepe-Lopez, Manuel A.; Craft, Meggan E.; Borbor-Cordova, Mercy J.; Svenning, Jens-Christian

    2016-12-01

    More than half of the world population is at risk of vector-borne diseases including dengue fever, chikungunya, zika, yellow fever, leishmaniasis, chagas disease, and malaria, with highest incidences in tropical regions. In Ecuador, vector-borne diseases are present from coastal and Amazonian regions to the Andes Mountains; however, a detailed characterization of the distribution of their vectors has never been carried out. We estimate the distribution of 14 vectors of the above vector-borne diseases under present-day and future climates. Our results consistently suggest that climate warming is likely threatening some vector species with extinction, locally or completely. These results suggest that climate change could reduce the burden of specific vector species. Other vector species are likely to shift and constrain their geographic range to the highlands in Ecuador potentially affecting novel areas and populations. These forecasts show the need for development of early prevention strategies for vector species currently absent in areas projected as suitable under future climate conditions. Informed interventions could reduce the risk of human exposure to vector species with distributional shifts, in response to current and future climate changes. Based on the mixed effects of future climate on human exposure to disease vectors, we argue that research on vector-borne diseases should be cross-scale and include climatic, demographic, and landscape factors, as well as forces facilitating disease transmission at fine scales.

  13. Life-long diseases need life-long treatment: long-term safety of ciclosporin in canine atopic dermatitis

    Science.gov (United States)

    Nuttall, Tim; Reece, Douglas; Roberts, Elizabeth

    2014-01-01

    Ciclosporin (Atopica; Novartis Animal Health) has been licensed for canine atopic dermatitis (AD) since 2002. Adverse events (AEs) have been reported in 55 per cent of 759 dogs in 15 clinical trials, but are rare in pharmacovigilance data (71.81 AEs/million capsules sold). Gastrointestinal reactions were most common, but were mild and rarely required intervention. Other AEs were rare (≤1 per cent in clinical trials; metabolism is not clinically significant for normal dogs. Concomitant treatment with most drugs is safe. Effects on cytochrome P450 and MDR1 P-glycoprotein activity may elevate plasma ciclosporin concentrations, but short-term changes are not clinically significant. Monitoring of complete blood counts, urinalysis or ciclosporin levels is not justified except with higher than recommended doses and/or long-term concurrent immunosuppressive drugs. Ciclosporin is not a contraindication for killed (including rabies) vaccines, but the licensed recommendation is that live vaccination is avoided during treatment. In conclusion, ciclosporin has a positive risk-benefit profile for the long-term management of canine AD. PMID:24682696

  14. Vaccine-induced canine distemper in a lesser panda.

    Science.gov (United States)

    Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J

    1976-11-01

    A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.

  15. Canine thymoma

    International Nuclear Information System (INIS)

    Aronsohn, M.

    1985-01-01

    Thymoma is an uncommon canine neoplasm of thymic epithelial cells. It is seen in various breeds but may occur more frequently in German Shepherd Dogs. Middle-aged or older dogs can be affected and no sex predilection exists. A paraneoplastic syndrome of myasthenia gravis, nonthymic malignant tumors, and/or polymyositis occurs in a significant number of dogs with thymoma. Clinical signs are variable and are related to a space-occupying cranial mediastinal mass and/or manifestations of the paraneo-plastic syndrome. Dyspnea is the most common presenting clinical sign. Thoracic radiographs usually show a cranial mediastinal mass. Lymphoma is the main differential diagnosis. A definitive diagnosis may be made by closed biopsy but is more likely to be confirmed by thoracotomy. Thymomas may be completely contained within the thymic capsule or may spread by local invasion or metastasis. A staging system allows for an accurate prognosis and a therapeutic plan. Surgical removal of encapsulated thymomas may result in long-term survival or cure. Invasive or metastatic thymomas carry a guarded prognosis. Manifestations of the paraneoplastic syndrome complicate treatment. Adjuvant radiation and chemotherapy may be of value for advanced cases; however, adequate clinical trials have not been done in the dog

  16. Arginase-1 expressing microglia in close proximity to motor neurons were increased early in disease progression in canine degenerative myelopathy, a model of amyotrophic lateral sclerosis.

    Science.gov (United States)

    Toedebusch, Christine M; Snyder, John C; Jones, Maria R; Garcia, Virginia B; Johnson, Gayle C; Villalón, Eric L; Coates, Joan R; Garcia, Michael L

    2018-04-01

    Toxicity within superoxide dismutase-1 (SOD1)-associated familial amyotrophic lateral sclerosis (ALS) is non-cell autonomous with direct contribution from microglia. Microglia exhibit variable expression of neuroprotective and neurotoxic molecules throughout disease progression. The mechanisms regulating microglial phenotype within ALS are not well understood. This work presents a first study to examine the specific microglial phenotypic response in close association to motor neurons in a naturally occurring disease model of ALS, canine degenerative myelopathy (DM). Microglia closely associated with motor neurons were increased in all stages of DM progression, although only DM Late reached statistical significance. Furthermore, the number of arginase-1 expressing microglia per motor neuron were significantly increased in early stages of DM, whereas the number of inducible nitric oxide synthase (iNOS)-expressing microglia per motor neuron was indistinguishable from aged controls at all stages of disease. Fractalkine, a chemotactic molecule for microglia, was expressed in motor neurons, and the fractalkine receptor was specifically localized to microglia. However, we found no correlation between microglial response and lumbar spinal cord fractalkine levels. Taken together, these data suggest that arginase-1-expressing microglia are recruited to the motor neuron early in DM disease through a fractalkine-independent mechanism. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War

    Science.gov (United States)

    1981-06-05

    anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges

  18. Radioresistant canine hematopoietic cells

    International Nuclear Information System (INIS)

    Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.

    1987-01-01

    Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells

  19. Frequency-Dependent Disease Transmission and the Dynamics of the Silene-Ustilago Host-Pathogen System

    NARCIS (Netherlands)

    Thrall, P.H.; Biere, A.; Uyenoyama, M.K.

    1995-01-01

    Models incorporating density-dependent disease transmission functions generally provide a good fit for airborne and directly transmitted bacterial or viral diseases. However, the transmission dynamics of sexually transmitted and vector-borne diseases are likely to be frequency- rather than density-

  20. Genetics of Human and Canine Dilated Cardiomyopathy

    OpenAIRE

    Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland

    2015-01-01

    Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...

  1. Regional Warming and Emerging Vector-Borne Zoonotic Dirofilariosis in the Russian Federation, Ukraine, and Other Post-Soviet States from 1981 to 2011 and Projection by 2030

    Directory of Open Access Journals (Sweden)

    Vladimir Kartashev

    2014-01-01

    Full Text Available We analyze through a climatic model the influence of regional warming on the geographical spreading and potential risk of infection of human dirofilariosis in Russia, Ukraine, and other post-Soviet states from 1981 to 2011 and estimate the situation by 2030. The model correctly predicts the spatiotemporal location of 97.10% of 2154 clinical cases reported in the area during the studied period, identified by a retrospective review of the literature. There exists also a significant correlation between annual predicted Dirofilaria generations and calculated morbidity. The model states the progressive increase of 14.8% in the potential transmission area, up to latitude 64°N, and 14.7% in population exposure. By 2030 an increase of 18.5% in transmission area and 10.8% in population exposure is expected. These findings strongly suggest the influence of global warming in both geographical spreading and increase in the number of Dirofilaria generations. The results should alert about the epidemiological behavior of dirofilariosis and other mosquito-borne diseases in these and other countries with similar climatic characteristics.

  2. Regional warming and emerging vector-borne zoonotic dirofilariosis in the Russian Federation, Ukraine, and other post-Soviet states from 1981 to 2011 and projection by 2030.

    Science.gov (United States)

    Kartashev, Vladimir; Afonin, Alexandr; González-Miguel, Javier; Sepúlveda, Rosa; Simón, Luis; Morchón, Rodrigo; Simón, Fernando

    2014-01-01

    We analyze through a climatic model the influence of regional warming on the geographical spreading and potential risk of infection of human dirofilariosis in Russia, Ukraine, and other post-Soviet states from 1981 to 2011 and estimate the situation by 2030. The model correctly predicts the spatiotemporal location of 97.10% of 2154 clinical cases reported in the area during the studied period, identified by a retrospective review of the literature. There exists also a significant correlation between annual predicted Dirofilaria generations and calculated morbidity. The model states the progressive increase of 14.8% in the potential transmission area, up to latitude 64 °N, and 14.7% in population exposure. By 2030 an increase of 18.5% in transmission area and 10.8% in population exposure is expected. These findings strongly suggest the influence of global warming in both geographical spreading and increase in the number of Dirofilaria generations. The results should alert about the epidemiological behavior of dirofilariosis and other mosquito-borne diseases in these and other countries with similar climatic characteristics.

  3. 78 FR 732 - Disease, Disability, and Injury Prevention and Control Special Emphasis Panel (SEP): Initial Review

    Science.gov (United States)

    2013-01-04

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Centers for Disease Control and Prevention Disease, Disability, and Injury Prevention and Control Special Emphasis Panel (SEP): Initial Review The meeting announced below concerns Identification, Surveillance, and Control of Vector-Borne and Zoonotic Infectious...

  4. Molecular entomology: analyzing tiny molecules to answer big questions about disease vectors and their biology

    Science.gov (United States)

    The entomologists at the Arthropod-Borne Animal Diseases Research Unit at USDA-Agricultural Research Service are tasked with protecting the nation’s livestock from domestic, foreign and emerging vector-borne diseases. To accomplish this task, a vast array of molecular techniques are being used in pr...

  5. Evaluation of the efficacy and duration of immunity of a canine combination vaccine against virulent parvovirus, infectious canine hepatitis virus, and distemper virus experimental challenges.

    Science.gov (United States)

    Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald

    2004-01-01

    The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.

  6. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe.

    Science.gov (United States)

    McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A

    2014-09-05

    Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  7. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

    Directory of Open Access Journals (Sweden)

    Anna McRee

    2014-09-01

    Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  8. Adjuvant effects of recombinant giant panda (Ailuropoda melanoleuca) IL-18 on the canine distemper disease vaccine in mice.

    Science.gov (United States)

    Yan, Yue; Niu, Lili; Deng, Jiabo; Wang, Qiang; Yu, Jianqiu; Zhang, Yizheng; Wang, Jianxi; Chen, Jiao; Wei, Changhe; Tan, Xuemei

    2015-02-01

    Canine distemper virus (CDV) is a morbillivirus known to cause morbidity and mortality in a broad range of animals. Giant pandas (Ailuropoda melanoleuca), especially captive ones, are susceptible to natural infection with CDV. Interleukin-18 (IL-18) is a powerful adjuvant molecule that can enhance the development of antigen-specific immunity and vaccine efficacy. In this study, a giant panda IL-18 gene eukaryotic expression plasmid (pcAmIL-18) was constructed. Female BALB/c mice were muscularly inoculated with the plasmids pcAmIL-18, pcDNA3.1 and PBS, respectively. They were subsequently injected with an attenuated CDV vaccine for dogs, and the induced humoral and cellular responses were evaluated. The results showed that pcAmIL-18 remarkably improved the level of specific antibody, IFN-γ and IL-2 in mice sera, the T lymphocyte proliferation index and the percentage of CD4(+) and CD8(+) cells. These data indicated that pcAmIL-18 is a potential adjuvant that promotes specific immunity.

  9. Glucosamine and chondroitin use in canines for osteoarthritis: A ...

    African Journals Online (AJOL)

    Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...

  10. Upregulation of CB2 receptors in reactive astrocytes in canine degenerative myelopathy, a disease model of amyotrophic lateral sclerosis

    Science.gov (United States)

    Fernández-Trapero, María; Espejo-Porras, Francisco; Rodríguez-Cueto, Carmen; Coates, Joan R.; Pérez-Díaz, Carmen; de Lago, Eva; Fernández-Ruiz, Javier

    2017-01-01

    ABSTRACT Targeting of the CB2 receptor results in neuroprotection in the SOD1G93A mutant mouse model of amyotrophic lateral sclerosis (ALS). The neuroprotective effects of CB2 receptors are facilitated by their upregulation in the spinal cord of the mutant mice. Here, we investigated whether similar CB2 receptor upregulation, as well as parallel changes in other endocannabinoid elements, is evident in the spinal cord of dogs with degenerative myelopathy (DM), caused by mutations in the superoxide dismutase 1 gene (SOD1). We used well-characterized post-mortem spinal cords from unaffected and DM-affected dogs. Tissues were used first to confirm the loss of motor neurons using Nissl staining, which was accompanied by glial reactivity (elevated GFAP and Iba-1 immunoreactivity). Next, we investigated possible differences in the expression of endocannabinoid genes measured by qPCR between DM-affected and control dogs. We found no changes in expression of the CB1 receptor (confirmed with CB1 receptor immunostaining) or NAPE-PLD, DAGL, FAAH and MAGL enzymes. In contrast, CB2 receptor levels were significantly elevated in DM-affected dogs determined by qPCR and western blotting, which was confirmed in the grey matter using CB2 receptor immunostaining. Using double-labelling immunofluorescence, CB2 receptor immunolabelling colocalized with GFAP but not Iba-1, indicating upregulation of CB2 receptors on astrocytes in DM-affected dogs. Our results demonstrate a marked upregulation of CB2 receptors in the spinal cord in canine DM, which is concentrated in activated astrocytes. Such receptors could be used as a potential target to enhance the neuroprotective effects exerted by these glial cells. PMID:28069688

  11. Upregulation of CB2 receptors in reactive astrocytes in canine degenerative myelopathy, a disease model of amyotrophic lateral sclerosis

    Directory of Open Access Journals (Sweden)

    María Fernández-Trapero

    2017-05-01

    Full Text Available Targeting of the CB2 receptor results in neuroprotection in the SOD1G93A mutant mouse model of amyotrophic lateral sclerosis (ALS. The neuroprotective effects of CB2 receptors are facilitated by their upregulation in the spinal cord of the mutant mice. Here, we investigated whether similar CB2 receptor upregulation, as well as parallel changes in other endocannabinoid elements, is evident in the spinal cord of dogs with degenerative myelopathy (DM, caused by mutations in the superoxide dismutase 1 gene (SOD1. We used well-characterized post-mortem spinal cords from unaffected and DM-affected dogs. Tissues were used first to confirm the loss of motor neurons using Nissl staining, which was accompanied by glial reactivity (elevated GFAP and Iba-1 immunoreactivity. Next, we investigated possible differences in the expression of endocannabinoid genes measured by qPCR between DM-affected and control dogs. We found no changes in expression of the CB1 receptor (confirmed with CB1 receptor immunostaining or NAPE-PLD, DAGL, FAAH and MAGL enzymes. In contrast, CB2 receptor levels were significantly elevated in DM-affected dogs determined by qPCR and western blotting, which was confirmed in the grey matter using CB2 receptor immunostaining. Using double-labelling immunofluorescence, CB2 receptor immunolabelling colocalized with GFAP but not Iba-1, indicating upregulation of CB2 receptors on astrocytes in DM-affected dogs. Our results demonstrate a marked upregulation of CB2 receptors in the spinal cord in canine DM, which is concentrated in activated astrocytes. Such receptors could be used as a potential target to enhance the neuroprotective effects exerted by these glial cells.

  12. The Menkes and Wilson disease genes counteract in copper toxicosis in Labrador retrievers: a new canine model for copper-metabolism disorders

    Directory of Open Access Journals (Sweden)

    Hille Fieten

    2016-01-01

    Full Text Available The deleterious effects of a disrupted copper metabolism are illustrated by hereditary diseases caused by mutations in the genes coding for the copper transporters ATP7A and ATP7B. Menkes disease, involving ATP7A, is a fatal neurodegenerative disorder of copper deficiency. Mutations in ATP7B lead to Wilson disease, which is characterized by a predominantly hepatic copper accumulation. The low incidence and the phenotypic variability of human copper toxicosis hamper identification of causal genes or modifier genes involved in the disease pathogenesis. The Labrador retriever was recently characterized as a new canine model for copper toxicosis. Purebred dogs have reduced genetic variability, which facilitates identification of genes involved in complex heritable traits that might influence phenotype in both humans and dogs. We performed a genome-wide association study in 235 Labrador retrievers and identified two chromosome regions containing ATP7A and ATP7B that were associated with variation in hepatic copper levels. DNA sequence analysis identified missense mutations in each gene. The amino acid substitution ATP7B:p.Arg1453Gln was associated with copper accumulation, whereas the amino acid substitution ATP7A:p.Thr327Ile partly protected against copper accumulation. Confocal microscopy indicated that aberrant copper metabolism upon expression of the ATP7B variant occurred because of mis-localization of the protein in the endoplasmic reticulum. Dermal fibroblasts derived from ATP7A:p.Thr327Ile dogs showed copper accumulation and delayed excretion. We identified the Labrador retriever as the first natural, non-rodent model for ATP7B-associated copper toxicosis. Attenuation of copper accumulation by the ATP7A mutation sheds an interesting light on the interplay of copper transporters in body copper homeostasis and warrants a thorough investigation of ATP7A as a modifier gene in copper-metabolism disorders. The identification of two new functional

  13. Molecular characterization of canine distemper vi- rus circulating in ...

    African Journals Online (AJOL)

    2OIE Collaborating Centre for Diseases at Animal and Human Interface, FAO Reference Centre for Rabies, Viale ... Asia-1 lineage canine distemper virus is circulating in outbreak. .... jected to cell culture on Vero cell lines for virus isolation.

  14. The Unculturables: targeted isolation of bacterial species associated with canine periodontal health or disease from dental plaque.

    Science.gov (United States)

    Davis, Ian J; Bull, Christopher; Horsfall, Alexander; Morley, Ian; Harris, Stephen

    2014-08-01

    The current inability to culture the entirety of observed bacteria is well known and with the advent of ever more powerful molecular tools, that can survey bacterial communities at previously unattainable depth, the gap in our capacity to culture and define all of these species increases exponentially. This gap has essentially become the rate limiting step in determining how the knowledge of which species are present in a sample can be applied to understand the role of these species in an ecosystem or disease process. A case in point is periodontal disease, which is the most widespread oral disease in dogs. If untreated the disease results in significant pain, eventual loss of the dentition and potentially an increased risk of systemic diseases. Previous molecular based studies have identified the bacterial species associated with periodontal disease in dogs; however without cultured strains from many of these species it has not been possible to study whether they play a role in the disease process. Using a quantitative polymerase chain reaction (qPCR) directed approach a range of microbiological media were screened and optimized to enrich for previously uncultivated target species. A systematic screening methodology was then employed to isolate the species of interest. In cases where the target species were not cultivable in isolation, helper strains grown underneath a nitrocellulose membrane were used to provide the necessary growth factors. This guided media optimization approach enabled the purification of 14 species, 8 of which we had previously been unable to cultivate in isolation. It is also applicable to the targeted isolation of isolates from species that have previously been cultured (for example to study intra-species variation) as demonstrated by the successful isolation of 6 targeted isolates of already cultured species. To our knowledge this is the first time this combination of qPCR guided media optimization, strategic screening and helper strain

  15. Tooth fractures in canine clinical practice

    International Nuclear Information System (INIS)

    Capik, I.; Ledecky, V.; Sevcik, A.

    2001-01-01

    Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients

  16. Canine distemper outbreak in rhesus monkeys, China.

    Science.gov (United States)

    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang; Hu, Rongliang

    2011-08-01

    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People's Republic of China. Approximately 10,000 animals were infected (25%-60% disease incidence); 5%-30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain.

  17. Canine Distemper Outbreak in Rhesus Monkeys, China

    Science.gov (United States)

    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang

    2011-01-01

    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People’s Republic of China. Approximately 10,000 animals were infected (25%–60% disease incidence); 5%–30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain. PMID:21801646

  18. Validation of commercially available automated canine-specific immunoturbidimetric method for measuring canine C-reactive protein

    DEFF Research Database (Denmark)

    Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold

    2014-01-01

    BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was

  19. Canine oral melanoma.

    Science.gov (United States)

    Bergman, Philip J

    2007-05-01

    Melanoma is the most common oral malignancy in the dog. Oral and/or mucosal melanoma has been routinely considered an extremely malignant tumor with a high degree of local invasiveness and high metastatic propensity. Primary tumor size has been found to be extremely prognostic. The World Health Organization staging scheme for dogs with oral melanoma is based on size, with stage I = or = 4cm tumor and/or lymph node metastasis, and stage IV = distant metastasis. Median survival times for dogs with oral melanoma treated with surgery are approximately 17 to 18, 5 to 6, and 3 months with stage I, II, and III disease, respectively. Significant negative prognostic factors include stage, size, evidence of metastasis, and a variety of histologic criteria. Standardized treatments such as surgery, coarse-fractionation radiation therapy, and chemotherapy have afforded minimal to modest stage-dependent clinical benefits and death is usually due to systemic metastasis. Numerous immunotherapeutic strategies have been employed to date with limited clinical efficacy; however, the use of xenogeneic DNA vaccines may represent a leap forward in clinical efficacy. Oral melanoma is a spontaneous syngeneic cancer occurring in outbred, immunocompetent dogs and appears to be a more clinically faithful therapeutic model for human melanoma; further use of canine melanoma as a therapeutic model for human melanoma is strongly encouraged. In addition, the development of an expanded but clinically relevant staging system incorporating the aforementioned prognostic factors is also strongly encouraged.

  20. A comparison of the histopathologic pattern of the left atrium in canine dilated cardiomyopathy and chronic mitral valve disease.

    Science.gov (United States)

    Janus, Izabela; Noszczyk-Nowak, Agnieszka; Nowak, Marcin; Ciaputa, Rafał; Kandefer-Gola, Małgorzata; Pasławska, Urszula

    2016-01-05

    Dilated cardiomyopathy (DCM) and chronic mitral valve disease (CMVD) in dogs are associated with heart chamber enlargement, also of the left atrium. DCM is often accompanied by rhythm disturbances (mainly atrial fibrillation or ventricular arrhythmias). In CMVD, arrhythmias are observed less frequently. It is still unclear whether left atrial enlargement in these diseases results from volume overload or if it is also connected with other factors (e.g. rhythm disturbances). This study was conducted on the left atrial myocardial specimens from 31 dogs, including those from 16 dogs with clinically diagnosed DCM and 15 dogs with CMVD. After fixation and staining (using haematoxylin-eosin and Masson-Goldner trichrome stain), the specimens underwent evaluation. Parenchymal changes (fibrosis, fatty infiltration, and vessel narrowing), degenerative changes (loss of striation, changes in cardiomyocyte structure, and abnormal cell nuclei) and the presence of inflammatory infiltrates were assessed. More interstitial fibrosis (median 4 vs. 2.5 grid fields; p < 0.05) and less perivascular fibrosis (median score 1 vs. 2; p < 0.05) was observed in the DCM group compared to the CMVD group. Moreover, less distinct vessel narrowing was observed in the DCM group than in the CMVD group (median lumen area ratio 0.3 vs. 0.26 respectively; p < 0.05). Dogs with DCM showed more strongly defined degenerative changes than the CMVD dogs (median nuclei enlargement score 3 vs. 1, median loss of striation score 3 vs. 2 and median structural alterations score 3 vs. 2, respectively; p < 0.05). The obtained results indicate a different nature of changes occurring in the left atrial myocardium of dogs with DCM compared to dogs with mitral valve disease, including differences in vessel narrowing, cardiomyocyte degeneration and in the distribution of connective tissue.

  1. A novel bocavirus in canine liver

    Directory of Open Access Journals (Sweden)

    Li Linlin

    2013-02-01

    Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.

  2. Prevention of inflammation-mediated bone loss in murine and canine periodontal disease via recruitment of regulatory lymphocytes.

    Science.gov (United States)

    Glowacki, Andrew J; Yoshizawa, Sayuri; Jhunjhunwala, Siddharth; Vieira, Andreia E; Garlet, Gustavo P; Sfeir, Charles; Little, Steven R

    2013-11-12

    The hallmark of periodontal disease is the progressive destruction of gingival soft tissue and alveolar bone, which is initiated by inflammation in response to an invasive and persistent bacterial insult. In recent years, it has become apparent that this tissue destruction is associated with a decrease in local regulatory processes, including a decrease of forkhead box P3-expressing regulatory lymphocytes. Accordingly, we developed a controlled release system capable of generating a steady release of a known chemoattractant for regulatory lymphocytes, C-C motif chemokine ligand 22 (CCL22), composed of a degradable polymer with a proven track record of clinical translation, poly(lactic-co-glycolic) acid. We have previously shown that this sustained presentation of CCL22 from a point source effectively recruits regulatory T cells (Tregs) to the site of injection. Following administration of the Treg-recruiting formulation to the gingivae in murine experimental periodontitis, we observed increases in hallmark Treg-associated anti-inflammatory molecules, a decrease of proinflammatory cytokines, and a marked reduction in alveolar bone resorption. Furthermore, application of the Treg-recruiting formulation (fabricated with human CCL22) in ligature-induced periodontitis in beagle dogs leads to reduced clinical measures of inflammation and less alveolar bone loss under severe inflammatory conditions in the presence of a diverse periodontopathogen milieu.

  3. Molecular-level evaluation of selected periodontal pathogens from subgingival regions in canines and humans with periodontal disease.

    Science.gov (United States)

    Gołyńska, Magdalena; Polkowska, Izabela; Bartoszcze-Tomaszewska, Małgorzata; Sobczyńska-Rak, Aleksandra; Matuszewski, Łukasz

    2017-03-30

    Dogs commonly serve as a model for various human conditions, including periodontal diseases. The aim of this study was to identify the anaerobic bacteria that colonize the subgingival areas in dogs and humans by using rapid real-time polymerase chain reaction (RT-PCR)-based tests and to compare the results obtained in each species. Bacterial microflora evaluations, both quantitative and qualitative, were performed by applying ready-made tests on twelve dogs and twelve humans. Five samples were collected from each subject's deepest gingival pockets and joined to form a collective sample. The results of the study revealed interspecies similarities in the prevalences of Porphyromonas ( P .) gingivalis, Treponema denticola, Tannerella forsythia , and Fusobacterium nucleatum . Red complex bacteria comprised the largest portion of the studied bacterial complexes in all study groups, with P. gingivalis being the most commonly isolated bacterium. The results show similarities in the prevalence of bacterial microflora in dogs and humans. Microbiological analysis of gingival pockets by using rapid real-time PCR-based tests in clinical practice, both veterinary and human, can facilitate the choice of appropriate pharmacological treatment and can provide a basis for subsequent verification of the treatment's effectiveness.

  4. Canine disorder mirrors human disease: exonic deletion in HES7 causes autosomal recessive spondylocostal dysostosis in miniature Schnauzer dogs.

    Directory of Open Access Journals (Sweden)

    Cali E Willet

    Full Text Available Spondylocostal dysostosis is a congenital disorder of the axial skeleton documented in human families from diverse racial backgrounds. The condition is characterised by truncal shortening, extensive hemivertebrae and rib anomalies including malalignment, fusion and reduction in number. Mutations in the Notch signalling pathway genes DLL3, MESP2, LFNG, HES7 and TBX6 have been associated with this defect. In this study, spondylocostal dysostosis in an outbred family of miniature schnauzer dogs is described. Computed tomography demonstrated that the condition mirrors the skeletal defects observed in human cases, but unlike most human cases, the affected dogs were stillborn or died shortly after birth. Through gene mapping and whole genome sequencing, we identified a single-base deletion in the coding region of HES7. The frameshift mutation causes loss of functional domains essential for the oscillatory transcriptional autorepression of HES7 during somitogenesis. A restriction fragment length polymorphism test was applied within the immediate family and supported a highly penetrant autosomal recessive mode of inheritance. The mutation was not observed in wider testing of 117 randomly sampled adult miniature schnauzer and six adult standard schnauzer dogs; providing a significance of association of Praw = 4.759e-36 (genome-wide significant. Despite this apparently low frequency in the Australian population, the allele may be globally distributed based on its presence in two unrelated sires from geographically distant locations. While isolated hemivertebrae have been observed in a small number of other dog breeds, this is the first clinical and genetic diagnosis of spontaneously occurring spondylocostal dysostosis in a non-human mammal and offers an excellent model in which to study this devastating human disorder. The genetic test can be utilized by dog breeders to select away from the disease and avoid unnecessary neonatal losses.

  5. Canine disorder mirrors human disease: exonic deletion in HES7 causes autosomal recessive spondylocostal dysostosis in miniature Schnauzer dogs.

    Science.gov (United States)

    Willet, Cali E; Makara, Mariano; Reppas, George; Tsoukalas, George; Malik, Richard; Haase, Bianca; Wade, Claire M

    2015-01-01

    Spondylocostal dysostosis is a congenital disorder of the axial skeleton documented in human families from diverse racial backgrounds. The condition is characterised by truncal shortening, extensive hemivertebrae and rib anomalies including malalignment, fusion and reduction in number. Mutations in the Notch signalling pathway genes DLL3, MESP2, LFNG, HES7 and TBX6 have been associated with this defect. In this study, spondylocostal dysostosis in an outbred family of miniature schnauzer dogs is described. Computed tomography demonstrated that the condition mirrors the skeletal defects observed in human cases, but unlike most human cases, the affected dogs were stillborn or died shortly after birth. Through gene mapping and whole genome sequencing, we identified a single-base deletion in the coding region of HES7. The frameshift mutation causes loss of functional domains essential for the oscillatory transcriptional autorepression of HES7 during somitogenesis. A restriction fragment length polymorphism test was applied within the immediate family and supported a highly penetrant autosomal recessive mode of inheritance. The mutation was not observed in wider testing of 117 randomly sampled adult miniature schnauzer and six adult standard schnauzer dogs; providing a significance of association of Praw = 4.759e-36 (genome-wide significant). Despite this apparently low frequency in the Australian population, the allele may be globally distributed based on its presence in two unrelated sires from geographically distant locations. While isolated hemivertebrae have been observed in a small number of other dog breeds, this is the first clinical and genetic diagnosis of spontaneously occurring spondylocostal dysostosis in a non-human mammal and offers an excellent model in which to study this devastating human disorder. The genetic test can be utilized by dog breeders to select away from the disease and avoid unnecessary neonatal losses.

  6. Long-term safety and efficacy of AAV gene therapy in the canine model of glycogen storage disease type Ia.

    Science.gov (United States)

    Lee, Young Mok; Conlon, Thomas J; Specht, Andrew; Coleman, Kirsten E; Brown, Laurie M; Estrella, Ana M; Dambska, Monika; Dahlberg, Kathryn R; Weinstein, David A

    2018-05-25

    Viral mediated gene therapy has progressed after overcoming early failures, and gene therapy has now been approved for several conditions in Europe and the USA. Glycogen storage disease (GSD) type Ia, caused by a deficiency of glucose-6-phosphatase-α, has been viewed as an outstanding candidate for gene therapy. This follow-up report describes the long-term outcome for the naturally occurring GSD-Ia dogs treated with rAAV-GPE-hG6PC-mediated gene therapy. A total of seven dogs were treated with rAAV-GPE-hG6PC-mediated gene therapy. The first four dogs were treated at birth, and three dogs were treated between 2 and 6 months of age to assess the efficacy and safety in animals with mature livers. Blood and urine samples, radiographic studies, histological evaluation, and biodistribution were assessed. Gene therapy improved survival in the GSD-Ia dogs. With treatment, the biochemical studies normalized for the duration of the study (up to 7 years). None of the rAAV-GPE-hG6PC-treated dogs had focal hepatic lesions or renal abnormalities. Dogs treated at birth required a second dose of rAAV after 2-4 months; gene therapy after hepatic maturation resulted in improved efficacy after a single dose. rAAV-GPE-hG6PC treatment in GSD-Ia dogs was found to be safe and efficacious. GSD-Ia is an attractive target for human gene therapy since it is a monogenic disorder with limited tissue involvement. Blood glucose and lactate monitoring can be used to assess effectiveness and as a biomarker of success. GSD-Ia can also serve as a model for other hepatic monogenic disorders.

  7. Morgan line and its relationship with distraction index, angle of inclination and degenerative joint disease in the diagnosis of canine hip dysplasia

    Directory of Open Access Journals (Sweden)

    F.G. Miranda

    2016-08-01

    Full Text Available ABSTRACT We evaluated 160 hip joint radiographs of 40 dogs of different large breeds (25 females and 15 males from the metropolitan area of Belo Horizonte, Minas Gerais, Brazil. The radiographs of each dog were obtained at two different stages: stage 1 (mean 7.23 months and stage 2 (mean 14.25. The conventional radiographic method (CRM and the radiographic distraction method (RDM were used, carried out in both stages. CRM measured the Norberg angle (NA, the angle of inclination (AI and evaluated the presence of degenerative joint disease (DJD. The MRD was performed to establish the distraction index (DI. The aims were to evaluate the presence of the Morgan line and other signs of DJD and correlate them with the degree of canine hip dysplasia (CHD and also check if the DI greater than 0.3 (first stage was associated with the presence of ML (second stage. It was found that DI, AI and changes of femoral neck and the formation of osteophytes were associated with the presence of ML. It was observed that if the DI is greater than 0.3 at the first stage, the chance of a positive outcome of ML in the second stage increases by 7.2 times. Thus, 49 joints showed DI > 0.3 at the first stage, in which 31 (63.3 % presented ML at the second stage. Of the 31 animals that showed DI ≤ 0.3 at first, six (19.4% had LM at the second stage. There has been a significant association between the presence of ML and the degree of CHD. The more severe the CHD, the higher the percentage of positive ML results. Thus, among the 24 (60 % animals that showed ML, 11 (45.83 % were classified as severe dysplastics, 5 (20.83% as moderate and 8 (33.33 % as mild. None of the animals classified as normal or borderline presented ML. Among the 8 animals classified as mild dysplastics, 5 showed only ML as DJD.

  8. First survey on canine leishmaniasis in a non classical area of the disease in Spain (Lleida, Catalonia) based on a veterinary questionnaire and a cross-sectional study.

    Science.gov (United States)

    Ballart, Cristina; Alcover, M Magdalena; Picado, Albert; Nieto, Javier; Castillejo, Soledad; Portús, Montserrat; Gállego, Montserrat

    2013-04-01

    The Spanish distribution of canine leishmaniasis (CanL) is heterogeneous and very few data are available for the north of the country, including the province of Lleida (Catalonia, Spain). This work describes the results obtained from a questionnaire sent to veterinarians throughout the province of Lleida. The majority of veterinarians (25/32, 78.1%) believed CanL cases were increasing and that the dogs had been infected locally (30/32, 93.8%). Also, a cross-sectional study was performed on the seroprevalence of CanL in kennel dogs, with and without compatible clinical signs, in the county of Pallars Sobirà (Pyrenees of Lleida), where an autochthonous case of CanL had been previously detected. Four serological tests were used (IFAT, ELISA, Western blot, ICF) and dogs that tested positive with at least two immunological methods were considered seropositive and probably infected. 33.1% (48/145) of the dogs were seropositive. The results of a mixed logistic regression model showed that the risk of seropositivity increased with age (OR=1.35, p-value=0.002), among dogs living in the southern part of Pallars Sobirà (OR=6.20, p-value=0.025) and among dogs whose owners considered their animals to be at risk of leishmaniasis infection (OR=1.26, p-value=0.024) and who were unaware of anti-sand fly preventive methods (OR=11.6, p-value=0.009). The risk decreased when dogs lived in an urban-periurban habitat (OR=0.17, p-value=0.002). The information gathered in the veterinary questionnaires helped us to define the knowledge, perception and awareness of the disease in a naïve region, supporting the hypothesis of an existing CanL focus in Pallars Sobirà, which was confirmed by the seroepidemiological survey. The seroprevalence study carried out on kennel dogs of local origin proved useful for detecting an autochthonous focus of leishmaniasis through the analysis of a small number of animals. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Pathogenesis of growth failure and partial reversal with gene therapy in murine and canine Glycogen Storage Disease type Ia.

    Science.gov (United States)

    Brooks, Elizabeth Drake; Little, Dianne; Arumugam, Ramamani; Sun, Baodong; Curtis, Sarah; Demaster, Amanda; Maranzano, Michael; Jackson, Mark W; Kishnani, Priya; Freemark, Michael S; Koeberl, Dwight D

    2013-06-01

    Glycogen Storage Disease type Ia (GSD-Ia) in humans frequently causes delayed bone maturation, decrease in final adult height, and decreased growth velocity. This study evaluates the pathogenesis of growth failure and the effect of gene therapy on growth in GSD-Ia affected dogs and mice. Here we found that homozygous G6pase (-/-) mice with GSD-Ia have normal growth hormone (GH) levels in response to hypoglycemia, decreased insulin-like growth factor (IGF) 1 levels, and attenuated weight gain following administration of GH. Expression of hepatic GH receptor and IGF 1 mRNAs and hepatic STAT5 (phospho Y694) protein levels are reduced prior to and after GH administration, indicating GH resistance. However, restoration of G6Pase expression in the liver by treatment with adeno-associated virus 8 pseudotyped vector expressing G6Pase (AAV2/8-G6Pase) corrected body weight, but failed to normalize plasma IGF 1 in G6pase (-/-) mice. Untreated G6pase (-/-) mice also demonstrated severe delay of growth plate ossification at 12 days of age; those treated with AAV2/8-G6Pase at 14 days of age demonstrated skeletal dysplasia and limb shortening when analyzed radiographically at 6 months of age, in spite of apparent metabolic correction. Moreover, gene therapy with AAV2/9-G6Pase only partially corrected growth in GSD-Ia affected dogs as detected by weight and bone measurements and serum IGF 1 concentrations were persistently low in treated dogs. We also found that heterozygous GSD-Ia carrier dogs had decreased serum IGF 1, adult body weights and bone dimensions compared to wild-type littermates. In sum, these findings suggest that growth failure in GSD-Ia results, at least in part, from hepatic GH resistance. In addition, gene therapy improved growth in addition to promoting long-term survival in dogs and mice with GSD-Ia. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Concomitant canine distemper, infectious canine hepatitis, canine parvoviral enteritis, canine infectious tracheobronchitis, and toxoplasmosis in a puppy.

    Science.gov (United States)

    Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes

    2013-01-01

    The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.

  11. Canine infection with Borrelia burgdorferi, Dirofilaria immitis, Anaplasma spp. and Ehrlichia spp. in Canada, 2013-2014.

    Science.gov (United States)

    Herrin, Brian H; Peregrine, Andrew S; Goring, Jonas; Beall, Melissa J; Little, Susan E

    2017-05-19

    Canine test results generated by veterinarians throughout Canada from 2013-2014 were evaluated to assess the geographical distribution of canine infection with Borrelia burgdorferi, Dirofilaria immitis, Ehrlichia spp., and Anaplasma spp. The percent positive test results of 115,636 SNAP® 4Dx® Plus tests from dogs tested were collated by province and municipality to determine the distribution of these vector-borne infections in Canada. A total of 2,844/115,636 (2.5%) dogs tested positive for antibody to B. burgdorferi. In contrast, positive test results for D. immitis antigen and antibodies to Ehrlichia spp. and Anaplasma spp. were low, with less than 0.5% of dogs testing positive for any one of these three agents nationwide. Provincial seroprevalence for antibodies to B. burgdorferi ranged from 0.5% (Saskatchewan)-15.7% (Nova Scotia); the areas of highest percent positive test results were in proximity to regions in the USA considered endemic for Lyme borreliosis, including Nova Scotia (15.7%) and Eastern Ontario (5.1%). These high endemic foci, which had significantly higher percent positive test results than the rest of the nation (P Canada. Using dogs as sentinels for these pathogens can aid in recognition of the public and veterinary health threat that each pose.

  12. Comparative occurrence of diabetes in canine, feline, and few wild animals and their association with pancreatic diseases and ketoacidosis with therapeutic approach

    OpenAIRE

    Kamal Niaz; Faheem Maqbool; Fazlullah Khan; Fatima Ismail Hassan; Saeideh Momtaz; Mohammad Abdollahi

    2018-01-01

    Diabetes mellitus (DM) is a chronic metabolic disorder in which blood glucose level raises that can result in severe complications. However, the incidence increased mostly by obesity, pregnancy, persistent corpus luteum, and diestrus phase in humans and animals. This review has focused on addressing the possible understanding and pathogenesis of spontaneous DM in canine, feline, and few wild animals. Furthermore, pancreatic associated disorders, diabetic ketoacidosis, hormonal and drug intera...

  13. Stem Cell-Associated Marker Expression in Canine Hair Follicles.

    Science.gov (United States)

    Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J

    2016-03-01

    Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.

  14. Evaluation of P16 expression in canine appendicular osteosarcoma.

    Science.gov (United States)

    Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K

    2017-06-20

    Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.

  15. Survey of canine tick-borne diseases in Lábrea, Brazilian Amazon: ‘accidental’ findings of Dirofilaria immitis infection

    Directory of Open Access Journals (Sweden)

    Herbert Sousa Soares

    2014-12-01

    Full Text Available Blood samples were collected from 99 domestic dogs from the urban and rural areas of the Lábrea municipality, state of Amazonas, Brazil. Canine serum samples were tested by immunofluorescence assay against Rickettsia spp., which revealed that only 3.0% (1/33 and 7.6% (5/66 of the dogs from urban and rural areas, respectively, reacted positively to at least one Rickettsia species. DNA was extracted from canine blood and tested by a battery of PCR assays targeting protozoa of the genera Babesia and Hepatozoon, and bacteria of the genera Rickettsia and Ehrlichia and family Anaplasmataceae. All samples were negative in the PCR assays targeting the genera Babesia, Hepatozoon, Ehrlichia and Rickettsia. For Anaplasmataceae, 3% (1/33 and 39.4% (26/66 of the urban and rural dogs, respectively, yielded amplicons that generated DNA sequences 100% identical to the corresponding sequence of Wolbachia endosymbiont of Dirofilaria immitis. Because of these results, all canine DNA samples were further tested in a PCR assay targeting filarial nematodes, which was positive for 18.2% (6/33 and 57.6% (38/66 urban and rural dogs, respectively. Filarial-PCR products generated DNA sequences 100% identical to D. immitis. While tick-borne infections were rare in Lábrea, D. immitis infection rates were among the highest reported in South America.

  16. Vaccines for Canine Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Faeze Foroughi-Parvar

    2014-01-01

    Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

  17. Canine Parvovirus: Current Perspective

    OpenAIRE

    Nandi, S.; Kumar, Manoj

    2010-01-01

    Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...

  18. Global warming and spread of infectious diseases; Globale Erwaermung und Ausbreitung von Infektionskrankheiten

    Energy Technology Data Exchange (ETDEWEB)

    Ebert, B.; Fleischer, B. [Bernhard-Nocht-Institut fuer Tropenmedizin (BNI), Hamburg (Germany)

    2005-01-15

    At the end of the twentieth century, tropical infectious diseases increased despite earlier successes of eradication campaigns. As a global warming of 1.4-5.8 C is anticipated to occur by 2100, mainly the vector-borne tropical diseases that are particularly sensitive to climate are expected to spread. Although biological reasons seemingly support this hypothesis, ecological and socio-economic factors have in the past proven to be stronger driving forces for the spread of infectious diseases than climate. (orig.)

  19. Launching the first postgraduate diploma in medical entomology and disease vector control in Pakistan.

    Science.gov (United States)

    Rathor, H R; Mnzava, A; Bile, K M; Hafeez, A; Zaman, S

    2010-01-01

    The Health Services Academy has launched a 12-month postgraduate diploma course in medical entomology and disease vector control. The objective is to create a core of experts trained to prevent and control vector-borne diseases. The course is a response to the serious health and socioeconomic burden caused by a number of vector-borne diseases in Pakistan. The persistence, emergence and re-emergence of these diseases is mainly attributed to the scarcity of trained vector-control experts. The training course attempts to fill the gap in trained manpower and thus reduce the morbidity and mortality due to these diseases, resulting in incremental gains to public health. This paper aims to outline the steps taken to establish the course and the perceived challenges to be addressed in order to sustain its future implementation.

  20. Cardiac involvement in canine babesiosis : review article

    Directory of Open Access Journals (Sweden)

    R.G. Lobetti

    2005-06-01

    Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.

  1. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    Directory of Open Access Journals (Sweden)

    Otávio Valério Carvalho

    2012-01-01

    Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.

  2. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    Science.gov (United States)

    Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo

    2012-01-01

    Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403

  3. Intracerebroventricular gene therapy that delays neurological disease progression is associated with selective preservation of retinal ganglion cells in a canine model of CLN2 disease.

    Science.gov (United States)

    Whiting, Rebecca E H; Jensen, Cheryl A; Pearce, Jacqueline W; Gillespie, Lauren E; Bristow, Daniel E; Katz, Martin L

    2016-05-01

    CLN2 disease is one of a group of lysosomal storage disorders called the neuronal ceroid lipofuscinoses (NCLs). The disease results from mutations in the TPP1 gene that cause an insufficiency or complete lack of the soluble lysosomal enzyme tripeptidyl peptidase-1 (TPP1). TPP1 is involved in lysosomal protein degradation, and lack of this enzyme results in the accumulation of protein-rich autofluorescent lysosomal storage bodies in numerous cell types including neurons throughout the central nervous system and the retina. CLN2 disease is characterized primarily by progressive loss of neurological functions and vision as well as generalized neurodegeneration and retinal degeneration. In children the progressive loss of neurological functions typically results in death by the early teenage years. A Dachshund model of CLN2 disease with a null mutation in TPP1 closely recapitulates the human disorder with a progression from disease onset at approximately 4 months of age to end-stage at 10-11 months. Delivery of functional TPP1 to the cerebrospinal fluid (CSF), either by periodic infusion of the recombinant protein or by a single administration of a TPP1 gene therapy vector to the CSF, significantly delays the onset and progression of neurological signs and prolongs life span but does not prevent the loss of vision or modest retinal degeneration that occurs by 11 months of age. In this study we found that in dogs that received the CSF gene therapy treatment, the degeneration of the retina and loss of retinal function continued to progress during the prolonged life spans of the treated dogs. Eventually the normal cell layers of the retina almost completely disappeared. An exception was the ganglion cell layer. In affected dogs that received TPP1 gene therapy to the CSF and survived an average of 80 weeks, ganglion cell axons were present in numbers comparable to those of normal Dachshunds of similar age. The selective preservation of the retinal ganglion cells suggests

  4. Severe canine distemper outbreak in unvaccinated dogs in Mozambique

    Directory of Open Access Journals (Sweden)

    Julieta Zacarias

    2016-07-01

    Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

  5. The Comparative Diagnostic Features of Canine and Human Lymphoma

    Directory of Open Access Journals (Sweden)

    Davis M. Seelig

    2016-06-01

    Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

  6. The Comparative Diagnostic Features of Canine and Human Lymphoma.

    Science.gov (United States)

    Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A

    2016-06-01

    The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

  7. Radiation, chemotherapy and surgery for canine osteosarcoma

    International Nuclear Information System (INIS)

    Powers, B.E.; Withrow, S.J.; La Rue, S.M.; Straw, R.C.; Gillette, E.L.

    1987-01-01

    Spontaneous canine osteosarcomas is an excellent model for of human osterosarcoma. Twenty dogs with obsteorsarcoma were treated with intravenous or intraarterial cisplatin with or without radiation therapy. This treatment was given 3 weeks prior to limb sparing surgery involving excision of the tumor and allograft replacement. The excised tumor specimen was examined for complete removal and percentage of necrotic tumor measured by planimetry. Intraveneous and intraarterial cisplatin and radiation methods were compared. Data discussing rate of disease development and recurrences is given

  8. Molecular characterization of the canine HMGB1.

    Science.gov (United States)

    Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I

    2003-01-01

    Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel

  9. How effective is integrated vector management against malaria and lymphatic filariasis where the diseases are transmitted by the same vector?

    OpenAIRE

    Stone, C.; Lindsay, S.W.; Chitnis, N.

    2014-01-01

    Background: The opportunity to integrate vector management across multiple vector-borne diseases is particularly plausible for malaria and lymphatic filariasis (LF) control where both diseases are transmitted by the same vector. To date most examples of integrated control targeting these diseases have been unanticipated consequences of malaria vector control, rather than planned strategies that aim to maximize the efficacy and take the complex ecological and biological interactions between th...

  10. Tropical diseases on insurgence: Clinician's perspective

    Directory of Open Access Journals (Sweden)

    Partha Chatterjee

    2017-01-01

    Full Text Available Many known and unknown factors play a synergistic role in the emergence or re-emergence of some infections in a particular area or country. In recent years, India has seen a significant increase in the prevalence of many viral or bacterial diseases. Many are vector borne and are zoonotic disease while others have different source and mode of transmission. These diseases are often associated with high morbidity and mortality. Five important diseases such as leptospirosis, dengue, chikungunya, Japanese encephalitis, and leishmaniasis have been discussed in this article.

  11. Current practices and research updates on diabetes mellitus in canine

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar

    2014-11-01

    Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.

  12. Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.

    Science.gov (United States)

    von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H

    2008-05-01

    Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.

  13. Using internet search queries for infectious disease surveillance: screening diseases for suitability.

    Science.gov (United States)

    Milinovich, Gabriel J; Avril, Simon M R; Clements, Archie C A; Brownstein, John S; Tong, Shilu; Hu, Wenbiao

    2014-12-31

    Internet-based surveillance systems provide a novel approach to monitoring infectious diseases. Surveillance systems built on internet data are economically, logistically and epidemiologically appealing and have shown significant promise. The potential for these systems has increased with increased internet availability and shifts in health-related information seeking behaviour. This approach to monitoring infectious diseases has, however, only been applied to single or small groups of select diseases. This study aims to systematically investigate the potential for developing surveillance and early warning systems using internet search data, for a wide range of infectious diseases. Official notifications for 64 infectious diseases in Australia were downloaded and correlated with frequencies for 164 internet search terms for the period 2009-13 using Spearman's rank correlations. Time series cross correlations were performed to assess the potential for search terms to be used in construction of early warning systems. Notifications for 17 infectious diseases (26.6%) were found to be significantly correlated with a selected search term. The use of internet metrics as a means of surveillance has not previously been described for 12 (70.6%) of these diseases. The majority of diseases identified were vaccine-preventable, vector-borne or sexually transmissible; cross correlations, however, indicated that vector-borne and vaccine preventable diseases are best suited for development of early warning systems. The findings of this study suggest that internet-based surveillance systems have broader applicability to monitoring infectious diseases than has previously been recognised. Furthermore, internet-based surveillance systems have a potential role in forecasting emerging infectious disease events, especially for vaccine-preventable and vector-borne diseases.

  14. A compendium of canine normal tissue gene expression.

    Directory of Open Access Journals (Sweden)

    Joseph Briggs

    Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.

  15. Increasing Incidence of Canine Leptospirosis in Switzerland

    Directory of Open Access Journals (Sweden)

    Andrea Major

    2014-07-01

    Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.

  16. Recombinant canine distemper virus serves as bivalent live vaccine against rabies and canine distemper.

    Science.gov (United States)

    Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao

    2012-07-20

    Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. The potential effects of global warming on changes in canine leishmaniasis in a focus outside the classical area of the disease in southern France.

    Science.gov (United States)

    Dereure, Jacques; Vanwambeke, Sophie O; Malé, Pierre; Martinez, Susana; Pratlong, Francine; Balard, Yves; Dedet, Jean-Pierre

    2009-12-01

    In 1994, an ecoepidemiologic study was carried out in the mid-Ariège valley (French Pyrenees) where autochthonous cases of canine leishmaniasis had been previously reported. Serologic samples were collected from 336 dogs in two groups of villages. The seroprevalences were 11.67% in the valley villages and only 1.43% in the foothill villages. Five lymph node biopsies were taken from serologically positive dogs, and resultant isolates were identified as Leishmania infantum zymodeme MON-1. Phlebotomine sandflies were collected in five locations by CDC light traps. Both of the known French vectors, Phlebotomus ariasi and P. perniciosus, were identified. Bioclimatic and floristic studies showed that this area is an enclave of the supra-Mediterranean climatic zone, containing a typically xerothermophilic Mediterranean flora. The Pyrenees Mountains are usually considered to be outside of the endemic range of leishmaniasis in southern France, and so our demonstration of a microfocus of canine leishmaniasis in the northern foothills is noteworthy. A second serologic survey carried out in 2007 (216 dogs) showed an inversion of the seropositive rates between the two groups of villages compared with those of 1994: only 2.72% in the valley villages and 11.32% in the foothills villages. The decrease of seroprevalence in the first area (valley villages) can be related to a considerable use of deltamethrin collars during the transmission season. The increase of seroprevalence of the foothill villages could be related to climatic conditions, since there was an increase of about 1 degrees C in the mean annual temperature.

  18. Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.

    Science.gov (United States)

    Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D

    2014-12-01

    Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis.

  19. Definition, Classification, and Pathophysiology of Canine Glaucoma.

    Science.gov (United States)

    Pizzirani, Stefano

    2015-11-01

    Glaucoma is a common ocular condition in humans and dogs leading to optic nerve degeneration and irreversible blindness. Primary glaucoma is a group of spontaneous heterogeneous diseases. Multiple factors are involved in its pathogenesis and these factors vary across human ethnic groups and canine breeds, so the clinical phenotypes are numerous and their classification can be challenging and remain superficial. Aging and oxidative stress are major triggers for the manifestation of disease. Multiple, intertwined inflammatory and biochemical cascades eventually alter cellular and extracellular physiology in the optic nerve and trabecular meshwork and lead to vision loss. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Bilateral supernumerary primary maxillary canines

    Directory of Open Access Journals (Sweden)

    Santanu Mukhopadhyay

    2018-01-01

    Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.

  1. Feline and canine coronaviruses: common genetic and pathobiological features.

    Science.gov (United States)

    Le Poder, Sophie

    2011-01-01

    A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP) and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV) will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

  2. Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features

    Directory of Open Access Journals (Sweden)

    Sophie Le Poder

    2011-01-01

    Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

  3. Canine Intracranial Meningioma: Case report

    Directory of Open Access Journals (Sweden)

    José Ricardo Gomes de Carvalho

    2016-11-01

    Full Text Available ABSTRACT. Carvalho J.R.G., Vasconcellos C.H.C., Bastos I. P.B., Trajano F.L.C., Costa T.S. & Fernandes J.I [Canine Intracranial Meningioma: Case report.] Meningioma intracraniano canino: Relato de caso. Revista Brasileira de Medicina Veterinária, 38(supl. 3:1- 7, 2016. Programa de Pós-Graduação em Ciências Veterinária, Universidade Federal Rural do Rio de Janeiro, BR 465 Km 7, Seropédica, RJ 23.897-000, Brasil, E-mail: vetjulio@yahoo.com.br Intracranial neoplasms usually show their signals in a moderate way, revealing a long background of nonspecific signs, making the diagnosis more difficult. The meningioma is the most common intracranial neoplasm in dogs and cats. Along the years, the Veterinary Medicine has experienced important technological improvements, making it possible the diagnosis of a lot of diseases. Therefore, diseases considered not common in the past, started being diagnosed more frequently, for instance, brain lesions. The objective of this research is to report a case of intracranial meningioma in a Boxer dog that arrived at the Veterinary Hospital of the Federal Rural University of Rio de Janeiro, highlighting its clinical improvement, diagnosis and treatment.

  4. IQGAP1 is an oncogenic target in canine melanoma.

    Directory of Open Access Journals (Sweden)

    Becky H Lee

    Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.

  5. Spatial analysis of visceral leishmaniasis in the municipality of Rondonópolis, in the Brazilian State of Mato Grosso, from 2003 to 2012: human, canine and vector distribution in areas of disease transmission

    Directory of Open Access Journals (Sweden)

    Alexander Gonçalves Ferreira Guimarães

    2015-06-01

    Full Text Available INTRODUCTION: Visceral leishmaniasis (VL is a zoonosis of great importance to public health and is considered a neglected disease by the World Health Organization. The disease has expanded and become more prevalent in urban areas in Brazil. METHODS: Geospatial analyses were performed and thematic maps of the triad of the disease were produced for the study period (2003-2012 in the urban area of the municipality of Rondonópolis in the midwestern State of Mato Grosso (MT, Brazil, TerraView 4.2.2 software was used for the analyses. RESULTS: A total of 87.9% of the 186 confirmed human cases of VL were cured. Children between the ages of 1 and 4 were the most affected. Registered deaths were predominant among adults aged 60 years or older. The urban area of the municipality consists of eight strata and 12 census districts include 237 neighborhoods. All sectors had confirmed cases of VL. During the study period, human cases of the disease were recorded in 90 neighborhoods. The 23 deaths from the disease were distributed in 21 neighborhoods. Sandflies carrying the parasite were captured in 192 out of 200 neighborhoods evaluated for the presence of the VL vector. The presence of dogs carrying the parasite was confirmed in, 140 out of 154 surveyed neighborhoods. CONCLUSIONS: The data demonstrated the endemic nature of VL, with a high percentage of infected children, a high distribution of canine infection, and a wide adaptation and dispersal of the vectors in the urban environment. These results, illustrate the process of urbanization of VL in the municipality of Rondonópolis, MT, Brazil.

  6. A New MRI-Based Model of Heart Function with Coupled Hemodynamics and Application to Normal and Diseased Canine Left Ventricles

    Science.gov (United States)

    Choi, Young Joon; Constantino, Jason; Vedula, Vijay; Trayanova, Natalia; Mittal, Rajat

    2015-01-01

    A methodology for the simulation of heart function that combines an MRI-based model of cardiac electromechanics (CE) with a Navier–Stokes-based hemodynamics model is presented. The CE model consists of two coupled components that simulate the electrical and the mechanical functions of the heart. Accurate representations of ventricular geometry and fiber orientations are constructed from the structural magnetic resonance and the diffusion tensor MR images, respectively. The deformation of the ventricle obtained from the electromechanical model serves as input to the hemodynamics model in this one-way coupled approach via imposed kinematic wall velocity boundary conditions and at the same time, governs the blood flow into and out of the ventricular volume. The time-dependent endocardial surfaces are registered using a diffeomorphic mapping algorithm, while the intraventricular blood flow patterns are simulated using a sharp-interface immersed boundary method-based flow solver. The utility of the combined heart-function model is demonstrated by comparing the hemodynamic characteristics of a normal canine heart beating in sinus rhythm against that of the dyssynchronously beating failing heart. We also discuss the potential of coupled CE and hemodynamics models for various clinical applications. PMID:26442254

  7. Canine hypothyroidism. A diagnostic challenge?

    International Nuclear Information System (INIS)

    Boretti, Felicitos; Reusch, C.E.

    2010-01-01

    Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen registered ) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high

  8. Canine obesity: an overview.

    Science.gov (United States)

    Gossellin, J; Wren, J A; Sunderland, S J

    2007-08-01

    Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.

  9. Peracute Infectious Canine Hepatitis

    Directory of Open Access Journals (Sweden)

    A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam

    2012-05-01

    Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.

  10. Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

    Science.gov (United States)

    Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2014-09-09

    Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

  11. Reference genes for reverse transcription quantitative PCR in canine brain tissue

    NARCIS (Netherlands)

    Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C

    2015-01-01

    BACKGROUND: In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and

  12. Transplacental transmission of Leishmania infantum as a means for continued disease incidence in North America.

    Science.gov (United States)

    Boggiatto, Paola Mercedes; Gibson-Corley, Katherine Nicole; Metz, Kyle; Gallup, Jack Michael; Hostetter, Jesse Michael; Mullin, Kathleen; Petersen, Christine Anne

    2011-04-12

    Dogs are the predominant domestic reservoir for human L. infantum infection. Zoonotic visceral leishmaniasis (ZVL) is an emerging problem in some U.S. dog breeds, with an annual quantitative PCR prevalence of greater than 20% within an at-risk Foxhound population. Although classically Leishmania is transmitted by infected sand flies and phlebotomine sand flies exist in the United States, means of ongoing L. infantum transmission in U.S. dogs is currently unknown. Possibilities include vertical (transplacental/transmammary) and horizontal/venereal transmission. Several reports have indicated that endemic ZVL may be transmitted vertically. Our aims for this present study were to establish whether vertical/transplacental transmission was occurring in this population of Leishmania-infected US dogs and determine the effect that this means of transmission has on immune recognition of Leishmania. A pregnant L. infantum-infected dam donated to Iowa State University gave birth in-house to 12 pups. Eight pups humanely euthanized at the time of birth and four pups and the dam humanely euthanized three months post-partum were studied via L. infantum-kinetoplast specific quantitative PCR (kqPCR), gross and histopathological assessment and CD4+ T cell proliferation assay. This novel report describes disseminated L. infantum parasites as identified by kqPCR in 8 day old pups born to a naturally-infected, seropositive U.S. dog with no travel history. This is the first report of vertical transmission of L. infantum in naturally-infected dogs in North America, emphasizing that this novel means of transmission could possibly sustain infection within populations. Evidence that vertical transmission of ZVL may be a driving force for ongoing disease in an otherwise non-endemic region has significant implications on current control strategies for ZVL, as at present parasite elimination efforts in endemic areas are largely focused on vector-borne transmission between canines and people

  13. Transplacental transmission of Leishmania infantum as a means for continued disease incidence in North America.

    Directory of Open Access Journals (Sweden)

    Paola Mercedes Boggiatto

    2011-04-01

    Full Text Available Dogs are the predominant domestic reservoir for human L. infantum infection. Zoonotic visceral leishmaniasis (ZVL is an emerging problem in some U.S. dog breeds, with an annual quantitative PCR prevalence of greater than 20% within an at-risk Foxhound population. Although classically Leishmania is transmitted by infected sand flies and phlebotomine sand flies exist in the United States, means of ongoing L. infantum transmission in U.S. dogs is currently unknown. Possibilities include vertical (transplacental/transmammary and horizontal/venereal transmission. Several reports have indicated that endemic ZVL may be transmitted vertically.Our aims for this present study were to establish whether vertical/transplacental transmission was occurring in this population of Leishmania-infected US dogs and determine the effect that this means of transmission has on immune recognition of Leishmania.A pregnant L. infantum-infected dam donated to Iowa State University gave birth in-house to 12 pups. Eight pups humanely euthanized at the time of birth and four pups and the dam humanely euthanized three months post-partum were studied via L. infantum-kinetoplast specific quantitative PCR (kqPCR, gross and histopathological assessment and CD4+ T cell proliferation assay.This novel report describes disseminated L. infantum parasites as identified by kqPCR in 8 day old pups born to a naturally-infected, seropositive U.S. dog with no travel history. This is the first report of vertical transmission of L. infantum in naturally-infected dogs in North America, emphasizing that this novel means of transmission could possibly sustain infection within populations.Evidence that vertical transmission of ZVL may be a driving force for ongoing disease in an otherwise non-endemic region has significant implications on current control strategies for ZVL, as at present parasite elimination efforts in endemic areas are largely focused on vector-borne transmission between canines

  14. Antiviral effect of lithium chloride on infection of cells by canine parvovirus.

    Science.gov (United States)

    Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun

    2015-11-01

    Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.

  15. Canine distemper spillover in domestic dogs from urban wildlife.

    Science.gov (United States)

    Kapil, Sanjay; Yeary, Teresa J

    2011-11-01

    Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.

  16. Canine distemper virus - a morbillivirus in search of new hosts?

    NARCIS (Netherlands)

    T.C. Harder (Timm); A.D.M.E. Osterhaus (Albert)

    1997-01-01

    textabstractCanine distemper morbillivirus (CDV) induces a multisystemic, often fatal disease in a wide and seemingly expanding host range among the Carnivora. Several genotypes of an otherwise monotypic virus species co-circulate in a geographically restricted pattern. Interspecies transmissions

  17. Aberrant hepatic lipid storage and metabolism in canine portosystemic shunts

    NARCIS (Netherlands)

    Van Den Bossche, Lindsay; Schoonenberg, Vivien A.C.; Burgener, Iwan A.; Penning, Louis C.; Schrall, Ingrid M.; Kruitwagen, Hedwig S.; Van Wolferen, Monique E.; Grinwis, Guy C.M.; Kummeling, Anne; Rothuizen, Jan; Van Velzen, Jeroen F.; Stathonikos, Nikolas; Molenaar, Martijn R.; Helms, Bernd J.; Brouwers, Jos F.H.M.; Spee, Bart; Van Steenbeek, Frank G.

    2017-01-01

    Non-alcoholic fatty liver disease (NAFLD) is a poorly understood multifactorial pandemic disorder. One of the hallmarks of NAFLD, hepatic steatosis, is a common feature in canine congenital portosystemic shunts. The aim of this study was to gain detailed insight into the pathogenesis of steatosis in

  18. Prognosis in canine idiopathic immune-mediated haemolytic anaemia

    NARCIS (Netherlands)

    Piek, C.J.

    2011-01-01

    Canine idiopathic immune-mediated haemolytic anaemia (iIMHA) is one of the most frequently occurring immune-mediated diseases in dogs. A gel-based Coombs' test was shown to perform equally well as a classical Coombs' test. Since the gel-based Coombs' test can be commercially produced and is easy and

  19. Clinical manifestations of canine distemper in Nigerian dogs ...

    African Journals Online (AJOL)

    Twenty dogs of local breeds found in Nigeria, experimentally infected with local isolate of canine distemper virus, manifested fever, conjunctivitis, photophobia salivation, anorexia, dermatitis, and diarrhoea. Apart from these clinical signs already described for the disease in other breeds of dogs,45% of the dogs showed ...

  20. Genetic variant of canine distemper virus from clinical cases in ...

    African Journals Online (AJOL)

    Canine distemper virus (CDV) is a highly contagious viral pathogen of worldwide distribution that can cause lethal disease in domestic dogs and other members of the family Canidae. Genetic diversity is found among reference strains and isolates of CDV, mainly in the haemagglutinin (H) protein, and this may be ...

  1. Canine distemper associated with generalized oedema in Nigerian ...

    African Journals Online (AJOL)

    Twenty puppies of Nigeria local breed of dogs which were experimentally infected with a local isolate of canine distemper virus manifested clinical signs known for the disease including anorexia, ocular discharges, postular dermatitis on the lower abdomen and diarrhoea. In addition, they also manifested generalized ...

  2. Severe canine distemper outbreak in unvaccinated dogs in Mozambique.

    Science.gov (United States)

    Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G

    2016-07-15

    Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.

  3. Canine parvovirus in asymptomatic feline carriers.

    Science.gov (United States)

    Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D

    2012-05-25

    Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog

  4. Comparative occurrence of diabetes in canine, feline, and few wild animals and their association with pancreatic diseases and ketoacidosis with therapeutic approach.

    Science.gov (United States)

    Niaz, Kamal; Maqbool, Faheem; Khan, Fazlullah; Hassan, Fatima Ismail; Momtaz, Saeideh; Abdollahi, Mohammad

    2018-04-01

    Diabetes mellitus (DM) is a chronic metabolic disorder in which blood glucose level raises that can result in severe complications. However, the incidence increased mostly by obesity, pregnancy, persistent corpus luteum, and diestrus phase in humans and animals. This review has focused on addressing the possible understanding and pathogenesis of spontaneous DM in canine, feline, and few wild animals. Furthermore, pancreatic associated disorders, diabetic ketoacidosis, hormonal and drug interaction with diabetes, and herbal remedies associated with DM are elucidated. Bibliographic search for the present review was done using PubMed, Scopus, and Google Scholar for articles on concurrent DM in small and wild animals. Persistent corpus luteal and pseudopregnancy in female dogs generate gestational DM (GDM). GDM can also be caused by extensive use of drugs/hormones such as glucocorticosteroids. Although many similarities are present between diabetic cats and diabetic humans which present islet amyloidosis, there was a progressive loss of β- and α-cells and the normal number of δ-cells. The most prominent similarity is the occurrence of islet amyloidosis in all cases of diabetic cat and over 90% of human non-insulin dependent DM Type-2. Acute pancreatic necrosis (APN) occurs due to predisposing factors such as insulin antagonism, insulin resistance, alteration in glucose tolerance, obesity, hyperadrenocorticism, and persistent usage of glucocorticoids, as these play a vital role in the progression of APN. To manage such conditions, it is important to deal with the etiological agent, risk factors, diagnosis of diabetes, and hormonal and drug interaction along with its termination with suitable therapy (herbal) protocols. It should be noted that the protocols used for the diagnosis and treatment of human DM are not appropriate for animals. Further investigations regarding diabetic conditions of pets and wild animals are required, which will benefit the health status of

  5. Comparative occurrence of diabetes in canine, feline, and few wild animals and their association with pancreatic diseases and ketoacidosis with therapeutic approach

    Directory of Open Access Journals (Sweden)

    Kamal Niaz

    2018-04-01

    Full Text Available Diabetes mellitus (DM is a chronic metabolic disorder in which blood glucose level raises that can result in severe complications. However, the incidence increased mostly by obesity, pregnancy, persistent corpus luteum, and diestrus phase in humans and animals. This review has focused on addressing the possible understanding and pathogenesis of spontaneous DM in canine, feline, and few wild animals. Furthermore, pancreatic associated disorders, diabetic ketoacidosis, hormonal and drug interaction with diabetes, and herbal remedies associated with DM are elucidated. Bibliographic search for the present review was done using PubMed, Scopus, and Google Scholar for articles on concurrent DM in small and wild animals. Persistent corpus luteal and pseudopregnancy in female dogs generate gestational DM (GDM. GDM can also be caused by extensive use of drugs/hormones such as glucocorticosteroids. Although many similarities are present between diabetic cats and diabetic humans which present islet amyloidosis, there was a progressive loss of β- and α-cells and the normal number of δ-cells. The most prominent similarity is the occurrence of islet amyloidosis in all cases of diabetic cat and over 90% of human non-insulin dependent DM Type-2. Acute pancreatic necrosis (APN occurs due to predisposing factors such as insulin antagonism, insulin resistance, alteration in glucose tolerance, obesity, hyperadrenocorticism, and persistent usage of glucocorticoids, as these play a vital role in the progression of APN. To manage such conditions, it is important to deal with the etiological agent, risk factors, diagnosis of diabetes, and hormonal and drug interaction along with its termination with suitable therapy (herbal protocols. It should be noted that the protocols used for the diagnosis and treatment of human DM are not appropriate for animals. Further investigations regarding diabetic conditions of pets and wild animals are required, which will benefit the

  6. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

    Directory of Open Access Journals (Sweden)

    Mostfa Shahabi

    2017-09-01

    Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.

  7. Characteristics, immunological events, and diagnostics of Babesia spp. infection, with emphasis on Babesia canis

    Directory of Open Access Journals (Sweden)

    Kostro Krzysztof

    2015-12-01

    Full Text Available Vector-borne infection constitutes a significant health issue in dogs worldwide. Recent reports point to an increasing number of canine vector-borne disease cases in European countries, including Poland. Canine babesiosis caused by various Babesia species is a protozoal tick-borne disease with worldwide distribution and significant veterinary importance. The development and application of molecular methods have increased our knowledge about canine babesiosis, its prevalence, and clinical and pathological aspects of the infection. Parasitologists and veterinary surgeons need an accurate description of the species responsible for canine babesiosis to improve diagnostic and therapeutic methods, as well as predictions for the course of the disease. Therefore, we decided to summarise recent knowledge concerning Babesia species and B. canis.

  8. Podoplanin Expression in Canine Melanoma

    OpenAIRE

    Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

    2016-01-01

    A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...

  9. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus

    DEFF Research Database (Denmark)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter

    2009-01-01

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper...

  10. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos

    Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  11. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.

    2011-01-01

    INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  12. Molecular and serological surveillance of canine enteric viruses in stray dogs from Vila do Maio, Cape Verde.

    Science.gov (United States)

    Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis

    2014-04-23

    Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from

  13. Assessment of Periodontal Status of Surgically Exposed and Orthodontically Aligned Impacted Maxillary Canines

    Directory of Open Access Journals (Sweden)

    Adina Coșarcă

    2014-02-01

    Full Text Available Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of teeth. Conclusions: The assessed periodontal indices may signal the appearance of a periodontal disease around the teeth that were surgically and orthodontically treated

  14. FLT3 mutations in canine acute lymphocytic leukemia

    International Nuclear Information System (INIS)

    Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L

    2011-01-01

    FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias

  15. The Menkes and Wilson disease genes counteract in copper toxicosis in Labrador retrievers: a new canine model for copper-metabolism disorders

    NARCIS (Netherlands)

    Fieten, Hille; Gill, Yadvinder; Martin, Alan J.; Concilli, Mafalda; Dirksen, Karen; van Steenbeek, Frank G.; Spee, Bart; van den Ingh, Ted S. G. A. M.; Martens, Ellen C. C. P.; Festa, Paola; Chesi, Giancarlo; van de Sluis, Bart; Houwen, Roderick H. J. H.; Watson, Adrian L.; Aulchenko, Yurii S.; Hodgkinson, Victoria L.; Zhu, Sha; Petris, Michael J.; Polishchuk, Roman S.; Leegwater, Peter A. J.; Rothuizen, Jan

    2016-01-01

    The deleterious effects of a disrupted copper metabolism are illustrated by hereditary diseases caused by mutations in the genes coding for the copper transporters ATP7A and ATP7B. Menkes disease, involving ATP7A, is a fatal neurodegenerative disorder of copper deficiency. Mutations in ATP7B lead to

  16. The Menkes and Wilson disease genes counteract in copper toxicosis in Labrador retrievers : a new canine model for copper-metabolism disorders

    NARCIS (Netherlands)

    Fieten, Hille; Gill, Yadvinder; Martin, Alan J.; Concilli, Mafalda; Dirksen, Karen; van Steenbeek, Frank G.; Spee, Bart; van den Ingh, Ted S. G. A. M.; Martens, Ellen C. C. P.; Festa, Paola; Chesi, Giancarlo; Sluis, van de Bart; Houwen, Roderick H. J. H.; Watson, Adrian L.; Aulchenko, Yurii S.; Hodgkinson, Victoria L.; Zhu, Sha; Petris, Michael J.; Polishchuk, Roman S.; Leegwater, Peter A. J.; Rothuizen, Jan

    2016-01-01

    The deleterious effects of a disrupted copper metabolism are illustrated by hereditary diseases caused by mutations in the genes coding for the copper transporters ATP7A and ATP7B. Menkes disease, involving ATP7A, is a fatal neurodegenerative disorder of copper deficiency. Mutations in ATP7B lead to

  17. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

    OpenAIRE

    Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch

    2017-01-01

    Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...

  18. Recent advances in canine leptospirosis: focus on vaccine development

    Directory of Open Access Journals (Sweden)

    Klaasen HLBM

    2015-06-01

    Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis

  19. Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia

    Directory of Open Access Journals (Sweden)

    Víctor Acero P

    2015-09-01

    Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.

  20. Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman

    2011-01-01

    Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.

  1. Surgical Removal of a Canine Aortic Thromboembolism Secondary to Pancreatitis

    Directory of Open Access Journals (Sweden)

    Jill Narak

    2015-01-01

    Full Text Available A 7-year-old castrated male Pomeranian was evaluated on emergency for diagnostic work-up and treatment for acute nonpainful paraparesis. The neurologic examination suggested a L4-S3 myelopathy, but physical examination revealed lack of femoral pulses and rectal hypothermia, as well as a grade II/VI systolic heart murmur, so ischemic neuromyopathy was suspected. Clinicopathologic analysis revealed increased muscle enzymes and proteinuria. Abdominal ultrasonography confirmed aortic thromboembolism (ATE, and surgical histopathology diagnosed necrotizing pancreatitis. Surgical aortic thrombectomy was performed, and antithrombotic therapy was instituted. Pancreatitis was treated supportively. The dog was discharged to the owners after 10 days of hospitalization. Recheck examination 6 weeks after initial presentation revealed a normal neurologic examination and normal femoral pulses. The patient has had no further bouts of pancreatitis and remains neurologically normal 5 years after initial presentation. Canine ATE is relatively rare compared to the feline counterpart. Directed therapy for feline ATE is often not recommended, as underlying conditions are oftentimes ultimately fatal. Underlying etiologies for canine ATE include cardiovascular disease and endocrinopathies, but canine ATE secondary to pancreatitis has not yet been reported. Surgical removal of aortic thromboembolus should be considered as curative for pelvic limb dysfunction in the canine patient without a terminal underlying disease.

  2. Current state of knowledge: the canine gastrointestinal microbiome.

    Science.gov (United States)

    Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S

    2012-06-01

    Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.

  3. Changing patterns of wildlife diseases

    Science.gov (United States)

    McLean, R.G.

    2001-01-01

    The purpose of this paper was not to analyze the effects of global warming on wildlife disease patterns, but to serve as a springboard for future efforts to identify those wildlife diseases, including zoonotic diseases, that could be influenced the most by warming climates and to encourage the development of models to examine the potential effects. Hales et al. (1999) examined the relationship of the incidence of a vector-borne human disease, Dengue fever, and El Nino southern oscillations for South Pacific Island nations. The development of similar models on specific wildlife diseases which have environmental factors strongly associated with transmission would provide information and options for the future management of our wildlife resources.

  4. Emerging perspectives on hereditary glomerulopathies in canines

    Directory of Open Access Journals (Sweden)

    Littman MP

    2015-04-01

    Full Text Available Meryl P LittmanDepartment of Clinical Studies – Philadelphia, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA, USAAbstract: Familial glomerulopathies have been described in more than two dozen dog breeds. These canine spontaneous cases of glomerular disease are good models for their human counterparts. The dogs present clinically with protein-losing nephropathy and variable signs of hypertension, thromboembolic events, edema/effusions/nephrotic syndrome, or eventually with signs of renal disease such as anorexia, vomiting, weight loss, and/or polyuria/polydipsia. Laboratory changes include proteinuria, hypoalbuminemia, hypercholesterolemia, and eventually azotemia, hyperphosphatemia, anemia, and isosthenuria. Renal biopsies examined with transmission electron microscopy, immunofluorescence, and thin section light microscopy may show ultrastructural glomerular basement membrane abnormalities, glomerulosclerosis, amyloidosis, non-amyloid fibrillary deposition, or breed-associated predispositions for immune-complex glomerulonephritis. Genome-wide association studies and fine sequencing of candidate genes have led to the discovery of variant alleles associated with disease in some breeds; eg, 1 glomerular basement membrane ultrastructural abnormalities due to defective collagen type IV, caused by different premature stop codons in each of four breeds; ie, in COL4A5 in Samoyeds and Navasota mix breed dogs (X-linked, and in COL4A4 in English Cocker Spaniels and English Springer Spaniels (autosomal recessive; and 2 glomerulosclerosis-related podocytopathy with slit diaphragm protein anomalies of both nephrin and Neph3/filtrin due to non-synonymous single nucleotide polymorphisms in conserved regions of their encoding genes, NPHS1 and KIRREL2, in Soft Coated Wheaten Terriers and Airedale Terriers, with a complex mode of inheritance. Age at onset and progression to end-stage renal disease vary depending on the model. Genetic

  5. Heterogeneity within the hemagglutinin genes of canine distemper virus (CDV) strains detected in Italy

    DEFF Research Database (Denmark)

    Martella, V.; Cirone, F.; Elia, G.

    2006-01-01

    Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause....... These results suggest that at least three different CDV lineages are present in Italy. Keywords: Canine distemper virus; Dogs; Lineages; H gene...

  6. An Update on Therapeutic Management of Canine Demodicosis

    Directory of Open Access Journals (Sweden)

    S. K. Singh

    2011-02-01

    Full Text Available Canine demodicosis is a common noncontagious parasitic dermatosis caused by different spp of Demodex mites including Demodex canis, Demodex injai and D. cornei. Generalized demodicosis can be one of the most frustrating skin diseases, one will ever treat. Conventional and newer miticidal therapies are available to veterinarian to treat this frustrating skin disease. All recognized Demodex mites in dogs appear to respond similarly to mite targeted therapy. Treatment for canine demodicosis includes amitraz, ivermectin, milbemicin oxime, moxidectin, and doramectin. The use of any glucocorticoid-containing products is contraindicated and could favour disease generalization. Conventional treatments will often appear to work however, but it relies heavily on a highly toxic method of treatment. Using natural remedies for mange, on the other hand, can enhance the dog’s immune system, so that the body can fight off the mange mite infection by itself. [Veterinary World 2011; 4(1.000: 41-44

  7. The effect of global warming on infectious diseases.

    Science.gov (United States)

    Kurane, Ichiro

    2010-12-01

    Global warming has various effects on human health. The main indirect effects are on infectious diseases. Although the effects on infectious diseases will be detected worldwide, the degree and types of the effect are different, depending on the location of the respective countries and socioeconomical situations. Among infectious diseases, water- and foodborne infectious diseases and vector-borne infectious diseases are two main categories that are forecasted to be most affected. The effect on vector-borne infectious diseases such as malaria and dengue fever is mainly because of the expansion of the infested areas of vector mosquitoes and increase in the number and feeding activity of infected mosquitoes. There will be increase in the number of cases with water- and foodborne diarrhoeal diseases. Even with the strongest mitigation procedures, global warming cannot be avoided for decades. Therefore, implementation of adaptation measures to the effect of global warming is the most practical action we can take. It is generally accepted that the impacts of global warming on infectious diseases have not been apparent at this point yet in East Asia. However, these impacts will appear in one form or another if global warming continues to progress in future. Further research on the impacts of global warming on infectious diseases and on future prospects should be conducted.

  8. Podoplanin Expression in Canine Melanoma.

    Science.gov (United States)

    Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

    2016-12-01

    A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.

  9. Neglected vector-borne zoonoses in Europe: Into the wild.

    NARCIS (Netherlands)

    Tomassone, Laura; Berriatua, Eduardo; De Sousa, Rita; Duscher, Gerhard Georg; Mihalca, Andrei Daniel; Silaghi, Cornelia; Sprong, Hein; Zintl, Annetta

    2018-01-01

    Wild vertebrates are involved in the transmission cycles of numerous pathogens. Additionally, they can affect the abundance of arthropod vectors. Urbanization, landscape and climate changes, and the adaptation of vectors and wildlife to human habitats represent complex and evolving scenarios, which

  10. Canine neosporosis: perspectives on pathogenesis and management

    Directory of Open Access Journals (Sweden)

    Silva RC

    2016-04-01

    Full Text Available Rodrigo C Silva,1 Gustavo P Machado2 1Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Starkville, MS, USA; 2Department of Internal Medicine and Surgery of Small Animals, Dr Munhoz Veterinary Hospital, Itápolis, Brazil Abstract: Canine neosporosis is a worldwide disease caused by the obligate intracellular parasite protozoan Neospora caninum, manifesting mainly neurological symptoms. N. caninum has a heteroxenous life cycle and affects a wide range of warm-blooded animals. The domestic and wild canids are the definitive host of the parasite. They shed oocysts after ingestion of tissue cysts from infected intermediate hosts (ovine, equine, bovine, canine, and many other species, containing bradyzoites, or oocyst-contaminated water and food. The presence of dogs in farms is considered a risk factor for production animals. A wide range of diagnostic methods are currently available, but the most used is serology, ie, indirect fluorescent antibody test specific to the antibody detection in blood serum samples. No vaccine is available, but control strategies should be focused on the vertical and horizontal transmission of the parasite, ie, avoid feeding dogs with raw or undercooked meat, and taking care with water for human and animal consumption. No medicines to control the transplacental transmission are available yet. Keywords: neosporosis, Neospora caninum, pathogenesis, management, dogs

  11. Seroepidemiology of Canine parvovirus infection in dogs

    Directory of Open Access Journals (Sweden)

    Indrawati Sendow

    2004-10-01

    Full Text Available Canine parvovirus is an acute and fatal viral disease in dogs. A total of 209 local, cross breed and breed dogs sera from Kodya Bogor, Kabupaten Bogor, Sukabumi, and Jakarta, had been tested using Haemagglutination Inhibition Test (HI with pig red blood cells. A total of 64 breed and cross breed dogs from Sukabumi and Kodya Bogor, were used as a sentinel dogs to study the epidemiology of Canine parvovirus (CPV infection and its immunological responses caused by vaccination. The results indicated that 78% (95 breed and cross bred dogs and 59% (51 local dogs had antibody to CPV. Sentinel dogs results indicated that dogs had been vaccinated showed antibody response with the varied titre dependant upon prevaccination titre. Low prevaccinated titre gave better response than protective level titre. From 19 puppies observed, Maternal antibodi were still detected until 5 weeks old puppies. First vaccination given at less than 3 months old, should be boosted after 3 months old puppied. Antibodi titre produced by natural infection will keep untill 2 years. These data concluded that the dog condition and time of vaccination will affect the optimum antibody response.

  12. Analyses of critical target cell responses during preclinical phases of evolving chronic radiation-induced myeloproliferative disease-exploitation of a unique canine model

    International Nuclear Information System (INIS)

    Seed, T.M.; Kaspar, L.V.; Tolle, D.V.; Fritz, T.E.; Frazier, M.E.

    1988-01-01

    This document briefly summarizes and highlights ongoing studies on the cellular and molecular processes involved in the induction and progression of myeloid leukemia in dogs chronically exposed to low daily doses of wholebody gamma irradiation. Under such conditions, select groups of dogs exhibit extremely high frequencies of myeloproliferative disease (MPD) (i.e., /congruent/50%) of which myeloid leukemia is most prominent. 2 figs

  13. Analyses of critical target cell responses during preclinical phases of evolving chronic radiation-induced myeloproliferative disease-exploitation of a unique canine model

    Energy Technology Data Exchange (ETDEWEB)

    Seed, T.M.; Kaspar, L.V.; Tolle, D.V.; Fritz, T.E.; Frazier, M.E.

    1988-01-01

    This document briefly summarizes and highlights ongoing studies on the cellular and molecular processes involved in the induction and progression of myeloid leukemia in dogs chronically exposed to low daily doses of wholebody gamma irradiation. Under such conditions, select groups of dogs exhibit extremely high frequencies of myeloproliferative disease (MPD) (i.e., /congruent/50%) of which myeloid leukemia is most prominent. 2 figs.

  14. Expression and function of survivin in canine osteosarcoma.

    Science.gov (United States)

    Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H

    2012-01-01

    Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.

  15. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    International Nuclear Information System (INIS)

    Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma

    2006-01-01

    Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs

  16. Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.

    Directory of Open Access Journals (Sweden)

    Emily J Shields

    Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.

  17. Canine and feline colostrum.

    Science.gov (United States)

    Chastant-Maillard, S; Aggouni, C; Albaret, A; Fournier, A; Mila, H

    2017-04-01

    Puppy and kitten survival over the first weeks is particularly dependent on colostrum, a specific secretion of the mammary gland produced during the first 2 days post-partum. Colostrum is a source of nutrients and immunoglobulins. It also contributes to the digestive tract maturation. Colostrum differentiates from milk mainly based on its concentration in immunoglobulins G: 20-30 g/L in dog colostrum, 40-50 g/L in cats' vs <1 g/L in milk. IgG concentration rapidly drops after parturition (-50% in 24 hr). Immune quality of colostrum is highly variable between bitches, with no relationship with maternal blood IgG level, dam's age, breed size or litter size. In addition to systemic immune protection, colostrum also plays a major role for local digestive protection, due to IgA, lysozyme, lactoferrin, white blood cells and various cytokines. Energetic concentration of canine and feline colostrum is not superior to that of mature milk. It depends on colostrum fat concentration and is affected by breed size (higher in breeds <10 kg adult body weight). As puppies and kittens are almost agammaglobulinemic at birth, transfer of IgG from their digestive tract into their bloodstream is crucial for their survival, IgG absorption ending at 12-16 hr after birth. Energetic supply over the two first days of life, as evidenced by growth rate over the two first days of life, also affects risk of neonatal mortality. Early and sufficient suckling of colostrum is thus the very first care to be provided to newborns for their later health and survival. © 2016 Blackwell Verlag GmbH.

  18. Soluble Form of Canine Transferrin Receptor Inhibits Canine Parvovirus Infection In Vitro and In Vivo

    Science.gov (United States)

    Wen, Jiexia; Pan, Sumin; Liang, Shuang; Zhong, Zhenyu; He, Ying; Lin, Hongyu; Li, Wenyan; Wang, Liyue; Li, Xiujin; Zhong, Fei

    2013-01-01

    Canine parvovirus (CPV) disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR) was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR)) possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo. PMID:24089666

  19. Soluble Form of Canine Transferrin Receptor Inhibits Canine Parvovirus Infection In Vitro and In Vivo

    Directory of Open Access Journals (Sweden)

    Jiexia Wen

    2013-01-01

    Full Text Available Canine parvovirus (CPV disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo.

  20. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  1. A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article

    Directory of Open Access Journals (Sweden)

    S. Gur

    2009-05-01

    Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.

  2. Surgical innovations in canine gonadectomy

    NARCIS (Netherlands)

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated

  3. Immunohistochemical Characterization of Canine Lymphomas

    Directory of Open Access Journals (Sweden)

    Roxana CORA

    2017-11-01

    Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.

  4. Canine faecal contamination and parasitic risk in the city of Naples (southern Italy

    Directory of Open Access Journals (Sweden)

    Veneziano Vincenzo

    2006-09-01

    Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between

  5. Ontogeny of canine dimorphism in extant hominoids.

    Science.gov (United States)

    Schwartz, G T; Dean, C

    2001-07-01

    Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.

  6. Canine parvovirus effect on wolf population change and pup survival

    Science.gov (United States)

    Mech, L.D.; Goyal, S.M.

    1993-01-01

    Canine parvovirus infected wild canids more than a decade ago, but no population effect has been documented. In wild Minnesota wolves (Canis lupus) over a 12-yr period, the annual percent population increase and proportion of pups each were inversely related to the percentage of wolves serologically positive to the disease. Although these effects did not seem to retard this large extant population, similar relationships in more isolated wolf populations might hinder recovery of this endangered and threatened species.

  7. Seroprevalence of Canine Parvovirus in Dogs in Lusaka District, Zambia

    OpenAIRE

    Saasa, Ngonda; Nalubamba, King Shimumbo; M’kandawire, Ethel; Siwila, Joyce

    2016-01-01

    Canine parvovirus (CPV) enteritis is a highly contagious enteric disease of young dogs. Limited studies have been done in Zambia to investigate the prevalence of CPV in dogs. Blood was collected from dogs from three veterinary clinics (clinic samples, n = 174) and one township of Lusaka (field samples, n = 56). Each dog's age, sex, breed, and vaccination status were recorded. A haemagglutination assay using pig erythrocytes and modified live parvovirus vaccine as the antigen was used. Antibod...

  8. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    Directory of Open Access Journals (Sweden)

    Helen L. Del Puerto

    2010-02-01

    Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

  9. Guidelines for the diagnosis and antimicrobial therapy of canine superficial bacterial folliculitis (Antimicrobial Guidelines Working Group of the International Society for Companion Animal Infectious Diseases)

    DEFF Research Database (Denmark)

    Hillier, Andrew; Lloyd, David H.; Weese, J. Scott

    2014-01-01

    from diplomates of the American and European Colleges of Veterinary Dermatology. They describe optimal methods for the diagnosis and management of SBF, including isolation of the causative organism, antimicrobial susceptibility testing, selection of antimicrobial drugs, therapeutic protocols and advice......BACKGROUND: Superficial bacterial folliculitis (SBF) is usually caused by Staphylococcus pseudintermedius and routinely treated with systemic antimicrobial agents. Infection is a consequence of reduced immunity associated with alterations of the skin barrier and underlying diseases that may...... be difficult to diagnose and resolve; thus, SBF is frequently recurrent and repeated treatment is necessary. The emergence of multiresistant bacteria, particularly meticillin-resistant S. pseudintermedius (MRSP), has focused attention on the need for optimal management of SBF. OBJECTIVES: Provision...

  10. The relationship between the Southern Oscillation Index, rainfall and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia.

    Science.gov (United States)

    Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P

    2015-07-01

    The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Emerging viral diseases from a vaccinology perspective: preparing for the next pandemic.

    Science.gov (United States)

    Graham, Barney S; Sullivan, Nancy J

    2018-01-01

    Emerging infectious diseases will continue to threaten public health and are sustained by global commerce, travel and disruption of ecological systems. Most pandemic threats are caused by viruses from either zoonotic sources or vector-borne sources. Developing better ways to anticipate and manage the ongoing microbial challenge will be critical for achieving the United Nations Sustainable Development Goals and, conversely, each such goal will affect the ability to control infectious diseases. Here we discuss how technology can be applied effectively to better prepare for and respond to new viral diseases with a focus on new paradigms for vaccine development.

  12. Hyperbaric oxygen therapy as an effective adjunctive treatment for chronic Lyme disease

    Directory of Open Access Journals (Sweden)