WorldWideScience

Sample records for canine plasma samples

  1. Estimation of reference intervals from small samples: an example using canine plasma creatinine.

    Science.gov (United States)

    Geffré, A; Braun, J P; Trumel, C; Concordet, D

    2009-12-01

    According to international recommendations, reference intervals should be determined from at least 120 reference individuals, which often are impossible to achieve in veterinary clinical pathology, especially for wild animals. When only a small number of reference subjects is available, the possible bias cannot be known and the normality of the distribution cannot be evaluated. A comparison of reference intervals estimated by different methods could be helpful. The purpose of this study was to compare reference limits determined from a large set of canine plasma creatinine reference values, and large subsets of this data, with estimates obtained from small samples selected randomly. Twenty sets each of 120 and 27 samples were randomly selected from a set of 1439 plasma creatinine results obtained from healthy dogs in another study. Reference intervals for the whole sample and for the large samples were determined by a nonparametric method. The estimated reference limits for the small samples were minimum and maximum, mean +/- 2 SD of native and Box-Cox-transformed values, 2.5th and 97.5th percentiles by a robust method on native and Box-Cox-transformed values, and estimates from diagrams of cumulative distribution functions. The whole sample had a heavily skewed distribution, which approached Gaussian after Box-Cox transformation. The reference limits estimated from small samples were highly variable. The closest estimates to the 1439-result reference interval for 27-result subsamples were obtained by both parametric and robust methods after Box-Cox transformation but were grossly erroneous in some cases. For small samples, it is recommended that all values be reported graphically in a dot plot or histogram and that estimates of the reference limits be compared using different methods.

  2. Correlation between glucose concentrations in serum, plasma, and whole blood measured by a point-of-care glucometer and serum glucose concentration measured by an automated biochemical analyzer for canine and feline blood samples.

    Science.gov (United States)

    Tauk, Barbara S; Drobatz, Kenneth J; Wallace, Koranda A; Hess, Rebecka S

    2015-06-15

    To investigate the correlation between glucose concentrations in serum, plasma, and whole blood measured by a point-of-care glucometer (POCG) and serum glucose concentration measured by a biochemical analyzer. Prospective clinical study. 96 blood samples from 80 dogs and 90 blood samples from 65 cats. Serum, plasma, and whole blood were obtained from each blood sample. The glucose concentrations in serum, plasma, and whole blood measured by a POCG were compared with the serum glucose concentration measured by a biochemical analyzer by use of the Lin concordance correlation coefficient (ρc) and Bland-Altman plots. For both canine and feline samples, glucose concentrations in serum and plasma measured by the POCG were more strongly correlated with the serum glucose concentration measured by the biochemical analyzer (ρc, 0.98 for both canine serum and plasma; ρc, 0.99 for both feline serum and plasma) than was that in whole blood (ρc, 0.62 for canine samples; ρc, 0.90 for feline samples). The mean difference between the glucose concentrations determined by the biochemical analyzer and the POCG in serum, plasma, and whole blood was 0.4, 0.3, and 31 mg/dL, respectively, for canine samples and 7, 6, and 32 mg/dL, respectively, for feline samples. Results indicated that use of a POCG to measure glucose concentrations in serum or plasma may increase the accuracy and reliability of diagnostic and treatment decisions associated with glucose homeostasis disorders in dogs and cats.

  3. Measurement of plasma canine C peptide by radioimmunoassay

    Energy Technology Data Exchange (ETDEWEB)

    Besch, W; Woltanski, K P; Fischer, U; Kohnert, K D; Ziegler, M

    1985-12-01

    A sensitive radioimmunoassay for canine C peptide (CCP) was established using synthetic CCP, a specific antiserum, and rabbit anti-guinea pig serum. Radioiodination was performed according to a modified chloramine T method. Tracer preparations have been used for 6 weeks after iodination. The standard curve ranges from 0.028 to 3.0 nmol/l. The intra-assay coefficient of variation (CV) was 3-5% and the inter-assay CV was 6-9% in the optimal range between 0.3 and 0.8 nmol/l. The average recovery of CCP added to plasma samples was 100.6% (n = 9). Canine insulin, porcine proinsulin, bovine proinsulin, and human C peptide exhibited no cross-reactivity. The mean fasting plasma CCP concentration was 0.089 +- 0.021 nmol/l in normal dogs and -0.005 +- 0.007 nmol/l (mean +- SEM) in diabetic dogs, respectively.

  4. Evaluation of microbial contamination of canine plasma eyedropper bottles following clinical use in canine patients.

    Science.gov (United States)

    Strauss, Rachel A; Genschel, Ulrike; Allbaugh, Rachel A; Sebbag, Lionel; Ben-Shlomo, Gil

    2018-05-24

    To investigate microbial contamination of canine plasma eye drops when used clinically and to compare the effect of two different eyedropper bottles on contamination rate. Forty-six bottles containing plasma were randomly dispensed for use on 42 dogs with ulcerative keratitis. Of these, 23 were standard eyedropper bottles and 23 were Novelia ® bottles designed to prevent contamination. After use for up to 2 weeks, samples for bacterial culture were obtained from a drop of plasma, the bottle tip, the plasma inside the bottle, and the corneal surface. Fungal culture was performed from a drop of plasma. The overall microbial contamination rate was 17.4% (8/46 bottles); however, only one bottle had growth from the plasma inside the bottle. There was a lower contamination rate of Novelia ® bottles (3/23 = 13.0%) compared to standard bottles (5/23 = 21.7%), but this difference was not statistically significant (P = .57). There were also no significant differences in contamination rate of bottles used greater than 7 days compared to less than or equal to 7 days, or in bottles used greater than 4 times daily compared to 4 times daily or less. Three corneal samples (6.5%) had bacterial growth, but none matched contamination from the bottles. Novelia ® bottles may decrease contamination of plasma eye drops used clinically. However, while microbial contamination of plasma bottles was documented, no clinically relevant complications were observed. This study supports safe use of plasma eye drops for up to 2 weeks when refrigerated and dispensed from either Novelia ® or standard eyedropper bottles. © 2018 American College of Veterinary Ophthalmologists.

  5. Evaluation of assays for quantification of DNA in canine plasma as an indirect marker of NETosis.

    Science.gov (United States)

    Smith, Stephanie A; Lawson, Corinne M; McMichael, Maureen A; Jung, Katrina; O'Brien, Mauria; Achiel, Ron

    2017-06-01

    Neutrophil extracellular traps (NET), consisting of a filamentous DNA/chromatin-histone scaffold originating from neutrophils are part of the innate immune response, may be released under a variety of inflammatory conditions and are associated with an increased risk for thrombosis. The purpose of this study was to evaluate a SYTOX green fluorescence assay and a histone-DNA complex (hisDNA) ELISA for quantification of NET-related DNA in canine plasma. The influence of variations in blood sample handling on assay results was tested. Accuracy of the SYTOX green fluorescence and the hisDNA ELISA was evaluated with dilutional linearity using serial dilutions. Interference was assessed by addition of purified bilirubin or hemoglobin. Precision was determined by calculating the intra- and inter-assay CV. Preanalytic sample handling did not influence DNA measurements by either assay. Citrate and EDTA plasma samples were equivalent. For the DNA fluorescence assay, dilutional linearity was poor due to autofluorescence, which was corrected by addition of canine plasma to the diluent. The presence of bilirubin and hemoglobin also increased autofluorescence, and resulted in falsely low concentrations of DNA. On the hisDNA ELISA, pigmentemia had no effect. Both assays as modified in this study are suitable for measuring DNA in canine EDTA or citrate plasma. However, performance of the fluorescence assay was impacted by pigmentemia, and it was less sensitive than the ELISA in detecting the presence of nucleosome material in the plasma. © 2017 American Society for Veterinary Clinical Pathology.

  6. Plasma and skin vitamin E concentrations in canine atopic dermatitis.

    Science.gov (United States)

    Plevnik Kapun, Alja; Salobir, Janez; Levart, Alenka; Tavčar Kalcher, Gabrijela; Nemec Svete, Alenka; Kotnik, Tina

    2013-01-01

    Altered homeostasis of vitamin E has been demonstrated in human atopic dermatitis. Data on plasma and skin vitamin E concentrations in canine atopic dermatitis (CAD) are not available. To determine vitamin E concentrations in plasma and skin of atopic dogs. Vitamin E concentrations in plasma and full-thickness skin biopsies of 15 atopic dogs were related to CAD extent and severity index (CADESI-03) scores and compared to the equivalent concentrations in 17 healthy dogs. Statistically significant differences of measured parameters between the two groups were determined by the nonparametric Mann Whitney U test and correlations between CADESI-03 scores and vitamin E concentrations were evaluated by the Spearman rank test. A value of P vitamin E were significantly lower in atopic dogs than in healthy dogs, with median values of 29.8 and 52.9 μmol/L, respectively. Skin vitamin E values did not differ significantly between patients and healthy controls. The median concentration of skin vitamin E in atopic dogs was higher than that in healthy dogs. No significant correlations were found between CADESI-03 score and plasma vitamin E or skin vitamin E concentrations. Significantly lower plasma vitamin E concentrations in atopic dogs than in healthy controls indicate altered homeostasis of vitamin E in CAD. Further investigation into vitamin E supplementation in CAD is warranted.

  7. Radioimmunoassay for male canine plasma 4-androstenedione, testosterone and 5α-dihydrotestosterone

    International Nuclear Information System (INIS)

    Inaba, Toshio; Shimizu, Ryosuke; Imori, Tatsuo

    1977-01-01

    The radioimmunoassay for the simultaneous measurement of 4-androstenedione (A), testosterone (T), and 5α-dihydrotestosterone (DHT) in canine plasma was carried out. The assay for these 3 plasma steroids showed to be satisfactorily sensitive, specific, and accurate. The plasma steroid levels of peripheral and spermary vein plasma collected from 15 male dogs were (A) 0.86 +-0.75, (T) 1.19+-1.05 and (DHT) 0.30+-0.25 in peripheral vein, and (A) 30.2+-18.5, (T) 157+-98 and (DHT) 17.5+-10.7 in spermary vein, respectively (ng/ml and SD). Analysing these data, the significant correlation between two vein plasma levels was suggested. In order to estimate the normal or common diurnal variations of these plasma steroid levels in male dogs, 5 animals were employed, and their peripheral plasma samples were collected every an hour or two, throughout 24 hour period. In these data, the frequent intermittent peaks of plasma steroids were observed in each dog, and these seem to be their own diurnal changes. It was concluded that the peripheral plasma levels of A, T, and DHT were correlated to those in spermary vein, and these steroid levels were seemingly reflected by the episodic secretion from the gonads. (Kobatake, H.)

  8. Optimisation of a double-centrifugation method for preparation of canine platelet-rich plasma.

    Science.gov (United States)

    Shin, Hyeok-Soo; Woo, Heung-Myong; Kang, Byung-Jae

    2017-06-26

    Platelet-rich plasma (PRP) has been expected for regenerative medicine because of its growth factors. However, there is considerable variability in the recovery and yield of platelets and the concentration of growth factors in PRP preparations. The aim of this study was to identify optimal relative centrifugal force and spin time for the preparation of PRP from canine blood using a double-centrifugation tube method. Whole blood samples were collected in citrate blood collection tubes from 12 healthy beagles. For the first centrifugation step, 10 different run conditions were compared to determine which condition produced optimal recovery of platelets. Once the optimal condition was identified, platelet-containing plasma prepared using that condition was subjected to a second centrifugation to pellet platelets. For the second centrifugation, 12 different run conditions were compared to identify the centrifugal force and spin time to produce maximal pellet recovery and concentration increase. Growth factor levels were estimated by using ELISA to measure platelet-derived growth factor-BB (PDGF-BB) concentrations in optimised CaCl 2 -activated platelet fractions. The highest platelet recovery rate and yield were obtained by first centrifuging whole blood at 1000 g for 5 min and then centrifuging the recovered platelet-enriched plasma at 1500 g for 15 min. This protocol recovered 80% of platelets from whole blood and increased platelet concentration six-fold and produced the highest concentration of PDGF-BB in activated fractions. We have described an optimised double-centrifugation tube method for the preparation of PRP from canine blood. This optimised method does not require particularly expensive equipment or high technical ability and can readily be carried out in a veterinary clinical setting.

  9. Profiling of plasma metabolites in canine oral melanoma using gas chromatography-mass spectrometry.

    Science.gov (United States)

    Kawabe, Mifumi; Baba, Yuta; Tamai, Reo; Yamamoto, Ryohei; Komori, Masayuki; Mori, Takashi; Takenaka, Shigeo

    2015-08-01

    Malignant melanoma is one of the most common and aggressive tumors in the oral cavity of dog. The tumor has a poor prognosis, and methods for diagnosis and prediction of prognosis after treatment are required. Here, we examined metabolite profiling using gas chromatography-mass spectrometry (GC-MS) for development of a discriminant model for evaluation of prognosis. Metabolite profiles were evaluated in healthy and melanoma plasma samples using orthogonal projection to latent structure using discriminant analysis (OPLS-DA). Cases that were predicted to be healthy using the OPLS discriminant model had no advanced lesions after radiation therapy. These results indicate that metabolite profiling may be useful in diagnosis and prediction of prognosis of canine malignant melanoma.

  10. Canine adiponectin: cDNA structure, mRNA expression in adipose tissues and reduced plasma levels in obesity.

    Science.gov (United States)

    Ishioka, K; Omachi, A; Sagawa, M; Shibata, H; Honjoh, T; Kimura, K; Saito, M

    2006-04-01

    Adiponectin is a protein synthesized and secreted by adipocytes. Decreased adiponectin is responsible for insulin resistance and atherosclerosis associated with human obesity. We obtained a cDNA clone corresponding to canine adiponectin, whose nucleotide and deduced amino acid sequences were highly identical to those of other species. Adiponectin mRNA was detected in adipose tissues, but not in other tissues, of dogs. When 22 adult beagles were given a high-energy diet for 14 weeks, they became obese, showing heavier body weights, higher plasma leptin concentrations, but lower plasma adiponectin concentrations. The adiponectin concentrations of plasma samples collected from 71 dogs visiting veterinary practices were negatively correlated to plasma leptin concentrations, being lower in obese than non-obese dogs. These results are compatible with those reported in other species, and suggest that adiponectin is an index of adiposity and a target molecule for studies on diseases associated with obesity in dogs.

  11. Phylogenetic analysis of Austrian canine distemper virus strains from clinical samples from dogs and wild carnivores.

    Science.gov (United States)

    Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K

    2011-04-09

    Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.

  12. Low-density Lipoprotein Improves Motility and Plasma Membrane Integrity of Cryopreserved Canine Epididymal Spermatozoa.

    Science.gov (United States)

    Prapaiwan, N; Tharasanit, T; Punjachaipornpol, S; Yamtang, D; Roongsitthichai, A; Moonarmart, W; Kaeoket, K; Manee-In, S

    2016-05-01

    Cryopreservation of caudal epididymal spermatozoa is an effective technique to conserve genetic potentials of superior dogs when it is not possible to collect ejaculated spermatozoa. Although hen egg yolk is commonly supplemented into the semen extender, active substances within the egg yolk which protect sperm against cryoinjury remain to be discovered. Among its compositions, low-density lipoprotein (LDL) has been reported to have a cryoprotective property for sperm cryopreservation. However, the effects of LDL on dog epididymal spermatozoa during cryopreservation have not yet been investigated. This study aimed to investigate the effects of LDL on epididymal spermatozoa quality following cryopreservation and thawing. After routine castration of 12 dogs, caudal epididymides from individuals were separated from the testes and cut into a few pieces in a Tris-buffer. Spermatozoa recovered from each sample were examined at once for sperm quality and divided into six groups of extender: no LDL, 20% egg yolk, 4%, 8%, 16%, and 24% LDL, before cryopreservation. The sperm aliquots were then equilibrated and conventionally frozen. After thawing, sperm motility, morphology, plasma membrane integrity, and acrosome integrity were evaluated. The results revealed that 4% LDL and 20% egg yolk yielded significantly higher sperm motility (57.69% and 52.69%, respectively, p<0.05) than other LDLs. In addition, 4% LDL yielded the significantly highest plasma membrane integrity (70.54%, p<0.05). In conclusion, the supplementation of 4% LDL in Tris-glucose extender could be applied for cryopreservation of canine epididymal spermatozoa.

  13. Low-density Lipoprotein Improves Motility and Plasma Membrane Integrity of Cryopreserved Canine Epididymal Spermatozoa

    Directory of Open Access Journals (Sweden)

    N. Prapaiwan

    2016-05-01

    Full Text Available Cryopreservation of caudal epididymal spermatozoa is an effective technique to conserve genetic potentials of superior dogs when it is not possible to collect ejaculated spermatozoa. Although hen egg yolk is commonly supplemented into the semen extender, active substances within the egg yolk which protect sperm against cryoinjury remain to be discovered. Among its compositions, low-density lipoprotein (LDL has been reported to have a cryoprotective property for sperm cryopreservation. However, the effects of LDL on dog epididymal spermatozoa during cryopreservation have not yet been investigated. This study aimed to investigate the effects of LDL on epididymal spermatozoa quality following cryopreservation and thawing. After routine castration of 12 dogs, caudal epididymides from individuals were separated from the testes and cut into a few pieces in a Tris-buffer. Spermatozoa recovered from each sample were examined at once for sperm quality and divided into six groups of extender: no LDL, 20% egg yolk, 4%, 8%, 16%, and 24% LDL, before cryopreservation. The sperm aliquots were then equilibrated and conventionally frozen. After thawing, sperm motility, morphology, plasma membrane integrity, and acrosome integrity were evaluated. The results revealed that 4% LDL and 20% egg yolk yielded significantly higher sperm motility (57.69% and 52.69%, respectively, p<0.05 than other LDLs. In addition, 4% LDL yielded the significantly highest plasma membrane integrity (70.54%, p<0.05. In conclusion, the supplementation of 4% LDL in Tris-glucose extender could be applied for cryopreservation of canine epididymal spermatozoa.

  14. Carprofen pharmacokinetics in plasma and in control and inflamed canine tissue fluid using in vivo ultrafiltration.

    Science.gov (United States)

    Messenger, K M; Wofford, J A; Papich, M G

    2016-02-01

    Measurement of unbound drug concentrations at their sites of action is necessary for accurate PK/PD modeling. The objective of this study was to determine the unbound concentration of carprofen in canine interstitial fluid (ISF) using in vivo ultrafiltration and to compare pharmacokinetic parameters of free carprofen concentrations between inflamed and control tissue sites. We hypothesized that active concentrations of carprofen would exhibit different dispositions in ISF between inflamed vs. normal tissues. Bilateral ultrafiltration probes were placed subcutaneously in six healthy Beagle dogs 12 h prior to induction of inflammation. Two milliliters of either 2% carrageenan or saline control was injected subcutaneously at each probe site, 12 h prior to intravenous carprofen (4 mg/kg) administration. Plasma and ISF samples were collected at regular intervals for 72 h, and carprofen concentrations were determined using HPLC. Prostaglandin E2 (PGE2 ) concentrations were quantified in ISF using ELISA. Unbound carprofen concentrations were higher in ISF compared with predicted unbound plasma drug concentrations. Concentrations were not significantly higher in inflamed ISF compared with control ISF. Compartmental modeling was used to generate pharmacokinetic parameter estimates, which were not significantly different between sites. Terminal half-life (T½) was longer in the ISF compared with plasma. PGE2 in ISF decreased following administration of carprofen. In vivo ultrafiltration is a reliable method to determine unbound carprofen in ISF, and that disposition of unbound drug into tissue is much higher than predicted from unbound drug concentration in plasma. However, concentrations and pharmacokinetic parameter estimates are not significantly different in inflamed vs. un-inflamed tissues. © 2015 John Wiley & Sons Ltd.

  15. Characteristics of canine platelet-rich plasma prepared with five commercially available systems.

    Science.gov (United States)

    Franklin, Samuel P; Garner, Bridget C; Cook, James L

    2015-09-01

    To characterize platelet-rich plasma (PRP) products obtained from canine blood by use of a variety of commercially available devices. Blood samples from 15 dogs between 18 months and 9 years of age with no concurrent disease, except for osteoarthritis in some dogs. PRP products were produced from blood obtained from each of the 15 dogs by use of each of 5 commercially available PRP-concentrating systems. Complete blood counts were performed on each whole blood sample and PRP product. The degree of platelet, leukocyte, and erythrocyte concentration or reduction for PRP, compared with results for the whole blood sample, was quantified for each dog and summarized for each concentrating system. The various PRP-concentrating systems differed substantially in the amount of blood processed, method of PRP preparation, amount of PRP produced, and platelet, leukocyte, and erythrocyte concentrations or reductions for PRP relative to results for whole blood. The characteristics of PRP products differed considerably. Investigators evaluating the efficacy of PRPs need to specify the characteristics of the product they are assessing. Clinicians should be aware of the data (or lack of data) supporting use of a particular PRP for a specific medical condition.

  16. Sequence analysis of the canine mitochondrial DNA control region from shed hair samples in criminal investigations.

    Science.gov (United States)

    Berger, C; Berger, B; Parson, W

    2012-01-01

    In recent years, evidence from domestic dogs has increasingly been analyzed by forensic DNA testing. Especially, canine hairs have proved most suitable and practical due to the high rate of hair transfer occurring between dogs and humans. Starting with the description of a contamination-free sample handling procedure, we give a detailed workflow for sequencing hypervariable segments (HVS) of the mtDNA control region from canine evidence. After the hair material is lysed and the DNA extracted by Phenol/Chloroform, the amplification and sequencing strategy comprises the HVS I and II of the canine control region and is optimized for DNA of medium-to-low quality and quantity. The sequencing procedure is based on the Sanger Big-dye deoxy-terminator method and the separation of the sequencing reaction products is performed on a conventional multicolor fluorescence detection capillary electrophoresis platform. Finally, software-aided base calling and sequence interpretation are addressed exemplarily.

  17. A homologous radioimmunoassay for canine prolactin: plasma levels huring the reproductive cycle

    International Nuclear Information System (INIS)

    Coster, R. De; Beerens, D.; Mey, J. De; Beckers, J.-F.

    1983-01-01

    A method is described for the purification of canine prolactin, involving preparative isoelectrofocusing. Canine prolactin has a molecular weight of 23 000 daltons, an isoelectric point of 5.7 and exhibits a high degree of homogeneity in polyacrylamide gels stained by means of a silver method. A specific, homologous radioimmunoassay is described using the Bolton-Hunter method for preparation of the labelled ligand, with a sensitivity of 0.1 ng/tube. Basal plasma prolactin levels of 2-4 ng/ml obtained through the oestrous cycle remained fairly constant but a rise of 9 ng/ml was found at the end of dioestrus in non-pregnant bitches. Level also rose 30 days after mating to reach a peak of about 50 ng/ml near parturition and during early lactation. (author)

  18. Investigation of cell-free DNA in canine plasma and its relation to disease.

    Science.gov (United States)

    Burnett, Deborah L; Cave, Nicholas J; Gedye, Kristene R; Bridges, Janis P

    2016-09-01

    DNA is released from dying cells during apoptosis and necrosis. This cell-free DNA (cfDNA) diffuses into the plasma where it can be measured. In humans, an increase in cfDNA correlates with disease severity and prognosis. It was hypothesized that when DNA in canine plasma was measured by emission fluorometry without prior DNA extraction, the concentration of cfDNA would increase with disease severity. The diseased population consisted of 97 client-owned dogs. The clinically normal population consisted of nine client-owned dogs presenting for 'wellness screens', and 15 colony-owned Harrier Hounds. Plasma cfDNA was measured by fluorometry without prior DNA extraction. The effects of ex vivo storage conditions were evaluated in plasma from two clinically normal dogs. In all other dogs, plasma was separated within two hours of collection. The association between the cfDNA concentration in hospitalized dogs and a variety of clinical, clinicopathological and outcome variables was tested. The concentration of cfDNA was reliably measured when plasma was separated within two hours of blood collection. The diseased dogs had significantly higher cfDNA than clinically normal dogs (P Dogs that did not survive to discharge had significantly higher cfDNA concentrations than survivors (P = 0.02). Conclusions/Clinical Importance: The concentration of cfDNA in the plasma of diseased dogs is associated with disease severity and prognosis. Measurement of canine cfDNA could be a useful non-specific disease indicator and prognostic tool.

  19. Disruption of Splenic Lymphoid Tissue and Plasmacytosis in Canine Visceral Leishmaniasis: Changes in Homing and Survival of Plasma Cells.

    Science.gov (United States)

    Silva-O'Hare, Joselli; de Oliveira, Isabela Silva; Klevorn, Thaís; Almeida, Valter A; Oliveira, Geraldo G S; Atta, Ajax M; de Freitas, Luiz Antonio R; Dos-Santos, Washington L C

    2016-01-01

    Visceral leishmaniasis (VL) is a disease caused by Leishmania infantum, which is transmitted by phlebotomine sandflies. Dogs are the main urban reservoir of this parasite and the disease presents similar characteristics in both humans and dogs. In this paper, we investigated the potential pathways involved in plasma cell replacement of normal cell populations in the spleen, with respect to disease severity in dogs from an endemic area for visceral leishmaniasis. To this end, canine spleen samples were grouped into three categories: TYPE1SC- (non-infected dogs or without active infection with organized white pulp), TYPE1SC+ (infected dogs with organized white pulp) or TYPE3SC+ (infected animals with disorganized white pulp). We analyzed the distribution of different plasma cell isotypes (IgA, IgG and IgM) in the spleen. The expression of cytokines and chemokines involved in plasma cell homing and survival were assessed by real time RT-PCR. Polyclonal B cell activation and hypergammaglobulinemia were also evaluated. The proportion of animals with moderate or intense plasmacytosis was higher in the TYPE3SC+ group than in the other groups (Fisher test, Pspleen may contribute to the progression of VL, and impair the spleen's ability to protect against blood borne pathogens.

  20. Disruption of Splenic Lymphoid Tissue and Plasmacytosis in Canine Visceral Leishmaniasis: Changes in Homing and Survival of Plasma Cells.

    Directory of Open Access Journals (Sweden)

    Joselli Silva-O'Hare

    Full Text Available Visceral leishmaniasis (VL is a disease caused by Leishmania infantum, which is transmitted by phlebotomine sandflies. Dogs are the main urban reservoir of this parasite and the disease presents similar characteristics in both humans and dogs. In this paper, we investigated the potential pathways involved in plasma cell replacement of normal cell populations in the spleen, with respect to disease severity in dogs from an endemic area for visceral leishmaniasis. To this end, canine spleen samples were grouped into three categories: TYPE1SC- (non-infected dogs or without active infection with organized white pulp, TYPE1SC+ (infected dogs with organized white pulp or TYPE3SC+ (infected animals with disorganized white pulp. We analyzed the distribution of different plasma cell isotypes (IgA, IgG and IgM in the spleen. The expression of cytokines and chemokines involved in plasma cell homing and survival were assessed by real time RT-PCR. Polyclonal B cell activation and hypergammaglobulinemia were also evaluated. The proportion of animals with moderate or intense plasmacytosis was higher in the TYPE3SC+ group than in the other groups (Fisher test, P<0.05. This was mainly due to a higher density of IgG+ plasma cells in the red pulp of this group. The albumin/globulin ratio was lower in the TYPE3SC+ animals than in the TYPE1SC- or TYPE1SC+ animals, which evidences VL-associated dysproteinemia. Interestingly, TYPE3SC+ animals showed increased expression of the BAFF and APRIL cytokines, as well as chemokine CXCL12. Aberrant expression of BAFF, APRIL and CXCL12, together with amplified extrafollicular B cell activation, lead to plasma cell homing and the extended survival of these cells in the splenic red pulp compartment. These changes in the distribution of immunocompetent cells in the spleen may contribute to the progression of VL, and impair the spleen's ability to protect against blood borne pathogens.

  1. Experimental determination of net protein charge and A(tot) and K(a) of nonvolatile buffers in canine plasma.

    Science.gov (United States)

    Constable, Peter D; Stämpfli, Henry R

    2005-01-01

    Acid-base abnormalities frequently are present in sick dogs. The mechanism for an acid-base disturbance can be determined with the simplified strong ion approach, which requires accurate values for the total concentration of plasma nonvolatile buffers (A(tot)) and the effective dissociation constant for plasma weak acids (K(a)). The aims of this study were to experimentally determine A(tot) and K(a) values for canine plasma. Plasma was harvested from 10 healthy dogs; the concentrations of quantitatively important strong ions (Na+, K+, Ca2+, Mg2+, Cl-, L-lactate) and nonvolatile buffer ions (total protein, albumin, phosphate) were determined; and the plasma was tonometered with CO2 at 37 degrees C. Strong ion difference (SID) was calculated from the measured strong ion concentrations, and nonlinear regression was used to estimate values for A(tot) and K(a), which were validated with data from an in vitro and in vivo study. Mean (+/- SD) values for canine plasma were A(tot) = (17.4 +/- 8.6) mM (equivalent to 0.273 mmol/g of total protein or 0.469 mmol/g of albumin); K(a) = (0.17 +/- 0.11) x 10(-7); pK(a) = 7.77. The calculated SID for normal canine plasma (pH = 7.40; P(CO2) = 37 mm Hg; [total protein] = 64 g/L) was 27 mEq/L. The net protein charge for normal canine plasma was 0.25 mEq/g of total protein or 0.42 mEq/g of albumin. Application of the experimentally determined values for A(tot), K(a), and net protein charge should improve understanding of the mechanism for complex acid-base disturbances in dogs.

  2. Surface studies of plasma processed Nb samples

    International Nuclear Information System (INIS)

    Tyagi, Puneet V.; Doleans, Marc; Hannah, Brian S.; Afanador, Ralph; Stewart, Stephen; Mammosser, John; Howell, Matthew P; Saunders, Jeffrey W; Degraff, Brian D; Kim, Sang-Ho

    2015-01-01

    Contaminants present at top surface of superconducting radio frequency (SRF) cavities can act as field emitters and restrict the cavity accelerating gradient. A room temperature in-situ plasma processing technology for SRF cavities aiming to clean hydrocarbons from inner surface of cavities has been recently developed at the Spallation Neutron Source (SNS). Surface studies of the plasma-processed Nb samples by Secondary ion mass spectrometry (SIMS) and Scanning Kelvin Probe (SKP) showed that the NeO_2 plasma processing is very effective to remove carbonaceous contaminants from top surface and improves the surface work function by 0.5 to 1.0 eV.

  3. Ammonia concentrations in canine whole blood, EDTA-anticoagulated whole blood, and plasma measured by use of a point-of-care ammonia meter.

    Science.gov (United States)

    Odunayo, Adesola; Tobias, Karen M; Okafor, Chika C; Flatland, Bente

    2017-11-01

    OBJECTIVE To investigate the use of canine whole blood (WB) for measurement of ammonia concentration by use of a point-of-care ammonia meter and to compare results of measuring ammonia concentrations in WB, EDTA-anticoagulated WB, and plasma. ANIMALS 40 client-owned dogs. PROCEDURES A blood sample (2 mL) was obtained from each dog. One drop of WB was immediately applied to a test strip for evaluation with an ammonia meter. The remainder of the blood sample was placed in an EDTA-containing tube, and 1 drop of EDTA-anticoagulated WB was applied to a test strip. The remaining EDTA-anticoagulated WB sample was centrifuged, and the plasma was harvested and placed on ice. One drop of plasma was applied to a test strip; the remainder of the plasma sample was transported on ice and used for ammonia measurement with a reference laboratory instrument. All samples were tested within 1 hour after sample collection. Results were evaluated to detect significant differences in ammonia concentration. RESULTS Ammonia concentrations did not differ significantly between WB and EDTA-anticoagulated WB and between plasma samples measured with the meter and reference laboratory instrument. However, median ammonia concentration was significantly higher in plasma than in WB or EDTA-anti-coagulated WB. CONCLUSIONS AND CLINICAL RELEVANCE Anticoagulant-free WB was a valid sample for measurement by use of the ammonia meter. Plasma samples had higher ammonia concentrations than did WB samples. Results for each sample type should be interpreted by use of specimen- and method-specific reference intervals.

  4. The effectiveness of cooling conditions on temperature of canine EDTA whole blood samples.

    Science.gov (United States)

    Tobias, Karen M; Serrano, Leslie; Sun, Xiaocun; Flatland, Bente

    2016-01-01

    Preanalytic factors such as time and temperature can have significant effects on laboratory test results. For example, ammonium concentration will increase 31% in blood samples stored at room temperature for 30 min before centrifugation. To reduce preanalytic error, blood samples may be placed in precooled tubes and chilled on ice or in ice water baths; however, the effectiveness of these modalities in cooling blood samples has not been formally evaluated. The purpose of this study was to evaluate the effectiveness of various cooling modalities on reducing temperature of EDTA whole blood samples. Pooled samples of canine EDTA whole blood were divided into two aliquots. Saline was added to one aliquot to produce a packed cell volume (PCV) of 40% and to the second aliquot to produce a PCV of 20% (simulated anemia). Thirty samples from each aliquot were warmed to 37.7 °C and cooled in 2 ml allotments under one of three conditions: in ice, in ice after transfer to a precooled tube, or in an ice water bath. Temperature of each sample was recorded at one minute intervals for 15 min. Within treatment conditions, sample PCV had no significant effect on cooling. Cooling in ice water was significantly faster than cooling in ice only or transferring the sample to a precooled tube and cooling it on ice. Mean temperature of samples cooled in ice water was significantly lower at 15 min than mean temperatures of those cooled in ice, whether or not the tube was precooled. By 4 min, samples cooled in an ice water bath had reached mean temperatures less than 4 °C (refrigeration temperature), while samples cooled in other conditions remained above 4.0 °C for at least 11 min. For samples with a PCV of 40%, precooling the tube had no significant effect on rate of cooling on ice. For samples with a PCV of 20%, transfer to a precooled tube resulted in a significantly faster rate of cooling than direct placement of the warmed tube onto ice. Canine EDTA whole blood samples cool most

  5. Comparison of three methods for recovery of Brucella canis DNA from canine blood samples.

    Science.gov (United States)

    Batinga, Maria Cryskely A; Dos Santos, Jaíne C; Lima, Julia T R; Bigotto, Maria Fernanda D; Muner, Kerstin; Faita, Thalita; Soares, Rodrigo M; da Silva, David A V; Oliveira, Trícia M F S; Ferreira, Helena L; Diniz, Jaqueline A; Keid, Lara B

    2017-12-01

    Brucella canis, a gram-negative, facultative intracellular and zoonotic bacterium causes canine brucellosis. Direct methods are the most appropriate for the detection of canine brucellosis and bacterial isolation from blood samples has been employed as gold-standard method. However, due to the delay in obtaining results and the biological risk of the bacterial culturing, the polymerase chain reaction (PCR) has been successfully used as an alternative method for the diagnosis of the infection. Sample preparation is a key step for successful PCR and protocols that provide high DNA yield and purity are recommended to ensure high diagnostic sensitivity. The objective of this study was to evaluate the performance of PCR for the diagnosis of B. canis infection in 36 dogs by testing DNA of whole blood obtained through different extraction and purification protocols. Methods 1 and 2 were based on a commercial kit, using protocols recommended for DNA purification of whole blood and tissue samples, respectively. Method 3 was an in-house method based on enzymatic lysis and purification using organic solvents. The results of the PCR on samples obtained through three different DNA extraction protocols were compared to the blood culture. Of the 36 dogs, 13 (36.1%) were positive by blood culturing, while nine (25.0%), 14 (38.8%), and 15 (41.6%) were positive by PCR after DNA extraction using methods 1, 2 and 3, respectively. PCR performed on DNA purified by Method 2 was as efficient as blood culturing and PCR performed on DNA purified with in-house method, but had the advantage of being less laborious and, therefore, a suitable alternative for the direct B. canis detection in dogs. Copyright © 2017. Published by Elsevier B.V.

  6. Assessment of canine autologous platelet-rich plasma produced with a commercial centrifugation and platelet recovery kit.

    Science.gov (United States)

    Frye, Chris W; Enders, Andrew; Brooks, Marjory B; Struble, Angela M; Wakshlag, Joseph J

    2016-01-01

    To characterize the cellular composition (platelets, erythrocytes, and leukocytes) and confirm reproducibility of platelet enrichment, as well as determine the platelet activation status in the final product of a commercial platelet-rich plasma kit using canine blood. Venous blood from 20 sedated client-owned dogs was used to prepare platelet-rich plasma (PRP) from a commercial kit. Complete blood counts were performed to determine erythrocyte, leukocyte, and platelet numbers in both whole blood (WB) and resultant PRP. The WB and PRP samples from jugular (fast collection) and cephalic (slow collection) venipuncture were also compared. P-selectin externalization was measured in WB and PRP samples from 15 of 20 dogs. This commercial kit produced an average percent recovery in platelets of 64.7 ± 17.4; erythrocytes of 3.7 ± 0.8, and leukocytes of 31.6 ± 10.0. Neutrophil, monocyte, and lymphocyte percent recovery was 19.6 ± 7.2, 44.89 ± 19.8, and 57.5 ± 10.6, respectively. The recovery of platelets from jugular venipuncture (59.7 ± 13.6%) was lower than from cephalic recovery (68.8 ± 19.1%). The mean percent P-Selectin externalization for WB, PRP, and PRP with thrombin was 25.5 ± 30.9, 4.5 ± 6.4, and 90.6 ± 4.4 respectively. Cellular reproducibility of this kit was confirmed and platelets were concentrated within autologous serum. Additionally, measurements of P-selectin externalization showed that platelets are inactive in PRP unless stimulated to degranulate.

  7. Comparison of noninvasive sample collection procedures for canine leishmaniasis diagnosis by PCR-hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Sidney de Almeida; Andrade, Antero Silva Ribeiro de [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)]. E-mail: vidasnino@yahoo.com.br; antero@cdtn.br; Ituassu, Leonardo Trindade; Melo, Maria Norma de [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)]. E-mail: melo@mono.icb.ufmg.br; ltituassu@yahoo.com.br

    2007-07-01

    The dogs are the main reservoir of the visceral leishmaniasis etiological agent Leishmania chagasi and these animals have to be systematically monitored. The aim of present work was to standardize a method for canine leishmaniasis diagnosis using DNA samples obtained by a noninvasive ways. Two kind of samples were compared: conjunctival swab and blood. The samples were analyzed by the Polymerase Chain Reaction (PCR) associated with the hybridization of {sup 32}P labeled DNA probes. An in vitro test was carried out using cotton swabs seeded with L. chagasi parasites at different cell numbers. After that, the PCR and hybridization sensitivity was evaluated in two groups of 23 seropositive dogs. Conjunctival swabs and 1,0 mL of blood were collected from each animal. 90 {mu}L of these blood were spotted onto filter paper and the remaining used to prepare the buffy coat. The DNA purification from cotton swabs was carried out through the phenol-chloroform (group 1) or boiling (group 2). The Wizard kit was used to DNA extraction from buffy coat. The filters were treated according to Dialab protocol. The analysis of the seeded samples showed that the PCR was able to identify until ten parasites while the following hybridization of the PCR products allows the detection of until one parasite. The PCR positivity for the conjunctival swabs were 73.9% and 52.2% respectively to the groups 1 and 2. For buffy coat the positivities were 43.5% and 56.5% respectively. The filters presented the lowest positivity. The hybridization step was not accomplished yet for these samples. (author)

  8. Phylogenetic characterization of Canine Parvovirus VP2 partial sequences from symptomatic dogs samples.

    Science.gov (United States)

    Zienius, D; Lelešius, R; Kavaliauskis, H; Stankevičius, A; Šalomskas, A

    2016-01-01

    The aim of the present study was to detect canine parvovirus (CPV) from faecal samples of clinically ill domestic dogs by polymerase chain reaction (PCR) followed by VP2 gene partial sequencing and molecular characterization of circulating strains in Lithuania. Eleven clinically and antigen-tested positive dog faecal samples, collected during the period of 2014-2015, were investigated by using PCR. The phylogenetic investigations indicated that the Lithuanian CPV VP2 partial sequences (3025-3706 cds) were closely related and showed 99.0-99.9% identity. All Lithuanian sequences were associated with one phylogroup, but grouped in different clusters. Ten of investigated Lithuanian CPV VP2 sequences were closely associated with CPV 2a antigenic variant (99.4% nt identity). Five CPV VP2 sequences from Lithuania were related to CPV-2a, but were rather divergent (6.8 nt differences). Only one CPV VP2 sequence from Lithuania was associated (99.3% nt identity) with CPV-2b VP2 sequences from France, Italy, USA and Korea. The four of eleven investigated Lithuanian dogs with CPV infection symptoms were vaccinated with CPV-2 vaccine, but their VP2 sequences were phylogenetically distantly associated with CPV vaccine strains VP2 sequences (11.5-15.8 nt differences). Ten Lithuanian CPV VP2 sequences had monophyletic relations among the close geographically associated samples, but five of them were rather divergent (1.0% less sequence similarity). The one Lithuanian CPV VP2 sequence was closely related with CPV-2b antigenic variant. All the Lithuanian CPV VP2 partial sequences were conservative and phylogenetically low associated with most commonly used CPV vaccine strains.

  9. Management of an endo perio lesion in a maxillary canine using platelet-rich plasma concentrate and an alloplastic bone substitute

    Directory of Open Access Journals (Sweden)

    Singh Sangeeta

    2009-01-01

    Full Text Available To evaluate the efficacy of platelet-rich plasma concentrate in the management of a cirumferential, infrabony defect associated with an endoperio lesion in a maxillary canine. A 45 year-old male patient with an endoperio lesion in the left maxillary canine was initially treated with endodontic therapy. Following the endodontic treatment, the circumferential, infrabony defect was treated using platelet-rich plasma and an alloplastic bone substitute. At the end of three months, there was a gain in the clinical attachment level and reduction in probing depth. Radiographic evidence showed that there was significant bony fill. The results were maintained at the time of recall nine months later.

  10. Validation of 2 commercially available enzyme-linked immunosorbent assays for adiponectin determination in canine serum samples.

    Science.gov (United States)

    Tvarijonaviciute, Asta; Martínez-Subiela, Silvia; Ceron, José J

    2010-10-01

    The aim of this study was to validate 2 commercially available enzyme-linked immunosorbent assays (ELISAs) for adiponectin in dogs, 1 canine-specific and 1 originally designed for measurements in humans. Intra-assay and interassay precision was evaluated by multiple measurements in canine serum samples, and assay accuracy was indirectly determined by linearity under dilution. Interference caused by hemolysis and lipemia was also studied. Both assays were subsequently used for measuring adiponectin concentrations in clinically healthy dogs and those with different grades of obesity. The intra-assay and inter-assay precision was less than 7.5% and 13.5% in serum samples with low and high adiponectin concentrations, respectively. Lipemia and hemolysis did not affect the results of any of the assays. Both assays were able to differentiate lean dogs from those that were overweight or obese on the basis of the measured adiponectin concentrations. From these results it can be concluded that canine adiponectin concentrations can be measured reliably by means of the 2 ELISAs evaluated in this study.

  11. Assessment of Canine Autologous Conditioned PlasmaTM Cellular and Transforming Growth Factor-β1 Content

    Directory of Open Access Journals (Sweden)

    Samuel P. Franklin

    2018-06-01

    Full Text Available To evaluate (1 the cellular composition of canine ACP™ including using two different preparation protocols with variations on centrifugation time, (2 the effect of different activation protocols on the transforming growth factor (TGF-β1 content in the ACP, and (3 patient factors that might influence platelet concentration of the ACP.ACP was made with blood from 15 dogs using a manufacturer-recommended protocol[1]. Each ACP sample was divided into three aliquots that were activated with calcium chloride (CaCl2, human γ-thrombin (HGT, or not activated. TGF-β1 was quantified in each aliquot using an ELISA and comparisons among activation protocols were performed using a Skillings-Mack test. Correlations between platelet and TGF-β1 concentration were assessed with a Pearson correlation coefficient. ACP was subsequently prepared from an additional 17 dogs using a slightly modified centrifugation protocol and cellular composition was assessed. Effects of dog age, body weight, and hematocrit were assessed for their potential impact on ACP platelet concentration using a multiple linear regression analysis.The mean increase in platelet concentration in the ACP above that in the whole blood was 1.2× (±std 0.62 and leukocyte concentration was a mean of 26% (0.37 that in the whole blood using the standard protocol. There was a significant (p < 0.01 effect of activation on TGF-β1 concentrations with mean concentrations of 4,538 (2,317, 14,948 (13,784, and 14,096 (15,210 pg/ml in aliquots that were not activated or were activated with thrombin or CaCl2 respectively. There were significant correlations between the platelet concentration and TGF-β1 concentration in aliquots that were activated with either thrombin (r = 0.66; p < 0.01 or CaCl2 (r = 0.86, p < 0.0001. The mean increase in platelet concentration was 1.4× (0.62 and the leukocyte concentration was 0.28× (0.13 that in whole blood using the modified ACP preparation protocol. Dog age

  12. MT-PCR panel detection of canine parvovirus (CPV-2): Vaccine and wild-type CPV-2 can be difficult to differentiate in canine diagnostic fecal samples.

    Science.gov (United States)

    Meggiolaro, Maira N; Ly, Anna; Rysnik-Steck, Benjamin; Silva, Carolina; Zhang, Joshua; Higgins, Damien P; Muscatello, Gary; Norris, Jacqueline M; Krockenberger, Mark; Šlapeta, Jan

    2017-06-01

    Canine parvovirus (CPV-2) remains an important cause of devastating enteritis in young dogs. It can be successfully prevented with live attenuated CPV-2 vaccines when given at the appropriate age and in the absence of maternal antibody interference. Rapid diagnosis of parvoviral enteritis in young dogs is essential to ensuring suitable barrier nursing protocols within veterinary hospitals. The current diagnostic trend is to use multiplexed PCR panels to detect an array of pathogens commonly responsible for diarrhea in dogs. The multiplexed PCR assays do not distinguish wild from vaccine CPV-2. They are highly sensitive and detect even a low level of virus shedding, such as those caused by the CPV-2 vaccine. The aim of this study was to identify the CPV-2 subtypes detected in diagnostic specimens and rule out occult shedding of CPV-2 vaccine strains. For a total of 21 samples that tested positive for CPV-2 in a small animal fecal pathogens diagnostic multiplexed tandem PCR (MT-PCR) panel during 2014-2016 we partially characterized the VP2 gene of CPV-2. Vaccine CPV-2 strain, wild type CPV-2a subtypes and vaccine-like CPV-2b subtypes were detected. High copy number was indicative of wild-type CPV-2a presence, but presence of vaccine-like CPV-2b had a variable copy number in fecal samples. A yardstick approach to a copy number or C t -value to discriminate vaccine strain from a wild type virus of CPV-2 can be, in some cases, potentially misleading. Therefore, discriminating vaccine strain from a wild type subtype of CPV-2 remains ambitious. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Plasma androgen concentrations in initial samples from spotted ...

    African Journals Online (AJOL)

    1990-01-31

    Jan 31, 1990 ... initial samples, the immobilization stress response and the response to exogenous GnRH administration, for ... the sex-specific differences in plasma androgens is confounded by other variables such as the reproductive.

  14. Comparison of the platelet-rich plasma and buffy coat protocols for preparation of canine platelet concentrates.

    Science.gov (United States)

    Hoareau, Guillaume L; Jandrey, Karl E; Burges, Julie; Bremer, Daphne; Tablin, Fern

    2014-12-01

    Platelet (PLT) concentrates (PC) can be produced via the buffy coat (BC) or platelet-rich plasma (PRP) protocols. The 2 methods have not been compared with canine blood. The aims of the study were to compare the PLT, WBC, and RBC concentrations, in vitro PLT function, and markers of platelet storage lesion (PSL) in canine PC generated by 2 different protocols, and determine microbial growth throughout storage. PC from 8 healthy donor dogs were produced using 2 standard protocols, PRP and BC. PLT, WBC, and RBC counts, optical aggregometry assays, and PSL markers (pH, pCO2 , HCO3 , lactate and glucose concentrations, and LDH activity) were determined on storage days 0, 1, 3, 5, and 7. Aerobic and anaerobic bacterial cultures were also performed. Mean PLT counts were comparable between protocols and remained stable throughout storage up to day 7, while median WBC and RBC counts on day 0 were significantly higher in the BC-PC group (17,800 WBCs/μL; 195,000 RBCs/μL) than in the PRP-PC group (200 WBCs/μL; 10,000 RBCs/μL) (P = .012). In PRP-PC aggregometry, the median slope and amplitude in response to γ-thrombin and convulxin (+ ADP) were significantly decreased, and virtually absent in BC-PC during storage. PSL markers (lactate, LDH activity) were higher in BC-PC. Aerobic bacterial growth was observed in 2 PRP-PC and 1 BC-PC. This in vitro study suggests that PRP-PC had lesser WBC and RBC contamination and superior PLT function compared with BC-PC. In vivo studies are required to address safety and efficacy of PRP-PC. © 2014 American Society for Veterinary Clinical Pathology.

  15. Plasma as alternatively sample to quantify tetanus antitoxin

    Directory of Open Access Journals (Sweden)

    Ariel Menéndez-Barrios

    2015-08-01

    Full Text Available Tetanus antitoxin is quantified in Cuba at blood banks, from the serum of immunized donors, to produce aspecific human gamma globulin. A heterogeneous indirect immunoenzymatic assay is used, using the serum as analytical sample. The possible use of plasma obtained from plasmapheresis as alternative sample was evaluated in this research, to minimize the volume of total blood extracted to the donors. One hundred plasma donors who came to donate between October and November 2013 were selected by simple random sampling. Serum sample was obtained for extraction of 5 mL of blood, deposited in dry glass tube. While the other sample took 1.5 mL of plasma in a plastic tube with cover, at the end of the donation directly of the unit of plasma collected. Comparison of the difference between the means of both groups was done using SPSS for Windows. It was found that the values obtained in serum were bigger than those obtained in plasma. Difference between the means of both groups was statistically significant (p 0.00. It is not advisable to use the obtained plasma of the plasmapheresis as analytic sample in this assay.

  16. Blood sampling and hemolysis affect concentration of plasma metabolites

    DEFF Research Database (Denmark)

    Theil, Peter Kappel; Pedersen, Lene Juul; Jensen, Margit Bak

    2012-01-01

    design and blood was collected after restraint via vein puncture 1, 4, 11, and 23 h after morning feeding. Plasma samples were categorized as without or with minor or major hemolysis [clear (n = 218), yellow (n = 97), or red (n = 37)] upon centrifugation. Plasma NEFA (P ...Two experiments were carried out to reveal and quantify plasma metabolites that are sensitive to hemolysis and animal stress due to the blood sampling procedure (vein puncture vs. catheter). In Exp. 1, 48 sows were fed 4 diets either once (0800 h) or twice daily (0800 h and 1500 h) in a crossover......, a subset of samples from 24 sows fed twice daily in Exp. 1 was combined with data obtained from 30 sows sampled using jugular vein catheters. All sows in Exp. 2 were fed twice daily (0800 h and 1500 h) and blood samples collected repeatedly 1, 4, 11, and 23 h after morning feeding (other conditions were...

  17. Ion sampling and transport in Inductively Coupled Plasma Mass Spectrometry

    Science.gov (United States)

    Farnsworth, Paul B.; Spencer, Ross L.

    2017-08-01

    Quantitative accuracy and high sensitivity in inductively coupled plasma mass spectrometry (ICP-MS) depend on consistent and efficient extraction and transport of analyte ions from an inductively coupled plasma to a mass analyzer, where they are sorted and detected. In this review we examine the fundamental physical processes that control ion sampling and transport in ICP-MS and compare the results of theory and computerized models with experimental efforts to characterize the flow of ions through plasma mass spectrometers' vacuum interfaces. We trace the flow of ions from their generation in the plasma, into the sampling cone, through the supersonic expansion in the first vacuum stage, through the skimmer, and into the ion optics that deliver the ions to the mass analyzer. At each stage we consider idealized behavior and departures from ideal behavior that affect the performance of ICP-MS as an analytical tool.

  18. 51Cr-EDTA plasma clearance in severe renal failure determined by one plasma sample

    DEFF Research Database (Denmark)

    Kamper, A L; Nielsen, S L

    1989-01-01

    Two hundred and thirty-four measurements of standard 51Cr-EDTA plasma clearance were made in 50 patients with severe chronic renal failure. Based on these data two calculation methods were attempted using one plasma sample drawn 24 h after injection of 51Cr-EDTA. One of the methods used the 'one...... at zero-time was derived from injected dose and body surface area. This method might provide values 1.5 ml/min below or 0.8 ml/min above the established method of 51Cr-EDTA plasma clearance, which would be acceptable for clinical purposes. It is concluded that exact plasma clearance of 51Cr-EDTA in severe...... renal dysfunction (estimated clearance values below 21 ml/min) may be determined with adequate precision by one plasma sample drawn at 24 h after injection of the tracer without sampling at 5 h. This appears to be a very practical simplification....

  19. Experimental breakdown of selected anodized aluminum samples in dilute plasmas

    Science.gov (United States)

    Grier, Norman T.; Domitz, Stanley

    1992-01-01

    Anodized aluminum samples representative of Space Station Freedom structural material were tested for electrical breakdown under space plasma conditions. In space, this potential arises across the insulating anodized coating when the spacecraft structure is driven to a negative bias relative to the external plasma potential due to plasma-surface interaction phenomena. For anodized materials used in the tests, it was found that breakdown voltage varied from 100 to 2000 volts depending on the sample. The current in the arcs depended on the sample, the capacitor, and the voltage. The level of the arc currents varied from 60 to 1000 amperes. The plasma number density varied from 3 x 10 exp 6 to 10 exp 3 ions per cc. The time between arcs increased as the number density was lowered. Corona testing of anodized samples revealed that samples with higher corona inception voltage had higher arcing inception voltages. From this it is concluded that corona testing may provide a method of screening the samples.

  20. Examination of anonymous canine faecal samples provides data on endoparasite prevalence rates in dogs for comparative studies.

    Science.gov (United States)

    Hinney, Barbara; Gottwald, Michaela; Moser, Jasmine; Reicher, Bianca; Schäfer, Bhavapriya Jasmin; Schaper, Roland; Joachim, Anja; Künzel, Frank

    2017-10-15

    Several endoparasites of dogs cannot only be detrimental to their primary host but might also represent a threat to human health because of their zoonotic potential. Due to their high dog population densities, metropolitan areas can be highly endemic for such parasites. We aimed to estimate the prevalence of endoparasites in dogs in the Austrian capital of Vienna by examining a representative number of canine faecal samples and to compare the prevalences with two neighbouring peri-urban and rural regions. In addition we analysed whether the density of dog populations and cleanliness of dog zones correlated with parasite occurrence. We collected 1001 anonymous faecal samples from 55 dog zones from all 23 districts of the federal state of Vienna, as well as 480 faecal samples from the Mödling district and Wolkersdorf with a peri-urban and rural character, respectively. Faeces were examined by flotation and by Baermann technique. Additionally we evaluated 292 Viennese, 102 peri-urban and 50 rural samples for Giardia and Cryptosporidium by GiardiaFASTest ® and CryptoFASTest ® . Samples from "clean" dog zones were compared to samples from "dirty" zones. The infection rate of Toxocara was surprisingly low, ranging from 0.6% to 1.9%. Trichuris was the most frequent helminth (1.8-7.5%) and Giardia the most frequent protozoan (4.0-10.8%). Ancylostomatidae, Crenosoma, Capillaria, Taeniidae, Cystoisospora and Sarcocystis were found in 1.8-2.2%, 0-0.9%, 0-0.9%, 0-0.6%, 0.3-3.1% and 0-0.6% of the samples, respectively. Samples from "dirty" dog zones in Vienna showed a significantly higher rate of parasites overall (p=0.003) and of Trichuris (p=0.048) compared to samples from "clean" dog zones. There were no statistically significant differences in densely vs. less densely populated areas of Vienna. Samples from the rural region of Wolkersdorf had significantly higher overall parasite, Trichuris and Cystoisospora prevalences than the peri-urban Mödling district and Vienna (p

  1. Plasma metanephrine for assessing the selectivity of adrenal venous sampling

    NARCIS (Netherlands)

    Dekkers, T.; Deinum, J.; Schultze Kool, L.J.; Blondin, D.; Vonend, O.; Hermus, A.R.M.M.; Peitzsch, M.; Rump, L.C.; Antoch, G.; Sweep, F.C.; Bornstein, S.R.; Lenders, J.W.M.; Willenberg, H.S.; Eisenhofer, G.

    2013-01-01

    Adrenal vein sampling is used to establish the origins of excess production of adrenal hormones in primary aldosteronism. Correct catheter positioning is confirmed using adrenal vein measurements of cortisol, but this parameter is not always reliable. Plasma metanephrine represents an alternative

  2. On-line Automated Sample Preparation-Capillary Gas Chromatography for the Analysis of Plasma Samples.

    NARCIS (Netherlands)

    Louter, A.J.H.; van der Wagt, R.A.C.A.; Brinkman, U.A.T.

    1995-01-01

    An automated sample preparation module, (the automated sample preparation with extraction columns, ASPEC), was interfaced with a capillary gas chromatograph (GC) by means of an on-column interface. The system was optimised for the determination of the antidepressant trazodone in plasma. The clean-up

  3. Enhancement of abdominal wall defect repair using allogenic platelet-rich plasma with commercial polyester/cotton fabric (Damour) in a canine model

    Science.gov (United States)

    ABOUELNASR, Khaled; HAMED, Mohamed; LASHEN, Samah; EL-ADL, Mohamed; ELTAYSH, Rasha; TAGAWA, Michihito

    2017-01-01

    Platelet-rich plasma (PRP) has an important role in musculoskeletal surgery; however, it has been underutilized for accelerating the healing of abdominal wall defects in veterinary practice. Therefore, the aim of this study was to evaluate the use of commercial polyester/cotton fabric (Damour) as a new composite mesh for the repair of experimentally induced abdominal wall defects in canine models, and to investigate the possible role of PRP for improving such repair and reducing allied complications. For this purpose, abdominal wall defects were created in 24 healthy mongrel dogs and then repaired with mesh alone (control group) or mesh and allogenic PRP (PRP group). Dogs were euthanized after 2 or 4 months for gross examination of implantation site, detection of adhesion score and hernia recurrence. Moreover, tissue samples were collected for histological and gene expression analyses for neovascularization, collagen formation and tissue incorporation. Hernia recurrence was not recorded in PRP-treated dogs that also displayed significantly more neovascularization and less severe adhesion to the underlings (1.08 ± 0.51) in comparison to control group (2.08 ± 0.99). Histological and molecular evaluation confirmed the gross findings that collagen deposition, new vessel formation, and overexpression of angiogenic and myofibroplastic genes (COL1α1, COL3α1, VEGF and TGFβ1) were observed more frequently in the PRP group, at both time points. In conclusion, we found that addition of allogenic PRP to Damour mesh enhanced neovessel formation, and increased tissue deposition and incorporation, with subsequent reduction of peritoneal adhesion and recurrence rate. PMID:28603214

  4. Frequency, antimicrobial susceptibility and clonal distribution of methicillin-resistant Staphylococcus pseudintermedius in canine clinical samples submitted to a veterinary diagnostic laboratory in Italy: A 3-year retrospective investigation

    DEFF Research Database (Denmark)

    Ventrella, G.; Moodley, A.; Grandolfo, E.

    2017-01-01

    In the last decade there has been a rapid global spread of methicillin-resistant Staphylococcus pseudintermedius (MRSP) clones displaying multidrug resistance in dogs. We investigated prevalence, antimicrobial susceptibility and clonal distribution of MRSP isolated from clinical canine samples be...

  5. Influência da temperatura e do tempo de armazenamento nas dosagens bioquímicas de uréia e creatinina em soro ou plasma caninos Effect of temperature and storage time on urea and creatinine dosages from canine serum or plasma

    Directory of Open Access Journals (Sweden)

    S.T. Fernandes

    2001-12-01

    Full Text Available O trabalho teve como objetivos avaliar algumas condições de estocagem de soro e de plasma com EDTA 10% utilizados para determinação dos valores de uréia e creatinina em cães, e avaliar a possibilidade de substituir o soro pelo plasma conservado com EDTA 10%. Foram realizadas 3600 análises (1800 amostras de soro e 1800 de plasma com amostras que permaneceram em temperaturas ambiente, de refrigeração e de congelamento. As análises foram realizadas imediatamente após a obtenção da amostra (tempo 0 e após 2, 6, 12, 24, 72 horas e 30 e 60 dias após a coleta do sangue. Os resultados permitiram concluir que a uréia conservou-se por mais tempo na amostra sérica refrigerada até 30 dias e a creatinina na amostra sérica congelada até 72h. O soro mostrou mais estabilidade que o plasma em todas as condições de estoque estabelecidas.Aiming to evaluating some conditions of EDTA 10% serum and plasma storage for urea and creatinine values determinations in canines as well as analyzing the possibility of serum substitution by plasma, a total of 3600 samples (1800 serum and 1800 of plasma were analyzed at room, refrigeration and freezing temperatures. Different time intervals were used in the analysis: immediately after sampling (time 0, and at 2, 6, 12, 24, and 72 hours, and 30 and 60 days after the blood collection. The data showed that urea remains conserved for more time in the refrigerated serum sample until 30 days and the creatinine in the frozen serum sample until 72 hours. Serum showed more stability than plasma in all storage conditions established.

  6. Estimation of technetium 99m mercaptoacetyltriglycine plasma clearance by use of one single plasma sample

    International Nuclear Information System (INIS)

    Mueller-Suur, R.; Magnusson, G.; Karolinska Inst., Stockholm; Bois-Svensson, I.; Jansson, B.

    1991-01-01

    Recent studies have shown that technetium 99m mercaptoacetyltriglycine (MAG-3) is a suitable replacement for iodine 131 or 123 hippurate in gamma-camera renography. Also, the determination of its clearance is of value, since it correlates well with that of hippurate and thus may be an indirect measure of renal plasma flow. In order to simplify the clearance method we developed formulas for the estimation of plasma clearance of MAG-3 based on a single plasma sample and compared them with the multiple sample method based on 7 plasma samples. The correlation to effective renal plasma flow (ERPF) (according to Tauxe's method, using iodine 123 hippurate), which ranged from 75 to 654 ml/min per 1.73 m 2 , was determined in these patients. Using the developed regression equations the error of estimate for the simplified clearance method was acceptably low (18-14 ml/min), when the single plasma sample was taken 44-64 min post-injection. Formulas for different sampling times at 44, 48, 52, 56, 60 and 64 min are given, and we recommend 60 min as optimal, with an error of estimate of 15.5 ml/min. The correlation between the MAG-3 clearances and ERPF was high (r=0.90). Since normal values for MAG-3 clearance are not yet available, transformation to estimated ERPF values by the regression equation (ERPF=1.86xC MAG-3 +4.6) could be of clinical value in order to compare it with the normal values for ERPF given in the literature. (orig.)

  7. Osteoinduction on acid and heat treated porous Ti metal samples in canine muscle.

    Directory of Open Access Journals (Sweden)

    Toshiyuki Kawai

    Full Text Available Samples of porous Ti metal were subjected to different acid and heat treatments. Ectopic bone formation on specimens embedded in dog muscle was compared with the surface characteristics of the specimen. Treatment of the specimens by H2SO4/HCl and heating at 600 °C produced micrometer-scale roughness with surface layers composed of rutile phase of titanium dioxide. The acid- and heat-treated specimens induced ectopic bone formation within 6 months of implantation. A specimen treated using NaOH followed by HCl acid and then heat treatment produced nanometer-scale surface roughness with a surface layer composed of both rutile and anatase phases of titanium dioxide. These specimens also induced bone formation after 6 months of implantation. Both these specimens featured positive surface charge and good apatite-forming abilities in a simulated body fluid. The amount of the bone induced in the porous structure increased with apatite-forming ability and higher positive surface charge. Untreated porous Ti metal samples showed no bone formation even after 12 months. Specimens that were only heat treated featured a smooth surface composed of rutile. A mixed acid treatment produced specimens with micrometer-scale rough surfaces composed of titanium hydride. Both of them also showed no bone formation after 12 months. The specimens that showed no bone formation also featured almost zero surface charge and no apatite-forming ability. These results indicate that osteoinduction of these porous Ti metal samples is directly related to positive surface charge that facilitates formation of apatite on the metal surfaces in vitro.

  8. Effect of plasma-rich in platelet-derived growth factors on peri-implant bone healing: An experimental study in canines

    Science.gov (United States)

    Birang, Reza; Torabi, Alireza; Shahabooei, Mohammad; Rismanchian, Mansour

    2012-01-01

    Background: Tissue engineering principles can be exploited to enhance alveolar and peri-implant bone reconstruction by applying such biological factors as platelet-derived growth factors. The objective of the present study is to investigate the effect of autologous plasma-rich in growth factors (on the healing of peri-implant bone in canine mandible). Materials and Methods: In this prospective experimental animal study, two healthy canines of the Iranian mix breed were selected. Three months after removing their premolar teeth on both sides of the mandible, 12 implants of the Osteo Implant Corporationsystem, 5 mm in diameter and 10 mm in length, were selected to be implanted. Plasma rich in growth factors (PRGF) were applied on six implants while the other six were used as plain implants without the plasma. The implants were installed in osteotomy sites on both sides of the mandible to be removed after 4 weeks with the surrounding bones using a trephine bur. Mesio-distal sections and implant blocks, 50 μ in diameter containing the peri-implant bone, were prepared By basic fuchin toluidine-bluefor histological and histomorphometric evaluation by optical microscope. The data were analyzed using Mann-Whitney Test (PPRGF and control groups had no statistically significant differences (P=0.261, P=0.2) although the parameters showed higher measured values in the PRGF group. However, compared to the control, application of PRGF had significantly increased bone-to-implant contact (P=0.028) Conclusion: Based on the results, it may be concluded that application of PRGF on the surface of implant may enhance bone-to-implant contact. PMID:22363370

  9. 9 CFR 113.306 - Canine Distemper Vaccine.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...

  10. Platelet-Rich Plasma Favors Proliferation of Canine Adipose-Derived Mesenchymal Stem Cells in Methacrylate-Endcapped Caprolactone Porous Scaffold Niches

    Directory of Open Access Journals (Sweden)

    Victoria Moreno-Manzano

    2012-08-01

    Full Text Available Osteoarticular pathologies very often require an implementation therapy to favor regeneration processes of bone, cartilage and/or tendons. Clinical approaches performed on osteoarticular complications in dogs constitute an ideal model for human clinical translational applications. The adipose-derived mesenchymal stem cells (ASCs have already been used to accelerate and facilitate the regenerative process. ASCs can be maintained in vitro and they can be differentiated to osteocytes or chondrocytes offering a good tool for cell replacement therapies in human and veterinary medicine. Although ACSs can be easily obtained from adipose tissue, the amplification process is usually performed by a time consuming process of successive passages. In this work, we use canine ASCs obtained by using a Bioreactor device under GMP cell culture conditions that produces a minimum of 30 million cells within 2 weeks. This method provides a rapid and aseptic method for production of sufficient stem cells with potential further use in clinical applications. We show that plasma rich in growth factors (PRGF treatment positively contributes to viability and proliferation of canine ASCs into caprolactone 2-(methacryloyloxy ethyl ester (CLMA scaffolds. This biomaterial does not need additional modifications for cASCs attachment and proliferation. Here we propose a framework based on a combination of approaches that may contribute to increase the therapeutical capability of stem cells by the use of PRGF and compatible biomaterials for bone and connective tissue regeneration.

  11. Platelet-Rich Plasma Favors Proliferation of Canine Adipose-Derived Mesenchymal Stem Cells in Methacrylate-Endcapped Caprolactone Porous Scaffold Niches

    Science.gov (United States)

    Rodríguez-Jiménez, Francisco Javier; Valdes-Sánchez, Teresa; Carrillo, José M.; Rubio, Mónica; Monleon-Prades, Manuel; García-Cruz, Dunia Mercedes; García, Montserrat; Cugat, Ramón; Moreno-Manzano, Victoria

    2012-01-01

    Osteoarticular pathologies very often require an implementation therapy to favor regeneration processes of bone, cartilage and/or tendons. Clinical approaches performed on osteoarticular complications in dogs constitute an ideal model for human clinical translational applications. The adipose-derived mesenchymal stem cells (ASCs) have already been used to accelerate and facilitate the regenerative process. ASCs can be maintained in vitro and they can be differentiated to osteocytes or chondrocytes offering a good tool for cell replacement therapies in human and veterinary medicine. Although ACSs can be easily obtained from adipose tissue, the amplification process is usually performed by a time consuming process of successive passages. In this work, we use canine ASCs obtained by using a Bioreactor device under GMP cell culture conditions that produces a minimum of 30 million cells within 2 weeks. This method provides a rapid and aseptic method for production of sufficient stem cells with potential further use in clinical applications. We show that plasma rich in growth factors (PRGF) treatment positively contributes to viability and proliferation of canine ASCs into caprolactone 2-(methacryloyloxy) ethyl ester (CLMA) scaffolds. This biomaterial does not need additional modifications for cASCs attachment and proliferation. Here we propose a framework based on a combination of approaches that may contribute to increase the therapeutical capability of stem cells by the use of PRGF and compatible biomaterials for bone and connective tissue regeneration. PMID:24955632

  12. Effect of sampling site, repeated sampling, pH, and PCO2 on plasma lactate concentration in healthy dogs.

    Science.gov (United States)

    Hughes, D; Rozanski, E R; Shofer, F S; Laster, L L; Drobatz, K J

    1999-04-01

    To characterize the variation in plasma lactate concentration among samples from commonly used blood sampling sites in conscious, healthy dogs. 60 healthy dogs. Cross-sectional study using a replicated Latin square design. Each dog was assigned to 1 of 6 groups (n = 10) representing all possible orders for 3 sites (cephalic vein, jugular vein, and femoral artery) used to obtain blood. Samples were analyzed immediately, by use of direct amperometry for pH, PO2, Pco2, glucose, and lactate concentration. Significant differences in plasma lactate concentrations were detected among blood samples from the cephalic vein (highest), femoral artery, and jugular vein (lowest). Mean plasma lactate concentration in the first sample obtained, irrespective of sampling site, was lower than in subsequent samples. Covariation was identified among plasma lactate concentration, pH, and PCO2, but correlation coefficients were low. Plasma lactate concentrations differed among blood samples from various sites. A reference range for plasma lactate concentration was 0.3 to 2.5 mmol/L. Differences in plasma lactate concentrations among samples from various sites and with repeated sampling, in healthy dogs, are small. Use of the reference range may facilitate the clinical use of plasma lactate concentration in dogs.

  13. Plasma rico em plaquetas para reparação de falhas ósseas em cães Platelet-rich plasma for canine bone restoration

    Directory of Open Access Journals (Sweden)

    Anna Laeticia Trindade Barbosa

    2008-08-01

    Full Text Available As plaquetas chegam rapidamente ao local da ferida e liberam múltiplos fatores de crescimento (FC e citocinas que contribuem para a reparação óssea e aumentam a vascularização local. O Plasma Rico em Plaquetas (PRP concentra as plaquetas e os FC liberados por elas, aceleram a formação óssea e melhora a qualidade do trabeculado. Este trabalho apresenta um protocolo para confecção de PRP e demonstra alguns aspectos da sua utilização na reparação óssea de cães. O protocolo foi desenvolvido a partir de sangue coletado por punção jugular em três cães adultos, pesando em média 20kg. Para avaliação da aplicação clínica e dos aspectos da reparação óssea, foram criadas duas falhas mediais no terço proximal de cada tíbia. Assim, a falha 1 não foi preenchida, constituindo o controle, a falha 2 foi preenchida com 3mg de enxerto ósseo autógeno da crista da tíbia, a falha 3 com gel de plaquetas (PRP e falha a número 4 com a associação PRP e 3mg de enxerto ósseo autógeno. O protocolo laboratorial proposto mostrou-se de fácil execução e de baixo custo e possibilitou a concentração adequada de plaquetas no PRP final, cujo número foi dependente da contagem inicial no sangue total de cada animal. A comparação da radiopacidade na região da falha, em todos os tratamentos, e ao longo do tempo demonstrou que o PRP associado ao enxerto determinou maior precocidade e uniformidade de radiopacidade, quando comparado à falha preenchida pelo PRP e ao enxerto usados isoladamente, e sendo que ambos determinam melhores resultados de preenchimento que a falha mantida sem tratamento.The platelets arrive quickly at the injury site and release several growth factors (GF and citokines that contribute to bone repair and increasing local vascularization. The Platelet-rich Plasma (PRP concentrates the platelets and their growth factors, increasing the rate of bone formation and better quality of trabecular bone. This research presents

  14. Description of a double centrifugation tube method for concentrating canine platelets

    OpenAIRE

    Perazzi, Anna; Busetto, Roberto; Martinello, Tiziana; Drigo, Michele; Pasotto, Daniela; Cian, Francesco; Patruno, Marco; Iacopetti, Ilaria

    2013-01-01

    Background To evaluate the efficiency of platelet-rich plasma preparations by means of a double centrifugation tube method to obtain platelet-rich canine plasma at a concentration at least 4 times higher than the baseline value and a concentration of white blood cells not exceeding twice the reference range. A complete blood count was carried out for each sample and each concentrate. Whole blood samples were collected from 12 clinically healthy dogs (consenting blood donors). Blood was proces...

  15. Investigation of Peri-Implant Bone Healing Using Autologous Plasma Rich in Growth Factors in the Canine Mandible After 12 Weeks: A Pilot Study

    Science.gov (United States)

    Birang, Reza; Tavakoli, Mohammad; Shahabouei, Mohammad; Torabi, Alireza; Dargahi, Ali; Soolari, Ahmad

    2011-01-01

    Introduction: Faster reconstruction of patients’ masticatory systems is the aim of modern dentistry. A number of studies have indicated that application of growth factors to the surface of a dental implant leads to accelerated and enhanced osseointegration. The objective of the present study was to investigate the effect of plasma rich in growth factors on peri-implant bone healing. Materials and Methods: For the purpose of this study, two healthy, mixed-breed canines were selected, and the premolars were extracted from both sides of the mandible. Three months after premolar removal, 12 implants, each 5 mm in diameter and 10 mm in length, were placed in osteotomy sites on both sides of the mandible. Prior to placement, plasma rich in growth factors was applied to the surfaces of six implants, while the other six were used without plasma rich in growth factors. The implants were removed after 12 weeks along with the bone surrounding the sites using a trephine bur. One mesiodistal section containing the surrounding bone from each implant block, 50 µm in diameter, was prepared for histologic and histomorphometric investigation with an optical microscope. Results: The sites with implants treated with plasma rich in growth factors showed more bone-to-implant contact compared to control sites. Also, higher values for bone trabecular thickness and bone maturity were recorded for the PRGF-treated sites than for the control sites. Conclusion: Application of plasma rich in growth factors to the surface of an implant may enhance the bone healing process as well as bone-to-implant contact, thereby helping to achieve faster osseointegration. PMID:22145011

  16. High throughput pyrosequencing technology for molecular differential detection of Babesia vogeli, Hepatozoon canis, Ehrlichia canis and Anaplasma platys in canine blood samples.

    Science.gov (United States)

    Kaewkong, Worasak; Intapan, Pewpan M; Sanpool, Oranuch; Janwan, Penchom; Thanchomnang, Tongjit; Kongklieng, Amornmas; Tantrawatpan, Chairat; Boonmars, Thidarut; Lulitanond, Viraphong; Taweethavonsawat, Piyanan; Chungpivat, Sudchit; Maleewong, Wanchai

    2014-06-01

    Canine babesiosis, hepatozoonosis, ehrlichiosis, and anaplasmosis are tick-borne diseases caused by different hemopathogens. These diseases are causes of morbidity and mortality in dogs. The classic method for parasite detection and differentiation is based on microscopic observation of blood smears. The limitations of the microscopic method are that its performance requires a specially qualified person with professional competence, and it is ineffective in differentiating closely related species. This study applied PCR amplification with high throughput pyrosequencing for molecular differential detection of the following 4 hemoparasites common to tropical areas in dog blood samples: Babesia vogeli, Hepatozoon canis, Ehrlichia canis, and Anaplasma platys. PCR was initially used to amplify specific target regions of the ribosomal RNA genes of each parasite using 2 primer pairs that included 18S rRNA for protozoa (B. vogeli and H. canis) and 16S rRNA for rickettsia (E. canis and A. platys). Babesia vogeli and H. canis were discriminated using 9 nucleotide positions out of 30 base pairs, whereas E. canis and A. platys were differentiated using 15 nucleotide positions out of 34 base pairs that were determined from regions adjacent to 3' ends of the sequencing primers. This method provides a challenging alternative for a rapid diagnosis and surveillance of these tick-borne diseases in canines. Copyright © 2014 Elsevier GmbH. All rights reserved.

  17. Analysis of bioethanol samples through Inductively Coupled Plasma Mass Spectrometry with a total sample consumption system

    Science.gov (United States)

    Sánchez, Carlos; Lienemann, Charles-Philippe; Todolí, Jose-Luis

    2016-10-01

    Bioethanol real samples have been directly analyzed through ICP-MS by means of the so called High Temperature Torch Integrated Sample Introduction System (hTISIS). Because bioethanol samples may contain water, experiments have been carried out in order to determine the effect of ethanol concentration on the ICP-MS response. The ethanol content studied went from 0 to 50%, because higher alcohol concentrations led to carbon deposits on the ICP-MS interface. The spectrometer default spray chamber (double pass) equipped with a glass concentric pneumatic micronebulizer has been taken as the reference system. Two flow regimes have been evaluated: continuous sample aspiration at 25 μL min- 1 and 5 μL air-segmented sample injection. hTISIS temperature has been shown to be critical, in fact ICP-MS sensitivity increased with this variable up to 100-200 °C depending on the solution tested. Higher chamber temperatures led to either a drop in signal or a plateau. Compared with the reference system, the hTISIS improved the sensitivities by a factor included within the 4 to 8 range while average detection limits were 6 times lower for the latter device. Regarding the influence of the ethanol concentration on sensitivity, it has been observed that an increase in the temperature was not enough to eliminate the interferences. It was also necessary to modify the torch position with respect to the ICP-MS interface to overcome them. This fact was likely due to the different extent of ion plasma radial diffusion encountered as a function of the matrix when working at high chamber temperatures. When the torch was moved 1 mm plasma down axis, ethanolic and aqueous solutions provided statistically equal sensitivities. A preconcentration procedure has been applied in order to validate the methodology. It has been found that, under optimum conditions from the point of view of matrix effects, recoveries for spiked samples were close to 100%. Furthermore, analytical concentrations for real

  18. Monte Carlo Sampling of Negative-temperature Plasma States

    International Nuclear Information System (INIS)

    John A. Krommes; Sharadini Rath

    2002-01-01

    A Monte Carlo procedure is used to generate N-particle configurations compatible with two-temperature canonical equilibria in two dimensions, with particular attention to nonlinear plasma gyrokinetics. An unusual feature of the problem is the importance of a nontrivial probability density function R0(PHI), the probability of realizing a set Φ of Fourier amplitudes associated with an ensemble of uniformly distributed, independent particles. This quantity arises because the equilibrium distribution is specified in terms of Φ, whereas the sampling procedure naturally produces particles states gamma; Φ and gamma are related via a gyrokinetic Poisson equation, highly nonlinear in its dependence on gamma. Expansion and asymptotic methods are used to calculate R0(PHI) analytically; excellent agreement is found between the large-N asymptotic result and a direct numerical calculation. The algorithm is tested by successfully generating a variety of states of both positive and negative temperature, including ones in which either the longest- or shortest-wavelength modes are excited to relatively very large amplitudes

  19. Canine gastritis.

    Science.gov (United States)

    Webb, Craig; Twedt, David C

    2003-09-01

    Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.

  20. Ontogeny of canine dimorphism in extant hominoids.

    Science.gov (United States)

    Schwartz, G T; Dean, C

    2001-07-01

    Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.

  1. Canine adenovirus type 1 in a fennec fox (Vulpes zerda).

    Science.gov (United States)

    Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku

    2014-12-01

    A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.

  2. LC-MS analysis of the plasma metabolome–a novel sample preparation strategy

    DEFF Research Database (Denmark)

    Skov, Kasper; Hadrup, Niels; Smedsgaard, Jørn

    2015-01-01

    Blood plasma is a well-known body fluid often analyzed in studies on the effects of toxic compounds as physiological or chemical induced changes in the mammalian body are reflected in the plasma metabolome. Sample preparation prior to LC-MS based analysis of the plasma metabolome is a challenge...... as plasma contains compounds with very different properties. Besides, proteins, which usually are precipitated with organic solvent, phospholipids, are known to cause ion suppression in electrospray mass spectrometry. We have compared two different sample preparation techniques prior to LC-qTOF analysis...... of plasma samples: The first is protein precipitation; the second is protein precipitation followed by solid phase extraction with sub-fractionation into three sub-samples; a phospholipid, a lipid and a polar sub-fraction. Molecular feature extraction of the data files from LC-qTOF analysis of the samples...

  3. Comparison of measurement of 99mTc-MAG3 plasma clearance by single plasma sample and renal uptake ratio

    International Nuclear Information System (INIS)

    Ushijima, Yo; Sugihara, Hiroki; Okuyama, Chio; Okitsu, Sigeyuki; Nii, Takeshi; Nishida, Takuji; Okamoto, Kunio; Maeda, Tomoho

    1997-01-01

    Measurement of 99m Tc-MAG 3 plasma clearance based on one-compartment model (MPC method) is a non-invasive method using the renal uptake ratio. We evaluated the clinical usefulness of this method, compared with effective renal plasma flow (ERPF) using 123 I-OIH and two single-plasma sample methods using 99m Tc-MAG 3 (Russell method and Bubeck method). The ratio of 99m Tc-MAG 3 clearance to ERPF was 1.00±0.26. MPC method correlated well with Russell and Bubeck methods (r=0.904, r=0.897). We conclude that MPC method is a suitable replacement for single-plasma sample method in routine clinical use. (author)

  4. High-fat diet-induced insulin resistance does not increase plasma anandamide levels or potentiate anandamide insulinotropic effect in isolated canine islets.

    Directory of Open Access Journals (Sweden)

    Orison O Woolcott

    Full Text Available Obesity has been associated with elevated plasma anandamide levels. In addition, anandamide has been shown to stimulate insulin secretion in vitro, suggesting that anandamide might be linked to hyperinsulinemia.To determine whether high-fat diet-induced insulin resistance increases anandamide levels and potentiates the insulinotropic effect of anandamide in isolated pancreatic islets.Dogs were fed a high-fat diet (n = 9 for 22 weeks. Abdominal fat depot was quantified by MRI. Insulin sensitivity was assessed by the euglycemic-hyperinsulinemic clamp. Fasting plasma endocannabinoid levels were analyzed by liquid chromatography-mass spectrometry. All metabolic assessments were performed before and after fat diet regimen. At the end of the study, pancreatic islets were isolated prior to euthanasia to test the in vitro effect of anandamide on islet hormones. mRNA expression of cannabinoid receptors was determined in intact islets. The findings in vitro were compared with those from animals fed a control diet (n = 7.Prolonged fat feeding increased abdominal fat content by 81.3±21.6% (mean±S.E.M, P<0.01. In vivo insulin sensitivity decreased by 31.3±12.1% (P<0.05, concomitant with a decrease in plasma 2-arachidonoyl glycerol (from 39.1±5.2 to 15.7±2.0 nmol/L but not anandamide, oleoyl ethanolamide, linoleoyl ethanolamide, or palmitoyl ethanolamide. In control-diet animals (body weight: 28.8±1.0 kg, islets incubated with anandamide had a higher basal and glucose-stimulated insulin secretion as compared with no treatment. Islets from fat-fed animals (34.5±1.3 kg; P<0.05 versus control did not exhibit further potentiation of anandamide-induced insulin secretion as compared with control-diet animals. Glucagon but not somatostatin secretion in vitro was also increased in response to anandamide, but there was no difference between groups (P = 0.705. No differences in gene expression of CB1R or CB2R between groups were found.In canines, high-fat diet

  5. Effects of blood sample handling procedures on measurable inflammatory markers in plasma, serum and dried blood spot samples

    DEFF Research Database (Denmark)

    Skogstrand, K.; Thorsen, P.; Vogel, I.

    2008-01-01

    of whole blood samples at low temperatures and rapid isolation of plasma and serum. Effects of different handling procedures for all markers studied are given. DBSS proved to be a robust and convenient way to handle samples for immunoassay analysis of inflammatory markers in whole blood Udgivelsesdato......The interests in monitoring inflammation by immunoassay determination of blood inflammatory markers call for information on the stability of these markers in relation to the handling of blood samples. The increasing use of stored biobank samples for such ventures that may have been collected...... and stored for other purposes, justifies the study hereof. Blood samples were stored for 0, 4, 24, and 48 h at 4 degrees C, room temperature (RT), and at 35 degrees C, respectively, before they were separated into serum or plasma and frozen. Dried blood spot samples (DBSS) were stored for 0, 1, 2, 3, 7...

  6. Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.

    Science.gov (United States)

    Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S

    2017-06-03

    Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.

  7. IFCC guideline for sampling, measuring and reporting ionized magnesium in plasma

    DEFF Research Database (Denmark)

    Rayana, M.C. Ben; Burnett, R.W.; Covington, A.K.

    2008-01-01

    Analyzers with ion-selective electrodes (ISEs) for ionized magnesium (iMg) should yield comparable and unbiased results for iMg. This IFCC guideline on sampling, measuring and reporting iMg in plasma provides a prerequisite to achieve this goal [in this document, "plasma" refers to circulating...... plasma and the forms in which it is sampled, namely the plasma phase of anticoagulated whole blood (or "blood"), plasma separated from blood cells, or serum]. The guideline recommends measuring and reporting ionized magnesium as a substance concentration relative to the substance concentration...... of magnesium in primary aqueous calibrants with magnesium, sodium, and calcium chloride of physiological ionic strength. The recommended name is "the concentration of ionized magnesium in plasma". Based on this guideline, results will be approximately 3% higher than the true substance concentration and 4...

  8. Screening Samples for Arsenic by Inductively Coupled Plasma-Mass Spectrometry for Treaty Samples

    Science.gov (United States)

    2014-02-01

    quality system in accordance with International Organization for Standardization/International Electrotechnical Commission ( ISO / IEC ) 17025 :2005...plasma-mass spectrometry ISO / IEC International Organization for Standardization/International Electrotechnical Commission L lewisite MDL method

  9. Limited sampling strategy for determining metformin area under the plasma concentration-time curve

    DEFF Research Database (Denmark)

    Santoro, Ana Beatriz; Stage, Tore Bjerregaard; Struchiner, Claudio José

    2016-01-01

    AIM: The aim was to develop and validate limited sampling strategy (LSS) models to predict the area under the plasma concentration-time curve (AUC) for metformin. METHODS: Metformin plasma concentrations (n = 627) at 0-24 h after a single 500 mg dose were used for LSS development, based on all su...

  10. Relative Abundance of Proteins in Blood Plasma Samples from Patients with Chronic Cerebral Ischemia.

    Science.gov (United States)

    Kaysheva, Anna L; Kopylov, Artur T; Ponomarenko, Elena A; Kiseleva, Olga I; Teryaeva, Nadezhda B; Potapov, Alexander A; Izotov, Alexander А; Morozov, Sergei G; Kudryavtseva, Valeria Yu; Archakov, Alexander I

    2018-03-01

    A comparative protein profile analysis of 17 blood plasma samples from patients with ischemia and 20 samples from healthy volunteers was carried out using ultra-high resolution mass spectrometry. The analysis of measurements was performed using the proteomics search engine OMSSA. Normalized spectrum abundance factor (NSAF) in the biological samples was assessed using SearchGUI. The findings of mass spectrometry analysis of the protein composition of blood plasma samples demonstrate that the depleted samples are quite similar in protein composition and relative abundance of proteins. By comparing them with the control samples, we have found a small group of 44 proteins characteristic of the blood plasma samples from patients with chronic cerebral ischemia. These proteins contribute to the processes of homeostasis maintenance, including innate immune response unfolding, the response of a body to stress, and contribution to the blood clotting cascade.

  11. Mass spectrometric identification of diagnostic markers for chronic prostatitis in seminal plasma by analysis of seminal plasma protein clinical samples.

    Science.gov (United States)

    Rokka, A; Mehik, A; Tonttila, P; Vaarala, M

    2017-08-15

    There are few specific diagnostic markers for chronic prostatitis. Therefore, we used mass spectrometry to evaluate differences in seminal plasma protein expression among patients with prostatitis and young and middle-aged healthy controls. We analysed pooled seminal plasma protein samples from four prostatitis patients (two pools), three young controls (one pool), and three middle-aged controls (one pool). The samples were analysed by liquid chromatography-tandem mass spectrometry. Of the 349 proteins identified, 16 were differentially expressed between the two control pools. Five proteins were up- or down-regulated in both of the prostatitis pools compared to middle-aged controls but not between young and middle-aged pools. Progestagen-associated endometrial protein (PAEP) was over-expressed in prostatitis samples compared to young and middle-aged controls. Our findings and those of previous studies indicate that PAEP is a potential seminal plasma marker for chronic prostatitis. In conclusion, we found age-related changes in seminal plasma protein expression. PAEP expression in seminal plasma should be investigated further to evaluate its potential as a diagnostic marker for chronic prostatitis.

  12. Cracks and nanodroplets produced on tungsten surface samples by dense plasma jets

    Science.gov (United States)

    Ticoş, C. M.; Galaţanu, M.; Galaţanu, A.; Luculescu, C.; Scurtu, A.; Udrea, N.; Ticoş, D.; Dumitru, M.

    2018-03-01

    Small samples of 12.5 mm in diameter made from pure tungsten were exposed to a dense plasma jet produced by a coaxial plasma gun operated at 2 kJ. The surface of the samples was analyzed using a scanning electron microscope (SEM) before and after applying consecutive plasma shots. Cracks and craters were produced in the surface due to surface tensions during plasma heating. Nanodroplets and micron size droplets could be observed on the samples surface. An energy-dispersive spectroscopy (EDS) analysis revealed that the composition of these droplets coincided with that of the gun electrode material. Four types of samples were prepared by spark plasma sintering from powders with the average particle size ranging from 70 nanometers up to 80 μm. The plasma power load to the sample surface was estimated to be ≈4.7 MJ m-2 s-1/2 per shot. The electron temperature and density in the plasma jet had peak values 17 eV and 1.6 × 1022 m-3, respectively.

  13. Liquid-based cytology and cell block immunocytochemistry in veterinary medicine: comparison with standard cytology for the evaluation of canine lymphoid samples.

    Science.gov (United States)

    Fernandes, N C C A; Guerra, J M; Réssio, R A; Wasques, D G; Etlinger-Colonelli, D; Lorente, S; Nogueira, E; Dagli, M L Z

    2016-08-01

    Liquid-based Cytology (LBC) consists of immediate wet cell fixation with automated slide preparation. We applied LBC, cell block (CB) and immunocytochemistry to diagnose canine lymphoma and compare results with conventional cytology. Samples from enlarged lymph nodes of 18 dogs were collected and fixed in preservative solution for automated slide preparation (LBC), CB inclusion and immunophenotyping. Two CB techniques were tested: fixed sediment method (FSM) and agar method (AM). Anti-CD79a, anti-Pax5, anti-CD3 and anti-Ki67 were used in immunocytochemistry. LBC smears showed better nuclear and nucleolar definition, without cell superposition, but presented smaller cell size and worse cytoplasmic definition. FSM showed consistent cellular groups and were employed for immunocytochemistry, while AM CBs presented sparse groups of lymphocytes, with compromised analysis. Anti-Pax-5 allowed B-cell identification, both in reactive and neoplastic lymph nodes. Our preliminary report suggests that LBC and FSM together may be promising tools to improve lymphoma diagnosis through fine-needle aspiration. © 2015 John Wiley & Sons Ltd.

  14. PIXE elemental analysis of erythrocyte and blood plasma samples from human pregnancies

    International Nuclear Information System (INIS)

    Borbely-Kiss, I.; Koltay, E.; Laszlo, S.; Szabo, Gy.

    1984-01-01

    Elemental concentrations of P, S, Cl, K, Ca, Fe, Ni, Cu, Zn, Br, Rb have been determined in erythrocyte and blood plasma samples from normal and diabetic human pregnancies. Average values, the dependence of the concentrations on the time during gestation period, the correlation coefficients for pairs of elements as well as for the same elements in plasma and erythrocyte samples are given. A marked difference appeared in a number of cases between normal and diabetic pregnancies. (author)

  15. PIXE elemental analysis of erythrocyte and blood plasma samples from human pregnancies

    Energy Technology Data Exchange (ETDEWEB)

    Borbely-Kiss, I; Koltay, E; Laszlo, S; Szabo, Gy [Magyar Tudomanyos Akademia, Debrecen. Atommag Kutato Intezete; Goedeny, S [Orvostudomanyi Egyetem, Szeged (Hungary). Szueleszeti es Noegyogyaszati Klinika; Seif El-Nasr, S [Teachers' Coll. for Women, Samia (Kuwait)

    1984-07-01

    Elemental concentrations of P, S, Cl, K, Ca, Fe, Ni, Cu, Zn, Br, Rb have been determined in erythrocyte and blood plasma samples from normal and diabetic human pregnancies. Average values, the dependence of the concentrations on the time during gestation period, the correlation coefficients for pairs of elements as well as for the same elements in plasma and erythrocyte samples are given. A marked difference appeared in a number of cases between normal and diabetic pregnancies. 11 refs.

  16. Lincosamide resistance is less frequent in Denmark in Staphylococcus pseudintermedius from first-time canine superficial pyoderma compared with skin isolates from clinical samples with unknown clinical background.

    Science.gov (United States)

    Larsen, Rikke; Boysen, Lene; Berg, June; Guardabassi, Luca; Damborg, Peter

    2015-06-01

    Antimicrobial resistance may be overestimated in bacterial isolates from clinical samples because veterinarians often submit samples in cases of treatment failure or recurrent cases, which are more frequently associated with resistant strains. To assess to what extent the prevalence of antimicrobial resistance in Staphylococcus pseudintermedius isolated from first-time superficial pyoderma differs from canine skin isolates from clinical samples with unknown clinical background. Two study groups were enrolled in Denmark between March 2012 and October 2013: 57 dogs with first-time superficial pyoderma and no prior antimicrobial treatment (Group A); and 289 different dogs for which skin specimens were submitted for culture during the study (Group B). One S. pseudintermedius isolate from each dog was confirmed by MALDI-TOF mass spectrometry and tested for antimicrobial susceptibility by broth microdilution. Resistance levels in the two groups were compared by Fisher's exact test. Clindamycin resistance was less frequent in Group A (14%) than in Group B (27%) (P = 0.02). Similar trends were observed for amoxicillin-clavulanic acid (1.8 versus 4.8%), chloramphenicol (8.8 versus 14.5%), enrofloxacin (1.8 versus 3.5%), oxacillin (1.8 versus 4.8%) and trimethoprim/sulfamethoxazole (3.5 versus 5.9%). Oxacillin resistance was significantly associated with resistance to six of seven non-β-lactams. The prevalence of lincosamide resistance is markedly influenced by patients' clinical and antimicrobial treatment history. To limit selection of multidrug-resistant bacteria, lincosamides are appropriate empirical choices for treatment of first-time superficial pyoderma even though resistance is not infrequent. Culture and susceptibility testing are, however, recommended for all pyoderma patients. © 2015 ESVD and ACVD.

  17. Pre-storage centrifugation conditions have significant impact on measured microRNA levels in biobanked EDTA plasma samples

    DEFF Research Database (Denmark)

    Binderup, Helle Glud; Houlind, Kim; Madsen, Jonna Skov

    2016-01-01

    in platelets this may partly be explained by residual platelets in the plasma samples used. When collecting fresh plasma samples, it is possible to produce cell-free/platelet-poor plasma by centrifugation. In this study, we systematically investigated whether biobanked EDTA plasma samples could be processed...... to be suitable for miRNA analysis. Materials and methods: Blood samples were collected from ten healthy volunteers and centrifuged to produce platelet-poor-plasma (PPP) and standard biobank plasma. After one week at -80 °C the biobanked EDTA plasma was re-centrifuged by different steps to remove residual...... platelets. Using RT-qPCR the levels of 14 miRNAs in the different plasma preparations were compared to that of PPP. Results: We were able to remove residual platelets from biobanked EDTA plasma by re-centrifugation of the thawed samples. Nevertheless, for most of the investigated miRNAs, the miRNA level...

  18. Comparison of miRNA quantitation by Nanostring in serum and plasma samples.

    Directory of Open Access Journals (Sweden)

    Catherine Foye

    Full Text Available Circulating microRNAs that are associated with specific diseases have garnered much attention for use in diagnostic assays. However, detection of disease-associated miRNA can be affected by several factors such as release of contaminating cellular miRNA during sample collection, variations due to amplification of transcript for detection, or controls used for normalization for accurate quantitation. We analyzed circulating miRNA in serum and plasma samples obtained concurrently from 28 patients, using a Nanostring quantitative assay platform. Total RNA concentration ranged from 32-125 μg/ml from serum and 30-220 μg/ml from plasma. Of 798 miRNAs, 371 miRNAs were not detected in either serum or plasma samples. 427 were detected in either serum or plasma but not both, whereas 151 miRNA were detected in both serum and plasma samples. The diversity of miRNA detected was greater in plasma than in serum samples. In serum samples, the number of detected miRNA ranged from 3 to 82 with a median of 17, whereas in plasma samples, the number of miRNA detected ranged from 25 to 221 with a median of 91. Several miRNA such as miR451a, miR 16-5p, miR-223-3p, and mir25-3p were highly abundant and differentially expressed between serum and plasma. The detection of endogenous and exogenous control miRNAs varied in serum and plasma, with higher levels observed in plasma. Gene expression stability identified candidate invariant microRNA that were highly stable across all samples, and could be used for normalization. In conclusion, there are significant differences in both the number of miRNA detected and the amount of miRNA detected between serum and plasma. Normalization using miRNA with constant expression is essential to minimize the impact of technical variations. Given the challenges involved, ideal candidates for blood based biomarkers would be those that are indifferent to type of body fluid, are detectable and can be reliably quantitated.

  19. Controls to validate plasma samples for cell free DNA quantification

    DEFF Research Database (Denmark)

    Pallisgaard, Niels; Spindler, Karen-Lise Garm; Andersen, Rikke Fredslund

    2015-01-01

    , are diverging due to methodological differences with lack of standardisation and definition of sensitivity. The new biological information has not yet come into routine use. The present study presents external standardisation by spiking with non-human DNA fragments to control for loss of DNA during sample...... preparation and measurement. It also suggests a method to control for admixture of DNA from normal lymphocytes by utilizing the unique immunoglobulin gene rearrangement in the B-cells. The results show that this approach improves the quality of the analysis and lowers the risk of falsely increased values...

  20. Simulation of rarefied low pressure RF plasma flow around the sample

    International Nuclear Information System (INIS)

    Zheltukhin, V S; Shemakhin, A Yu

    2017-01-01

    The paper describes a mathematical model of the flow of radio frequency plasma at low pressure. The hybrid mathematical model includes the Boltzmann equation for the neutral component of the RF plasma, the continuity and the thermal equations for the charged component. Initial and boundary conditions for the corresponding equations are described. The electron temperature in the calculations is 1-4 eV, atoms temperature in the plasma clot is (3-4) • 10 3 K, in the plasma jet is (3.2-10) • 10 2 K, the degree of ionization is 10 -7 -10 -5 , electron density is 10 15 -10 19 m -3 . For calculations plasma parameters is developed soft package on C++ program language, that uses the OpenFOAM library package. Simulations for the vacuum chamber in the presence of a sample and the free jet flow were carried out. (paper)

  1. Simulation of rarefied low pressure RF plasma flow around the sample

    Science.gov (United States)

    Zheltukhin, V. S.; Shemakhin, A. Yu

    2017-01-01

    The paper describes a mathematical model of the flow of radio frequency plasma at low pressure. The hybrid mathematical model includes the Boltzmann equation for the neutral component of the RF plasma, the continuity and the thermal equations for the charged component. Initial and boundary conditions for the corresponding equations are described. The electron temperature in the calculations is 1-4 eV, atoms temperature in the plasma clot is (3-4) • 103 K, in the plasma jet is (3.2-10) • 102 K, the degree of ionization is 10-7-10-5, electron density is 1015-1019 m-3. For calculations plasma parameters is developed soft package on C++ program language, that uses the OpenFOAM library package. Simulations for the vacuum chamber in the presence of a sample and the free jet flow were carried out.

  2. Socket preservation using demineralized freezed dried bone allograft with and without plasma rich in growth factor: A canine study

    Science.gov (United States)

    Mogharehabed, Ahmad; Birang, Reza; Torabinia, Nakisa; Nasiri, Saman; Behfarnia, Parichehr

    2014-01-01

    Background: The accelerating effect of plasma rich in growth factors (PRGFs) in the healing of extraction sockets has been demonstrated by some studies. The aim of the present study was to histologically and histomorphometrically evaluate whether bone formation would increase by the combined use of PRGF and demineralized freeze-dried bone allograft (DFDBA). Materials and Methods: In four female dogs, the distal root of the second, third and fourth lower premolars were extracted bilaterally and the mesial roots were preserved. The extraction sockets were randomly divided into DFDBA + PRGF, DFDBA + saline or control groups. Two dogs were sacrificed after 2 weeks and two dogs were sacrificed after 6 weeks. The extraction sockets were evaluated from both histological and histomorphometrical aspects. The data were analyzed by Mann-Whitney followed by Kruskal-Wallis tests using the Statistical Package for the Social Sciences version 20 (SPSS Inc., Chicago, IL, USA). Significant levels were set at 0.05. Results: The least decrease in socket height was observed in the DFDBA + PRGF group (0.73 ± 0.42 mm). The least decrease in the coronal portion was observed in the DFDBA + PRGF group (1.38 ± 1.35 mm²). The least decrease in the middle surface was observed in the DFDBA group (0.61 ± 0.80 mm²). The least decrease in the apical portion was observed in the DFDBA group (0.34 ± 0.39 mm²). Conclusion: The present study showed better socket preservation subsequent to the application of DFDBA and PRGF combination in comparison with the two other groups. However, the difference was not statistically significant. PMID:25225559

  3. Socket preservation using demineralized freezed dried bone allograft with and without plasma rich in growth factor: A canine study

    Directory of Open Access Journals (Sweden)

    Ahmad Mogharehabed

    2014-01-01

    Full Text Available Background: The accelerating effect of plasma rich in growth factors (PRGFs in the healing of extraction sockets has been demonstrated by some studies. The aim of the present study was to histologically and histomorphometrically evaluate whether bone formation would increase by the combined use of PRGF and demineralized freeze-dried bone allograft (DFDBA. Materials and Methods: In four female dogs, the distal root of the second, third and fourth lower premolars were extracted bilaterally and the mesial roots were preserved. The extraction sockets were randomly divided into DFDBA + PRGF, DFDBA + saline or control groups. Two dogs were sacrificed after 2 weeks and two dogs were sacrificed after 6 weeks. The extraction sockets were evaluated from both histological and histomorphometrical aspects. The data were analyzed by Mann-Whitney followed by Kruskal-Wallis tests using the Statistical Package for the Social Sciences version 20 (SPSS Inc., Chicago, IL, USA. Significant levels were set at 0.05. Results: The least decrease in socket height was observed in the DFDBA + PRGF group (0.73 ± 0.42 mm. The least decrease in the coronal portion was observed in the DFDBA + PRGF group (1.38 ± 1.35 mm². The least decrease in the middle surface was observed in the DFDBA group (0.61 ± 0.80 mm². The least decrease in the apical portion was observed in the DFDBA group (0.34 ± 0.39 mm². Conclusion: The present study showed better socket preservation subsequent to the application of DFDBA and PRGF combination in comparison with the two other groups. However, the difference was not statistically significant.

  4. Proteomic biomarker discovery in 1000 human plasma samples with mass spectrometry

    DEFF Research Database (Denmark)

    Cominetti, Ornella; Núñez Galindo, Antonio; Corthésy, John

    2016-01-01

    automated proteomic biomarker discovery workflow. Herein, we have applied this approach to analyze 1000 plasma samples from the multicentered human dietary intervention study "DiOGenes". Study design, sample randomization, tracking, and logistics were the foundations of our large-scale study. We checked...

  5. Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

    NARCIS (Netherlands)

    Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2007-01-01

    Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

  6. Inductively coupled plasma mass spectrometry in the analysis of biological samples and pharmaceutical drugs

    Science.gov (United States)

    Ossipov, K.; Seregina, I. F.; Bolshov, M. A.

    2016-04-01

    Inductively coupled plasma mass spectrometry (ICP-MS) is widely used in the analysis of biological samples (whole blood, serum, blood plasma, urine, tissues, etc.) and pharmaceutical drugs. The shortcomings of this method related to spectral and non-spectral interferences are manifested in full measure in determination of the target analytes in these complex samples strongly differing in composition. The spectral interferences are caused by similarity of masses of the target component and sample matrix components. Non-spectral interferences are related to the influence of sample matrix components on the physicochemical processes taking place during formation and transportation of liquid sample aerosols into the plasma, on the value and spatial distribution of plasma temperature and on the transmission of the ion beam from the interface to mass spectrometer detector. The review is devoted to analysis of different mechanisms of appearance of non-spectral interferences and to ways for their minimization or elimination. Special attention is paid to the techniques of biological sample preparation, which largely determine the mechanisms of the influence of sample composition on the results of element determination. The ways of lowering non-spectral interferences by instrumental parameter tuning and application of internal standards are considered. The bibliography includes 189 references.

  7. Centrifugation protocols: tests to determine optimal lithium heparin and citrate plasma sample quality.

    Science.gov (United States)

    Dimeski, Goce; Solano, Connie; Petroff, Mark K; Hynd, Matthew

    2011-05-01

    Currently, no clear guidelines exist for the most appropriate tests to determine sample quality from centrifugation protocols for plasma sample types with both lithium heparin in gel barrier tubes for biochemistry testing and citrate tubes for coagulation testing. Blood was collected from 14 participants in four lithium heparin and one serum tube with gel barrier. The plasma tubes were centrifuged at four different centrifuge settings and analysed for potassium (K(+)), lactate dehydrogenase (LD), glucose and phosphorus (Pi) at zero time, poststorage at six hours at 21 °C and six days at 2-8°C. At the same time, three citrate tubes were collected and centrifuged at three different centrifuge settings and analysed immediately for prothrombin time/international normalized ratio, activated partial thromboplastin time, derived fibrinogen and surface-activated clotting time (SACT). The biochemistry analytes indicate plasma is less stable than serum. Plasma sample quality is higher with longer centrifugation time, and much higher g force. Blood cells present in the plasma lyse with time or are damaged when transferred in the reaction vessels, causing an increase in the K(+), LD and Pi above outlined limits. The cells remain active and consume glucose even in cold storage. The SACT is the only coagulation parameter that was affected by platelets >10 × 10(9)/L in the citrate plasma. In addition to the platelet count, a limited but sensitive number of assays (K(+), LD, glucose and Pi for biochemistry, and SACT for coagulation) can be used to determine appropriate centrifuge settings to consistently obtain the highest quality lithium heparin and citrate plasma samples. The findings will aid laboratories to balance the need to provide the most accurate results in the best turnaround time.

  8. Efficient discrimination and removal of phospholipids during electromembrane extraction from human plasma samples

    DEFF Research Database (Denmark)

    Vårdal, Linda; Gjelstad, Astrid; Huang, Chuixiu

    2017-01-01

    to be highly efficient for providing phospholipid-free extracts. CONCLUSION: Ultra-HPLC-MS/MS analysis of the donor solutions revealed that the phospholipids principally remained in the plasma samples. This proved that the phospholipids did not migrate in the electrical field and they were prevented from......AIM: For the first time, extracts obtained from human plasma samples by electromembrane extraction (EME) were investigated comprehensively with particular respect to phospholipids using ultra-high-performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS). Thhe purpose...

  9. Quantification of isotope-labelled and unlabelled folates in plasma, ileostomy and food samples.

    Science.gov (United States)

    Büttner, Barbara E; Öhrvik, Veronica E; Witthöft, Cornelia M; Rychlik, Michael

    2011-01-01

    New stable isotope dilution assays were developed for the simultaneous quantitation of [(13)C(5)]-labelled and unlabelled 5-methyltetrahydrofolic acid, 5-formyltetrahydrofolic acid, folic acid along with unlabelled tetrahydrofolic acid and 10-formylfolic acid in clinical samples deriving from human bioavailability studies, i.e. plasma, ileostomy samples, and food. The methods were based on clean-up by strong anion exchange followed by LC-MS/MS detection. Deuterated analogues of the folates were applied as the internal standards in the stable isotope dilution assays. Assay sensitivity was sufficient to detect all relevant folates in the respective samples as their limits of detection were below 0.62 nmol/L in plasma and below 0.73 μg/100 g in food or ileostomy samples. Quantification of the [(13)C(5)]-label in clinical samples offers the possibility to differentiate between folate from endogenous body pools and the administered dose when executing bioavailability trials.

  10. Canine thymoma

    International Nuclear Information System (INIS)

    Aronsohn, M.

    1985-01-01

    Thymoma is an uncommon canine neoplasm of thymic epithelial cells. It is seen in various breeds but may occur more frequently in German Shepherd Dogs. Middle-aged or older dogs can be affected and no sex predilection exists. A paraneoplastic syndrome of myasthenia gravis, nonthymic malignant tumors, and/or polymyositis occurs in a significant number of dogs with thymoma. Clinical signs are variable and are related to a space-occupying cranial mediastinal mass and/or manifestations of the paraneo-plastic syndrome. Dyspnea is the most common presenting clinical sign. Thoracic radiographs usually show a cranial mediastinal mass. Lymphoma is the main differential diagnosis. A definitive diagnosis may be made by closed biopsy but is more likely to be confirmed by thoracotomy. Thymomas may be completely contained within the thymic capsule or may spread by local invasion or metastasis. A staging system allows for an accurate prognosis and a therapeutic plan. Surgical removal of encapsulated thymomas may result in long-term survival or cure. Invasive or metastatic thymomas carry a guarded prognosis. Manifestations of the paraneoplastic syndrome complicate treatment. Adjuvant radiation and chemotherapy may be of value for advanced cases; however, adequate clinical trials have not been done in the dog

  11. Liquid sampling-atmospheric pressure glow discharge as a secondary excitation source: Assessment of plasma characteristics

    Science.gov (United States)

    Manard, Benjamin T.; Gonzalez, Jhanis J.; Sarkar, Arnab; Dong, Meirong; Chirinos, Jose; Mao, Xianglei; Russo, Richard E.; Marcus, R. Kenneth

    The liquid sampling-atmospheric pressure glow discharge (LS-APGD) has been assessed as a secondary excitation source with a parametric evaluation regarding carrier gas flow rate, applied current, and electrode distance. With this parametric evaluation, plasma optical emission was monitored in order to obtain a fundamental understanding with regards to rotational temperature (Trot), excitation temperature (Texc), electron number density (ne), and plasma robustness. Incentive for these studies is not only for a greater overall fundamental knowledge of the APGD, but also in instrumenting a secondary excitation/ionization source following laser ablation (LA). Rotational temperatures were determined through experimentally fitting of the N2 and OH molecular emission bands while atomic excitation temperatures were calculated using a Boltzmann distribution of He and Mg atomic lines. The rotational and excitation temperatures were determined to be ~ 1000 K and ~ 2700 K respectively. Electron number density was calculated to be on the order of ~ 3 × 1015 cm- 3 utilizing Stark broadening effects of the Hα line of the Balmer series and a He I transition. In addition, those diagnostics were performed introducing magnesium (by solution feed and laser ablation) into the plasma in order to determine any perturbation under heavy matrix sampling. The so-called plasma robustness factor, derived by monitoring Mg II/Mg I emission ratios, is also employed as a reflection of potential perturbations in microplasma energetics across the various operation conditions and sample loadings. While truly a miniaturized source (laser ablation sample introduction.

  12. Plasma functionalization of powdery nanomaterials using porous filter electrode and sample circulation

    Science.gov (United States)

    Lee, Deuk Yeon; Choi, Jae Hong; Shin, Jung Chul; Jung, Man Ki; Song, Seok Kyun; Suh, Jung Ki; Lee, Chang Young

    2018-06-01

    Compared with wet processes, dry functionalization using plasma is fast, scalable, solvent-free, and thus presents a promising approach for grafting functional groups to powdery nanomaterials. Previous approaches, however, had difficulties in maintaining an intimate sample-plasma contact and achieving uniform functionalization. Here, we demonstrate a plasma reactor equipped with a porous filter electrode that increases both homogeneity and degree of functionalization by capturing and circulating powdery carbon nanotubes (CNTs) via vacuum and gas blowing. Spectroscopic measurements verify that treatment with O2/air plasma generates oxygen-containing groups on the surface of CNTs, with the degree of functionalization readily controlled by varying the circulation number. Gas sensors fabricated using the plasma-treated CNTs confirm alteration of molecular adsorption on the surface of CNTs. A sequential treatment with NH3 plasma following the oxidation pre-treatment results in the functionalization with nitrogen species of up to 3.2 wt%. Our approach requiring no organic solvents not only is cost-effective and environmentally friendly, but also serves as a versatile tool that applies to other powdery micro or nanoscale materials for controlled modification of their surfaces.

  13. Study of aerosol sample interaction with dc plasma in the presence of oscillating magnetic field

    International Nuclear Information System (INIS)

    Stoiljkovic, M.M.; Pavlovic, M.S.; Savovic, J.; Kuzmanovic, M.; Marinkovic, M.

    2005-01-01

    Oscillating magnetic field was used to study the efficiency of the aerosol sample introduction into the dc plasma. At atmospheric plasmas, the effect of magnetic field is reduced to Lorentz forces on the current carrying plasma, which produces motion of the plasma. The motion velocity of dc plasma caused by oscillating magnetic field was correlated to spectral emission enhancement of analytes introduced as aerosols. Emission enhancement is the consequence of the reduced barrier to introduction of analyte species and aerosol particles into the hot plasma region. Two hypotheses described in the literature for the origin of the barrier are considered: (i) barrier induced by temperature field is based upon the thermophoretic forces on the aerosol particles when their radius is comparable to the molecular free path in the surrounding gas and (ii) barrier induced by radial electric field, recently described, that originates from gradients of charged particles in radial direction. Correlation between ionization energy of the analyte atoms with experimental emission enhancement obtained by the use of oscillating magnetic field indicates that mechanism (ii) based upon the radial electric field is predominant. The ultimate emission enhancement and possible analytical advantage is discussed

  14. New high temperature plasmas and sample introduction systems for analytical atomic emission and mass spectrometry

    International Nuclear Information System (INIS)

    Montaser, A.

    1993-01-01

    In this research, new high-temperature plasmas and new sample introduction systems are explored for rapid elemental and isotopic analysis of gases, solutions, and solids using mass spectrometry and atomic emission spectrometry. During the period January 1993--December 1993, emphasis was placed on (a) analytical investigations of atmospheric-pressure helium inductively coupled plasma (He ICP) that are suitable for atomization, excitation, and ionization of elements possessing high excitation and ionization energies; (b) simulation and computer modeling of plasma sources to predict their structure and fundamental and analytical properties without incurring the enormous cost of experimental studies; (c) spectrosopic imaging and diagnostic studies of high-temperature plasmas; (d) fundamental studies of He ICP discharges and argon-nitrogen plasma by high-resolution Fourier transform spectrometry; and (e) fundamental and analytical investigation of new, low-cost devices as sample introduction systems for atomic spectrometry and examination of new diagnostic techniques for probing aerosols. Only the most important achievements are included in this report to illustrate progress and obstacles. Detailed descriptions of the authors' investigations are outlined in the reprints and preprints that accompany this report. The technical progress expected next year is briefly described at the end of this report

  15. Canine specific ELISA for coagulation factor VII

    DEFF Research Database (Denmark)

    Knudsen, Tom; Kjelgaard-Hansen, Mads; Tranholm, Mikael

    2011-01-01

    available to date. In this study, a canine specific ELISA for measurement of FVII:Ag in plasma was developed and validated. The FVII:Ag ELISA correctly diagnosed homozygous and heterozygous hereditary FVII deficiency. Together with activity based assays, such as FVII:C, the FVII:Ag ELISA should be valuable...

  16. Analyses of metallic first mirror samples after long term plasma exposure in Tore Supra

    International Nuclear Information System (INIS)

    Lipa, M.; Schunke, B.; Gil, Ch.; Bucalossi, J.; Voitsenya, V.S.; Konovalov, V.; Vukolov, K.; Balden, M.; De Temmerman, G.; Oelhafen, P.; Litnovsky, A.; Wienhold, P.

    2006-01-01

    Metallic mirrors are foreseen in ITER diagnostic systems as optical elements directly viewing the plasma radiation. In the frame of an EFDA contract, metallic mirror samples have been exposed for long pulse plasma discharges in Tore Supra (TS) in order to investigate surface modifications caused by erosion and re-deposition processes. Three different materials have been selected: mono-crystalline molybdenum (mc-Mo), polycrystalline stainless steel (SS) and copper (Cu). The mc-Mo samples showed after TS exposure almost no surface roughness modifications and the lowest net-erosion. A slight reflectivity reduction, most pronounced in the near UV, is attributed to light absorption in a thin carbon deposit. Cu mirrors showed by far the highest surface roughness, erosion and diffusive reflectivity. Comparative laboratory glow discharge experiments with virgin reference samples and numerical simulations of erosion/deposition confirm the dominant contribution of conditioning procedures to erosion of mirrors exposed (without shutter protection) in Tore Supra

  17. The Spectral Emission Characteristics of Laser Induced Plasma on Tea Samples

    International Nuclear Information System (INIS)

    Zheng Peichao; Shi Minjie; Wang Jinmei; Liu Hongdi

    2015-01-01

    Laser induced breakdown spectroscopy (LIBS) provides a useful technique for food security as well as determining nutrition contents. In this paper, optical emission studies of laser induced plasma on commercial tea samples were carried out. The spectral intensities of Mg, Mn, Ca, Al, C and CN vibration bands varying with laser energy and the detection delay time of an intensified charge coupled device were studied. In addition, the relative concentrations of six microelements, i.e., Mg, Mn, Ca, Al, Na and K, were analyzed semi-quantitatively as well as H, for four kinds of tea samples. Moreover, the plasma parameters were explored, including electron temperature and electron number density. The electron temperature and electron number density were around 11000 K and 10 17 cm −3 , respectively. The results show that it is reasonable to consider the LIBS technique as a new method for analyzing the compositions of tea leaf samples. (paper)

  18. Proteomic Biomarker Discovery in 1000 Human Plasma Samples with Mass Spectrometry.

    Science.gov (United States)

    Cominetti, Ornella; Núñez Galindo, Antonio; Corthésy, John; Oller Moreno, Sergio; Irincheeva, Irina; Valsesia, Armand; Astrup, Arne; Saris, Wim H M; Hager, Jörg; Kussmann, Martin; Dayon, Loïc

    2016-02-05

    The overall impact of proteomics on clinical research and its translation has lagged behind expectations. One recognized caveat is the limited size (subject numbers) of (pre)clinical studies performed at the discovery stage, the findings of which fail to be replicated in larger verification/validation trials. Compromised study designs and insufficient statistical power are consequences of the to-date still limited capacity of mass spectrometry (MS)-based workflows to handle large numbers of samples in a realistic time frame, while delivering comprehensive proteome coverages. We developed a highly automated proteomic biomarker discovery workflow. Herein, we have applied this approach to analyze 1000 plasma samples from the multicentered human dietary intervention study "DiOGenes". Study design, sample randomization, tracking, and logistics were the foundations of our large-scale study. We checked the quality of the MS data and provided descriptive statistics. The data set was interrogated for proteins with most stable expression levels in that set of plasma samples. We evaluated standard clinical variables that typically impact forthcoming results and assessed body mass index-associated and gender-specific proteins at two time points. We demonstrate that analyzing a large number of human plasma samples for biomarker discovery with MS using isobaric tagging is feasible, providing robust and consistent biological results.

  19. Design and Demonstration of a Material-Plasma Exposure Target Station for Neutron Irradiated Samples

    International Nuclear Information System (INIS)

    Rapp, Juergen; Aaron, A. M.; Bell, Gary L.; Burgess, Thomas W.; Ellis, Ronald James; Giuliano, D.; Howard, R.; Kiggans, James O.; Lessard, Timothy L.; Ohriner, Evan Keith; Perkins, Dale E.; Varma, Venugopal Koikal

    2015-01-01

    5-20 MW/m"2 and ion fluxes up to 10"2"4 m"-"2s"-"1. Since PFCs will have to withstand neutron irradiation displacement damage up to 50 dpa, the target station design must accommodate radioactive specimens (materials to be irradiated in HFIR or at SNS) to enable investigations of the impact of neutron damage on materials. Therefore, the system will have to be able to install and extract irradiated specimens using equipment and methods to avoid sample modification, control contamination, and minimize worker dose. Included in the design considerations will be an assessment of all the steps between neutron irradiation and post-exposure materials examination/characterization, as well as an evaluation of the facility hazard categorization. In particular, the factors associated with the acquisition of radioactive specimens and their preparation, transportation, experimental configuration at the plasma-specimen interface, post-plasma-exposure sample handling, and specimen preparation will be evaluated. Neutronics calculations to determine the dose rates of the samples were carried out for a large number of potential plasma-facing materials.

  20. High plasma corticosterone levels persist during frequent automatic blood sampling in rats

    DEFF Research Database (Denmark)

    Abelson, Klas S P; Adem, Bashir; Royo, Felix

    2005-01-01

    Corticosterone levels in blood may be used as a marker of stress in rodents, provided that the blood sampling procedure itself is non-stressful. Automated blood sampling equipment (Accusampler) allows blood sampling without any interference with the animal and might be useful as a tool for an on......-line measurement of stress markers in blood. However, the impact of the blood sampling itself on the corticosterone levels in blood is unknown. The present study was designed to evaluate whether the frequency of blood sampling influences the plasma corticosterone levels in male and female rats. During anaesthesia...... the importance of considering the frequency of blood withdrawal during automated blood sampling. This parameter may have an impact on the experimental results when using blood corticosterone levels as a stress marker, but also during any in vivo study where blood is collected, since high corticosterone levels...

  1. Three-phase double-arc plasma for spectrochemical analysis of environmental samples.

    Science.gov (United States)

    Mohamed, M M; Ghatass, Z F; Shalaby, E A; Kotb, M M; El-Raey, M

    2000-12-01

    A new instrument, which uses a three-phase current to support a double-arc argon plasma torch for evaporation, atomization and excitation of solid or powder samples, is described. The sampling arc is ignited between the first and second electrode while the excitation arc is ignited between the second and third electrode. Aerosol generated from the sample (first electrode) is swept by argon gas, through a hole in the second electrode (carbon tubing electrode), into the excitation plasma. A tangential stream of argon gas is introduced through an inlet orifice as a coolant gas for the second electrode. This gas stream forces the excitation arc discharge to rotate reproducibly around the electrode surface. Discharge rotation increases the stability of the excitation plasma. Spectroscopic measurements are made directly in the current-carrying region of the excitation arc. An evaluation of each parameter influencing the device performance was performed. Analytical calibration curves were obtained for Fe, Al, K, and Pb. Finally, the present technique was applied for the analysis of environmental samples. The present method appears to have significant, low cost analytical utility for environmental measurements.

  2. Radionuclide determination in environmental samples by inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Lariviere, Dominic; Taylor, Vivien F.; Evans, R. Douglas; Cornett, R. Jack

    2006-01-01

    The determination of naturally occurring and anthropogenic radionuclides in the environment by inductively coupled plasma mass spectrometry has gained recognition over the last fifteen years, relative to radiometric techniques, as the result of improvement in instrumental performance, sample introduction equipment, and sample preparation. With the increase in instrumental sensitivity, it is now possible to measure ultratrace levels (fg range) of many radioisotopes, including those with half-lives between 1 and 1000 years, without requiring very complex sample pre-concentration schemes. However, the identification and quantification of radioisotopes in environmental matrices is still hampered by a variety of analytical issues such as spectral (both atomic and molecular ions) and non-spectral (matrix effect) interferences and instrumental limitations (e.g., abundance sensitivity). The scope of this review is to highlight recent analytical progress and issues associated with the determination of radionuclides by inductively coupled plasma mass spectrometry. The impact of interferences, instrumental limitations (e.g., degree of ionization, abundance sensitivity, detection limits) and low sample-to-plasma transfer efficiency on the measurement of radionuclides by inductively coupled plasma mass spectrometry will be described. Solutions that overcome these issues will be discussed, highlighting their pros and cons and assessing their impact on the measurement of environmental radioactivity. Among the solutions proposed, mass and chemical resolution through the use of sector-field instruments and chemical reactions/collisions in a pressurized cell, respectively, will be described. Other methods, such as unique sample introduction equipment (e.g., laser ablation, electrothermal vaporisation, high efficiency nebulization) and instrumental modifications/optimizations (e.g., instrumental vacuum, radiofrequency power, guard electrode) that improve sensitivity and performance

  3. Prediction of two-sample 99mTc-diethylene triamine pentaacetic acid plasma clearance from single-sample method

    International Nuclear Information System (INIS)

    Zuo Li; Ma Ying-Chun; Wang Mei; Zhang Chun-Li; Wang Rong-Fu; Wang Hai-Yan

    2005-01-01

    The objective of this study was to develop an equation to predict dual plasma sample method (DPSM) 99m Tc-diethylene triamine pentaacetic acid ( 99m Tc-DTPA) plasma clearance from single plasma sample method (SPSM), and to clarify the condition in which DPSM can be substituted by SPSM in measurement of glomerular filtration rate (GFR). Patients with chronic kidney disease (CKD) were selected. Watson modified Christensen and Groth equation was used to calculate 99m Tc-DTPA plasma clearance by SPSM (sGFR). The equation recommended by the Nephrourology Committee of the Society of Nuclear Medicine was used to calculate 99m Tc-DTPA plasma clearance by DPSM (tGFR) in each patient. The difference between sGFR and tGFR was expressed as percent of the average of these two methods, and tGFR was predicted from sGFR. Plasma creatinine was measured by the kinetic picrate method, and GFR estimated by abbreviated modification of diet in renal disease (MDRD) equation (aGFR) and Cockcroft-Gault equation (cGFR) were evaluated as criteria in selection of DPSM and SPSM. Three hundred and sixty-nine patients with CKD were selected (208 male and 161 female). The average age and body weight were 51.4±15.5 years and 67.2±12.5 kg, respectively. The causes of CKD were glomerular disease, renal arterial stenosis, chronic tubulointerstitial disease, and other causes or causes unknown. The average tGFR was 62.9±36.5 ml/min/1.73 m 2 , ranging from 1-180 ml/min/1.73 m 2 . sGFR was significantly correlated with tGFR (r=0.9194, p 2 ; in contrast, then tGFR was±30 ml/min/1.73 m 2 , the difference was constant (-1.1%, 95% confidence interval -18.3%, 16.1%), and tGFR could be predicted from sGFR using the equation: predicted tGFR (ml/min/1.73 m 2 )=7 4244+0.7318 x sGFR+0.0022 x sGFR 2 (n=299, r 2 =0.9428, p 2 , the diagnostic sensitivity of a cut off value of aGFR=45 ml/min/1.73 m 2 was 91.8%, and recommended as a criterion in the selection of DPSM and SPSM. When GFR ≥30 ml/min/1.73 m 2 , t

  4. Plasma interaction with tungsten samples in the COMPASS tokamak in ohmic ELMy H-modes

    International Nuclear Information System (INIS)

    Dimitrova, M; Weinzettl, V; Matejicek, J; Dejarnac, R; Stöckel, J; Havlicek, J; Panek, R; Popov, Tsv; Marinov, S; Costea, S

    2016-01-01

    This paper reports experimental results on plasma interaction with tungsten samples with or without pre-grown He fuzz. Under the experimental conditions, arcing was observed on the fuzzy tungsten samples, resulting in localized melting of the fuzz structure that did not extend into the bulk. The parallel power flux densities were obtained from the data measured by Langmuir probes embedded in the divertor tiles on the COMPASS tokamak. Measurements of the current-voltage probe characteristics were performed during ohmic ELMy H-modes reached in deuterium plasmas at a toroidal magnetic field B T = 1.15 T, plasma current I p = 300 kA and line-averaged electron density n e = 5×10 19 m -3 . The data obtained between the ELMs were processed by the recently published first-derivative probe technique for precise determination of the plasma potential and the electron energy distribution function (EEDF). The spatial profile of the EEDF shows that at the high-field side it is Maxwellian with a temperature of 5 -- 10 eV. The electron temperatures and the ion-saturation current density obtained were used to evaluate the radial distribution of the parallel power flux density as being in the order of 0.05 -- 7 MW/m 2 . (paper)

  5. An evaluation of multiplex bead-based analysis of cytokines and soluble proteins in archived lithium heparin plasma, EDTA plasma and serum samples

    DEFF Research Database (Denmark)

    Brøndum, Line; Sørensen, Brita Singers; Eriksen, Jesper Grau

    2016-01-01

    -13, and VEGF, LH plasma levels vs. EDTA plasma: IL-2 and IL-4. CONCLUSION: Stored serum, LH plasma, and EDTA plasma from clinical trials can be used for analysis of circulating cytokines and proteins. Variations in measurements occur, but are within reasonable ranges. The optimal type of media...... in plasma and serum from 86 head and neck cancer patients and 33 controls were evaluated: EGFR, leptin, OPN, VEGFR-1, VEGFR-2, IL-2, IL-13, PDGF-bb, TNF, PAI-1, SDF-1a, IL-4, IL-6, IL-8, eotaxin, G-CSF, VEGF, GRO-a, and HGF. RESULTS: The correlation between measurements of the same samples analyzed...... on different dates was reasonable. However, samples run on different dates could exhibit different absolute values. The 75th percentile of the fold differences for samples run on different dates was 2.2. No significant difference was found between one and four freeze-thaw cycles (except for HGF...

  6. Single injection 51Cr EDTA plasma clearance determination in children using capillary blood samples

    International Nuclear Information System (INIS)

    Broechner-Mortensen, J.; Christoffersen, J.

    1977-01-01

    The reliability of a determination of the total 51 Cr EDTA plasma clearance (e) (and with it the glomerular filtration rate), by a simplified single injection method (injected dose: 4.5 μCi per kg b.w.) using capillary blood samples (0.2 ml), was investigated in twenty children. Clearance values determined from capillary blood samples did not differ significantly from those measured simultaneously from venous blood samples, the mean ratio+-SD being 1.02+-0.06(n = 10). The reproducibility (total day-to-day variation) of E determined from capillary blood samples was 6.7% in children with decreased renal function (n = 3) and 6.9% in children with normal renal function (n = 7). The present data indicate that the use of capillary blood samples is an accurate and very precise approach for determination of E in children. (Auth.)

  7. Measurement of GFR by Tc-99m DTPA: Comparison of 5 plasma sample and 2 plasma sample methods in North Indian population

    International Nuclear Information System (INIS)

    Mittal, B.R.; Bhattacharya, A.; Singh, B.; Jha, V.; Sarika, Kumar R.

    2007-01-01

    Assessment of Glomerular filtration rate (GFR) has significant impact on both prognosis and treatment of patients with renal disease. In this study we compared the two-plasma-sample method (G2S) using a MS excel spreadsheet based program, with a manual five-plasmasample method (GS) used to measure GFR by determining Tc-99m-diethylenetriamine penta-acetic acid (Tc-99m DTPA) clearance in patients with chronic kidney disease (CKD) and healthy renal donors. The study was conducted in 148 subjects (64 men and 84 women; age range 14 to 70 yr); 59 patients of CKD and 89 prospective healthy kidney donors. Tc-99m DTPA (74-100 MBq) was injected intravenously and thereafter blood samples were obtained at 60, 90, 120, 150 and 180 min via the patent venflon. Radioactivity in the injection syringe and plasma was measured by means of a multi-well gamma counter. The correlation coefficient between the 2 methods was 0.9453, with a slope of 0.90 and an intercept of 14.72 mL/min. Bland Altman plot of disagreement showed that G2S underestimated the GFR values by 9.0 ml/min, 11.3 ml/min and 6.9 ml/min, in the entire study, CKD and healthy donor groups respectively. Our results indicate that in spite of good correlation between GS and G2S method, the G2S method constantly underestimated GFR in our study population. However, regression equation may be applied to the GFR values estimated by G2S method to match the GFR determined by GS method. (author)

  8. Detection of hemophilia A carriers by use of frozen plasma samples

    International Nuclear Information System (INIS)

    Yang, H.C.; Hardin, J.; Vaudreuil, C.

    1978-01-01

    The efficacy of using promptly frozen plasma samples in the diagnosis of the carrier state for hemophilia A was evaluated by simultaneous measurement of factor VIII activity and antigen in 20 normal women and 20 obligate carriers. Factor VIII antigen was measured by two methods, electroimmunoassay and immunoradiometric assay. When the factor VIII activity and antigen data were evaluated by regression analysis, 94% of the carriers were correctly identified at the 95% confidence level

  9. Design and Demonstration of a Material-Plasma Exposure Target Station for Neutron Irradiated Samples

    Energy Technology Data Exchange (ETDEWEB)

    Rapp, Juergen [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Aaron, A. M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Bell, Gary L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Burgess, Thomas W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ellis, Ronald James [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Giuliano, D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Howard, R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Kiggans, James O. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Lessard, Timothy L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ohriner, Evan Keith [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Perkins, Dale E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Varma, Venugopal Koikal [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2015-10-20

    -state heat fluxes of 5–20 MW/m2 and ion fluxes up to 1024 m-2s-1. Since PFCs will have to withstand neutron irradiation displacement damage up to 50 dpa, the target station design must accommodate radioactive specimens (materials to be irradiated in HFIR or at SNS) to enable investigations of the impact of neutron damage on materials. Therefore, the system will have to be able to install and extract irradiated specimens using equipment and methods to avoid sample modification, control contamination, and minimize worker dose. Included in the design considerations will be an assessment of all the steps between neutron irradiation and post-exposure materials examination/characterization, as well as an evaluation of the facility hazard categorization. In particular, the factors associated with the acquisition of radioactive specimens and their preparation, transportation, experimental configuration at the plasma-specimen interface, post-plasma-exposure sample handling, and specimen preparation will be evaluated. Neutronics calculations to determine the dose rates of the samples were carried out for a large number of potential plasma-facing materials.

  10. Novel canine circovirus strains from Thailand: Evidence for genetic recombination.

    Science.gov (United States)

    Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E

    2018-05-14

    Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.

  11. Liquid sampling-atmospheric pressure glow discharge as a secondary excitation source: Assessment of plasma characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Manard, Benjamin T. [Department of Chemistry, Clemson University, Clemson, SC 29634 (United States); Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Gonzalez, Jhanis J. [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Sarkar, Arnab [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Fuel Chemistry Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Dong, Meirong; Chirinos, Jose; Mao, Xianglei; Russo, Richard E. [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Marcus, R. Kenneth [Department of Chemistry, Clemson University, Clemson, SC 29634 (United States)

    2014-04-01

    The liquid sampling-atmospheric pressure glow discharge (LS-APGD) has been assessed as a secondary excitation source with a parametric evaluation regarding carrier gas flow rate, applied current, and electrode distance. With this parametric evaluation, plasma optical emission was monitored in order to obtain a fundamental understanding with regards to rotational temperature (T{sub rot}), excitation temperature (T{sub exc}), electron number density (n{sub e}), and plasma robustness. Incentive for these studies is not only for a greater overall fundamental knowledge of the APGD, but also in instrumenting a secondary excitation/ionization source following laser ablation (LA). Rotational temperatures were determined through experimentally fitting of the N{sub 2} and OH molecular emission bands while atomic excitation temperatures were calculated using a Boltzmann distribution of He and Mg atomic lines. The rotational and excitation temperatures were determined to be ∼ 1000 K and ∼ 2700 K respectively. Electron number density was calculated to be on the order of ∼ 3 × 10{sup 15} cm{sup −3} utilizing Stark broadening effects of the Hα line of the Balmer series and a He I transition. In addition, those diagnostics were performed introducing magnesium (by solution feed and laser ablation) into the plasma in order to determine any perturbation under heavy matrix sampling. The so-called plasma robustness factor, derived by monitoring Mg II/Mg I emission ratios, is also employed as a reflection of potential perturbations in microplasma energetics across the various operation conditions and sample loadings. While truly a miniaturized source (< 1 mm{sup 3} volume), the LS-APGD is shown to be quite robust with plasma characteristics and temperatures being unaffected upon introduction of metal species, whether by liquid or laser ablation sample introduction. - Highlights: • Liquid sampling-atmospheric pressure glow discharge (LS-APGD) • LS-APGD as a secondary

  12. Liquid sampling-atmospheric pressure glow discharge as a secondary excitation source: Assessment of plasma characteristics

    International Nuclear Information System (INIS)

    Manard, Benjamin T.; Gonzalez, Jhanis J.; Sarkar, Arnab; Dong, Meirong; Chirinos, Jose; Mao, Xianglei; Russo, Richard E.; Marcus, R. Kenneth

    2014-01-01

    The liquid sampling-atmospheric pressure glow discharge (LS-APGD) has been assessed as a secondary excitation source with a parametric evaluation regarding carrier gas flow rate, applied current, and electrode distance. With this parametric evaluation, plasma optical emission was monitored in order to obtain a fundamental understanding with regards to rotational temperature (T rot ), excitation temperature (T exc ), electron number density (n e ), and plasma robustness. Incentive for these studies is not only for a greater overall fundamental knowledge of the APGD, but also in instrumenting a secondary excitation/ionization source following laser ablation (LA). Rotational temperatures were determined through experimentally fitting of the N 2 and OH molecular emission bands while atomic excitation temperatures were calculated using a Boltzmann distribution of He and Mg atomic lines. The rotational and excitation temperatures were determined to be ∼ 1000 K and ∼ 2700 K respectively. Electron number density was calculated to be on the order of ∼ 3 × 10 15 cm −3 utilizing Stark broadening effects of the Hα line of the Balmer series and a He I transition. In addition, those diagnostics were performed introducing magnesium (by solution feed and laser ablation) into the plasma in order to determine any perturbation under heavy matrix sampling. The so-called plasma robustness factor, derived by monitoring Mg II/Mg I emission ratios, is also employed as a reflection of potential perturbations in microplasma energetics across the various operation conditions and sample loadings. While truly a miniaturized source ( 3 volume), the LS-APGD is shown to be quite robust with plasma characteristics and temperatures being unaffected upon introduction of metal species, whether by liquid or laser ablation sample introduction. - Highlights: • Liquid sampling-atmospheric pressure glow discharge (LS-APGD) • LS-APGD as a secondary excitation source for laser-ablated (LA

  13. Automated processing of whole blood samples into microliter aliquots of plasma.

    Science.gov (United States)

    Burtis, C A; Johnson, W W; Walker, W A

    1988-01-01

    A rotor that accepts and automatically processes a bulk aliquot of a single blood sample into multiple aliquots of plasma has been designed and built. The rotor consists of a central processing unit, which includes a disk containing eight precision-bore capillaries. By varying the internal diameters of the capillaries, aliquot volumes ranging 1 to 10 mul can be prepared. In practice, an unmeasured volume of blood is placed in a centre well, and, as the rotor begins to spin, is moved radially into a central annular ring where it is distributed into a series of processing chambers. The rotor is then spun at 3000 rpm for 10 min. When the centrifugal field is removed by slowly decreasing the rotor speed, an aliquot of plasma is withdrawn by capillary action into each of the capillary tubes. The disk containing the eight measured aliquots of plasma is subsequently removed and placed in a modifed rotor for conventional centrifugal analysis. Initial evaluation of the new rotor indicates that it is capable of producing discrete, microliter volumes of plasma with a degree of accuracy and precision approaching that of mechanical pipettes.

  14. Multi-elemental analysis of aqueous geological samples by inductively coupled plasma-optical emission spectrometry

    Science.gov (United States)

    Todorov, Todor I.; Wolf, Ruth E.; Adams, Monique

    2014-01-01

    Typically, 27 major, minor, and trace elements are determined in natural waters, acid mine drainage, extraction fluids, and leachates of geological and environmental samples by inductively coupled plasma-optical emission spectrometry (ICP-OES). At the discretion of the analyst, additional elements may be determined after suitable method modifications and performance data are established. Samples are preserved in 1–2 percent nitric acid (HNO3) at sample collection or as soon as possible after collection. The aqueous samples are aspirated into the ICP-OES discharge, where the elemental emission signals are measured simultaneously for 27 elements. Calibration is performed with a series of matrix-matched, multi-element solution standards.

  15. Platelets Inhibit Migration of Canine Osteosarcoma Cells.

    Science.gov (United States)

    Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C

    2017-01-01

    The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.

  16. Canine scent detection of canine cancer: a feasibility study

    Directory of Open Access Journals (Sweden)

    Dorman DC

    2017-10-01

    Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of

  17. A new Langmuir probe concept for rapid sampling of space plasma electron density

    International Nuclear Information System (INIS)

    Jacobsen, K S; Pedersen, A; Moen, J I; Bekkeng, T A

    2010-01-01

    In this paper we describe a new Langmuir probe concept that was invented for the in situ investigation of HF radar backscatter irregularities, with the capability to measure absolute electron density at a resolution sufficient to resolve the finest conceivable structure in an ionospheric plasma. The instrument consists of two or more fixed-bias cylindrical Langmuir probes whose radius is small compared to the Debye length. With this configuration, it is possible to acquire absolute electron density measurements independent of electron temperature and rocket/satellite potential. The system was flown on the ICI-2 sounding rocket to investigate the plasma irregularities which cause HF backscatter. It had a sampling rate of more than 5 kHz and successfully measured structures down to the scale of one electron gyro radius. The system can easily be adapted for any ionospheric rocket or satellite, and provides high-quality measurements of electron density at any desired resolution

  18. Estimation of 131J-Jodohippurateclearance by a simplified method using a single plasma sample

    International Nuclear Information System (INIS)

    Botsch, H.; Golde, G.; Kampf, D.

    1980-01-01

    Theoretical volumes calculated from the reciprocal of the plasma concentration of 131 J-Jodohippurate were compared in 95 patients with clearance values calculated by the 2-compartment-method and in 18 patients with conventional PAH-clearance. For estimating Hippurate-clearance from a single blood sampling the most favorable time is 45 min. after injection (r = 0.96; clearance 400/ml/min.: r = 0.98). Clearance values may be derived from the formula: C = 0.4 + 7.26 V - 0.021 x V 2 (V = injected activity/activity per l plasma taken 45 min. after injection). The simplicity, precision and reproducibility of the above mentioned clearance-method is emphasized. (orig.) [de

  19. Radiometric-microbiologic assay fo vitamin B-6: analysis of plasma samples

    International Nuclear Information System (INIS)

    Guilarte, T.R.; McIntyre, P.A.

    1981-01-01

    A radiometric microbiologic assay for the analysis of vitamin B-6 in plasma was developed. The method is based on the measurement of 14CO2 generated from the metabolism of DL-l-14C-valine (L-l-14C-valine) by Kloeckera brevis. The assay is specific for the biologically active forms of the vitamin, that is, pyridoxine, pyridoxal and pyridoxamine, and their respective phosphorylated forms. The biologically inert vitamin B-6 metabolite (4-pyridoxic acid) did not generate a response at concentrations tested. The radiometric technique was shown to be sensitive to the 1 nanogram level. Reproducibility and recovery studies gave good results. Fifteen plasma samples were assayed using the radiometric and turbidimetric techniques. The correlation coefficient was r . 0.98. Turbid material or precipitated debris did not interfere with the radiometric microbiologic assay, thus allowing for simplification of assay procedure

  20. Flow induced dispersion analysis rapidly quantifies proteins in human plasma samples

    DEFF Research Database (Denmark)

    Poulsen, Nicklas N; Andersen, Nina Z; Østergaard, Jesper

    2015-01-01

    Rapid and sensitive quantification of protein based biomarkers and drugs is a substantial challenge in diagnostics and biopharmaceutical drug development. Current technologies, such as ELISA, are characterized by being slow (hours), requiring relatively large amounts of sample and being subject...... to cumbersome and expensive assay development. In this work a new approach for quantification based on changes in diffusivity is presented. The apparent diffusivity of an indicator molecule interacting with the protein of interest is determined by Taylor Dispersion Analysis (TDA) in a hydrodynamic flow system...... in a blood plasma matrix), fully automated, and being subject to a simple assay development. FIDA is demonstrated for quantification of the protein Human Serum Albumin (HSA) in human plasma as well as for quantification of an antibody against HSA. The sensitivity of the FIDA assay depends on the indicator...

  1. An attempt to validate serum and plasma as sample matrices for analyses of polychlorobiphenylols

    Energy Technology Data Exchange (ETDEWEB)

    Weiss, J.; Bergman, Aa. [Stockholm Univ. (Sweden). Dept. of Environmental Chemistry; Bignert, A. [Museum of Natural History (Sweden)

    2004-09-15

    Polychlorinated biphenyls (PCBs) form hydroxylated metabolites (OH-PCBs), as reported both from wildlife and from experimental animal studies already in the early 1970s'. However, the interest increased in OH-PCBs from the mid 1990s' depending on the discovery that some OHPCB congeners are strongly retained in the blood of birds, fish and mammals, including humans. The interest is linked to the fact that OH-PCBs is strongly, but reversibly, bound to the blood protein transthyretin (TTR). It is reasonable to believe that the strong TTR binding may have toxicological impact, probably related to endocrine type effects. Importantly, OH-PCBs are present in blood at far higher concentrations than in any other compartment in the body, which is dependent on the physico-chemical characteristics of the phenols. Analyses of OH-PCBs have thus been concentrated to whole blood, plasma or serum. Still there is no comparison between the three sample types even though it is clear that whole blood is not optimal due to the large proportion of haemoglobin in the sample that make the clean up more difficult than if plasma or serum is selected for analysis. In the present study we have addressed two questions: First we have looked at any potential differences in the analytical results of OH-PCBs when using serum and plasma for extraction and clean up; Second, the serum and plasma applied in the validation has been unfrozen, frozen (at -20 C) for two months and frozen for twenty months, respectively.

  2. Effects of fusion relevant transient energetic radiation, plasma and thermal load on PLANSEE double forged tungsten samples in a low-energy plasma focus device

    Science.gov (United States)

    Javadi, S.; Ouyang, B.; Zhang, Z.; Ghoranneviss, M.; Salar Elahi, A.; Rawat, R. S.

    2018-06-01

    Tungsten is the leading candidate for plasma facing component (PFC) material for thermonuclear fusion reactors and various efforts are ongoing to evaluate its performance or response to intense fusion relevant radiation, plasma and thermal loads. This paper investigates the effects of hot dense decaying pinch plasma, highly energetic deuterium ions and fusion neutrons generated in a low-energy (3.0 kJ) plasma focus device on the structure, morphology and hardness of the PLANSEE double forged tungsten (W) samples surfaces. The tungsten samples were provided by Forschungszentrum Juelich (FZJ), Germany via International Atomic Energy Agency, Vienna, Austria. Tungsten samples were irradiated using different number of plasma focus (PF) shots (1, 5 and 10) at a fixed axial distance of 5 cm from the anode top and also at various distances from the top of the anode (5, 7, 9 and 11 cm) using fixed number (5) of plasma focus shots. The virgin tungsten sample had bcc structure (α-W phase). After PF irradiation, the XRD analysis showed (i) the presence of low intensity new diffraction peak corresponding to β-W phase at (211) crystalline plane indicating the partial structural phase transition in some of the samples, (ii) partial amorphization, and (iii) vacancy defects formation and compressive stress in irradiated tungsten samples. Field emission scanning electron microscopy showed the distinctive changes to non-uniform surface with nanometer sized particles and particle agglomerates along with large surface cracks at higher number of irradiation shots. X-ray photoelectron spectroscopy analysis demonstrated the reduction in relative tungsten oxide content and the increase in metallic tungsten after irradiation. Hardness of irradiated samples initially increased for one shot exposure due to reduction in tungsten oxide phase, but then decreased with increasing number of shots due to increasing concentration of defects. It is demonstrated that the plasma focus device provides

  3. Radioimmunoassay of canine growth hormone

    International Nuclear Information System (INIS)

    Eigenmann, J.E.; Eigenmann, R.Y.

    1981-01-01

    A sensitive radioimmunoassay (RIA) for canine growth hormone (GH) was developed. Antibodies were elicited in rhesus monkeys. One antiserum exhibited a working titer at a dilution of 1:500 000. Radioiodination was performed enzymatically employing lactoperoxidase. Logit-log transformation and least squares fitting resulted in straight line fitting of the standard curve between 0.39 and 50 ng/ml. Formation of large-molecular [ 125 I]GH during storage caused diminished assay sensitivity. Therefore [ 125 I]GH was re-purified by gel chromatography. Using this procedure, high and reproducible assay sensitivity was obtained. Tracer preparations were used for as long as 3 months after iodination. Diluted plasma from normal and acromegalic dogs resulted in a dose-response curve parallel to the standard curve. Canine prolactin exhibited a cross-reactivity of 2%. The within-assay coefficient of variation (CV) was 3.8 and the between-assay CV was 7.2%. Mean plasma GH concentration in normal dogs was 1.92 +- 0.14 ng/ml (mean +- SEM.) GH levels in acromegalic dogs were appreciably higher. Insulin-induced hypoglycaemia, arginine and ornithine administration resulted in inconsistent and sluggish GH increment. A better response was obtained by injecting a low dose of clonidine. Clonidine administration to hypopituitary dogs resulted in absent or poor GH increment. (author)

  4. Etching of Niobium Sample Placed on Superconducting Radio Frequency Cavity Surface in Ar/CL2 Plasma

    International Nuclear Information System (INIS)

    Upadhyay, Janardan; Phillips, Larry; Valente, Anne-Marie

    2011-01-01

    Plasma based surface modification is a promising alternative to wet etching of superconducting radio frequency (SRF) cavities. It has been proven with flat samples that the bulk Niobium (Nb) removal rate and the surface roughness after the plasma etchings are equal to or better than wet etching processes. To optimize the plasma parameters, we are using a single cell cavity with 20 sample holders symmetrically distributed over the cell. These holders serve the purpose of diagnostic ports for the measurement of the plasma parameters and for the holding of the Nb sample to be etched. The plasma properties at RF (100 MHz) and MW (2.45 GHz) frequencies are being measured with the help of electrical and optical probes at different pressures and RF power levels inside of this cavity. The niobium coupons placed on several holders around the cell are being etched simultaneously. The etching results will be presented at this conference.

  5. Etching of Niobium Sample Placed on Superconducting Radio Frequency Cavity Surface in Ar/CL2 Plasma

    Energy Technology Data Exchange (ETDEWEB)

    Janardan Upadhyay, Larry Phillips, Anne-Marie Valente

    2011-09-01

    Plasma based surface modification is a promising alternative to wet etching of superconducting radio frequency (SRF) cavities. It has been proven with flat samples that the bulk Niobium (Nb) removal rate and the surface roughness after the plasma etchings are equal to or better than wet etching processes. To optimize the plasma parameters, we are using a single cell cavity with 20 sample holders symmetrically distributed over the cell. These holders serve the purpose of diagnostic ports for the measurement of the plasma parameters and for the holding of the Nb sample to be etched. The plasma properties at RF (100 MHz) and MW (2.45 GHz) frequencies are being measured with the help of electrical and optical probes at different pressures and RF power levels inside of this cavity. The niobium coupons placed on several holders around the cell are being etched simultaneously. The etching results will be presented at this conference.

  6. Cardiac involvement in canine babesiosis : review article

    Directory of Open Access Journals (Sweden)

    R.G. Lobetti

    2005-06-01

    Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.

  7. In vitro evaluation of canine leukocytes radiolabeled in whole blood with 99mTc stannous colloid

    International Nuclear Information System (INIS)

    Abushhiwa, Mohamed H.; Salehi, Nouria S.; Whitton, Robert C.; Charles, Jennifer A.; Finnin, Peter J.; Lording, Peter M.; Caple, Ivan W.; Parry, Bruce W.

    2008-01-01

    Introduction: Technetium-99m stannous colloid ( 99m TcSnC)-labeled leukocytes are used to investigate a variety of inflammatory diseases in human medicine. The present study investigates the in vitro behavior of canine leukocytes labeled in whole blood with 99m TcSnC. Methods: Blood samples from 10 healthy dogs were labeled with 99m TcSnC using a standard procedure. The distribution of radioactivity among blood components (plasma, leukocyte layers and erythrocytes) was measured following separation of the radiolabeled samples across Histopaque density gradients. Phagocytic function of labeled and unlabeled leukocytes was estimated using zymosan particles. Labeling retention by leukocytes was determined at 1, 3, 4 and 7 h postlabeling. Results: The mean±standard error percentage of radioactivity associated with plasma, erythrocyte and leukocyte fractions was 2.0±0.21%, 55.5±0.60% and 42.5±0.54%, respectively (the last comprising 70.2±0.83% in polymorphonuclear leukocytes and 29.8±0.83% in mononuclear leukocytes). Labeled canine leukocytes had a phagocytic activity of 91.3±0.28% (control, 91.7±0.26%). The radiolabeled canine leukocytes retained 94.1±0.30% of radioactivity at 7 h postlabeling. Conclusions: Radiolabeling of canine leukocytes in whole blood with 99m TcSnC has minor adverse effect on their phagocytic function. The radiolabeled canine leukocytes retained a large percentage of radioactivity for at least 7 h postlabeling

  8. Determination of organically bound Tritium in environmental samples by application of the oxidizing plasma technique

    International Nuclear Information System (INIS)

    Strack, S.; Koenig, L.A.

    1981-12-01

    The low-temperature oxidizing plasma technique with a suitable system for trapping the water formed in the oxidation process can be used to determine T bound organically in low-level samples. First, the samples are freeze-dried and the tissue water obtained in this way is measured, after distillation, in a liquid scintillation spectrometer. The residual dry matter is ashed in the reactor chamber of the plasma system. Oxidation takes place at temperatures not exceeding 200 0 C in an oxygen flow of about 40 ml/min. The water of oxidation is collected in a cold trap installed behind the reactor chamber. A volume of about 10 ml of water is sufficient to measure the tritium activity without enrichment. The oxidation behavior of various organic materials has been tested. Some first results of T concentrations in tissue water and the organic dry matter from food and plant samples collected in the vicinity of the Nuclear Research Center are presented. The method has the advantage that a commercially available instrument can be used requiring only little additional equipment. Handling is much less dangerous and contamination effects by atmospheric T can be easily kept at a minimum. (orig./HP) [de

  9. Determination of the neutral oxygen atom density in a plasma reactor loaded with metal samples

    Science.gov (United States)

    Mozetic, Miran; Cvelbar, Uros

    2009-08-01

    The density of neutral oxygen atoms was determined during processing of metal samples in a plasma reactor. The reactor was a Pyrex tube with an inner diameter of 11 cm and a length of 30 cm. Plasma was created by an inductively coupled radiofrequency generator operating at a frequency of 27.12 MHz and output power up to 500 W. The O density was measured at the edge of the glass tube with a copper fiber optics catalytic probe. The O atom density in the empty tube depended on pressure and was between 4 and 7 × 1021 m-3. The maximum O density was at a pressure of about 150 Pa, while the dissociation fraction of O2 molecules was maximal at the lowest pressure and decreased with increasing pressure. At about 300 Pa it dropped below 10%. The measurements were repeated in the chamber loaded with different metallic samples. In these cases, the density of oxygen atoms was lower than that in the empty chamber. The results were explained by a drain of O atoms caused by heterogeneous recombination on the samples.

  10. Energy metabolism in mobile, wild-sampled sharks inferred by plasma lipids.

    Science.gov (United States)

    Gallagher, Austin J; Skubel, Rachel A; Pethybridge, Heidi R; Hammerschlag, Neil

    2017-01-01

    Evaluating how predators metabolize energy is increasingly useful for conservation physiology, as it can provide information on their current nutritional condition. However, obtaining metabolic information from mobile marine predators is inherently challenging owing to their relative rarity, cryptic nature and often wide-ranging underwater movements. Here, we investigate aspects of energy metabolism in four free-ranging shark species ( n  = 281; blacktip, bull, nurse, and tiger) by measuring three metabolic parameters [plasma triglycerides (TAG), free fatty acids (FFA) and cholesterol (CHOL)] via non-lethal biopsy sampling. Plasma TAG, FFA and total CHOL concentrations (in millimoles per litre) varied inter-specifically and with season, year, and shark length varied within a species. The TAG were highest in the plasma of less active species (nurse and tiger sharks), whereas FFA were highest among species with relatively high energetic demands (blacktip and bull sharks), and CHOL concentrations were highest in bull sharks. Although temporal patterns in all metabolites were varied among species, there appeared to be peaks in the spring and summer, with ratios of TAG/CHOL (a proxy for condition) in all species displaying a notable peak in summer. These results provide baseline information of energy metabolism in large sharks and are an important step in understanding how the metabolic parameters can be assessed through non-lethal sampling in the future. In particular, this study emphasizes the importance of accounting for intra-specific and temporal variability in sampling designs seeking to monitor the nutritional condition and metabolic responses of shark populations.

  11. Effect of sample matrix on the fundamental properties of the inductively coupled plasma

    International Nuclear Information System (INIS)

    Lehn, Scott A.; Warner, Kelly A.; Huang Mao; Hieftje, Gary M.

    2003-01-01

    In the inductively coupled plasma (ICP), the emission intensities of atomic and ionic spectral lines are controlled by fundamental parameters such as electron temperature, electron number density, gas-kinetic temperature, analyte atom and ion number densities, and others. Accordingly, the effect of a sample matrix on the analyte emission intensity in an ICP might be attributable to changes in these fundamental parameters caused by the matrix elements. In the present study, a plasma imaging instrument that combines Thomson scattering, Rayleigh scattering, laser-induced fluorescence and computed tomography has been employed to measure the above-mentioned parameters in the presence and absence of matrix elements. The data thus obtained were all collected on a spatially resolved basis and without the need for Abel inversion. Calcium, strontium and barium served as analytes, while lithium, copper and zinc were introduced as matrix elements. Comparing the data with and without the matrix elements allows us to determine the extent to which each fundamental parameter changes in the presence of a matrix element, and to better understand the nature of the matrix effects that occur in the ICP. As has been seen in previous studies with different matrix elements, ion emission and ion number densities follow opposite trends when matrix interferents are introduced into the plasma: ion emission is enhanced by the presence of matrix interferents while ion concentrations are lowered. These changes are consistent with a shift from collisional deactivation to radiative decay of excited-state analyte species

  12. Sample diagnosis using indicator elements and non-analyte signals for inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Antler, Margaret; Ying Hai; Burns, David H.; Salin, Eric D.

    2003-01-01

    A sample diagnosis procedure that uses both non-analyte and analyte signals to estimate matrix effects in inductively coupled plasma-mass spectrometry is presented. Non-analyte signals are those of background species in the plasma (e.g. N + , ArO + ), and changes in these signals can indicate changes in plasma conditions. Matrix effects of Al, Ba, Cs, K and Na on 19 non-analyte signals and 15 element signals were monitored. Multiple linear regression was used to build the prediction models, using a genetic algorithm for objective feature selection. Non-analyte elemental signals and non-analyte signals were compared for diagnosing matrix effects, and both were found to be suitable for estimating matrix effects. Individual analyte matrix effect estimation was compared with the overall matrix effect prediction, and models used to diagnose overall matrix effects were more accurate than individual analyte models. In previous work [Spectrochim. Acta Part B 57 (2002) 277], we tested models for analytical decision making. The current models were tested in the same way, and were able to successfully diagnose matrix effects with at least an 80% success rate

  13. Effects of Long-Term Storage Time and Original Sampling Month on Biobank Plasma Protein Concentrations

    Directory of Open Access Journals (Sweden)

    Stefan Enroth

    2016-10-01

    Full Text Available The quality of clinical biobank samples is crucial to their value for life sciences research. A number of factors related to the collection and storage of samples may affect the biomolecular composition. We have studied the effect of long-time freezer storage, chronological age at sampling, season and month of the year and on the abundance levels of 108 proteins in 380 plasma samples collected from 106 Swedish women. Storage time affected 18 proteins and explained 4.8–34.9% of the observed variance. Chronological age at sample collection after adjustment for storage-time affected 70 proteins and explained 1.1–33.5% of the variance. Seasonal variation had an effect on 15 proteins and month (number of sun hours affected 36 proteins and explained up to 4.5% of the variance after adjustment for storage-time and age. The results show that freezer storage time and collection date (month and season exerted similar effect sizes as age on the protein abundance levels. This implies that information on the sample handling history, in particular storage time, should be regarded as equally prominent covariates as age or gender and need to be included in epidemiological studies involving protein levels.

  14. Elemental analysis of bead samples using a laser-induced plasma at low pressure

    International Nuclear Information System (INIS)

    Lie, Tjung Jie; Kurniawan, Koo Hendrik; Kurniawan, Davy P.; Pardede, Marincan; Suliyanti, Maria Margaretha; Khumaeni, Ali; Natiq, Shouny A.; Abdulmadjid, Syahrun Nur; Lee, Yong Inn; Kagawa, Kiichiro; Idris, Nasrullah; Tjia, May On

    2006-01-01

    An Nd:YAG laser (1064 nm, 8 ns, 30 mJ) was focused on various types of fresh, fossilized white coral and giant shell samples, including samples of imitation shell and marble. Such samples are extremely important as material for preparing prayer beads that are extensively used in the Buddhist faith. The aim of this research was to develop a non-destructive method to distinguish original beads from their imitations by means of spectral measurements of the carbon, hydrogen, sodium and magnesium emission intensities and by measuring the hardness of the sample using the ratio between Ca (II) 396.8 nm and Ca (I) 422.6 nm. Based on these measurements, original fresh coral beads can be distinguished from any imitation made from hard wood. The same technique was also effective in distinguishing beads made of shell from its imitation. A spectral analysis of bead was also performed on a fossilized white coral sample and the result can be used to distinguish to some extent the fossilized white coral beads from any imitation made from marble. It was also found that the plasma plume should be generated at low ambient pressure to significantly improve the hydrogen and carbon emission intensity and also to avoid energy loss inside the crater during laser irradiation at atmospheric pressure. The results of this study confirm that operating the laser-induced plasma spectroscopy at reduced ambient pressure offers distinct advantage for bead analysis over the conventional laser-induced breakdown spectroscopy (LIBS) technique operated at atmospheric pressure

  15. Elemental analysis of bead samples using a laser-induced plasma at low pressure

    Energy Technology Data Exchange (ETDEWEB)

    Lie, Tjung Jie [Research Center of Maju Makmur Mandiri Foundation, 40 Srengseng Raya, Kembangan, Jakarta Barat 11630 (Indonesia); Kurniawan, Koo Hendrik [Research Center of Maju Makmur Mandiri Foundation, 40 Srengseng Raya, Kembangan, Jakarta Barat 11630 (Indonesia)]. E-mail: kurnia18@cbn.net.id; Kurniawan, Davy P. [Research Center of Maju Makmur Mandiri Foundation, 40 Srengseng Raya, Kembangan, Jakarta Barat 11630 (Indonesia); Pardede, Marincan [Research Center of Maju Makmur Mandiri Foundation, 40 Srengseng Raya, Kembangan, Jakarta Barat 11630 (Indonesia); Suliyanti, Maria Margaretha [Graduate Program in Opto Electrotechniques and Laser Applications, Faculty of Engineering, The University of Indonesia, 4 Salemba Raya, Jakarta 10430 (Indonesia); Khumaeni, Ali [Department of Physics, Faculty of Mathematics and Natural Sciences, Diponegoro University, Tembalang Campus, Semarang 50275 (Indonesia); Natiq, Shouny A. [Department of Physics, Faculty of Mathematics and Natural Sciences, Diponegoro University, Tembalang Campus, Semarang 50275 (Indonesia); Abdulmadjid, Syahrun Nur [Department of Physics, Faculty of Mathematics and Natural Sciences, Syiah Kuala University, Darussalam, Banda Aceh 23116 (Indonesia); Lee, Yong Inn [Physics Department, Chonbuk National University, Chonju 561-756, South Korea (Korea); Kagawa, Kiichiro [Department of Physics, Faculty of Education and Regional Studies, Fukui University, 9-1 bunkyo 3-chome, Fukui 910-8507 (Japan); Idris, Nasrullah [Department of Physics, Faculty of Education and Regional Studies, Fukui University, 9-1 bunkyo 3-chome, Fukui 910-8507 (Japan); Tjia, May On [Department of Physics, Faculty of Mathematics and Natural Sciences, Bandung Institute of Technology, 10 Ganesha, Bandung 40132 (Indonesia)

    2006-01-15

    An Nd:YAG laser (1064 nm, 8 ns, 30 mJ) was focused on various types of fresh, fossilized white coral and giant shell samples, including samples of imitation shell and marble. Such samples are extremely important as material for preparing prayer beads that are extensively used in the Buddhist faith. The aim of this research was to develop a non-destructive method to distinguish original beads from their imitations by means of spectral measurements of the carbon, hydrogen, sodium and magnesium emission intensities and by measuring the hardness of the sample using the ratio between Ca (II) 396.8 nm and Ca (I) 422.6 nm. Based on these measurements, original fresh coral beads can be distinguished from any imitation made from hard wood. The same technique was also effective in distinguishing beads made of shell from its imitation. A spectral analysis of bead was also performed on a fossilized white coral sample and the result can be used to distinguish to some extent the fossilized white coral beads from any imitation made from marble. It was also found that the plasma plume should be generated at low ambient pressure to significantly improve the hydrogen and carbon emission intensity and also to avoid energy loss inside the crater during laser irradiation at atmospheric pressure. The results of this study confirm that operating the laser-induced plasma spectroscopy at reduced ambient pressure offers distinct advantage for bead analysis over the conventional laser-induced breakdown spectroscopy (LIBS) technique operated at atmospheric pressure.

  16. Secretory pattern of canine growth hormone

    International Nuclear Information System (INIS)

    French, M.B.; Vaitkus, P.; Cukerman, E.; Sirek, A.; Sirek, O.V.

    1987-01-01

    The aim of this paper was to define the secretory pattern of growth hormone (GH) under basal conditions in fasted, conscious, male dogs accustomed to handling. Blood samples were withdrawn from a cephalic vein at 15-min intervals. In this way, any ultradian rhythms, if present, could be detected within the frequency range of 0.042-2 cycles/h. In addition, samples were drawn at either 1- or 2.5-min intervals for 2.5 or 5 h to determine whether frequency components greater than 2 cycles/h were present. GH was measured by radioimmunoassay and the raw data were submitted to time series analysis employing power spectral estimation by means of fast Fourier transformation techniques. Peak plasma levels were up to 12 times higher than the baseline concentration of ∼ 1 ng/ml. Spectral analysis revealed an endogenous frequency of 0.22 cycles/h, i.e., a periodicity of 4.5 h/cycle. The results indicate that under basal conditions the secretory bursts of canine GH are limited to one peak every 4.5 h

  17. Analysis of liquid samples using dried-droplet laser ablation inductively coupled plasma mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Do, Trong-Mui; Hsieh, Hui-Fang; Chang, Wei-Ciang [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Hsinchu, 30013 Taiwan (China); Chang, E.-E. [Department of Biochemistry, Taipei Medical University, Taipei City, 11031 Taiwan (China); Wang, Chu-Fang, E-mail: cfwang@mx.nthu.edu.tw [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Hsinchu, 30013 Taiwan (China); Institute of Nuclear Engineering and Science, National Tsing Hua University, Hsinchu 30013, Taiwan (China)

    2011-08-15

    In this study we developed a dried-droplet method for laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS). The proposed method provides accurate and precise results when building calibration curves and determining elements of interest in real liquid samples. After placing just 1 {mu}L of a liquid standard solution or a real sample onto the filter surface and then converting the solution into a very small, thin dry spot, the sample could be applied as an analytical subject for LA. To demonstrate the feasibility of this proposed method, we used LA-ICP-MS and conventional ICP-MS to determine the levels of 13 elements (Li, V, Mn, Co, Ni, Cu, Zn, As, Mo, Cd, Sb, Tl, and Pb) in five water samples. The correlation coefficients obtained from the various calibration curves ranged from 0.9920 ({sup 205}Tl) to 0.9998 ({sup 51}V), sufficient to allow the determination of a wide range of elements in the samples. We also investigated the effects of Methylene Blue (MB) and the NaCl concentration on the elemental analyses. MB could be used as an indicator during the ablation process; its presence in the samples only negligibly influenced the intensities of the signals of most of the tested elements. Notably, high NaCl contents led to signal suppression for some of the elements. In comparison with the established sample introduction by nebulization, our developed technique abrogates the need for time-consuming sample preparation and reduces the possibility of sample contamination.

  18. Multielement determination of rare earth elements in rock sample by liquid chromatography / inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Hamanaka, Tadashi; Itoh, Akihide; Itoh, Shinya; Sawatari, Hideyuki; Haraguchi, Hiroki.

    1995-01-01

    Rare earth elements in geological standard rock sample JG-1 (granodiolite)issued from the Geological Survey of Japan have been determined by a combined system of liquid chromatography and inductively coupled plasma mass spectrometry. (author)

  19. No positive effect of Acid etching or plasma cleaning on osseointegration of titanium implants in a canine femoral condyle press-fit model

    DEFF Research Database (Denmark)

    Saksø, Henrik; Jakobsen, Thomas Vestergaard; Mortensen, Mikkel Saksø

    2013-01-01

    Implant surface treatments that improve early osseointegration may prove useful in long-term survival of uncemented implants. We investigated Acid Etching and Plasma Cleaning on titanium implants.......Implant surface treatments that improve early osseointegration may prove useful in long-term survival of uncemented implants. We investigated Acid Etching and Plasma Cleaning on titanium implants....

  20. Description of a double centrifugation tube method for concentrating canine platelets.

    Science.gov (United States)

    Perazzi, Anna; Busetto, Roberto; Martinello, Tiziana; Drigo, Michele; Pasotto, Daniela; Cian, Francesco; Patruno, Marco; Iacopetti, Ilaria

    2013-07-22

    To evaluate the efficiency of platelet-rich plasma preparations by means of a double centrifugation tube method to obtain platelet-rich canine plasma at a concentration at least 4 times higher than the baseline value and a concentration of white blood cells not exceeding twice the reference range. A complete blood count was carried out for each sample and each concentrate. Whole blood samples were collected from 12 clinically healthy dogs (consenting blood donors). Blood was processed by a double centrifugation tube method to obtain platelet concentrates, which were then analyzed by a flow cytometry haematology system for haemogram. Platelet concentration and white blood cell count were determined in all samples. Platelet concentration at least 4 times higher than the baseline value and a white blood cell count not exceeding twice the reference range were obtained respectively in 10 cases out of 12 (83.3%) and 11 cases out of 12 (91.6%). This double centrifugation tube method is a relatively simple and inexpensive method for obtaining platelet-rich canine plasma, potentially available for therapeutic use to improve the healing process.

  1. Iohexol plasma clearance measurement in older adults with chronic kidney disease-sampling time matters.

    Science.gov (United States)

    Ebert, Natalie; Loesment, Amina; Martus, Peter; Jakob, Olga; Gaedeke, Jens; Kuhlmann, Martin; Bartel, Jan; Schuchardt, Mirjam; Tölle, Markus; Huang, Tao; van der Giet, Markus; Schaeffner, Elke

    2015-08-01

    Accurate and precise measurement of GFR is important for patients with chronic kidney disease (CKD). Sampling time of exogenous filtration markers may have great impact on measured GFR (mGFR) results, but there is still uncertainty about optimal timing of plasma clearance measurement in patients with advanced CKD, for whom 24-h measurement is recommended. This satellite project of the Berlin Initiative Study evaluates whether 24-h iohexol plasma clearance reveals a clinically relevant difference compared with 5-h measurement in older adults. In 104 participants with a mean age of 79 years and diagnosed CKD, we performed standard GFR measurement over 5 h (mGFR300) using iohexol plasma concentrations at 120, 180, 240 and 300 min after injection. With an additional sample at 1440 min, we assessed 24-h GFR measurement (mGFR1440). Study design was cross-sectional. Calculation of mGFR was conducted with a one compartment model using the Brochner-Mortensen equation to calculate the fast component. mGFR values were compared with estimated GFR values (MDRD, CKD-EPI, BIS1, Revised Lund-Malmö and Cockcroft-Gault). In all 104 subjects, mGFR1440 was lower than mGFR300 (23 ± 8 versus 29 ± 9 mL/min/1.73 m(2), mean ± SD; P clearance up to 5 h leads to a clinically relevant overestimation of GFR compared with 24-h measurement. In clinical care, this effect should be bore in mind especially for patients with considerably reduced GFR levels. A new correction formula has been developed to predict mGFR1440 from mGFR300. For accurate GFR estimates in elderly CKD patients, we recommend the Revised Lund Malmö equation. © The Author 2015. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.

  2. NEXAFS spectroscopy with a laser plasma x-ray source on soil samples

    International Nuclear Information System (INIS)

    Sedlmair, J; Geber, S-C; Thieme, J; Peth, C; Mann, K

    2009-01-01

    Humic substances are post-mortal organic substances without an exact chemical structure. Their large specific surface is important for transport processes, especially in soils. We analyzed the NEXAFS spectra of humic substances, from which the amount of certain chemical compounds such as aromatic and aliphatic groups can be verified by the resonances of their binding energy. For the experiments, a compact table-top setup working with a laser plasma source was used. NEXAFS makes it possible to distinguish between samples, even if they contain the same composits, because information about the specific functional groups in the sample is supplied. The evaluation was carried out using the program SpecFit. It was developed on IDL within our group and allows to fit the NEXAFS-data with a combination of arctangent, Gaussian and Lorentzian curves.

  3. NEXAFS spectroscopy with a laser plasma x-ray source on soil samples

    Energy Technology Data Exchange (ETDEWEB)

    Sedlmair, J; Geber, S-C; Thieme, J [Institute for X-Ray Physics, Georg-August-University Goettingen, Friedrich-Hund-Platz 1, D-37077 (Germany); Peth, C; Mann, K, E-mail: jsedlma@gwdg.d [Laser-Laboratorium Goettingen e.V., Hans-Adolf-Krebs-Weg 1, D-37077 (Germany)

    2009-09-01

    Humic substances are post-mortal organic substances without an exact chemical structure. Their large specific surface is important for transport processes, especially in soils. We analyzed the NEXAFS spectra of humic substances, from which the amount of certain chemical compounds such as aromatic and aliphatic groups can be verified by the resonances of their binding energy. For the experiments, a compact table-top setup working with a laser plasma source was used. NEXAFS makes it possible to distinguish between samples, even if they contain the same composits, because information about the specific functional groups in the sample is supplied. The evaluation was carried out using the program SpecFit. It was developed on IDL within our group and allows to fit the NEXAFS-data with a combination of arctangent, Gaussian and Lorentzian curves.

  4. Method validation in plasma source optical emission spectroscopy (ICP-OES) - From samples to results

    International Nuclear Information System (INIS)

    Pilon, Fabien; Vielle, Karine; Birolleau, Jean-Claude; Vigneau, Olivier; Labet, Alexandre; Arnal, Nadege; Adam, Christelle; Camilleri, Virginie; Amiel, Jeanine; Granier, Guy; Faure, Joel; Arnaud, Regine; Beres, Andre; Blanchard, Jean-Marc; Boyer-Deslys, Valerie; Broudic, Veronique; Marques, Caroline; Augeray, Celine; Bellefleur, Alexandre; Bienvenu, Philippe; Delteil, Nicole; Boulet, Beatrice; Bourgarit, David; Brennetot, Rene; Fichet, Pascal; Celier, Magali; Chevillotte, Rene; Klelifa, Aline; Fuchs, Gilbert; Le Coq, Gilles; Mermet, Jean-Michel

    2017-01-01

    Even though ICP-OES (Inductively Coupled Plasma - Optical Emission Spectroscopy) is now a routine analysis technique, requirements for measuring processes impose a complete control and mastering of the operating process and of the associated quality management system. The aim of this (collective) book is to guide the analyst during all the measurement validation procedure and to help him to guarantee the mastering of its different steps: administrative and physical management of samples in the laboratory, preparation and treatment of the samples before measuring, qualification and monitoring of the apparatus, instrument setting and calibration strategy, exploitation of results in terms of accuracy, reliability, data covariance (with the practical determination of the accuracy profile). The most recent terminology is used in the book, and numerous examples and illustrations are given in order to a better understanding and to help the elaboration of method validation documents

  5. Environmental samples analysis by Atomic Absorption Spectrophotometry and Inductively Coupled Plasma-Optical Emission Spectroscopy

    International Nuclear Information System (INIS)

    Popescu, I.V.; Iordan, M.; Stihi, C.; Bancuta, A.; Busuioc, G.; Dima, G.; Ciupina, V.; Belc, M.; Vlaicu, Gh.; Marian, R.

    2002-01-01

    Biological samples are interesting from many aspects of environmental monitoring. By analyzing tree leaves conclusions can be drown regarding the metal loading in the growth medium. So that, starting from assumption that the pollution factors from environmental medium can modify the normal concentration of elements, we decided to control the presence of toxic elements and the deviation from normal state of elements in leaves of different trees from areas situated at different distances of pollution source. The aim of this work is to determine the elemental composition of tree leaves using Atomic Absorption Spectrophotometry (AAS) method and Inductively Coupled Plasma-Optical Emission Spectroscopy (ICP-OES) method. Using AAS spectrophotometer SHIMADZU we identified and determined the concentration of: Cd, Co, Cu, Zn, Mn, Cr, Fe, Se, Pb with an instrumental error less than 1% for most of the elements analyzed. The same samples were analyzed by ICP-OES spectrometer, BAIRD ICP2070-Sequential Plasma spectrometer. We identified and determined in leaves of different trees the concentration of Mg, Ca, and Sr with a precision less than 6%. (authors)

  6. Trace Analysis of Irradiated Granite Samples from Hiroshima by Laser Ablation Inductively Coupled Plasma Mass Spectrometry

    International Nuclear Information System (INIS)

    Amr, M.A.; Helal, N.F.; Zahran, N.F.; Becker, J.S.; Pickhardt, C.; Dietze, H.J.

    1999-01-01

    Laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) is widely accepted as a rapid and sensitive technique for trace elemental analysis of solid materials and for local analysis of inhomogeneous materials (such as geological samples). Due to its direct solid sample analysis capability, LA-ICP-MS (using a quadrupole based ICP-MS and at the Research Center Juelich developed laser ablation system: Nd-YAG-laser, 226 nm, 10 Hz and 5 ns) is applied for the analysis of geological (granite) samples from Hiroshima. In order to prepare homogeneous targets, these samples were melted together with a lithium-borate mixture in a muffle furnace at 1050 degree c. Furthermore, for investigating of matrix effects the powder of these samples is mixed with graphite and pressed as targets for laser ablation. The quantification of the analysis results was carried out using granite (GM) as standard reference material. The relative sensitivity coefficients (RSCs) for most elements, which were determined for correction of the measured values, varied between 0.3 and 3

  7. Determination of uranium from nuclear fuel in environmental samples using inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Boulyga, S.F.; Becker, J.S.

    2000-01-01

    As a result of the accident at the Chernobyl nuclear power plant (NPP) the environment was contaminated with spent nuclear fuel. The 236 U isotope was used in this study to monitor the spent uranium from nuclear fallout in soil samples collected in the vicinity of the Chernobyl NPP. A rapid and sensitive analytical procedure was developed for uranium isotopic ratio measurement in environmental samples based on inductively coupled plasma quadrupole mass spectrometry with a hexapole collision cell (HEX-ICP-QMS). The figures of merit of the HEX-ICP-QMS were studied with a plasma-shielded torch using different nebulizers (such as an ultrasonic nebulizer (USN) and Meinhard nebulizer) for solution introduction. A 238 U + ion intensity of up to 27000 MHz/ppm in HEX-ICP-QMS with USN was observed by introducing helium into the hexapole collision cell as the collision gas at a flow rate of 10 ml min -1 . The formation rate of uranium hydride ions UH + /U + of 2 x 10 -6 was obtained by using USN with a membrane desolvator. The limit of 236 U/ 238 U ratio determination in 10 μg 1 -1 uranium solution was 3 x 10 -7 corresponding to the detection limit for 236 U of 3 pg 1 -1 . The precision of uranium isotopic ratio measurements in 10 μg 1 -1 laboratory uranium isotopic standard solution was 0.13% ( 235 U/ 238 U) and 0.33% ( 236 U/ 238 U) using a Meinhard nebulizer and 0.45% ( 235 U/ 238 U) and 0.88% ( 236 U/ 238 U) using a USN. The isotopic composition of all investigated Chernobyl soil samples differed from those of natural uranium; i.e. in these samples the 236 U/ 238 U ratio ranged from 10 -5 to 10 -3 . (orig.)

  8. Slurry sampling electrothermal vaporization inductively coupled plasma mass spectrometry for steelmaking flue dust analysis

    Science.gov (United States)

    Coedo, A. G.; Dorado, T.; Padilla, I.; Maibusch, R.; Kuss, H.-M.

    2000-02-01

    A commercial atomic absorption graphite furnace (AAGF), with a self-made adapter and valve system, was used as a slurry sampling cell for electrothermal vaporization inductively coupled plasma mass spectrometry (ETV-ICP-MS). The system was applied to the determination of As, Sn, Sb, Se, Te, Bi, Cd, V, Ti and Mo in steelmaking flue dusts. Experimental conditions with respect to ETV and ICP-MS operating parameters were optimized. Compared to aqueous solutions, slurry samples were found to present better analyte transport. Microgram amounts of Rh were used to reduce the difference in analyte response in sensitivity for aqueous solutions of the tested analytes. No such increasing effect was observed for slurry samples and aqueous standards. An added quantity of Rh acting as modifier/carrier resulted in an increase for the same analytes in matrix-slurry solutions, even the addition of an extra Rh quantity has resulted in a decrease in the signals. The effect of Triton X-100 (used as a dispersant agent) on analyte intensity and precision was also studied. External calibration from aqueous standards spiked with 100 μg ml -1 Rh was performed to quantified 0.010 g/100 ml slurry samples. Results are presented for a certified reference electrical arc furnace flue dust (EAF): CRM-876-1 (Bureau of Analysis Samples Ltd., Cleveland, UK), a reference sample of coke ashes X-3705 (from AG der Dillinger Hüttenwerke, Germany), and a representative sample of EAF flue dust from a Spanish steelmaking company (CENIM-1). For the two reference materials an acceptable agreement with certificate values was achieved, and the results for the CENIM sample matched with those obtained from conventional nebulization solution.

  9. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe.

    Science.gov (United States)

    McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A

    2014-09-05

    Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  10. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

    Directory of Open Access Journals (Sweden)

    Anna McRee

    2014-09-01

    Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  11. Chromium-51-EDTA clearance in adults with a single-plasma sample.

    Science.gov (United States)

    Mårtensson, J; Groth, S; Rehling, M; Gref, M

    1998-12-01

    In 1996, a committee on renal clearance recommended a mean sojourn time-based methodology for single-sample determination of plasma clearance of 99mTc-diethylenetriamine pentaacetic acid (DTPA) to be used on adults if the patient's glomerular filtration rate (GFR) is suspected to be >30 ml/min. The main purpose of this study was to derive a mean sojourn time-based formula for calculation of 51Cr-ethylenediamine tetraacetic acid (EDTA) clearance in adults. Two groups of patients with 51Cr-EDTA clearance (Cl) between 16 and 172 ml/min were studied. In Group I (n = 46), reference Cl was determined as a multiplasma sample, single-injection method (ClSM). Sixteen blood samples were drawn from 0 until 5 hr after a single intravenous injection of 51Cr-EDTA. In Group II (n = 1046), reference Cl was determined by the Brøchner-Mortensen four-sample clearance method (ClBM). The plasma time-activity curves of Group I were used to derive two mean sojourn time-based formulas (Formulas 1 and 2) for calculation of a single-sample clearance. Formula 1 was derived from the entire time-activity curve, whereas the derivation of Formula 2 used only the final slope of the time-activity curve. The accuracy of the two formulas and the Christensen and Groth 99mTc-DTPA formula was tested on Group II. Chromium-51-EDTA Cl calculated by Formula 1 was almost identical to the Cl calculated by the reference Cl method (r = 0.982; SDdiff = 5.82 ml/min). Both 51Cr-EDTA Cl calculated by Formula 2 and by the 99mTc-DTPA formula showed close correlation with the reference method (r = 0.976, r = 0.985, respectively) but systematically overestimated GFR for the whole range of clearance values by 3.5 and 3.2 ml/min (ptime methodology. The determination is marginally more accurate (ptime-activity curve than from only the final slope. The single-sample formula derived for determination of 99mTc-DTPA Cl tends slightly to overestimate GFR if used to calculate 51Cr-EDTA Cl.

  12. A random sampling approach for robust estimation of tissue-to-plasma ratio from extremely sparse data.

    Science.gov (United States)

    Chu, Hui-May; Ette, Ene I

    2005-09-02

    his study was performed to develop a new nonparametric approach for the estimation of robust tissue-to-plasma ratio from extremely sparsely sampled paired data (ie, one sample each from plasma and tissue per subject). Tissue-to-plasma ratio was estimated from paired/unpaired experimental data using independent time points approach, area under the curve (AUC) values calculated with the naïve data averaging approach, and AUC values calculated using sampling based approaches (eg, the pseudoprofile-based bootstrap [PpbB] approach and the random sampling approach [our proposed approach]). The random sampling approach involves the use of a 2-phase algorithm. The convergence of the sampling/resampling approaches was investigated, as well as the robustness of the estimates produced by different approaches. To evaluate the latter, new data sets were generated by introducing outlier(s) into the real data set. One to 2 concentration values were inflated by 10% to 40% from their original values to produce the outliers. Tissue-to-plasma ratios computed using the independent time points approach varied between 0 and 50 across time points. The ratio obtained from AUC values acquired using the naive data averaging approach was not associated with any measure of uncertainty or variability. Calculating the ratio without regard to pairing yielded poorer estimates. The random sampling and pseudoprofile-based bootstrap approaches yielded tissue-to-plasma ratios with uncertainty and variability. However, the random sampling approach, because of the 2-phase nature of its algorithm, yielded more robust estimates and required fewer replications. Therefore, a 2-phase random sampling approach is proposed for the robust estimation of tissue-to-plasma ratio from extremely sparsely sampled data.

  13. Investigation of nanodiamonds interactions in canine blood

    Science.gov (United States)

    WÄ sowicz, Michał; Marek, Kulka; Cićkiewicz, Maciej; Cymerman, Magdalena

    2017-02-01

    The whole blood contains red cells, white cells, and platelets suspended in plasma. In the following study we investigated an impact of nanodiamond particles on blood elements over various periods of time.The material used in the study consisted of samples taken from ten healthy canines (Canis lupus f. domestica) of various age, different blood types and both sexes. The markings were conducted by adding to the blood unmodified diamonds (SND), modified O2 (SO2) suspended in 0,9% NaCl. The blood was put under an impact of two diamond concentrations: 20μl and 100μl. The amount of abnormal cells increased with time. The percentage of echinocytes as a result of interaction with nanodiamonds in various time periods for individual specimens was scarce. In the examined microscopic image a summary was made for 100 white blood cells. Following cells were included in said group: band neutrophils, segmented neutrophils, eosinophils, basophils, lymphocytes, monocytes, lymphocytes with granulates, stimulated lymphocytes, lymphocytes with vacuoles, metamielocytes and smudge cells. The impact of the three diamond types had no clinical importance on red blood cells. After the diamonds mixed with white blood cells, atypical cells came into being, in the range of agranulocytes in stimulated form or with granulates and/or vacuoles. It is supposed that as a result of longlasting exposure a stimulation and vacuolisation takes place, because of the function of the cells.

  14. Validation of commercially available automated canine-specific immunoturbidimetric method for measuring canine C-reactive protein

    DEFF Research Database (Denmark)

    Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold

    2014-01-01

    BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was

  15. Assessment of CCL2 and CXCL8 chemokines in serum, bronchoalveolar lavage fluid and lung tissue samples from dogs affected with canine idiopathic pulmonary fibrosis.

    Science.gov (United States)

    Roels, Elodie; Krafft, Emilie; Farnir, Frederic; Holopainen, Saila; Laurila, Henna P; Rajamäki, Minna M; Day, Michael J; Antoine, Nadine; Pirottin, Dimitri; Clercx, Cecile

    2015-10-01

    Canine idiopathic pulmonary fibrosis (CIPF) is a progressive disease of the lung parenchyma that is more prevalent in dogs of the West Highland white terrier (WHWT) breed. Since the chemokines (C-C motif) ligand 2 (CCL2) and (C-X-C motif) ligand 8 (CXCL8) have been implicated in pulmonary fibrosis in humans, the aim of the present study was to investigate whether these same chemokines are involved in the pathogenesis of CIPF. CCL2 and CXCL8 concentrations were measured by ELISA in serum and bronchoalveolar lavage fluid (BALF) from healthy dogs and WHWTs affected with CIPF. Expression of the genes encoding CCL2 and CXCL8 and their respective receptors, namely (C-C motif) receptor 2 (CCR2) and (C-X-C motif) receptor 2 (CXCR2), was compared in unaffected lung tissue and biopsies from dogs affected with CIPF by quantitative PCR and localisation of CCL2 and CXCL8 proteins were determined by immunohistochemistry. Significantly greater CCL2 and CXCL8 concentrations were found in the BALF from WHWTs affected with CIPF, compared with healthy dogs. Significantly greater serum concentrations of CCL2, but not CXCL8, were found in CIPF-affected dogs compared with healthy WHWTs. No differences in relative gene expression for CCL2, CXCL8, CCR2 or CXCR2 were observed when comparing lung biopsies from control dogs and those affected with CIPF. In affected lung tissues, immunolabelling for CCL2 and CXCL8 was observed in bronchial airway epithelial cells in dogs affected with CIPF. The study findings suggest that both CCL2 and CXCL8 are involved in the pathogenesis of CIPF. Further studies are required to determine whether these chemokines might have a clinical use as biomarkers of fibrosis or as targets for therapeutic intervention. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Liquid sample introduction in inductively coupled plasma atomic emission and mass spectrometry — Critical review

    Energy Technology Data Exchange (ETDEWEB)

    Bings, N.H., E-mail: bings@uni-mainz.de; Orlandini von Niessen, J.O.; Schaper, J.N.

    2014-10-01

    Inductively coupled plasma optical emission spectroscopy (ICP-OES) and mass spectrometry (ICP-MS) can be considered as the most important tools in inorganic analytical chemistry. Huge progress has been made since the first analytical applications of the ICP. More stable RF generators, improved spectrometers and detection systems were designed along with the achievements gained from advanced microelectronics, leading to overall greatly improved analytical performance of such instruments. In contrast, for the vast majority of cases liquid sample introduction is still based on the pneumatic principle as described in the late 19th century. High flow pneumatic nebulizers typically demand the use of spray chambers as “aerosol filters” in order to match the prerequisites of an ICP. By this, only a small fraction of the nebulized sample actually contributes to the measured signal. Hence, the development of micronebulizers was brought forward. Those systems produce fine aerosols at low sample uptake rates, but they are even more prone for blocking or clogging than conventional systems in the case of solutions containing a significant amount of total dissolved solids (TDS). Despite the high number of publications devoted to liquid sample introduction, it is still considered the Achilles' heel of atomic spectrometry and it is well accepted, that the technology used for liquid sample introduction is still far from ideal, even when applying state-of-the-art systems. Therefore, this review is devoted to offer an update on developments in the field liquid sample introduction that had been reported until the year 2013. The most recent and noteworthy contributions to this field are discussed, trends are highlighted and future directions are outlined. The first part of this review provides a brief overview on theoretical considerations regarding conventional pneumatic nebulization, the fundamentals on aerosol generation and discusses characteristics of aerosols ideally

  17. Liquid sample introduction in inductively coupled plasma atomic emission and mass spectrometry — Critical review

    International Nuclear Information System (INIS)

    Bings, N.H.; Orlandini von Niessen, J.O.; Schaper, J.N.

    2014-01-01

    Inductively coupled plasma optical emission spectroscopy (ICP-OES) and mass spectrometry (ICP-MS) can be considered as the most important tools in inorganic analytical chemistry. Huge progress has been made since the first analytical applications of the ICP. More stable RF generators, improved spectrometers and detection systems were designed along with the achievements gained from advanced microelectronics, leading to overall greatly improved analytical performance of such instruments. In contrast, for the vast majority of cases liquid sample introduction is still based on the pneumatic principle as described in the late 19th century. High flow pneumatic nebulizers typically demand the use of spray chambers as “aerosol filters” in order to match the prerequisites of an ICP. By this, only a small fraction of the nebulized sample actually contributes to the measured signal. Hence, the development of micronebulizers was brought forward. Those systems produce fine aerosols at low sample uptake rates, but they are even more prone for blocking or clogging than conventional systems in the case of solutions containing a significant amount of total dissolved solids (TDS). Despite the high number of publications devoted to liquid sample introduction, it is still considered the Achilles' heel of atomic spectrometry and it is well accepted, that the technology used for liquid sample introduction is still far from ideal, even when applying state-of-the-art systems. Therefore, this review is devoted to offer an update on developments in the field liquid sample introduction that had been reported until the year 2013. The most recent and noteworthy contributions to this field are discussed, trends are highlighted and future directions are outlined. The first part of this review provides a brief overview on theoretical considerations regarding conventional pneumatic nebulization, the fundamentals on aerosol generation and discusses characteristics of aerosols ideally

  18. Influence of sample temperature on the expansion dynamics and the optical emission of laser-induced plasma

    Energy Technology Data Exchange (ETDEWEB)

    Eschlböck-Fuchs, S.; Haslinger, M.J.; Hinterreiter, A.; Kolmhofer, P.; Huber, N. [Christian Doppler Laboratory for Laser-Assisted Diagnostics, Institute of Applied Physics, Johannes Kepler University Linz, A-4040 Linz (Austria); Rössler, R. [voestalpine Stahl GmbH, A-4031 Linz (Austria); Heitz, J. [Christian Doppler Laboratory for Laser-Assisted Diagnostics, Institute of Applied Physics, Johannes Kepler University Linz, A-4040 Linz (Austria); Pedarnig, J.D., E-mail: johannes.pedarnig@jku.at [Christian Doppler Laboratory for Laser-Assisted Diagnostics, Institute of Applied Physics, Johannes Kepler University Linz, A-4040 Linz (Austria)

    2013-09-01

    We investigate the influence of sample temperature on the dynamics and optical emission of laser induced plasma for various solid materials. Bulk aluminum alloy, silicon wafer, and metallurgical slag samples are heated to temperature T{sub S} ≤ 500 °C and ablated in air by Nd:YAG laser pulses (wavelength 1064 nm, pulse duration approx. 7 ns). The plasma dynamics is investigated by fast time-resolved photography. For laser-induced breakdown spectroscopy (LIBS) the optical emission of plasma is measured by Echelle spectrometers in combination with intensified CCD cameras. For all sample materials the temporal evolution of plume size and broadband plasma emission vary systematically with T{sub S}. The size and brightness of expanding plumes increase at higher T{sub S} while the mean intensity remains independent of temperature. The intensity of emission lines increases with temperature for all samples. Plasma temperature and electron number density do not vary with T{sub S}. We apply the calibration-free LIBS method to determine the concentration of major oxides in slag and find good agreement to reference data up to T{sub S} = 450 °C. The LIBS analysis of multi-component materials at high temperature is of interest for technical applications, e.g. in industrial production processes. - Highlights: • Size and emission of laser-induced plasma increase with sample temperature Ts. • Mean optical intensity of plasma is independent of Ts. • Plasma temperature and electron number density do not vary with Ts. • Major oxides in steel slag are quantified up to Ts = 450 °C. • Industrial steel slags are analyzed by calibration-free LIBS method.

  19. Activity, specificity, and titer of naturally occurring canine anti-DEA 7 antibodies.

    Science.gov (United States)

    Spada, Eva; Proverbio, Daniela; Baggiani, Luciana; Canzi, Ilaria; Perego, Roberta

    2016-11-01

    The reported prevalence of naturally occurring anti-dog erythrocyte antigen (DEA) 7 antibodies in DEA 7-negative dogs is as high as 50%. Characterization of these antibodies may better define their importance in canine transfusion medicine. We determined in vitro activity, specificity, and titer of anti-DEA 7 antibodies in DEA 7-negative dogs. Plasma samples from 317 DEA 7-negative dogs were cross-matched with DEA 7-positive red blood cells (RBCs) using gel column technology. Agglutination occurred with DEA 7-positive RBCs but not with DEA 7-negative RBCs in 73 samples (23%), which were hence classified as containing anti-DEA 7 antibodies. These samples were evaluated for hemolytic and agglutinating activity, strength of agglutination, and antibody specificity and titers. All samples showed agglutination but none showed hemolysis. Gel agglutination was graded as 1+ for 20 samples (27%), 2+ for 49 samples (67%), 3+ for 4 samples (6%); no samples were graded 4+. The agglutination titer was DEA 7 antibodies were found in 23% of DEA 7-negative dogs. The presence of naturally occurring anti-DEA 7 antibodies suggests that cross-matching of canine blood recipients is advisable, even at first transfusion, to minimize delayed transfusion reactions. © 2016 The Author(s).

  20. Use of dc Ar microdischarge with nonlocal plasma for identification of metal samples

    Energy Technology Data Exchange (ETDEWEB)

    Kudryavtsev, A. A., E-mail: akud@ak2138.spb.edu [St. Petersburg State University, 7-9 Universitetskaya nab., 199034 St. Petersburg (Russian Federation); Stefanova, M. S.; Pramatarov, P. M. [Institute of Solid State Physics, Bulgarian Academy of Sciences, 72 Tzarigradsko Chaussee Blvd., 1784 Sofia (Bulgaria)

    2015-04-07

    The possibility of using the collisional electron spectroscopy (CES) method for the detection of atoms from metal samples is experimentally verified. The detection and identification of metal atoms from a Pt sample in the nonlocal plasma of short (without positive column) dc Ar microdischarge at intermediate pressures (5–30 Torr) is realized in this work. Cathode sputtering is used for atomization of the metal under analysis. The identification of the analyzed metal is made from the energy spectra of groups of fast nonlocal electrons—characteristic electrons released in the Penning ionization of the Pt atoms by Ar metastable atoms and molecules. The acquisition of the electron energy spectra is performed using an additional electrode—a sensor located at the boundary of the discharge volume. The Pt characteristic Penning electrons form the maxima in the electron energy spectra at the energies of their appearance, which are 2.6 eV and 1.4 eV. From the measured energy of the maxima, identification of the metal atoms is accomplished. The characteristic Ar maxima due to pair collisions between Ar metastable atoms and molecules and super-elastic collisions are also recorded. This study demonstrates the possibility of creating a novel microplasma analyzer for atoms from metal samples.

  1. PFAS concentrations in plasma samples from Danish school children and their mothers.

    Science.gov (United States)

    Mørck, Thit A; Nielsen, Flemming; Nielsen, Jeanette K S; Siersma, Volkert D; Grandjean, Philippe; Knudsen, Lisbeth E

    2015-06-01

    Perfluoroalkyl substances (PFASs) are accumulating in our environment and human exposure to these potentially harmful chemicals are of growing concern. In the present study, 116 children aged 6-11 and 143 mothers in two locations in Denmark donated blood samples as a supplement to their participation in the large European human biomonitoring project, DEMOCOPHES (Demonstration of a study to COordinate and Perform Human Biomonitoring on a European Scale). The blood samples were analyzed by LC-MS/MS for the concentration of six PFASs: PFOA, PFHxS, PFNA, PFDA, br-PFOS and n-PFOS. All measured compounds were above the detection limit in both mothers and children except for PFHxS in one child. There was a significant correlation between the levels in children and their mothers, indicating a family-related exposure pattern. However, we also found that the levels of PFOA, PFNA, PFDA, br-PFOS and total-PFOS were significantly higher in children compared to their mothers. This may be due to higher exposure in children through for example dust and soil, and due to the fact that children are smaller in body size and blood volume and hence have a lower storage capacity. Furthermore, we found an association between plasma levels and the age of the mothers and higher levels of plasma PFASs in mothers with low parity. There were no associations between PFAS concentrations and residential area, dietary habits of the participants or with respect to the birth order of the children. The levels are comparable to concentrations found in other Western countries. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.

    Science.gov (United States)

    Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi

    2017-10-01

    Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.

  3. Analytical sample preparation strategies for the determination of antimalarial drugs in human whole blood, plasma and urine

    DEFF Research Database (Denmark)

    Casas, Monica Escolà; Hansen, Martin; Krogh, Kristine A

    2014-01-01

    the available sample preparation strategies combined with liquid chromatographic (LC) analysis to determine antimalarials in whole blood, plasma and urine published over the last decade. Sample preparation can be done by protein precipitation, solid-phase extraction, liquid-liquid extraction or dilution. After...

  4. Determination of uranium from nuclear fuel in environmental samples using inductively coupled plasma mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Boulyga, S.F. [Forschungszentrum Juelich GmbH (Germany). Zentralabteilung fuer Chemische Analysen]|[Radiation Physics and Chemistry Problems Inst., Minsk (Belarus); Becker, J.S. [Forschungszentrum Juelich GmbH (Germany). Zentralabteilung fuer Chemische Analysen

    2000-11-01

    As a result of the accident at the Chernobyl nuclear power plant (NPP) the environment was contaminated with spent nuclear fuel. The {sup 236}U isotope was used in this study to monitor the spent uranium from nuclear fallout in soil samples collected in the vicinity of the Chernobyl NPP. A rapid and sensitive analytical procedure was developed for uranium isotopic ratio measurement in environmental samples based on inductively coupled plasma quadrupole mass spectrometry with a hexapole collision cell (HEX-ICP-QMS). The figures of merit of the HEX-ICP-QMS were studied with a plasma-shielded torch using different nebulizers (such as an ultrasonic nebulizer (USN) and Meinhard nebulizer) for solution introduction. A {sup 238}U{sup +} ion intensity of up to 27000 MHz/ppm in HEX-ICP-QMS with USN was observed by introducing helium into the hexapole collision cell as the collision gas at a flow rate of 10 ml min{sup -1}. The formation rate of uranium hydride ions UH{sup +}/U{sup +} of 2 x 10{sup -6} was obtained by using USN with a membrane desolvator. The limit of {sup 236}U/{sup 238}U ratio determination in 10 {mu}g 1{sup -1} uranium solution was 3 x 10{sup -7} corresponding to the detection limit for {sup 236}U of 3 pg 1{sup -1}. The precision of uranium isotopic ratio measurements in 10 {mu}g 1{sup -1} laboratory uranium isotopic standard solution was 0.13% ({sup 235}U/{sup 238}U) and 0.33% ({sup 236}U/{sup 238}U) using a Meinhard nebulizer and 0.45% ({sup 235}U/{sup 238}U) and 0.88% ({sup 236}U/{sup 238}U) using a USN. The isotopic composition of all investigated Chernobyl soil samples differed from those of natural uranium; i.e. in these samples the {sup 236}U/{sup 238}U ratio ranged from 10{sup -5} to 10{sup -3}. (orig.)

  5. Stability of BDNF in Human Samples Stored Up to 6 Months and Correlations of Serum and EDTA-Plasma Concentrations.

    Science.gov (United States)

    Polyakova, Maryna; Schlögl, Haiko; Sacher, Julia; Schmidt-Kassow, Maren; Kaiser, Jochen; Stumvoll, Michael; Kratzsch, Jürgen; Schroeter, Matthias L

    2017-06-03

    Brain-derived neurotrophic factor (BDNF), an important neural growth factor, has gained growing interest in neuroscience, but many influencing physiological and analytical aspects still remain unclear. In this study we assessed the impact of storage time at room temperature, repeated freeze/thaw cycles, and storage at -80 °C up to 6 months on serum and ethylenediaminetetraacetic acid (EDTA)-plasma BDNF. Furthermore, we assessed correlations of serum and plasma BDNF concentrations in two independent sets of samples. Coefficients of variations (CVs) for serum BDNF concentrations were significantly lower than CVs of plasma concentrations ( n = 245, p = 0.006). Mean serum and plasma concentrations at all analyzed time points remained within the acceptable change limit of the inter-assay precision as declared by the manufacturer. Serum and plasma BDNF concentrations correlated positively in both sets of samples and at all analyzed time points of the stability assessment ( r = 0.455 to r s = 0.596; p plasma up to 6 months. Due to a higher reliability, we suggest favoring serum over EDTA-plasma for future experiments assessing peripheral BDNF concentrations.

  6. Characterisation of nuclear fuel samples by quadrupole and multi-collector inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Wernli, Beath; Guenther-Leopold, Ines; Kobler Waldis, Judith; Kopajtic, Zlatan

    2003-01-01

    The characterisation of nuclear fuel cycle materials for trace and minor metallic constituents is of great interest for the nuclear industry and safeguard officials. The main objective of various international programmes dealing with postirradiation examinations is to improve the knowledge of the inventories of actinides, fission and spallation products in spent nuclear fuels. The low detection limits for a large number of elements combined with the ability to analyse the isotopic composition of the elements have established inductively coupled plasma mass spectrometry (ICP-MS) as a powerful multi-element technique in diverse analytical applications for the characterisation of nuclear materials. Because numerous isobaric overlaps restrict the direct determination of many fission products by mass spectrometry, extensive chemical separations are required for these elements. In order to simplify this sample preparation procedure, a high performance liquid chromatography system (HPLC) was online coupled to the mass spectrometer. Since about 10 years a quadrupole based ICP-MS (Q-ICP-MS) combined with an HPLC is used within the Hot Laboratory of the Paul Scherrer Institut for different applications on nuclear fuel samples. Since May 2003 also a new multi-collector ICP-MS (MC-ICP-MS) is used for the mass spectrometric characterisation of nuclear fuel samples, especially for the precise determination of the isotopic vectors of fission products and actinides. Therefore, two complementary analytical systems are now available in the group of 'Isotope and Wet Analytical Chemistry'. A comparison of the analytical performance of both systems (with and without an online coupled HPLC system) for the determination of the isotopic composition and the elemental concentration of different nuclides in nuclear fuel samples, the advantages and limitations of both techniques, the accuracy and precision of the results and typical applications for both methods will be discussed in the

  7. Fluorescence imaging of ion distributions in an inductively coupled plasma with laser ablation sample introduction

    International Nuclear Information System (INIS)

    Moses, Lance M.; Ellis, Wade C.; Jones, Derick D.; Farnsworth, Paul B.

    2015-01-01

    High-resolution images of the spatial distributions of Sc II, Ca II, and Ba II ion densities in the 10 mm upstream from the sampling cone in a laser ablation-inductively coupled plasma-mass spectrometer (LA-ICP-MS) were obtained using planar laser induced fluorescence. Images were obtained for each analyte as a function of the carrier gas flow rate with laser ablation (LA) sample introduction and compared to images with solution nebulization (SN) over the same range of flow rates. Additionally, images were obtained using LA at varying fluences and with varying amounts of helium added to a constant flow of argon gas. Ion profiles in SN images followed a pattern consistent with previous work: increasing gas flow caused a downstream shift in the ion profiles. When compared to SN, LA led to ion profiles that were much narrower radially and reached a maximum near the sampling cone at higher flow rates. Increasing the fluence led to ions formed in the ICP over greater axial and radial distances. The addition of He to the carrier gas prior to the ablation cell led to an upstream shift in the position of ionization and lower overall fluorescence intensities. - Highlights: • We map distributions of analytes in the ICP using laser ablation sample introduction. • We compare images from laser ablation with those from a pneumatic nebulizer. • We document the effects of water added to the laser ablation aerosol. • We compare distributions from a metal to those from crystalline solids. • We document the effect of laser fluence on ion distributions

  8. Steroid hormones content and proteomic analysis of canine follicular fluid during the preovulatory period

    Directory of Open Access Journals (Sweden)

    Reynaud Karine

    2010-11-01

    Full Text Available Abstract Background Follicular fluid contains substances involved in follicle activity, cell differentiation and oocyte maturation. Studies of its components may contribute to better understanding of the mechanisms underlying follicular development and oocyte quality. The canine species is characterized by several ovarian activity features that are not extensively described such as preovulatory luteinization, oocyte ovulated at the GV stage (prophase 1 and poly-oocytic follicles. In this study, we examined the hypothesis that the preovulatory LH surge is associated with changes in steroid and protein content of canine follicular fluid prior to ovulation. Methods Follicular fluid samples were collected from canine ovaries during the preovulatory phase, before (pre-LH; n = 16 bitches and after (post-LH; n = 16 the LH surge. Blood was simultaneously collected. Steroids were assayed by radioimmunoassay and proteomic analyses were carried out by 2D-PAGE and mass spectrometry. Results The concentrations of 17beta-estradiol and progesterone at the pre-LH stage were 737.2 +/- 43.5 ng/ml and 2630.1 +/- 287.2 ng/ml in follicular fluid vs. 53 +/- 4.1 pg/ml and 3.9 +/- 0.3 ng/ml in plasma, respectively. At that stage, significant positive correlations between follicular size and intra-follicular steroid concentrations were recorded. After the LH peak, the intrafollicular concentration of 17beta-estradiol decreased significantly (48.3 +/- 4.4 ng/ml; p Proteomic analysis of canine follicular fluid identified 38 protein spots, corresponding to 21 proteins, some of which are known to play roles in the ovarian physiology. The comparison of 2D-PAGE patterns of follicular fluids from the pre- and post-LH stages demonstrated 3 differentially stained single spot or groups of spots. One of them was identified as complement factor B. A comparison of follicular fluid and plasma protein patterns demonstrated a group of 4 spots that were more concentrated in plasma than

  9. Association of plasma homocysteine and white matter hypodensities in a sample of stroke patients

    International Nuclear Information System (INIS)

    Naveed, G.

    2015-01-01

    Studies of homocysteine in vascular disorders have yielded conflicting data. There are also differences based on various ethnicities and cultures. In this study, we have examined the homocysteine patterns in local stroke patients, so as to ascertain the homocysteine status in a sample of local population. Homocysteine-white matter hypodensities relationship in stroke is emerging, as an important aspect in stroke pathophysiology and is thought to have prognostic and therapeutic values. Methods: We included 150 stroke patients who were diagnosed as having clinical stroke on the basis of history; physical examination and CT (Computerized Tomography) scan of brain. These patients were recruited from neurology and emergency wards of two public sector hospitals of Lahore. The presence or absence of white matter hypodensities were diagnosed after consultation with a radiologist. Blood samples were collected from the same stroke patients. Results: We found a strong association between white matter hypodensities and total homocysteine in plasma of stroke patients p<0.001. Conclusion: Homocysteine is a risk factor for white matter hypodensities in stroke patients in our study. (author)

  10. Field desorption and field ion surface studies of samples exposed to the plasmas of PLT and ISX

    International Nuclear Information System (INIS)

    Kellogg, G.L.; Panitz, J.A.

    1978-01-01

    Modifications to the surface of field-ion specimens exposed to plasma discharges in PLT and ISX determined by Imaging Probe, Field Ion Microscope, and Transmission Electron Microscope analysis have in the past shown several consistent features. Surface films consisting primarily of limiter material with trapped plasma and impurity species have been found to reside on samples with direct line of sight exposure to the plasma during the discharges. Control specimens placed in the tokamak, but shielded from the plasma, on the other hand, remained free of deposits. When exposed to only high power plasma discharges, samples placed at the wall position in PLT and ISX have survived the exposures with no evidence of damage or implantation. In this paper we describe the results of a recent exposure in PLT in which for the first time samples of stainless steel were included for High-Field Surface Analysis. Tokamak operating conditions, including stainless-steel limiters, titanium gettering between discharges, and the occurrence of a disruption, also distinguished this exposure from those carried out previously. Surprisingly, even with stainless-steel limiters, carbon films were found to be deposited on the samples at a rate

  11. The Effect of Using a Modified Dentoalveolar Distractor on Canine Angulation following Rapid Canine Retraction: A Split-mouth Design Randomized Controlled Trial.

    Science.gov (United States)

    Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y

    2016-01-01

    New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.

  12. Opposing effects of cAMP and T259 phosphorylation on plasma membrane diffusion of the water channel aquaporin-5 in Madin-Darby canine kidney cells

    DEFF Research Database (Denmark)

    Koffman, Jennifer Skaarup; Christensen, Eva Arnspang; Marlar, Saw

    2015-01-01

    Aquaporin-5 (AQP5) facilitates passive water transport in glandular epithelia in response to secretory stimuli via intracellular pathways involving calcium release, cAMP and protein kinase A (PKA). In epithelial plasma membranes, AQP5 may be acutely regulated to facilitate water transport...... in the plasma membrane diffusion coefficient of AQP5. We aimed to test the short-term regulatory effects of the above pathways, by measuring lateral diffusion of AQP5 and an AQP5 phospho-mutant, T259A, using k-space Image Correlation Spectroscopy of quantum dot- and EGFP-labeled AQP5. Elevated cAMP and PKA...... inhibition significantly decreased lateral diffusion of AQP5, whereas T259A mutation showed opposing effects; slowing diffusion without stimulation and increasing diffusion to basal levels after cAMP elevation. Thus, lateral diffusion of AQP5 is significantly regulated by cAMP, PKA, and T259 phosphorylation...

  13. Seminal Plasma Characteristics and Expression of ATP-binding Cassette Transporter A1 (ABCA1) in Canine Spermatozoa from Ejaculates with Good and Bad Freezability.

    Science.gov (United States)

    Schäfer-Somi, S; Palme, N

    2016-04-01

    The composition of seminal plasma and the localization of the ATP-binding cassette transporter A1 (ABCA1) in spermatozoa from good and bad freezers were compared to frozen-thawed spermatozoa from the same dog. Ejaculates were obtained from 31 stud dogs, and the sperm-rich fraction (SRF) was kept for analysis. One aliquot was used for the analysis of concentration, progressive motility (P; CASA), viability (V; CASA) and leucocyte count, and the analysis was performed by flow cytometry (FITC-PNA/PI), SCSA and HOST. In seminal plasma, concentration of albumin, cholesterol, calcium, inorganic phosphate, sodium, potassium, zinc and copper was measured. Semen smears were prepared and evaluated for the expression of ABCA1. The remainder of each ejaculate was frozen. After thawing, the quality assessment was repeated and further smears were prepared. According to post-thaw semen quality, dogs were assigned to good freezers (n = 20) or bad freezers (n = 11), the latter were defined as 40% morphologically abnormal sperm and/or < 50% viability. Bad freezers were older than good freezers (5.3 vs 3.4 years, p < 0.05). In bad freezers, the percentage of sperm with ABCA1 signal in the acrosome was lower (26.3% vs 35.7%, p < 0.01) and the percentage of sperm with complete loss of ABCA1 signal higher (46.7% vs 30%, p < 0.01); the percentage of dead spermatozoa was higher (36.1% vs 25.5%, p < 0.05), and the concentration of cholesterol and sodium in seminal plasma was lower than in good freezers (p < 0.05). We conclude that in thawed bad freezer sperm, an increase in acrosome damages coincided with an increased loss of cholesterol transporters and cell death, and a lower cholesterol concentration in seminal plasma. Follow-up studies revealed whether a relation exists between these findings. © 2016 Blackwell Verlag GmbH.

  14. Comparison of ESR1 Mutations in Tumor Tissue and Matched Plasma Samples from Metastatic Breast Cancer Patients

    Directory of Open Access Journals (Sweden)

    Takashi Takeshita

    2017-10-01

    Full Text Available BACKGROUND: ESR1 mutation in circulating cell-free DNA (cfDNA is emerging as a noninvasive biomarker of acquired resistance to endocrine therapy, but there is a paucity of data comparing the status of ESR1 gene in cfDNA with that in its corresponding tumor tissue. The objective of this study is to validate the degree of concordance of ESR1 mutations between plasma and tumor tissue. METHODS: ESR1 ligand-binding domain mutations Y537S, Y537N, Y537C, and D538G were analyzed using droplet digital PCR in 35 patients with metastatic breast cancer (MBC (35 tumor tissue samples and 67 plasma samples. RESULTS: Of the 35 paired samples, 26 (74.3% were concordant: one patient had detectable ESR1 mutations both plasma (ESR1 Y537S/Y537N and tumor tissue (ESR1 Y537S/Y537C, and 25 had WT ESR1 alleles in both. Nine (25.7% had discordance between the plasma and tissue results: five had mutations detected only in their tumor tissue (two Y537S, one Y537C, one D538G, and one Y537S/Y537N/D538G, and four had mutations detected only in their plasma (one Y537S, one Y537N, and two Y537S/Y537N/D538G. Furthermore, longitudinal plasma samples from 19 patients were used to assess changes in the presence of ESR1 mutations during treatment. Eleven patients had cfDNA ESR1 mutations over the course of treatment. A total of eight of 11 patients with MBC with cfDNA ESR1 mutations (72.7% had the polyclonal mutations. CONCLUSION: We have shown the independent distribution of ESR1 mutations between plasma and tumor tissue in 35 patients with MBC.

  15. High-fat diet-induced insulin resistance does not increase plasma anandamide levels or potentiate anandamide insulinotropic effect in isolated canine islets.

    Science.gov (United States)

    Woolcott, Orison O; Richey, Joyce M; Kabir, Morvarid; Chow, Robert H; Iyer, Malini S; Kirkman, Erlinda L; Stefanovski, Darko; Lottati, Maya; Kim, Stella P; Harrison, L Nicole; Ionut, Viorica; Zheng, Dan; Hsu, Isabel R; Catalano, Karyn J; Chiu, Jenny D; Bradshaw, Heather; Wu, Qiang; Kolka, Cathryn M; Bergman, Richard N

    2015-01-01

    Obesity has been associated with elevated plasma anandamide levels. In addition, anandamide has been shown to stimulate insulin secretion in vitro, suggesting that anandamide might be linked to hyperinsulinemia. To determine whether high-fat diet-induced insulin resistance increases anandamide levels and potentiates the insulinotropic effect of anandamide in isolated pancreatic islets. Dogs were fed a high-fat diet (n = 9) for 22 weeks. Abdominal fat depot was quantified by MRI. Insulin sensitivity was assessed by the euglycemic-hyperinsulinemic clamp. Fasting plasma endocannabinoid levels were analyzed by liquid chromatography-mass spectrometry. All metabolic assessments were performed before and after fat diet regimen. At the end of the study, pancreatic islets were isolated prior to euthanasia to test the in vitro effect of anandamide on islet hormones. mRNA expression of cannabinoid receptors was determined in intact islets. The findings in vitro were compared with those from animals fed a control diet (n = 7). Prolonged fat feeding increased abdominal fat content by 81.3±21.6% (mean±S.E.M, Pcanines, high-fat diet-induced insulin resistance does not alter plasma anandamide levels or further potentiate the insulinotropic effect of anandamide in vitro.

  16. Genotoxicity studies in semiconductor industry. 1. In vitro mutagenicity and genotoxicity studies of waste samples resulting from plasma etching

    Energy Technology Data Exchange (ETDEWEB)

    Braun, R.; Huettner, E.M.; Merten, H.; Raabe, F. (Institute of Plant Genetics and Crop Plant Research, Gatersleben (Germany))

    1993-07-01

    Solid waste samples taken from the etching reactor, the turbo pump, and the waste air system of a plasma etching technology line in semiconductor production were studied as to their genotoxic properties in a bacterial repair test, in the Ames/Salmonella microsome assay, in the SOS chromotest, in primary mouse hepatocytes, and in Chinese hamster V79 cell cultures. All three waste samples were found to be active by inducing of unscheduled DNA-synthesis in mouse hepatocytes in vitro. In the bacterial rec-type repair test with Proteus mirabilis, waste samples taken from the turbo pump and the vacuum pipe system were not genotoxic. The waste sample taken from the chlorine-mediated plasma reactor was clearly positive in the bacterial repair assay and in the SOS chromotest with Escherichia coli. Mutagenic activity was demonstrated for all samples in the presence and absence of S9 mix made from mouse liver homogenate. Again, highest mutagenic activity was recorded for the waste sample taken from the plasma reactor, while samples collected from the turbo pump and from the waste air system before dilution and liberation of the air were less mutagenic. For all samples chromosomal damage in V79 cells was not detected, indicating absence of clastogenic activity in vitro. Altogether, these results indicate generation of genotoxic and mutagenic products as a consequence of chlorine-mediated plasma etching in the microelectronics industry and the presence of genotoxins even in places distant from the plasma reactor. Occupational exposure can be expected both from the precipitated wastes and from chemicals reaching the environment with the air stream.

  17. An evaluation of inductively coupled plasma optical emission spectrometry using electrothermal atomisation sample introduction and photographic plate detection

    International Nuclear Information System (INIS)

    Khathing, D.T.; Pickford, C.J.

    1984-05-01

    A photographic radiation measurement approach has been used with an inductively coupled plasma source to evaluate and tabulate the more prominent optical emission lines of 66 elements. Compared with the more common sample introduction technique using nebulisation, increased sensitivity for multielement analysis of small samples was achieved by using a simple graphite electrothermal atomisation system. This was constructed to serve as a dual purpose atomiser ie both for Atomic Absorption and for Inductively Coupled Plasma Emission spectroscopy. The system offers the advantage of a wide multi-elemental coverage, but sensitivities achieved with photographic detection are poorer than those obtained photoelectrically. (author)

  18. Electroerosion of metal in aqueous solution for sample introduction into an inductively coupled plasma mass spectrometer

    International Nuclear Information System (INIS)

    Goltz, Douglas; Boileau, Michael; Reinfelds, Gundars

    2003-01-01

    When high current (1-10 A cm -2 ) is applied between two conductive samples (metals) in aqueous solution, electroerosion occurs on the surface as a result of electrolysis and possibly collisions of dissolved ions with the metal surface. The power supply for the electroerosion apparatus in this work was a modified spark source unit. Current could be varied in intervals of 2.5, 5 and 10 A in either half-wave (unipolar) or full-wave (bipolar) output. The electroeroded metal forms a colloidal suspension in aqueous solution with particle sizes of the order of 1-10 μm and possibly larger. The suspension is readily dissolved using a small amount (100 μl) of concentrated acid (HCl or HNO 3 ) prior to analysis. Electroerosion of steel and brass in aqueous solution is described both for rapid sample dissolution and as a solid sampling approach for ICP-MS. Some of the electroerosion properties described in this paper include rates of erosion as a function of gap between the conductive samples and solution conductivity. Rates of electroerosion decreased from 120 to 30 μg s -1 as the gap was increased from 2 to 5 mm. Rates of electroerosion also increased significantly from 200 to 1000 μg s -1 as the conductivity of the electroerosion solution increased from 0.01 to 0.05 M NaCl. Interfacing the electroerosion apparatus to an ICP-MS was straight forward, as no special equipment was required. Therefore, the electroerosion apparatus can be used for rapid 'on-line' sample dissolution prior to introduction into an ICP. ICP-MS time profiles of selected metals in stainless steel 308L illustrate the behavior of 52 Cr + , 55 Mn + and 60 Ni + during a typical electroerosion cycle. Aspiration of the colloidal suspension into the ICP did not appear to load the plasma significantly, however, all of the metals produced noisy signals (±10%). A glass concentric nebulizer was used without clogging, so it is likely that the heterogeneous nature of the colloidal suspension caused this effect

  19. Electroerosion of metal in aqueous solution for sample introduction into an inductively coupled plasma mass spectrometer

    Science.gov (United States)

    Goltz, Douglas; Boileau, Michael; Reinfelds, Gundars

    2003-07-01

    When high current (1-10 A cm -2) is applied between two conductive samples (metals) in aqueous solution, electroerosion occurs on the surface as a result of electrolysis and possibly collisions of dissolved ions with the metal surface. The power supply for the electroerosion apparatus in this work was a modified spark source unit. Current could be varied in intervals of 2.5, 5 and 10 A in either half-wave (unipolar) or full-wave (bipolar) output. The electroeroded metal forms a colloidal suspension in aqueous solution with particle sizes of the order of 1-10 μm and possibly larger. The suspension is readily dissolved using a small amount (100 μl) of concentrated acid (HCl or HNO 3) prior to analysis. Electroerosion of steel and brass in aqueous solution is described both for rapid sample dissolution and as a solid sampling approach for ICP-MS. Some of the electroerosion properties described in this paper include rates of erosion as a function of gap between the conductive samples and solution conductivity. Rates of electroerosion decreased from 120 to 30 μg s -1 as the gap was increased from 2 to 5 mm. Rates of electroerosion also increased significantly from 200 to 1000 μg s -1 as the conductivity of the electroerosion solution increased from 0.01 to 0.05 M NaCl. Interfacing the electroerosion apparatus to an ICP-MS was straight forward, as no special equipment was required. Therefore, the electroerosion apparatus can be used for rapid 'on-line' sample dissolution prior to introduction into an ICP. ICP-MS time profiles of selected metals in stainless steel 308L illustrate the behavior of 52Cr +, 55Mn + and 60Ni + during a typical electroerosion cycle. Aspiration of the colloidal suspension into the ICP did not appear to load the plasma significantly, however, all of the metals produced noisy signals (±10%). A glass concentric nebulizer was used without clogging, so it is likely that the heterogeneous nature of the colloidal suspension caused this effect.

  20. Electroerosion of metal in aqueous solution for sample introduction into an inductively coupled plasma mass spectrometer

    Energy Technology Data Exchange (ETDEWEB)

    Goltz, Douglas E-mail: dgoltz@uwinnipeg.ca; Boileau, Michael; Reinfelds, Gundars

    2003-07-18

    When high current (1-10 A cm{sup -2}) is applied between two conductive samples (metals) in aqueous solution, electroerosion occurs on the surface as a result of electrolysis and possibly collisions of dissolved ions with the metal surface. The power supply for the electroerosion apparatus in this work was a modified spark source unit. Current could be varied in intervals of 2.5, 5 and 10 A in either half-wave (unipolar) or full-wave (bipolar) output. The electroeroded metal forms a colloidal suspension in aqueous solution with particle sizes of the order of 1-10 {mu}m and possibly larger. The suspension is readily dissolved using a small amount (100 {mu}l) of concentrated acid (HCl or HNO{sub 3}) prior to analysis. Electroerosion of steel and brass in aqueous solution is described both for rapid sample dissolution and as a solid sampling approach for ICP-MS. Some of the electroerosion properties described in this paper include rates of erosion as a function of gap between the conductive samples and solution conductivity. Rates of electroerosion decreased from 120 to 30 {mu}g s{sup -1} as the gap was increased from 2 to 5 mm. Rates of electroerosion also increased significantly from 200 to 1000 {mu}g s{sup -1} as the conductivity of the electroerosion solution increased from 0.01 to 0.05 M NaCl. Interfacing the electroerosion apparatus to an ICP-MS was straight forward, as no special equipment was required. Therefore, the electroerosion apparatus can be used for rapid 'on-line' sample dissolution prior to introduction into an ICP. ICP-MS time profiles of selected metals in stainless steel 308L illustrate the behavior of {sup 52}Cr{sup +}, {sup 55}Mn{sup +} and {sup 60}Ni{sup +} during a typical electroerosion cycle. Aspiration of the colloidal suspension into the ICP did not appear to load the plasma significantly, however, all of the metals produced noisy signals ({+-}10%). A glass concentric nebulizer was used without clogging, so it is likely that the

  1. Concomitant canine distemper, infectious canine hepatitis, canine parvoviral enteritis, canine infectious tracheobronchitis, and toxoplasmosis in a puppy.

    Science.gov (United States)

    Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes

    2013-01-01

    The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.

  2. Direct determination of trace rare earth elements in ancient porcelain samples with slurry sampling electrothermal vaporization inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Xiang Guoqiang; Jiang Zucheng; He Man; Hu Bin

    2005-01-01

    A method for the direct determination of trace rare earth elements in ancient porcelain samples by slurry sampling fluorinating electrothermal vaporization inductively coupled plasma mass spectrometry was developed with the use of polytetrafluoroethylene as fluorinating reagent. It was found that Si, as a main matrix element in ancient porcelain sample, could be mostly removed at the ashing temperature of 1200 deg. C without considerable losses of the analytes. However, the chemical composition of ancient porcelain sample is very complicated, which makes the influences resulting from other matrix elements not be ignored. Therefore, the matrix effect of ancient porcelain sample was also investigated, and it was found that the matrix effect is obvious when the matrix concentration was larger than 0.8 g l -1 . The study results of particle size effect indicated that when the sample particle size was less than 0.057 mm, the particle size effect is negligible. Under the optimized operation conditions, the detection limits for rare earth elements by fluorinating electrothermal vaporization inductively coupled plasma mass spectrometry were 0.7 ng g -1 (Eu)-33.3 ng g -1 (Nd) with the precisions of 4.1% (Yb)-10% (La) (c = 1 μg l -1 , n = 9). The proposed method was used to directly determine the trace rare earth elements in ancient porcelain samples produced in different dynasty (Sui, Ming and Qing), and the analytical results are satisfactory

  3. Porous Silicon Antibody Microarrays for Quantitative Analysis: Measurement of Free and Total PSA in Clinical Plasma Samples

    Science.gov (United States)

    Tojo, Axel; Malm, Johan; Marko-Varga, György; Lilja, Hans; Laurell, Thomas

    2014-01-01

    The antibody microarrays have become widespread, but their use for quantitative analyses in clinical samples has not yet been established. We investigated an immunoassay based on nanoporous silicon antibody microarrays for quantification of total prostate-specific-antigen (PSA) in 80 clinical plasma samples, and provide quantitative data from a duplex microarray assay that simultaneously quantifies free and total PSA in plasma. To further develop the assay the porous silicon chips was placed into a standard 96-well microtiter plate for higher throughput analysis. The samples analyzed by this quantitative microarray were 80 plasma samples obtained from men undergoing clinical PSA testing (dynamic range: 0.14-44ng/ml, LOD: 0.14ng/ml). The second dataset, measuring free PSA (dynamic range: 0.40-74.9ng/ml, LOD: 0.47ng/ml) and total PSA (dynamic range: 0.87-295ng/ml, LOD: 0.76ng/ml), was also obtained from the clinical routine. The reference for the quantification was a commercially available assay, the ProStatus PSA Free/Total DELFIA. In an analysis of 80 plasma samples the microarray platform performs well across the range of total PSA levels. This assay might have the potential to substitute for the large-scale microtiter plate format in diagnostic applications. The duplex assay paves the way for a future quantitative multiplex assay, which analyses several prostate cancer biomarkers simultaneously. PMID:22921878

  4. Duration of serological response to canine parvovirus-type 2, canine distemper virus, canine adenovirus type 1 and canine parainfluenza virus in client-owned dogs in Australia.

    Science.gov (United States)

    Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J

    2012-12-01

    To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.

  5. A computational platform for MALDI-TOF mass spectrometry data: application to serum and plasma samples.

    Science.gov (United States)

    Mantini, Dante; Petrucci, Francesca; Pieragostino, Damiana; Del Boccio, Piero; Sacchetta, Paolo; Candiano, Giovanni; Ghiggeri, Gian Marco; Lugaresi, Alessandra; Federici, Giorgio; Di Ilio, Carmine; Urbani, Andrea

    2010-01-03

    Mass spectrometry (MS) is becoming the gold standard for biomarker discovery. Several MS-based bioinformatics methods have been proposed for this application, but the divergence of the findings by different research groups on the same MS data suggests that the definition of a reliable method has not been achieved yet. In this work, we propose an integrated software platform, MASCAP, intended for comparative biomarker detection from MALDI-TOF MS data. MASCAP integrates denoising and feature extraction algorithms, which have already shown to provide consistent peaks across mass spectra; furthermore, it relies on statistical analysis and graphical tools to compare the results between groups. The effectiveness in mass spectrum processing is demonstrated using MALDI-TOF data, as well as SELDI-TOF data. The usefulness in detecting potential protein biomarkers is shown comparing MALDI-TOF mass spectra collected from serum and plasma samples belonging to the same clinical population. The analysis approach implemented in MASCAP may simplify biomarker detection, by assisting the recognition of proteomic expression signatures of the disease. A MATLAB implementation of the software and the data used for its validation are available at http://www.unich.it/proteomica/bioinf. (c) 2009 Elsevier B.V. All rights reserved.

  6. Plasma sample based analysis of gastric cancer progression using targeted metabolomics.

    Science.gov (United States)

    Lario, Sergio; Ramírez-Lázaro, Maria José; Sanjuan-Herráez, Daniel; Brunet-Vega, Anna; Pericay, Carles; Gombau, Lourdes; Junquera, Félix; Quintás, Guillermo; Calvet, Xavier

    2017-12-19

    Gastric carcinogenesis is a multifactorial process described as a stepwise progression from non-active gastritis (NAG), chronic active gastritis (CAG), precursor lesions of gastric cancer (PLGC) and gastric adenocarcinoma. Gastric cancer (GC) 5-year survival rate is highly dependent upon stage of disease at diagnosis, which is based on endoscopy, biopsy and pathological examinations. Non-invasive GC biomarkers would facilitate its diagnosis at early stages leading to improved GC prognosis. We analyzed plasma samples collected from 80 patients diagnosed with NAG without H. pylori infection (NAG-), CAG with H. pylori infection (CAG+), PLGC and GC. A panel of 208 metabolites including acylcarnitines, amino acids and biogenic amines, sphingolipids, glycerophospholipids, hexoses, and tryptophan and phenylalanine metabolites were quantified using two complementary quantitative approaches: Biocrates AbsoluteIDQ®p180 kit and a LC-MS method designed for the analysis of 29 tryptophan pathway and phenylalanine metabolites. Significantly altered metabolic profiles were found in GC patients that allowing discrimination from NAG-, CAG+ and PLGC patients. Pathway analysis showed significantly altered tryptophan and nitrogen metabolic pathways (FDR P < 0.01). Three metabolites (histidine, tryprophan and phenylacetylglutamine) discriminated between non-GC and GC groups. These metabolic signatures open new possibilities to improve surveillance of PLGC patients using a minimally invasive blood analysis.

  7. Mass spectrometric detection of siRNA in plasma samples for doping control purposes.

    Science.gov (United States)

    Kohler, Maxie; Thomas, Andreas; Walpurgis, Katja; Schänzer, Wilhelm; Thevis, Mario

    2010-10-01

    Small interfering ribonucleic acid (siRNA) molecules can effect the expression of any gene by inducing the degradation of mRNA. Therefore, these molecules can be of interest for illicit performance enhancement in sports by affecting different metabolic pathways. An example of an efficient performance-enhancing gene knockdown is the myostatin gene that regulates muscle growth. This study was carried out to provide a tool for the mass spectrometric detection of modified and unmodified siRNA from plasma samples. The oligonucleotides are purified by centrifugal filtration and the use of an miRNA purification kit, followed by flow-injection analysis using an Exactive mass spectrometer to yield the accurate masses of the sense and antisense strands. Although chromatography and sensitive mass spectrometric analysis of oligonucleotides are still challenging, a method was developed and validated that has adequate sensitivity (limit of detection 0.25-1 nmol mL(-1)) and performance (precision 11-21%, recovery 23-67%) for typical antisense oligonucleotides currently used in clinical studies.

  8. Determination of stable cesium and strontium in rice samples by inductively coupled plasma mass spectrometry

    Science.gov (United States)

    Srinuttrakul, W.; Yoshida, S.

    2017-06-01

    For long-term radiation dose assessment models, food ingestion is one of the major exposure pathways to human. In general, the stable isotopes can serve as analogues of radioisotopes. In this study, rice samples were collected from 30 paddy fields in Si Sa Ket, Yasothon and Roi Et in the northeast of Thailand in November 2014. The concentrations of stable cesium (Cs-133) and strontium (Sr-88) in polished rice were determined by inductively coupled plasma mass spectrometry (ICP-MS). The standard reference material of rice flour (NIST 1568a) with spiked Cs and Sr was used to validate the analytical method. The concentration of Cs in polished rice from Si Sa Ket, Yasothon and Roi Et was 0.158 ± 0.167 mg kg-1, 0.090 ± 0.117 mg kg-1 and 0.054 ± 0.031 mg kg-1, respectively. The concentration of Sr in polished rice from Si Sa Ket, Yasothon and Roi Et was 0.351 ± 0.108 mg kg-1, 0.364 ± 0.215 mg kg-1 and 0.287 ± 0.102 mg kg-1, respectively. Comparison of the results with Japanese data before the Fukushima Di-ichi nuclear power plant accident showed that the concentrations of both Cs and Sr for Thai rice were higher than those for Japanese rice.

  9. Determination of stable cesium and strontium in rice samples by inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Srinuttrakul, W; Yoshida, S

    2017-01-01

    For long-term radiation dose assessment models, food ingestion is one of the major exposure pathways to human. In general, the stable isotopes can serve as analogues of radioisotopes. In this study, rice samples were collected from 30 paddy fields in Si Sa Ket, Yasothon and Roi Et in the northeast of Thailand in November 2014. The concentrations of stable cesium (Cs-133) and strontium (Sr-88) in polished rice were determined by inductively coupled plasma mass spectrometry (ICP-MS). The standard reference material of rice flour (NIST 1568a) with spiked Cs and Sr was used to validate the analytical method. The concentration of Cs in polished rice from Si Sa Ket, Yasothon and Roi Et was 0.158 ± 0.167 mg kg -1 , 0.090 ± 0.117 mg kg -1 and 0.054 ± 0.031 mg kg -1 , respectively. The concentration of Sr in polished rice from Si Sa Ket, Yasothon and Roi Et was 0.351 ± 0.108 mg kg -1 , 0.364 ± 0.215 mg kg -1 and 0.287 ± 0.102 mg kg -1 , respectively. Comparison of the results with Japanese data before the Fukushima Di-ichi nuclear power plant accident showed that the concentrations of both Cs and Sr for Thai rice were higher than those for Japanese rice. (paper)

  10. Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

    International Nuclear Information System (INIS)

    Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.

    1974-01-01

    Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

  11. Vaccines for Canine Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Faeze Foroughi-Parvar

    2014-01-01

    Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

  12. Canine Parvovirus: Current Perspective

    OpenAIRE

    Nandi, S.; Kumar, Manoj

    2010-01-01

    Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...

  13. Versatile lipid profiling by liquid chromatography–high resolution mass spectrometry using all ion fragmentation and polarity switching. Preliminary application for serum samples phenotyping related to canine mammary cancer

    Energy Technology Data Exchange (ETDEWEB)

    Gallart-Ayala, H., E-mail: laberca@oniris-nantes.fr [LUNAM, Ecole Nationale Vétérinaire, Agroalimentaire et de l’Alimentation Nantes Atlantique (Oniris), USC 1329 INRA Laboratoire d’Etude des résidus et Contaminants dans les Aliments (LABERCA), Site de la Chantrerie – CS50707, 44307 Nantes cedex 3 (France); Courant, F.; Severe, S.; Antignac, J.-P. [LUNAM, Ecole Nationale Vétérinaire, Agroalimentaire et de l’Alimentation Nantes Atlantique (Oniris), USC 1329 INRA Laboratoire d’Etude des résidus et Contaminants dans les Aliments (LABERCA), Site de la Chantrerie – CS50707, 44307 Nantes cedex 3 (France); Morio, F.; Abadie, J. [LUNAM, Ecole Nationale Vétérinaire, Agroalimentaire et de l’Alimentation Nantes Atlantique (Oniris), Cancers Animaux, Modèles pour la Recherche en Oncologie Comparée (AMaROC), Site de la Chantrerie–CS50707, 44307 Nantes cedex 3 (France); Le Bizec, B. [LUNAM, Ecole Nationale Vétérinaire, Agroalimentaire et de l’Alimentation Nantes Atlantique (Oniris), USC 1329 INRA Laboratoire d’Etude des résidus et Contaminants dans les Aliments (LABERCA), Site de la Chantrerie – CS50707, 44307 Nantes cedex 3 (France)

    2013-09-24

    Graphical abstract: -- Highlights: •Lipidomics, high resolution mass spectrometry, polarity switching, serum, canine mammary cancer. -- Abstract: Lipids represent an extended class of substances characterized by such high variety and complexity that makes their unified analyses by liquid chromatography coupled to either high resolution or tandem mass spectrometry (LC–HRMS or LC–MS/MS) a real challenge. In the present study, a new versatile methodology associating ultra high performance liquid chromatography coupled to high resolution tandem mass spectrometry (UHPLC–HRMS/MS) have been developed for a comprehensive analysis of lipids. The use of polarity switching and “all ion fragmentation” (AIF) have been two action levels particularly exploited to finally permit the detection and identification of a multi-class and multi-analyte extended range of lipids in a single run. For identification purposes, both higher energy collision dissociation (HCD) and in-source CID (collision induced dissociation) fragmentation were evaluated in order to obtain information about the precursor and product ions in the same spectra. This approach provides both class-specific and lipid-specific fragments, enhancing lipid identification. Finally, the developed method was applied for differential phenotyping of serum samples collected from pet dogs developing spontaneous malignant mammary tumors and health controls. A biological signature associated with the presence of cancer was then successfully revealed from this lipidome analysis, which required to be further investigated and confirmed at larger scale.

  14. Versatile lipid profiling by liquid chromatography–high resolution mass spectrometry using all ion fragmentation and polarity switching. Preliminary application for serum samples phenotyping related to canine mammary cancer

    International Nuclear Information System (INIS)

    Gallart-Ayala, H.; Courant, F.; Severe, S.; Antignac, J.-P.; Morio, F.; Abadie, J.; Le Bizec, B.

    2013-01-01

    Graphical abstract: -- Highlights: •Lipidomics, high resolution mass spectrometry, polarity switching, serum, canine mammary cancer. -- Abstract: Lipids represent an extended class of substances characterized by such high variety and complexity that makes their unified analyses by liquid chromatography coupled to either high resolution or tandem mass spectrometry (LC–HRMS or LC–MS/MS) a real challenge. In the present study, a new versatile methodology associating ultra high performance liquid chromatography coupled to high resolution tandem mass spectrometry (UHPLC–HRMS/MS) have been developed for a comprehensive analysis of lipids. The use of polarity switching and “all ion fragmentation” (AIF) have been two action levels particularly exploited to finally permit the detection and identification of a multi-class and multi-analyte extended range of lipids in a single run. For identification purposes, both higher energy collision dissociation (HCD) and in-source CID (collision induced dissociation) fragmentation were evaluated in order to obtain information about the precursor and product ions in the same spectra. This approach provides both class-specific and lipid-specific fragments, enhancing lipid identification. Finally, the developed method was applied for differential phenotyping of serum samples collected from pet dogs developing spontaneous malignant mammary tumors and health controls. A biological signature associated with the presence of cancer was then successfully revealed from this lipidome analysis, which required to be further investigated and confirmed at larger scale

  15. European canine lymphoma network consensus recommendations for reporting flow cytometry in canine hematopoietic neoplasms.

    Science.gov (United States)

    Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W

    2017-09-01

    Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.

  16. PFAS concentrations in plasma samples from Danish school children and their mothers

    DEFF Research Database (Denmark)

    Mørck, Thit A; Nielsen, Flemming; Nielsen, Jeanette K S

    2015-01-01

    an association between plasma levels and the age of the mothers and higher levels of plasma PFASs in mothers with low parity. There were no associations between PFAS concentrations and residential area, dietary habits of the participants or with respect to the birth order of the children. The levels...

  17. Blood plasma sample preparation method to determine thyroid hormone-disrupting compounds in Effect-Directed Analysis

    NARCIS (Netherlands)

    Simon, E.; Bytingsvik, J.; Jonker, W.; Leonards, P.E.G.; de Boer, J.; Jenssen, B.M.; Lie, E.; Aars, J.; Hamers, T.H.M.; Lamoree, M.H.

    2011-01-01

    A sample preparation method combining solid-phase extraction (SPE) and liquid-liquid extraction (LLE) was developed to be used in Effect-Directed Analysis (EDA) of blood plasma. Until now such a method was not available. It can be used for extraction of a broad range of thyroid hormone

  18. A Comprehensive Software and Database Management System for Glomerular Filtration Rate Estimation by Radionuclide Plasma Sampling and Serum Creatinine Methods.

    Science.gov (United States)

    Jha, Ashish Kumar

    2015-01-01

    Glomerular filtration rate (GFR) estimation by plasma sampling method is considered as the gold standard. However, this method is not widely used because the complex technique and cumbersome calculations coupled with the lack of availability of user-friendly software. The routinely used Serum Creatinine method (SrCrM) of GFR estimation also requires the use of online calculators which cannot be used without internet access. We have developed user-friendly software "GFR estimation software" which gives the options to estimate GFR by plasma sampling method as well as SrCrM. We have used Microsoft Windows(®) as operating system and Visual Basic 6.0 as the front end and Microsoft Access(®) as database tool to develop this software. We have used Russell's formula for GFR calculation by plasma sampling method. GFR calculations using serum creatinine have been done using MIRD, Cockcroft-Gault method, Schwartz method, and Counahan-Barratt methods. The developed software is performing mathematical calculations correctly and is user-friendly. This software also enables storage and easy retrieval of the raw data, patient's information and calculated GFR for further processing and comparison. This is user-friendly software to calculate the GFR by various plasma sampling method and blood parameter. This software is also a good system for storing the raw and processed data for future analysis.

  19. Kinetics of canine dental calculus crystallization: an in vitro study on the influence of inorganic components of canine saliva.

    Science.gov (United States)

    Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H

    2014-07-01

    This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. A novel bocavirus in canine liver

    Directory of Open Access Journals (Sweden)

    Li Linlin

    2013-02-01

    Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.

  1. Automated Sample Preparation Platform for Mass Spectrometry-Based Plasma Proteomics and Biomarker Discovery

    Directory of Open Access Journals (Sweden)

    Vilém Guryča

    2014-03-01

    Full Text Available The identification of novel biomarkers from human plasma remains a critical need in order to develop and monitor drug therapies for nearly all disease areas. The discovery of novel plasma biomarkers is, however, significantly hampered by the complexity and dynamic range of proteins within plasma, as well as the inherent variability in composition from patient to patient. In addition, it is widely accepted that most soluble plasma biomarkers for diseases such as cancer will be represented by tissue leakage products, circulating in plasma at low levels. It is therefore necessary to find approaches with the prerequisite level of sensitivity in such a complex biological matrix. Strategies for fractionating the plasma proteome have been suggested, but improvements in sensitivity are often negated by the resultant process variability. Here we describe an approach using multidimensional chromatography and on-line protein derivatization, which allows for higher sensitivity, whilst minimizing the process variability. In order to evaluate this automated process fully, we demonstrate three levels of processing and compare sensitivity, throughput and reproducibility. We demonstrate that high sensitivity analysis of the human plasma proteome is possible down to the low ng/mL or even high pg/mL level with a high degree of technical reproducibility.

  2. Vaccines for canine leishmaniasis

    Directory of Open Access Journals (Sweden)

    Clarisa B. Palatnik-De-Sousa

    2012-04-01

    Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans

  3. Canine Skin and Conjunctival Swab Samples for the Detection and Quantification of Leishmania infantum DNA in an Endemic Urban Area in Brazil

    Science.gov (United States)

    de Almeida Ferreira, Sidney; Leite, Rodrigo Souza; Ituassu, Leonardo Trindade; Almeida, Gregório Guilherme; Souza, Daniel Menezes; Fujiwara, Ricardo Toshio; de Andrade, Antero Silva Ribeiro; Melo, Maria Norma

    2012-01-01

    Background We evaluated kDNA PCR/hybridization and quantitative real-time PCR (qPCR) targeting the gene of DNA polymerase of Leishmania infantum for CVL diagnosis and assessment of parasite load in clinical samples obtained invasively and non-invasively. Methodology/Principal Findings Eighty naturally infected dogs from an endemic urban area in Brazil were used. Animals were divided into two groups based on the presence or absence of CVL clinical sings. Skin biopsies, bone marrow, blood and conjunctival swabs samples were collected and submitted to L. infantum DNA detection. In addition, anti-Leishmania antibody titers were measured by Immunofluorescence antibody test. The symptomatic dogs had increased titers compared to asymptomatic dogs (P = 0.025). The frequencies of positive results obtained by kDNA PCR/hybridization for asymptomatic and symptomatic dogs, respectively, were as follows: right conjunctiva, 77.5% and 95.0%; left conjunctiva, 75.0% and 87.5%; skin, 45.0% and 75.0%; bone marrow, 50.0% and 77.5%; and blood, 27.5% and 22.5%. In both groups, the parasite load in the skin samples was the highest (P<0.0001). The parasite loads in the conjunctival swab and bone marrow samples were statistically equivalent within each group. The parasite burden in conjunctival swabs was higher in the dogs with clinical signs than in asymptomatic dogs (P = 0.028). This same relationship was also observed in the bone marrow samples (P = 0.002). No differences in amastigotes load in the skin were detected between the groups. Conclusions The conjunctival swab is a suitable clinical sample for qualitative molecular diagnosis of CVL. The highest parasite burdens were detected in skin regardless of the presence of VL-associated clinical signs. The qPCR results emphasized the role of dogs, particularly asymptomatic dogs, as reservoirs for CVL because of the high cutaneous parasite loads. These results may help to explain the maintenance of high transmission rates and

  4. Age estimation by canines' pulp/tooth ratio in an Iranian population using digital panoramic radiography.

    Science.gov (United States)

    Dehghani, Mahdieh; Shadkam, Elaheh; Ahrari, Farzaneh; Dehghani, Mahboobe

    2018-04-01

    Age estimation in adults is an important issue in forensic science. This study aimed to estimate the chronological age of Iranians by means of pulp/tooth area ratio (AR) of canines in digital panoramic radiographs. The sample consisted of panoramic radiographs of 271 male and female subjects aged 16-64 years. The pulp/tooth area ratio (AR) of upper and lower canines was calculated by AutoCAD software. Data were subjected to correlation and regression analysis. There was a significant and inverse correlation between age and pulp/tooth area ratio of upper and lower canines (r=-0.794 for upper canine and r=-0.282 for lower canine; p-value<0.001). Linear regression equations were derived separately for upper, lower and both canines. The mean difference between actual and estimated age using upper canine was 6.07±1.7. The results showed that the pulp/tooth area ratios of canines are a reliable method for age estimation in Iranians. The pulp/tooth area ratio of upper canine was better correlated with chronological age than that of lower canine. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Untargeted metabolomic profiling plasma samples of patients with lung cancer for searching significant metabolites by HPLC-MS method

    Science.gov (United States)

    Dementeva, N.; Ivanova, K.; Kokova, D.; Kurzina, I.; Ponomaryova, A.; Kzhyshkowska, J.

    2017-09-01

    Lung cancer is one of the most common types of cancer leading to death. Consequently, the search and the identification of the metabolites associated with the risk of developing cancer are very valuable. For the purpose, untargeted metabolic profiling of the plasma samples collected from the patients with lung cancer (n = 100) and the control group (n = 100) was conducted. After sample preparation, the plasma samples were analyzed using LC-MS method. Biostatistics methods were applied to pre-process the data for elicitation of dominating metabolites which responded to the difference between the case and the control groups. At least seven significant metabolites were evaluated and annotated. The most part of identified metabolites are connected with lipid metabolism and their combination could be useful for follow-up studies of lung cancer pathogenesis.

  6. Study of plasma amino acid levels in children with autism: An Egyptian sample

    Directory of Open Access Journals (Sweden)

    Farida M. ElBaz

    2014-04-01

    Conclusions: Autistic children had lower levels of some plasma amino acids except for glycine and glutamic acids and phosphoserine were increased with normal serum levels of urea, ammonia, total proteins, albumin and globulins (alpha 1, alpha 2, beta and gamma.

  7. Diagnosis of canine visceral leishmaniasis with radiolabelled probes: comparison of the kDNA PCR-hybridization with three molecular methods in different clinical samples

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R., E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Departamento de Parasitologia. Instituto de Ciencias Biologicas. Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)

    2011-07-01

    Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with {sup 32}P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)

  8. Diagnosis of canine visceral leishmaniasis with radiolabelled probes: comparison of the kDNA PCR-hybridization with three molecular methods in different clinical samples

    International Nuclear Information System (INIS)

    Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R.

    2011-01-01

    Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with 32 P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)

  9. Blood Lead Toxicity Analysis of Multipurpose Canines and Military Working Dogs.

    Science.gov (United States)

    Reid, Paul; George, Clinton; Byrd, Christopher M; Miller, Laura; Lee, Stephen J; Motsinger-Reif, Alison; Breen, Matthew; Hayduk, Daniel W

    Special Operations Forces and their accompanying tactical multipurpose canines (MPCs) who are involved in repeated live-fire exercises and military operations have the potential for increased blood lead levels and toxicity due to aerosolized and environmental lead debris. Clinical lead-toxicity symptoms can mimic other medical disorders, rendering accurate diagnosis more challenging. The objective of this study was to examine baseline lead levels of MPCs exposed to indoor firing ranges compared with those of nontactical military working dogs (MWDs) with limited or no exposure to the same environment. In the second part of the study, results of a commercially available, human-blood lead testing system were compared with those of a benchtop inductively coupled plasma-mass spectrometry (ICP-MS) analysis technique. Blood samples from 18 MPCs were tested during routine clinical blood draws, and six samples from a canine group with limited exposure to environmental lead (nontactical MWDs) were tested for comparison. There was a high correlation between results of the commercial blood-testing system compared with ICP-MS when blood lead levels were higher than 4.0µg/dL. Both testing methods recorded higher blood lead levels in the MPC blood samples than in those of the nontactical MWDs, although none of the MPC samples tested contained lead levels approaching those at which symptoms of lead toxicity have previously been reported in animals (i.e., 35µg/dL). 2018.

  10. Molecular analysis of partial VP-2 gene amplified from rectal swab samples of diarrheic dogs in Pakistan confirms the circulation of canine parvovirus genetic variant CPV-2a and detects sequences of feline panleukopenia virus (FPV).

    Science.gov (United States)

    Ahmed, Nisar; Riaz, Adeel; Zubair, Zahra; Saqib, Muhammad; Ijaz, Sehrish; Nawaz-Ul-Rehman, Muhammad Shah; Al-Qahtani, Ahmed; Mubin, Muhammad

    2018-03-15

    The infection in dogs due to canine parvovirus (CPV), is a highly contagious one with high mortality rate. The present study was undertaken for a detailed genetic analysis of partial VP2 gene i.e., 630 bp isolated from rectal swab samples of infected domestic and stray dogs from all areas of district Faisalabad. Monitoring of viruses is important, as continuous prevalence of viral infection might be associated with emergence of new virulent strains. In the present study, 40 rectal swab samples were collected from diarrheic dogs from different areas of district Faisalabad, Pakistan, in 2014-15 and screened for the presence of CPV by immunochromatography. Most of these dogs were stray dogs showing symptoms of diarrhea. Viral DNA was isolated and partial VP2 gene was amplified using gene specific primer pair Hfor/Hrev through PCR. Amplified fragments were cloned in pTZ57R/T (Fermentas) and completely sequenced. Sequences were analyzed and assembled by the Lasergene DNA analysis package (v8; DNAStar Inc., Madison, WI, USA). The results with immunochromatography showed that 33/40 (82%) of dogs were positive for CPV. We were able to amplify a fragment of 630 bp from 25 samples. In 25 samples the sequences of CPV-2a were detected showing the amino acid substitution Ser297Ala and presence of amino acid (426-Asn) in partial VP2 protein. Interestingly the BLAST analysis showed the of feline panleukopenia virus (FPV) sequences in 3 samples which were already positive for new CPV-2a, with 99% sequence homology to other FPV sequences present in GenBank. Phylogenetic analysis showed clustering of partial CPV-VP-2 gene with viruses from China, India, Japan and Uruguay identifying a new variant, whereas the 3 FPV sequences showed immediate ancestral relationship with viruses from Portugal, South Africa and USA. Interesting observation was that CPV are clustering away from the commercial vaccine strains. In this work we provide a better understanding of CPV prevailing in Pakistan

  11. Chlamydia in canine or feline coronary arteriosclerotic lesions.

    Science.gov (United States)

    Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas

    2011-09-09

    There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.

  12. Chlamydia in canine or feline coronary arteriosclerotic lesions

    Directory of Open Access Journals (Sweden)

    Grabarevic Zeljko

    2011-09-01

    Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.

  13. Isotopic analysis of calcium in blood plasma and bone from mouse samples by multiple collector-ICP-mass spectrometry

    International Nuclear Information System (INIS)

    Hirata, Takafumi; Tanoshima, Mina; Suga, Akinobu; Tanaka, Yu-ki; Nagata, Yuichi; Shinohara, Atsuko; Chiba, Momoko

    2008-01-01

    The biological processing of Ca produces significant stable isotope fractionation. The level of isotopic fractionation can provide key information about the variation in dietary consumption or Ca metabolism. To investigate this, we measured the 43 Ca/ 42 Ca and 44 Ca/ 42 Ca ratios for bone and blood plasma samples collected from mice of various ages using multiple collector-ICP-mass spectrometry (MC-ICP-MS). The 44 Ca/ 42 Ca ratio in bones was significantly (0.44 - 0.84 per mille) lower than the corresponding ratios in the diet, suggesting that Ca was isotopically fractionated during Ca metabolism for bone formation. The resulting 44 Ca/ 42 Ca ratios for blood plasma showed almost identical, or slightly higher, values (0.03 - 0.2 per mille) than found in a corresponding diet. This indicates that a significant amount of Ca in the blood plasma was from dietary sources. Unlike that discovered for Fe, there were not significant differences in the measured 44 Ca/ 42 Ca ratios between female and male specimens (for either bone or blood plasma samples). Similarity, the 44 Ca/ 42 Ca ratios suggests that there were no significant differences in Ca dietary consumption or Ca metabolism between female and male specimens. In contrast, the 44 Ca/ 42 Ca ratios of blood plasma from mother mice during the lactation period were significantly higher than those for all other adult specimens. This suggests that Ca supplied to infants through lactation was isotopically lighter, and the preferential supply of isotropically lighter Ca resulted in isotopically heavier Ca in blood plasma of mother mice during the lactation period. The data obtained here clearly demonstrate that the Ca isotopic ratio has a potential to become a new tool for evaluating changes in dietary consumption, or Ca metabolism of animals. (author)

  14. Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma.

    Science.gov (United States)

    Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid

    2016-01-01

    Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma.

  15. The effect of a plasma needle on bacteria in planktonic samples and on peripheral blood mesenchymal stem cells

    International Nuclear Information System (INIS)

    Lazovic, Sasa; Puac, Nevena; Maletic, Dejan; Malovic, Gordana; Petrovic, Zoran; Miletic, Maja; Pavlica, Dusan; Jovanovic, Milena; Milenkovic, Pavle; Bugarski, Diana; Mojsilovic, Slavko

    2010-01-01

    In this paper, we study the application of a plasma needle to induce necrosis in planktonic samples containing a single breed of bacteria. Two different types of bacteria, Staphylococcus aureus (ATCC 25923) and Escherichia coli (ATCC 25922), were covered in this study. In all experiments with bacteria, the samples were liquid suspensions of several different concentrations of bacteria prepared according to the McFarland standard. The second system studied in this paper was human peripheral blood mesenchymal stem cells (hPB-MSC). In the case of hPB-MSC, two sets of experiments were performed: when cells were covered with a certain amount of liquid (indirect) and when the cell sample was in direct contact with the plasma. Most importantly, the study is made with the aim to see the effects when the living cells are in a liquid medium, which normally acts as protection against the many agents that may be released by plasmas. It was found that a good effect may be expected for a wide range of initial cell densities and operating conditions causing destruction of several orders of magnitude even under the protection of a liquid. It was established independently that a temperature increase could not affect the cells under the conditions of our experiment, so the effect could originate only from the active species produced by the plasma. In the case of those hPB-MSC that were not protected by a liquid, gas flow proved to produce a considerable effect, presumably due to poor adhesion of the cells, but in a liquid the effect was only due to the plasma. Further optimization of the operation may be attempted, opening up the possibility of localized in vivo sterilization.

  16. The effect of a plasma needle on bacteria in planktonic samples and on peripheral blood mesenchymal stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Lazovic, Sasa; Puac, Nevena; Maletic, Dejan; Malovic, Gordana; Petrovic, Zoran [Institute of Physics, Pregrevica 118, 11080 Belgrade (Serbia); Miletic, Maja; Pavlica, Dusan; Jovanovic, Milena; Milenkovic, Pavle [Faculty of Stomatology, Dr Subotica 8, 11000 Belgrade (Serbia); Bugarski, Diana; Mojsilovic, Slavko, E-mail: lazovic@ipb.ac.r [Institute for Medical Research, Dr Subotica-starijeg 4, 11000 Belgrade (Serbia)

    2010-08-15

    In this paper, we study the application of a plasma needle to induce necrosis in planktonic samples containing a single breed of bacteria. Two different types of bacteria, Staphylococcus aureus (ATCC 25923) and Escherichia coli (ATCC 25922), were covered in this study. In all experiments with bacteria, the samples were liquid suspensions of several different concentrations of bacteria prepared according to the McFarland standard. The second system studied in this paper was human peripheral blood mesenchymal stem cells (hPB-MSC). In the case of hPB-MSC, two sets of experiments were performed: when cells were covered with a certain amount of liquid (indirect) and when the cell sample was in direct contact with the plasma. Most importantly, the study is made with the aim to see the effects when the living cells are in a liquid medium, which normally acts as protection against the many agents that may be released by plasmas. It was found that a good effect may be expected for a wide range of initial cell densities and operating conditions causing destruction of several orders of magnitude even under the protection of a liquid. It was established independently that a temperature increase could not affect the cells under the conditions of our experiment, so the effect could originate only from the active species produced by the plasma. In the case of those hPB-MSC that were not protected by a liquid, gas flow proved to produce a considerable effect, presumably due to poor adhesion of the cells, but in a liquid the effect was only due to the plasma. Further optimization of the operation may be attempted, opening up the possibility of localized in vivo sterilization.

  17. The effect of a plasma needle on bacteria in planktonic samples and on peripheral blood mesenchymal stem cells

    Science.gov (United States)

    Lazović, Saša; Puač, Nevena; Miletić, Maja; Pavlica, Dušan; Jovanović, Milena; Bugarski, Diana; Mojsilović, Slavko; Maletić, Dejan; Malović, Gordana; Milenković, Pavle; Petrović, Zoran

    2010-08-01

    In this paper, we study the application of a plasma needle to induce necrosis in planktonic samples containing a single breed of bacteria. Two different types of bacteria, Staphylococcus aureus (ATCC 25923) and Escherichia coli (ATCC 25922), were covered in this study. In all experiments with bacteria, the samples were liquid suspensions of several different concentrations of bacteria prepared according to the McFarland standard. The second system studied in this paper was human peripheral blood mesenchymal stem cells (hPB-MSC). In the case of hPB-MSC, two sets of experiments were performed: when cells were covered with a certain amount of liquid (indirect) and when the cell sample was in direct contact with the plasma. Most importantly, the study is made with the aim to see the effects when the living cells are in a liquid medium, which normally acts as protection against the many agents that may be released by plasmas. It was found that a good effect may be expected for a wide range of initial cell densities and operating conditions causing destruction of several orders of magnitude even under the protection of a liquid. It was established independently that a temperature increase could not affect the cells under the conditions of our experiment, so the effect could originate only from the active species produced by the plasma. In the case of those hPB-MSC that were not protected by a liquid, gas flow proved to produce a considerable effect, presumably due to poor adhesion of the cells, but in a liquid the effect was only due to the plasma. Further optimization of the operation may be attempted, opening up the possibility of localized in vivo sterilization.

  18. Use of a dry-plasma collection device to overcome problems with storage and transportation of blood samples for epidemiology studies in developing countries.

    Science.gov (United States)

    Nurgalieva, Z Z; Almuchambetova, R; Machmudova, A; Kapsultanova, D; Osato, M S; Peacock, J; Zoltek, R P; Marchildon, P A; Graham, D Y; Zhangabylov, A

    2000-11-01

    Studies are difficult in areas lacking modern facilities due to the inability to reliably collect, store, and ship samples. Thus, we sought to evaluate the use of a dry plasma collection device for seroepidemiology studies. Plasma was obtained by fingerstick using a commercial dry plasma collection device (Chemcard Plasma Collection Device) and serum (venipuncture) from individuals in Kazakhstan. Plasma samples were air dried for 15 min and then stored desiccated in foil zip-lock pouches at 4 to 6 degrees C and subsequently shipped to the United States by air at ambient temperature. Serum samples remained frozen at -20 degrees C until assayed. Helicobacter pylori status was determined by enzyme-linked immunosorbent assay (HM-CAP EIA) for the dry plasma and the serum samples. The results were concordant in 250 of the 289 cases (86.5%). In 25 cases (8.6%), the dry plasma samples gave indeterminate results and could not be retested because only one sample was collected. Five serum samples were positive, and the corresponding dry plasma samples were negative; one serum sample was negative, and the corresponding plasma sample was positive. The relative sensitivity and specificity of the Chemcard samples to serum were 97.6 and 97.9%, respectively, excluding those with indeterminate results. Repeated freeze-thawing had no adverse effect on the accuracy of the test. We found the dry plasma collection device to provide an accurate and practical alternative to serum when venipuncture may be difficult or inconvenient and sample storage and handling present difficulties, especially for seroepidemiologic studies in rural areas or developing countries and where freeze-thawing may be unavoidable.

  19. Simultaneous electrothermal vaporization and nebulizer sample introduction system for inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Arnquist, Isaac J.; Kreschollek, Thomas E.; Holcombe, James A.

    2011-01-01

    The novel analytical application of the combination of an inline electrothermal vaporization (ETV) and nebulization source for inductively coupled plasma mass spectrometry (ICP-MS) has been studied. Wet plasma conditions are sustained during ETV introduction by 200 mL/min gas flow through the nebulizer, which is merged with the ETV transport line at the torch. The use of a wet plasma with ETV introduction avoided the need to change power settings and torch positions that normally accompany a change from wet to dry plasma operating conditions. This inline-ETV source is shown to have good detection limits for a variety of elements in both HNO 3 and HCl matrices. Using the inline-ETV source, improved limits of detection (LOD) were obtained for elements typically suppressed by polyatomic interferences using a nebulizer. Specifically, improved LODs for 51 V and 53 Cr suffering from Cl interferences ( 51 ClO + and 53 ClO + respectively) in a 1% HCl matrix were obtained using the inline-ETV source. LODs were improved by factors of 65 and 22 for 51 V and 53 Cr, respectively, using the inline-ETV source compared to a conventional concentric glass nebulizer. For elements without polyatomic interferences, LODs from the inline-ETV were comparable to conventional dry plasma ETV-ICP time-of-flight mass spectrometry results. Lastly, the inline-ETV source offers a simple means of changing from nebulizer introduction to inline-ETV introduction without extinguishing the plasma. This permits, for example, the use of the time-resolved ETV-ICP-MS signals to distinguish between an analyte ion and polyatomic isobar.

  20. Pro-tumorigenic effects of transforming growth factor beta 1 in canine osteosarcoma.

    Science.gov (United States)

    Portela, R F; Fadl-Alla, B A; Pondenis, H C; Byrum, M L; Garrett, L D; Wycislo, K L; Borst, L B; Fan, T M

    2014-01-01

    Transforming growth factor beta 1 (TGFβ1) is a pleiotropic cytokine that contributes to reparative skeletal remodeling by inducing osteoblast proliferation, migration, and angiogenesis. Organic bone matrix is the largest bodily reservoir for latent TGFβ1, and active osteoblasts express cognate receptors for TGFβ1 (TGFβRI and TGFβRII). During malignant osteolysis, TGFβ1 is liberated from eroded bone matrix and promotes local progression of osteotropic solid tumors by its mitogenic and prosurvival activities. Canine osteosarcoma (OS) cells will possess TGFβ1 signaling machinery. Blockade of TGFβ1 signaling will attenuate pro-tumorigenic activities in OS cells. Naturally occurring primary OS samples will express cognate TGFβ1 receptors; and in dogs with OS, focal malignant osteolysis will contribute to circulating TGFβ1 concentrations. Thirty-three dogs with appendicular OS. Expression of TGFβ1 and its cognate receptors, as well as the biologic effects of TGFβ1 blockade, was characterized in OS cells. Ten spontaneous OS samples were characterized for TGFβRI/II expressions by immunohistochemistry. In 33 dogs with OS, plasma TGFβ1 concentrations were quantified and correlated with bone resorption. Canine OS cells secrete TGFβ1, express cognate receptors, and TGFβ1 signaling blockade decreases proliferation, migration, and vascular endothelial growth factor secretion. Naturally occurring OS samples abundantly and uniformly express TGFβRI/II, and in OS-bearing dogs, circulating TGFβ1 concentrations correlate with urine N-telopeptide excretion. Canine OS cells possess TGFβ1 signaling machinery, potentially allowing for the establishment of an autocrine and paracrine pro-tumorigenic signaling loop. As such, TGFβ1 inhibitors might impede localized OS progression in dogs. Copyright © 2014 by the American College of Veterinary Internal Medicine.

  1. INR calibration of Owren-type prothrombin time based on the relationship between PT% and INR utilizing normal plasma samples.

    Science.gov (United States)

    Lindahl, Tomas L; Egberg, Nils; Hillarp, Andreas; Ødegaard, Ole R; Edlund, Bror; Svensson, Jan; Sandset, Per M; Rånby, Mats

    2004-06-01

    Prothrombin time (PT) is clinically important and is used to monitor oral anticoagulant therapy. To obtain PT results in international normalized ratio (INR), the current standardization procedure is complex and involves reference reagents. The PT of diluted plasma samples can be determined with a combined thromboplastin (the Owren-type procedure), but not necessarily with a plain thromboplastin (the Quick-type procedure). Owren-type PT procedures can therefore, as an alternative to the INR calibration, be calibrated with diluted normal plasma to give PT results in percent of normal PT activity (PT%). The present study explored if a plasma-based calibration of an Owren-type PT procedure can be used to obtain results in INR. The approach was to establish a relationship between PT% and INR by multi-center analysis of 365 samples from healthy individuals and patients on warfarin treatment. INR values were obtained by manual Quick-type reference procedure and PT% values by various automated Owren-type procedures. A relationship INR = (1/PT% + 0.018)/0.028 was found. A calibration procedure, based on the relationship, was investigated. Calibrators were the median PT of 21 normal plasma at dilutions representing 100%, 50%, 25%, 12.5% and 6.25% of normal PT activity. These were assigned INR values of 1.00, 1.36, 2.07, 3.05 and 6.36. Calibration of various Owren-type assays was repeatedly performed by 5 expert laboratories during 3 consecutive years. The INR values of certain lyophilised or frozen control plasmas were determined. The frozen control plasmas had externally assigned INR values according to WHO guide-lines. Within the laboratory, CV was typically below 3%. No appreciable difference among the results of the different laboratories or the three assay occasions was found. Externally assigned and INR values were essentially identical to those found. These and other results indicated that the calibration procedure was reproducible, precise and accurate. Thus, an

  2. Tritium retention on the surface of stainless steel samples fixed on the plasma-facing wall in LHD

    International Nuclear Information System (INIS)

    Matsuyama, Masao; Abe, Shinsuke; Nishimura, Kiyohiko; Ashikawa, Naoko; Sagara, Akio; Oya, Yasuhisa; Okuno, Kenji; Yamauchi, Yuji; Nobuta, Yuji

    2014-01-01

    Effects of pre-heating for retention and distribution of tritium have been studied using samples fixed on the wall of the Large Helical Device during a plasma campaign. The samples were fixed at four different locations. The plasma-facing surface of the samples was covered with deposition layers of different thickness in each sample. Retention behavior in deposition layers was observed using β-ray-induced X-ray spectrometry and imaging plate technique. Pre-heating of the samples in vacuum was changed in a temperature range from 300 to 623 K, and subsequent tritium exposure was carried out at 300 K in every runs. Non-uniformity of tritium distribution clearly appeared even in the as-received samples which was not pre-heated. It is considered, therefore, that non-uniform adsorption sites of tritium have been produced during a formation process of deposition layers. In addition, it was seen that the amount of tritium retention increased with an increase in the pre-heating temperature, indicating that adsorption sites of tritium were newly formed in the deposition layers by heating in vacuum. (author)

  3. Canine parvovirus: current perspective.

    Science.gov (United States)

    Nandi, S; Kumar, Manoj

    2010-06-01

    Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.

  4. American Canine Hepatozoonosis

    Science.gov (United States)

    Ewing, S. A.; Panciera, R. J.

    2003-01-01

    American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294

  5. Simulated Irradiation of Samples in HFIR for use as Possible Test Materials in the MPEX (Material Plasma Exposure Experiment) Facility

    Energy Technology Data Exchange (ETDEWEB)

    Ellis, Ronald James [ORNL; Rapp, Juergen [ORNL

    2014-01-01

    The importance of Plasma Material Interaction (PMI) is a major concern in fusion reactor design and analysis. The Material-Plasma Exposure eXperiment (MPEX) facility will explore PMI under fusion reactor plasma conditions. Samples with accumulated displacements per atom (DPA) damage produced by irradiations in the High Flux Isotope Reactor (HFIR) at Oak Ridge National Laboratory (ORNL) will be studied in the MPEX facility. The project presented in this paper involved performing assessments of the induced radioactivity and resulting radiation fields of a variety of potential fusion reactor materials. The scientific code packages MCNP and SCALE were used to simulate irradiation of the samples in HFIR; generation and depletion of nuclides in the material and the subsequent composition, activity levels, gamma radiation fields, and resultant dose rates as a function of cooling time. These state-of-the-art simulation methods were used in addressing the challenge of the MPEX project to minimize the radioactive inventory in the preparation of the samples for inclusion in the MPEX facility.

  6. Expression of nociceptive ligands in canine osteosarcoma.

    Science.gov (United States)

    Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M

    2015-01-01

    Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.

  7. Salinity effects on plasma ion levels, cortisol, and osmolality in Chinook salmon following lethal sampling.

    Science.gov (United States)

    Stewart, Heather A; Noakes, David L G; Cogliati, Karen M; Peterson, James T; Iversen, Martin H; Schreck, Carl B

    2016-02-01

    Studies on hydromineral balance in fishes frequently employ measurements of electrolytes following euthanasia. We tested the effects of fresh- or salt-water euthanasia baths of tricaine mesylate (MS-222) on plasma magnesium (Mg(2+)) and sodium (Na(+)) ions, cortisol and osmolality in fish exposed to saltwater challenges, and the ion and steroid hormone fluctuations over time following euthanasia in juvenile spring Chinook salmon (Oncorhynchus tshawytscha). Salinity of the euthanasia bath affected plasma Mg(2+) and Na(+) concentrations as well as osmolality, with higher concentrations in fish euthanized in saltwater. Time spent in the bath positively affected plasma Mg(2+) and osmolality, negatively affected cortisol, and had no effect on Na(+) concentrations. The difference of temporal trends in plasma Mg(2+) and Na(+) suggests that Mg(2+) may be more sensitive to physiological changes and responds more rapidly than Na(+). When electrolytes and cortisol are measured as endpoints after euthanasia, care needs to be taken relative to time after death and the salinity of the euthanasia bath. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Eruption of the maxillary canines in relation to skeletal maturity.

    Science.gov (United States)

    Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica

    2008-05-01

    Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.

  9. Genomic instability and telomere fusion of canine osteosarcoma cells.

    Directory of Open Access Journals (Sweden)

    Junko Maeda

    Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.

  10. Multiple stage MS in analysis of plasma, serum, urine and in vitro samples relevant to clinical and forensic toxicology.

    Science.gov (United States)

    Meyer, Golo M; Maurer, Hans H; Meyer, Markus R

    2016-01-01

    This paper reviews MS approaches applied to metabolism studies, structure elucidation and qualitative or quantitative screening of drugs (of abuse) and/or their metabolites. Applications in clinical and forensic toxicology were included using blood plasma or serum, urine, in vitro samples, liquids, solids or plant material. Techniques covered are liquid chromatography coupled to low-resolution and high-resolution multiple stage mass analyzers. Only PubMed listed studies published in English between January 2008 and January 2015 were considered. Approaches are discussed focusing on sample preparation and mass spectral settings. Comments on advantages and limitations of these techniques complete the review.

  11. Nd : YAG surgical laser effects in canine prostate tissue: temperature and damage distribution

    NARCIS (Netherlands)

    van Nimwegen, S. A.; L'Eplattenier, H. F.; Rem, A. I.; van der Lugt, J. J.; Kirpensteijn, J.

    2009-01-01

    An in vitro model was used to predict short-term, laser-induced, thermal damage in canine prostate tissue. Canine prostate tissue samples were equipped with thermocouple probes to measure tissue temperature at 3, 6, 9 and 12 mm depths. The tissue surface was irradiated with a Nd:YAG laser in contact

  12. Multi-elemental analysis of aqueous geochemical samples by quadrupole inductively coupled plasma-mass spectrometry (ICP-MS)

    Science.gov (United States)

    Wolf, Ruth E.; Adams, Monique

    2015-01-01

    Typically, quadrupole inductively coupled plasma-mass spectrometry (ICP-MS) is used to determine as many as 57 major, minor, and trace elements in aqueous geochemical samples, including natural surface water and groundwater, acid mine drainage water, and extracts or leachates from geological samples. The sample solution is aspirated into the inductively coupled plasma (ICP) which is an electrodeless discharge of ionized argon gas at a temperature of approximately 6,000 degrees Celsius. The elements in the sample solution are subsequently volatilized, atomized, and ionized by the ICP. The ions generated are then focused and introduced into a quadrupole mass filter which only allows one mass to reach the detector at a given moment in time. As the settings of the mass analyzer change, subsequent masses are allowed to impact the detector. Although the typical quadrupole ICP-MS system is a sequential scanning instrument (determining each mass separately), the scan speed of modern instruments is on the order of several thousand masses per second. Consequently, typical total sample analysis times of 2–3 minutes are readily achievable for up to 57 elements.

  13. Determination of 90Sr and Pu isotopes in contaminated groundwater samples by inductively coupled plasma mass spectrometry

    Science.gov (United States)

    Zoriy, Miroslav V.; Ostapczuk, Peter; Halicz, Ludwik; Hille, Ralf; Becker, J. Sabine

    2005-04-01

    A sensitive analytical method for determining the artificial radionuclides 90Sr, 239Pu and 240Pu at the ultratrace level in groundwater samples from the Semipalatinsk Test Site area in Kazakhstan by double-focusing sector field inductively coupled plasma mass spectrometry (ICP-SFMS) was developed. In order to avoid possible isobaric interferences at m/z 90 for 90Sr determination (e.g. 90Zr+, 40Ar50Cr+, 36Ar54Fe+, 58Ni16O2+, 180Hf2+, etc.), the measurements were performed at medium mass resolution under cold plasma conditions. Pu was separated from uranium by means of extraction chromatography using Eichrom TEVA resin with a recovery of 83%. The limits of detection for 90Sr, 239Pu and 240Pu in water samples were determined as 11, 0.12 and 0.1 fg ml-1, respectively. Concentrations of 90Sr and 239Pu in contaminated groundwater samples ranged from 18 to 32 and from 28 to 856 fg ml-1, respectively. The 240Pu/239Pu isotopic ratio in groundwater samples was measured as 0.17. This isotope ratio indicates that the most probable source of contamination of the investigated groundwater samples was the nuclear weapons tests at the Semipalatinsk Test Site conducted by the USSR in the 1960s.

  14. Hormone Receptor Expression Analyses in Neoplastic and Non-Neoplastic Canine Mammary Tissue by a Bead Based Multiplex Branched DNA Assay: A Gene Expression Study in Fresh Frozen and Formalin-Fixed, Paraffin-Embedded Samples.

    Directory of Open Access Journals (Sweden)

    Annika Mohr

    Full Text Available Immunohistochemistry (IHC is currently considered the method of choice for steroid hormone receptor status evaluation in human breast cancer and, therefore, it is commonly utilized for assessing canine mammary tumors. In case of low hormone receptor expression, IHC is limited and thus is complemented by molecular analyses. In the present study, a multiplex bDNA assay was evaluated as a method for hormone receptor gene expression detection in canine mammary tissues. Estrogen receptor (ESR1, progesterone receptor (PGR, prolactin receptor (PRLR and growth hormone receptor (GHR gene expressions were evaluated in neoplastic and non-neoplastic canine mammary tissues. A set of 119 fresh frozen and 180 formalin-fixed, paraffin-embedded (FFPE was comparatively analyzed and used for assay evaluation. Furthermore, a possible association between the hormone receptor expression in different histological subtypes of canine malignant mammary tumors and the castration status, breed and invasive growth of the tumor were analyzed. The multiplex bDNA assay proved to be more sensitive for fresh frozen specimens. Hormone receptor expression found was significantly decreased in malignant mammary tumors in comparison to non-neoplastic tissue and benign mammary tumors. Among the histological subtypes the lowest gene expression levels of ESR1, PGR and PRLR were found in solid, anaplastic and ductal carcinomas. In summary, the evaluation showed that the measurement of hormone receptors with the multiplex bDNA assay represents a practicable method for obtaining detailed quantitative information about gene expression in canine mammary tissue for future studies. Still, comparison with IHC or quantitative real-time PCR is needed for further validation of the present method.

  15. Coryneform bacteria associated with canine otitis externa

    DEFF Research Database (Denmark)

    Aalbæk, Bent; Bemis, David A.; Schjærff, Mette

    2010-01-01

    This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...

  16. Rapid determination of piracetam in human plasma and cerebrospinal fluid by micellar electrokinetic chromatography with sample direct injection.

    Science.gov (United States)

    Yeh, Hsin-Hua; Yang, Yuan-Han; Ko, Ju-Yun; Chen, Su-Hwei

    2006-07-07

    A simple micellar electrokinetic chromatography (MEKC) method with UV detection at 200 nm for analysis of piracetam in plasma and in cerebrospinal fluid (CSF) by direct injection without any sample pretreatment is described. The separation of piracetam from biological matrix was performed at 25 degrees C using a background electrolyte consisting of Tris buffer with sodium dodecyl sulfate (SDS) as the electrolyte solution. Several parameters affecting the separation of the drug from biological matrix were studied, including the pH and concentrations of the Tris buffer and SDS. Under optimal MEKC condition, good separation with high efficiency and short analyses time is achieved. Using imidazole as an internal standard (IS), the linear ranges of the method for the determination of piracetam in plasma and in CSF were all between 5 and 500 microg/mL; the detection limit of the drug in plasma and in CSF (signal-to-noise ratio=3; injection 0.5 psi, 5s) was 1.0 microg/mL. The applicability of the proposed method for determination of piracetam in plasma and CSF collected after intravenous administration of 3g piracetam every 6h and oral administration 1.2g every 6h in encephalopathy patients with aphasia was demonstrated.

  17. Accuracy and Precision in Elemental Analysis of Environmental Samples using Inductively Coupled Plasma-Atomic Emission Spectrometry

    International Nuclear Information System (INIS)

    Quraishi, Shamsad Begum; Chung, Yong-Sam; Choi, Kwang Soon

    2005-01-01

    Inductively Coupled Plasma-Atomic Emission Spectrometry followed by micro-wave digestion have been performed on different environmental Certified Reference Materials (CRMs). Analytical results show that accuracy and precision in ICP-AES analysis were acceptable and satisfactory in case of soil and hair CRM samples. The relative error of most of the elements in these two CRMs is within 10% with few exceptions and coefficient of variation is also less than 10%. Z-score as an analytical performance was also within the acceptable range (±2). ICP-AES was found as an inadequate method for Air Filter CRM due to incomplete dissolution, low concentration of elements and very low mass of the sample. However, real air filter sample could have been analyzed with high accuracy and precision by increasing sample mass during collection. (author)

  18. Plasma volume changes during hypoglycaemia: the effect of arterial blood sampling

    DEFF Research Database (Denmark)

    Hilsted, J; Bendtsen, Flemming; Christensen, N J

    1990-01-01

    To investigate whether previously reported changes in venous blood volume and composition induced by acute hypoglycaemia in humans are representative for the entire body we measured erythrocyte 51Cr content, haematocrit, plasma volume, intravascular albumin content and transcapillary escape rate...... hypoglycaemia. The magnitude of the changes in arterial and venous blood were not significantly different. These results indicate that the above changes in blood volume and composition are whole-body phenomena: furthermore, the major part of the changes are likely to occur in tissues other than upper extremity...... of albumin in arterial and venous blood in seven healthy subjects before and during insulin-induced hypoglycaemia. In both vascular sites blood 51Cr content and the haematocrit increased, plasma volume and intravascular albumin content decreased and the transcapillary escape rate of albumin increased during...

  19. HPLC/Fluorometric Detection of Carvedilol in Real Human Plasma Samples Using Liquid-Liquid Extraction.

    Science.gov (United States)

    Yilmaz, Bilal; Arslan, Sakir

    2016-03-01

    A simple, rapid and sensitive high-performance liquid chromatography (HPLC) method has been developed to quantify carvedilol in human plasma using an isocratic system with fluorescence detection. The method included a single-step liquid-liquid extraction with diethylether and ethylacetate mixture (3 : 1, v/v). HPLC separation was carried out by reversed-phase chromatography with a mobile phase composed of 20 mM phosphate buffer (pH 7)-acetonitrile (65 : 35, v/v), pumped at a flow rate of 1.0 mL/min. Fluorescence detection was performed at 240 nm (excitation) and 330 nm (emission). The calibration curve for carvedilol was linear from 10 to 250 ng/mL. Intra- and interday precision values for carvedilol in human plasma were plasma averaged out to 91.8%. The limits of detection and quantification of carvedilol were 3.0 and 10 ng/mL, respectively. Also, the method was successfully applied to three patients with hypertension who had been given an oral tablet of 25 mg carvedilol. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Sampling

    CERN Document Server

    Thompson, Steven K

    2012-01-01

    Praise for the Second Edition "This book has never had a competitor. It is the only book that takes a broad approach to sampling . . . any good personal statistics library should include a copy of this book." —Technometrics "Well-written . . . an excellent book on an important subject. Highly recommended." —Choice "An ideal reference for scientific researchers and other professionals who use sampling." —Zentralblatt Math Features new developments in the field combined with all aspects of obtaining, interpreting, and using sample data Sampling provides an up-to-date treat

  1. pH adjustment of human blood plasma prior to bioanalytical sample preparation

    NARCIS (Netherlands)

    Hendriks, G.; Uges, D. R. A.; Franke, J. P.

    2008-01-01

    pH adjustment in bioanalytical sample preparation concerning ionisable compounds is one of the most common sample treatments. This is often done by mixing an aliquot of the sample with a proper buffer adjusted to the proposed pH. The pH of the resulting mixture however, does not necessarily have to

  2. Bilateral supernumerary primary maxillary canines

    Directory of Open Access Journals (Sweden)

    Santanu Mukhopadhyay

    2018-01-01

    Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.

  3. Nanoparticle Enhanced Laser Induced Breakdown Spectroscopy: Effect of nanoparticles deposited on sample surface on laser ablation and plasma emission

    International Nuclear Information System (INIS)

    De Giacomo, A.; Gaudiuso, R.; Koral, C.; Dell'Aglio, M.; De Pascale, O.

    2014-01-01

    In this paper the use of metallic nanoparticles (NPs) for improving Laser Induced Breakdown Spectroscopy (LIBS) is discussed. In the case of conductors an emission signal enhancement up to 1–2 orders of magnitude was obtained depositing NPs on the sample surface by drying a micro-drop of colloidal solution. The basic mechanisms of Nanoparticle Enhanced LIBS (NELIBS) were studied and the main causes of this significantly large enhancement were found to be related to the effect of NPs on the laser ablation process, in terms of a faster and more efficient production of seed electrons with respect to conventional LIBS. The characteristics of NELIBS-produced plasma were investigated by emission spectroscopy and spectrally resolved images. In spite of similar plasma parameters, the NELIBS plasma was found to have larger emission volume and longer persistence than the LIBS one. A method to determine NP concentration and size was also proposed, which involved depositing NPs on non-interacting substrates, and proved the feasibility of LIBS as a fast detection tool for a preliminary characterization of NPs. - Highlights: • Effect of NPs on sample surface enables instantaneous field emission. • More efficient ablation • LIBS emission enhancement up to 1–2 orders of magnitude • Possibility of NP characterization in terms of concentration and size

  4. Influence of feeding on serum canine pancreatic lipase immunoreactivity concentrations

    Directory of Open Access Journals (Sweden)

    Steiner JM

    2014-10-01

    Full Text Available Jörg M Steiner, Craig G Ruaux, David A Williams Gastrointestinal Laboratory, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, USA Abstract: Measurement of serum concentration of pancreatic lipase immunoreactivity (PLI has been shown to be highly specific for exocrine pancreatic function and sensitive for the diagnosis of canine pancreatitis. Currently, it is recommended that food be withheld for at least 12 hours before collecting a blood sample for analysis from dogs. However, it is unknown whether feeding has any influence on serum canine PLI concentration. Thus, the goal of this study was to evaluate the influence of feeding on serum canine PLI concentrations in healthy dogs. Food was withheld from eight healthy adult Beagle dogs for at least 17 hours and a baseline serum sample (0 minutes was collected. Dogs were fed and serum samples were collected at 15, 30, 45, 60, 75, 90, 105, 150, 180, 210, 240, 300, 360, 420, and 480 minutes. There was no significant difference in serum canine PLI concentrations at any time after feeding (P=0.131. We conclude that feeding has no significant influence on serum canine PLI concentrations. Keywords: dog, pancreatic function, pancreatitis, biomarker, diagnostic test

  5. Plasma phenylalanine and tyrosine responses to different nutritional conditions (fasting/postprandial) in patients with phenylketonuria: effect of sample timing.

    Science.gov (United States)

    van Spronsen, F J; van Rijn, M; van Dijk, T; Smit, G P; Reijngoud, D J; Berger, R; Heymans, H S

    1993-10-01

    To evaluate the adequacy of dietary treatment in patients with phenylketonuria, the monitoring of plasma phenylalanine and tyrosine concentrations is of great importance. The preferable time of blood sampling in relation to the nutritional condition during the day, however, is not known. It was the aim of this study to define guidelines for the timing of blood sampling with a minimal burden for the patient. Plasma concentrations of phenylalanine and tyrosine were measured in nine patients with phenylketonuria who had no clinical evidence of tyrosine deficiency. These values were measured during the day both after a prolonged overnight fast, and before and after breakfast. Phenylalanine showed a small rise during prolonged fasting, while tyrosine decreased slightly. After an individually tailored breakfast, phenylalanine remained stable, while tyrosine showed large fluctuations. It is concluded that the patient's nutritional condition (fasting/postprandial) is not important in the evaluation of the phenylalanine intake. To detect a possible tyrosine deficiency, however, a single blood sample is not sufficient and a combination of a preprandial and postprandial blood sample on the same day is advocated.

  6. Development of near-field laser ablation inductively coupled plasma mass spectrometry for sub-micrometric analysis of solid samples

    International Nuclear Information System (INIS)

    Jabbour, Chirelle

    2016-01-01

    A near field laser ablation method was developed for chemical analysis of solid samples at sub-micrometric scale. This analytical technique combines a nanosecond laser Nd:YAG, an atomic Force Microscope (AFM), and an inductively coupled plasma mass spectrometer (ICPMS). In order to improve the spatial resolution of the laser ablation process, the near-field enhancement effect was applied by illuminating, by the laser beam, the apex of the AFM conductive sharp tip maintained at a few nanometers (5 to 30 nm) above the sample surface. The interaction between the illuminated tip and the sample surface enhances locally the incident laser energy and leads to the ablation process. By applying this technique to conducting gold and tantalum samples, and semiconducting silicon sample, a lateral resolution of 100 nm and depths of a few nanometers were demonstrated. Two home-made numerical codes have enabled the study of two phenomena occurring around the tip: the enhancement of the laser electrical field by tip effect, and the induced laser heating at the sample surface. The influence of the main operating parameters on these two phenomena, amplification and heating, was studied. an experimental multi-parametric study was carried out in order to understand the effect of different experimental parameters (laser fluence, laser wavelength, number of laser pulses, tip-to-sample distance, sample and tip nature) on the near-field laser ablation efficiency, crater dimensions and amount of ablated material. (author) [fr

  7. The Effects of Orthodontic Forces during Canine Retraction Using Self-ligating Brackets on Gingival Crevicular Fluid Enzyme Activity, Canine Movement and Root Resorption

    International Nuclear Information System (INIS)

    Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin

    2015-01-01

    Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)

  8. Effects of Low-Temperature Plasma-Sterilization on Mars Analog Soil Samples Mixed with Deinococcus radiodurans

    Directory of Open Access Journals (Sweden)

    Janosch Schirmack

    2016-05-01

    Full Text Available We used Ar plasma-sterilization at a temperature below 80 °C to examine its effects on the viability of microorganisms when intermixed with tested soil. Due to a relatively low temperature, this method is not thought to affect the properties of a soil, particularly its organic component, to a significant degree. The method has previously been shown to work well on spacecraft parts. The selected microorganism for this test was Deinococcus radiodurans R1, which is known for its remarkable resistance to radiation effects. Our results showed a reduction in microbial counts after applying a low temperature plasma, but not to a degree suitable for a sterilization of the soil. Even an increase of the treatment duration from 1.5 to 45 min did not achieve satisfying results, but only resulted in in a mean cell reduction rate of 75% compared to the untreated control samples.

  9. Plasma volume changes during hypoglycaemia: the effect of arterial blood sampling

    DEFF Research Database (Denmark)

    Hilsted, J; Bendtsen, F; Christensen, N J

    1990-01-01

    To investigate whether previously reported changes in venous blood volume and composition induced by acute hypoglycaemia in humans are representative for the entire body we measured erythrocyte 51Cr content, haematocrit, plasma volume, intravascular albumin content and transcapillary escape rate...... hypoglycaemia. The magnitude of the changes in arterial and venous blood were not significantly different. These results indicate that the above changes in blood volume and composition are whole-body phenomena: furthermore, the major part of the changes are likely to occur in tissues other than upper extremity...

  10. Online Determination of Sm, Eu and Yb in Environmental Samples by Inductively Coupled Plasma – Optical Emission Spectrometry

    Directory of Open Access Journals (Sweden)

    J. Dilip Kumar

    2007-01-01

    Full Text Available A procedure was developed for the determination of Sm, Eu and Yb in water samples by inductively coupled plasma-optical emission spectrometry (ICP-OES after preconcentration on synthesized 5-(4-pyridyl azo-8-quinolinol supported by Borassus flabellifer inflorescence (BFI. The sorbed element was subsequently eluted with 0.4 M HNO3 and the acid eluates were analyzed by ICP-OES. Under the optimal conditions, Sm, Eu and Yb in aqueous samples were concentrated 100-fold. Recoveries were obtained by the proposed method in the range of 98.6 -99.8%. This method was also applied for the analysis of spiked and natural water samples. The results provide strong evidence to support the hypothesis of an adsorption mechanism.

  11. Investigations of the inductively coupled plasma source for analyzing NURE water samples at the Los Alamos Scientific Laboratory

    International Nuclear Information System (INIS)

    Apel, C.T.; Bieniewski, T.M.; Cox, L.E.; Steinhaus, D.W.

    1977-03-01

    A 3.4-meter direct-reading spectrograph is being used with an inductively coupled plasma source for the simultaneous determination of Ag, Bi, Cd, Cu, Nb, Ni, Pb, Sn, and W in water samples. We have attached a small digital computer to the system in order to obtain intensity data on each element once a second. After the intensities during a run on a sample have stabilized, the computer records the intensity data and outputs the average concentration for each element. To approach the published detection limits, a peristaltic pump must be used to force the water sample into the usual cross-flow nebulizer. We have studied several different nebulizer designs with the goal of improving efficiency and hence sensitivity. One design, the fritted-disk nebulizer, has an efficiency over 60 percent, as compared with the 5 percent efficiency of the original nebulizer

  12. Direct determination of mercury in cosmetic samples by isotope dilution inductively coupled plasma mass spectrometry after dissolution with formic acid

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Ying; Shi, Zeming; Zong, Qinxia; Wu, Peng; Su, Jing [Sichuan Provincial Key Laboratory of Nuclear Technology in Geology, College of Nuclear Technology and Automation Engineering, Chengdu University of Technology, Chengdu 610059 (China); Liu, Rui, E-mail: liur.ray@gmail.com [Mineral Resources Chemistry Key Laboratory of Sichuan Higher Education Institutions, College of Materials and Chemistry and Chemical Engineering, Chengdu University of Technology, Chengdu 610059 (China)

    2014-02-17

    Graphical abstract: -- Highlights: •Simple, sensitive, and accurate method is established for mercury determination in cosmetics. •The sample preparation procedure is highly simplified. •Isotope dilution efficiently eliminates matrix effect. •First report of using formic acid based method in combination with PVG-ID-ICP MS for mercury quantitation in cosmetics. -- Abstract: A new method was proposed for the accurate determination of mercury in cosmetic samples based on isotopic dilution (ID)-photochemical vapor generation (PVG)-inductively coupled plasma mass spectrometry (ICP MS) measurement. Cosmetic samples were directly dissolved in formic acid solution and subsequently subjected to PVG for the reduction of mercury into vapor species following by ICP MS detection. Therefore, the risks of analyte contamination and loss were avoided. Highly enriched {sup 201}Hg isotopic spike is added to cosmetics and the isotope ratios of {sup 201}Hg/{sup 202}Hg were measured for the quantitation of mercury. With ID calibration, the influences originating from sample matrixes for the determination of mercury in cosmetic samples have been efficiently eliminated. The effects of several experimental parameters, such as the concentration of the formic acid, and the flow rates of carrier gas and sample were investigated. The method provided good reproducibility and the detection limits were found to be 0.6 pg mL{sup −1}. Finally, the developed method was successfully applied for the determination of mercury in six cosmetic samples and a spike test was performed to verify the accuracy of the method.

  13. Comparison of Three Sample Preparation Procedures for the Quantification of L-Arginine, Asymmetric Dimethylarginine, and Symmetric Dimethylarginine in Human Plasma Using HPLC-FLD

    DEFF Research Database (Denmark)

    Schou-Pedersen, Anne Marie Voigt; Lykkesfeldt, Jens

    2018-01-01

    Increased asymmetric dimethylarginine (ADMA) in human plasma has been associated with reduced generation of nitric oxide, leading to atherosclerotic diseases. ADMA may therefore be an important biomarker for cardiovascular disease. In the present study, three sample preparation techniques were co...... sample preparation of human plasma samples before HPLC-FLD in providing important information regarding elevated ADMA concentrations.......Increased asymmetric dimethylarginine (ADMA) in human plasma has been associated with reduced generation of nitric oxide, leading to atherosclerotic diseases. ADMA may therefore be an important biomarker for cardiovascular disease. In the present study, three sample preparation techniques were...... compared regarding the quantification of L-arginine and ADMA in human plasma: (A) protein precipitation (PP) based on aqueous trichloroacetic acid (TCA), (B) PP using a mixture of ammonia and acetonitrile, and (C) solid-phase extraction (SPE). The samples were analysed by using high-performance liquid...

  14. Canine parvovirus in asymptomatic feline carriers.

    Science.gov (United States)

    Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D

    2012-05-25

    Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog

  15. Changes in alt, ast and alp values of plasma and serum samples ...

    African Journals Online (AJOL)

    Blood samples were obtained from a total of 20 patients that presented with cases of liver malfunction at the Ebonyi State University Teaching Hospital, Abakaliki, Nigeria. The enzyme assays were carried out immediately upon sample collection and separation to obtain the baseline value (BV), and thereafter at specified ...

  16. Novel double-isotope technique for enzymatic assay of catecholamines, permitting high precision, sensitivity and plasma sample capacity

    International Nuclear Information System (INIS)

    Brown, M.J.; Jenner, D.A.

    1981-01-01

    A novel use of a double-isotope method is described which allows radioenzymatic assays to combine precision and sensitivity. In the catechol O-methyltransferase assay separate portions of each plasma sample are incubated with either S-[ 3 H]- or S-[ 14 C]-adenosyl-L-methionine. Standards of noradrenaline and adrenaline are added to the latter portions and are thus converted into standards of [ 14 C]metadrenalines. These are added to the 3 H-labelled portions after the incubation, where they function as tracers. The final recovery of 14 C radioactivity corrects for (a) the efficiency of methylation in the plasma sample concerned and (b) the recovery of metadrenalines during the extraction procedures. The 3 H/ 14 C ratio is constant in each assay for a given catecholamine concentration and is determined for samples to which standards of noradrenaline and adrenaline are added to the 3 H- (as well as the 14 C-) labelled portions before the initial incubation. The sensitivity of the assay is increased by using high specific radioactivity S-[ 3 H]adenosyl-L-methionine, and low backgrounds are maintained by catecholamine depletion in vivo in the rats used for enzyme preparation. Both catecholamines (1.5 pg/ml; 10 pmol/l) may be detected; the coefficients of variation are 3.0 and 3.2% for noradrenaline and adrenaline respectively (intra-assay) and 4.6 and 5.0% (inter-assay). (author)

  17. Microparticle counts in platelet-rich and platelet-free plasma, effect of centrifugation and sample-processing protocols.

    Science.gov (United States)

    Chandler, Wayne L

    2013-03-01

    This study provides the first estimates of microparticle numbers in platelet-rich plasma (PRP) from normal individuals, closer to in-vivo levels, using higher-resolution flow cytometry. We measured platelet (CD41+) and annexin V+ microparticles in fresh and frozen aliquots of PRP, platelet-poor plasma, platelet-free plasma (PFP), and microparticles isolated by high-speed centrifugation. PRP from healthy individuals contained 730,000/μl total microparticles based on light-scattering measurements. A median of 27,000/μl microparticles in PRP were of platelet origin and 120,000/μl annexin V+, and of these, 24,000/μl were dual-positive procoagulant platelet microparticles. Double centrifugation of PRP removed 99% of platelets, but also 80% of annexin V+ CD41+, 93% of annexin V+ CD41-, and 58% of annexin V- CD41+ microparticles. Loss of microparticles with centrifugation varied from individual to individual. Microparticle counts after isolation by centrifugation and double washing were not significantly different than counts in the original PFP sample, but lower than in PRP. Freeze-thawing of PFP had no effect on platelet microparticle counts, but slightly increased annexin V+, CD41- counts. Freeze-thawing of isolated washed microparticles resulted in a 30-50% increase in annexin V+ microparticles. PRP contains large numbers of cellular microparticles, including platelet and annexin V+ microparticles, which are lost to varying degrees when PRP is double centrifuged to remove platelets. Microparticles remaining in PFP can be recovered by high-speed centrifugation without loss compared to the original PFP sample. Freeze-thawing has variable effects on microparticle counts depending on the sample preparation used.

  18. Direct trace-elemental analysis of urine samples by laser ablation-inductively coupled plasma mass spectrometry after sample deposition on clinical filter papers.

    Science.gov (United States)

    Aramendía, Maite; Rello, Luis; Vanhaecke, Frank; Resano, Martín

    2012-10-16

    Collection of biological fluids on clinical filter papers shows important advantages from a logistic point of view, although analysis of these specimens is far from straightforward. Concerning urine analysis, and particularly when direct trace elemental analysis by laser ablation-inductively coupled plasma mass spectrometry (LA-ICPMS) is aimed at, several problems arise, such as lack of sensitivity or different distribution of the analytes on the filter paper, rendering obtaining reliable quantitative results quite difficult. In this paper, a novel approach for urine collection is proposed, which circumvents many of these problems. This methodology consists on the use of precut filter paper discs where large amounts of sample can be retained upon a single deposition. This provides higher amounts of the target analytes and, thus, sufficient sensitivity, and allows addition of an adequate internal standard at the clinical lab prior to analysis, therefore making it suitable for a strategy based on unsupervised sample collection and ulterior analysis at referral centers. On the basis of this sampling methodology, an analytical method was developed for the direct determination of several elements in urine (Be, Bi, Cd, Co, Cu, Ni, Sb, Sn, Tl, Pb, and V) at the low μg L(-1) level by means of LA-ICPMS. The method developed provides good results in terms of accuracy and LODs (≤1 μg L(-1) for most of the analytes tested), with a precision in the range of 15%, fit-for-purpose for clinical control analysis.

  19. The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D

    Directory of Open Access Journals (Sweden)

    MarkéŽta Vaňkov‡á

    2016-01-01

    Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.

  20. Ultratrace determination of Pb, Se and As in wine samples by electrothermal vaporization inductively coupled plasma mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Grindlay, Guillermo, E-mail: guillermo.grindlay@ua.es [Department of Analytical Chemistry, Nutrition and Food Sciences, University of Alicante, PO Box 99, 03080 - Alicante (Spain); Mora, Juan; Gras, Luis [Department of Analytical Chemistry, Nutrition and Food Sciences, University of Alicante, PO Box 99, 03080 - Alicante (Spain); de Loos-Vollebregt, M.T.C. [Delft University of Technology, Fac. Applied Sciences, Julianalaan 67, 2628 BC - Delft (Netherlands)

    2009-10-12

    The determination of Pb, Se and As in wine has a great interest due to health risks and legal requirements. To perform the analysis of wine, two considerations must be taken into account: (i) the low concentration level of the analytes; and (ii) the risk of interferences due to wine matrix components. The goal of this work is to evaluate electrothermal vaporization (ETV) sample introduction for ultratrace determination of Pb, Se and As in wine samples by inductively coupled plasma mass spectrometry (ICP-MS). The results obtained with ETV-ICP-MS were compared to those obtained with conventional liquid sample introduction in ICP-MS and electrothermal atomic absorption spectrometry (ETAAS). Analytical figures of merit of ETV sample introduction strongly depend on the amount of wine sample, on the modifier nature (i.e. Pd, ascorbic acid or citric acid) and concentration and on the temperature program. Wine matrix components exert a great influence on analyte transport efficiency. Due to this fact, the analysis of wine cannot be performed by means of external calibration but the standard addition methodology should be used. The determination of Pb and Se in wine by ETV-ICP-MS provides similar results as conventional liquid sample introduction ICP-MS. For As, the concentration values obtained with ETV sample introduction were between two and four times lower than with the conventional system. These differences are related to the lower intensity of polyatomic interferences (i.e. {sup 40}Ar{sup 35}Cl{sup +} vs. {sup 75}As{sup +}) obtained for ETV sample introduction when compared to the conventional system. Finally, no differences for Pb determination were observed between ETV sample introduction and ETAAS. Unfortunately, the limits of detection for As and Se in ETAAS were not low enough to quantify these elements in the wine samples tested.

  1. Ultratrace determination of Pb, Se and As in wine samples by electrothermal vaporization inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Grindlay, Guillermo; Mora, Juan; Gras, Luis; de Loos-Vollebregt, M.T.C.

    2009-01-01

    The determination of Pb, Se and As in wine has a great interest due to health risks and legal requirements. To perform the analysis of wine, two considerations must be taken into account: (i) the low concentration level of the analytes; and (ii) the risk of interferences due to wine matrix components. The goal of this work is to evaluate electrothermal vaporization (ETV) sample introduction for ultratrace determination of Pb, Se and As in wine samples by inductively coupled plasma mass spectrometry (ICP-MS). The results obtained with ETV-ICP-MS were compared to those obtained with conventional liquid sample introduction in ICP-MS and electrothermal atomic absorption spectrometry (ETAAS). Analytical figures of merit of ETV sample introduction strongly depend on the amount of wine sample, on the modifier nature (i.e. Pd, ascorbic acid or citric acid) and concentration and on the temperature program. Wine matrix components exert a great influence on analyte transport efficiency. Due to this fact, the analysis of wine cannot be performed by means of external calibration but the standard addition methodology should be used. The determination of Pb and Se in wine by ETV-ICP-MS provides similar results as conventional liquid sample introduction ICP-MS. For As, the concentration values obtained with ETV sample introduction were between two and four times lower than with the conventional system. These differences are related to the lower intensity of polyatomic interferences (i.e. 40 Ar 35 Cl + vs. 75 As + ) obtained for ETV sample introduction when compared to the conventional system. Finally, no differences for Pb determination were observed between ETV sample introduction and ETAAS. Unfortunately, the limits of detection for As and Se in ETAAS were not low enough to quantify these elements in the wine samples tested.

  2. Ultra-Sensitive Elemental Analysis Using Plasmas 5.Speciation of Arsenic Compounds in Biological Samples by High Performance Liquid Chromatography-Inductively Coupled Plasma Mass Spectrometry System

    Science.gov (United States)

    Kaise, Toshikazu

    Arsenic originating from the lithosphere is widely distributed in the environment. Many arsenicals in the environment are in organic and methylated species. These arsenic compounds in drinking water or food products of marine origin are absorbed in human digestive tracts, metabolized in the human body, and excreted viatheurine. Because arsenic shows varying biological a spects depending on its chemical species, the biological characteristics of arsenic must be determined. It is thought that some metabolic pathways for arsenic and some arsenic circulation exist in aqueous ecosystems. In this paper, the current status of the speciation analysis of arsenic by HPLC/ICP-MS (High Performance Liquid Chromatography-Inductively Coupled Plasma Mass spectrometry) in environmental and biological samples is summarized using recent data.

  3. Canine obesity: an overview.

    Science.gov (United States)

    Gossellin, J; Wren, J A; Sunderland, S J

    2007-08-01

    Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.

  4. Peracute Infectious Canine Hepatitis

    Directory of Open Access Journals (Sweden)

    A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam

    2012-05-01

    Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.

  5. Radioresistant canine hematopoietic cells

    International Nuclear Information System (INIS)

    Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.

    1987-01-01

    Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells

  6. Molecular and serological surveillance of canine enteric viruses in stray dogs from Vila do Maio, Cape Verde.

    Science.gov (United States)

    Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis

    2014-04-23

    Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from

  7. Trace analysis of irradiated steel samples from hiroshima by laser ablation inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Helal, A.I.; Zahran, N.F.

    2000-01-01

    A double focusing (JEOL, PLASMAX2) and quadrupole (ELAN6000, Perkin Elmer) mass spectrometers were used for the quantitative analysis of trace elements in steel samples from Hiroshima. The quantification of the analytical results was carried out using steel 468 as a standard reference material. The relative sensitivity coefficients (RSC's) for most of the elements varied between 0.12 and 2.93. The effect of iron as a matrix and the non-spectroscopic interferences are studied. Comparison of the results obtained on two steel samples from Hiroshima with that obtained on steel 468 standard reference materials demonstrated that there is no significant difference between them. Therefore, it is possible to say that the irradiated steel samples from Hiroshima have nearly the same specifications of trace element content as those of the normal steel samples

  8. Determination of extremely low 236U/238U isotope ratios in environmental samples by sector-field inductively coupled plasma mass spectrometry using high-efficiency sample introduction

    International Nuclear Information System (INIS)

    Boulyga, Sergei F.; Heumann, Klaus G.

    2006-01-01

    A method by inductively coupled plasma mass spectrometry (Icp-Ms) was developed which allows the measurement of 236 U at concentration ranges down to 3 x 10 -14 g g -1 and extremely low 236 U/ 238 U isotope ratios in soil samples of 10 -7 . By using the high-efficiency solution introduction system APEX in connection with a sector-field ICP-MS a sensitivity of more than 5000 counts fg -1 uranium was achieved. The use of an aerosol desolvating unit reduced the formation rate of uranium hydride ions UH + /U + down to a level of 10 -6 . An abundance sensitivity of 3 x 10 -7 was observed for 236 U/ 238 U isotope ratio measurements at mass resolution 4000. The detection limit for 236 U and the lowest detectable 236 U/ 238 U isotope ratio were improved by more than two orders of magnitude compared with corresponding values by alpha spectrometry. Determination of uranium in soil samples collected in the vicinity of Chernobyl nuclear power plant (NPP) resulted in that the 236 U/ 238 U isotope ratio is a much more sensitive and accurate marker for environmental contamination by spent uranium in comparison to the 235 U/ 238 U isotope ratio. The ICP-MS technique allowed for the first time detection of irradiated uranium in soil samples even at distances more than 200 km to the north of Chernobyl NPP (Mogilev region). The concentration of 236 U in the upper 0-10 cm soil layers varied from 2 x 10 -9 g g -1 within radioactive spots close to the Chernobyl NPP to 3 x 10 -13 g g -1 on a sampling site located by >200 km from Chernobyl

  9. Determination of extremely low (236)U/(238)U isotope ratios in environmental samples by sector-field inductively coupled plasma mass spectrometry using high-efficiency sample introduction.

    Science.gov (United States)

    Boulyga, Sergei F; Heumann, Klaus G

    2006-01-01

    A method by inductively coupled plasma mass spectrometry (ICP-MS) was developed which allows the measurement of (236)U at concentration ranges down to 3 x 10(-14)g g(-1) and extremely low (236)U/(238)U isotope ratios in soil samples of 10(-7). By using the high-efficiency solution introduction system APEX in connection with a sector-field ICP-MS a sensitivity of more than 5,000 counts fg(-1) uranium was achieved. The use of an aerosol desolvating unit reduced the formation rate of uranium hydride ions UH(+)/U(+) down to a level of 10(-6). An abundance sensitivity of 3 x 10(-7) was observed for (236)U/(238)U isotope ratio measurements at mass resolution 4000. The detection limit for (236)U and the lowest detectable (236)U/(238)U isotope ratio were improved by more than two orders of magnitude compared with corresponding values by alpha spectrometry. Determination of uranium in soil samples collected in the vicinity of Chernobyl nuclear power plant (NPP) resulted in that the (236)U/(238)U isotope ratio is a much more sensitive and accurate marker for environmental contamination by spent uranium in comparison to the (235)U/(238)U isotope ratio. The ICP-MS technique allowed for the first time detection of irradiated uranium in soil samples even at distances more than 200 km to the north of Chernobyl NPP (Mogilev region). The concentration of (236)U in the upper 0-10 cm soil layers varied from 2 x 10(-9)g g(-1) within radioactive spots close to the Chernobyl NPP to 3 x 10(-13)g g(-1) on a sampling site located by >200 km from Chernobyl.

  10. The feasibility of TEA CO2 laser-induced plasma for spectrochemical analysis of geological samples in simulated Martian conditions

    Science.gov (United States)

    Savovic, Jelena; Stoiljkovic, Milovan; Kuzmanovic, Miroslav; Momcilovic, Milos; Ciganovic, Jovan; Rankovic, Dragan; Zivkovic, Sanja; Trtica, Milan

    2016-04-01

    The present work studies the possibility of using pulsed Transversely Excited Atmospheric (TEA) carbon dioxide laser as an energy source for laser-induced breakdown spectroscopy (LIBS) analysis of rocks under simulated Martian atmospheric conditions. Irradiation of a basaltic rock sample with the laser intensity of 56 MW cm- 2, in carbon-dioxide gas at a pressure of 9 mbar, created target plasma with favorable conditions for excitation of all elements usually found in geological samples. Detection limits of minor constituents (Ba, Cr, Cu, Mn, Ni, Sr, V, and Zr) were in the 3 ppm-30 ppm range depending on the element. The precision varied between 5% and 25% for concentration levels of 1% to 10 ppm, respectively. Generally, the proposed relatively simple TEA CO2 laser-LIBS system provides good sensitivity for geological studies under reduced CO2 pressure.

  11. Determination of daily intake of elements from Philippine total diet samples using inductively coupled plasma-atomic emission spectrometry

    International Nuclear Information System (INIS)

    Leon, G.C. de; Shiraishi, K.; Kawamura, H.; Igaraishi, Y.; Palattao, M.V.; Azanon, E.M.

    1990-10-01

    Total diet samples were analyzed for major elements (Na, K, Ca, Mg, P) and some minor trace elements (Fe, Zn, Mn, Al, Sr, Cu, Ba, Yt) using inductively coupled plasma-atomic emission spectrometry (ICP-AES). Samples analyzed were classified into sex and age groups. Results for some elements (Na, K, Mg, Zn, Cu, Mn) were compared with values from Bataan dietary survey calculated using the Philippine composition table. Exceot for Na, analytical results were similar to calculated values. Analytical results for Ca and Fe were also compared with the values from Food and Nutrition Research Institute. In general, values obtained in the study were lower than the FNRI values. Comparison of the analytical and calculated results with the Japanese and ICRP data showed that Philippine values were lower than foreign values. (Auth.). 22 refs., 9 tabs

  12. Application of isotope dilution for the determination of thorium in biological samples by inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Igarashi, Yasuhito; Shiraishi, Kunio; Takaku, Yuichi; Masuda, Kimihiko; Seki, Riki; Yamamoto, Masayoshi.

    1992-01-01

    The applicability of isotope dilution-inductively coupled plasma mass spectrometry (ID-ICP-MS) was examined for Th in biological samples. A naturally occurring isotope of Th(Th-230) was used as the spiking isotope. The concentration of Th-230 in the final sample solution was about 50 - 60 pg/ml; an isotope ratio of 232/230 could be measured with a relative standard deviation of less than 2%. The error magnification depended on the amount of Th-232 being concomitant with the Th-230. Though it was shown that one ng of Th-232 could be determined with reasonable precision with a tracer of the present purity, more care should be taken to reduce any source of systematic error. (author)

  13. Development and validation of reversed-phase high performance liquid chromatographic method for analysis of cephradine in human plasma samples

    International Nuclear Information System (INIS)

    Ahmad, M.; Usman, M.; Madni, A.; Akhtar, N.; Khalid, N.; Asghar, W.

    2010-01-01

    An HPLC method with high precision, accuracy and selectivity was developed and validated for the assessment of cephradine in human plasma samples. The extraction procedure was simple and accurate with single step followed by direct injection of sample into HPLC system. The extracted cephradine in spiked human plasma was separated and quantitated using reversed phase C/sub 18/ column and UV detection wavelength of 254 nm. The optimized mobile phase of new composition of 0.05 M potassium dihydrogen phosphate (pH 3.4)-acetonitrile (88: 12) was pumped at an optimum flow rate of 1 mL.min/sup 1/. The method resulted linearity in the concentration range 0.15- 20 micro g mL/sup -1/. The limit of detection (LOD) and limit of quantification (LOQ) were 0.05 and 0.150 Microg.mL/sup -1/, respectively. The accuracy of method was 98.68 %. This method can 1>e applied for bioequivalence studies and therapeutic drug monitoring as well as for the routine analysis of cephradine. (author)

  14. Determination of Coreceptor Usage of Human Immunodeficiency Virus Type 1 from Patient Plasma Samples by Using a Recombinant Phenotypic Assay

    Science.gov (United States)

    Trouplin, Virginie; Salvatori, Francesca; Cappello, Fanny; Obry, Veronique; Brelot, Anne; Heveker, Nikolaus; Alizon, Marc; Scarlatti, Gabriella; Clavel, François; Mammano, Fabrizio

    2001-01-01

    We developed a recombinant virus technique to determine the coreceptor usage of human immunodeficiency virus type 1 (HIV-1) from plasma samples, the source expected to represent the most actively replicating virus population in infected subjects. This method is not subject to selective bias associated with virus isolation in culture, a step required for conventional tropism determination procedures. The addition of a simple subcloning step allowed semiquantitative evaluation of virus populations with a different coreceptor (CCR5 or CXCR4) usage specificity present in each plasma sample. This procedure detected mixtures of CCR5- and CXCR4-exclusive virus populations as well as dualtropic viral variants, in variable proportions. Sequence analysis of dualtropic clones indicated that changes in the V3 loop are necessary for the use of CXCR4 as a coreceptor, but the overall context of the V1-V3 region is important to preserve the capacity to use CCR5. This convenient technique can greatly assist the study of virus evolution and compartmentalization in infected individuals. PMID:11119595

  15. Comparison of glomerular filtration rates by dynamic renal scintigraphy and dual-plasma sample clearance method in diabetic nephropathy

    International Nuclear Information System (INIS)

    Xie Peng; Huang Jianmin; Pan Liping; Liu Xiaomei; Wei Lingge; Gao Jianqing

    2010-01-01

    Objective: To evaluate the accuracy of renal scintigraphy for the estimation of glomerular filtration rates (dGFR) in patients with diabetic nephropathy as compared to the conventional dual-plasma sample clearance method (pscGFR). Methods: Forty-six patients with diabetic nephropathy underwent both dynamic renal scintigraphy and dual-plasma sample measurement after 99 Tc m -DTPA injection. Paired student t-test and correlation analysis were performed to compare dGFR and pscGFR (normalized to body surface area, 1.73 m -2 ). Results: The mean dGFR was higher than mean pscGFR ((51.08±26.78)ml·min -1 vs (44.06±29.43)ml·min -1 , t=4.209, P=0.000). The dGFR correlated with pscGFR (r=0.923, P=0.000) linearly (regression equation: pscGFR=1.015 x dGFR -7.773, F=254.656, P=0.000). Conclusions: dGFR correlated well with pscGFR. Although it could not absolutely replace the latter in patients with diabetic nephropathy, dGFR could reasonably evaluate the filtration function for these patients. (authors)

  16. Plasma treatment of bulk niobium surface for superconducting rf cavities: Optimization of the experimental conditions on flat samples

    Directory of Open Access Journals (Sweden)

    M. Rašković

    2010-11-01

    Full Text Available Accelerator performance, in particular the average accelerating field and the cavity quality factor, depends on the physical and chemical characteristics of the superconducting radio-frequency (SRF cavity surface. Plasma based surface modification provides an excellent opportunity to eliminate nonsuperconductive pollutants in the penetration depth region and to remove the mechanically damaged surface layer, which improves the surface roughness. Here we show that the plasma treatment of bulk niobium (Nb presents an alternative surface preparation method to the commonly used buffered chemical polishing and electropolishing methods. We have optimized the experimental conditions in the microwave glow discharge system and their influence on the Nb removal rate on flat samples. We have achieved an etching rate of 1.7  μm/min⁡ using only 3% chlorine in the reactive mixture. Combining a fast etching step with a moderate one, we have improved the surface roughness without exposing the sample surface to the environment. We intend to apply the optimized experimental conditions to the preparation of single cell cavities, pursuing the improvement of their rf performance.

  17. Production of aerosols by optical catapulting: Imaging, performance parameters and laser-induced plasma sampling rate

    International Nuclear Information System (INIS)

    Abdelhamid, M.; Fortes, F.J.; Fernández-Bravo, A.; Harith, M.A.; Laserna, J.J.

    2013-01-01

    Optical catapulting (OC) is a sampling and manipulation method that has been extensively studied in applications ranging from single cells in heterogeneous tissue samples to analysis of explosive residues in human fingerprints. Specifically, analysis of the catapulted material by means of laser-induced breakdown spectroscopy (LIBS) offers a promising approach for the inspection of solid particulate matter. In this work, we focus our attention in the experimental parameters to be optimized for a proper aerosol generation while increasing the particle density in the focal region sampled by LIBS. For this purpose we use shadowgraphy visualization as a diagnostic tool. Shadowgraphic images were acquired for studying the evolution and dynamics of solid aerosols produced by OC. Aluminum silicate particles (0.2–8 μm) were ejected from the substrate using a Q-switched Nd:YAG laser at 1064 nm, while time-resolved images recorded the propagation of the generated aerosol. For LIBS analysis and shadowgraphy visualization, a Q-switched Nd:YAG laser at 1064 nm and 532 nm was employed, respectively. Several parameters such as the time delay between pulses and the effect of laser fluence on the aerosol production have been also investigated. After optimization, the particle density in the sampling focal volume increases while improving the aerosol sampling rate till ca. 90%. - Highlights: • Aerosol generation by optical catapulting has been successfully optimized. • We study the evolution and dynamics of solid aerosols produced by OC. • We use shadowgraphy visualization as a diagnostic tool. • Effects of temporal conditions and laser fluence on the elevation of the aerosol cloud have been investigated. • The observed LIBS sampling rate increased from 50% reported before to approximately 90%

  18. Experimental study of laser ablation as sample introduction technique for inductively coupled plasma-mass spectrometry

    International Nuclear Information System (INIS)

    Van Winckel, S.

    2001-01-01

    The contribution consists of an abstract of a PhD thesis. In the PhD study, several complementary applications of laser-ablation were investigated in order to characterise experimentally laser ablation (LA) as a sample introduction technique for ICP-MS. Three applications of LA as a sample introduction technique are discussed: (1) the microchemical analysis of the patina of weathered marble; (2) the possibility to measure isotope ratios (in particular Pb isotope ratios in archaeological bronze artefacts); and (3) the determination of Si in Al as part of a dosimetric study of the BR2 reactor vessel

  19. The microwave induced plasma with optical emission spectrometry (MIP-OES) in 23 elements determination in geological samples.

    Science.gov (United States)

    Niedzielski, P; Kozak, L; Wachelka, M; Jakubowski, K; Wybieralska, J

    2015-01-01

    The article presents the optimisation, validation and application of the microwave induced plasma optical emission spectrometry (MIP-OES) dedicated for a routine determination of Ag, Al, B, Ba, Bi, Ca, Cd, Cr, Cu, Fe, Ga, In, K, Li, Mg, Mn, Mo, Na, Ni, Pb, Sr, Tl, Zn, in the geological samples. The three procedures of sample preparation has been proposed: sample digestion with the use of hydrofluoric acid for determination of total concentration of elements, extraction by aqua regia for determination of the quasi-total element concentration and extraction by hydrochloric acid solution to determine contents of the elements in acid leachable fraction. The detection limits were on the level 0.001-0.121 mg L(-1) (from 0.010-0.10 to 1.2-12 mg kg(-1) depend on the samples preparation procedure); the precision: 0.20-1.37%; accuracy 85-115% (for recovery for certified standards materials analysis and parallel analysis by independent analytical techniques: X-ray fluorescence (XRF) and flame absorption spectrometry (FAAS)). The conformity of the results obtained by MIP-OES analytical procedures with the results obtained by XRF and FAAS analysis allows to propose the procedures for studies of elemental composition of the fraction of the geological samples. Additionally, the MIP-OES technique is much less expensive than ICP techniques and much less time-consuming than AAS techniques. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Evaluation of a cost effective in-house method for HIV-1 drug resistance genotyping using plasma samples.

    Directory of Open Access Journals (Sweden)

    Devidas N Chaturbhuj

    Full Text Available OBJECTIVES: Validation of a cost effective in-house method for HIV-1 drug resistance genotyping using plasma samples. DESIGN: The validation includes the establishment of analytical performance characteristics such as accuracy, reproducibility, precision and sensitivity. METHODS: The accuracy was assessed by comparing 26 paired Virological Quality Assessment (VQA proficiency testing panel sequences generated by in-house and ViroSeq Genotyping System 2.0 (Celera Diagnostics, US as a gold standard. The reproducibility and precision were carried out on five samples with five replicates representing multiple HIV-1 subtypes (A, B, C and resistance patterns. The amplification sensitivity was evaluated on HIV-1 positive plasma samples (n = 88 with known viral loads ranges from 1000-1.8 million RNA copies/ml. RESULTS: Comparison of the nucleotide sequences generated by ViroSeq and in-house method showed 99.41±0.46 and 99.68±0.35% mean nucleotide and amino acid identity respectively. Out of 135 Stanford HIVdb listed HIV-1 drug resistance mutations, partial discordance was observed at 15 positions and complete discordance was absent. The reproducibility and precision study showed high nucleotide sequence identities i.e. 99.88±0.10 and 99.82±0.20 respectively. The in-house method showed 100% analytical sensitivity on the samples with HIV-1 viral load >1000 RNA copies/ml. The cost of running the in-house method is only 50% of that for ViroSeq method (112$ vs 300$, thus making it cost effective. CONCLUSIONS: The validated cost effective in-house method may be used to collect surveillance data on the emergence and transmission of HIV-1 drug resistance in resource limited countries. Moreover, the wide applications of a cost effective and validated in-house method for HIV-1 drug resistance testing will facilitate the decision making for the appropriate management of HIV infected patients.

  1. Macro- and micro-element analysis in milk samples by inductively coupled plasma-optical emission spectrometry

    Directory of Open Access Journals (Sweden)

    Petrović Sanja M.

    2016-01-01

    Full Text Available The paper describes the determination of Ag, Al, B, Ba, Bi, Ca, Cd, Co, Cr, Cu, Fe, Ga, In, K, Li, Mg, Mn, Na, Ni, Pb, Sr, Tl and Zn, as well as total fat content of milk samples, originated from different sources. The analyzed milk samples were: human milk, fresh cow milk, pasteurized cow milk from a local market, and reconstituted powder milk. The milk samples were obtained from Jablanica District (Serbia territory. Preparation of samples for macro- and micro-analyses was done by wet digestion. Concentrations of the elements after digestion were determined by inductively coupled plasma optical emission spectrometry (ICP-OES. Total fat content of milk samples was determinate by the Weibull and Stoldt method. The results showed that potassium and calcium concentrations were the highest in all samples: 1840.64 - 2993.26 mg/L and 456.05 - 1318.08 mg/L, respectively. Of all heavy metals from the examined milk samples (copper, zinc, manganese, nickel, cadmium, and lead, the most common were zinc and copper, with approximately similar content in the range of 5 - 12 mg/l, while cadmium nickel and manganese were not detected at all. Samples of fresh cow milk and human milk showed the highest fat content of 3.6 and 4.2 %, respectively. Results for total fat and macro- and micro-analyses showed that fresh cow milk has the highest contents of fat and calcium, making it the most nutritious. [Projekat Ministarstva nauke Republike Srbije, br. TR 34012

  2. The effect of two packaging systems on the post-thaw characteristics of canine sperm.

    Science.gov (United States)

    Strzeżek, R; Polakiewicz, P; Kordan, W

    2015-01-01

    The aim of this study was to compare the effect of different packaging systems on some parameters of cryopreserved canine spermatozoa. The experimental material consisted of the sperm-rich fractions of ejaculates collected from four Beagle dogs. Semen samples for cryopreservation were stored in 0.25 ml plastic straws and two aluminum tubes with a total volume of 5.0 ml. Semen was frozen in static nitrogen vapor for 10 minutes (0.25 ml straws) or 15 and 20 minutes (aluminum tubes). Post-thaw assessments involved the determination of sperm motility parameters using a computer assisted sperm analyzer (CASA), sperm plasma membrane integrity (SPMI), mitochondrial membrane potential (MMP) and acrosome integrity (normal apical ridge, NAR). Regardless of the packaging system applied, no significant differences in total sperm motility (TMOT) or selected kinematic parameters were observed after freezing-thawing. However, spermatozoa frozen in 0.25 mL straws were characterized by improved functionality, in particular mitochondrial function, after thawing. The results indicate that large quantities of canine semen can be frozen in aluminum tubes. Further studies are required, however, to evaluate different freezing and thawing rates of aluminum tubes.

  3. Automated Processing of Plasma Samples for Lipoprotein Separation by Rate-Zonal Ultracentrifugation.

    Science.gov (United States)

    Peters, Carl N; Evans, Iain E J

    2016-12-01

    Plasma lipoproteins are the primary means of lipid transport among tissues. Defining alterations in lipid metabolism is critical to our understanding of disease processes. However, lipoprotein measurement is limited to specialized centers. Preparation for ultracentrifugation involves the formation of complex density gradients that is both laborious and subject to handling errors. We created a fully automated device capable of forming the required gradient. The design has been made freely available for download by the authors. It is inexpensive relative to commercial density gradient formers, which generally create linear gradients unsuitable for rate-zonal ultracentrifugation. The design can easily be modified to suit user requirements and any potential future improvements. Evaluation of the device showed reliable peristaltic pump accuracy and precision for fluid delivery. We also demonstrate accurate fluid layering with reduced mixing at the gradient layers when compared to usual practice by experienced laboratory personnel. Reduction in layer mixing is of critical importance, as it is crucial for reliable lipoprotein separation. The automated device significantly reduces laboratory staff input and reduces the likelihood of error. Overall, this device creates a simple and effective solution to formation of complex density gradients. © 2015 Society for Laboratory Automation and Screening.

  4. A needle extraction utilizing a molecularly imprinted-sol-gel xerogel for on-line microextraction of the lung cancer biomarker bilirubin from plasma and urine samples.

    Science.gov (United States)

    Moein, Mohammad Mahdi; Jabbar, Dunia; Colmsjö, Anders; Abdel-Rehim, Mohamed

    2014-10-31

    In the present work, a needle trap utilizing a molecularly imprinted sol-gel xerogel was prepared for the on-line microextraction of bilirubin from plasma and urine samples. Each prepared needle could be used for approximately one hundred extractions before it was discarded. Imprinted and non-imprinted sol-gel xerogel were applied for the extraction of bilirubin from plasma and urine samples. The produced molecularly imprinted sol-gel xerogel polymer showed high binding capacity and fast adsorption/desorption kinetics for bilirubin in plasma and urine samples. The adsorption capacity of molecularly imprinted sol-gel xerogel polymer was approximately 60% higher than that of non-imprinted polymer. The effect of the conditioning, washing and elution solvents, pH, extraction time, adsorption capacity and imprinting factor were investigated. The limit of detection and the lower limit of quantification were set to 1.6 and 5nmolL(-1), respectively using plasma or urine samples. The standard calibration curves were obtained within the concentration range of 5-1000nmolL(-1) in both plasma and urine samples. The coefficients of determination values (R(2)) were ≥0.998 for all runs. The extraction recovery was approximately 80% for BR in the human plasma and urine samples. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Determination of rare earth elements in uranium bearing samples using Inductively Coupled Plasma Mass Spectrometry (ICPMS)

    International Nuclear Information System (INIS)

    Mishra, S.; Chaudhury, P.; Pradeepkumar, K.S.; Sahoo, S.K.

    2017-01-01

    In the present study a methodology has been described for determination of REEs without involving separation and the method is successfully applied for determination of REE concentration in uranium ore as well as in soil samples from a uranium mining site

  6. Assessment of glomerular filtration rate measurement with plasma sampling: a technical review.

    Science.gov (United States)

    Murray, Anthony W; Barnfield, Mark C; Waller, Michael L; Telford, Tania; Peters, A Michael

    2013-06-01

    This article reviews available radionuclide-based techniques for glomerular filtration rate (GFR) measurement, focusing on clinical indications for GFR measurement, ideal GFR radiopharmaceutical tracer properties, and the 2 most common tracers in clinical use. Methods for full, 1-compartment, and single-sample renal clearance characterization are discussed. GFR normalization and the role of GFR measurement in chemotherapy dosing are also considered.

  7. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

    Directory of Open Access Journals (Sweden)

    Mostfa Shahabi

    2017-09-01

    Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.

  8. Polybrominated diphenyl ethers in paired samples of maternal and umbilical cord blood plasma and associations with house dust in a Danish cohort

    DEFF Research Database (Denmark)

    Frederiksen, Marie; Thomsen, Cathrine; Frøshaug, May

    2010-01-01

    determined in placental tissue from the same individuals, and the relationship with the external exposure from house dust from the participants' homes was explored. Samples of maternal and umbilical cord plasma from a cohort of 51 pregnant women from the Copenhagen area were collected. Paired maternal...... and umbilical cord plasma were analysed for BDE-28, 37, 47, 85, 99, 100, 119, 138, 153, 154, 183, 209 and the brominated biphenyl BB-153 using automated SPE extraction and GC-HRMS for the tri- to hepta-BDEs and GC-LRMS (ECNI) for BDE-209. PBDEs were detected in all maternal and umbilical cord plasma samples...

  9. Thallium Analysis in Environmental Samples by Inductively Coupled Plasma Mass Spectrometry; Analisis de Talio en Muestras Ambientales por Espectrometria de Masas con Fuente de Plasma de Acoplamiento Inductivo

    Energy Technology Data Exchange (ETDEWEB)

    Higueras, I; Fernandez, M; Conde, E; Gajate, A

    2008-08-06

    Due to its high toxicity, thallium has been considered by the US Environmental Protection Agency as one of the priority pollutants to be controlled. While being a highly toxic element, thallium has been studied to a much lesser degree than other toxic elements, mainly because thallium is often undetected by classical analytical methods. Thallium is a rare and dispersed element that occurs mainly in sulfur-containing ores. Thus, it is a potential pollutant to surrounding environment, if Tl-rich mineral and/or their industrial wastes are not properly disposed. In this work an Inductively Coupled Plasma Mass Spectrometry analytical procedure has been developed in order to determine thallium in environmental solid samples and its application to the study of this element as a potential pollutant associated with natural and anthropogenic activities. The analytical procedure has been validated by the use of appropriate reference materials, and through the isotope dilution technique as a primary method of measurement. Finally, the developed procedure has been applied to several samples from a mining area, as one of the scenarios where thallium it is likely to occur. (Author) 87 refs.

  10. A liquid chromatography/tandem mass spectrometry assay for the analysis of atomoxetine in human plasma and in vitro cellular samples

    Science.gov (United States)

    Appel, David I.; Brinda, Bryan; Markowitz, John S.; Newcorn, Jeffrey H.; Zhu, Hao-Jie

    2012-01-01

    A simple, rapid and sensitive method for quantification of atomoxetine by liquid chromatography- tandem mass spectrometry (LC-MS/MS) was developed. This assay represents the first LC-MS/MS quantification method for atomoxetine utilizing electrospray ionization. Deuterated atomoxetine (d3-atomoxetine) was adopted as the internal standard. Direct protein precipitation was utilized for sample preparation. This method was validated for both human plasma and in vitro cellular samples. The lower limit of quantification was 3 ng/ml and 10 nM for human plasma and cellular samples, respectively. The calibration curves were linear within the ranges of 3 ng/ml to 900 ng/ml and 10 nM to 10 μM for human plasma and cellular samples, respectively (r2 > 0.999). The intra- and inter-day assay accuracy and precision were evaluated using quality control samples at 3 different concentrations in both human plasma and cellular lysate. Sample run stability, assay selectivity, matrix effect, and recovery were also successfully demonstrated. The present assay is superior to previously published LC-MS and LC-MS/MS methods in terms of sensitivity or the simplicity of sample preparation. This assay is applicable to the analysis of atomoxetine in both human plasma and in vitro cellular samples. PMID:22275222

  11. Podoplanin Expression in Canine Melanoma

    OpenAIRE

    Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

    2016-01-01

    A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...

  12. First detection of canine parvovirus type 2c in Brazil.

    OpenAIRE

    Streck, André Felipe; Souza, Carine Kunzler; Gonçalves, K. R.; Zang, Luciana; Pinto, Luciane Dubina; Canal, Cláudio Wageck

    2009-01-01

    The presence of canine parvovirus type 2 (CPV-2), 2a and 2b has been described in Brazil, however, the type 2c had not been reported until now. In the current study, seven out of nine samples from dogs with diarrhea were characterized as CPV-2c, indicating that this virus is already circulating in the Brazilian canine population.No Brasil, a presença do parvovírus canino do tipo 2 (CPV-2), 2a e 2b já havia sido descrita, contudo, ainda não havia sido verificada a presença do tipo 2c. No prese...

  13. Use of plasma-source multicollector magnetic-sector mass spectrometry for uranium and plutonium analysis in environmental samples

    International Nuclear Information System (INIS)

    Price Russ, G.; Williams, Ross

    2001-01-01

    Full text: The ability to detect and isotopically characterize uranium and plutonium in environmental samples is of primary importance in the search for nuclear proliferation. The utility of isotope ratio measurements for environmental monitoring is limited by sample preparation costs, measurement precision, and sensitivity. This is particularly true for wide-area monitoring where the number of samples required varies inversely with obtainable precision and sensitivity. Historically isotopic measurements have been made by thermal ionization mass spectrometry (TIMS). While requiring extensive sample preparation, no other technique matched its precision and sensitivity for such measurements. Inductively-coupled-plasma, magnetic-sector, multicollector, mass spectrometry offers the prospect of extending the state-of-the-art to higher precision while increasing sensitivity and reducing costs through more rapid analysis and reduced sample preparation. At LLNL this technique is being implemented in the form of an IsoProbe (Micromass, UK). This paper will present data for both standards and IAEA supplied samples demonstrating the power and limitations of the technique. The precision and sensitivity of the IsoProbe results will be compared to TIMS performance for comparable samples. For 48 determinations of natural uranium, using the double spike to correct for bias, a relative standard deviation of 0.04% (1σ) for 238 U/ 235 U has been obtained in a preliminary study. This is a substantial improvement over the TIMS result of 0.1% reported at the previous conference. Further improvements can be expected as we gain a better understanding of the background peaks occurring in the IsoProbe spectra. (author)

  14. Surface plasmon resonance biosensor for detection of pregnancy associated plasma protein A2 in clinical samples

    Czech Academy of Sciences Publication Activity Database

    Bocková, Markéta; Chadtová Song, Xue; Gedeonová, Erika; Levová, K.; Kalousová, M.; Zima, T.; Homola, Jiří

    2016-01-01

    Roč. 408, č. 26 (2016), s. 7265-7269 ISSN 1618-2642 R&D Projects: GA ČR(CZ) GBP205/12/G118 Grant - others:AV ČR(CZ) AP1101 Program:Akademická prémie - Praemium Academiae Institutional support: RVO:67985882 Keywords : Nanoparticles * Blood sample * Surface plasmon resonance Subject RIV: BO - Biophysics Impact factor: 3.431, year: 2016

  15. Determination of protein carbonyls in plasma, cell extracts, tissue homogenates, isolated proteins: Focus on sample preparation and derivatization conditions.

    Science.gov (United States)

    Weber, Daniela; Davies, Michael J; Grune, Tilman

    2015-08-01

    Protein oxidation is involved in regulatory physiological events as well as in damage to tissues and is thought to play a key role in the pathophysiology of diseases and in the aging process. Protein-bound carbonyls represent a marker of global protein oxidation, as they are generated by multiple different reactive oxygen species in blood, tissues and cells. Sample preparation and stabilization are key steps in the accurate quantification of oxidation-related products and examination of physiological/pathological processes. This review therefore focuses on the sample preparation processes used in the most relevant methods to detect protein carbonyls after derivatization with 2,4-dinitrophenylhydrazine with an emphasis on measurement in plasma, cells, organ homogenates, isolated proteins and organelles. Sample preparation, derivatization conditions and protein handling are presented for the spectrophotometric and HPLC method as well as for immunoblotting and ELISA. An extensive overview covering these methods in previously published articles is given for researchers who plan to measure protein carbonyls in different samples. © 2015 Published by Elsevier Ltd.

  16. NS3 protease resistance-associated substitutions in liver tissue and plasma samples from patients infected by hepatitis C virus genotype 1A or 1B.

    Science.gov (United States)

    Morsica, Giulia; Andolina, Andrea; Merli, Marco; Messina, Emanuela; Hasson, Hamid; Lazzarin, Adriano; Uberti-Foppa, Caterina; Bagaglio, Sabrina

    2017-08-01

    The presence of naturally occurring resistance-associated substitutions (RASs) in the HCV-protease domain has been poorly investigated in the liver, the main site of HCV replication. We evaluated the natural resistance of the virus to NS3 protease inhibitors in liver tissue and plasma samples taken from HCV-infected patients. RASs were investigated by means of viral population sequencing in liver tissue samples from 18 HCV-infected patients harbouring genotype 1a or genotype 1b; plasma samples from 12 of these patients were also available for virological investigation. A discordant genotype was found in two of the 12 patients (16.6%) who provided samples from both compartments. Sequence analysis of the NS3 protease domain showed the presence of RASs in four of the 18 liver tissue samples (22.2%), two of which showed cross-resistance to protease inhibitors in clinical use or phase 2-3 trials. The analysis of the 12 paired tissues and plasma samples excluded the presence of RASs in the plasma compartment. The dominance of discordant genotypes in the paired liver and plasma samples of some HCV-infected patients suggests mixed infection possibly leading to the selective advantage of different genotype in the two compartments. The presence of RASs at intra-hepatic level is not uncommon and may lead to the early emergence of cross-resistant strains.

  17. Analytical and between-subject variation of thrombin generation measured by calibrated automated thrombography on plasma samples.

    Science.gov (United States)

    Kristensen, Anne F; Kristensen, Søren R; Falkmer, Ursula; Münster, Anna-Marie B; Pedersen, Shona

    2018-05-01

    The Calibrated Automated Thrombography (CAT) is an in vitro thrombin generation (TG) assay that holds promise as a valuable tool within clinical diagnostics. However, the technique has a considerable analytical variation, and we therefore, investigated the analytical and between-subject variation of CAT systematically. Moreover, we assess the application of an internal standard for normalization to diminish variation. 20 healthy volunteers donated one blood sample which was subsequently centrifuged, aliquoted and stored at -80 °C prior to analysis. The analytical variation was determined on eight runs, where plasma from the same seven volunteers was processed in triplicates, and for the between-subject variation, TG analysis was performed on plasma from all 20 volunteers. The trigger reagents used for the TG assays included both PPP reagent containing 5 pM tissue factor (TF) and PPPlow with 1 pM TF. Plasma, drawn from a single donor, was applied to all plates as an internal standard for each TG analysis, which subsequently was used for normalization. The total analytical variation for TG analysis performed with PPPlow reagent is 3-14% and 9-13% for PPP reagent. This variation can be minimally reduced by using an internal standard but mainly for ETP (endogenous thrombin potential). The between-subject variation is higher when using PPPlow than PPP and this variation is considerable higher than the analytical variation. TG has a rather high inherent analytical variation but considerable lower than the between-subject variation when using PPPlow as reagent.

  18. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos

    Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  19. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.

    2011-01-01

    INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  20. Plasma procalcitonin concentrations are increased in dogs with sepsis

    Science.gov (United States)

    Goggs, Robert; Milloway, Matthew; Troia, Roberta; Giunti, Massimo

    2018-01-01

    Sepsis, the life-threatening organ dysfunction caused by a dysregulated host response to infection, is difficult to identify and to prognosticate for. In people with sepsis, procalcitonin (PCT) measurement aids diagnosis, enables therapeutic monitoring and improves prognostic accuracy. This study used a commercial canine PCT assay to measure plasma PCT concentrations in dogs with gastric dilatation volvulus (GDV) syndrome and in dogs with sepsis. It was hypothesised that dogs with GDV syndrome and with sepsis have greater plasma PCT concentrations than healthy dogs and that dogs with sepsis have greater PCT concentrations than dogs with GDV syndrome. Before analysing canine plasma samples, the ability of the assay to identify canine PCT, in addition to assay imprecision and the lower limit of detection were established. The assay had low imprecision with coefficients of variation ≤4.5 per cent. The lower limit of detection was 3.4 pg/ml. Plasma PCT concentrations were measured in 20 dogs with sepsis, in 32 dogs with GDV syndrome and in 52 healthy dogs. Median (IQR) PCT concentration in dogs with sepsis 78.7 pg/ml (39.1–164.7) was significantly greater than in healthy dogs 49.8 pg/ml (36.2–63.7) (P=0.019), but there were no significant differences between PCT concentrations in dogs with GDV syndrome and controls (P=0.072) or between dogs with sepsis and GDV syndrome (P=1.000). Dogs with sepsis have significantly increased plasma PCT concentrations compared with healthy dogs, although considerable overlap between these populations was identified. Future investigations should confirm this finding in other populations and evaluate the diagnostic and prognostic value of PCT in dogs with sepsis. PMID:29682292

  1. Determination of Pt, Pd and Rh in Brassica Napus using solid sampling electrothermal vaporization inductively coupled plasma optical emission spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Nischkauer, Winfried [Vienna University of Technology, Institute of Chemical Technologies and Analytics, Division of Instrumental Analytical Chemistry, Getreidemarkt 9/164-IAC, A-1060 Vienna (Austria); Herincs, Esther [Vienna University of Technology, Institute of Chemical Technologies and Analytics, Division of Instrumental Analytical Chemistry, Getreidemarkt 9/164-IAC, A-1060 Vienna (Austria); University of Natural Resources and Life Sciences, Department of Forest and Soil Sciences, Institute of Soil Research, Konrad Lorenz Straße 24, A-3430 Tulln (Austria); Puschenreiter, Markus; Wenzel, Walter [University of Natural Resources and Life Sciences, Department of Forest and Soil Sciences, Institute of Soil Research, Konrad Lorenz Straße 24, A-3430 Tulln (Austria); Limbeck, Andreas, E-mail: A.Limbeck@tuwien.ac.at [Vienna University of Technology, Institute of Chemical Technologies and Analytics, Division of Instrumental Analytical Chemistry, Getreidemarkt 9/164-IAC, A-1060 Vienna (Austria)

    2013-11-01

    Conventional approaches for the analysis of platinum group elements (PGEs) in plant material suffer from sample digestion which results in sample dilution and therefore requires high sample intakes to maintain the sensitivity. The presented solid-sampling method avoids sample digestion while improving sensitivity when compared to digestion-based inductively coupled plasma optical emission spectrometry (ICP-OES) methods and allows the analysis of sample masses of 5 mg or less. Detection limits of 0.38 μg g{sup −1}, 0.14 μg g{sup −1} and 0.13 μg g{sup −1} were obtained for Pt, Pd and Rh, respectively using a sample intake of 5 mg. The reproducibility of the procedure ranged between 4.7% (Pd) relative standard deviation (RSD, n = 7) and 7.1% (Rh) RSD for 25 ng analytes. For quantification, aqueous standards were applied on paper filter strips and dried. Only the dried filters were introduced into the electrothermal vaporization unit. This approach successfully removed memory-effects observed during analysis of platinum which occurred only if liquid standards came into contact with the graphite material of the furnace. The presented method for overcoming the Pt-memory-effects may be of further interest for the analysis of other carbide-forming analytes as it does not require any technical modification of the graphite furnace (e.g., metal inlays, pyrolytic coating). Owing to lack of suitable certified reference materials, the proposed method was compared with conventional ICP-OES analysis of digested samples and a good agreement was obtained. As a result of the low sample consumption, it was possible to determine the spatial distribution of PGEs within a single plant. Significant differences in PGE concentrations were observed between the shoots (stem, leaves) and the roots. Pd was mainly found in the roots, whereas Pt and Rh were also found in higher concentrations in the shoots. - Highlights: • The uptake of Pt, Pd and Rh by hydroponically grown plants was

  2. Determination of Pt, Pd and Rh in Brassica Napus using solid sampling electrothermal vaporization inductively coupled plasma optical emission spectrometry

    International Nuclear Information System (INIS)

    Nischkauer, Winfried; Herincs, Esther; Puschenreiter, Markus; Wenzel, Walter; Limbeck, Andreas

    2013-01-01

    Conventional approaches for the analysis of platinum group elements (PGEs) in plant material suffer from sample digestion which results in sample dilution and therefore requires high sample intakes to maintain the sensitivity. The presented solid-sampling method avoids sample digestion while improving sensitivity when compared to digestion-based inductively coupled plasma optical emission spectrometry (ICP-OES) methods and allows the analysis of sample masses of 5 mg or less. Detection limits of 0.38 μg g −1 , 0.14 μg g −1 and 0.13 μg g −1 were obtained for Pt, Pd and Rh, respectively using a sample intake of 5 mg. The reproducibility of the procedure ranged between 4.7% (Pd) relative standard deviation (RSD, n = 7) and 7.1% (Rh) RSD for 25 ng analytes. For quantification, aqueous standards were applied on paper filter strips and dried. Only the dried filters were introduced into the electrothermal vaporization unit. This approach successfully removed memory-effects observed during analysis of platinum which occurred only if liquid standards came into contact with the graphite material of the furnace. The presented method for overcoming the Pt-memory-effects may be of further interest for the analysis of other carbide-forming analytes as it does not require any technical modification of the graphite furnace (e.g., metal inlays, pyrolytic coating). Owing to lack of suitable certified reference materials, the proposed method was compared with conventional ICP-OES analysis of digested samples and a good agreement was obtained. As a result of the low sample consumption, it was possible to determine the spatial distribution of PGEs within a single plant. Significant differences in PGE concentrations were observed between the shoots (stem, leaves) and the roots. Pd was mainly found in the roots, whereas Pt and Rh were also found in higher concentrations in the shoots. - Highlights: • The uptake of Pt, Pd and Rh by hydroponically grown plants was investigated

  3. Silver nanoparticles plasmon resonance-based method for the determination of uric acid in human plasma and urine samples

    International Nuclear Information System (INIS)

    Amjadi, M.; Rahimpour, E.

    2012-01-01

    We have developed a simple and sensitive colorimetric procedure for the quantification of trace amounts of uric acid. It is based on the finding that uric acid in a medium containing ammonia and sodium hydroxide at 65 0 C can reduce silver ions to form yellow silver nanoparticles (Ag NPs). These are stabilized in solution by using poly(vinyl alcohol) as a capping agent. The yellow color of the solution that results from the localized surface plasmon resonance of Ag NPs can be observed by the bare eye. The absorbance at 415 nm is proportional to the concentration of uric acid which therefore can be determined quantitatively. The calibration curve is linear in the concentration range from 10 to 200 nM, with a limit of detection of 3.3 nM. The method was successfully applied to the determination of uric acid in human plasma and urine samples. (author)

  4. Determination of dimethyltryptamine and β-carbolines (ayahuasca alkaloids) in plasma samples by LC-MS/MS.

    Science.gov (United States)

    Oliveira, Carolina Dizioli Rodrigues; Okai, Guilherme Gonçalves; da Costa, José Luiz; de Almeida, Rafael Menck; Oliveira-Silva, Diogo; Yonamine, Mauricio

    2012-07-01

    Ayahuasca is a psychoactive plant beverage originally used by indigenous people throughout the Amazon Basin, long before its modern use by syncretic religious groups established in Brazil, the USA and European countries. The objective of this study was to develop a method for quantification of dimethyltryptamine and β-carbolines in human plasma samples. The analytes were extracted by means of C18 cartridges and injected into LC-MS/MS, operated in positive ion mode and multiple reaction monitoring. The LOQs obtained for all analytes were below 0.5 ng/ml. By using the weighted least squares linear regression, the accuracy of the analytical method was improved at the lower end of the calibration curve (from 0.5 to 100 ng/ml; r(2)> 0.98). The method proved to be simple, rapid and useful to estimate administered doses for further pharmacological and toxicological investigations of ayahuasca exposure.

  5. [Determination of iodine and its species in plant samples using ion chromatography-inductively coupled plasma mass spectrometry].

    Science.gov (United States)

    Lin, Li; Chen, Guang; Chen, Yuhong

    2011-07-01

    A method was established for the determination of iodine and its species in plant samples using ion chromatography-inductively coupled plasma mass spectrometry (IC-ICP/ MS). Alkaline extraction and IC-ICP/MS were applied as the sample pre-treatment method and the detection technique respectively, for iodate and iodide determination. Moreover, high-temperature pyrolysis absorption was adopted as the pre-treatment method for total iodine analysis, which finally converted all the iodine species into iodide and measured the iodide by IC-ICP/MS. The recoveries of iodine for alkaline extraction and high-temperature pyrolysis absorption were 89.6%-97.5% and 95.2%-111.2%, respectively. The results were satisfactory. The detection limit of iodine was 0.010 mg/kg. The iodine and its speciation contents in several kinds of plant samples such as seaweeds, kelp, cabbage, tea leaf and spinach were investigated. It was shown that the iodine in seaweeds mainly existed as organic iodine; while the ones in kelp, cabbage, tea leaf and spinach mainly existed as inorganic iodine.

  6. DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA.

    Science.gov (United States)

    Folitse, R D; Kodie, D O; Amemor, E; Dei, D; Tasiame, W; Burimuah, V; Emikpe, B O

    2018-01-01

    Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT ® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α 0.05 . We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection.

  7. Compensatory canine angulation in angle Class II and III patients

    Directory of Open Access Journals (Sweden)

    Mauro Carlos Agner Busato

    2009-09-01

    Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.

  8. DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA

    Science.gov (United States)

    Folitse, R. D; Kodie, D.O; Amemor, E.; Dei, D.; Tasiame, W.; Burimuah, V.; Emikpe, B.O

    2018-01-01

    Background: Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Materials and Methods: Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α0.05 Results: We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. Conclusion: The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection. PMID:29302647

  9. Simultaneous determination of CRP and D-dimer in human blood plasma samples with White Light Reflectance Spectroscopy.

    Science.gov (United States)

    Koukouvinos, Georgios; Petrou, Panagiota; Misiakos, Konstantinos; Drygiannakis, Dimitris; Raptis, Ioannis; Stefanitsis, Gerasimos; Martini, Spyridoula; Nikita, Dimitra; Goustouridis, Dimitrios; Moser, Isabella; Jobst, Gerhard; Kakabakos, Sotirios

    2016-10-15

    A dual-analyte assay for the simultaneous determination of C-reactive protein (CRP) and D-dimer in human blood plasma based on a white light interference spectroscopy sensing platform is presented. Measurement is accomplished in real-time by scanning the sensing surface, on which distinct antibody areas have been created, with a reflection probe used both for illumination of the surface and collection of the reflected interference spectrum. The composition of the transducer, the sensing surface chemical activation and biofunctionalization procedures were optimized with respect to signal magnitude and repeatability. The assay format involved direct detection of CRP whereas for D-dimer a two-site immunoassay employing a biotinylated reporter antibody and reaction with streptavidin was selected. The assays were sensitive with detection limits of 25ng/mL for both analytes, precise with intra- and inter-assay CV values ranging from 3.6% to 7.7%, and from 4.8% to 9.5%, respectively, for both assays, and accurate with recovery values ranging from 88.5% to 108% for both analytes. Moreover, the values determined for the two analytes in 35 human plasma samples were in excellent agreement with those received for the same samples by standard diagnostic laboratory instrumentation employing commercial kits. The excellent agreement of the results supported the validity of the proposed system for clinical application for the detection of multiple analytes since it was demonstrated that up to seven antibody areas can be created on the sensing surface and successfully interrogated with the developed optical set-up. Copyright © 2015. Published by Elsevier B.V.

  10. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

    OpenAIRE

    Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch

    2017-01-01

    Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...

  11. Thinning of N-face GaN (0001) samples by inductively coupled plasma etching and chemomechanical polishing

    International Nuclear Information System (INIS)

    Rizzi, F.; Gu, E.; Dawson, M. D.; Watson, I. M.; Martin, R. W.; Kang, X. N.; Zhang, G. Y.

    2007-01-01

    The processing of N-polar GaN (0001) samples has been studied, motivated by applications in which extensive back side thinning of freestanding GaN (FS-GaN) substrates is required. Experiments were conducted on FS-GaN from two commercial sources, in addition to epitaxial GaN with the N-face exposed by a laser lift-off process. The different types of samples produced equivalent results. Surface morphologies were examined over relatively large areas, using scanning electron microscopy and stylus profiling. The main focus of this study was on inductively coupled plasma (ICP) etch processes, employing Cl 2 /Ar or Cl 2 /BCl 3 Ar gas mixtures. Application of a standard etch recipe, optimized for feature etching of Ga-polar GaN (0001) surfaces, caused severe roughening of N-polar samples and confirmed the necessity for specific optimization of etch conditions for N-face material. A series of recipes with a reduced physical (sputter-based) contribution to etching allowed average surface roughness values to be consistently reduced to below 3 nm. Maximum N-face etch rates of 370-390 nm/min have been obtained in recipes examined to date. These are typically faster than etch rates obtained on Ga-face samples under the same conditions and adequate for the process flows of interest. Mechanistic aspects of the ICP etch process and possible factors contributing to residual surface roughness are discussed. This study also included work on chemomechanical polishing (CMP). The optimized CMP process had stock removal rates of ∼500 nm/h on the GaN N face. This was much slower than the ICP etching but showed the important capability of recovering smooth surfaces on samples roughened in previous processing. In one example, a surface roughened by nonoptimized ICP etching was smoothed to give an average surface roughness of ∼2 nm

  12. Determination of technetium-99 in soil samples by high performance liquid chromatography coupled to inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Muto, Toshio; Shimokawa, Toshinari

    1997-01-01

    A new powerful analytical technique viz. high performance liquid chromatography(HPLC) coupled to inductively coupled plasma mass spectrometry(HPLC/ICP-MS) has been applied to the determination of technetium-99( 99 Tc) in soils as a typical environmental sample. Technetium was enriched in a solution from incinerated soil samples by leaching in HNO 3 and passed through 'TEVA resin' column. The solution was injected into HPLC/ICP-MS system to eliminate the interfering elements (i.e. Ru and Mo) and to determine the 99 Tc concentration at the same time. The concentrations of 99 Tc in the incinerated soils were found to be 0.49Bq/kg(0.77ng/kg)-1.4Bq/kg(2.2ng/kg) with the determination limit of 0.02Bq/kg(0.03ng/kg(0.03ppt)). The results indicate the following findings; 1) the determination of 99 Tc by ICP-MS after strict elimination of the interfering elements by HPLC brings about the improvement in their reliability; 2) the detection limits identified are much lower compared with those by conventional ICP-MS methods because of the concentration of 99 Tc to smaller volume, which is due to only 100μl of samples could be measured by HPLC/ICP-MS system; 3) sample preparation could be simplified because of strict elimination of the interfering elements by HPLC. This research showed that HPLC/ICP-MS system is very effective to determine 99 Tc in environmental samples. (author)

  13. Comparison of Three Sample Preparation Procedures for the Quantification of L-Arginine, Asymmetric Dimethylarginine, and Symmetric Dimethylarginine in Human Plasma Using HPLC-FLD

    Science.gov (United States)

    Schou-Pedersen, Anne Marie Voigt

    2018-01-01

    Increased asymmetric dimethylarginine (ADMA) in human plasma has been associated with reduced generation of nitric oxide, leading to atherosclerotic diseases. ADMA may therefore be an important biomarker for cardiovascular disease. In the present study, three sample preparation techniques were compared regarding the quantification of L-arginine and ADMA in human plasma: (A) protein precipitation (PP) based on aqueous trichloroacetic acid (TCA), (B) PP using a mixture of ammonia and acetonitrile, and (C) solid-phase extraction (SPE). The samples were analysed by using high-performance liquid chromatography with fluorescence detection (HPLC-FLD). The analytical performance of (A) was comparable with that of (C), demonstrating recoveries of >90%, coefficient of variations (CVs, %) of 0.994), precision (sample preparation of human plasma samples before HPLC-FLD in providing important information regarding elevated ADMA concentrations. PMID:29484214

  14. Comprehensive characterization of commercially available canine training aids.

    Science.gov (United States)

    Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A

    2014-09-01

    Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine

  15. Metabolic fingerprinting of high-fat plasma samples processed by centrifugation- and filtration-based protein precipitation delineates significant differences in metabolite information coverage.

    Science.gov (United States)

    Barri, Thaer; Holmer-Jensen, Jens; Hermansen, Kjeld; Dragsted, Lars O

    2012-03-09

    Metabolomics and metabolic fingerprinting are being extensively employed for improved understanding of biological changes induced by endogenous or exogenous factors. Blood serum or plasma samples are often employed for metabolomics studies. Plasma protein precipitation (PPP) is currently performed in most laboratories before LC-MS analysis. However, the impact of fat content in plasma samples on metabolite coverage has not previously been investigated. Here, we have studied whether PPP procedures influence coverage of plasma metabolites from high-fat plasma samples. An optimized UPLC-QTOF/MS metabolic fingerprinting approach and multivariate modeling (PCA and OPLS-DA) were utilized for finding characteristic metabolite changes induced by two PPP procedures; centrifugation and filtration. We used 12-h fasting samples and postprandial samples collected at 2h after a standardized high-fat protein-rich meal in obese non-diabetic subjects recruited in a dietary intervention. The two PPP procedures as well as external and internal standards (ISs) were used to track errors in response normalization and quantification. Remarkably and sometimes uniquely, the fPPP, but not the cPPP approach, recovered not only high molecular weight (HMW) lipophilic metabolites, but also small molecular weight (SMW) relatively polar metabolites. Characteristic SMW markers of postprandial samples were aromatic and branched-chain amino acids that were elevated (p<0.001) as a consequence of the protein challenge. In contrast, some HMW lipophilic species, e.g. acylcarnitines, were moderately lower (p<0.001) in postprandial samples. LysoPCs were largely unaffected. In conclusion, the fPPP procedure is recommended for processing high-fat plasma samples in metabolomics studies. While method improvements presented here were clear, use of several ISs revealed substantial challenges to untargeted metabolomics due to large and variable matrix effects. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Headspace concentrations of explosive vapors in containers designed for canine testing and training: theory, experiment, and canine trials.

    Science.gov (United States)

    Lotspeich, Erica; Kitts, Kelley; Goodpaster, John

    2012-07-10

    It is a common misconception that the amount of explosive is the chief contributor to the quantity of vapor that is available to trained canines. In fact, this quantity (known as odor availability) depends not only on the amount of explosive material, but also the container volume, explosive vapor pressure and temperature. In order to better understand odor availability, headspace experiments were conducted and the results were compared to theory. The vapor-phase concentrations of three liquid explosives (nitromethane, nitroethane and nitropropane) were predicted using the Ideal Gas Law for containers of various volumes that are in use for canine testing. These predictions were verified through experiments that varied the amount of sample, the container size, and the temperature. These results demonstrated that the amount of sample that is needed to saturate different sized containers is small, predictable and agrees well with theory. In general, and as expected, once the headspace of a container is saturated, any subsequent increase in sample volume will not result in the release of more vapors. The ability of canines to recognize and alert to differing amounts of nitromethane has also been studied. In particular, it was found that the response of trained canines is independent of the amount of nitromethane present, provided it is a sufficient quantity to saturate the container in which it is held. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  17. The study of selective emission lines from plasma, obtained by evaporating as sample by laser radiation in air and argon media

    International Nuclear Information System (INIS)

    Sufian, A.; Dimitrov, G.

    1993-01-01

    Ultra violet visible emission spectroscopic analysis of a plasma produced through laser interaction with a solid probe in different gaseous atmospheres is conducted. Reported are the effects of air and argon, as enveloping media, on the spectral intensities of some lines. The temperature gradient of the plasma, in different atmosphere, is also plotted. In order to improve the detection limits of individual elements, suggested are the possible areas of illuminating the slit of the spectroscopic from the plasma, in respect of the height, above the sample, when working in different gaseous media. (author)

  18. Canine oral melanoma.

    Science.gov (United States)

    Bergman, Philip J

    2007-05-01

    Melanoma is the most common oral malignancy in the dog. Oral and/or mucosal melanoma has been routinely considered an extremely malignant tumor with a high degree of local invasiveness and high metastatic propensity. Primary tumor size has been found to be extremely prognostic. The World Health Organization staging scheme for dogs with oral melanoma is based on size, with stage I = or = 4cm tumor and/or lymph node metastasis, and stage IV = distant metastasis. Median survival times for dogs with oral melanoma treated with surgery are approximately 17 to 18, 5 to 6, and 3 months with stage I, II, and III disease, respectively. Significant negative prognostic factors include stage, size, evidence of metastasis, and a variety of histologic criteria. Standardized treatments such as surgery, coarse-fractionation radiation therapy, and chemotherapy have afforded minimal to modest stage-dependent clinical benefits and death is usually due to systemic metastasis. Numerous immunotherapeutic strategies have been employed to date with limited clinical efficacy; however, the use of xenogeneic DNA vaccines may represent a leap forward in clinical efficacy. Oral melanoma is a spontaneous syngeneic cancer occurring in outbred, immunocompetent dogs and appears to be a more clinically faithful therapeutic model for human melanoma; further use of canine melanoma as a therapeutic model for human melanoma is strongly encouraged. In addition, the development of an expanded but clinically relevant staging system incorporating the aforementioned prognostic factors is also strongly encouraged.

  19. Direct measurements of sample heating by a laser-induced air plasma in pre-ablation spark dual-pulse laser-induced breakdown spectroscopy (LIBS).

    Science.gov (United States)

    Register, Janna; Scaffidi, Jonathan; Angel, S Michael

    2012-08-01

    Direct measurements of temperature changes were made using small thermocouples (TC), placed near a laser-induced air plasma. Temperature changes up to ~500 °C were observed. From the measured temperature changes, estimates were made of the amount of heat absorbed per unit area. This allowed calculations to be made of the surface temperature, as a function of time, of a sample heated by the air plasma that is generated during orthogonal pre-ablation spark dual-pulse (DP) LIBS measurements. In separate experiments, single-pulse (SP) LIBS emission and sample ablation rate measurements were performed on nickel at sample temperatures ranging from room temperature to the maximum surface temperature that was calculated using the TC measurement results (500 °C). A small, but real sample temperature-dependent increase in both SP LIBS emission and the rate of sample ablation was found for nickel samples heated up to 500 °C. Comparison of DP LIBS emission enhancement values for bulk nickel samples at room temperature versus the enhanced SP LIBS emission and sample ablation rates observed as a function of increasing sample temperature suggests that sample heating by the laser-induced air plasma plays only a minor role in DP LIBS emission enhancement.

  20. Molecularly imprinted polymeric stir bar: Preparation and application for the determination of naftopidil in plasma and urine samples.

    Science.gov (United States)

    Peng, Jun; Xiao, Deli; He, Hua; Zhao, Hongyan; Wang, Cuixia; Shi, Tian; Shi, Kexin

    2016-01-01

    In this study, molecularly imprinting technology and stir bar absorption technology were combined to develop a microextraction approach based on a molecularly imprinted polymeric stir bar. The molecularly imprinted polymer stir bar has a high performance, is specific, economical, and simple to prepare. The obtained naftopidil-imprinted polymer-coated bars could simultaneously agitate and adsorb naftopidil in the sample solution. The ratio of template/monomer/cross-linker and conditions of template removal were optimized to prepare a stir bar with highly efficient adsorption. Fourier transform infrared spectroscopy, scanning electron microscopy, selectivity, and extraction capacity experiments showed that the molecularly imprinted polymer stir bar was prepared successfully. To utilize the molecularly imprinted polymer stir bar for the determination of naftopidil in complex body fluid matrices, the extraction time, stirring speed, eluent, and elution time were optimized. The limits of detection of naftopidil in plasma and urine sample were 7.5 and 4.0 ng/mL, respectively, and the recoveries were in the range of 90-112%. The within-run precision and between-run precision were acceptable (relative standard deviation bar based microextraction with high-performance liquid chromatography was a convenient, rapid, efficient, and specific method for the precise determination of trace naftopidil in clinical analysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Application of inductively coupled plasma mass spectrometry for multielement analysis in small sample amounts of thyroid tissue from Chernobyl area

    International Nuclear Information System (INIS)

    Becker, J.S.; Dietze, H.J.; Boulyga, S.F.; Bazhanova, N.N.; Kanash, N.V.; Malenchenko, A.F.

    2000-01-01

    As a result of the Chernobyl nuclear power plant accident in 1986, thyroid pathologies occurred among children in some regions of belarus. Besides the irradiation of children's thyroids by radioactive iodine and caesium nuclides, toxic elements from fallout are a direct risk to health. Inductively coupled plasma quadrupole-based mass spectrometry (Icp-Ms) and instrumental neutron activation analysis (IAA) were used for multielement determination in small amounts (I-10 mg) of human thyroid tissue samples. The accuracy of the applied analytical technique for small biological sample amounts was checked using NIST standard reference material oyster tissue (SRM 1566 b). Almost all essential elements as well as a number of toxic elements such as Cd, Pb, Hg, U etc. Were determined in a multitude of human thyroid tissues by quadrupole-based Icp-Ms using micro nebulization. In general, the thyroid tissue affected by pathology is characterized by higher calcium content. Some other elements, among them Sr, Zn, Fe, Mn, V, As, Cr, Ni, Pb, U, Ba, Sb, were also Accumulated in such tissue. The results obtained will be used as initial material for further specific studies of the role of particular elements in thyroid pathology development

  2. Application of slurry nebulization to trace elemental analysis of some biological samples by inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Mochizuki, T.; Sakashita, A.; Iwata, H.; Ishibashi, Y.; Gunji, N.

    1991-01-01

    The application of slurry nebulization/inductively coupled plasma mass spectrometry (ICP-MS) to trace elemental analysis of biological samples has been investigated. Three standard samples of the National Institute of Standards and Technology (NIST) were dispersed in 1% aqueous Triton X-100 solution by grinding with a planetary micronizing mill. The resulting slurries were nebulized into an ICP without any additional treatments. The 1% (m/v) slurry of the NIST bovine liver showed no significant influence on cone blockage and signal suppression/enhancement. Detection limit, precision and accuracy were discussed for the determination of 24 elements of interest in bovine liver, rice flour and pine needles. Detection limits ranged from 0.0001 μg g -1 for U to 0.52 μg g -1 for Zn at the effective integrating time of 10 s. For high mass elements, low blank values were obtained, yielding excellent limits ( -1 ). Acceptable accuracy and precision were obtained for most of the elements in the NIST bovine liver and rice flour, even for the volatile elements, such as As, Se and Br. However, relatively poor accuracy was obtained for the analysis of pine needles. (orig.)

  3. Experimental research of covered stent implanted in canine hepatic artery

    International Nuclear Information System (INIS)

    Zhou Bing; Liu Linxiang; Li Minghua; Wang Yongli; Cheng Yongde

    2007-01-01

    Objective: To evaluate the feasibility of success rate of implantation, post-procedure stenosis rate, apposition ability and endothelialization level, etc. for implantation with balloon-expandable covered stent in canine hepatic artery. Methods: 8 adult canines were implanted with balloon-expendable stents covered by expandable poly Teflon ester membrane (e-PTFEM). Follow-up DSA was performed immediately, 2, 4 and 12 wk after the procedure. The canines were sacrificed for histopathologic examination and statistical analysis with correlation of implantation manenvor and angiographic manifestations. Results: 8 cases were all implanted with the covered stents in proper hepatic artery/right hepatic artery successfully; showing good apposition ability and non-opacification of the separated branches. 2 cases showed intraluminal obvious stenosis( > 50%)of the stent at 2 weeks follow-up, so did 3 cases at 12 weeks follow-up, and the total stenosis rate was 37.5% and 5 cases manifested full endothelialization (3 different locations of the sample all manifested full endothelialization), 3 cased manifested partial endothelialization (at least 1 location of the sample didn't show full endothelialization), and the two terminal parts were easier to get endothelialization than the central part. Before and after the stent implantation, hepatic function of all cases didn't demonstrate any obvious changes. Conclusions: Balloon-expandable covered stent can be implanted in canine hepatic artery. successfully, with good apposition ability, full endothelialization, and no influence on hepatic function. (authors)

  4. Podoplanin Expression in Canine Melanoma.

    Science.gov (United States)

    Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

    2016-12-01

    A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.

  5. A rapid, accurate and robust particle-based assay for the simultaneous screening of plasma samples for the presence of five different anti-cytokine autoantibodies

    DEFF Research Database (Denmark)

    Guldager, Daniel Kring Rasmussen; von Stemann, Jakob Hjorth; Larsen, Rune

    2015-01-01

    suitable for larger screenings. Based on confirmed antibody binding characteristics and the resultant reactivity in this multiplex assay, a classification of the c-aAb levels was suggested. The screening results of the recipients who received blood transfusions indicate that more studies are needed...... plasma samples and pooled normal immunoglobulin preparations were used to validate the assay. Plasma samples from 98 transfusion recipients, half of whom presented with febrile reactions, were tested by the assay. RESULTS: The assay detected specific and saturable immunoglobulin G (IgG) binding to each...... cytokine autoantibodies quantities in the negative plasma samples ranged between 80% and 125%. The analytical intra- and inter-assay variations were 4% and 11%, respectively. Varying c-aAb levels were detectable in the transfusion recipients. There was no difference in c-aAb frequency between the patients...

  6. Approaches to canine health surveillance.

    Science.gov (United States)

    O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C

    2014-01-01

    Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.

  7. Canine faecal contamination and parasitic risk in the city of Naples (southern Italy

    Directory of Open Access Journals (Sweden)

    Veneziano Vincenzo

    2006-09-01

    Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between

  8. Preparation of magnetic ODS-PAN thin-films for microextraction of quetiapine and clozapine in plasma and urine samples followed by HPLC-UV detection.

    Science.gov (United States)

    Li, Dan; Zou, Juan; Cai, Pei-Shan; Xiong, Chao-Mei; Ruan, Jin-Lan

    2016-06-05

    In this study, conventional thin-film microextraction (TFME) was endowed with magnetic by introducing superparamagnetic SiO2@Fe3O4 nanoparticles in thin-films. Novel magnetic octadecylsilane (ODS)-polyacrylonitrile (PAN) thin-films were prepared by spraying, and used for the microextraction of quetiapine and clozapine in plasma and urine samples, followed by the detection of HPLC-UV. The influencing factors on the extraction efficiency of magnetic ODS-PAN TFME, including pH, extraction time, desorption solvent, desorption time, and ion strength were investigated systematically. Under the optimal conditions, both analytes showed good linearity over ranges of 0.070-9.000μgmL(-1) and 0.012-9.000μgmL(-1) in plasma and urine samples, respectively, with correlation coefficients (R(2)) above 0.9990. Limits of detection (LODs) for quetiapine in plasma and urine samples were 0.013 and 0.003μgmL(-1), respectively. LODs for clozapine in plasma and urine samples were 0.015 and 0.003μgmL(-1), respectively. The relative standard deviations (RSDs) for quetiapine and clozapine were less than 9.23%. After the validation, the protocol was successfully applied for the determination of quetiapine and clozapine in patients' plasma and urine samples with satisfactory recoveries between 99-110%. The proposed magnetic ODS-PAN TFME was very simple, fast and easy to handle. It showed high potential as a powerful pretreatment technology for routine therapeutic drug monitoring (TDM) in plasma and urine samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. The Effect of Using Self-ligating Brackets on Maxillary Canine Retraction: A Split-mouth Design Randomized Controlled Trial.

    Science.gov (United States)

    Hassan, Siba E; Hajeer, Mohammad Y; Alali, Osama H; Kaddah, Ayham S

    2016-06-01

    The results of previous studies about the efficacy of using self-ligating brackets (SLBs) in controlling canine movement during retraction are not in harmony. Therefore, the current study aimed to compare the effects of using new passive SLBs on maxillary canine retraction with sliding mechanics vs conventional ligating brackets (CLBs) tied with metal ligatures. The sample comprised 15 adult patients (4 males, 11 females; 18-24 years) requiring bilateral extraction of maxillary first premolars. Units of randomization are the left or right maxillary canines within the same patient. The two maxillary canines in each patient were randomly assigned to one of the two groups in a simple split-mouth design. The canines in the SLBs group (n = 15) were bracketed with SLBs (Damon Q™), while the canines in the CLBs group (n = 15) were bracketed with conventional brackets (Mini Master Series). Transpalatal bars were used for anchorage. After leveling and alignment, 0.019 × 0.025" stainless steel working archwires were placed. Canines were retracted using a nickel-titanium close-coil springs with a 150 gm force. The amount and rate of maxillary canine retraction, canine rotation, and loss of anchorage were measured on study models collected at the beginning of canine retraction (T0) and 12 weeks later (T1). Differences were analyzed using paired-samples t-tests. The effect differences were statistically significant (p brackets gave better results compared to the CLBs in terms of rate of movement, amount of canine rotation following extraction, and anchorage loss.

  10. Seroprevalence of Canine Parvovirus in Dogs in Lusaka District, Zambia

    OpenAIRE

    Saasa, Ngonda; Nalubamba, King Shimumbo; M’kandawire, Ethel; Siwila, Joyce

    2016-01-01

    Canine parvovirus (CPV) enteritis is a highly contagious enteric disease of young dogs. Limited studies have been done in Zambia to investigate the prevalence of CPV in dogs. Blood was collected from dogs from three veterinary clinics (clinic samples, n = 174) and one township of Lusaka (field samples, n = 56). Each dog's age, sex, breed, and vaccination status were recorded. A haemagglutination assay using pig erythrocytes and modified live parvovirus vaccine as the antigen was used. Antibod...

  11. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    Directory of Open Access Journals (Sweden)

    Helen L. Del Puerto

    2010-02-01

    Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

  12. Molecular detection of canine parvovirus in flies (Diptera) at open and closed canine facilities in the eastern United States.

    Science.gov (United States)

    Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan

    2014-06-01

    More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year

  13. Multistage plasma initiation process by pulsed CO2 laser irradiation of a Ti sample in an ambient gas (He, Ar, or N2)

    Science.gov (United States)

    Hermann, J.; Boulmer-Leborgne, C.; Mihailescu, I. N.; Dubreuil, B.

    1993-02-01

    New experimental results are reported on plasma initiation in front of a titanium sample irradiated by ir (λ=10.6 μm) laser pulses in an ambient gas (He, Ar, and N2) at pressures ranging from several Torr up to the atmosphere. The plasma is studied by space- and time-resolved emission spectroscopy, while sample vaporization is probed by laser-induced fluorescence spectroscopy. Threshold laser intensities leading to the formation of a plasma in the vapor and in the ambient gases are determined. Experimental results support the model of a vaporization mechanism for the plasma initiation (vaporization-initiated plasma breakdown). The plasma initiation is described by simple numerical criteria based on a two-stage process. Theoretical predictions are found to be in a reasonable agreement with the experiment. This study provides also a clear explanation of the influence of the ambient gas on the laser beam-metal surface energy transfer. Laser irradiation always causes an important vaporization when performed in He, while in the case of Ar or N2, the interaction is reduced in heating and vaporization of some surface defects and impurities.

  14. Canine and feline colostrum.

    Science.gov (United States)

    Chastant-Maillard, S; Aggouni, C; Albaret, A; Fournier, A; Mila, H

    2017-04-01

    Puppy and kitten survival over the first weeks is particularly dependent on colostrum, a specific secretion of the mammary gland produced during the first 2 days post-partum. Colostrum is a source of nutrients and immunoglobulins. It also contributes to the digestive tract maturation. Colostrum differentiates from milk mainly based on its concentration in immunoglobulins G: 20-30 g/L in dog colostrum, 40-50 g/L in cats' vs <1 g/L in milk. IgG concentration rapidly drops after parturition (-50% in 24 hr). Immune quality of colostrum is highly variable between bitches, with no relationship with maternal blood IgG level, dam's age, breed size or litter size. In addition to systemic immune protection, colostrum also plays a major role for local digestive protection, due to IgA, lysozyme, lactoferrin, white blood cells and various cytokines. Energetic concentration of canine and feline colostrum is not superior to that of mature milk. It depends on colostrum fat concentration and is affected by breed size (higher in breeds <10 kg adult body weight). As puppies and kittens are almost agammaglobulinemic at birth, transfer of IgG from their digestive tract into their bloodstream is crucial for their survival, IgG absorption ending at 12-16 hr after birth. Energetic supply over the two first days of life, as evidenced by growth rate over the two first days of life, also affects risk of neonatal mortality. Early and sufficient suckling of colostrum is thus the very first care to be provided to newborns for their later health and survival. © 2016 Blackwell Verlag GmbH.

  15. Two-compartment, two-sample technique for accurate estimation of effective renal plasma flow: Theoretical development and comparison with other methods

    International Nuclear Information System (INIS)

    Lear, J.L.; Feyerabend, A.; Gregory, C.

    1989-01-01

    Discordance between effective renal plasma flow (ERPF) measurements from radionuclide techniques that use single versus multiple plasma samples was investigated. In particular, the authors determined whether effects of variations in distribution volume (Vd) of iodine-131 iodohippurate on measurement of ERPF could be ignored, an assumption implicit in the single-sample technique. The influence of Vd on ERPF was found to be significant, a factor indicating an important and previously unappreciated source of error in the single-sample technique. Therefore, a new two-compartment, two-plasma-sample technique was developed on the basis of the observations that while variations in Vd occur from patient to patient, the relationship between intravascular and extravascular components of Vd and the rate of iodohippurate exchange between the components are stable throughout a wide range of physiologic and pathologic conditions. The new technique was applied in a series of 30 studies in 19 patients. Results were compared with those achieved with the reference, single-sample, and slope-intercept techniques. The new two-compartment, two-sample technique yielded estimates of ERPF that more closely agreed with the reference multiple-sample method than either the single-sample or slope-intercept techniques

  16. Design and development of a highly sensitive, field portable plasma source instrument for on-line liquid stream monitoring and real-time sample analysis

    International Nuclear Information System (INIS)

    Duan, Yixiang; Su, Yongxuan; Jin, Zhe; Abeln, Stephen P.

    2000-01-01

    The development of a highly sensitive, field portable, low-powered instrument for on-site, real-time liquid waste stream monitoring is described in this article. A series of factors such as system sensitivity and portability, plasma source, sample introduction, desolvation system, power supply, and the instrument configuration, were carefully considered in the design of the portable instrument. A newly designed, miniature, modified microwave plasma source was selected as the emission source for spectroscopy measurement, and an integrated small spectrometer with a charge-coupled device detector was installed for signal processing and detection. An innovative beam collection system with optical fibers was designed and used for emission signal collection. Microwave plasma can be sustained with various gases at relatively low power, and it possesses high detection capabilities for both metal and nonmetal pollutants, making it desirable to use for on-site, real-time, liquid waste stream monitoring. An effective in situ sampling system was coupled with a high efficiency desolvation device for direct-sampling liquid samples into the plasma. A portable computer control system is used for data processing. The new, integrated instrument can be easily used for on-site, real-time monitoring in the field. The system possesses a series of advantages, including high sensitivity for metal and nonmetal elements; in situ sampling; compact structure; low cost; and ease of operation and handling. These advantages will significantly overcome the limitations of previous monitoring techniques and make great contributions to environmental restoration and monitoring. (c)

  17. Canine neosporosis: perspectives on pathogenesis and management

    Directory of Open Access Journals (Sweden)

    Silva RC

    2016-04-01

    Full Text Available Rodrigo C Silva,1 Gustavo P Machado2 1Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Starkville, MS, USA; 2Department of Internal Medicine and Surgery of Small Animals, Dr Munhoz Veterinary Hospital, Itápolis, Brazil Abstract: Canine neosporosis is a worldwide disease caused by the obligate intracellular parasite protozoan Neospora caninum, manifesting mainly neurological symptoms. N. caninum has a heteroxenous life cycle and affects a wide range of warm-blooded animals. The domestic and wild canids are the definitive host of the parasite. They shed oocysts after ingestion of tissue cysts from infected intermediate hosts (ovine, equine, bovine, canine, and many other species, containing bradyzoites, or oocyst-contaminated water and food. The presence of dogs in farms is considered a risk factor for production animals. A wide range of diagnostic methods are currently available, but the most used is serology, ie, indirect fluorescent antibody test specific to the antibody detection in blood serum samples. No vaccine is available, but control strategies should be focused on the vertical and horizontal transmission of the parasite, ie, avoid feeding dogs with raw or undercooked meat, and taking care with water for human and animal consumption. No medicines to control the transplacental transmission are available yet. Keywords: neosporosis, Neospora caninum, pathogenesis, management, dogs

  18. UPLC-MS/MS assay of riluzole in human plasma and cerebrospinal fluid (CSF): Application in samples from spinal cord injured patients.

    Science.gov (United States)

    Sarkar, Mahua; Grossman, Robert G; Toups, Elizabeth G; Chow, Diana S-L

    2017-11-30

    In the present study, a sensitive and robust LC-MS/MS method has been developed and validated for the quantification of riluzole in human plasma and cerebrospinal fluid (CSF) in clinical samples from patients with spinal cord injury (SCI). Riluzole and its labeled internal standard (IS) were isolated from plasma and CSF by liquid-liquid extraction using ethyl acetate. Riluzole (m/z 235→166) and IS (m/z 238→169) were detected by electrospray ionization (ESI) using multiple reaction monitoring (MRM) in a positive mode. The assay was linear in the concentration range of 0.5 (LLOQ, signal/noise ratio>10)-800ng/ml in plasma, and 1.0 (LLOQ)-800ng/ml in CSF samples. The intra- and inter-day accuracy in plasma were 94.2-110.0% and 97.8-102.0%, respectively, and those in CSF were 87.6-105.1% and 91.9-98.8%, respectively. The intra- and inter-day precision were 2.2-7.2% and 4.0-9.1%, respectively, in plasma, and 1.4-14.1% and 2.6-11.5%, respectively in CSF. Matrix effect was negligible from both matrices with signal percentages of 97.6-100.6% in plasma and 99.4-106.4% in CSF. The recoveries were >75% in plasma, >84% in CSF with low protein (53.9mg/dl), and >68% in CSF with high protein (348.2mg/dl). This method was successfully applied to quantify riluzole concentrations in plasma and CSF from patients with SCI. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Characterization of Canine parvovirus 2 variants circulating in Greece.

    Science.gov (United States)

    Ntafis, Vasileios; Xylouri, Eftychia; Kalli, Iris; Desario, Costantina; Mari, Viviana; Decaro, Nicola; Buonavoglia, Canio

    2010-09-01

    The aim of the present study was to characterize Canine parvovirus 2 (CPV-2) variants currently circulating in Greece. Between March 2008 and March 2009, 167 fecal samples were collected from diarrheic dogs from different regions of Greece. Canine parvovirus 2 was detected by standard polymerase chain reaction, whereas minor groove binder probe assays were used to distinguish genetic variants and discriminate between vaccine and field strains. Of 84 CPV-2-positive samples, 81 CPV-2a, 1 CPV-2b, and 2 CPV-2c were detected. Vaccine strains were not detected in any sample. Sequence analysis of the VP2 gene of the 2 CPV-2c viruses revealed up to 100% amino acid identity with the CPV-2c strains previously detected in Europe. The results indicated that, unlike other European countries, CPV-2a remains the most common variant in Greece, and that the CPV-2c variant found in Europe is also present in Greece.

  20. Inductively coupled plasma mass spectrometry with a twin quadrupole instrument using laser ablation sample introduction and monodisperse dried microparticulate injection

    Energy Technology Data Exchange (ETDEWEB)

    Allen, Lloyd A. [Iowa State Univ., Ames, IA (United States)

    1996-10-17

    The focus of this dissertation is the use of a twin quadrupole inductively coupled plasma mass spectrometer (ICP-MS) for the simultaneous detection of two m/z values. The twin quadrupole ICP-MS is used with laser ablation sample introduction in both the steady state (10 Hz) and single pulse modes. Steady state signals are highly correlated and the majority of flicker noise cancels when the ratio is calculated. Using a copper sample, the isotope ratio 63Cu+/65Cu+ is measured with a relative standard deviation (RSD) of 0.26%. Transient signals for single laser pulses are also obtained. Copper isotope ratio measurements for several laser pulses are measured with an RSD of 0.85%. Laser ablation (LA) is used with steel samples to assess the ability of the twin quadrupole ICP-MS to eliminate flicker noise of minor components of steel samples. Isotopic and internal standard ratios are measured in the first part of this work. The isotope ratio 52Cr+/53Cr+ (Cr present at 1.31 %) can be measured with an RSD of 0.06 % to 0.1 %. For internal standard elements, RSDs improve from 1.9 % in the Cr+ signal to 0.12% for the ratio of 51V+ to 52Cr+. In the second part of this work, one mass spectrometer is scanned while the second channel measures an individual m/z value. When the ratio of these two signals is calculated, the peak shapes in the mass spectrum are improved significantly. Pulses of analyte and matrix ions from individual drops are measured simultaneously using the twin quadrupole ICP-MS with monodisperse dried microparticulate injection (MDMI). At modest Pb concentrations (500 ppm), a shoulder on the leading edge of the Li+ signal becomes apparent. Space charge effects are consistent with the disturbances seen.

  1. Canine oral mucosa evaluation as a potential autograft tissue for the treatment of unresponsive keratoconjunctivitis sicca.

    Science.gov (United States)

    Cherry, Rose L; Smith, Jodi D; Ben-Shlomo, Gil

    2018-01-01

    Labial mucosa transplantation for the treatment of canine keratoconjunctivitis sicca (KCS) has been reported recently. Postoperative alleviation of clinical signs was noted and assumed to be the result of labial salivary glands providing lubrication to the ocular tissue. The aim of this study was to evaluate the presence of minor salivary glands (MSG) in the canine oral mucosa. Oral mucosal biopsies were collected from six dogs that died (n = 1) or were euthanized (n = 5) for reasons unrelated to this study. The breeds included were two Doberman Pinschers, one Labrador Retriever, one Portuguese Water Dog, one German Shepherd Dog, and one mixed canine. Three were spayed females, and three were castrated males with the median age of 9 years (range, 6-13 years). Samples were obtained by an 8-mm punch biopsy at the following locations of the canine oral cavity: upper rostral labial mucosa at midline, lower rostral labial mucosa at midline, upper labial mucosa near the commissure, lower labial mucosa near the commissure, and buccal mucosa approximately 1 cm caudal to the commissure. Samples were routinely processed with hematoxylin and eosin, and periodic acid-Schiff stains. Samples were evaluated by light microscopy. At the selected locations, no MSG or other secreting cells were detected. Minor salivary glands are not associated with alleviation of canine KCS symptoms following labial mucosa transplantation. Further studies are needed to determine the mechanism leading to the transient improvement of KCS symptoms in canine patients following labial mucosa transplantation. © 2017 American College of Veterinary Ophthalmologists.

  2. Automation of gender determination in human canines using artificial intelligence

    Directory of Open Access Journals (Sweden)

    F. Fidya

    2017-09-01

    Full Text Available Background: Gender determination is an important aspect of the identification process. The tooth represents a part of the human body that indicates the nature of sexual dimorphism. Artificial intelligence enables computers to perform to the same standard the same tasks as those carried out by humans. Several methods of classification exist within an artificial intelligence approach to identifying sexual dimorphism in canines. Purpose: This study aimed to quantify the respective accuracy of the Naive Bayes, decision tree, and multi-layer perceptron (MLP methods in identifying sexual dimorphism in canines. Methods: A sample of results derived from 100 measurements of the diameter of mesiodistal, buccolingual, and diagonal upper and lower canine jaw models of both genders were entered into an application computer program that implements the algorithm (MLP. The analytical process was conducted by the program to obtain a classification model with testing being subsequently carried out in order to obtain 50 new measurement results, 25 each for males and females. A comparative analysis was conducted on the program-generated information. Results: The accuracy rate of the Naive Bayes method was 82%, while that of the decision tree and MLP amounted to 84%. The MLP method had an absolute error value lower than that of its decision tree counterpart. Conclusion: The use of artificial intelligence methods produced a highly accurate identification process relating to the gender determination of canine teeth. The most appropriate method was the MLP with an accuracy rate of 84%.

  3. Surgical innovations in canine gonadectomy

    NARCIS (Netherlands)

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated

  4. Immunohistochemical Characterization of Canine Lymphomas

    Directory of Open Access Journals (Sweden)

    Roxana CORA

    2017-11-01

    Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.

  5. Determination of mercury species in biological samples by inductively coupled plasma mass spectrometry combined with solvent extraction and ultrasonication

    International Nuclear Information System (INIS)

    Sun, J.; Li, Y.F.; Wang, J.X.; Chen, C.Y.; Li, B.; Gao, Y.X.; Chai, Z.F.

    2005-01-01

    Mercury (Hg) is a well-known toxic element. The toxic effects of Hg depend on its chemical forms. The most important chemical forms are elemental Hg (Hg 0 ), inorganic Hg (Hg 2+ ) and methylmercury (CH 3 Hg + ). In the biogeochemical cycle of Hg, these species may interchange in atmospheric, aquatic and terrestrial environments. Among them, methylmercury is considerably higher toxic than elemental mercury and inorganic mercury because it is recognized as one of major health hazards for human due to its teratogenic, immunotoxic, and neurotoxic effects. Therefore, determinations of not only total mercury, but also methylmercury content in biological samples is necessary. In large numbers of analytical methods, inductively coupled plasma mass spectrometry (ICP-MS) using conventional sample introduction with a peristaltic pump is widely used for the determination of trace metals in a wide variety of different sample matrices. ICP-MS can offer high sensitivity, low detection limit, reasonable accuracy and precision, and can easily be automated. However, mercury is considered as an element with analytical problems. One problem is well known in Hg analysis that the memory effect increases the blank counts and worsens the analytical performance of ICP-MS. The possibility of Hg losses during sample decomposition procedure due to its volatility is another important issue. Additionally, its high first ionization potential and numerous isotopes have limited its sensitivity in ICP-MS analysis. In order to solve the above questions, the present work was carried out to develop a method based on ICP-MS coupled with solvent extraction for determination of mercury species in biological samples. At first step, we investigated different solvent extraction methods including acid leaching, CuSO 4 extraction, alkaline-methanol extraction, and surfactant extraction with ultrasonication for methylmercury determination using the certified reference materials GBW07601 (Human Hair). Next, we

  6. Comprehensive study on the pressure dependence of shock wave plasma generation under TEA CO2 laser bombardment on metal sample

    International Nuclear Information System (INIS)

    Marpaung, A.M.; Kurniawan, H.; Tjia, M.O.; Kagawa, K.

    2001-01-01

    An experimental study has been carried out on the dynamical process taking place in the plasma generated by a TEA CO 2 laser (400 mJ, 100 ns) on a zinc target when surrounded by helium gas of pressure ranging from 2 Torr to 1 atm. Plasma characteristics were examined in detail on the emission lines of Zn I 481.0 nm and He I 587.6 nm by means of an unique time-resolved spatial distribution technique in addition to an ordinary time-resolved emission measurement technique. The results reveal, for the first time, persistent shock wave characteristics in all cases throughout the entire pressure range considered. Further analysis of the data has clarified the distinct characteristics of laser plasmas generated in different ranges of gas pressure. It is concluded that three types of shock wave plasma can be identified; namely, a target shock wave plasma in the pressure range from 2 Torr to around 50 Torr; a coupling shock wave plasma in the pressure range from around 50 Torr to 200 Torr and a gas breakdown shock wave plasma in the pressure range from around 200 Torr to 1 atm. These distinct characteristics are found to be ascribable to the different extents of the gas breakdown process taking place at the different gas pressures. These results, obtained for a TEA CO 2 laser, will provide a useful basis for the analyses of plasmas induced by other lasers. (author)

  7. Radioimmunological determination of apparent free progesterone concentration in plasma samples of pregnant and non-pregnant women

    International Nuclear Information System (INIS)

    Clerico, A.; Del Chicca, M.G.; Strigini, F.; Melis, G.B.; Paoletti, A.M.; Mariani, G.; Fioretti, P.

    1980-01-01

    The determination of free steroids would be preferable with respect to total hormone plasma content, since it yields more reliable information about the most biologically active form of circulating steroids. The authors report a method for the determination of apparent free progesterone concentration (AFPC) in plasma, by means of direct radioimmunoassay of dialyzed progesterone after equilibrium dialysis. (Auth.)

  8. Occurrence of severe gastroenteritis in pups after canine parvovirus vaccine administration: a clinical and laboratory diagnostic dilemma.

    Science.gov (United States)

    Decaro, Nicola; Desario, Costantina; Elia, Gabriella; Campolo, Marco; Lorusso, Alessio; Mari, Viviana; Martella, Vito; Buonavoglia, Canio

    2007-01-26

    A total of 29 faecal samples collected from dogs with diarrhoea following canine parvovirus (CPV) vaccination were tested by minor groove binder (MGB) probe assays for discrimination between CPV vaccine and field strains and by diagnostic tests for detection of other canine pathogens. Fifteen samples tested positive only for CPV field strains; however, both vaccine and field strains were detected in three samples. Eleven samples were found to contain only the vaccine strain, although eight of them tested positive for other pathogens of dogs. Only three samples were found to contain the vaccine strain without evidence of canine pathogens. The present study confirms that most cases of parvovirus-like disease occurring shortly after vaccination are related to infection with field strains of canine parvovirus type 2 (CPV-2) rather than to reversion to virulence of the modified live virus contained in the vaccine.

  9. Reliability of a Cryoscopic Micro-Osmometer Using 15-µL Plasma Samples to Measure Hydration Status in Varied Environmental Conditions

    Science.gov (United States)

    Scanlan, Aaron T.; Richter-Stretton, Gina L.; Madueno, Maria C.; Borges, Nattai R.; Fenning, Andrew S.

    2017-01-01

    Measurement of plasma osmolality (P[subscript osm]) remains popular for assessing hydration status in exercise science. However, a controlled reliability assessment of micro-osmometry using small sample volumes to measure Posm remains to be performed. This study aimed to examine the reliability of a cryoscopic micro-osmometer requiring 15-µL…

  10. Analytical and clinical performance of the Hologic Aptima HCV Quant Dx Assay for the quantification of HCV RNA in plasma samples

    DEFF Research Database (Denmark)

    Schønning, Kristian; Pedersen, Martin Schou; Johansen, Kim

    2017-01-01

    obtained from 13 patients undergoing treatment with DAAs. RESULTS: Deming regression of results from 187 plasma samples with HCV RNA >2 Log IU/mL indicated that the Aptima assay quantified higher than the CAPCTMv2 test for HCV RNA >4.9 Log IU/mL. The linearity of the Aptima assay was excellent across...

  11. Direct analysis of samples by mass spectrometry: From elements to bio-molecules using laser ablation inductively couple plasma mass spectrometry and laser desorption/ionization mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Perdian, David C. [Iowa State Univ., Ames, IA (United States)

    2009-01-01

    Mass spectrometric methods that are able to analyze solid samples or biological materials with little or no sample preparation are invaluable to science as well as society. Fundamental research that has discovered experimental and instrumental parameters that inhibit fractionation effects that occur during the quantification of elemental species in solid samples by laser ablation inductively coupled plasma mass spectrometry is described. Research that determines the effectiveness of novel laser desorption/ionization mass spectrometric methods for the molecular analysis of biological tissues at atmospheric pressure and at high spatial resolution is also described. A spatial resolution is achieved that is able to analyze samples at the single cell level.

  12. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  13. A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article

    Directory of Open Access Journals (Sweden)

    S. Gur

    2009-05-01

    Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.

  14. Design of a scanning probe microscope with advanced sample treatment capabilities: An atomic force microscope combined with a miniaturized inductively coupled plasma source

    International Nuclear Information System (INIS)

    Hund, Markus; Herold, Hans

    2007-01-01

    We describe the design and performance of an atomic force microscope (AFM) combined with a miniaturized inductively coupled plasma source working at a radio frequency of 27.12 MHz. State-of-the-art scanning probe microscopes (SPMs) have limited in situ sample treatment capabilities. Aggressive treatments such as plasma etching or harsh treatments such as etching in aggressive liquids typically require the removal of the sample from the microscope. Consequently, time consuming procedures are required if the same sample spot has to be imaged after successive processing steps. We have developed a first prototype of a SPM which features a quasi in situ sample treatment using a modified commercial atomic force microscope. A sample holder is positioned in a special reactor chamber; the AFM tip can be retracted by several millimeters so that the chamber can be closed for a treatment procedure. Most importantly, after the treatment, the tip is moved back to the sample with a lateral drift per process step in the 20 nm regime. The performance of the prototype is characterized by consecutive plasma etching of a nanostructured polymer film

  15. Human herpesvirus infections of the central nervous system: laboratory diagnosis based on DNA detection by nested PCR in plasma and cerebrospinal fluid samples.

    Science.gov (United States)

    Rimério, Carla Aparecida Tavares; De Oliveira, Renato Souza; de Almeida Bonatelli, Murilo Queiroz; Nucci, Anamarli; Costa, Sandra Cecília Botelho; Bonon, Sandra Helena Alves

    2015-04-01

    Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the "gold standard," and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture. © 2015 Wiley Periodicals, Inc.

  16. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  17. Root length and alveolar bone level of impacted canines and adjacent teeth after orthodontic traction: a long-term evaluation

    Science.gov (United States)

    da SILVA, Aldir Cordeiro; CAPISTRANO, Anderson; de ALMEIDA-PEDRIN, Renata Rodrigues; CARDOSO, Maurício de Almeida; CONTI, Ana Cláudia de Castro Ferreira; CAPELOZZA, Leopoldino

    2017-01-01

    Abstract Objective The aim of this retrospective study was to evaluate the long-term effects of orthodontic traction on root length and alveolar bone level in impacted canines and adjacent teeth. Material and Methods Sample consisted of 16 patients (nine males and seven females), mean initial age 11 years and 8 months presenting with unilaterally maxillary impacted canines, palatally displaced, treated with the same surgical and orthodontic approach. Teeth from the impacted-canine side were assigned as Group I (GI), and contralateral teeth as control, Group II (GII). The mean age of patients at the end of orthodontic treatment was 14 years and 2 months and the mean post-treatment time was 5 years and 11 months. Both contralateral erupted maxillary canines and adjacent teeth served as control. Root length and alveolar bone level (buccal and palatal) were evaluated on cone-beam computed tomography (CBCT) images. The comparison of root length and alveolar bone level changes between groups were assessed by applying paired t-test, at a significance level of 5% (p<0.05). Results There were no statistically significant differences in root length and buccal and palatal bone levels of canines and adjacent teeth among groups. Conclusions Impacted canine treatment by closed-eruption technique associated with canine crown perforation, has a minimal effect on root length and buccal and palatal alveolar bone level in both canine and adjacent teeth, demonstrating that this treatment protocol has a good long-term prognosis. PMID:28198979

  18. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    Science.gov (United States)

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  19. Comparison of glomerular filtration rate measured by plasma sample technique, Cockroft Gault method and Gates’ method in voluntary kidney donors and renal transplant recipients

    International Nuclear Information System (INIS)

    Hephzibah, Julie; Shanthly, Nylla; Oommen, Regi

    2013-01-01

    There are numerous methods for calculation of glomerular filtration rate (GFR), which is a crucial measurement to identify patients with renal disease. The aim of this study is to compare four different methods of GFR calculation. Clinical setup, prospective study. Data was collected from routine renal scans done for voluntary kidney donors (VKD) or renal transplant recipients 6 months after transplantation. Following technetium-99m diethylene triamine penta acetic acid injection, venous blood samples were collected from contralateral arm at 120, 180, and 240 min through an indwelling venous cannula and direct collection by syringe. A total volume of 1 ml of plasma from each sample and standards were counted in an automatic gamma counter for 1 min. Blood samples taken at 120 min and 240 min were used for double plasma sample method (DPSM) and a sample taken at 180 min for single plasma sample method (SPSM). Russell's formulae for SPSM and DPSM were used for GFR estimation. Gates’ method GFR was calculated by vendor provided software. Correlation analysis was performed using Pearson's correlation test. SPSM correlated well with DPSM. GFR value in healthy potential kidney donors has a significant role in the selection of donors. The mean GFR ± (standard deviation) in VKD using SPSM, DPSM, camera depth method and Cockroft Gault method was 134.6 (25.9), 137.5 (42.4), 98.6 (15.9), 83.5 (21.1) respectively. Gates’ GFR calculation did not correlate well with plasma sampling method. Calculation of GFR plays a vital role in the management of renal patients, hence it was noted that Gates GFR may not be a reliable method of calculation. SPSM was more reliable. DPSM is reliable but cumbersome. It is difficult to accurately calculate GFR without a gold standard

  20. Genetics of Human and Canine Dilated Cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Siobhan Simpson

    2015-01-01

    Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

  1. Genetics of Human and Canine Dilated Cardiomyopathy.

    Science.gov (United States)

    Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S

    2015-01-01

    Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

  2. Multicomponent kinetic spectrophotometric determination of pefloxacin and norfloxacin in pharmaceutical preparations and human plasma samples with the aid of chemometrics

    Science.gov (United States)

    Ni, Yongnian; Wang, Yong; Kokot, Serge

    2008-10-01

    A spectrophotometric method for the simultaneous determination of the important pharmaceuticals, pefloxacin and its structurally similar metabolite, norfloxacin, is described for the first time. The analysis is based on the monitoring of a kinetic spectrophotometric reaction of the two analytes with potassium permanganate as the oxidant. The measurement of the reaction process followed the absorbance decrease of potassium permanganate at 526 nm, and the accompanying increase of the product, potassium manganate, at 608 nm. It was essential to use multivariate calibrations to overcome severe spectral overlaps and similarities in reaction kinetics. Calibration curves for the individual analytes showed linear relationships over the concentration ranges of 1.0-11.5 mg L -1 at 526 and 608 nm for pefloxacin, and 0.15-1.8 mg L -1 at 526 and 608 nm for norfloxacin. Various multivariate calibration models were applied, at the two analytical wavelengths, for the simultaneous prediction of the two analytes including classical least squares (CLS), principal component regression (PCR), partial least squares (PLS), radial basis function-artificial neural network (RBF-ANN) and principal component-radial basis function-artificial neural network (PC-RBF-ANN). PLS and PC-RBF-ANN calibrations with the data collected at 526 nm, were the preferred methods—%RPE T ˜ 5, and LODs for pefloxacin and norfloxacin of 0.36 and 0.06 mg L -1, respectively. Then, the proposed method was applied successfully for the simultaneous determination of pefloxacin and norfloxacin present in pharmaceutical and human plasma samples. The results compared well with those from the alternative analysis by HPLC.

  3. Radioimmunoassay of three oestrogens and three androgens in the same plasma sample after extraction and chromatographic separation

    International Nuclear Information System (INIS)

    Paradisi, R.; Lodi, S.; Bolelli, G.; Venturoli, S.

    1980-01-01

    The plasma levels of oestrone (Oe 1 ), 17β-oestradiol (Oe 2 ), oestriol (Oe 3 ), testosterone (T), 5α-dihydrotestosterone (DHT) and androstenedione (A) were assayed by radioimmunoassay (RIA) in plasma obtained from peripheral venous blood. The hormones are isolated from the plasma extract, first by Sephadex LH-20 column chromatography (Oe 2 /Oe 3 /Oe 1 , T, DHT, A) and after Oe 1 , T, DHT, A by thin layer chromatography (TLC) on silica gel 60 F 254 . The accuracy, reproducibility and sensitivity of the method make it satisfactory for clinical studies. (author)

  4. Microwave assisted digestion of atmospheric aerosol samples followed by inductively coupled plasma mass spectrometry determination of trace elements

    Energy Technology Data Exchange (ETDEWEB)

    Swami, K.; Judd, C.D.; Orsini, J.; Yang, K.X. [New York State Dept. of Health, Albany, NY (United States). Wadsworth Center for Labs. and Research; Husain, L. [New York State Dept. of Health, Albany, NY (United States). Wadsworth Center for Labs. and Research; Dept. of Environmental Health and Toxicology, State Univ. of New York, Albany (United States)

    2001-01-01

    A microwave digestion method in a closed vessel was developed for the determination of trace metals in atmospheric aerosols using inductively coupled plasma mass spectrometry (ICP-MS). A recovery study for the elements V, Cr, Mn, Fe, Co, Ni, Cu, Zn, As, Se, Cd, Sb, and Pb was conducted using multi-elemental standard solutions, NIST 1633b Trace Elements in Coal Fly Ash, and NIST 1648 Urban Particulate Matter. A simple digestion method using only HNO{sub 3}/H{sub 2}O{sub 2}gave good recoveries (90%-108%) for all elements except Cr in SRM 1648, but yielded low recoveries for SRM 1633b. A more robust method using HNO {sub 3}/H {sub 2}O {sub 2}/HF/H {sub 3}BO {sub 3} yielded higher recoveries (82%-103%) for the lighter elements (V - Zn) in SRM 1633b, and improved the Cr recovery in SRM 1648, but decreased the Se recovery in both SRMs. A comparative analysis of aerosol samples obtained at a remote mountain location Nathiagali, Pakistan (2.5 km above mean sea level), and Mayville, New York, downwind from the highly industrialized Midwestern United States, was carried out using Instrumental Neutron Activation Analysis (INAA) for the elements Cr, Mn, Fe, Co, Zn, As, Se, and Sb. The simple digestion method yielded excellent agreement for Cr, Fe, Zn, As, Se, and Sb, with slopes of the ICP-MS vs. INAA regressions of 0.90-1.00 and R {sup 2} values of 0.96-1.00. The regressions for Mn and Co had slopes of 0.82 and 0.84 with R {sup 2} values of 0.83 and 0.82, respectively. Addition of HF/H {sub 3}BO {sub 3} did not improve the correlation for any of the elements and degraded the precision somewhat. The technique provides sensitivity and accuracy for trace elements in relatively small aerosol samples used in atmospheric chemistry studies related to SO {sub 2} oxidation in cloud droplets. The ability to determine concentrations of a very large number of elements from a single analysis will permit source apportionment of various trace pollutants and hence strategies to control the

  5. Magnetic molecularly imprinted polymer nanoparticles for the solid-phase extraction of paracetamole from plasma samples, followed its determination by HPLC

    International Nuclear Information System (INIS)

    Azodi-Deilami, Saman; Najafabadi, Alireza Hassani; Asadi, Ebadullah; Abdouss, Majid; Kordestani, Davood

    2014-01-01

    We are presenting magnetic molecularly imprinted polymer nanoparticles (m-MIPs) for solid-phase extraction and sample clean-up of paracetamole. The m-MIPs were prepared from magnetite (Fe 3 O 4 ) as the magnetic component, paracetamole as the template, methacrylic acid as a functional monomer, and 2-(methacrylamido) ethyl methacrylate as a cross-linker. The m-MIPs were then characterized by transmission electron microscopy, FT-IR spectroscopy, X-ray diffraction and vibrating sample magnetometry. The m-MIPs were applied to the extraction of paracetamole from human blood plasma samples. Following its elution from the column loaded with the m-MIPs with an acetonitrile-buffer (9:1) mixture, it was submitted to HPLC analysis. Paracetamole can be quantified by this method in the 1 μg L −1 to 300 μg L −1 concentration range. The limit of detection and limit of quantification in plasma samples are 0.17 and 0.4 μg L −1 . The preconcentration factor of the m-MIPs is 40. The HPLC method shows good precision (4.5 % at 50 μg L −1 levels) and recoveries (between 83 and 91 %) from spiked plasma samples. (author)

  6. Biocompatible in-tube solid phase microextraction coupled with liquid chromatography-fluorescence detection for determination of interferon α in plasma samples.

    Science.gov (United States)

    Chaves, Andréa R; Silva, Bruno J G; Lanças, Fernando M; Queiroz, Maria Eugênia C

    2011-05-27

    The present work demonstrates the successful application of automated biocompatible in-tube solid-phase microextraction coupled with liquid chromatography (in-tube SPME/LC) for determination of interferon alpha(2a) (IFN α(2a)) in plasma samples for therapeutic drug monitoring. A restricted access material (RAM, protein-coated silica) was employed for preparation of a lab-made biocompatible in-tube SPME capillary that enables the direct injection of biological fluids as well as the simultaneous exclusion of macromolecules by chemical diffusion barrier and drug pre-concentration. The in-tube SPME variables, such as sample volume, draw/eject volume, number of draw-eject cycles, and desorption mode were optimized, to improve the sensitivity of the proposed method. The IFN α(2a) analyses in plasma sample were carried out within 25min (sample preparation and LC analyses). The response of the proposed method was linear over a dynamic range, from 0.06 to 3.0MIUmL(-1), with correlation coefficient equal to 0.998. The interday precision of the method presented coefficient of variation lower than 8%. The proposed automated method has adequate analytical sensitivity and selectivity for determination of IFN α(2a) in plasma samples for therapeutic drug monitoring. Copyright © 2010 Elsevier B.V. All rights reserved.

  7. European Surveillance for Pantropic Canine Coronavirus

    Science.gov (United States)

    Cordonnier, Nathalie; Demeter, Zoltan; Egberink, Herman; Elia, Gabriella; Grellet, Aurélien; Le Poder, Sophie; Mari, Viviana; Martella, Vito; Ntafis, Vasileios; von Reitzenstein, Marcela; Rottier, Peter J.; Rusvai, Miklos; Shields, Shelly; Xylouri, Eftychia; Xu, Zach; Buonavoglia, Canio

    2013-01-01

    Highly virulent pantropic canine coronavirus (CCoV) strains belonging to subtype IIa were recently identified in dogs. To assess the distribution of such strains in Europe, tissue samples were collected from 354 dogs that had died after displaying systemic disease in France (n = 92), Hungary (n = 75), Italy (n = 69), Greece (n = 87), The Netherlands (n = 27), Belgium (n = 4), and Bulgaria (n = 1). A total of 124 animals tested positive for CCoV, with 33 of them displaying the virus in extraintestinal tissues. Twenty-four CCoV strains (19.35% of the CCoV-positive dogs) detected in internal organs were characterized as subtype IIa and consequently assumed to be pantropic CCoVs. Sequence and phylogenetic analyses of the 5′ end of the spike protein gene showed that pantropic CCoV strains are closely related to each other, with the exception of two divergent French viruses that clustered with enteric strains. PMID:23100349

  8. Metallomic study on plasma samples from Nile tilapia using SR-XRF and GFAAS after separation by 2D PAGE: Initial results

    International Nuclear Information System (INIS)

    Santos, F.A.; Lima, P.M.; Neves, R.C.F.; Moraes, P.M.; Castro, G.R.; Padilha, P.M.; Perez, C.A.; Silva, M.O.A.; Arruda, M.A.Z.

    2011-01-01

    An investigation was made on plasma samples obtained after protein separation. The proteome of the plasma of Nile tilapia (Oreochromis niloticus) was separated by 2D PAGE, and manganese and zinc in protein spots was qualitatively and quantitatively determined by synchrotron radiation X-ray fluorescence (SR-XRF) and graphite furnace atomic absorption spectrometry (GFAAS). Manganese and zinc are present in four and six plasma protein spots, respectively. These ions are bound to proteins with molecular weights ranging from 19 to 70 kDa and with isoelectric point (pI) ranging from 4.7 to 6.3. The concentrations of manganese and zinc bound to these proteins as determined by GFAAS following acid digestion of the spots range from 0.8 to 2.6 mg of manganese, and from 1.0 to 6.3 mg of zinc, respectively, per g of protein. (author)

  9. Expression, Purification and Characterization of Recombinant Canine FGF21 in Escherichia coli.

    Science.gov (United States)

    Zheng, Zhong; Yang, Chengjun; Yin, Ruofeng; Jiang, Jinxi; He, Haiting; Wang, Xinxin; Kan, Mujie; Xiao, Yechen

    2016-01-01

    The canine metabolic diseases, such as obesity and diabetes, have become a worldwide problem. Fibroblast growth factor 21 (FGF21) is a potent regulator which has many biological functions relative to metabolism regulation. It suggests that FGF21 plays important roles in regulating canine metabolic diseases. To acquire the recombinant canine FGF21 (rcFGF21) in Escherichia coli, the recombinant bacteria were induced by 0.5 mM IPTG for 16 hours at 16 °C, and the rcFGF21 protein was purified by Ni-NTA. 8 mg rcFGF21 was acquired from one liter bacteria. The rcFGF21 protein has specific immunoblot reactivity against anti-FGF21 and anti-His antibody. The in vivo experimental result showed that rcFGF21 can significantly reduce plasma glucose of STZ-induced diabetic mice.

  10. Canine scent detection and microbial source tracking of human waste contamination in storm drains.

    Science.gov (United States)

    Van De Werfhorst, Laurie C; Murray, Jill L S; Reynolds, Scott; Reynolds, Karen; Holden, Patricia A

    2014-06-01

    Human fecal contamination of surface waters and drains is difficult to diagnose. DNA-based and chemical analyses of water samples can be used to specifically quantify human waste contamination, but their expense precludes routine use. We evaluated canine scent tracking, using two dogs trained to respond to the scent of municipal wastewater, as a field approach for surveying human fecal contamination. Fecal indicator bacteria, as well as DNA-based and chemical markers of human waste, were analyzed in waters sampled from canine scent-evaluated sites (urban storm drains and creeks). In the field, the dogs responded positively (70% and 100%) at sites for which sampled waters were then confirmed as contaminated with human waste. When both dogs indicated a negative response, human waste markers were absent. Overall, canine scent tracking appears useful for prioritizing sampling sites for which DNA-based and similarly expensive assays can confirm and quantify human waste contamination.

  11. Cryopreservation of microencapsulated canine sperm.

    Science.gov (United States)

    Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu

    2011-03-01

    The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Surgical innovations in canine gonadectomy

    OpenAIRE

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated negative consequences (lengthy placement, impaired wound healing around bulky knots, and the effect of unsightly knots on cosmetics). A study in 9 dogs found that celiotomy closure was easily achiev...

  13. Transcutaneous glomerular filtration rate measurement in a canine animal model of chronic kidney disease.

    Science.gov (United States)

    Mondritzki, Thomas; Steinbach, Sarah M L; Boehme, Philip; Hoffmann, Jessica; Kullmann, Maximilian; Schock-Kusch, Daniel; Vogel, Julia; Kolkhof, Peter; Sandner, Peter; Bischoff, Erwin; Hüser, Jörg; Dinh, Wilfried; Truebel, Hubert

    Quantitative assessment of renal function by measurement of glomerular filtration rate (GFR) is an important part of safety and efficacy evaluation in preclinical drug development. Existing methods are often time consuming, imprecise and associated with animal burden. Here we describe the comparison between GFR determinations with sinistrin (PS-GFR) and fluorescence-labelled sinistrin-application and its transcutaneous detection (TD-GFR) in a large animal model of chronic kidney disease (CKD). TD-GFR measurements compared to a standard method using i.v. sinistrin were performed in a canine model. Animals were treated with one-sided renal wrapping (RW) followed by renal artery occlusion (RO). Biomarker and remote hemodynamic measurements were performed. Plasma sinistrin in comparison to transcutaneous derived GFR data were determined during healthy conditions, after RW and RW+RO. RW alone did not led to any significant changes in renal function, neither with PS-GFR nor TD-GFR. Additional RO showed a rise in blood pressure (+68.0mmHg), plasma urea (+28.8mmol/l), creatinine (+224,4μmol/l) and symmetric dimethylarginine (SDMA™; +12.6μg/dl). Plasma sinistrin derived data confirmed the expected drop (-44.7%, p<0.0001) in GFR. The calculated transcutaneous determined Fluorescein Isothiocyanate (FITC)-sinistrin GFR showed no differences to plasma sinistrin GFR at all times. Both methods were equaly sensitive to diagnose renal dysfunction in the affected animals. Renal function assessment using TD-GFR is a valid method to improve preclinical drug discovery and development. Furthermore, TD-GFR method offers advantages in terms of reduced need for blood sampling and thus decreasing animal burden compared to standard procedures. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Simultaneous determination of amino acids and neurotransmitters in plasma samples from schizophrenic patients by hydrophilic interaction liquid chromatography with tandem mass spectrometry.

    Science.gov (United States)

    Domingues, Diego Soares; Crevelin, Eduardo José; de Moraes, Luiz Alberto Beraldo; Cecilio Hallak, Jaime Eduardo; de Souza Crippa, José Alexandre; Costa Queiroz, Maria Eugênia

    2015-03-01

    A sensitive, reproducible, and rapid method was developed for the simultaneous determination of underivatized amino acids (aspartate, serine, glycine, alanine, methionine, leucine, tyrosine, and tryptophan) and neurotransmitters (glutamate and γ-aminobutyric acid) in plasma samples using hydrophilic interaction liquid chromatography coupled to triple quadrupole tandem mass spectrometry. The plasma concentrations of amino acids and neurotransmitters obtained from 35 schizophrenic patients in treatment with clozapine (27 patients) and olanzapine (eight patients) were compared with those obtained from 38 healthy volunteers to monitor the effectiveness of treatment. The chromatographic conditions separated ten target compounds within 3 min. This method presented linear ranges that varied from (lower limit of quantification: 9.7-13.3 nmol/mL) to (upper limit of quantification: 19.4-800 nmol/mL), intra- and interassay precision with coefficients of variation lower than 10%, and relative standard error values of the accuracy ranged from -2.1 to 9.9%. The proposed method appropriately determines amino acids and neurotransmitters in plasma from schizophrenic patients. Compared with the control group (healthy volunteers), the plasma levels of methionine in schizophrenic patients treated with olanzapine are statistically significantly higher. Moreover, schizophrenic patients treated with clozapine tend to have increased plasma levels of glutamate. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Molecularly imprinted polymer cartridges coupled on-line with high performance liquid chromatography for simple and rapid analysis of dextromethorphan in human plasma samples.

    Science.gov (United States)

    Moein, Mohammad Mahdi; Javanbakht, Mehran; Akbari-Adergani, Behrouz

    2011-04-01

    In this paper, a novel method is described for automated determination of dextromethorphan in biological fluids using molecularly imprinted solid-phase extraction (MISPE) as a sample clean-up technique combined with high performance liquid chromatography (HPLC). The water-compatible molecularly imprinted polymers (MIPs) were prepared using methacrylic acid as functional monomer, ethylene glycol dimethacrylate as cross-linker, chloroform as porogen and dextromethorphan as template molecule. These imprinted polymers were used as solid-phase extraction sorbent for the extraction of dextromethorphan from human plasma samples. Various parameters affecting the extraction efficiency of the MIP cartridges were evaluated. The high selectivity of the sorbent coupled to the high performance liquid chromatographic system permitted a simple and rapid analysis of this drug in plasma samples with limits of detection (LOD) and quantification (LOQ) of 0.12 ng/mL and 0.35 ng/mL, respectively. The MIP selectivity was evaluated by analyzing of the dextromethorphan in presence of several substances with similar molecular structures and properties. Results from the HPLC analyses showed that the recoveries of dextromethorphan using MIP cartridges from human plasma samples in the range of 1-50 ng/mL were higher than 87%. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Three-dimensional localization of impacted canines and root resorption assessment using cone beam computed tomography.

    Science.gov (United States)

    Almuhtaseb, Eyad; Mao, Jing; Mahony, Derek; Bader, Rawan; Zhang, Zhi-xing

    2014-06-01

    The purpose of this study was to develop a new way to localize the impacted canines from three dimensions and to investigate the root resorption of the adjacent teeth by using cone beam computed tomography (CBCT). Forty-six patients undergoing orthodontic treatments and having impacted canines in Tongji Hospital were examined. The images of CBCT scans were obtained from KaVo 3D exam vision. Angular and linear measurements of the cusp tip and root apex according to the three planes (mid-sagittal, occlusal and frontal) have been taken using the cephalometric tool of the InVivo Dental Anatomage Version 5.1.10. The measurements of the angular and linear coordinates of the maxillary and mandibular canines were obtained. Using this technique the operators could envision the location of the impacted canine according to the three clinical planes. Adjacent teeth root resorption of 28.26 % was in the upper lateral incisors while 17.39% in upper central incisors, but no lower root resorption was found in our samples. Accurate and reliable localization of the impacted canines could be obtained from the novel analysis system, which offers a better surgical and orthodontic treatment for the patients with impacted canines.

  17. Comparative trial of the canine parvovirus, canine distemper virus and canine adenovirus type 2 fractions of two commercially available modified live vaccines.

    Science.gov (United States)

    Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G

    2006-11-25

    The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.

  18. A comparative study of sample dissolution techniques and plasma-based instruments for the precise and accurate quantification of REEs in mineral matrices

    Energy Technology Data Exchange (ETDEWEB)

    Whitty-Léveillé, Laurence; Turgeon, Keven [Département de génie des mines, de la métallurgie et des matériaux, Université Laval, Québec, QC (Canada); Département de chimie, Université Laval, Québec, QC (Canada); Bazin, Claude [Département de génie des mines, de la métallurgie et des matériaux, Université Laval, Québec, QC (Canada); Larivière, Dominic, E-mail: dominic.lariviere@chm.ulaval.ca [Département de chimie, Université Laval, Québec, QC (Canada)

    2017-04-08

    The recent commercialisation of inductively coupled plasma tandem mass spectrometric (ICP-MS/MS) instruments has provided analytical chemists with a new tool to properly quantify atomic composition in a variety of matrices with minimal sample preparation. In this article, we report on our assessment of the compatibility of 3 sample preparation techniques (open-vessel acid digestion, microwave digestion and alkaline fusion) for the quantification of rare earth elements (REEs) in mineral matrices. The combination of the high digestion temperatures (1050 °C) and using LiBO{sub 2} as a flux was the most effective strategy for the digestion of all rare earth elements in mineral matrices and was compatible with ICP-MS/MS measurements. We also assessed the analytical performances of ICP-MS/MS against other plasma-based instrumentation (microwave induced plasma and inductively coupled plasma atomic emission spectroscopy (MIP-AES and ICP-AES, respectively) and single quadrupole inductively coupled plasma mass spectrometry (ICP-MS). The comparative study showed that the concentrations obtained by ICP-MS/MS are in excellent agreement with the certified reference material values, and much more suited than the other analytical techniques tested for the quantification of REEs, which exhibited low detectability and/or spectral interferences for some elements/isotopes. Finally, the ruggedness of the analytical protocol proposed which combines a rapid sample dissolution step performed by an automated fusion unit and an ICP-MS/MS as a detector was established using various certified mineral matrices containing variable levels of REEs. - Highlights: • Three types of digestion methods were tested. • Four types of analytical techniques were compared. • Elimination of the spectral interferences encountered in ICP-MS was achieved by the use of Tandem ICP-MS. • Robustness of the analytical procedure was successfully evaluate on four types of certified reference material.

  19. A comparative study of sample dissolution techniques and plasma-based instruments for the precise and accurate quantification of REEs in mineral matrices

    International Nuclear Information System (INIS)

    Whitty-Léveillé, Laurence; Turgeon, Keven; Bazin, Claude; Larivière, Dominic

    2017-01-01

    The recent commercialisation of inductively coupled plasma tandem mass spectrometric (ICP-MS/MS) instruments has provided analytical chemists with a new tool to properly quantify atomic composition in a variety of matrices with minimal sample preparation. In this article, we report on our assessment of the compatibility of 3 sample preparation techniques (open-vessel acid digestion, microwave digestion and alkaline fusion) for the quantification of rare earth elements (REEs) in mineral matrices. The combination of the high digestion temperatures (1050 °C) and using LiBO_2 as a flux was the most effective strategy for the digestion of all rare earth elements in mineral matrices and was compatible with ICP-MS/MS measurements. We also assessed the analytical performances of ICP-MS/MS against other plasma-based instrumentation (microwave induced plasma and inductively coupled plasma atomic emission spectroscopy (MIP-AES and ICP-AES, respectively) and single quadrupole inductively coupled plasma mass spectrometry (ICP-MS). The comparative study showed that the concentrations obtained by ICP-MS/MS are in excellent agreement with the certified reference material values, and much more suited than the other analytical techniques tested for the quantification of REEs, which exhibited low detectability and/or spectral interferences for some elements/isotopes. Finally, the ruggedness of the analytical protocol proposed which combines a rapid sample dissolution step performed by an automated fusion unit and an ICP-MS/MS as a detector was established using various certified mineral matrices containing variable levels of REEs. - Highlights: • Three types of digestion methods were tested. • Four types of analytical techniques were compared. • Elimination of the spectral interferences encountered in ICP-MS was achieved by the use of Tandem ICP-MS. • Robustness of the analytical procedure was successfully evaluate on four types of certified reference material.

  20. [Inductively coupled plasma mass spectrometry for the simultaneous determination of thirty metals and metalloids elements in blood samples].

    Science.gov (United States)

    Ding, Chun-guang; Zhu, Chun; Liu, De-ye; Dong, Ming; Zhang, Ai-hua; Pan, Ya-juan; Yan, Hui-fang

    2012-08-01

    To establish an inductively coupled plasma mass spectrometry(ICP-MS) method for determination of 30 trace elements including As, Ba, Be, Bi, Ni, Cd, Co, Cr, Cs, Cu, Ga, Mn, Pb, Sr, Tl, V, Ge, Mo, Nb, Ti, W, Te, Se, Zr, In, Sb, Hg, Ce, La, and Sm in human blood. The blood samples were analyzed by ICP-MS after diluted 1/10 with 0.01% Triton-X-100 and 0.5% nitric acid solution. Y, Rh and Lu were selected as internal standard in order to correct the matrix interference of Cr, As, Se, and Hg by a hex pole-based collision-reaction cell. Other elements were determined with standard method. The limits of detection, precision and accuracy of the method were evaluated. The accuracy was validated by the determination of the whole blood reference material. All the 30 trace elements have good linearity in their determination range, with the correlation coefficient > 0.9999. The limits of detection of the 30 trace elements were in the range of 1.19 - 2.15 µg/L and the intra-precision and inter-precision (relative standard deviation, RSD) were less than 14.3% (except Hg RSD < 21.2%, and Ni RSD < 15.4%). The spiked recovery for all elements fell within 59.3% - 119.2%. Among the 13 whole blood reference materials, V, Cr, Mn, Co, Ni, Cu, As, Se, Cd, Te, and Pb (1.45, 1.19, 18.40, 0.18, 1.57, 591.00, 2.97, 61.00, 0.35, 1.86, and 9.70 µg/L respectively) fell within the acceptable range and the detection results of Hg (0.59 µg/L) and Mo (1.59 µg/L) were slightly beyond the range. This method was simple, fast and effective. It can be used to monitor the multi-elementary concentration in human blood.

  1. An ultrasound-assisted digestion method for the determination of toxic element concentrations in ash samples by inductively coupled plasma optical emission spectrometry

    International Nuclear Information System (INIS)

    Ilander, Aki; Vaeisaenen, Ari

    2007-01-01

    A method of ultrasound-assisted digestion followed by inductively coupled plasma optical emission spectrometry (ICP-OES) used for the determination of toxic element concentrations (arsenic, barium, cobalt, copper, lead, nickel, strontium, vanadium and zinc) in ash samples was developed. All the measurements were performed in robust plasma conditions which were tested by measuring the Mg(II) 280.270 nm/Mg(I) 285.213 nm line intensity ratios. The highest line intensity ratios were observed when a nebulizer gas flow of 0.6 L min -1 , auxiliary gas flow of 0.2 L min -1 and plasma power of 1400 W were used for radially viewed plasma. The analysis of SRM 1633b showed that the ultrasound-assisted method developed is highly comparable with the microwave digestion method standardized by the United States Environmental Protection Agency (EPA-3052). The ultrasound-assisted digestion with a digestion solution of aqua regia and hydrofluoric acid (HF) resulted in recovery rates of over 81%. One exception is arsenic which resulted in recoveries of about 60% only; however, it could be digested with good recovery (>90%) using a digestion solution of 5 mL of water and 5 mL of aqua regia. The major advantage of the ultrasound-assisted digestion over microwave digestion is the high treatment rate (30 samples simultaneously with a sonication time of 18 min)

  2. Soluble HLA-G and HLA-E Levels in Bone Marrow Plasma Samples Are Related to Disease Stage in Neuroblastoma Patients

    Directory of Open Access Journals (Sweden)

    Fabio Morandi

    2016-01-01

    Full Text Available The role of nonclassical HLA-class Ib molecules HLA-G and HLA-E in the progression of Neuroblastoma (NB, the most common pediatric extracranial solid tumor, has been characterized in the last years. Since BM infiltration by NB cells is an adverse prognostic factor, we have here analyzed for the first time the concentration of soluble (sHLA-G and HLA-E in bone marrow (BM plasma samples from NB patients at diagnosis and healthy donors. sHLA-G and sHLA-E are present in BM plasma samples, and their levels were similar between NB patients and controls, thus suggesting that these molecules are physiologically released by resident or stromal BM cell populations. This hypothesis was supported by the finding that sHLA-G and sHLA-E levels did not correlate with BM infiltration and other adverse prognostic factors (MYCN amplification and age at diagnosis. In contrast, BM plasma levels of both molecules were higher in patients with metastatic disease than in patients with localized NB, thus suggesting that concentration of these molecules might be correlated with disease progression. The prognostic role of sHLA-G and sHLA-E concentration in the BM plasma for NB patients will be evaluated in future studies, by analyzing the clinical outcome of the same NB patients at follow-up.

  3. Dose-effective investigation of intraarterial r-Sak in canine model with acute cerebral infarctions

    International Nuclear Information System (INIS)

    Liu Sheng; Shi Haibin; Zhang Peng; Wang Chenghu; Zhou Chunguo; Li Linsun

    2007-01-01

    Objective: To compare the effect and complications of intraarterial thrombolysis with different doses of recombinant-staphylokinase (r-Sak) in canine model with acute cerebral infarction, and then to find out the most properly appropriate effective dose. Methods: The model with left cerebral embolism was established with interventional technique in 24 beagle adult dogs. They were randomly divided into 4 groups including control group(saline, 10 ml), group of low dose(r-Sak, 5 000 u/kg), middle dose(r-Sak, 10 000 u/kg) and high dose(r-Sak, 20 000 u/kg). Angiography and intraarterial thrombolysis were performed within 30 minutes after the embolization. Microcatheter was superselectively inserted into left carotid artery. Five hour's later with a repeated angiography at half, 1 and 2 hours after thrombolysis to observe the recanalization. Blood samples were collected at a series of time pre-and post-thrombolysis to test the plasma levels of PT, APTT and D-dimer. These canines were sacrificed, and their cerebri were taken out for pathologic study by the end of 24 hours. Results: The rates of efficacy within 2 hours after thrombolysis were 10.0% (1/10) in control group, 40.0% (4/10) in low dose group, 90.9% (10/11) in middle dose group and 100% (9/9) in high dose group. The rates of complete recanalization were 0, 10% (1/10), 36.4% (4/11) and 66.7% (6/9), correspondingly and respectively. There were statistically obvious differences between the 3 groups (P 0.05). Death occurred in 1 canine(high dose group) within 24 hours after thrombolysis with hemorrhagic lesion in parietal lobe of brain. No other severe complications ocurred. Conclusions: (1) Intraarterial thrombolysis with r-Sak within 5 hours after onset of thrombosis is effective and feasible. Intraarterial r-Sak shows strong thrombolytic effect for white thrombus including a few platelets. There is relative high rate of recanalization with no less than 10 000U/kg of r-Sak but accompanied with high risk of

  4. Heparin removal by ecteola-cellulose pre-treatment enables the use of plasma samples for accurate measurement of anti-Yellow fever virus neutralizing antibodies.

    Science.gov (United States)

    Campi-Azevedo, Ana Carolina; Peruhype-Magalhães, Vanessa; Coelho-Dos-Reis, Jordana Grazziela; Costa-Pereira, Christiane; Yamamura, Anna Yoshida; Lima, Sheila Maria Barbosa de; Simões, Marisol; Campos, Fernanda Magalhães Freire; de Castro Zacche Tonini, Aline; Lemos, Elenice Moreira; Brum, Ricardo Cristiano; de Noronha, Tatiana Guimarães; Freire, Marcos Silva; Maia, Maria de Lourdes Sousa; Camacho, Luiz Antônio Bastos; Rios, Maria; Chancey, Caren; Romano, Alessandro; Domingues, Carla Magda; Teixeira-Carvalho, Andréa; Martins-Filho, Olindo Assis

    2017-09-01

    Technological innovations in vaccinology have recently contributed to bring about novel insights for the vaccine-induced immune response. While the current protocols that use peripheral blood samples may provide abundant data, a range of distinct components of whole blood samples are required and the different anticoagulant systems employed may impair some properties of the biological sample and interfere with functional assays. Although the interference of heparin in functional assays for viral neutralizing antibodies such as the functional plaque-reduction neutralization test (PRNT), considered the gold-standard method to assess and monitor the protective immunity induced by the Yellow fever virus (YFV) vaccine, has been well characterized, the development of pre-analytical treatments is still required for the establishment of optimized protocols. The present study intended to optimize and evaluate the performance of pre-analytical treatment of heparin-collected blood samples with ecteola-cellulose (ECT) to provide accurate measurement of anti-YFV neutralizing antibodies, by PRNT. The study was designed in three steps, including: I. Problem statement; II. Pre-analytical steps; III. Analytical steps. Data confirmed the interference of heparin on PRNT reactivity in a dose-responsive fashion. Distinct sets of conditions for ECT pre-treatment were tested to optimize the heparin removal. The optimized protocol was pre-validated to determine the effectiveness of heparin plasma:ECT treatment to restore the PRNT titers as compared to serum samples. The validation and comparative performance was carried out by using a large range of serum vs heparin plasma:ECT 1:2 paired samples obtained from unvaccinated and 17DD-YFV primary vaccinated subjects. Altogether, the findings support the use of heparin plasma:ECT samples for accurate measurement of anti-YFV neutralizing antibodies. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Accuracy of recommended sampling and assay methods for the determination of plasma-free and urinary fractionated metanephrines in the diagnosis of pheochromocytoma and paraganglioma: a systematic review.

    Science.gov (United States)

    Därr, Roland; Kuhn, Matthias; Bode, Christoph; Bornstein, Stefan R; Pacak, Karel; Lenders, Jacques W M; Eisenhofer, Graeme

    2017-06-01

    To determine the accuracy of biochemical tests for the diagnosis of pheochromocytoma and paraganglioma. A search of the PubMed database was conducted for English-language articles published between October 1958 and December 2016 on the biochemical diagnosis of pheochromocytoma and paraganglioma using immunoassay methods or high-performance liquid chromatography with coulometric/electrochemical or tandem mass spectrometric detection for measurement of fractionated metanephrines in 24-h urine collections or plasma-free metanephrines obtained under seated or supine blood sampling conditions. Application of the Standards for Reporting of Diagnostic Studies Accuracy Group criteria yielded 23 suitable articles. Summary receiver operating characteristic analysis revealed sensitivities/specificities of 94/93% and 91/93% for measurement of plasma-free metanephrines and urinary fractionated metanephrines using high-performance liquid chromatography or immunoassay methods, respectively. Partial areas under the curve were 0.947 vs. 0.911. Irrespective of the analytical method, sensitivity was significantly higher for supine compared with seated sampling, 95 vs. 89% (p sampling compared with 24-h urine, 95 vs. 90% (p sampling, seated sampling, and urine. Test accuracy increased linearly from 90 to 93% for 24-h urine at prevalence rates of 0.0-1.0, decreased linearly from 94 to 89% for seated sampling and was constant at 95% for supine conditions. Current tests for the biochemical diagnosis of pheochromocytoma and paraganglioma show excellent diagnostic accuracy. Supine sampling conditions and measurement of plasma-free metanephrines using high-performance liquid chromatography with coulometric/electrochemical or tandem mass spectrometric detection provides the highest accuracy at all prevalence rates.

  6. Characterization of lipoproteins in human and canine cerebrospinal fluid (CSF)

    International Nuclear Information System (INIS)

    Pitas, R.E.; Weisgraber, K.H.; Boyles, J.K.; Lee, S.; Mahley, R.W.

    1986-01-01

    Previously the authors demonstrated that rat brain astrocytes in vitro synthesize and secrete apo-E and possess apo-B,E(LDL) receptors. The apo-E secreted by astrocytes and apo-E in rat brain extracts differed from serum apo-E in two respects. Brain apo-E had a higher apparent molecular weight and a higher percentage of more acidic isoforms. To characterize further the apo-E within the central nervous system, apo-E in human and canine CSF was investigated. Compared to plasma apo-E, CSF apo-E had a higher apparent M/sub r/ and a higher percentage of acidic isoforms which were sialylated, as shown by neuraminidase digestion. The apo-E in human CSF was approx.5-10% of the plasma level. In CSF 60-80% of the apo-E was in lipoproteins with d = 1.09-1.15. The remainder of the apo-E was in the d > 1.21 fraction. Human CSF lipoproteins were primarily spherical (110-190 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) and spheres (100-150 A). The CSF also contained apo-AI in the d = 1.09-1.15 g/ml fraction. Human CSF lipoproteins containing both apo-E and apo-AI were isolated on an anti-apo-E affinity column, suggesting that apo-E and AI occurred in the same particles. The CSF apo-E-containing lipoproteins competed for binding of 125 I-LDL to the apo-B,E(LDL) receptor. There was no detectable apo-B in CSF. These data suggest that CSF lipoproteins might transport lipid and regulate lipid homeostasis within the brain

  7. A precise evaluation of glomerular filtration rate (GFR) in two plasma samples following a single administration of 57Co-B12 vitamin

    International Nuclear Information System (INIS)

    Camargo, E.E.; Rockmann, R.L.; Barreto, T.M.; Eston, T.E.; Papaleo Netto, M.; Carvalho, N.

    1974-01-01

    Through a logarithmic regression performed with the contings of 4 plasma samples withdrawn at 20,40,60 and 80 minutes after a venous injection of vitamin B 12 - 57 Co, the glomerular filtration-rate(GFR) in 11 patients, performing simultaneously the same study with EDTA- 51 Cr in 3 of them, is evaluated. The values obtained through the regression straight line are compared with those given by only 2 points, in the 6 possible combinations: 20 and 40 minutes, 20 and 60 minutes, 20 and 80 minutes, 40 and 60 minutes, 40 and 80 minutes, 60 and 80 minutes. The pair of points obtained at 20 and 80 minutes determined the straight line most similar to the logarithmic regression and as a simplification of the method, the withdraw of only 2 plasma samples, at and 80 minutes after a single injection of vitamin B 12 -57 Co is proposed [pt

  8. Study of the effects of E × B fields as mechanism to carbon-nitrogen plasma immersion ion implantation on stainless steel samples

    Science.gov (United States)

    Pillaca, E. J. D. M.; Ueda, M.; Oliveira, R. M.; Pichon, L.

    2014-08-01

    Effects of E × B fields as mechanism to carbon-nitrogen plasma immersion ion implantation (PIII) have been investigated. This magnetic configuration when used in PIII allows obtaining high nitrogen plasma density close to the ion implantation region. Consequently, high ions dose on the target is possible to be achieved compared with standard PIII. In this scenario, nitrogen and carbon ions were implanted simultaneously on stainless steel, as measured by GDOES and detected by X-ray diffraction. Carbon-tape disposed on the sample-holder was sputtered by intense bombardment of nitrogen ions, being the source of carbon atoms in this experiment. The implantation of both N and C caused changes on sample morphology and improvement of the tribological properties of the stainless steel.

  9. Simultaneous extraction and quantification of lamotrigine, phenobarbital, and phenytoin in human plasma and urine samples using solidified floating organic drop microextraction and high-performance liquid chromatography.

    Science.gov (United States)

    Asadi, Mohammad; Dadfarnia, Shayessteh; Haji Shabani, Ali Mohammad; Abbasi, Bijan

    2015-07-01

    A novel and simple method based on solidified floating organic drop microextraction followed by high-performance liquid chromatography with ultraviolet detection has been developed for simultaneous preconcentration and determination of phenobarbital, lamotrigine, and phenytoin in human plasma and urine samples. Factors affecting microextraction efficiency such as the type and volume of the extraction solvent, sample pH, extraction time, stirring rate, extraction temperature, ionic strength, and sample volume were optimized. Under the optimum conditions (i.e. extraction solvent, 1-undecanol (40 μL); sample pH, 8.0; temperature, 25°C; stirring rate, 500 rpm; sample volume, 7 mL; potassium chloride concentration, 5% and extraction time, 50 min), the limits of detection for phenobarbital, lamotrigine, and phenytoin were 1.0, 0.1, and 0.3 μg/L, respectively. Also, the calibration curves for phenobarbital, lamotrigine, and phenytoin were linear in the concentration range of 2.0-300.0, 0.3-200.0, and 1.0-200.0 μg/L, respectively. The relative standard deviations for six replicate extractions and determinations of phenobarbital, lamotrigine, and phenytoin at 50 μg/L level were less than 4.6%. The method was successfully applied to determine phenobarbital, lamotrigine, and phenytoin in plasma and urine samples. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Multielemental Determination of As, Bi, Ge, Sb, and Sn in Agricultural Samples Using Hydride Generation Coupled to Microwave-Induced Plasma Optical Emission Spectrometry.

    Science.gov (United States)

    Machado, Raquel C; Amaral, Clarice D B; Nóbrega, Joaquim A; Araujo Nogueira, Ana Rita

    2017-06-14

    A microwave-induced plasma optical emission spectrometer with N 2 -based plasma was combined with a multimode sample introduction system (MSIS) for hydride generation (HG) and multielemental determination of As, Bi, Ge, Sb, and Sn in samples of forage, bovine liver, powdered milk, agricultural gypsum, rice, and mineral fertilizer, using a single condition of prereduction and reduction. The accuracy of the developed analytical method was evaluated using certified reference materials of water and mineral fertilizer, and recoveries ranged from 95 to 106%. Addition and recovery experiments were carried out, and the recoveries varied from 85 to 117% for all samples evaluated. The limits of detection for As, Bi, Ge, Sb, and Sn were 0.46, 0.09, 0.19, 0.46, and 5.2 μg/L, respectively, for liquid samples, and 0.18, 0.04, 0.08, 0.19, and 2.1 mg/kg, respectively, for solid samples. The method proposed offers a simple, fast, multielemental, and robust alternative for successful determination of all five analytes in agricultural samples with low operational cost without compromising analytical performance.

  11. Nuclear Glycogen Inclusions in Canine Parietal Cells.

    Science.gov (United States)

    Silvestri, S; Lepri, E; Dall'Aglio, C; Marchesi, M C; Vitellozzi, G

    2017-05-01

    Nuclear glycogen inclusions occur infrequently in pathologic conditions but also in normal human and animal tissues. Their function or significance is unclear. To the best of the authors' knowledge, no reports of nuclear glycogen inclusions in canine parietal cells exist. After initial observations of nuclear inclusions/pseudoinclusions during routine histopathology, the authors retrospectively examined samples of gastric mucosa from dogs presenting with gastrointestinal signs for the presence of intranuclear inclusions/pseudoinclusions and determined their composition using histologic and electron-microscopic methods. In 24 of 108 cases (22%), the authors observed various numbers of intranuclear inclusions/pseudoinclusions within scattered parietal cells. Nuclei were characterized by marked karyomegaly and chromatin margination around a central optically empty or slightly eosinophilic area. The intranuclear inclusions/pseudoinclusions stained positive with periodic acid-Schiff (PAS) and were diastase sensitive, consistent with glycogen. Several PAS-positive/diastase-sensitive sections were further examined by transmission electron microscopy, also using periodic acid-thiocarbohydrazide-silver proteinate (PA-TCH-SP) staining to identify polysaccharides. Ultrastructurally, the nuclear inclusions were composed of electron-dense particles that were not membrane bound, without evidence of nuclear membrane invaginations or cytoplasmic organelles in the nuclei, and positive staining with PA-TCH-SP, confirming a glycogen composition. No cytoplasmic glycogen deposits were observed, suggesting that the intranuclear glycogen inclusions were probably synthesized in loco. Nuclear glycogen inclusions were not associated with gastritis or colonization by Helicobacter-like organisms ( P > .05). Our findings suggest that nuclear glycogen inclusions in canine parietal cells could be an incidental finding. Nevertheless, since nuclear glycogen is present in several pathologic

  12. Detection of canine pneumovirus in dogs with canine infectious respiratory disease.

    Science.gov (United States)

    Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe

    2013-12-01

    Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.

  13. Detection of a group 2 coronavirus in dogs with canine infectious respiratory disease

    International Nuclear Information System (INIS)

    Erles, Kerstin; Toomey, Crista; Brooks, Harriet W.; Brownlie, Joe

    2003-01-01

    An investigation into the causes of canine infectious respiratory disease was carried out in a large rehoming kennel. Tissue samples taken from the respiratory tract of diseased dogs were tested for the presence of coronaviruses using RT-PCR with conserved primers for the polymerase gene. Sequence analysis of four positive samples showed the presence of a coronavirus with high similarity to both bovine and human coronavirus (strain OC43) in their polymerase and spike genes, whereas there was a low similarity to comparable genes in the enteric canine coronavirus. This canine respiratory coronavirus (CRCV) was detected by RT-PCR in 32/119 tracheal and 20/119 lung samples, with the highest prevalence being detected in dogs with mild clinical symptoms. Serological analysis showed that the presence of antibodies against CRCV on the day of entry into the kennel decreased the risk of developing respiratory disease

  14. Molecular epidemiology of canine parvovirus in Morocco.

    Science.gov (United States)

    Amrani, Nadia; Desario, Costantina; Kadiri, Ahlam; Cavalli, Alessandra; Berrada, Jaouad; Zro, Khalil; Sebbar, Ghizlane; Colaianni, Maria Loredana; Parisi, Antonio; Elia, Gabriella; Buonavoglia, Canio; Malik, Jamal; Decaro, Nicola

    2016-07-01

    Since it first emergence in the mid-1970's, canine parvovirus 2 (CPV-2) has evolved giving rise to new antigenic variants termed CPV-2a, CPV-2b and CPV-2c, which have completely replaced the original strain and had been variously distributed worldwide. In Africa limited data are available on epidemiological prevalence of these new types. Hence, the aim of the present study was to determine circulating variants in Morocco. Through TaqMan-based real-time PCR assay, 91 samples, collected from symptomatic dogs originating from various cities between 2011 and 2015, were diagnosed. Positive specimens were characterised by means of minor groove binder (MGB) probe PCR. The results showed that all samples but one (98.9%) were CPV positive, of which 1 (1.1%) was characterised as CPV-2a, 43 (47.7%) as CPV-2b and 39 (43.3%) as CPV-2c. Interestingly, a co-infection with CPV-2b and CPV-2c was detected in 4 (4.4%) samples and 3 (3.3%) samples were not characterised. Sequencing of the full VP2 gene revealed these 3 uncharacterised strains as CPV-2c, displaying a change G4068A responsible for the replacement of aspartic acid with asparagine at residue 427, impacting the MGB probe binding. In this work we provide a better understanding of the current status of prevailing CPV strains in northern Africa. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Novel liquid chromatography method based on linear weighted regression for the fast determination of isoprostane isomers in plasma samples using sensitive tandem mass spectrometry detection.

    Science.gov (United States)

    Aszyk, Justyna; Kot, Jacek; Tkachenko, Yurii; Woźniak, Michał; Bogucka-Kocka, Anna; Kot-Wasik, Agata

    2017-04-15

    A simple, fast, sensitive and accurate methodology based on a LLE followed by liquid chromatography-tandem mass spectrometry for simultaneous determination of four regioisomers (8-iso prostaglandin F 2α , 8-iso-15(R)-prostaglandin F 2α , 11β-prostaglandin F 2α , 15(R)-prostaglandin F 2α ) in routine analysis of human plasma samples was developed. Isoprostanes are stable products of arachidonic acid peroxidation and are regarded as the most reliable markers of oxidative stress in vivo. Validation of method was performed by evaluation of the key analytical parameters such as: matrix effect, analytical curve, trueness, precision, limits of detection and limits of quantification. As a homoscedasticity was not met for analytical data, weighted linear regression was applied in order to improve the accuracy at the lower end points of calibration curve. The detection limits (LODs) ranged from 1.0 to 2.1pg/mL. For plasma samples spiked with the isoprostanes at the level of 50pg/mL, intra-and interday repeatability ranged from 2.1 to 3.5% and 0.1 to 5.1%, respectively. The applicability of the proposed approach has been verified by monitoring of isoprostane isomers level in plasma samples collected from young patients (n=8) subjected to hyperbaric hyperoxia (100% oxygen at 280kPa(a) for 30min) in a multiplace hyperbaric chamber. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. 9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...

  17. High-performance liquid chromatography-tandem mass spectrometry for simultaneous determination of raltegravir, dolutegravir and elvitegravir concentrations in human plasma and cerebrospinal fluid samples.

    Science.gov (United States)

    Tsuchiya, Kiyoto; Ohuchi, Mayu; Yamane, Naoe; Aikawa, Hiroaki; Gatanaga, Hiroyuki; Oka, Shinichi; Hamada, Akinobu

    2018-02-01

    A simple sample treatment procedure and sensitive liquid chromatography-tandem mass spectrometry method were developed for the simultaneous quantification of the concentrations of human immunodeficiency virus-1 integrase strand transfer inhibitors - raltegravir, dolutegravir and elvitegravir - in human plasma and cerebrospinal fluid (CSF). Plasma and CSF samples (20 μL each) were deproteinized with acetonitrile. Raltegravir-d 3 was used as the internal standard. Chromatographic separation was achieved on an XBridge C 18 column (50 × 2.1 mm i.d., particle size 3.5 μm) using acetonitrile-water (7:3, v/v) containing 0.1% formic acid as the mobile phase at a flow rate of 0.2 mL/min. The run time was 5 min. Calibration curves for all three drugs were linear in the range 5-1500 ng/mL for plasma and 1-200 ng/mL for CSF. The intra- and inter-day precision and accuracy of all three drugs in plasma were coefficient of variation (CV) <12.9% and 100.0 ± 12.2%, respectively, while those in CSF were CV <12.3% and 100.0 ± 7.9%, respectively. Successful validation under the same LC-MS/MS conditions for both plasma and CSF indicates this analytical method is useful for monitoring the levels of these integrase strand transfer inhibitors in the management of treatment of HIV-1 carriers. Copyright © 2017 John Wiley & Sons, Ltd.

  18. Detection and genetic characterization of Canine parvovirus and Canine coronavirus strains circulating in district of Tirana in Albania.

    Science.gov (United States)

    Cavalli, Alessandra; Desario, Costantina; Kusi, Ilir; Mari, Viviana; Lorusso, Eleonora; Cirone, Francesco; Kumbe, Ilirjan; Colaianni, Maria Loredana; Buonavoglia, Domenico; Decaro, Nicola

    2014-07-01

    An epidemiological survey for Canine parvovirus 2 (CPV-2) and Canine coronavirus (CCoV) was conducted in Albania. A total of 57 fecal samples were collected from diarrheic dogs in the District of Tirana during 2011-2013. The molecular assays detected 53 and 31 CPV- and CCoV-positive specimens, respectively, with mixed CPV-CCoV infections diagnosed in 28 dogs. The most frequently detected CPV type was 2a, whereas IIa was the predominant CCoV subtype. A better comprehension of the CPV-CCoV epidemiology in eastern European countries will help to assess the most appropriate vaccination strategies to prevent disease due to infections with these widespread agents of acute gastroenteritis in the dog.

  19. An evaluation of the histological effects of intra-articular methadone in the canine model.

    Science.gov (United States)

    Jones, Timothy A; Hand, Walter R; Ports, Michael D; Unger, Daniel V; Herbert, Daniel; Pellegrini, Joseph E

    2003-02-01

    Methadone hydrochloride is an opiate that has pharmacodynamic and pharmacokinetic properties that suggest it may provide longer analgesia than morphine when administered via the intra-articular route. However, no studies to date have been conducted examining the effects of intra-articular methadone hydrochloride on local tissues. Therefore, the purpose of this study was to determine the histopathologic effects of intra-articular methadone hydrochloride on local tissues in the canine knee. Nine canines, 1 to 4 years old, weighing between 20 kg and 23 kg were used. All canines had their knees randomized to receive either bupivacaine, 0.5% with epinephrine 1:200,000 (4.5 mL), and 5 mg methadone hydrochloride (0.5 mL) for the study knee, or bupivacaine, 0.5% with epinephrine 1:200,000 (4.5 mL), and 0.5 mL normal saline for the control knee. Serum methadone hydrochloride levels were obtained on all canines at 6 and 24 hours. Canines were randomly assigned to 1 of 3 groups to be euthanized at either 24 hours, 14 days, or 28 days. Following euthanization and necropsy, synovial fluid levels and tissue samples were obtained and examined for histopathologic changes. Synovial fluid samples noted a few white blood cells at 24 hours and none at 14 and 28 days. Tissue samples showed no histopathologic changes, and serum concentration levels of methadone hydrochloride were negligible.

  20. Rabies, canine distemper, and canine parvovirus exposure in large carnivore communities from two Zambian ecosystems.

    Science.gov (United States)

    Berentsen, Are R; Dunbar, Mike R; Becker, Matthew S; M'soka, Jassiel; Droge, Egil; Sakuya, Nicholas M; Matandiko, Wigganson; McRobb, Rachel; Hanlon, Cathleen A

    2013-09-01

    Disease transmission within and among wild and domestic carnivores can have significant impacts on populations, particularly for threatened and endangered species. We used serology to evaluate potential exposure to rabies virus, canine distemper virus (CDV), and canine parvovirus (CPV) for populations of African lions (Panthera leo), African wild dogs (Lycaon pictus), and spotted hyenas (Crocuta crocuta) in Zambia's South Luangwa National Park (SLNP) and Liuwa Plain National Park (LPNP) as well as community lands bordering these areas. In addition, domestic dogs in the study region were evaluated for exposure to CDV and rabies. We provide the first comprehensive disease exposure data for these species in these ecosystems. Twenty-one lions, 20 hyenas, 13 wild dogs, and 38 domestic dogs were sampled across both regions from 2009 to 2011. Laboratory results show 10.5% of domestic dogs, 5.0% of hyenas, and 7.7% of wild dogs sampled were positive for CDV exposure. All lions were negative. Exposure to CPV was 10.0% and 4.8% for hyenas and lions, respectively. All wild dogs were negative, and domestic dogs were not tested due to insufficient serum samples. All species sampled were negative for rabies virus neutralizing antibodies except lions. Forty percent of lions tested positive for rabies virus neutralizing antibodies. Because these lions appeared clinically healthy, this finding is consistent with seroconversion following exposure to rabies antigen. To our knowledge, this finding represents the first ever documentation of rabies virus neutralizing antibodies consistent with rabies exposure that did not lead to clinical disease in free-ranging African lions from this region. With ever-increasing human pressure on these ecosystems, understanding disease transmission dynamics is essential for proper management and conservation of these carnivore species.

  1. Use of oxidative and reducing vapor generation for reducing the detection limits of iodine in biological samples by inductively coupled plasma atomic emission spectrometry

    International Nuclear Information System (INIS)

    Vtorushina, Eh.A.; Saprykin, A.I.; Knapp, G.

    2009-01-01

    Procedures of microwave combustion in an oxygen flow and microwave acid decomposition of biological samples were optimized for the subsequent determination of iodine. A new method was proposed for the generation of molecular iodine from periodate iona using hydrogen peroxide as a reductant. Procedures were developed for determining iodine in biological samples by inductively coupled plasma atomic emission spectrometry (ICP-AES) using oxidative and reducing vapor generation; these allowed the detection limit for iodine to be lowered by 3-4 orders of magnitude. The developed procedures were used to analyze certified reference materials of milk (Skim Milk Powder BCR 150) and seaweed (Sea Lettuce BCR 279) and a Supradyn vitamin complex

  2. New and emerging pathogens in canine infectious respiratory disease.

    Science.gov (United States)

    Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J

    2014-03-01

    Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.

  3. Single-sample 99mTc-diethylenetriamine penta-acetate plasma clearance in advanced renal failure by the mean sojourn time approach.

    Science.gov (United States)

    Gref, Margareta C; Karp, Kjell H

    2009-03-01

    The single-sample Tc-diethylenetriamine penta-acetate (DTPA) clearance method by Christensen and Groth is recommended by the Radionuclides in Nephrourology Committee on Renal Clearance for use in adults with an estimated glomerular filtration rate (GFR) > or = 30 ml/min. The purpose of this study was to test a new Tc-DTPA single-sample low clearance formula for GFR lesser than 30 ml/min. Twenty-one adult patients (29 investigations) were included. Reference clearance was calculated with both Cr-EDTA and Tc-DTPA according to Brøchner-Mortensen with samples drawn between 3 and 24 h. Single-sample clearance was calculated from a 24 h sample using the low clearance formula(Equation is included in full-text article.) C(t) is the activity of the tracer in the plasma sample t minutes after the injection and Q0 is the injected amount. ECV is the extracellular volume in ml defined as the distribution volume of the tracer. ECV is estimated from the body surface area as ECV=8116.6xbody surface area-28.2. The mean difference between reference and Tc-DTPA single-sample clearance was -0.5 ml/min (SD 1.0 ml/min) for Tc-DTPA and -0.8 ml/min (SD 1.2 ml/min) for Cr-EDTA as reference clearance. In adult patients it is possible, even with GFR lesser than 30 ml/min, to get an accurate determination of Tc-DTPA plasma clearance from a single sample using the mean sojourn time approach. The blood sample should be obtained about 24 h after injection of the GFR tracer.

  4. Evaluation of Sample Stability and Automated DNA Extraction for Fetal Sex Determination Using Cell-Free Fetal DNA in Maternal Plasma

    Directory of Open Access Journals (Sweden)

    Elena Ordoñez

    2013-01-01

    Full Text Available Objective. The detection of paternally inherited sequences in maternal plasma, such as the SRY gene for fetal sexing or RHD for fetal blood group genotyping, is becoming part of daily routine in diagnostic laboratories. Due to the low percentage of fetal DNA, it is crucial to ensure sample stability and the efficiency of DNA extraction. We evaluated blood stability at 4°C for at least 24 hours and automated DNA extraction, for fetal sex determination in maternal plasma. Methods. A total of 158 blood samples were collected, using EDTA-K tubes, from women in their 1st trimester of pregnancy. Samples were kept at 4°C for at least 24 hours before processing. An automated DNA extraction was evaluated, and its efficiency was compared with a standard manual procedure. The SRY marker was used to quantify cfDNA by real-time PCR. Results. Although lower cfDNA amounts were obtained by automated DNA extraction (mean 107,35 GE/mL versus 259,43 GE/mL, the SRY sequence was successfully detected in all 108 samples from pregnancies with male fetuses. Conclusion. We successfully evaluated the suitability of standard blood tubes for the collection of maternal blood and assessed samples to be suitable for analysis at least 24 hours later. This would allow shipping to a central reference laboratory almost from anywhere in Europe.

  5. Optimum time of blood sampling for determination of glomerular filtration rate by single-injection [51Cr]EDTA plasma clearance

    International Nuclear Information System (INIS)

    Broechner-Mortensen, J.; Roedbro, P.

    1976-01-01

    We have investigated the influence on reproducibility of total [ 51 Cr]EDTA plasma clearance (E) of various times and numbers of blood samples in patients with normal (13 patients) and low (14 patients) renal function. The study aims at fixing a clinically useful procedure suitable for all levels of renal function. Six different types of E were evaluated with time periods for blood sampling between 3 and 5 h after tracer injection, and the variation from counting radioactivity, s 1 , was determined as part of the total variation, s 2 . Optimum mean time, t(E), for blood sampling was calculated as a function of E, as the mean time giving the least change in E for a given change in the 'final slope' of the plasma curve. For patients with normal E, s 1 did not contribute significantly to s 2 , and t(E) was about 2h. For patients with low renal function s 1 contributed significantly to s 2 , and t(E) increased steeply with decreasing E. The relative error in s 1 from fixed Etypes was calculated for all levels of renal function. The results indicate that blood sampling individualized according to predicted E values is not necessary. A sufficient precision of E can be achieved for all function levels from three blood samples drawn at 180, 240, and 300 min after injection. (Auth.)

  6. Binding of /sup 125/I-labeled endotoxin to bovine, canine, and equine platelets and endotoxin-induced agglutination of canine platelets

    Energy Technology Data Exchange (ETDEWEB)

    Meyers, K.M.; Boehme, M.; Inbar, O.

    1982-10-01

    Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.

  7. Binding of 125I-labeled endotoxin to bovine, canine, and equine platelets and endotoxin-induced agglutination of canine platelets

    International Nuclear Information System (INIS)

    Meyers, K.M.; Boehme, M.; Inbar, O.

    1982-01-01

    Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using 125 I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed

  8. Determination of the pyrethroid insecticide metabolite 3-PBA in plasma and urine samples from farmer and consumer groups in northern Thailand

    Science.gov (United States)

    THIPHOM, SARUNYA; PRAPAMONTOL, TIPPAWAN; CHANTARA, SOMPORN; MANGKLABRUKS, AMPICA; SUPHAVILAI, CHAISUREE; AHN, KI CHANG; GEE, SHIRLEY J.; HAMMOCK, BRUCE D.

    2014-01-01

    In this study, the enzyme-linked immunosorbent assays (ELISA) were modified to detect 3-PBA in plasma (including the adducted form) and urine among a large group of consumers and farmers in an agricultural area. The samples were collected on the same day in the morning from 100 consumers (50 females, 50 males) and 100 farmers (50 females, 50 males) in the Fang district, Chiang Mai province, northern Thailand. The ELISA was very sensitive having an IC50 value of 26.7 and 15.3 ng/mL, a limit of quantitation of 5 and 2.5 ng/mL and a limit of detection of 1.08 and 1.94 ng/mL for plasma and urine, respectively. These methods had low (< 5%) intra- and inter-assay coefficients of variation. The extraction technique satisfactorily eliminated the matrix effect from samples before ELISA analysis, yielding good recoveries (85.9–99.4% and 87.3–98.0%, respectively). For the volunteer study, the detection rate for plasma 3-PBA was 24% in consumers and 42% in farmers, but the median and range values were similar (median 5.87 ng/mL, range 5.16–8.44 ng/mL in consumers and 6.27 ng/mL, range 4.29–9.57 ng/mL in farmers). The rate of detection in the urine was similar (76% and 69%, in consumers and in farmers), yet the median concentration was significantly higher in farmers (8.86 μg/g creatinine in consumers vs 16.1 μg/g creatinine in farmers) and the range also much wider in farmers (1.62–80.5 μg/g creatinine in consumers and 0.80–256.2 μg/g creatinine in farmers). There was no correlation between plasma 3-PBA and urinary 3-PBA concentrations in the study presumably because plasma 3-PBA is a measure of cumulative exposures while urinary 3-PBA reflects acute exposures. In addition, metabolism and excretion of pyrethroids varies by individual. Nevertheless, this study demonstrated that these volunteers were exposed to pyrethroids. To our knowledge, this is the first report that compared plasma 3-PBA and urinary 3-PBA in a large group of volunteers. The ELISA method

  9. Plasma cortisol and noradrenalin concentrations in pigs: automated sampling of freely moving pigs housed in PigTurn versus manually sampled and restrained pigs

    Science.gov (United States)

    Minimizing the effects of restraint and human interaction on the endocrine physiology of animals is essential for collection of accurate physiological measurements. Our objective was to compare stress-induced cortisol (CORT) and noradrenalin (NorA) responses in automated versus manual blood sampling...

  10. Genotyping of Canine parvovirus in western Mexico.

    Science.gov (United States)

    Pedroza-Roldán, César; Páez-Magallan, Varinia; Charles-Niño, Claudia; Elizondo-Quiroga, Darwin; De Cervantes-Mireles, Raúl Leonel; López-Amezcua, Mario Alberto

    2015-01-01

    Canine parvovirus (CPV) is one of the most common infectious agents related to high morbidity rates in dogs. In addition, the virus is associated with severe gastroenteritis, diarrhea, and vomiting, resulting in high death rates, especially in puppies and nonvaccinated dogs. To date, there are 3 variants of the virus (CPV-2a, CPV-2b, and CPV-2c) circulating worldwide. In Mexico, reports describing the viral variants circulating in dog populations are lacking. In response to this deficiency, a total of 41 fecal samples of suspected dogs were collected from October 2013 through April 2014 in the Veterinary Hospital of the University of Guadalajara in western Mexico. From these, 24 samples resulted positive by polymerase chain reaction, and the viral variant was determined by restriction fragment length polymorphism. Five positive diagnosed samples were selected for partial sequencing of the vp2 gene and codon analysis. The results demonstrated that the current dominant viral variant in Mexico is CPV-2c. The current study describes the genotyping of CPV strains, providing valuable evidence of the dominant frequency of this virus in a dog population from western Mexico. © 2014 The Author(s).

  11. Gas chromatography--inductively coupled plasma--time-of-flight mass spectrometry for the speciation analysis of organolead compounds in environmental water samples.

    Science.gov (United States)

    Heisterkamp, M; Adams, F C

    2001-07-01

    The application of inductively coupled plasma--time-of-flight mass spectrometry for the speciation analysis of organolead compounds in environmental waters is described. Construction of the transfer line was achieved by means of a relatively simple and rapid coupling procedure. Derivatization of the ionic lead species was achieved by in-situ propylation with sodium tetrapropylborate; simultaneous extraction of the derivatized compounds in hexane was followed by separation and detection by capillary gas chromatography hyphenated to inductively coupled plasma-time-of-flight mass spectrometry. Detection limits for the different organolead species ranged from 10 to 15 fg (as Pb), corresponding to procedural detection limits between 50 and 75 ng L(-1), on the basis of a 50 mL snow sample, extraction with 200 microL hexane, and subsequent injection of 1 microL of the organic extract on to the column. The accuracy of the system was confirmed by additional analysis of the water samples by capillary gas chromatography coupled with microwave-induced plasma-atomic-emission spectrometry and the analysis of a standard reference material CRM 605 (road dust) with a certified content of trimethyllead.

  12. A micro-fluidic sub-microliter sample introduction system for direct analysis of Chinese rice wine by inductively coupled plasma mass spectrometry using external aqueous calibration

    Science.gov (United States)

    Cheng, Heyong; Liu, Jinhua; Xu, Zigang; Yin, Xuefeng

    2012-07-01

    A microfluidic sub-microliter sample introducing system was developed for direct analysis of Chinese rice wine by inductively coupled plasma mass spectrometry (ICP-MS). It consisted of a microfluidic chip integrating variable-volume sampling channels (0.1-0.8 μL), an eight-way multi-functional valve used in flow injection analysis (FIA), a syringe pump and a peristaltic pump of the Ar ICP-MS instrument. Three solutions, i.e., 15, 40 and 100 g L- 1 glucose in 20% ethanol were used to simulate Chinese rice wine of the dry type, the semidry type and the semisweet type, each. The effects of their volume introduced into ICP-MS on the plasma stability and ICP-MS intensities were studied. The experimental results showed that neither alteration of plasma stability nor carbon deposition was observed when the sampling volume of 20% ethanol containing 100 g L- 1 glucose was downscaled to 0.8 μL. Further reducing the sampling volume to 0.4 μL, no significant difference between the intensities of multi-element standard prepared in three simulated Chinese rice wine matrices and those in aqueous solution was observed. It indicated no negative effect of Chinese rice wine matrix on the ICP-MS intensities. A sampling volume of 0.4 μL was considered to be a good compromise between sensitivity and matrix effect. The flow rate of the carrier was chosen as 20 μL min- 1 for obtaining peaks with the highest peak height within the shortest time. Based on these observations, a microflow injection (μFI) method for the direct determination of cadmium and lead in Chinese rice wine by ICP-MS using an external aqueous calibration was developed. The sample throughput was 45 h- 1 with the detection limit of 19.8 and 10.4 ng L- 1 for Cd and Pb, respectively. The contents of Cd and Pb in 10 Chinese rice wine samples were measured. The results agreed well with those determined by ICP-MS with the conventional sampling system after microwave assisted digestion. The recoveries of three Chinese

  13. Validation of a Commercially Available Enzyme ImmunoAssay for the Determination of Oxytocin in Plasma Samples from Seven Domestic Animal Species.

    Science.gov (United States)

    Bienboire-Frosini, Cecile; Chabaud, Camille; Cozzi, Alessandro; Codecasa, Elisa; Pageat, Patrick

    2017-01-01

    The neurohormone oxytocin (OT) has a broad range of behavioral effects in mammals. It modulates a multitude of social behaviors, e.g., affiliative and sexual interactions. Consequently, the OT role in various animal species is increasingly explored. However, several issues have been raised regarding the peripheral OT measurement. Indeed, various methods have been described, leading to assay discrepancies and inconsistent results. This highlights the need for a recognized and reliable method to measure peripheral OT. Our aim was to validate a method combining a pre-extraction step, previously demonstrated as essential by several authors, and a commercially available enzyme immunoassay (EIA) for OT measurement, using plasma from seven domestic species (cat, dog, horse, cow, pig, sheep, and goat). The Oxytocin EIA kit (EnzoLifeSciences) was used to assay the solid-phase extracted samples following the manufacturer's instructions with slight modifications. For all species except dogs and cats, concentration factors were applied to work above the kit's sensitivity (15 pg/ml). To validate the method, the following performance characteristics were evaluated using Validation Samples (VS) at various concentrations in each species: extraction efficiency via spiking tests and intra- and inter-assay precision, allowing for the calculation of total errors. Parallelism studies to assess matrix effects could not be performed because of too low basal concentrations. Quantification ranges and associated precision profiles were established to account for the various OT plasma concentrations in each species. According to guidelines for bioanalytical validation of immunoassays, the measurements were sufficiently precise and accurate in each species to achieve a total error ≤30% in each VS sample. In each species, the inter-assay precision after 3 runs was acceptable, except in low concentration samples. The linearity under dilution of dogs and cats' samples was verified. Although

  14. Validation of a Commercially Available Enzyme ImmunoAssay for the Determination of Oxytocin in Plasma Samples from Seven Domestic Animal Species

    Directory of Open Access Journals (Sweden)

    Cecile Bienboire-Frosini

    2017-09-01

    Full Text Available The neurohormone oxytocin (OT has a broad range of behavioral effects in mammals. It modulates a multitude of social behaviors, e.g., affiliative and sexual interactions. Consequently, the OT role in various animal species is increasingly explored. However, several issues have been raised regarding the peripheral OT measurement. Indeed, various methods have been described, leading to assay discrepancies and inconsistent results. This highlights the need for a recognized and reliable method to measure peripheral OT. Our aim was to validate a method combining a pre-extraction step, previously demonstrated as essential by several authors, and a commercially available enzyme immunoassay (EIA for OT measurement, using plasma from seven domestic species (cat, dog, horse, cow, pig, sheep, and goat. The Oxytocin EIA kit (EnzoLifeSciences was used to assay the solid-phase extracted samples following the manufacturer's instructions with slight modifications. For all species except dogs and cats, concentration factors were applied to work above the kit's sensitivity (15 pg/ml. To validate the method, the following performance characteristics were evaluated using Validation Samples (VS at various concentrations in each species: extraction efficiency via spiking tests and intra- and inter-assay precision, allowing for the calculation of total errors. Parallelism studies to assess matrix effects could not be performed because of too low basal concentrations. Quantification ranges and associated precision profiles were established to account for the various OT plasma concentrations in each species. According to guidelines for bioanalytical validation of immunoassays, the measurements were sufficiently precise and accurate in each species to achieve a total error ≤30% in each VS sample. In each species, the inter-assay precision after 3 runs was acceptable, except in low concentration samples. The linearity under dilution of dogs and cats' samples was

  15. Determination of Cu, Mn, Ni and Sn in gasoline by electrothermal vaporization inductively coupled plasma mass spectrometry, and emulsion sample introduction

    International Nuclear Information System (INIS)

    Saint'Pierre, Tatiana D.; Dias, Lucia Felicidade; Pozebon, Dirce; Aucelio, Ricardo Q.; Curtius, Adilson J.; Welz, Bernhard

    2002-01-01

    Trace metals in fuels, except in the case of additives, are usually undesirable and normally they occur in very low concentrations in gasoline, requiring sensitive techniques for their determination. Coupling of electrothermal vaporization with inductively coupled plasma mass spectrometry minimizes the problems related to the introduction of organic solvents into the plasma. Furthermore, sample preparation as oil-in-water emulsions reduces problems related to gasoline analysis. In this work, a method for determination of Cu, Mn, Ni and Sn in gasoline is proposed. Samples were prepared by forming a 10-fold diluted emulsion with a surfactant (Triton X-100), after treatment with concentrated HNO 3 . The sample emulsion was pre-concentrated in the graphite tube by repeated pipetting and drying. External calibration was used with aqueous standards in a purified gasoline emulsion. Six samples from different gas stations were analyzed, and the analyte concentrations were found to be in the μg l -1 range or below. The limits of detection were 0.22, 0.02, 0.38 and 0.03 μg l -1 for Cu, Mn, Ni and Sn, respectively. The accuracy of the method was estimated using a recovery test

  16. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies

    OpenAIRE

    J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides

    2002-01-01

    Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...

  17. Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

    1999-08-02

    Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

  18. Determination of trace elements in biological samples treated with formic acid by inductively coupled plasma mass spectrometry using a microconcentric nebulizer

    International Nuclear Information System (INIS)

    Tormen, Luciano; Gil, Raul A.; Frescura, Vera L.A.; Dante Martinez, Luis; Curtius, Adilson J.

    2010-01-01

    A simple and fast method for the determination of As, Ba, Cd, Co, Cu, Fe, Ga, Mn, Mo, Ni, Pb, Rb, Se, Sr, Tl, U, V and Zn in biological samples by inductively coupled plasma mass spectrometry (ICP-MS), after sample solubilization with formic acid and introduction by a microconcentric nebulizer, is proposed. The sample is mixed with formic acid, kept at 90 o C for one hour and then diluted with nitric acid aqueous solution to a 50% v/v formic acid and 1% v/v nitric acid final concentrations. The final sample solution flow rate for introduction into the plasma was 30 μL min -1 . The optimized and adopted nebulizer gas flow rate was 0.7 L min -1 and RF power was 800 W. These conditions are very different than those normally used when a conventional nebulizer is employed. Rodhium was used as internal standard. External calibration against aqueous standard solutions, without formic acid, could be used for quantification, except for As, Se and Zn. However, external calibration with 50% formic acid allows the determination of all analytes with high accuracy and it is recommended. The detection limits were between 0.0005 (Tl) and 0.22 mg kg -1 (Fe) and the precision expressed by the relative standard deviations (RSD) were between 0.2% (Sr) and 3.5% (Ga). Accuracy was validated by the analysis of four certified reference biological materials of animal tissues, comparing the results by linear regressions and by the t-test at a 95% confidence level. The recommended procedure avoids plasma instability and carbon deposit on the cones.

  19. Bioanalysis of a panel of neurotransmitters and their metabolites in plasma samples obtained from pediatric patients with neuroblastoma and Wilms' tumor.

    Science.gov (United States)

    Konieczna, Lucyna; Roszkowska, Anna; Stachowicz-Stencel, Teresa; Synakiewicz, Anna; Bączek, Tomasz

    2018-02-01

    This paper details the quantitative analysis of neurotransmitters, including dopamine (DA), norepinephrine (NE), epinephrine (E), and serotonin (5-HT), along with their respective precursors and metabolites in children with solid tumors: Wilms' tumor (WT) and neuroblastoma (NB). A panel of neurotransmitters was determined with the use of dispersive liquid-liquid microextraction (DLLME) technique combined with liquid-chromatography mass spectrometry (LC-MS/MS) in plasma samples obtained from a group of pediatric subjects with solid tumors and a control group of healthy children. Next, statistical univariate analysis (t-test) and multivariate analysis (Principal Component Analysis) were performed using chromatographic data. The levels of tyrosine (Tyr) and tryptophan (Trp) (the precursors of analyzed neurotransmitters) as well as 3,4-dihydroxyphenylacetic acid (DOPAC) (a product of metabolism of DA) were significantly higher in the plasma samples obtained from pediatric patients with WT than in the samples taken from the control group. Moreover, statistically significant differences were observed between the levels of 5-HT and homovanillic acid (HVA) in the plasma samples from pediatric patients with solid tumors and the control group. However, elevated levels of these analytes did not facilitate a clear distinction between pediatric patients with WT and those with NB. Nonetheless, the application of advanced statistical tools allowed the healthy controls to be differentiated from the pediatric oncological patients. The identification and quantification of a panel of neurotransmitters as potential prognostic factors in selected childhood malignancies may provide clinically relevant information about ongoing metabolic alterations, and it could potentially serve as an adjunctive strategy in the effective diagnosis and treatment of solid tumors in children. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Characterization of the canine urinary proteome.

    Science.gov (United States)

    Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E

    2014-06-01

    Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.

  1. Development of SPME-LC-MS method for screening of eight beta-blockers and bronchodilators in plasma and urine samples.

    Science.gov (United States)

    Goryński, Krzysztof; Kiedrowicz, Alicja; Bojko, Barbara

    2016-08-05

    The current work describes the development and validation of a simple, efficient, and fast method using solid phase microextraction coupled to liquid chromatography-tandem mass spectrometry (SPME-LC-MS/MS) for the concomitant measurement of eight beta-blockers and bronchodilators in plasma and urine. The presented assay enables quantitative determination of acebutolol, atenolol, fenoterol, nadolol, pindolol, procaterol, sotalol, and timolol. In this work, samples were prepared on a high-throughput platform using the 96-well plate format of the thin film solid phase microextraction (TFME) system, and a biocompatible extraction phase made of hydrophilic-lipophilic balance particles. Analytes were separated on a pentafluorophenyl column (100mm×2.1mm, 3μm) by gradient elution using an UPLC Nexera coupled with an LCMS-8060 mass spectrometer. The mobile phase consisted of water-acetonitrile (0.1% formic acid) at a flow rate of 0.4mLmin(-1). The linearity of the method was checked within therapeutic blood-plasma concentrations, and shown to adequately reflect typically expected concentrations of future study samples. Post-extraction addition experiments showed that the matrix effect ranged in plasma from 98% for procaterol to 115% for nadolol, and in urine, from 85% for nadolol and pindolol to 119% for atenolol. The method was successfully validated using Food and Drug Administration (FDA) guidelines, and met all acceptance criteria for bioanalytical assays at five concentration levels for all selected drugs. The final protocol can be successfully applied for monitoring concentrations of the selected drugs in both plasma and urine matrices obtained from patients or athletes. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Particle transport in a He-microchip plasma atomic emission system with an ultrasonic nebulizer for aqueous sample introduction

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Joosuck [Department of Chemistry, Dankook University, 126 Jukjeon-dong, Suji-gu, Yongin-si, Gyeonggi-do, 448-701 (Korea, Republic of); Lim, H.B. [Department of Chemistry, Dankook University, 126 Jukjeon-dong, Suji-gu, Yongin-si, Gyeonggi-do, 448-701 (Korea, Republic of)], E-mail: plasma@dankook.ac.kr

    2008-11-15

    The transport efficiency of dried particles generated from an ultrasonic nebulizer (USN) was studied to improve the analytical performance of a lab-made, He-microchip plasma system, in which a quartz tube ({approx} 1 mm i.d.) was positioned inside the central channel of a poly(dimethylsiloxane) (PDMS) polymer chip. The polymer microchip plasma has the advantages of low cost, small size, easy handling and design, and self-ignition with long stabilization (> 24 h). However, direct introduction of aqueous solution into the microplasma for the detection of metals remains problematic due to plasma instability. In addition, the much smaller size of the system can cause signal suppression due to low transport efficiency. Therefore, knowledge of particle transport efficiency in this microplasma system is required to enhance the sensitivity and stability. The weight of transported particles in the range of 0.02 to 10 mg m{sup -3} was measured using a piezobalance with a precision of 0.4-17.8%, depending on the operating conditions. The significant effects of the USN operating conditions and the physical properties of the tubing, namely, length, inner diameter and surface characteristics, on the number of particles transported from the nebulizer to the microplasma were studied. When selected metals, such as Na, Mg and Pb, at a concentration of 5 mg L{sup -1} were nebulized, transported particles were obtained with a mass range of 0.5-5 mg m{sup -3}, depending on atomic weights. For application of the He-rf-microplasma, the atomic emission system was optimized by changing both the radio frequency (rf) power (60-200 W) and cooling temperature of the USN (- 12-9 deg. C). The limits of detection obtained for K, Na and Cu were 0.26, 0.22, and 0.28 mg L{sup -1}, respectively. These results confirmed the suitable stability and sensitivity of the He-rf-PDMS microchip plasma for application as an atomization source.

  3. Novel system using microliter order sample volume for measuring arterial radioactivity concentrations in whole blood and plasma for mouse PET dynamic study.

    Science.gov (United States)

    Kimura, Yuichi; Seki, Chie; Hashizume, Nobuya; Yamada, Takashi; Wakizaka, Hidekatsu; Nishimoto, Takahiro; Hatano, Kentaro; Kitamura, Keishi; Toyama, Hiroshi; Kanno, Iwao

    2013-11-21

    This study aimed to develop a new system, named CD-Well, for mouse PET dynamic study. CD-Well allows the determination of time-activity curves (TACs) for arterial whole blood and plasma using 2-3 µL of blood per sample; the minute sample size is ideal for studies in small animals. The system has the following merits: (1) measures volume and radioactivity of whole blood and plasma separately; (2) allows measurements at 10 s intervals to capture initial rapid changes in the TAC; and (3) is compact and easy to handle, minimizes blood loss from sampling, and delay and dispersion of the TAC. CD-Well has 36 U-shaped channels. A drop of blood is sampled into the opening of the channel and stored there. After serial sampling is completed, CD-Well is centrifuged and scanned using a flatbed scanner to define the regions of plasma and blood cells. The length measured is converted to volume because the channels have a precise and uniform cross section. Then, CD-Well is exposed to an imaging plate to measure radioactivity. Finally, radioactivity concentrations are computed. We evaluated the performance of CD-Well in in vitro measurement and in vivo (18)F-fluorodeoxyglucose and [(11)C]2-carbomethoxy-3β-(4-fluorophenyl) tropane studies. In in vitro evaluation, per cent differences (mean±SE) from manual measurement were 4.4±3.6% for whole blood and 4.0±3.5% for plasma across the typical range of radioactivity measured in mouse dynamic study. In in vivo studies, reasonable TACs were obtained. The peaks were captured well, and the time courses coincided well with the TAC derived from PET imaging of the heart chamber. The total blood loss was less than 200 µL, which had no physiological effect on the mice. CD-Well demonstrates satisfactory performance, and is useful for mouse PET dynamic study.

  4. Apical root resorption of incisors after orthodontic treatment of impacted maxillary canines: a radiographic study.

    Science.gov (United States)

    Brusveen, Elin Marie Gravdal; Brudvik, Pongsri; Bøe, Olav Egil; Mavragani, Maria

    2012-04-01

    The purpose of the study was to evaluate impacted maxillary canines as risk factor for orthodontic apical root resorption. The sample comprised 66 patients treated with fixed appliances. Thirty-two patients with a unilateral impacted maxillary canine, which was distanced from the roots of the incisors at a preliminary phase of treatment before bonding, formed the impaction group, and 34 patients without impactions served as the controls. Root shortening was calculated by using pretreatment and posttreatment intraoral radiographs. Inclination of the eruption path of the impacted canine relative to the midline, axis of the lateral incisor, and nasal line, root development, and the medial and vertical positions of the impacted tooth were recorded on orthopantomograms and lateral cephalometric films. The follicle/tooth ratio was evaluated by using periapical radiographs. No significant difference in apical resorption of the maxillary incisors was detected between the impaction and control groups, or between the incisors of the impacted and contralateral sides in the same subject. Likewise, no difference in the severity of root resorption was found between the incisors of impacted side alone and the incisors of the control group. Mesial and vertical inclinations of the impacted canines were negatively related to a lateral incisor's root resorption. No correlations were found between resorption and medial or vertical position of the crown of the canine. The follicle/tooth ratio was significantly related to the mesial inclination of the impacted canine, but not to root resorption. An impacted maxillary canine, after being distanced from the incisor roots, does not seem to be a risk factor for apical root resorption during orthodontic treatment. Copyright © 2012 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

  5. Ultrasonic slurry sampling electrothermal vaporization inductively coupled plasma mass spectrometry for the determination of Cr, Fe, Cu, Zn and Se in cereals

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shih-Yi [Department of Chemistry, National Sun Yat-sen University, Kaohsiung 80424, Taiwan (China); Jiang, Shiuh-Jen, E-mail: sjjiang@faculty.nsysu.edu.tw [Department of Chemistry, National Sun Yat-sen University, Kaohsiung 80424, Taiwan (China); Department of Medical Laboratory Science and Biotechnology, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Sahayam, A.C. [National Centre for Compositional Characterisation of Materials (CCCM), Hyderabad (India)

    2014-11-01

    Ultrasonic slurry sampling electrothermal vaporization inductively coupled plasma mass spectrometry (USS-ETV-ICP-MS) has been applied to determine Cr, Fe, Cu, Zn and Se in several cereal samples. Thioacetamide was used as the modifier to enhance the ion signals. The background ions at the masses of interest were reduced in intensity significantly by using 1.0 mL min{sup −1} methane (CH{sub 4}) as reaction cell gas in the dynamic reaction cell (DRC). Since the sensitivities of Cr, Fe, Cu, Zn and Se in different matrices were quite different, standard addition and isotope dilution methods were used for the determination of Cr, Fe, Cu, Zn and Se in these cereal samples. The method detection limits estimated from standard addition curves were about 1, 10, 4, 12 and 2 ng g{sup −1} for Cr, Fe, Cu, Zn and Se, respectively, in original cereal samples. This procedure has been applied to the determination of Cr, Fe, Cu, Zn and Se whose concentrations are in μg g{sup −1} (except Cr and Se) in standard reference materials (SRM) of National institute of standards and technology (NIST), NIST SRM 1568a Rice Flour and NIST SRM 1567a Wheat Flour and two cereal samples purchased from a local market. The analysis results of reference materials agreed with certified values at 95% confidence level according to Student's T-test. The results for the real world cereal samples were also found to be in good agreement with the pneumatic nebulization DRC ICP-MS results of the sample solutions. - Highlights: • Determination of Cr, Fe, Cu, Zn and Se in cereal samples • Ultrasonic slurry sampling in combination with DRC-ICP-MS • Better sensitivity with thioacetamide modifier in ETV • Decreased sample preparation time with solid sampling • Validation with NIST SRM 1568a Rice Flour and NIST SRM 1567a Wheat Flour.

  6. Ultrasonic slurry sampling electrothermal vaporization inductively coupled plasma mass spectrometry for the determination of Cr, Fe, Cu, Zn and Se in cereals

    International Nuclear Information System (INIS)

    Huang, Shih-Yi; Jiang, Shiuh-Jen; Sahayam, A.C.

    2014-01-01

    Ultrasonic slurry sampling electrothermal vaporization inductively coupled plasma mass spectrometry (USS-ETV-ICP-MS) has been applied to determine Cr, Fe, Cu, Zn and Se in several cereal samples. Thioacetamide was used as the modifier to enhance the ion signals. The background ions at the masses of interest were reduced in intensity significantly by using 1.0 mL min −1 methane (CH 4 ) as reaction cell gas in the dynamic reaction cell (DRC). Since the sensitivities of Cr, Fe, Cu, Zn and Se in different matrices were quite different, standard addition and isotope dilution methods were used for the determination of Cr, Fe, Cu, Zn and Se in these cereal samples. The method detection limits estimated from standard addition curves were about 1, 10, 4, 12 and 2 ng g −1 for Cr, Fe, Cu, Zn and Se, respectively, in original cereal samples. This procedure has been applied to the determination of Cr, Fe, Cu, Zn and Se whose concentrations are in μg g −1 (except Cr and Se) in standard reference materials (SRM) of National institute of standards and technology (NIST), NIST SRM 1568a Rice Flour and NIST SRM 1567a Wheat Flour and two cereal samples purchased from a local market. The analysis results of reference materials agreed with certified values at 95% confidence level according to Student's T-test. The results for the real world cereal samples were also found to be in good agreement with the pneumatic nebulization DRC ICP-MS results of the sample solutions. - Highlights: • Determination of Cr, Fe, Cu, Zn and Se in cereal samples • Ultrasonic slurry sampling in combination with DRC-ICP-MS • Better sensitivity with thioacetamide modifier in ETV • Decreased sample preparation time with solid sampling • Validation with NIST SRM 1568a Rice Flour and NIST SRM 1567a Wheat Flour

  7. Simplified sample preparation in the simultaneous measurement of whole blood antimony, bismuth, manganese, and zinc by inductively coupled plasma mass spectrometry.

    Science.gov (United States)

    Haglock-Adler, Carrie J; Strathmann, Frederick G

    2015-02-01

    We developed and validated a simplified sample preparation for the analysis of antimony (Sb), bismuth (Bi), manganese (Mn), and zinc (Zn) in whole blood. This simplification included a reduction in sample volume, removal of a lengthy acidic digestion, and optimization of the internal standard. Measurement of Sb, Bi, Mn and Zn in whole blood was conducted using inductively coupled-plasma mass spectrometry. Method performance characteristics, including intra- and inter-assay imprecision, accuracy, linearity, AMR, sensitivity, carryover, sample stability and assay stability were determined in accordance with clinical laboratory standards. In addition, analytical and clinical recoveries were assessed to investigate comparability between goat blood matrix and pooled patient blood. Established assay performance characteristics included inter- and intra-assay imprecision samples, proficiency testing samples, and comparison to an outside reference laboratory. This method overcomes the laborious acidic heat digestion previously used and replaces it with a simplified sample preparation involving an alkaline dilution. The method requires minimal sample preparation with the dilution of alkaline diluent and is validated to quantify Sb and Bi from 1 to 25 μg/L, Mn from 1 to 80 μg/L, and Zn from 50 to 1500 μg/dL in whole blood. Copyright © 2014 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  8. Direct determination of cadmium in foods by solid sampling electrothermal vaporization inductively coupled plasma mass spectrometry using a tungsten coil trap

    Science.gov (United States)

    Zhang, Ying; Mao, Xuefei; Liu, Jixin; Wang, Min; Qian, Yongzhong; Gao, Chengling; Qi, Yuehan

    2016-04-01

    In this work, a solid sampling device consisting of a tungsten coil trap, porous carbon vaporizer and on-line ashing furnace of a Ni-Cr coil was interfaced with inductively coupled plasma mass spectrometry (ICP-MS). A modified double gas circuit system was employed that was composed of carrier and supplemental gas lines controlled by separate gas mass flow controllers. For Cd determination in food samples using the assembled solid sampling ICP-MS, the optimal ashing and vaporization conditions, flow rate of the argon-hydrogen (Ar/H2) (v:v = 24:1) carrier gas and supplemental gas, and minimum sampling mass were investigated. Under the optimized conditions, the limit of quantification was 0.5 pg and the relative standard deviation was within a 10.0% error range (n = 10). Furthermore, the mean spiked recoveries for various food samples were 99.4%-105.9% (n = 6). The Cd concentrations measured by the proposed method were all within the certified values of the reference materials or were not significantly different (P > 0.05) from those of the microwave digestion ICP-MS method, demonstrating the good accuracy and precision of the solid sampling ICP-MS method for Cd determination in food samples.

  9. Determination of uranium isotopic composition and 236U content of soil samples and hot particles using inductively coupled plasma mass spectrometry.

    Science.gov (United States)

    Boulyga, S F; Becker, J S

    2001-07-01

    As a result of the accident at the Chernobyl nuclear power plant (NPP) the environment was contaminated with spent nuclear fuel. The 236U isotope was used in this study to monitor the spent uranium from nuclear fallout in soil samples collected in the vicinity of the Chernobyl NPP. Nuclear track radiography was applied for the identification and extraction of hot radioactive particles from soil samples. A rapid and sensitive analytical procedure was developed for uranium isotopic ratio measurement in environmental samples based on double-focusing inductively coupled plasma mass spectrometry (DF-ICP-MS) with a MicroMist nebulizer and a direct injection high-efficiency nebulizer (DIHEN). The performance of the DF-ICP-MS with a quartz DIHEN and plasma shielded torch was studied. Overall detection efficiencies of 4 x 10(-4) and 10(-3) counts per atom were achieved for 238U in DF-ICP-QMS with the MicroMist nebulizer and DIHEN, respectively. The rate of formation of uranium hydride ions UH+/U+ was 1.2 x 10(-4) and 1.4 x 10(-4), respectively. The precision of short-term measurements of uranium isotopic ratios (n = 5) in 1 microg L(-1) NBS U-020 standard solution was 0.11% (238U/235U) and 1.4% (236U/238U) using a MicroMist nebulizer and 0.25% (235U/238U) and 1.9% (236U/P38U) using a DIHEN. The isotopic composition of all investigated Chernobyl soil samples differed from those of natural uranium; i.e. in these samples the 236U/238U ratio ranged from 10(-5) to 10(-3). Results obtained with ICP-MS, alpha- and gamma-spectrometry showed differences in the migration properties of spent uranium, plutonium, and americium. The isotopic ratio of uranium was also measured in hot particles extracted from soil samples.

  10. Determination of uranium isotopic composition and 236U content of soil samples and hot particles using inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Boulyga, S.F.; Becker, J.S.

    2001-01-01

    As a result of the accident at the Chernobyl nuclear power plant (NPP) the environment was contaminated with spent nuclear fuel. The 236 U isotope was used in this study to monitor the spent uranium from nuclear fallout in soil samples collected in the vicinity of the Chernobyl NPP. Nuclear track radiography was applied for the identification and extraction of hot radioactive particles from soil samples. A rapid and sensitive analytical procedure was developed for uranium isotopic ratio measurement in environmental samples based on double-focusing inductively coupled plasma mass spectrometry (DF-ICP-MS) with a MicroMist nebulizer and a direct injection high-efficiency nebulizer (DIHEN). The performance of the DF-ICP-MS with a quartz DIHEN and plasma shielded torch was studied. Overall detection efficiencies of 4 x 10 -4 and 10 -3 counts per atom were achieved for 238 U in DF-ICP-QMS with the MicroMist nebulizer and DIHEN, respectively. The rate of formation of uranium hydride ions UH + /U + was 1.2 x 10 -4 and 1.4 x 10 -4 , respectively. The precision of short-term measurements of uranium isotopic ratios (n = 5) in 1 μg L -1 NBS U-020 standard solution was 0.11% ( 238 U/ 235 U) and 1.4% ( 236 U/ 238 U) using a MicroMist nebulizer and 0.25% ( 235 U/ 238 U) and 1.9% ( 236 U/ 238 U) using a DIHEN. The isotopic composition of all investigated Chernobyl soil samples differed from those of natural uranium; i.e. in these samples the 236 U/ 238 U ratio ranged from 10 -5 to 10 -3 . Results obtained with ICP-MS, α- and γ-spectrometry showed differences in the migration properties of spent uranium, plutonium, and americium. The isotopic ratio of uranium was also measured in hot particles extracted from soil samples. (orig.)

  11. Calibration-free quantitative elemental analysis of meteor plasma using reference laser-induced breakdown spectroscopy of meteorite samples

    Science.gov (United States)

    Ferus, Martin; Koukal, Jakub; Lenža, Libor; Srba, Jiří; Kubelík, Petr; Laitl, Vojtěch; Zanozina, Ekaterina M.; Váňa, Pavel; Kaiserová, Tereza; Knížek, Antonín; Rimmer, Paul; Chatzitheodoridis, Elias; Civiš, Svatopluk

    2018-03-01

    Aims: We aim to analyse real-time Perseid and Leonid meteor spectra using a novel calibration-free (CF) method, which is usually applied in the laboratory for laser-induced breakdown spectroscopic (LIBS) chemical analysis. Methods: Reference laser ablation spectra of specimens of chondritic meteorites were measured in situ simultaneously with a high-resolution laboratory echelle spectrograph and a spectral camera for meteor observation. Laboratory data were subsequently evaluated via the CF method and compared with real meteor emission spectra. Additionally, spectral features related to airglow plasma were compared with the spectra of laser-induced breakdown and electric discharge in the air. Results: We show that this method can be applied in the evaluation of meteor spectral data observed in real time. Specifically, CF analysis can be used to determine the chemical composition of meteor plasma, which, in the case of the Perseid and Leonid meteors analysed in this study, corresponds to that of the C-group of chondrites.

  12. Effects of Carbenoxolone on the Canine Pituitary-Adrenal Axis.

    Science.gov (United States)

    Teshima, Takahiro; Matsumoto, Hirotaka; Okusa, Tomoko; Nakamura, Yumi; Koyama, Hidekazu

    2015-01-01

    Cushing's disease caused by pituitary corticotroph adenoma is a common endocrine disease in dogs. A characteristic biochemical feature of corticotroph adenomas is their relative resistance to suppressive negative feedback by glucocorticoids. The abnormal expression of 11beta-hydroxysteroid dehydrogenase (11HSD), which is a cortisol metabolic enzyme, is found in human and murine corticotroph adenomas. Our recent studies demonstrated that canine corticotroph adenomas also have abnormal expression of 11HSD. 11HSD has two isoforms in dogs, 11HSD type1 (HSD11B1), which converts cortisone into active cortisol, and 11HSD type2 (HSD11B2), which converts cortisol into inactive cortisone. It has been suggested that glucocorticoid resistance in corticotroph tumors is related to the overexpression of HSD11B2. Therefore it was our aim to investigate the effects of carbenoxolone (CBX), an 11HSD inhibitor, on the healthy dog's pituitary-adrenal axis. Dogs were administered 50 mg/kg of CBX twice each day for 15 days. During CBX administration, no adverse effects were observed in any dogs. The plasma adrenocorticotropic hormone (ACTH), and serum cortisol and cortisone concentrations were significantly lower at day 7 and 15 following corticotropin releasing hormone stimulation. After completion of CBX administration, the HSD11B1 mRNA expression was higher, and HSD11B2 mRNA expression was significantly lower in the pituitaries. Moreover, proopiomelanocortin mRNA expression was lower, and the ratio of ACTH-positive cells in the anterior pituitary was also significantly lower after CBX treatment. In adrenal glands treated with CBX, HSD11B1 and HSD11B2 mRNA expression were both lower compared to normal canine adrenal glands. The results of this study suggested that CBX inhibits ACTH secretion from pituitary due to altered 11HSD expressions, and is potentially useful for the treatment of canine Cushing's disease.

  13. Plasma creatinine in dogs: intra- and inter-laboratory variation in 10 European veterinary laboratories

    Directory of Open Access Journals (Sweden)

    Ulleberg Thomas

    2011-04-01

    Full Text Available Abstract Background There is substantial variation in reported reference intervals for canine plasma creatinine among veterinary laboratories, thereby influencing the clinical assessment of analytical results. The aims of the study was to determine the inter- and intra-laboratory variation in plasma creatinine among 10 veterinary laboratories, and to compare results from each laboratory with the upper limit of its reference interval. Methods Samples were collected from 10 healthy dogs, 10 dogs with expected intermediate plasma creatinine concentrations, and 10 dogs with azotemia. Overlap was observed for the first two groups. The 30 samples were divided into 3 batches and shipped in random order by postal delivery for plasma creatinine determination. Statistical testing was performed in accordance with ISO standard methodology. Results Inter- and intra-laboratory variation was clinically acceptable as plasma creatinine values for most samples were usually of the same magnitude. A few extreme outliers caused three laboratories to fail statistical testing for consistency. Laboratory sample means above or below the overall sample mean, did not unequivocally reflect high or low reference intervals in that laboratory. Conclusions In spite of close analytical results, further standardization among laboratories is warranted. The discrepant reference intervals seem to largely reflect different populations used in establishing the reference intervals, rather than analytical variation due to different laboratory methods.

  14. Plasma chromatography

    International Nuclear Information System (INIS)

    Anon.

    1984-01-01

    This book examines the fundamental theory and various applications of ion mobility spectroscopy. Plasma chromatography developed from research on the diffusion and mobility of ions. Topics considered include instrument design and description (e.g., performance, spectral interpretation, sample handling, mass spectrometry), the role of ion mobility in plasma chromatography (e.g., kinetic theory of ion transport), atmospheric pressure ionization (e.g., rate equations), the characterization of isomers by plasma chromatography (e.g., molecular ion characteristics, polynuclear aromatics), plasma chromatography as a gas chromatographic detection method (e.g., qualitative analysis, continuous mobility monitoring, quantitative analysis), the analysis of toxic vapors by plasma chromatography (e.g., plasma chromatograph calibration, instrument control and data processing), the analysis of semiconductor devices and microelectronic packages by plasma chromatography/mass spectroscopy (e.g., analysis of organic surface contaminants, analysis of water in sealed electronic packages), and instrument design and automation (hardware, software)

  15. Development of novel and sensitive methods for the determination of sulfide in aqueous samples by hydrogen sulfide generation-inductively coupled plasma-atomic emission spectroscopy.

    Science.gov (United States)

    Colon, M; Todolí, J L; Hidalgo, M; Iglesias, M

    2008-02-25

    Two new, simple and accurate methods for the determination of sulfide (S(2-)) at low levels (microgL(-1)) in aqueous samples were developed. The generation of hydrogen sulfide (H(2)S) took place in a coil where sulfide reacted with hydrochloric acid. The resulting H(2)S was then introduced as a vapor into an inductively coupled plasma-atomic emission spectrometer (ICP-AES) and sulfur emission intensity was measured at 180.669nm. In comparison to when aqueous sulfide was introduced, the introduction of sulfur as H(2)S enhanced the sulfur signal emission. By setting a gas separator at the end of the reaction coil, reduced sulfur species in the form of H(2)S were removed from the water matrix, thus, interferences could be avoided. Alternatively, the gas separator was replaced by a nebulizer/spray chamber combination to introduce the sample matrix and reagents into the plasma. This methodology allowed the determination of both sulfide and sulfate in aqueous samples. For both methods the linear response was found to range from 5microgL(-1) to 25mgL(-1) of sulfide. Detection limits of 5microgL(-1) and 6microgL(-1) were obtained with and without the gas separator, respectively. These new methods were evaluated by comparison to the standard potentiometric method and were successfully applied to the analysis of reduced sulfur species in environmental waters.

  16. Plasma emission induced by an Nd-YAG laser at low pressure on solid organic sample, its mechanism, and analytical application

    International Nuclear Information System (INIS)

    Suliyanti, Maria Margaretha; Sardy, Sar; Kusnowo, Anung; Hedwig, Rinda; Abdulmadjid, Syahrun Nur; Kurniawan, Koo Hendrik; Lie, T.J.; Pardede, Marincan; Kagawa, Kiichiro; Tjia, M.O.

    2005-01-01

    An Nd-YAG laser (1064 nm, 120 mJ, 8 ns) was focused on various types of solid organic samples such as a black acrylic plate, a black polyvinyl chloride plastic sheet, and a methoxy polyaniline film coated on the surface of a glass substrate, under a surrounding air pressure of 2 Torr. A modulated plasma technique was used to study the mechanism of excitation of the emission of the organic material. As a result, we conclude that ablated atoms and molecules are excited by a shock-wave mechanism, similar to the case of hard samples such as metal. The ablation speed of hydrogen emission (H I 656.2 nm) was examined and the results show that the release speed of the ablated atoms is relatively low (less than Mach 10) and persists for a longer period of time (around 1 μs); this phenomenon can be understood by assuming that the soft target absorbs recoil energy, causing a low release speed of ablated atoms which would form the shock wave. This was overcome by placing a subtarget on the back of the soft sample so as to enhance the repelling force, thus increasing the release speed of the atoms. A possible application of the low-pressure plasma on an organic solid was demonstrated in the detection of chlorine in a black polyvinyl chloride plastic sheet

  17. Multielement detection limits and sample nebulization efficiencies of an improved ultrasonic nebulizer and a conventional pneumatic nebulizer in inductively coupled plasma-atomic emission spectrometry

    International Nuclear Information System (INIS)

    Olson, K.W.; Haas, W.J. Jr.; Fassel, V.A.

    1977-01-01

    Two important aspects of the analytical performance of a newly developed ultrasonic nebulizer and a specially designed pneumatic nebulizer have been compared for use in inductively coupled plasma--atomic emission spectroscopy (ICP-AES). The ultrasonic nebulizer, when combined with a conventional aerosol desolvation apparatus, provided an order of magnitude or more improvement in simultaneous multielement detection limits as compared to those obtained when the pneumatic nebulizer was used either with or without desolvation. Application of a novel method for direct measurement of the overall efficiency of nebulization to the two systems showed that an approximately tenfold greater rate of sample delivery to the plasma torch was primarily responsible for the superior detection limits afforded by the ultrasonic nebulizer. A unique feature of the ultrasonic nebulizer described is the protection against chemical attack which is achieved by completely enclosing the transducer in an acoustically coupled borosilicate glass cylinder. Direct sample introduction, convenient sample change, and rapid cleanout are other important characteristics of the system which make it an attractive alternate to pneumatic nebulizer systems

  18. A column switching ultrahigh-performance liquid chromatography-tandem mass spectrometry method to determine anandamide and 2-arachidonoylglycerol in plasma samples.

    Science.gov (United States)

    Marchioni, Camila; de Souza, Israel Donizeti; Grecco, Caroline Fernandes; Crippa, José Alexandre; Tumas, Vitor; Queiroz, Maria Eugênia Costa

    2017-05-01

    This study reports a fast, sensitive, and selective column switching ultrahigh-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) method to determine the endocannabinoids (eCBs), anandamide (AEA), and 2-arachidonoylglycerol (2-AG) in plasma samples. This bidimensional system used a restricted access media column (RP-8 ADS, 25 mm × 4 mm × 25 μM) in the first dimension and a core-shell Kinetex C18 (100 mm × 2, 1.7 mm × 1 μM) column in the second dimension, followed by detection in a mass spectrometer triple quadrupole (multiple reactions monitoring mode) operating in the positive mode. RP-8 ADS was used for trace enrichment of eCBs (reverse phase partitioning) and macromolecular matrix size exclusion; the core-shell column was used for the chromatographic separation. The column switching UHPLC-MS/MS method presented a linear range spanning from 0.1 ng mL -1 (LOQ) to 6 ng mL -1 for AEA and from 0.04 ng mL -1 (LOQ) to 10 ng mL -1 for 2-AG. Excluding the LLOQ values, the precision assays provided coefficients of variation lower than 8% and accuracy with relative standard error values lower than 14%. Neither carryover nor matrix effects were detected. This high-throughput column switching method compared to conventional methods is time saving as it involves fewer steps, consumes less solvent, and presents lower LLOQ. The column switching UHPLC-MS/MS method was successfully applied to determine AEA and 2-AG in plasma samples obtained from Alzheimer's disease patients. Graphical abstract A column switching ultra high-performance liquid chromatography-tandem mass spectrometry method using RP-8 ADS column and core shell column to determine endocannabinoids in plasma samples.

  19. High Throughput qPCR Expression Profiling of Circulating MicroRNAs Reveals Minimal Sex- and Sample Timing-Related Variation in Plasma of Healthy Volunteers.

    Directory of Open Access Journals (Sweden)

    Catherine Mooney

    Full Text Available MicroRNAs are a class of small non-coding RNA that regulate gene expression at a post-transcriptional level. MicroRNAs have been identified in various body fluids under normal conditions and their stability as well as their dysregulation in disease opens up a new field for biomarker study. However, diurnal and day-to-day variation in plasma microRNA levels, and differential regulation between males and females, may affect biomarker stability. A QuantStudio 12K Flex Real-Time PCR System was used to profile plasma microRNA levels using OpenArray in male and female healthy volunteers, in the morning and afternoon, and at four time points over a one month period. Using this system we were able to run four OpenArray plates in a single run, the equivalent of 32 traditional 384-well qPCR plates or 12,000 data points. Up to 754 microRNAs can be identified in a single plasma sample in under two hours. 108 individual microRNAs were identified in at least 80% of all our samples which compares favourably with other reports of microRNA profiles in serum or plasma in healthy adults. Many of these microRNAs, including miR-16-5p, miR-17-5p, miR-19a-3p, miR-24-3p, miR-30c-5p, miR-191-5p, miR-223-3p and miR-451a are highly expressed and consistent with previous studies using other platforms. Overall, microRNA levels were very consistent between individuals, males and females, and time points and we did not detect significant differences in levels of microRNAs. These results suggest the suitability of this platform for microRNA profiling and biomarker discovery and suggest minimal confounding influence of sex or sample timing. However, the platform has not been subjected to rigorous validation which must be demonstrated in future biomarker studies where large differences may exist between disease and control samples.

  20. Evaluation of a centrifuge with rapid turnaround time for the preparation of plasma samples for measurement of common STAT markers on the ACS: 180 system.

    Science.gov (United States)

    Foster, K; Datta, P; Orswell, M; Tasaico, K; Alpert, A; Bluestein, B

    2000-01-01

    Reported is the evaluation of a new centrifugation method, Statspin, that addresses both time and sample separation integrity. The method can successfully separate the plasma fraction from the cellular material in 2 minutes as compared to 20 minutes for the conventional centrifuge method. The Statspin, combined with the ACS:180 system, can generate test results in less than 30 minutes, exclusive of transport to the laboratory. This study demonstrated that the combined technologies offer timing-saving improvements for clinical laboratories offering STAT immunoassays for cardiac markers, endocrine molecules, and therapeutic drugs.

  1. Analysis of Rare Earth Elements in Geologic Samples using Inductively Coupled Plasma Mass Spectrometry; US DOE Topical Report - DOE/NETL-2016/1794

    Energy Technology Data Exchange (ETDEWEB)

    Bank, Tracy L. [AECOM, Pittsburgh, PA (United States); Roth, Elliot A. [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United States); Tinker, Phillip [AECOM, Pittsburgh, PA (United States); Granite, Evan [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United States)

    2016-04-17

    Inductively Coupled Plasma Mass Spectrometry (ICP-MS) is used to measure the concentrations of rare earth elements (REE) in certified standard reference materials including shale and coal. The instrument used in this study is a Perkin Elmer Nexion 300D ICP-MS. The goal of the study is to identify sample preparation and operating conditions that optimized recovery of each element of concern. Additionally, the precision and accuracy of the technique are summarized and the drawbacks and limitations of the method are outlined.

  2. Simple protein precipitation extraction technique followed by validated chromatographic method for linezolid analysis in real human plasma samples to study its pharmacokinetics.

    Science.gov (United States)

    Mohammed, Samah A; Eissa, Maya S; Ahmed, Hytham M

    2017-02-01

    Fast and sensitive HPLC method was developed, optimized and validated for quantification of linezolid (LNZ) in human plasma using guaifenesin as an internal standard (IS). Analyte and IS were extracted from plasma by simple protein precipitation extraction technique using methanol as the precipitating solvent. The pretreated samples were injected in a mobile phase formed of acetonitrile:water:methanol (20:70:10v/v/v) in an isocratic mode at a flow rate of 1.5mL/min with UV detection at 251nm. Separation was done using Aglient ODS C 18 . The method showed linearity in the range of 0.75-50μg/mL with correlation coefficients equals to 0.9991. Precision and accuracy were in conformity with the criteria normally accepted in bio-analytical method validation. The RSDs for intra- and inter-day assays were <3.56 and 4.63%, respectively. The intra- and inter-day accuracies were 94.67-98.28% and 91.25-96.18%, respectively. The mean absolute recoveries ranged from 92.56±1.78 to 95.24±2.84. According to stability results, LNZ was stable in human plasma during the storage and analysis. LNZ a pharmacokinetic behavior was studied by applying the proposed analytical method. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Polymerase spiral reaction (PSR): a novel, visual isothermal amplification method for detection of canine parvovirus 2 genomic DNA.

    Science.gov (United States)

    Gupta, Vikas; Chakravarti, Soumendu; Chander, Vishal; Majumder, Saurabh; Bhat, Shabir Ahmad; Gupta, Vivek Kumar; Nandi, Sukdeb

    2017-07-01

    Canine parvovirus-2 (CPV-2), which is ubiquitously distributed worldwide, causes severe and often fatal gastroenteritis in dogs. Accurate, differential and rapid diagnosis of canine parvoviral enteritis remains a challenge for clinicians. A recently developed isothermal amplification technique, polymerase spiral reaction (PSR), was optimized for the first time for a viral pathogen with reference recombinant plasmid standards from different CPV-2 antigenic variants (CPV-2, CPV-2a, CPV-2b and CPV-2c) and subsequently validated using clinical samples. Addition of chromogenic substrate SYBR Green I after the completion of the reaction resulted in bright green fluorescence in positive samples, while negative samples and a no-template control remained orange. These results were further substantiated through visualization of a laddering pattern of the PSR-amplified product in an agarose gel in positive cases and the absence of this pattern in no-template control and negative samples. The PSR assay was found to be highly specific, as it did not react with other putative canine pathogens (canine adenovirus 1 and canine distemper virus). The sensitivity of the newly developed PSR technique was compared with that of conventional PCR, real-time PCR and LAMP, using a serial tenfold dilution of canine parvovirus DNA. The detection limit of PSR was found to be at the femtogram level, which is comparable with that of real-time PCR and LAMP, which are ten times more sensitive than conventional PCR. The assay was validated using 90 clinical samples, of which 54 were found positive, while only 45 samples were positive in conventional PCR. This novel assay, which is fully compliant with the 'ASSURED' concept for disease diagnosis, provides a simple, rapid, specific, sensitive and cost-effective method for diagnosis of canine parvoviral enteritis in veterinary clinics.

  4. Extrusion processing : effects on dry canine diets

    NARCIS (Netherlands)

    Tran, Q.D.

    2008-01-01

    Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying.

    Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the

  5. Calibration-free quantitative elemental analysis of meteor plasma using reference laser-induced breakdown spectroscopy of meteorite samples

    Czech Academy of Sciences Publication Activity Database

    Ferus, Martin; Koukal, J.; Lenža, Libor; Srba, J.; Kubelík, Petr; Laitl, V.; Zanozina, Ekaterina M.; Váňa, Pavel; Kaiserová, Tereza; Knížek, Antonín; Rimmer, P.; Chatzitheodoridis, E.; Civiš, Svatopluk

    2017-01-01

    Roč. 2017, DEC 2017 (2017), č. článku 29950. E-ISSN 1432-0746 R&D Projects: GA ČR(CZ) GA14-12010S; GA ČR(CZ) GA18-27653S Grant - others:Akademie věd - GA AV ČR(CZ) R200401521; Akademie věd - GA AV ČR(CZ) R200401721; COST(XE) CM1104; COST(XE) TD1308; RFBR(RU) 16-32-00034 Institutional support: RVO:61388955 Keywords : astrochemistry * spectroscopic techniques * calibration-free LIBS * plasma simulation Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.014, year: 2016

  6. Development of new applications of inductively coupled plasma mass spectrometry (ICP-MS) hyphenated with different sample introduction systems

    OpenAIRE

    Ugarte Baztán, Ana

    2014-01-01

    225 p. : il. Texto en español con conclusiones en inglés Hoy en día, la espectrometría de masas con plasma de acoplamiento inductivo (ICP-MS) es una de las técnicas más potentes y versátiles para el análisis de elementos traza dada su robustez y bajos límites de detección. En el presente trabajo se pretende ampliar el abanico de aplicaciones de esta técnica desarrollando nuevas combinaciones de la misma a distintos sistemas de introducción de muestra. En primera lugar, se presenta el a...

  7. Laser sampling

    International Nuclear Information System (INIS)

    Gorbatenko, A A; Revina, E I

    2015-01-01

    The review is devoted to the major advances in laser sampling. The advantages and drawbacks of the technique are considered. Specific features of combinations of laser sampling with various instrumental analytical methods, primarily inductively coupled plasma mass spectrometry, are discussed. Examples of practical implementation of hybrid methods involving laser sampling as well as corresponding analytical characteristics are presented. The bibliography includes 78 references

  8. Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.

    Science.gov (United States)

    Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D

    2000-12-01

    To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.

  9. The possibilities of atmospheric plasma-spraying application to obtain hydroxyapatite coatings on the stainless steel samples

    Directory of Open Access Journals (Sweden)

    Mihailović Marija D.

    2013-01-01

    Full Text Available For decades, the standard metallic materials for hip implants, besides the 316LVM stainless steel, were titanium- and cobalt/chromium-based alloys. Although bioinert, due to their corrosion resistance, they are not biocompatible. Contemporary surgical implants are not made just of bioinert metal anymore, but with deposited bioactive hydroxyapatite (HAp coating. Hydroxyapatite is chemically identical with the mineral constituent of bones and teeth, what besides its biocompatibility provides bioactivity as well. The HAp limitations are, however, weak tensile strength and low fatigue resistance for long term loadings, if used alone. This is the reason for HAp to be deposited onto the surgical implant, and to enable its bioactivity, what means intergrowth with bones, and therefore the long-lasting and mechanical stable non-cemented prosthesis. This is important predominantly because the need for such prostheses for younger population, and a better life quality. There are several contemporary techniques that have been used for deposition of these coatings onto the metal implant. The possibilities of atmospheric plasma-spraying for obtaining the stable HAp coatings on the 316LVM stainless steel, ordinary used as a standard material for hip implants production are presented in this paper. The coatings of a commercially available hydroxyapatite powder were plasma-sprayed onto the specimens of medical grade 316LVM stainless steel under various operating conditions. The optical microscopy was used for microstructure and porosity characterization, while coating morphology and Ca/P ratio were analyzed using SEM equipped with EDX. Coating microstructure varied from a porous to a glassy structure, depending on operating conditions applied and coating thickness. Coating porosity was determined to be at the lower required limit requested for the bone-coating intergrowth possibility, but nevertheless adhesion measurements showed good results. The Ca/P ratio was

  10. Quantitative determination of polysulfide in albumins, plasma proteins and biological fluid samples using a novel combined assays approach.

    Science.gov (United States)

    Ikeda, Mayumi; Ishima, Yu; Shibata, Akitomo; Chuang, Victor T G; Sawa, Tomohiro; Ihara, Hideshi; Watanabe, Hiroshi; Xian, Ming; Ouchi, Yuya; Shimizu, Taro; Ando, Hidenori; Ukawa, Masami; Ishida, Tatsuhiro; Akaike, Takaaki; Otagiri, Masaki; Maruyama, Toru

    2017-05-29

    Hydrogen sulfide (H 2 S) signaling involves polysulfide (RSS n SR') formation on various proteins. However, the current lack of sensitive polysulfide detection assays poses methodological challenges for understanding sulfane sulfur homeostasis and signaling. We developed a novel combined assay by modifying Sulfide Antioxidant Buffer (SAOB) to produce an "Elimination Method of Sulfide from Polysulfide" (EMSP) treatment solution that liberates sulfide, followed with methylene blue (MB) sulfide detection assay. The combined EMSP-MB sulfide detection assay performed on low molecular weight sulfur species showed that sulfide was produced from trisulfide compounds such as glutathione trisulfide and diallyl trisulfide, but not from the thiol compounds such as cysteine, cystine and glutathione. In the case of plasma proteins, this novel combined detection assay revealed that approximately 14.7, 1.7, 3.9, 3.7 sulfide mol/mol released from human serum albumin, α 1 -anti-trypsin, α 1 -acid glycoprotein and ovalbumin, respectively, suggesting that serum albumin is a major pool of polysulfide in human blood circulation. Taken together with the results of albumins of different species, the liberated sulfide has a good correlation with cysteine instead of methionine, indicating the site of incorporation of polysulfide is cysteine. With this novel sulfide detention assay, approximately 8,000, 120 and 1100 μM of polysulfide concentrations was quantitated in human healthy plasma, saliva and tear, respectively. Our promising polysulfide specific detection assay can be a very important tool because quantitative determination of polysulfide sheds light on the functional consequence of protein-bound cysteine polysulfide and expands the research area of reactive oxygen to reactive polysulfide species. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Determination of Acyclovir in Human Plasma Samples by HPLC Method with UV Detection: Application to Single-Dose Pharmacokinetic Study

    Directory of Open Access Journals (Sweden)

    Dragica Zendelovska

    2015-03-01

    CONCLUSION: Good precision, accuracy, simplicity, sensitivity and shorter time of analysis of the method makes it particularly useful for processing of multiple samples in a limited period of time for pharmacokinetic study of acyclovir.

  12. The effect of buccal corticotomy on accelerating orthodontic tooth movement of maxillary canine

    Science.gov (United States)

    Jahanbakhshi, Mohammad Reza; Motamedi, Ali Mohammad Kalantar; Feizbakhsh, Masoud; Mogharehabed, Ahmad

    2016-01-01

    Background: Selective alveolar corticotomy is defined as an intentional injury to cortical bone. This technique is an effective means of accelerating orthodontic tooth movement. The aim of this study is to evaluate the effect of buccal corticotomy in accelerating maxillary canine retraction. Materials and Methods: The sample in this clinical trial study consisted of 15 adult female patients with therapeutic need for extraction of maxillary first premolars and maximum canine retraction. By use of split-mouth design, at the time of premolars extraction, buccal corticotomy was performed around the maxillary first premolar, randomly on one side of maxilla, and the other side was reserved as the control side. Canine retraction was performed by use of friction – less mechanic with simple vertical loop. Every 2 weeks, distance between canines and second premolars was measured until complete space closure. The velocity of space closure was calculated to evaluate the effect of this technique in accelerating orthodontic tooth movement. The obtained data were statistically analyzed using independent t-test, and the significance was set at 0.05. Results: The rate of canine retraction was significantly higher on the corticotomy side than the control side by an average of 1.8 mm/month versus 1.1 mm/month in the corticotomy side and control side, respectively (P orthodontic tooth movement about two times faster than conventional orthodontics and it is significant in early stages after surgical porsedure. Therefore Buccal corticotomy is a useful adjunct technique for accelerating orthodontic tooth movement. PMID:27605986

  13. Panoramic radiological study to identify locally displaced maxillary canines in Bangladeshi population

    International Nuclear Information System (INIS)

    Alif, Sheikh Mohammad; Haque, Sejuty; Nimmi, Naima; Ashraf, Ali; Khan, Saeed Hossain; Khan, Mahfujul Haq

    2011-01-01

    This study was performed to determine the prevalence of maxillary canine impaction on a basis of a single panoramic radiograph in Bangladeshi population. A random sample of seven hundred panoramic radiographs was collected from the patient record of a dental clinic. All the selected panoramic radiographs were taken from January 2009 to August 2010 by a single panoramic radiograph machine with the same exposure time (19 seconds) for all radiographs. One hundred and twenty panoramic radiographs were excluded to minimize the selection bias. In a dim lit room, an observer assessed the radiographs on a standard radiographic light box. The position of the impacted maxillary canine was recorded in line with the longitudinal axis of a tooth using the edge of a metal ruler. Data were subsequently put on SPSS 11.5 software and chi-square (x 2 ) tests were applied to find out the association. Among 580 panoramic radiographs it was found that impacted maxillary canines were present in only 7 (1.2%) radiographs. A statistical significant difference was found between the age of the patients and the vertical position of the impacted canines (p=0.000) and between the age of the patients and the horizontal position of the impacted canines (p=0.003). The prevalence was found to be low compared with the present study from the limitation of panoramic image. Further study needs to include three-dimensional imaging modality.

  14. Homologous radioimmunoassay for canine prolactin and its application in various physiological states

    International Nuclear Information System (INIS)

    Graef, K.-J.; Friedreich, E.; Matthes, S.; Hasan, S.H.

    1977-01-01

    The purification of canine prolactin and the development of an homologous radioimmunoassay including several physiological studies in the Beagle dog are described. The assay measured immunoreactive canine prolactin with a sensitivity limit of 0.6 ng/ml. Purified canine luteinizing hormone gave no significant inhibition in the assay whereas purified canine growth hormone inhibited the binding of 125 I-labelled canine prolactin to antiserum only at very high dose levels. In Beagle dogs, basal serum prolactin concentrations were in the range 1 to 2 ng/ml in normal male, normal female (metoestrus and anoestrus) and oophorectomized-hysterectomized female dogs. The prolactin concentration in one sample of amniotic fluid was in the same range, while in hypophysectomized make dogs no serum prolactin could be detected by the assay system. Serum prolactin concentrations tended to increase during late pregnancy and parturition, remaining high during the first 9 days of lactation. In consequence, a negative correlation was suggested between serum prolactin and serum progesterone concentrations. (author)

  15. Varied clinico-radiological presentations of transmigrated canines

    Directory of Open Access Journals (Sweden)

    Ishita Gupta

    2015-01-01

    Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missi