WorldWideScience

Sample records for canine plasma samples

  1. Correlation between glucose concentrations in serum, plasma, and whole blood measured by a point-of-care glucometer and serum glucose concentration measured by an automated biochemical analyzer for canine and feline blood samples.

    Science.gov (United States)

    Tauk, Barbara S; Drobatz, Kenneth J; Wallace, Koranda A; Hess, Rebecka S

    2015-06-15

    To investigate the correlation between glucose concentrations in serum, plasma, and whole blood measured by a point-of-care glucometer (POCG) and serum glucose concentration measured by a biochemical analyzer. Prospective clinical study. 96 blood samples from 80 dogs and 90 blood samples from 65 cats. Serum, plasma, and whole blood were obtained from each blood sample. The glucose concentrations in serum, plasma, and whole blood measured by a POCG were compared with the serum glucose concentration measured by a biochemical analyzer by use of the Lin concordance correlation coefficient (ρc) and Bland-Altman plots. For both canine and feline samples, glucose concentrations in serum and plasma measured by the POCG were more strongly correlated with the serum glucose concentration measured by the biochemical analyzer (ρc, 0.98 for both canine serum and plasma; ρc, 0.99 for both feline serum and plasma) than was that in whole blood (ρc, 0.62 for canine samples; ρc, 0.90 for feline samples). The mean difference between the glucose concentrations determined by the biochemical analyzer and the POCG in serum, plasma, and whole blood was 0.4, 0.3, and 31 mg/dL, respectively, for canine samples and 7, 6, and 32 mg/dL, respectively, for feline samples. Results indicated that use of a POCG to measure glucose concentrations in serum or plasma may increase the accuracy and reliability of diagnostic and treatment decisions associated with glucose homeostasis disorders in dogs and cats.

  2. Measurement of plasma canine C peptide by radioimmunoassay

    Energy Technology Data Exchange (ETDEWEB)

    Besch, W; Woltanski, K P; Fischer, U; Kohnert, K D; Ziegler, M

    1985-12-01

    A sensitive radioimmunoassay for canine C peptide (CCP) was established using synthetic CCP, a specific antiserum, and rabbit anti-guinea pig serum. Radioiodination was performed according to a modified chloramine T method. Tracer preparations have been used for 6 weeks after iodination. The standard curve ranges from 0.028 to 3.0 nmol/l. The intra-assay coefficient of variation (CV) was 3-5% and the inter-assay CV was 6-9% in the optimal range between 0.3 and 0.8 nmol/l. The average recovery of CCP added to plasma samples was 100.6% (n = 9). Canine insulin, porcine proinsulin, bovine proinsulin, and human C peptide exhibited no cross-reactivity. The mean fasting plasma CCP concentration was 0.089 +- 0.021 nmol/l in normal dogs and -0.005 +- 0.007 nmol/l (mean +- SEM) in diabetic dogs, respectively.

  3. Estimation of reference intervals from small samples: an example using canine plasma creatinine.

    Science.gov (United States)

    Geffré, A; Braun, J P; Trumel, C; Concordet, D

    2009-12-01

    According to international recommendations, reference intervals should be determined from at least 120 reference individuals, which often are impossible to achieve in veterinary clinical pathology, especially for wild animals. When only a small number of reference subjects is available, the possible bias cannot be known and the normality of the distribution cannot be evaluated. A comparison of reference intervals estimated by different methods could be helpful. The purpose of this study was to compare reference limits determined from a large set of canine plasma creatinine reference values, and large subsets of this data, with estimates obtained from small samples selected randomly. Twenty sets each of 120 and 27 samples were randomly selected from a set of 1439 plasma creatinine results obtained from healthy dogs in another study. Reference intervals for the whole sample and for the large samples were determined by a nonparametric method. The estimated reference limits for the small samples were minimum and maximum, mean +/- 2 SD of native and Box-Cox-transformed values, 2.5th and 97.5th percentiles by a robust method on native and Box-Cox-transformed values, and estimates from diagrams of cumulative distribution functions. The whole sample had a heavily skewed distribution, which approached Gaussian after Box-Cox transformation. The reference limits estimated from small samples were highly variable. The closest estimates to the 1439-result reference interval for 27-result subsamples were obtained by both parametric and robust methods after Box-Cox transformation but were grossly erroneous in some cases. For small samples, it is recommended that all values be reported graphically in a dot plot or histogram and that estimates of the reference limits be compared using different methods.

  4. Evaluation of assays for quantification of DNA in canine plasma as an indirect marker of NETosis.

    Science.gov (United States)

    Smith, Stephanie A; Lawson, Corinne M; McMichael, Maureen A; Jung, Katrina; O'Brien, Mauria; Achiel, Ron

    2017-06-01

    Neutrophil extracellular traps (NET), consisting of a filamentous DNA/chromatin-histone scaffold originating from neutrophils are part of the innate immune response, may be released under a variety of inflammatory conditions and are associated with an increased risk for thrombosis. The purpose of this study was to evaluate a SYTOX green fluorescence assay and a histone-DNA complex (hisDNA) ELISA for quantification of NET-related DNA in canine plasma. The influence of variations in blood sample handling on assay results was tested. Accuracy of the SYTOX green fluorescence and the hisDNA ELISA was evaluated with dilutional linearity using serial dilutions. Interference was assessed by addition of purified bilirubin or hemoglobin. Precision was determined by calculating the intra- and inter-assay CV. Preanalytic sample handling did not influence DNA measurements by either assay. Citrate and EDTA plasma samples were equivalent. For the DNA fluorescence assay, dilutional linearity was poor due to autofluorescence, which was corrected by addition of canine plasma to the diluent. The presence of bilirubin and hemoglobin also increased autofluorescence, and resulted in falsely low concentrations of DNA. On the hisDNA ELISA, pigmentemia had no effect. Both assays as modified in this study are suitable for measuring DNA in canine EDTA or citrate plasma. However, performance of the fluorescence assay was impacted by pigmentemia, and it was less sensitive than the ELISA in detecting the presence of nucleosome material in the plasma. © 2017 American Society for Veterinary Clinical Pathology.

  5. Evaluation of microbial contamination of canine plasma eyedropper bottles following clinical use in canine patients.

    Science.gov (United States)

    Strauss, Rachel A; Genschel, Ulrike; Allbaugh, Rachel A; Sebbag, Lionel; Ben-Shlomo, Gil

    2018-05-24

    To investigate microbial contamination of canine plasma eye drops when used clinically and to compare the effect of two different eyedropper bottles on contamination rate. Forty-six bottles containing plasma were randomly dispensed for use on 42 dogs with ulcerative keratitis. Of these, 23 were standard eyedropper bottles and 23 were Novelia ® bottles designed to prevent contamination. After use for up to 2 weeks, samples for bacterial culture were obtained from a drop of plasma, the bottle tip, the plasma inside the bottle, and the corneal surface. Fungal culture was performed from a drop of plasma. The overall microbial contamination rate was 17.4% (8/46 bottles); however, only one bottle had growth from the plasma inside the bottle. There was a lower contamination rate of Novelia ® bottles (3/23 = 13.0%) compared to standard bottles (5/23 = 21.7%), but this difference was not statistically significant (P = .57). There were also no significant differences in contamination rate of bottles used greater than 7 days compared to less than or equal to 7 days, or in bottles used greater than 4 times daily compared to 4 times daily or less. Three corneal samples (6.5%) had bacterial growth, but none matched contamination from the bottles. Novelia ® bottles may decrease contamination of plasma eye drops used clinically. However, while microbial contamination of plasma bottles was documented, no clinically relevant complications were observed. This study supports safe use of plasma eye drops for up to 2 weeks when refrigerated and dispensed from either Novelia ® or standard eyedropper bottles. © 2018 American College of Veterinary Ophthalmologists.

  6. Radioimmunoassay for male canine plasma 4-androstenedione, testosterone and 5α-dihydrotestosterone

    International Nuclear Information System (INIS)

    Inaba, Toshio; Shimizu, Ryosuke; Imori, Tatsuo

    1977-01-01

    The radioimmunoassay for the simultaneous measurement of 4-androstenedione (A), testosterone (T), and 5α-dihydrotestosterone (DHT) in canine plasma was carried out. The assay for these 3 plasma steroids showed to be satisfactorily sensitive, specific, and accurate. The plasma steroid levels of peripheral and spermary vein plasma collected from 15 male dogs were (A) 0.86 +-0.75, (T) 1.19+-1.05 and (DHT) 0.30+-0.25 in peripheral vein, and (A) 30.2+-18.5, (T) 157+-98 and (DHT) 17.5+-10.7 in spermary vein, respectively (ng/ml and SD). Analysing these data, the significant correlation between two vein plasma levels was suggested. In order to estimate the normal or common diurnal variations of these plasma steroid levels in male dogs, 5 animals were employed, and their peripheral plasma samples were collected every an hour or two, throughout 24 hour period. In these data, the frequent intermittent peaks of plasma steroids were observed in each dog, and these seem to be their own diurnal changes. It was concluded that the peripheral plasma levels of A, T, and DHT were correlated to those in spermary vein, and these steroid levels were seemingly reflected by the episodic secretion from the gonads. (Kobatake, H.)

  7. Experimental determination of net protein charge and A(tot) and K(a) of nonvolatile buffers in canine plasma.

    Science.gov (United States)

    Constable, Peter D; Stämpfli, Henry R

    2005-01-01

    Acid-base abnormalities frequently are present in sick dogs. The mechanism for an acid-base disturbance can be determined with the simplified strong ion approach, which requires accurate values for the total concentration of plasma nonvolatile buffers (A(tot)) and the effective dissociation constant for plasma weak acids (K(a)). The aims of this study were to experimentally determine A(tot) and K(a) values for canine plasma. Plasma was harvested from 10 healthy dogs; the concentrations of quantitatively important strong ions (Na+, K+, Ca2+, Mg2+, Cl-, L-lactate) and nonvolatile buffer ions (total protein, albumin, phosphate) were determined; and the plasma was tonometered with CO2 at 37 degrees C. Strong ion difference (SID) was calculated from the measured strong ion concentrations, and nonlinear regression was used to estimate values for A(tot) and K(a), which were validated with data from an in vitro and in vivo study. Mean (+/- SD) values for canine plasma were A(tot) = (17.4 +/- 8.6) mM (equivalent to 0.273 mmol/g of total protein or 0.469 mmol/g of albumin); K(a) = (0.17 +/- 0.11) x 10(-7); pK(a) = 7.77. The calculated SID for normal canine plasma (pH = 7.40; P(CO2) = 37 mm Hg; [total protein] = 64 g/L) was 27 mEq/L. The net protein charge for normal canine plasma was 0.25 mEq/g of total protein or 0.42 mEq/g of albumin. Application of the experimentally determined values for A(tot), K(a), and net protein charge should improve understanding of the mechanism for complex acid-base disturbances in dogs.

  8. Optimisation of a double-centrifugation method for preparation of canine platelet-rich plasma.

    Science.gov (United States)

    Shin, Hyeok-Soo; Woo, Heung-Myong; Kang, Byung-Jae

    2017-06-26

    Platelet-rich plasma (PRP) has been expected for regenerative medicine because of its growth factors. However, there is considerable variability in the recovery and yield of platelets and the concentration of growth factors in PRP preparations. The aim of this study was to identify optimal relative centrifugal force and spin time for the preparation of PRP from canine blood using a double-centrifugation tube method. Whole blood samples were collected in citrate blood collection tubes from 12 healthy beagles. For the first centrifugation step, 10 different run conditions were compared to determine which condition produced optimal recovery of platelets. Once the optimal condition was identified, platelet-containing plasma prepared using that condition was subjected to a second centrifugation to pellet platelets. For the second centrifugation, 12 different run conditions were compared to identify the centrifugal force and spin time to produce maximal pellet recovery and concentration increase. Growth factor levels were estimated by using ELISA to measure platelet-derived growth factor-BB (PDGF-BB) concentrations in optimised CaCl 2 -activated platelet fractions. The highest platelet recovery rate and yield were obtained by first centrifuging whole blood at 1000 g for 5 min and then centrifuging the recovered platelet-enriched plasma at 1500 g for 15 min. This protocol recovered 80% of platelets from whole blood and increased platelet concentration six-fold and produced the highest concentration of PDGF-BB in activated fractions. We have described an optimised double-centrifugation tube method for the preparation of PRP from canine blood. This optimised method does not require particularly expensive equipment or high technical ability and can readily be carried out in a veterinary clinical setting.

  9. Investigation of cell-free DNA in canine plasma and its relation to disease.

    Science.gov (United States)

    Burnett, Deborah L; Cave, Nicholas J; Gedye, Kristene R; Bridges, Janis P

    2016-09-01

    DNA is released from dying cells during apoptosis and necrosis. This cell-free DNA (cfDNA) diffuses into the plasma where it can be measured. In humans, an increase in cfDNA correlates with disease severity and prognosis. It was hypothesized that when DNA in canine plasma was measured by emission fluorometry without prior DNA extraction, the concentration of cfDNA would increase with disease severity. The diseased population consisted of 97 client-owned dogs. The clinically normal population consisted of nine client-owned dogs presenting for 'wellness screens', and 15 colony-owned Harrier Hounds. Plasma cfDNA was measured by fluorometry without prior DNA extraction. The effects of ex vivo storage conditions were evaluated in plasma from two clinically normal dogs. In all other dogs, plasma was separated within two hours of collection. The association between the cfDNA concentration in hospitalized dogs and a variety of clinical, clinicopathological and outcome variables was tested. The concentration of cfDNA was reliably measured when plasma was separated within two hours of blood collection. The diseased dogs had significantly higher cfDNA than clinically normal dogs (P Dogs that did not survive to discharge had significantly higher cfDNA concentrations than survivors (P = 0.02). Conclusions/Clinical Importance: The concentration of cfDNA in the plasma of diseased dogs is associated with disease severity and prognosis. Measurement of canine cfDNA could be a useful non-specific disease indicator and prognostic tool.

  10. Profiling of plasma metabolites in canine oral melanoma using gas chromatography-mass spectrometry.

    Science.gov (United States)

    Kawabe, Mifumi; Baba, Yuta; Tamai, Reo; Yamamoto, Ryohei; Komori, Masayuki; Mori, Takashi; Takenaka, Shigeo

    2015-08-01

    Malignant melanoma is one of the most common and aggressive tumors in the oral cavity of dog. The tumor has a poor prognosis, and methods for diagnosis and prediction of prognosis after treatment are required. Here, we examined metabolite profiling using gas chromatography-mass spectrometry (GC-MS) for development of a discriminant model for evaluation of prognosis. Metabolite profiles were evaluated in healthy and melanoma plasma samples using orthogonal projection to latent structure using discriminant analysis (OPLS-DA). Cases that were predicted to be healthy using the OPLS discriminant model had no advanced lesions after radiation therapy. These results indicate that metabolite profiling may be useful in diagnosis and prediction of prognosis of canine malignant melanoma.

  11. Canine adiponectin: cDNA structure, mRNA expression in adipose tissues and reduced plasma levels in obesity.

    Science.gov (United States)

    Ishioka, K; Omachi, A; Sagawa, M; Shibata, H; Honjoh, T; Kimura, K; Saito, M

    2006-04-01

    Adiponectin is a protein synthesized and secreted by adipocytes. Decreased adiponectin is responsible for insulin resistance and atherosclerosis associated with human obesity. We obtained a cDNA clone corresponding to canine adiponectin, whose nucleotide and deduced amino acid sequences were highly identical to those of other species. Adiponectin mRNA was detected in adipose tissues, but not in other tissues, of dogs. When 22 adult beagles were given a high-energy diet for 14 weeks, they became obese, showing heavier body weights, higher plasma leptin concentrations, but lower plasma adiponectin concentrations. The adiponectin concentrations of plasma samples collected from 71 dogs visiting veterinary practices were negatively correlated to plasma leptin concentrations, being lower in obese than non-obese dogs. These results are compatible with those reported in other species, and suggest that adiponectin is an index of adiposity and a target molecule for studies on diseases associated with obesity in dogs.

  12. Phylogenetic analysis of Austrian canine distemper virus strains from clinical samples from dogs and wild carnivores.

    Science.gov (United States)

    Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K

    2011-04-09

    Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.

  13. Ammonia concentrations in canine whole blood, EDTA-anticoagulated whole blood, and plasma measured by use of a point-of-care ammonia meter.

    Science.gov (United States)

    Odunayo, Adesola; Tobias, Karen M; Okafor, Chika C; Flatland, Bente

    2017-11-01

    OBJECTIVE To investigate the use of canine whole blood (WB) for measurement of ammonia concentration by use of a point-of-care ammonia meter and to compare results of measuring ammonia concentrations in WB, EDTA-anticoagulated WB, and plasma. ANIMALS 40 client-owned dogs. PROCEDURES A blood sample (2 mL) was obtained from each dog. One drop of WB was immediately applied to a test strip for evaluation with an ammonia meter. The remainder of the blood sample was placed in an EDTA-containing tube, and 1 drop of EDTA-anticoagulated WB was applied to a test strip. The remaining EDTA-anticoagulated WB sample was centrifuged, and the plasma was harvested and placed on ice. One drop of plasma was applied to a test strip; the remainder of the plasma sample was transported on ice and used for ammonia measurement with a reference laboratory instrument. All samples were tested within 1 hour after sample collection. Results were evaluated to detect significant differences in ammonia concentration. RESULTS Ammonia concentrations did not differ significantly between WB and EDTA-anticoagulated WB and between plasma samples measured with the meter and reference laboratory instrument. However, median ammonia concentration was significantly higher in plasma than in WB or EDTA-anti-coagulated WB. CONCLUSIONS AND CLINICAL RELEVANCE Anticoagulant-free WB was a valid sample for measurement by use of the ammonia meter. Plasma samples had higher ammonia concentrations than did WB samples. Results for each sample type should be interpreted by use of specimen- and method-specific reference intervals.

  14. A homologous radioimmunoassay for canine prolactin: plasma levels huring the reproductive cycle

    International Nuclear Information System (INIS)

    Coster, R. De; Beerens, D.; Mey, J. De; Beckers, J.-F.

    1983-01-01

    A method is described for the purification of canine prolactin, involving preparative isoelectrofocusing. Canine prolactin has a molecular weight of 23 000 daltons, an isoelectric point of 5.7 and exhibits a high degree of homogeneity in polyacrylamide gels stained by means of a silver method. A specific, homologous radioimmunoassay is described using the Bolton-Hunter method for preparation of the labelled ligand, with a sensitivity of 0.1 ng/tube. Basal plasma prolactin levels of 2-4 ng/ml obtained through the oestrous cycle remained fairly constant but a rise of 9 ng/ml was found at the end of dioestrus in non-pregnant bitches. Level also rose 30 days after mating to reach a peak of about 50 ng/ml near parturition and during early lactation. (author)

  15. Characteristics of canine platelet-rich plasma prepared with five commercially available systems.

    Science.gov (United States)

    Franklin, Samuel P; Garner, Bridget C; Cook, James L

    2015-09-01

    To characterize platelet-rich plasma (PRP) products obtained from canine blood by use of a variety of commercially available devices. Blood samples from 15 dogs between 18 months and 9 years of age with no concurrent disease, except for osteoarthritis in some dogs. PRP products were produced from blood obtained from each of the 15 dogs by use of each of 5 commercially available PRP-concentrating systems. Complete blood counts were performed on each whole blood sample and PRP product. The degree of platelet, leukocyte, and erythrocyte concentration or reduction for PRP, compared with results for the whole blood sample, was quantified for each dog and summarized for each concentrating system. The various PRP-concentrating systems differed substantially in the amount of blood processed, method of PRP preparation, amount of PRP produced, and platelet, leukocyte, and erythrocyte concentrations or reductions for PRP relative to results for whole blood. The characteristics of PRP products differed considerably. Investigators evaluating the efficacy of PRPs need to specify the characteristics of the product they are assessing. Clinicians should be aware of the data (or lack of data) supporting use of a particular PRP for a specific medical condition.

  16. Description of a double centrifugation tube method for concentrating canine platelets.

    Science.gov (United States)

    Perazzi, Anna; Busetto, Roberto; Martinello, Tiziana; Drigo, Michele; Pasotto, Daniela; Cian, Francesco; Patruno, Marco; Iacopetti, Ilaria

    2013-07-22

    To evaluate the efficiency of platelet-rich plasma preparations by means of a double centrifugation tube method to obtain platelet-rich canine plasma at a concentration at least 4 times higher than the baseline value and a concentration of white blood cells not exceeding twice the reference range. A complete blood count was carried out for each sample and each concentrate. Whole blood samples were collected from 12 clinically healthy dogs (consenting blood donors). Blood was processed by a double centrifugation tube method to obtain platelet concentrates, which were then analyzed by a flow cytometry haematology system for haemogram. Platelet concentration and white blood cell count were determined in all samples. Platelet concentration at least 4 times higher than the baseline value and a white blood cell count not exceeding twice the reference range were obtained respectively in 10 cases out of 12 (83.3%) and 11 cases out of 12 (91.6%). This double centrifugation tube method is a relatively simple and inexpensive method for obtaining platelet-rich canine plasma, potentially available for therapeutic use to improve the healing process.

  17. Description of a double centrifugation tube method for concentrating canine platelets

    OpenAIRE

    Perazzi, Anna; Busetto, Roberto; Martinello, Tiziana; Drigo, Michele; Pasotto, Daniela; Cian, Francesco; Patruno, Marco; Iacopetti, Ilaria

    2013-01-01

    Background To evaluate the efficiency of platelet-rich plasma preparations by means of a double centrifugation tube method to obtain platelet-rich canine plasma at a concentration at least 4 times higher than the baseline value and a concentration of white blood cells not exceeding twice the reference range. A complete blood count was carried out for each sample and each concentrate. Whole blood samples were collected from 12 clinically healthy dogs (consenting blood donors). Blood was proces...

  18. Management of an endo perio lesion in a maxillary canine using platelet-rich plasma concentrate and an alloplastic bone substitute

    Directory of Open Access Journals (Sweden)

    Singh Sangeeta

    2009-01-01

    Full Text Available To evaluate the efficacy of platelet-rich plasma concentrate in the management of a cirumferential, infrabony defect associated with an endoperio lesion in a maxillary canine. A 45 year-old male patient with an endoperio lesion in the left maxillary canine was initially treated with endodontic therapy. Following the endodontic treatment, the circumferential, infrabony defect was treated using platelet-rich plasma and an alloplastic bone substitute. At the end of three months, there was a gain in the clinical attachment level and reduction in probing depth. Radiographic evidence showed that there was significant bony fill. The results were maintained at the time of recall nine months later.

  19. Plasma and skin vitamin E concentrations in canine atopic dermatitis.

    Science.gov (United States)

    Plevnik Kapun, Alja; Salobir, Janez; Levart, Alenka; Tavčar Kalcher, Gabrijela; Nemec Svete, Alenka; Kotnik, Tina

    2013-01-01

    Altered homeostasis of vitamin E has been demonstrated in human atopic dermatitis. Data on plasma and skin vitamin E concentrations in canine atopic dermatitis (CAD) are not available. To determine vitamin E concentrations in plasma and skin of atopic dogs. Vitamin E concentrations in plasma and full-thickness skin biopsies of 15 atopic dogs were related to CAD extent and severity index (CADESI-03) scores and compared to the equivalent concentrations in 17 healthy dogs. Statistically significant differences of measured parameters between the two groups were determined by the nonparametric Mann Whitney U test and correlations between CADESI-03 scores and vitamin E concentrations were evaluated by the Spearman rank test. A value of P vitamin E were significantly lower in atopic dogs than in healthy dogs, with median values of 29.8 and 52.9 μmol/L, respectively. Skin vitamin E values did not differ significantly between patients and healthy controls. The median concentration of skin vitamin E in atopic dogs was higher than that in healthy dogs. No significant correlations were found between CADESI-03 score and plasma vitamin E or skin vitamin E concentrations. Significantly lower plasma vitamin E concentrations in atopic dogs than in healthy controls indicate altered homeostasis of vitamin E in CAD. Further investigation into vitamin E supplementation in CAD is warranted.

  20. In vitro evaluation of canine leukocytes radiolabeled in whole blood with 99mTc stannous colloid

    International Nuclear Information System (INIS)

    Abushhiwa, Mohamed H.; Salehi, Nouria S.; Whitton, Robert C.; Charles, Jennifer A.; Finnin, Peter J.; Lording, Peter M.; Caple, Ivan W.; Parry, Bruce W.

    2008-01-01

    Introduction: Technetium-99m stannous colloid ( 99m TcSnC)-labeled leukocytes are used to investigate a variety of inflammatory diseases in human medicine. The present study investigates the in vitro behavior of canine leukocytes labeled in whole blood with 99m TcSnC. Methods: Blood samples from 10 healthy dogs were labeled with 99m TcSnC using a standard procedure. The distribution of radioactivity among blood components (plasma, leukocyte layers and erythrocytes) was measured following separation of the radiolabeled samples across Histopaque density gradients. Phagocytic function of labeled and unlabeled leukocytes was estimated using zymosan particles. Labeling retention by leukocytes was determined at 1, 3, 4 and 7 h postlabeling. Results: The mean±standard error percentage of radioactivity associated with plasma, erythrocyte and leukocyte fractions was 2.0±0.21%, 55.5±0.60% and 42.5±0.54%, respectively (the last comprising 70.2±0.83% in polymorphonuclear leukocytes and 29.8±0.83% in mononuclear leukocytes). Labeled canine leukocytes had a phagocytic activity of 91.3±0.28% (control, 91.7±0.26%). The radiolabeled canine leukocytes retained 94.1±0.30% of radioactivity at 7 h postlabeling. Conclusions: Radiolabeling of canine leukocytes in whole blood with 99m TcSnC has minor adverse effect on their phagocytic function. The radiolabeled canine leukocytes retained a large percentage of radioactivity for at least 7 h postlabeling

  1. Validation of 2 commercially available enzyme-linked immunosorbent assays for adiponectin determination in canine serum samples.

    Science.gov (United States)

    Tvarijonaviciute, Asta; Martínez-Subiela, Silvia; Ceron, José J

    2010-10-01

    The aim of this study was to validate 2 commercially available enzyme-linked immunosorbent assays (ELISAs) for adiponectin in dogs, 1 canine-specific and 1 originally designed for measurements in humans. Intra-assay and interassay precision was evaluated by multiple measurements in canine serum samples, and assay accuracy was indirectly determined by linearity under dilution. Interference caused by hemolysis and lipemia was also studied. Both assays were subsequently used for measuring adiponectin concentrations in clinically healthy dogs and those with different grades of obesity. The intra-assay and inter-assay precision was less than 7.5% and 13.5% in serum samples with low and high adiponectin concentrations, respectively. Lipemia and hemolysis did not affect the results of any of the assays. Both assays were able to differentiate lean dogs from those that were overweight or obese on the basis of the measured adiponectin concentrations. From these results it can be concluded that canine adiponectin concentrations can be measured reliably by means of the 2 ELISAs evaluated in this study.

  2. Cardiac involvement in canine babesiosis : review article

    Directory of Open Access Journals (Sweden)

    R.G. Lobetti

    2005-06-01

    Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.

  3. Disruption of Splenic Lymphoid Tissue and Plasmacytosis in Canine Visceral Leishmaniasis: Changes in Homing and Survival of Plasma Cells.

    Science.gov (United States)

    Silva-O'Hare, Joselli; de Oliveira, Isabela Silva; Klevorn, Thaís; Almeida, Valter A; Oliveira, Geraldo G S; Atta, Ajax M; de Freitas, Luiz Antonio R; Dos-Santos, Washington L C

    2016-01-01

    Visceral leishmaniasis (VL) is a disease caused by Leishmania infantum, which is transmitted by phlebotomine sandflies. Dogs are the main urban reservoir of this parasite and the disease presents similar characteristics in both humans and dogs. In this paper, we investigated the potential pathways involved in plasma cell replacement of normal cell populations in the spleen, with respect to disease severity in dogs from an endemic area for visceral leishmaniasis. To this end, canine spleen samples were grouped into three categories: TYPE1SC- (non-infected dogs or without active infection with organized white pulp), TYPE1SC+ (infected dogs with organized white pulp) or TYPE3SC+ (infected animals with disorganized white pulp). We analyzed the distribution of different plasma cell isotypes (IgA, IgG and IgM) in the spleen. The expression of cytokines and chemokines involved in plasma cell homing and survival were assessed by real time RT-PCR. Polyclonal B cell activation and hypergammaglobulinemia were also evaluated. The proportion of animals with moderate or intense plasmacytosis was higher in the TYPE3SC+ group than in the other groups (Fisher test, Pspleen may contribute to the progression of VL, and impair the spleen's ability to protect against blood borne pathogens.

  4. Low-density Lipoprotein Improves Motility and Plasma Membrane Integrity of Cryopreserved Canine Epididymal Spermatozoa.

    Science.gov (United States)

    Prapaiwan, N; Tharasanit, T; Punjachaipornpol, S; Yamtang, D; Roongsitthichai, A; Moonarmart, W; Kaeoket, K; Manee-In, S

    2016-05-01

    Cryopreservation of caudal epididymal spermatozoa is an effective technique to conserve genetic potentials of superior dogs when it is not possible to collect ejaculated spermatozoa. Although hen egg yolk is commonly supplemented into the semen extender, active substances within the egg yolk which protect sperm against cryoinjury remain to be discovered. Among its compositions, low-density lipoprotein (LDL) has been reported to have a cryoprotective property for sperm cryopreservation. However, the effects of LDL on dog epididymal spermatozoa during cryopreservation have not yet been investigated. This study aimed to investigate the effects of LDL on epididymal spermatozoa quality following cryopreservation and thawing. After routine castration of 12 dogs, caudal epididymides from individuals were separated from the testes and cut into a few pieces in a Tris-buffer. Spermatozoa recovered from each sample were examined at once for sperm quality and divided into six groups of extender: no LDL, 20% egg yolk, 4%, 8%, 16%, and 24% LDL, before cryopreservation. The sperm aliquots were then equilibrated and conventionally frozen. After thawing, sperm motility, morphology, plasma membrane integrity, and acrosome integrity were evaluated. The results revealed that 4% LDL and 20% egg yolk yielded significantly higher sperm motility (57.69% and 52.69%, respectively, p<0.05) than other LDLs. In addition, 4% LDL yielded the significantly highest plasma membrane integrity (70.54%, p<0.05). In conclusion, the supplementation of 4% LDL in Tris-glucose extender could be applied for cryopreservation of canine epididymal spermatozoa.

  5. Low-density Lipoprotein Improves Motility and Plasma Membrane Integrity of Cryopreserved Canine Epididymal Spermatozoa

    Directory of Open Access Journals (Sweden)

    N. Prapaiwan

    2016-05-01

    Full Text Available Cryopreservation of caudal epididymal spermatozoa is an effective technique to conserve genetic potentials of superior dogs when it is not possible to collect ejaculated spermatozoa. Although hen egg yolk is commonly supplemented into the semen extender, active substances within the egg yolk which protect sperm against cryoinjury remain to be discovered. Among its compositions, low-density lipoprotein (LDL has been reported to have a cryoprotective property for sperm cryopreservation. However, the effects of LDL on dog epididymal spermatozoa during cryopreservation have not yet been investigated. This study aimed to investigate the effects of LDL on epididymal spermatozoa quality following cryopreservation and thawing. After routine castration of 12 dogs, caudal epididymides from individuals were separated from the testes and cut into a few pieces in a Tris-buffer. Spermatozoa recovered from each sample were examined at once for sperm quality and divided into six groups of extender: no LDL, 20% egg yolk, 4%, 8%, 16%, and 24% LDL, before cryopreservation. The sperm aliquots were then equilibrated and conventionally frozen. After thawing, sperm motility, morphology, plasma membrane integrity, and acrosome integrity were evaluated. The results revealed that 4% LDL and 20% egg yolk yielded significantly higher sperm motility (57.69% and 52.69%, respectively, p<0.05 than other LDLs. In addition, 4% LDL yielded the significantly highest plasma membrane integrity (70.54%, p<0.05. In conclusion, the supplementation of 4% LDL in Tris-glucose extender could be applied for cryopreservation of canine epididymal spermatozoa.

  6. Ontogeny of canine dimorphism in extant hominoids.

    Science.gov (United States)

    Schwartz, G T; Dean, C

    2001-07-01

    Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.

  7. 9 CFR 113.306 - Canine Distemper Vaccine.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...

  8. Carprofen pharmacokinetics in plasma and in control and inflamed canine tissue fluid using in vivo ultrafiltration.

    Science.gov (United States)

    Messenger, K M; Wofford, J A; Papich, M G

    2016-02-01

    Measurement of unbound drug concentrations at their sites of action is necessary for accurate PK/PD modeling. The objective of this study was to determine the unbound concentration of carprofen in canine interstitial fluid (ISF) using in vivo ultrafiltration and to compare pharmacokinetic parameters of free carprofen concentrations between inflamed and control tissue sites. We hypothesized that active concentrations of carprofen would exhibit different dispositions in ISF between inflamed vs. normal tissues. Bilateral ultrafiltration probes were placed subcutaneously in six healthy Beagle dogs 12 h prior to induction of inflammation. Two milliliters of either 2% carrageenan or saline control was injected subcutaneously at each probe site, 12 h prior to intravenous carprofen (4 mg/kg) administration. Plasma and ISF samples were collected at regular intervals for 72 h, and carprofen concentrations were determined using HPLC. Prostaglandin E2 (PGE2 ) concentrations were quantified in ISF using ELISA. Unbound carprofen concentrations were higher in ISF compared with predicted unbound plasma drug concentrations. Concentrations were not significantly higher in inflamed ISF compared with control ISF. Compartmental modeling was used to generate pharmacokinetic parameter estimates, which were not significantly different between sites. Terminal half-life (T½) was longer in the ISF compared with plasma. PGE2 in ISF decreased following administration of carprofen. In vivo ultrafiltration is a reliable method to determine unbound carprofen in ISF, and that disposition of unbound drug into tissue is much higher than predicted from unbound drug concentration in plasma. However, concentrations and pharmacokinetic parameter estimates are not significantly different in inflamed vs. un-inflamed tissues. © 2015 John Wiley & Sons Ltd.

  9. Duration of serological response to canine parvovirus-type 2, canine distemper virus, canine adenovirus type 1 and canine parainfluenza virus in client-owned dogs in Australia.

    Science.gov (United States)

    Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J

    2012-12-01

    To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.

  10. Canine scent detection of canine cancer: a feasibility study

    Directory of Open Access Journals (Sweden)

    Dorman DC

    2017-10-01

    Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of

  11. Assessment of canine autologous platelet-rich plasma produced with a commercial centrifugation and platelet recovery kit.

    Science.gov (United States)

    Frye, Chris W; Enders, Andrew; Brooks, Marjory B; Struble, Angela M; Wakshlag, Joseph J

    2016-01-01

    To characterize the cellular composition (platelets, erythrocytes, and leukocytes) and confirm reproducibility of platelet enrichment, as well as determine the platelet activation status in the final product of a commercial platelet-rich plasma kit using canine blood. Venous blood from 20 sedated client-owned dogs was used to prepare platelet-rich plasma (PRP) from a commercial kit. Complete blood counts were performed to determine erythrocyte, leukocyte, and platelet numbers in both whole blood (WB) and resultant PRP. The WB and PRP samples from jugular (fast collection) and cephalic (slow collection) venipuncture were also compared. P-selectin externalization was measured in WB and PRP samples from 15 of 20 dogs. This commercial kit produced an average percent recovery in platelets of 64.7 ± 17.4; erythrocytes of 3.7 ± 0.8, and leukocytes of 31.6 ± 10.0. Neutrophil, monocyte, and lymphocyte percent recovery was 19.6 ± 7.2, 44.89 ± 19.8, and 57.5 ± 10.6, respectively. The recovery of platelets from jugular venipuncture (59.7 ± 13.6%) was lower than from cephalic recovery (68.8 ± 19.1%). The mean percent P-Selectin externalization for WB, PRP, and PRP with thrombin was 25.5 ± 30.9, 4.5 ± 6.4, and 90.6 ± 4.4 respectively. Cellular reproducibility of this kit was confirmed and platelets were concentrated within autologous serum. Additionally, measurements of P-selectin externalization showed that platelets are inactive in PRP unless stimulated to degranulate.

  12. Sequence analysis of the canine mitochondrial DNA control region from shed hair samples in criminal investigations.

    Science.gov (United States)

    Berger, C; Berger, B; Parson, W

    2012-01-01

    In recent years, evidence from domestic dogs has increasingly been analyzed by forensic DNA testing. Especially, canine hairs have proved most suitable and practical due to the high rate of hair transfer occurring between dogs and humans. Starting with the description of a contamination-free sample handling procedure, we give a detailed workflow for sequencing hypervariable segments (HVS) of the mtDNA control region from canine evidence. After the hair material is lysed and the DNA extracted by Phenol/Chloroform, the amplification and sequencing strategy comprises the HVS I and II of the canine control region and is optimized for DNA of medium-to-low quality and quantity. The sequencing procedure is based on the Sanger Big-dye deoxy-terminator method and the separation of the sequencing reaction products is performed on a conventional multicolor fluorescence detection capillary electrophoresis platform. Finally, software-aided base calling and sequence interpretation are addressed exemplarily.

  13. Validation of commercially available automated canine-specific immunoturbidimetric method for measuring canine C-reactive protein

    DEFF Research Database (Denmark)

    Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold

    2014-01-01

    BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was

  14. Influência da temperatura e do tempo de armazenamento nas dosagens bioquímicas de uréia e creatinina em soro ou plasma caninos Effect of temperature and storage time on urea and creatinine dosages from canine serum or plasma

    Directory of Open Access Journals (Sweden)

    S.T. Fernandes

    2001-12-01

    Full Text Available O trabalho teve como objetivos avaliar algumas condições de estocagem de soro e de plasma com EDTA 10% utilizados para determinação dos valores de uréia e creatinina em cães, e avaliar a possibilidade de substituir o soro pelo plasma conservado com EDTA 10%. Foram realizadas 3600 análises (1800 amostras de soro e 1800 de plasma com amostras que permaneceram em temperaturas ambiente, de refrigeração e de congelamento. As análises foram realizadas imediatamente após a obtenção da amostra (tempo 0 e após 2, 6, 12, 24, 72 horas e 30 e 60 dias após a coleta do sangue. Os resultados permitiram concluir que a uréia conservou-se por mais tempo na amostra sérica refrigerada até 30 dias e a creatinina na amostra sérica congelada até 72h. O soro mostrou mais estabilidade que o plasma em todas as condições de estoque estabelecidas.Aiming to evaluating some conditions of EDTA 10% serum and plasma storage for urea and creatinine values determinations in canines as well as analyzing the possibility of serum substitution by plasma, a total of 3600 samples (1800 serum and 1800 of plasma were analyzed at room, refrigeration and freezing temperatures. Different time intervals were used in the analysis: immediately after sampling (time 0, and at 2, 6, 12, 24, and 72 hours, and 30 and 60 days after the blood collection. The data showed that urea remains conserved for more time in the refrigerated serum sample until 30 days and the creatinine in the frozen serum sample until 72 hours. Serum showed more stability than plasma in all storage conditions established.

  15. Activity, specificity, and titer of naturally occurring canine anti-DEA 7 antibodies.

    Science.gov (United States)

    Spada, Eva; Proverbio, Daniela; Baggiani, Luciana; Canzi, Ilaria; Perego, Roberta

    2016-11-01

    The reported prevalence of naturally occurring anti-dog erythrocyte antigen (DEA) 7 antibodies in DEA 7-negative dogs is as high as 50%. Characterization of these antibodies may better define their importance in canine transfusion medicine. We determined in vitro activity, specificity, and titer of anti-DEA 7 antibodies in DEA 7-negative dogs. Plasma samples from 317 DEA 7-negative dogs were cross-matched with DEA 7-positive red blood cells (RBCs) using gel column technology. Agglutination occurred with DEA 7-positive RBCs but not with DEA 7-negative RBCs in 73 samples (23%), which were hence classified as containing anti-DEA 7 antibodies. These samples were evaluated for hemolytic and agglutinating activity, strength of agglutination, and antibody specificity and titers. All samples showed agglutination but none showed hemolysis. Gel agglutination was graded as 1+ for 20 samples (27%), 2+ for 49 samples (67%), 3+ for 4 samples (6%); no samples were graded 4+. The agglutination titer was DEA 7 antibodies were found in 23% of DEA 7-negative dogs. The presence of naturally occurring anti-DEA 7 antibodies suggests that cross-matching of canine blood recipients is advisable, even at first transfusion, to minimize delayed transfusion reactions. © 2016 The Author(s).

  16. Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.

    Science.gov (United States)

    Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S

    2017-06-03

    Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.

  17. Effect of plasma-rich in platelet-derived growth factors on peri-implant bone healing: An experimental study in canines

    Science.gov (United States)

    Birang, Reza; Torabi, Alireza; Shahabooei, Mohammad; Rismanchian, Mansour

    2012-01-01

    Background: Tissue engineering principles can be exploited to enhance alveolar and peri-implant bone reconstruction by applying such biological factors as platelet-derived growth factors. The objective of the present study is to investigate the effect of autologous plasma-rich in growth factors (on the healing of peri-implant bone in canine mandible). Materials and Methods: In this prospective experimental animal study, two healthy canines of the Iranian mix breed were selected. Three months after removing their premolar teeth on both sides of the mandible, 12 implants of the Osteo Implant Corporationsystem, 5 mm in diameter and 10 mm in length, were selected to be implanted. Plasma rich in growth factors (PRGF) were applied on six implants while the other six were used as plain implants without the plasma. The implants were installed in osteotomy sites on both sides of the mandible to be removed after 4 weeks with the surrounding bones using a trephine bur. Mesio-distal sections and implant blocks, 50 μ in diameter containing the peri-implant bone, were prepared By basic fuchin toluidine-bluefor histological and histomorphometric evaluation by optical microscope. The data were analyzed using Mann-Whitney Test (PPRGF and control groups had no statistically significant differences (P=0.261, P=0.2) although the parameters showed higher measured values in the PRGF group. However, compared to the control, application of PRGF had significantly increased bone-to-implant contact (P=0.028) Conclusion: Based on the results, it may be concluded that application of PRGF on the surface of implant may enhance bone-to-implant contact. PMID:22363370

  18. The effectiveness of cooling conditions on temperature of canine EDTA whole blood samples.

    Science.gov (United States)

    Tobias, Karen M; Serrano, Leslie; Sun, Xiaocun; Flatland, Bente

    2016-01-01

    Preanalytic factors such as time and temperature can have significant effects on laboratory test results. For example, ammonium concentration will increase 31% in blood samples stored at room temperature for 30 min before centrifugation. To reduce preanalytic error, blood samples may be placed in precooled tubes and chilled on ice or in ice water baths; however, the effectiveness of these modalities in cooling blood samples has not been formally evaluated. The purpose of this study was to evaluate the effectiveness of various cooling modalities on reducing temperature of EDTA whole blood samples. Pooled samples of canine EDTA whole blood were divided into two aliquots. Saline was added to one aliquot to produce a packed cell volume (PCV) of 40% and to the second aliquot to produce a PCV of 20% (simulated anemia). Thirty samples from each aliquot were warmed to 37.7 °C and cooled in 2 ml allotments under one of three conditions: in ice, in ice after transfer to a precooled tube, or in an ice water bath. Temperature of each sample was recorded at one minute intervals for 15 min. Within treatment conditions, sample PCV had no significant effect on cooling. Cooling in ice water was significantly faster than cooling in ice only or transferring the sample to a precooled tube and cooling it on ice. Mean temperature of samples cooled in ice water was significantly lower at 15 min than mean temperatures of those cooled in ice, whether or not the tube was precooled. By 4 min, samples cooled in an ice water bath had reached mean temperatures less than 4 °C (refrigeration temperature), while samples cooled in other conditions remained above 4.0 °C for at least 11 min. For samples with a PCV of 40%, precooling the tube had no significant effect on rate of cooling on ice. For samples with a PCV of 20%, transfer to a precooled tube resulted in a significantly faster rate of cooling than direct placement of the warmed tube onto ice. Canine EDTA whole blood samples cool most

  19. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

    Directory of Open Access Journals (Sweden)

    Anna McRee

    2014-09-01

    Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  20. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe.

    Science.gov (United States)

    McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A

    2014-09-05

    Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  1. Canine specific ELISA for coagulation factor VII

    DEFF Research Database (Denmark)

    Knudsen, Tom; Kjelgaard-Hansen, Mads; Tranholm, Mikael

    2011-01-01

    available to date. In this study, a canine specific ELISA for measurement of FVII:Ag in plasma was developed and validated. The FVII:Ag ELISA correctly diagnosed homozygous and heterozygous hereditary FVII deficiency. Together with activity based assays, such as FVII:C, the FVII:Ag ELISA should be valuable...

  2. Canine adenovirus type 1 in a fennec fox (Vulpes zerda).

    Science.gov (United States)

    Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku

    2014-12-01

    A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.

  3. Binding of 125I-labeled endotoxin to bovine, canine, and equine platelets and endotoxin-induced agglutination of canine platelets

    International Nuclear Information System (INIS)

    Meyers, K.M.; Boehme, M.; Inbar, O.

    1982-01-01

    Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using 125 I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed

  4. Comparison of three methods for recovery of Brucella canis DNA from canine blood samples.

    Science.gov (United States)

    Batinga, Maria Cryskely A; Dos Santos, Jaíne C; Lima, Julia T R; Bigotto, Maria Fernanda D; Muner, Kerstin; Faita, Thalita; Soares, Rodrigo M; da Silva, David A V; Oliveira, Trícia M F S; Ferreira, Helena L; Diniz, Jaqueline A; Keid, Lara B

    2017-12-01

    Brucella canis, a gram-negative, facultative intracellular and zoonotic bacterium causes canine brucellosis. Direct methods are the most appropriate for the detection of canine brucellosis and bacterial isolation from blood samples has been employed as gold-standard method. However, due to the delay in obtaining results and the biological risk of the bacterial culturing, the polymerase chain reaction (PCR) has been successfully used as an alternative method for the diagnosis of the infection. Sample preparation is a key step for successful PCR and protocols that provide high DNA yield and purity are recommended to ensure high diagnostic sensitivity. The objective of this study was to evaluate the performance of PCR for the diagnosis of B. canis infection in 36 dogs by testing DNA of whole blood obtained through different extraction and purification protocols. Methods 1 and 2 were based on a commercial kit, using protocols recommended for DNA purification of whole blood and tissue samples, respectively. Method 3 was an in-house method based on enzymatic lysis and purification using organic solvents. The results of the PCR on samples obtained through three different DNA extraction protocols were compared to the blood culture. Of the 36 dogs, 13 (36.1%) were positive by blood culturing, while nine (25.0%), 14 (38.8%), and 15 (41.6%) were positive by PCR after DNA extraction using methods 1, 2 and 3, respectively. PCR performed on DNA purified by Method 2 was as efficient as blood culturing and PCR performed on DNA purified with in-house method, but had the advantage of being less laborious and, therefore, a suitable alternative for the direct B. canis detection in dogs. Copyright © 2017. Published by Elsevier B.V.

  5. Plasma as alternatively sample to quantify tetanus antitoxin

    Directory of Open Access Journals (Sweden)

    Ariel Menéndez-Barrios

    2015-08-01

    Full Text Available Tetanus antitoxin is quantified in Cuba at blood banks, from the serum of immunized donors, to produce aspecific human gamma globulin. A heterogeneous indirect immunoenzymatic assay is used, using the serum as analytical sample. The possible use of plasma obtained from plasmapheresis as alternative sample was evaluated in this research, to minimize the volume of total blood extracted to the donors. One hundred plasma donors who came to donate between October and November 2013 were selected by simple random sampling. Serum sample was obtained for extraction of 5 mL of blood, deposited in dry glass tube. While the other sample took 1.5 mL of plasma in a plastic tube with cover, at the end of the donation directly of the unit of plasma collected. Comparison of the difference between the means of both groups was done using SPSS for Windows. It was found that the values obtained in serum were bigger than those obtained in plasma. Difference between the means of both groups was statistically significant (p 0.00. It is not advisable to use the obtained plasma of the plasmapheresis as analytic sample in this assay.

  6. Disruption of Splenic Lymphoid Tissue and Plasmacytosis in Canine Visceral Leishmaniasis: Changes in Homing and Survival of Plasma Cells.

    Directory of Open Access Journals (Sweden)

    Joselli Silva-O'Hare

    Full Text Available Visceral leishmaniasis (VL is a disease caused by Leishmania infantum, which is transmitted by phlebotomine sandflies. Dogs are the main urban reservoir of this parasite and the disease presents similar characteristics in both humans and dogs. In this paper, we investigated the potential pathways involved in plasma cell replacement of normal cell populations in the spleen, with respect to disease severity in dogs from an endemic area for visceral leishmaniasis. To this end, canine spleen samples were grouped into three categories: TYPE1SC- (non-infected dogs or without active infection with organized white pulp, TYPE1SC+ (infected dogs with organized white pulp or TYPE3SC+ (infected animals with disorganized white pulp. We analyzed the distribution of different plasma cell isotypes (IgA, IgG and IgM in the spleen. The expression of cytokines and chemokines involved in plasma cell homing and survival were assessed by real time RT-PCR. Polyclonal B cell activation and hypergammaglobulinemia were also evaluated. The proportion of animals with moderate or intense plasmacytosis was higher in the TYPE3SC+ group than in the other groups (Fisher test, P<0.05. This was mainly due to a higher density of IgG+ plasma cells in the red pulp of this group. The albumin/globulin ratio was lower in the TYPE3SC+ animals than in the TYPE1SC- or TYPE1SC+ animals, which evidences VL-associated dysproteinemia. Interestingly, TYPE3SC+ animals showed increased expression of the BAFF and APRIL cytokines, as well as chemokine CXCL12. Aberrant expression of BAFF, APRIL and CXCL12, together with amplified extrafollicular B cell activation, lead to plasma cell homing and the extended survival of these cells in the splenic red pulp compartment. These changes in the distribution of immunocompetent cells in the spleen may contribute to the progression of VL, and impair the spleen's ability to protect against blood borne pathogens.

  7. Steroid hormones content and proteomic analysis of canine follicular fluid during the preovulatory period

    Directory of Open Access Journals (Sweden)

    Reynaud Karine

    2010-11-01

    Full Text Available Abstract Background Follicular fluid contains substances involved in follicle activity, cell differentiation and oocyte maturation. Studies of its components may contribute to better understanding of the mechanisms underlying follicular development and oocyte quality. The canine species is characterized by several ovarian activity features that are not extensively described such as preovulatory luteinization, oocyte ovulated at the GV stage (prophase 1 and poly-oocytic follicles. In this study, we examined the hypothesis that the preovulatory LH surge is associated with changes in steroid and protein content of canine follicular fluid prior to ovulation. Methods Follicular fluid samples were collected from canine ovaries during the preovulatory phase, before (pre-LH; n = 16 bitches and after (post-LH; n = 16 the LH surge. Blood was simultaneously collected. Steroids were assayed by radioimmunoassay and proteomic analyses were carried out by 2D-PAGE and mass spectrometry. Results The concentrations of 17beta-estradiol and progesterone at the pre-LH stage were 737.2 +/- 43.5 ng/ml and 2630.1 +/- 287.2 ng/ml in follicular fluid vs. 53 +/- 4.1 pg/ml and 3.9 +/- 0.3 ng/ml in plasma, respectively. At that stage, significant positive correlations between follicular size and intra-follicular steroid concentrations were recorded. After the LH peak, the intrafollicular concentration of 17beta-estradiol decreased significantly (48.3 +/- 4.4 ng/ml; p Proteomic analysis of canine follicular fluid identified 38 protein spots, corresponding to 21 proteins, some of which are known to play roles in the ovarian physiology. The comparison of 2D-PAGE patterns of follicular fluids from the pre- and post-LH stages demonstrated 3 differentially stained single spot or groups of spots. One of them was identified as complement factor B. A comparison of follicular fluid and plasma protein patterns demonstrated a group of 4 spots that were more concentrated in plasma than

  8. Binding of /sup 125/I-labeled endotoxin to bovine, canine, and equine platelets and endotoxin-induced agglutination of canine platelets

    Energy Technology Data Exchange (ETDEWEB)

    Meyers, K.M.; Boehme, M.; Inbar, O.

    1982-10-01

    Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.

  9. Kinetics of canine dental calculus crystallization: an in vitro study on the influence of inorganic components of canine saliva.

    Science.gov (United States)

    Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H

    2014-07-01

    This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Pro-tumorigenic effects of transforming growth factor beta 1 in canine osteosarcoma.

    Science.gov (United States)

    Portela, R F; Fadl-Alla, B A; Pondenis, H C; Byrum, M L; Garrett, L D; Wycislo, K L; Borst, L B; Fan, T M

    2014-01-01

    Transforming growth factor beta 1 (TGFβ1) is a pleiotropic cytokine that contributes to reparative skeletal remodeling by inducing osteoblast proliferation, migration, and angiogenesis. Organic bone matrix is the largest bodily reservoir for latent TGFβ1, and active osteoblasts express cognate receptors for TGFβ1 (TGFβRI and TGFβRII). During malignant osteolysis, TGFβ1 is liberated from eroded bone matrix and promotes local progression of osteotropic solid tumors by its mitogenic and prosurvival activities. Canine osteosarcoma (OS) cells will possess TGFβ1 signaling machinery. Blockade of TGFβ1 signaling will attenuate pro-tumorigenic activities in OS cells. Naturally occurring primary OS samples will express cognate TGFβ1 receptors; and in dogs with OS, focal malignant osteolysis will contribute to circulating TGFβ1 concentrations. Thirty-three dogs with appendicular OS. Expression of TGFβ1 and its cognate receptors, as well as the biologic effects of TGFβ1 blockade, was characterized in OS cells. Ten spontaneous OS samples were characterized for TGFβRI/II expressions by immunohistochemistry. In 33 dogs with OS, plasma TGFβ1 concentrations were quantified and correlated with bone resorption. Canine OS cells secrete TGFβ1, express cognate receptors, and TGFβ1 signaling blockade decreases proliferation, migration, and vascular endothelial growth factor secretion. Naturally occurring OS samples abundantly and uniformly express TGFβRI/II, and in OS-bearing dogs, circulating TGFβ1 concentrations correlate with urine N-telopeptide excretion. Canine OS cells possess TGFβ1 signaling machinery, potentially allowing for the establishment of an autocrine and paracrine pro-tumorigenic signaling loop. As such, TGFβ1 inhibitors might impede localized OS progression in dogs. Copyright © 2014 by the American College of Veterinary Internal Medicine.

  11. Platelets Inhibit Migration of Canine Osteosarcoma Cells.

    Science.gov (United States)

    Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C

    2017-01-01

    The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.

  12. SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.

    Science.gov (United States)

    Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi

    2017-10-01

    Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.

  13. Radioimmunoassay of canine growth hormone

    International Nuclear Information System (INIS)

    Eigenmann, J.E.; Eigenmann, R.Y.

    1981-01-01

    A sensitive radioimmunoassay (RIA) for canine growth hormone (GH) was developed. Antibodies were elicited in rhesus monkeys. One antiserum exhibited a working titer at a dilution of 1:500 000. Radioiodination was performed enzymatically employing lactoperoxidase. Logit-log transformation and least squares fitting resulted in straight line fitting of the standard curve between 0.39 and 50 ng/ml. Formation of large-molecular [ 125 I]GH during storage caused diminished assay sensitivity. Therefore [ 125 I]GH was re-purified by gel chromatography. Using this procedure, high and reproducible assay sensitivity was obtained. Tracer preparations were used for as long as 3 months after iodination. Diluted plasma from normal and acromegalic dogs resulted in a dose-response curve parallel to the standard curve. Canine prolactin exhibited a cross-reactivity of 2%. The within-assay coefficient of variation (CV) was 3.8 and the between-assay CV was 7.2%. Mean plasma GH concentration in normal dogs was 1.92 +- 0.14 ng/ml (mean +- SEM.) GH levels in acromegalic dogs were appreciably higher. Insulin-induced hypoglycaemia, arginine and ornithine administration resulted in inconsistent and sluggish GH increment. A better response was obtained by injecting a low dose of clonidine. Clonidine administration to hypopituitary dogs resulted in absent or poor GH increment. (author)

  14. Chlamydia in canine or feline coronary arteriosclerotic lesions

    Directory of Open Access Journals (Sweden)

    Grabarevic Zeljko

    2011-09-01

    Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.

  15. Chlamydia in canine or feline coronary arteriosclerotic lesions.

    Science.gov (United States)

    Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas

    2011-09-09

    There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.

  16. Blood Lead Toxicity Analysis of Multipurpose Canines and Military Working Dogs.

    Science.gov (United States)

    Reid, Paul; George, Clinton; Byrd, Christopher M; Miller, Laura; Lee, Stephen J; Motsinger-Reif, Alison; Breen, Matthew; Hayduk, Daniel W

    Special Operations Forces and their accompanying tactical multipurpose canines (MPCs) who are involved in repeated live-fire exercises and military operations have the potential for increased blood lead levels and toxicity due to aerosolized and environmental lead debris. Clinical lead-toxicity symptoms can mimic other medical disorders, rendering accurate diagnosis more challenging. The objective of this study was to examine baseline lead levels of MPCs exposed to indoor firing ranges compared with those of nontactical military working dogs (MWDs) with limited or no exposure to the same environment. In the second part of the study, results of a commercially available, human-blood lead testing system were compared with those of a benchtop inductively coupled plasma-mass spectrometry (ICP-MS) analysis technique. Blood samples from 18 MPCs were tested during routine clinical blood draws, and six samples from a canine group with limited exposure to environmental lead (nontactical MWDs) were tested for comparison. There was a high correlation between results of the commercial blood-testing system compared with ICP-MS when blood lead levels were higher than 4.0µg/dL. Both testing methods recorded higher blood lead levels in the MPC blood samples than in those of the nontactical MWDs, although none of the MPC samples tested contained lead levels approaching those at which symptoms of lead toxicity have previously been reported in animals (i.e., 35µg/dL). 2018.

  17. Headspace concentrations of explosive vapors in containers designed for canine testing and training: theory, experiment, and canine trials.

    Science.gov (United States)

    Lotspeich, Erica; Kitts, Kelley; Goodpaster, John

    2012-07-10

    It is a common misconception that the amount of explosive is the chief contributor to the quantity of vapor that is available to trained canines. In fact, this quantity (known as odor availability) depends not only on the amount of explosive material, but also the container volume, explosive vapor pressure and temperature. In order to better understand odor availability, headspace experiments were conducted and the results were compared to theory. The vapor-phase concentrations of three liquid explosives (nitromethane, nitroethane and nitropropane) were predicted using the Ideal Gas Law for containers of various volumes that are in use for canine testing. These predictions were verified through experiments that varied the amount of sample, the container size, and the temperature. These results demonstrated that the amount of sample that is needed to saturate different sized containers is small, predictable and agrees well with theory. In general, and as expected, once the headspace of a container is saturated, any subsequent increase in sample volume will not result in the release of more vapors. The ability of canines to recognize and alert to differing amounts of nitromethane has also been studied. In particular, it was found that the response of trained canines is independent of the amount of nitromethane present, provided it is a sufficient quantity to saturate the container in which it is held. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  18. Secretory pattern of canine growth hormone

    International Nuclear Information System (INIS)

    French, M.B.; Vaitkus, P.; Cukerman, E.; Sirek, A.; Sirek, O.V.

    1987-01-01

    The aim of this paper was to define the secretory pattern of growth hormone (GH) under basal conditions in fasted, conscious, male dogs accustomed to handling. Blood samples were withdrawn from a cephalic vein at 15-min intervals. In this way, any ultradian rhythms, if present, could be detected within the frequency range of 0.042-2 cycles/h. In addition, samples were drawn at either 1- or 2.5-min intervals for 2.5 or 5 h to determine whether frequency components greater than 2 cycles/h were present. GH was measured by radioimmunoassay and the raw data were submitted to time series analysis employing power spectral estimation by means of fast Fourier transformation techniques. Peak plasma levels were up to 12 times higher than the baseline concentration of ∼ 1 ng/ml. Spectral analysis revealed an endogenous frequency of 0.22 cycles/h, i.e., a periodicity of 4.5 h/cycle. The results indicate that under basal conditions the secretory bursts of canine GH are limited to one peak every 4.5 h

  19. The Effect of Using a Modified Dentoalveolar Distractor on Canine Angulation following Rapid Canine Retraction: A Split-mouth Design Randomized Controlled Trial.

    Science.gov (United States)

    Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y

    2016-01-01

    New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.

  20. Novel canine circovirus strains from Thailand: Evidence for genetic recombination.

    Science.gov (United States)

    Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E

    2018-05-14

    Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.

  1. Plasma procalcitonin concentrations are increased in dogs with sepsis

    Science.gov (United States)

    Goggs, Robert; Milloway, Matthew; Troia, Roberta; Giunti, Massimo

    2018-01-01

    Sepsis, the life-threatening organ dysfunction caused by a dysregulated host response to infection, is difficult to identify and to prognosticate for. In people with sepsis, procalcitonin (PCT) measurement aids diagnosis, enables therapeutic monitoring and improves prognostic accuracy. This study used a commercial canine PCT assay to measure plasma PCT concentrations in dogs with gastric dilatation volvulus (GDV) syndrome and in dogs with sepsis. It was hypothesised that dogs with GDV syndrome and with sepsis have greater plasma PCT concentrations than healthy dogs and that dogs with sepsis have greater PCT concentrations than dogs with GDV syndrome. Before analysing canine plasma samples, the ability of the assay to identify canine PCT, in addition to assay imprecision and the lower limit of detection were established. The assay had low imprecision with coefficients of variation ≤4.5 per cent. The lower limit of detection was 3.4 pg/ml. Plasma PCT concentrations were measured in 20 dogs with sepsis, in 32 dogs with GDV syndrome and in 52 healthy dogs. Median (IQR) PCT concentration in dogs with sepsis 78.7 pg/ml (39.1–164.7) was significantly greater than in healthy dogs 49.8 pg/ml (36.2–63.7) (P=0.019), but there were no significant differences between PCT concentrations in dogs with GDV syndrome and controls (P=0.072) or between dogs with sepsis and GDV syndrome (P=1.000). Dogs with sepsis have significantly increased plasma PCT concentrations compared with healthy dogs, although considerable overlap between these populations was identified. Future investigations should confirm this finding in other populations and evaluate the diagnostic and prognostic value of PCT in dogs with sepsis. PMID:29682292

  2. Influence of feeding on serum canine pancreatic lipase immunoreactivity concentrations

    Directory of Open Access Journals (Sweden)

    Steiner JM

    2014-10-01

    Full Text Available Jörg M Steiner, Craig G Ruaux, David A Williams Gastrointestinal Laboratory, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, USA Abstract: Measurement of serum concentration of pancreatic lipase immunoreactivity (PLI has been shown to be highly specific for exocrine pancreatic function and sensitive for the diagnosis of canine pancreatitis. Currently, it is recommended that food be withheld for at least 12 hours before collecting a blood sample for analysis from dogs. However, it is unknown whether feeding has any influence on serum canine PLI concentration. Thus, the goal of this study was to evaluate the influence of feeding on serum canine PLI concentrations in healthy dogs. Food was withheld from eight healthy adult Beagle dogs for at least 17 hours and a baseline serum sample (0 minutes was collected. Dogs were fed and serum samples were collected at 15, 30, 45, 60, 75, 90, 105, 150, 180, 210, 240, 300, 360, 420, and 480 minutes. There was no significant difference in serum canine PLI concentrations at any time after feeding (P=0.131. We conclude that feeding has no significant influence on serum canine PLI concentrations. Keywords: dog, pancreatic function, pancreatitis, biomarker, diagnostic test

  3. Molecular and serological surveillance of canine enteric viruses in stray dogs from Vila do Maio, Cape Verde.

    Science.gov (United States)

    Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis

    2014-04-23

    Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from

  4. Compensatory canine angulation in angle Class II and III patients

    Directory of Open Access Journals (Sweden)

    Mauro Carlos Agner Busato

    2009-09-01

    Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.

  5. Canine parvovirus in asymptomatic feline carriers.

    Science.gov (United States)

    Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D

    2012-05-25

    Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog

  6. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  7. Effect of sampling site, repeated sampling, pH, and PCO2 on plasma lactate concentration in healthy dogs.

    Science.gov (United States)

    Hughes, D; Rozanski, E R; Shofer, F S; Laster, L L; Drobatz, K J

    1999-04-01

    To characterize the variation in plasma lactate concentration among samples from commonly used blood sampling sites in conscious, healthy dogs. 60 healthy dogs. Cross-sectional study using a replicated Latin square design. Each dog was assigned to 1 of 6 groups (n = 10) representing all possible orders for 3 sites (cephalic vein, jugular vein, and femoral artery) used to obtain blood. Samples were analyzed immediately, by use of direct amperometry for pH, PO2, Pco2, glucose, and lactate concentration. Significant differences in plasma lactate concentrations were detected among blood samples from the cephalic vein (highest), femoral artery, and jugular vein (lowest). Mean plasma lactate concentration in the first sample obtained, irrespective of sampling site, was lower than in subsequent samples. Covariation was identified among plasma lactate concentration, pH, and PCO2, but correlation coefficients were low. Plasma lactate concentrations differed among blood samples from various sites. A reference range for plasma lactate concentration was 0.3 to 2.5 mmol/L. Differences in plasma lactate concentrations among samples from various sites and with repeated sampling, in healthy dogs, are small. Use of the reference range may facilitate the clinical use of plasma lactate concentration in dogs.

  8. Concomitant canine distemper, infectious canine hepatitis, canine parvoviral enteritis, canine infectious tracheobronchitis, and toxoplasmosis in a puppy.

    Science.gov (United States)

    Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes

    2013-01-01

    The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.

  9. Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.

    Science.gov (United States)

    Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D

    2000-12-01

    To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.

  10. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

    Directory of Open Access Journals (Sweden)

    Mostfa Shahabi

    2017-09-01

    Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.

  11. 51Cr-EDTA plasma clearance in severe renal failure determined by one plasma sample

    DEFF Research Database (Denmark)

    Kamper, A L; Nielsen, S L

    1989-01-01

    Two hundred and thirty-four measurements of standard 51Cr-EDTA plasma clearance were made in 50 patients with severe chronic renal failure. Based on these data two calculation methods were attempted using one plasma sample drawn 24 h after injection of 51Cr-EDTA. One of the methods used the 'one...... at zero-time was derived from injected dose and body surface area. This method might provide values 1.5 ml/min below or 0.8 ml/min above the established method of 51Cr-EDTA plasma clearance, which would be acceptable for clinical purposes. It is concluded that exact plasma clearance of 51Cr-EDTA in severe...... renal dysfunction (estimated clearance values below 21 ml/min) may be determined with adequate precision by one plasma sample drawn at 24 h after injection of the tracer without sampling at 5 h. This appears to be a very practical simplification....

  12. The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D

    Directory of Open Access Journals (Sweden)

    MarkéŽta Vaňkov‡á

    2016-01-01

    Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.

  13. Comparative trial of the canine parvovirus, canine distemper virus and canine adenovirus type 2 fractions of two commercially available modified live vaccines.

    Science.gov (United States)

    Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G

    2006-11-25

    The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.

  14. European canine lymphoma network consensus recommendations for reporting flow cytometry in canine hematopoietic neoplasms.

    Science.gov (United States)

    Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W

    2017-09-01

    Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.

  15. The Effects of Orthodontic Forces during Canine Retraction Using Self-ligating Brackets on Gingival Crevicular Fluid Enzyme Activity, Canine Movement and Root Resorption

    International Nuclear Information System (INIS)

    Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin

    2015-01-01

    Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)

  16. Comprehensive characterization of commercially available canine training aids.

    Science.gov (United States)

    Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A

    2014-09-01

    Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine

  17. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos

    Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  18. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.

    2011-01-01

    INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  19. A novel bocavirus in canine liver

    Directory of Open Access Journals (Sweden)

    Li Linlin

    2013-02-01

    Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.

  20. Expression, Purification and Characterization of Recombinant Canine FGF21 in Escherichia coli.

    Science.gov (United States)

    Zheng, Zhong; Yang, Chengjun; Yin, Ruofeng; Jiang, Jinxi; He, Haiting; Wang, Xinxin; Kan, Mujie; Xiao, Yechen

    2016-01-01

    The canine metabolic diseases, such as obesity and diabetes, have become a worldwide problem. Fibroblast growth factor 21 (FGF21) is a potent regulator which has many biological functions relative to metabolism regulation. It suggests that FGF21 plays important roles in regulating canine metabolic diseases. To acquire the recombinant canine FGF21 (rcFGF21) in Escherichia coli, the recombinant bacteria were induced by 0.5 mM IPTG for 16 hours at 16 °C, and the rcFGF21 protein was purified by Ni-NTA. 8 mg rcFGF21 was acquired from one liter bacteria. The rcFGF21 protein has specific immunoblot reactivity against anti-FGF21 and anti-His antibody. The in vivo experimental result showed that rcFGF21 can significantly reduce plasma glucose of STZ-induced diabetic mice.

  1. Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

    1999-08-02

    Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

  2. Experimental breakdown of selected anodized aluminum samples in dilute plasmas

    Science.gov (United States)

    Grier, Norman T.; Domitz, Stanley

    1992-01-01

    Anodized aluminum samples representative of Space Station Freedom structural material were tested for electrical breakdown under space plasma conditions. In space, this potential arises across the insulating anodized coating when the spacecraft structure is driven to a negative bias relative to the external plasma potential due to plasma-surface interaction phenomena. For anodized materials used in the tests, it was found that breakdown voltage varied from 100 to 2000 volts depending on the sample. The current in the arcs depended on the sample, the capacitor, and the voltage. The level of the arc currents varied from 60 to 1000 amperes. The plasma number density varied from 3 x 10 exp 6 to 10 exp 3 ions per cc. The time between arcs increased as the number density was lowered. Corona testing of anodized samples revealed that samples with higher corona inception voltage had higher arcing inception voltages. From this it is concluded that corona testing may provide a method of screening the samples.

  3. Expression of nociceptive ligands in canine osteosarcoma.

    Science.gov (United States)

    Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M

    2015-01-01

    Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.

  4. Canine faecal contamination and parasitic risk in the city of Naples (southern Italy

    Directory of Open Access Journals (Sweden)

    Veneziano Vincenzo

    2006-09-01

    Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between

  5. Occurrence of severe gastroenteritis in pups after canine parvovirus vaccine administration: a clinical and laboratory diagnostic dilemma.

    Science.gov (United States)

    Decaro, Nicola; Desario, Costantina; Elia, Gabriella; Campolo, Marco; Lorusso, Alessio; Mari, Viviana; Martella, Vito; Buonavoglia, Canio

    2007-01-26

    A total of 29 faecal samples collected from dogs with diarrhoea following canine parvovirus (CPV) vaccination were tested by minor groove binder (MGB) probe assays for discrimination between CPV vaccine and field strains and by diagnostic tests for detection of other canine pathogens. Fifteen samples tested positive only for CPV field strains; however, both vaccine and field strains were detected in three samples. Eleven samples were found to contain only the vaccine strain, although eight of them tested positive for other pathogens of dogs. Only three samples were found to contain the vaccine strain without evidence of canine pathogens. The present study confirms that most cases of parvovirus-like disease occurring shortly after vaccination are related to infection with field strains of canine parvovirus type 2 (CPV-2) rather than to reversion to virulence of the modified live virus contained in the vaccine.

  6. Estimation of technetium 99m mercaptoacetyltriglycine plasma clearance by use of one single plasma sample

    International Nuclear Information System (INIS)

    Mueller-Suur, R.; Magnusson, G.; Karolinska Inst., Stockholm; Bois-Svensson, I.; Jansson, B.

    1991-01-01

    Recent studies have shown that technetium 99m mercaptoacetyltriglycine (MAG-3) is a suitable replacement for iodine 131 or 123 hippurate in gamma-camera renography. Also, the determination of its clearance is of value, since it correlates well with that of hippurate and thus may be an indirect measure of renal plasma flow. In order to simplify the clearance method we developed formulas for the estimation of plasma clearance of MAG-3 based on a single plasma sample and compared them with the multiple sample method based on 7 plasma samples. The correlation to effective renal plasma flow (ERPF) (according to Tauxe's method, using iodine 123 hippurate), which ranged from 75 to 654 ml/min per 1.73 m 2 , was determined in these patients. Using the developed regression equations the error of estimate for the simplified clearance method was acceptably low (18-14 ml/min), when the single plasma sample was taken 44-64 min post-injection. Formulas for different sampling times at 44, 48, 52, 56, 60 and 64 min are given, and we recommend 60 min as optimal, with an error of estimate of 15.5 ml/min. The correlation between the MAG-3 clearances and ERPF was high (r=0.90). Since normal values for MAG-3 clearance are not yet available, transformation to estimated ERPF values by the regression equation (ERPF=1.86xC MAG-3 +4.6) could be of clinical value in order to compare it with the normal values for ERPF given in the literature. (orig.)

  7. Blood sampling and hemolysis affect concentration of plasma metabolites

    DEFF Research Database (Denmark)

    Theil, Peter Kappel; Pedersen, Lene Juul; Jensen, Margit Bak

    2012-01-01

    design and blood was collected after restraint via vein puncture 1, 4, 11, and 23 h after morning feeding. Plasma samples were categorized as without or with minor or major hemolysis [clear (n = 218), yellow (n = 97), or red (n = 37)] upon centrifugation. Plasma NEFA (P ...Two experiments were carried out to reveal and quantify plasma metabolites that are sensitive to hemolysis and animal stress due to the blood sampling procedure (vein puncture vs. catheter). In Exp. 1, 48 sows were fed 4 diets either once (0800 h) or twice daily (0800 h and 1500 h) in a crossover......, a subset of samples from 24 sows fed twice daily in Exp. 1 was combined with data obtained from 30 sows sampled using jugular vein catheters. All sows in Exp. 2 were fed twice daily (0800 h and 1500 h) and blood samples collected repeatedly 1, 4, 11, and 23 h after morning feeding (other conditions were...

  8. Comparison of the platelet-rich plasma and buffy coat protocols for preparation of canine platelet concentrates.

    Science.gov (United States)

    Hoareau, Guillaume L; Jandrey, Karl E; Burges, Julie; Bremer, Daphne; Tablin, Fern

    2014-12-01

    Platelet (PLT) concentrates (PC) can be produced via the buffy coat (BC) or platelet-rich plasma (PRP) protocols. The 2 methods have not been compared with canine blood. The aims of the study were to compare the PLT, WBC, and RBC concentrations, in vitro PLT function, and markers of platelet storage lesion (PSL) in canine PC generated by 2 different protocols, and determine microbial growth throughout storage. PC from 8 healthy donor dogs were produced using 2 standard protocols, PRP and BC. PLT, WBC, and RBC counts, optical aggregometry assays, and PSL markers (pH, pCO2 , HCO3 , lactate and glucose concentrations, and LDH activity) were determined on storage days 0, 1, 3, 5, and 7. Aerobic and anaerobic bacterial cultures were also performed. Mean PLT counts were comparable between protocols and remained stable throughout storage up to day 7, while median WBC and RBC counts on day 0 were significantly higher in the BC-PC group (17,800 WBCs/μL; 195,000 RBCs/μL) than in the PRP-PC group (200 WBCs/μL; 10,000 RBCs/μL) (P = .012). In PRP-PC aggregometry, the median slope and amplitude in response to γ-thrombin and convulxin (+ ADP) were significantly decreased, and virtually absent in BC-PC during storage. PSL markers (lactate, LDH activity) were higher in BC-PC. Aerobic bacterial growth was observed in 2 PRP-PC and 1 BC-PC. This in vitro study suggests that PRP-PC had lesser WBC and RBC contamination and superior PLT function compared with BC-PC. In vivo studies are required to address safety and efficacy of PRP-PC. © 2014 American Society for Veterinary Clinical Pathology.

  9. Surface studies of plasma processed Nb samples

    International Nuclear Information System (INIS)

    Tyagi, Puneet V.; Doleans, Marc; Hannah, Brian S.; Afanador, Ralph; Stewart, Stephen; Mammosser, John; Howell, Matthew P; Saunders, Jeffrey W; Degraff, Brian D; Kim, Sang-Ho

    2015-01-01

    Contaminants present at top surface of superconducting radio frequency (SRF) cavities can act as field emitters and restrict the cavity accelerating gradient. A room temperature in-situ plasma processing technology for SRF cavities aiming to clean hydrocarbons from inner surface of cavities has been recently developed at the Spallation Neutron Source (SNS). Surface studies of the plasma-processed Nb samples by Secondary ion mass spectrometry (SIMS) and Scanning Kelvin Probe (SKP) showed that the NeO_2 plasma processing is very effective to remove carbonaceous contaminants from top surface and improves the surface work function by 0.5 to 1.0 eV.

  10. DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA.

    Science.gov (United States)

    Folitse, R D; Kodie, D O; Amemor, E; Dei, D; Tasiame, W; Burimuah, V; Emikpe, B O

    2018-01-01

    Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT ® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α 0.05 . We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection.

  11. DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA

    Science.gov (United States)

    Folitse, R. D; Kodie, D.O; Amemor, E.; Dei, D.; Tasiame, W.; Burimuah, V.; Emikpe, B.O

    2018-01-01

    Background: Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Materials and Methods: Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α0.05 Results: We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. Conclusion: The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection. PMID:29302647

  12. Platelet-Rich Plasma Favors Proliferation of Canine Adipose-Derived Mesenchymal Stem Cells in Methacrylate-Endcapped Caprolactone Porous Scaffold Niches

    Directory of Open Access Journals (Sweden)

    Victoria Moreno-Manzano

    2012-08-01

    Full Text Available Osteoarticular pathologies very often require an implementation therapy to favor regeneration processes of bone, cartilage and/or tendons. Clinical approaches performed on osteoarticular complications in dogs constitute an ideal model for human clinical translational applications. The adipose-derived mesenchymal stem cells (ASCs have already been used to accelerate and facilitate the regenerative process. ASCs can be maintained in vitro and they can be differentiated to osteocytes or chondrocytes offering a good tool for cell replacement therapies in human and veterinary medicine. Although ACSs can be easily obtained from adipose tissue, the amplification process is usually performed by a time consuming process of successive passages. In this work, we use canine ASCs obtained by using a Bioreactor device under GMP cell culture conditions that produces a minimum of 30 million cells within 2 weeks. This method provides a rapid and aseptic method for production of sufficient stem cells with potential further use in clinical applications. We show that plasma rich in growth factors (PRGF treatment positively contributes to viability and proliferation of canine ASCs into caprolactone 2-(methacryloyloxy ethyl ester (CLMA scaffolds. This biomaterial does not need additional modifications for cASCs attachment and proliferation. Here we propose a framework based on a combination of approaches that may contribute to increase the therapeutical capability of stem cells by the use of PRGF and compatible biomaterials for bone and connective tissue regeneration.

  13. Platelet-Rich Plasma Favors Proliferation of Canine Adipose-Derived Mesenchymal Stem Cells in Methacrylate-Endcapped Caprolactone Porous Scaffold Niches

    Science.gov (United States)

    Rodríguez-Jiménez, Francisco Javier; Valdes-Sánchez, Teresa; Carrillo, José M.; Rubio, Mónica; Monleon-Prades, Manuel; García-Cruz, Dunia Mercedes; García, Montserrat; Cugat, Ramón; Moreno-Manzano, Victoria

    2012-01-01

    Osteoarticular pathologies very often require an implementation therapy to favor regeneration processes of bone, cartilage and/or tendons. Clinical approaches performed on osteoarticular complications in dogs constitute an ideal model for human clinical translational applications. The adipose-derived mesenchymal stem cells (ASCs) have already been used to accelerate and facilitate the regenerative process. ASCs can be maintained in vitro and they can be differentiated to osteocytes or chondrocytes offering a good tool for cell replacement therapies in human and veterinary medicine. Although ACSs can be easily obtained from adipose tissue, the amplification process is usually performed by a time consuming process of successive passages. In this work, we use canine ASCs obtained by using a Bioreactor device under GMP cell culture conditions that produces a minimum of 30 million cells within 2 weeks. This method provides a rapid and aseptic method for production of sufficient stem cells with potential further use in clinical applications. We show that plasma rich in growth factors (PRGF) treatment positively contributes to viability and proliferation of canine ASCs into caprolactone 2-(methacryloyloxy) ethyl ester (CLMA) scaffolds. This biomaterial does not need additional modifications for cASCs attachment and proliferation. Here we propose a framework based on a combination of approaches that may contribute to increase the therapeutical capability of stem cells by the use of PRGF and compatible biomaterials for bone and connective tissue regeneration. PMID:24955632

  14. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

    OpenAIRE

    Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch

    2017-01-01

    Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...

  15. Comparison of noninvasive sample collection procedures for canine leishmaniasis diagnosis by PCR-hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Sidney de Almeida; Andrade, Antero Silva Ribeiro de [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)]. E-mail: vidasnino@yahoo.com.br; antero@cdtn.br; Ituassu, Leonardo Trindade; Melo, Maria Norma de [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)]. E-mail: melo@mono.icb.ufmg.br; ltituassu@yahoo.com.br

    2007-07-01

    The dogs are the main reservoir of the visceral leishmaniasis etiological agent Leishmania chagasi and these animals have to be systematically monitored. The aim of present work was to standardize a method for canine leishmaniasis diagnosis using DNA samples obtained by a noninvasive ways. Two kind of samples were compared: conjunctival swab and blood. The samples were analyzed by the Polymerase Chain Reaction (PCR) associated with the hybridization of {sup 32}P labeled DNA probes. An in vitro test was carried out using cotton swabs seeded with L. chagasi parasites at different cell numbers. After that, the PCR and hybridization sensitivity was evaluated in two groups of 23 seropositive dogs. Conjunctival swabs and 1,0 mL of blood were collected from each animal. 90 {mu}L of these blood were spotted onto filter paper and the remaining used to prepare the buffy coat. The DNA purification from cotton swabs was carried out through the phenol-chloroform (group 1) or boiling (group 2). The Wizard kit was used to DNA extraction from buffy coat. The filters were treated according to Dialab protocol. The analysis of the seeded samples showed that the PCR was able to identify until ten parasites while the following hybridization of the PCR products allows the detection of until one parasite. The PCR positivity for the conjunctival swabs were 73.9% and 52.2% respectively to the groups 1 and 2. For buffy coat the positivities were 43.5% and 56.5% respectively. The filters presented the lowest positivity. The hybridization step was not accomplished yet for these samples. (author)

  16. Cracks and nanodroplets produced on tungsten surface samples by dense plasma jets

    Science.gov (United States)

    Ticoş, C. M.; Galaţanu, M.; Galaţanu, A.; Luculescu, C.; Scurtu, A.; Udrea, N.; Ticoş, D.; Dumitru, M.

    2018-03-01

    Small samples of 12.5 mm in diameter made from pure tungsten were exposed to a dense plasma jet produced by a coaxial plasma gun operated at 2 kJ. The surface of the samples was analyzed using a scanning electron microscope (SEM) before and after applying consecutive plasma shots. Cracks and craters were produced in the surface due to surface tensions during plasma heating. Nanodroplets and micron size droplets could be observed on the samples surface. An energy-dispersive spectroscopy (EDS) analysis revealed that the composition of these droplets coincided with that of the gun electrode material. Four types of samples were prepared by spark plasma sintering from powders with the average particle size ranging from 70 nanometers up to 80 μm. The plasma power load to the sample surface was estimated to be ≈4.7 MJ m-2 s-1/2 per shot. The electron temperature and density in the plasma jet had peak values 17 eV and 1.6 × 1022 m-3, respectively.

  17. Genomic instability and telomere fusion of canine osteosarcoma cells.

    Directory of Open Access Journals (Sweden)

    Junko Maeda

    Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.

  18. Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

    International Nuclear Information System (INIS)

    Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.

    1974-01-01

    Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

  19. Comparison of miRNA quantitation by Nanostring in serum and plasma samples.

    Directory of Open Access Journals (Sweden)

    Catherine Foye

    Full Text Available Circulating microRNAs that are associated with specific diseases have garnered much attention for use in diagnostic assays. However, detection of disease-associated miRNA can be affected by several factors such as release of contaminating cellular miRNA during sample collection, variations due to amplification of transcript for detection, or controls used for normalization for accurate quantitation. We analyzed circulating miRNA in serum and plasma samples obtained concurrently from 28 patients, using a Nanostring quantitative assay platform. Total RNA concentration ranged from 32-125 μg/ml from serum and 30-220 μg/ml from plasma. Of 798 miRNAs, 371 miRNAs were not detected in either serum or plasma samples. 427 were detected in either serum or plasma but not both, whereas 151 miRNA were detected in both serum and plasma samples. The diversity of miRNA detected was greater in plasma than in serum samples. In serum samples, the number of detected miRNA ranged from 3 to 82 with a median of 17, whereas in plasma samples, the number of miRNA detected ranged from 25 to 221 with a median of 91. Several miRNA such as miR451a, miR 16-5p, miR-223-3p, and mir25-3p were highly abundant and differentially expressed between serum and plasma. The detection of endogenous and exogenous control miRNAs varied in serum and plasma, with higher levels observed in plasma. Gene expression stability identified candidate invariant microRNA that were highly stable across all samples, and could be used for normalization. In conclusion, there are significant differences in both the number of miRNA detected and the amount of miRNA detected between serum and plasma. Normalization using miRNA with constant expression is essential to minimize the impact of technical variations. Given the challenges involved, ideal candidates for blood based biomarkers would be those that are indifferent to type of body fluid, are detectable and can be reliably quantitated.

  20. LC-MS analysis of the plasma metabolome–a novel sample preparation strategy

    DEFF Research Database (Denmark)

    Skov, Kasper; Hadrup, Niels; Smedsgaard, Jørn

    2015-01-01

    Blood plasma is a well-known body fluid often analyzed in studies on the effects of toxic compounds as physiological or chemical induced changes in the mammalian body are reflected in the plasma metabolome. Sample preparation prior to LC-MS based analysis of the plasma metabolome is a challenge...... as plasma contains compounds with very different properties. Besides, proteins, which usually are precipitated with organic solvent, phospholipids, are known to cause ion suppression in electrospray mass spectrometry. We have compared two different sample preparation techniques prior to LC-qTOF analysis...... of plasma samples: The first is protein precipitation; the second is protein precipitation followed by solid phase extraction with sub-fractionation into three sub-samples; a phospholipid, a lipid and a polar sub-fraction. Molecular feature extraction of the data files from LC-qTOF analysis of the samples...

  1. The effect of two packaging systems on the post-thaw characteristics of canine sperm.

    Science.gov (United States)

    Strzeżek, R; Polakiewicz, P; Kordan, W

    2015-01-01

    The aim of this study was to compare the effect of different packaging systems on some parameters of cryopreserved canine spermatozoa. The experimental material consisted of the sperm-rich fractions of ejaculates collected from four Beagle dogs. Semen samples for cryopreservation were stored in 0.25 ml plastic straws and two aluminum tubes with a total volume of 5.0 ml. Semen was frozen in static nitrogen vapor for 10 minutes (0.25 ml straws) or 15 and 20 minutes (aluminum tubes). Post-thaw assessments involved the determination of sperm motility parameters using a computer assisted sperm analyzer (CASA), sperm plasma membrane integrity (SPMI), mitochondrial membrane potential (MMP) and acrosome integrity (normal apical ridge, NAR). Regardless of the packaging system applied, no significant differences in total sperm motility (TMOT) or selected kinematic parameters were observed after freezing-thawing. However, spermatozoa frozen in 0.25 mL straws were characterized by improved functionality, in particular mitochondrial function, after thawing. The results indicate that large quantities of canine semen can be frozen in aluminum tubes. Further studies are required, however, to evaluate different freezing and thawing rates of aluminum tubes.

  2. Detection of canine distemper virus nucleocapsid protein gene in canine peripheral blood mononuclear cells by RT-PCR.

    Science.gov (United States)

    Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T

    1995-06-01

    For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.

  3. Age estimation by canines' pulp/tooth ratio in an Iranian population using digital panoramic radiography.

    Science.gov (United States)

    Dehghani, Mahdieh; Shadkam, Elaheh; Ahrari, Farzaneh; Dehghani, Mahboobe

    2018-04-01

    Age estimation in adults is an important issue in forensic science. This study aimed to estimate the chronological age of Iranians by means of pulp/tooth area ratio (AR) of canines in digital panoramic radiographs. The sample consisted of panoramic radiographs of 271 male and female subjects aged 16-64 years. The pulp/tooth area ratio (AR) of upper and lower canines was calculated by AutoCAD software. Data were subjected to correlation and regression analysis. There was a significant and inverse correlation between age and pulp/tooth area ratio of upper and lower canines (r=-0.794 for upper canine and r=-0.282 for lower canine; p-value<0.001). Linear regression equations were derived separately for upper, lower and both canines. The mean difference between actual and estimated age using upper canine was 6.07±1.7. The results showed that the pulp/tooth area ratios of canines are a reliable method for age estimation in Iranians. The pulp/tooth area ratio of upper canine was better correlated with chronological age than that of lower canine. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. [Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

    Science.gov (United States)

    Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

    2012-11-04

    To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

  5. Detection of canine pneumovirus in dogs with canine infectious respiratory disease.

    Science.gov (United States)

    Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe

    2013-12-01

    Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.

  6. Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jong-Hyuk, E-mail: jhkim@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Robinson, Sally [Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Sharkey, Leslie C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); O' Brien, Timothy D. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Dickerson, Erin B. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Modiano, Jaime F., E-mail: modiano@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States)

    2014-04-15

    Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

  7. Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

    International Nuclear Information System (INIS)

    Kim, Jong-Hyuk; Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C.; Robinson, Sally; Sharkey, Leslie C.; O'Brien, Timothy D.; Dickerson, Erin B.; Modiano, Jaime F.

    2014-01-01

    Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

  8. Canine scent detection and microbial source tracking of human waste contamination in storm drains.

    Science.gov (United States)

    Van De Werfhorst, Laurie C; Murray, Jill L S; Reynolds, Scott; Reynolds, Karen; Holden, Patricia A

    2014-06-01

    Human fecal contamination of surface waters and drains is difficult to diagnose. DNA-based and chemical analyses of water samples can be used to specifically quantify human waste contamination, but their expense precludes routine use. We evaluated canine scent tracking, using two dogs trained to respond to the scent of municipal wastewater, as a field approach for surveying human fecal contamination. Fecal indicator bacteria, as well as DNA-based and chemical markers of human waste, were analyzed in waters sampled from canine scent-evaluated sites (urban storm drains and creeks). In the field, the dogs responded positively (70% and 100%) at sites for which sampled waters were then confirmed as contaminated with human waste. When both dogs indicated a negative response, human waste markers were absent. Overall, canine scent tracking appears useful for prioritizing sampling sites for which DNA-based and similarly expensive assays can confirm and quantify human waste contamination.

  9. Polymerase spiral reaction (PSR): a novel, visual isothermal amplification method for detection of canine parvovirus 2 genomic DNA.

    Science.gov (United States)

    Gupta, Vikas; Chakravarti, Soumendu; Chander, Vishal; Majumder, Saurabh; Bhat, Shabir Ahmad; Gupta, Vivek Kumar; Nandi, Sukdeb

    2017-07-01

    Canine parvovirus-2 (CPV-2), which is ubiquitously distributed worldwide, causes severe and often fatal gastroenteritis in dogs. Accurate, differential and rapid diagnosis of canine parvoviral enteritis remains a challenge for clinicians. A recently developed isothermal amplification technique, polymerase spiral reaction (PSR), was optimized for the first time for a viral pathogen with reference recombinant plasmid standards from different CPV-2 antigenic variants (CPV-2, CPV-2a, CPV-2b and CPV-2c) and subsequently validated using clinical samples. Addition of chromogenic substrate SYBR Green I after the completion of the reaction resulted in bright green fluorescence in positive samples, while negative samples and a no-template control remained orange. These results were further substantiated through visualization of a laddering pattern of the PSR-amplified product in an agarose gel in positive cases and the absence of this pattern in no-template control and negative samples. The PSR assay was found to be highly specific, as it did not react with other putative canine pathogens (canine adenovirus 1 and canine distemper virus). The sensitivity of the newly developed PSR technique was compared with that of conventional PCR, real-time PCR and LAMP, using a serial tenfold dilution of canine parvovirus DNA. The detection limit of PSR was found to be at the femtogram level, which is comparable with that of real-time PCR and LAMP, which are ten times more sensitive than conventional PCR. The assay was validated using 90 clinical samples, of which 54 were found positive, while only 45 samples were positive in conventional PCR. This novel assay, which is fully compliant with the 'ASSURED' concept for disease diagnosis, provides a simple, rapid, specific, sensitive and cost-effective method for diagnosis of canine parvoviral enteritis in veterinary clinics.

  10. Nd : YAG surgical laser effects in canine prostate tissue: temperature and damage distribution

    NARCIS (Netherlands)

    van Nimwegen, S. A.; L'Eplattenier, H. F.; Rem, A. I.; van der Lugt, J. J.; Kirpensteijn, J.

    2009-01-01

    An in vitro model was used to predict short-term, laser-induced, thermal damage in canine prostate tissue. Canine prostate tissue samples were equipped with thermocouple probes to measure tissue temperature at 3, 6, 9 and 12 mm depths. The tissue surface was irradiated with a Nd:YAG laser in contact

  11. Detection of a group 2 coronavirus in dogs with canine infectious respiratory disease

    International Nuclear Information System (INIS)

    Erles, Kerstin; Toomey, Crista; Brooks, Harriet W.; Brownlie, Joe

    2003-01-01

    An investigation into the causes of canine infectious respiratory disease was carried out in a large rehoming kennel. Tissue samples taken from the respiratory tract of diseased dogs were tested for the presence of coronaviruses using RT-PCR with conserved primers for the polymerase gene. Sequence analysis of four positive samples showed the presence of a coronavirus with high similarity to both bovine and human coronavirus (strain OC43) in their polymerase and spike genes, whereas there was a low similarity to comparable genes in the enteric canine coronavirus. This canine respiratory coronavirus (CRCV) was detected by RT-PCR in 32/119 tracheal and 20/119 lung samples, with the highest prevalence being detected in dogs with mild clinical symptoms. Serological analysis showed that the presence of antibodies against CRCV on the day of entry into the kennel decreased the risk of developing respiratory disease

  12. An evaluation of the histological effects of intra-articular methadone in the canine model.

    Science.gov (United States)

    Jones, Timothy A; Hand, Walter R; Ports, Michael D; Unger, Daniel V; Herbert, Daniel; Pellegrini, Joseph E

    2003-02-01

    Methadone hydrochloride is an opiate that has pharmacodynamic and pharmacokinetic properties that suggest it may provide longer analgesia than morphine when administered via the intra-articular route. However, no studies to date have been conducted examining the effects of intra-articular methadone hydrochloride on local tissues. Therefore, the purpose of this study was to determine the histopathologic effects of intra-articular methadone hydrochloride on local tissues in the canine knee. Nine canines, 1 to 4 years old, weighing between 20 kg and 23 kg were used. All canines had their knees randomized to receive either bupivacaine, 0.5% with epinephrine 1:200,000 (4.5 mL), and 5 mg methadone hydrochloride (0.5 mL) for the study knee, or bupivacaine, 0.5% with epinephrine 1:200,000 (4.5 mL), and 0.5 mL normal saline for the control knee. Serum methadone hydrochloride levels were obtained on all canines at 6 and 24 hours. Canines were randomly assigned to 1 of 3 groups to be euthanized at either 24 hours, 14 days, or 28 days. Following euthanization and necropsy, synovial fluid levels and tissue samples were obtained and examined for histopathologic changes. Synovial fluid samples noted a few white blood cells at 24 hours and none at 14 and 28 days. Tissue samples showed no histopathologic changes, and serum concentration levels of methadone hydrochloride were negligible.

  13. IFCC guideline for sampling, measuring and reporting ionized magnesium in plasma

    DEFF Research Database (Denmark)

    Rayana, M.C. Ben; Burnett, R.W.; Covington, A.K.

    2008-01-01

    Analyzers with ion-selective electrodes (ISEs) for ionized magnesium (iMg) should yield comparable and unbiased results for iMg. This IFCC guideline on sampling, measuring and reporting iMg in plasma provides a prerequisite to achieve this goal [in this document, "plasma" refers to circulating...... plasma and the forms in which it is sampled, namely the plasma phase of anticoagulated whole blood (or "blood"), plasma separated from blood cells, or serum]. The guideline recommends measuring and reporting ionized magnesium as a substance concentration relative to the substance concentration...... of magnesium in primary aqueous calibrants with magnesium, sodium, and calcium chloride of physiological ionic strength. The recommended name is "the concentration of ionized magnesium in plasma". Based on this guideline, results will be approximately 3% higher than the true substance concentration and 4...

  14. Homologous radioimmunoassay for canine prolactin and its application in various physiological states

    International Nuclear Information System (INIS)

    Graef, K.-J.; Friedreich, E.; Matthes, S.; Hasan, S.H.

    1977-01-01

    The purification of canine prolactin and the development of an homologous radioimmunoassay including several physiological studies in the Beagle dog are described. The assay measured immunoreactive canine prolactin with a sensitivity limit of 0.6 ng/ml. Purified canine luteinizing hormone gave no significant inhibition in the assay whereas purified canine growth hormone inhibited the binding of 125 I-labelled canine prolactin to antiserum only at very high dose levels. In Beagle dogs, basal serum prolactin concentrations were in the range 1 to 2 ng/ml in normal male, normal female (metoestrus and anoestrus) and oophorectomized-hysterectomized female dogs. The prolactin concentration in one sample of amniotic fluid was in the same range, while in hypophysectomized make dogs no serum prolactin could be detected by the assay system. Serum prolactin concentrations tended to increase during late pregnancy and parturition, remaining high during the first 9 days of lactation. In consequence, a negative correlation was suggested between serum prolactin and serum progesterone concentrations. (author)

  15. Detection and genetic characterization of Canine parvovirus and Canine coronavirus strains circulating in district of Tirana in Albania.

    Science.gov (United States)

    Cavalli, Alessandra; Desario, Costantina; Kusi, Ilir; Mari, Viviana; Lorusso, Eleonora; Cirone, Francesco; Kumbe, Ilirjan; Colaianni, Maria Loredana; Buonavoglia, Domenico; Decaro, Nicola

    2014-07-01

    An epidemiological survey for Canine parvovirus 2 (CPV-2) and Canine coronavirus (CCoV) was conducted in Albania. A total of 57 fecal samples were collected from diarrheic dogs in the District of Tirana during 2011-2013. The molecular assays detected 53 and 31 CPV- and CCoV-positive specimens, respectively, with mixed CPV-CCoV infections diagnosed in 28 dogs. The most frequently detected CPV type was 2a, whereas IIa was the predominant CCoV subtype. A better comprehension of the CPV-CCoV epidemiology in eastern European countries will help to assess the most appropriate vaccination strategies to prevent disease due to infections with these widespread agents of acute gastroenteritis in the dog.

  16. Eruption of the maxillary canines in relation to skeletal maturity.

    Science.gov (United States)

    Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica

    2008-05-01

    Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.

  17. The Effect of Using Self-ligating Brackets on Maxillary Canine Retraction: A Split-mouth Design Randomized Controlled Trial.

    Science.gov (United States)

    Hassan, Siba E; Hajeer, Mohammad Y; Alali, Osama H; Kaddah, Ayham S

    2016-06-01

    The results of previous studies about the efficacy of using self-ligating brackets (SLBs) in controlling canine movement during retraction are not in harmony. Therefore, the current study aimed to compare the effects of using new passive SLBs on maxillary canine retraction with sliding mechanics vs conventional ligating brackets (CLBs) tied with metal ligatures. The sample comprised 15 adult patients (4 males, 11 females; 18-24 years) requiring bilateral extraction of maxillary first premolars. Units of randomization are the left or right maxillary canines within the same patient. The two maxillary canines in each patient were randomly assigned to one of the two groups in a simple split-mouth design. The canines in the SLBs group (n = 15) were bracketed with SLBs (Damon Q™), while the canines in the CLBs group (n = 15) were bracketed with conventional brackets (Mini Master Series). Transpalatal bars were used for anchorage. After leveling and alignment, 0.019 × 0.025" stainless steel working archwires were placed. Canines were retracted using a nickel-titanium close-coil springs with a 150 gm force. The amount and rate of maxillary canine retraction, canine rotation, and loss of anchorage were measured on study models collected at the beginning of canine retraction (T0) and 12 weeks later (T1). Differences were analyzed using paired-samples t-tests. The effect differences were statistically significant (p brackets gave better results compared to the CLBs in terms of rate of movement, amount of canine rotation following extraction, and anchorage loss.

  18. Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma.

    Science.gov (United States)

    Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid

    2016-01-01

    Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma.

  19. Measurement of lower canine clinical crown index in male and female for gender identification

    Directory of Open Access Journals (Sweden)

    Rita Dewi Handayani

    2007-11-01

    Full Text Available The purpose of this research was to acquire the value index of clinical crown lower jaw canine male and female, and to prove whether the index of male's canine is bigger than female's. The samples of the research was the students of Faculty of Dentistry Universitas Padjadjaran class of 1998 until 2001 by using proportional random sampling method according to the criteria and also adjust with the numbers of male and female composition in per class. The characteristic of the research was analytical descriptive with survey technique. The result of t test statistic measurement was that index of clinical crown tower jaw canine of mate was 1.50 and female was 1.21, by using reliance 95%. The inference of the research showed that the index of clinical crown lower jaw canine of male was significantly bigger than female's. The result of the research can be used as auxiliary data from the techniques to process gender identification in odontology forensic.

  20. Molecular characterization of canine parvovirus in Vientiane, Laos.

    Science.gov (United States)

    Vannamahaxay, Soulasack; Vongkhamchanh, Souliya; Intanon, Montira; Tangtrongsup, Sahatchai; Tiwananthagorn, Saruda; Pringproa, Kidsadagon; Chuammitri, Phongsakorn

    2017-05-01

    The global emergence of canine parvovirus type 2c (CPV-2c) has been well documented. In the present study, 139 rectal swab samples collected from diarrheic dogs living in Vientiane, Laos, in 2016 were tested for the presence of the canine parvovirus (CPV) VP2 gene by PCR. The results showed that 82.73% (115/139) of dogs were CPV positive by PCR. The partial VP2 gene was sequenced in 94 of the positive samples; 91 samples belonged to CPV-2c (426Glu) subtype, while 3 samples belonged to the CPV-2a (426Asn) subtype. Notably, phylogenetic analysis of amino acid sequences revealed a close relationship between Laotian isolates and novel Chinese CPV-2c isolates. In Laotian CPV isolates, aligned protein sequences indicated a high rate of residue substitutions at positions 305, 324, 345, 370, 375, and 426 in the GH loop. The mutation at residue 370 (Q370R), a single mutation, was characterized as a unique mutant residue specific to the Laotian CPV-2c variant.

  1. Three-year serologic immunity against canine parvovirus type 2 and canine adenovirus type 2 in dogs vaccinated with a canine combination vaccine.

    Science.gov (United States)

    Larson, L J; Schultz, R D

    2007-01-01

    A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.

  2. Expression of monocarboxylate transporter 1 in oral and ocular canine melanocytic tumors.

    Science.gov (United States)

    Shimoyama, Y; Akihara, Y; Kirat, D; Iwano, H; Hirayama, K; Kagawa, Y; Ohmachi, T; Matsuda, K; Okamoto, M; Kadosawa, T; Yokota, H; Taniyama, H

    2007-07-01

    Solid tumors are composed of a heterogeneous population of cells surviving in various concentrations of oxygen. In a hypoxic environment, tumor cells generally up-regulate glycolysis and, therefore, generate more lactate that must be expelled from the cell through proton transporters to prevent intracellular acidosis. Monocarboxylate transporter 1 (MCT1) is a major proton transporter in mammalian cells that transports monocarboxylates, such as lactate and pyruvate, together with a proton across the plasma membrane. Melanocytic neoplasia occurs frequently in dogs, but the prognosis is highly site-dependent. In this study, 50 oral canine melanomas, which were subdivided into 3 histologic subtypes, and 17 ocular canine melanocytic neoplasms (14 melanocytomas and 3 melanomas) were used to examine and compare MCT1 expression. Immunohistochemistry using a polyclonal chicken anti-rat MCT1 antibody showed that most oral melanoma exhibited cell membrane staining, although there were no significant differences observed among the 3 histologic subtypes. In contrast, the majority of ocular melanocytic tumors were not immunoreactive. Additionally, we documented the presence of a 45-kDa band in cell membrane protein Western blots, and sequencing of a reverse transcriptase polymerase chain reaction band of expected size confirmed its identity as a partial canine MCT1 transcript in 3 oral tumors. Increased MCT1 expression in oral melanomas compared with ocular melanocytic tumors may reflect the very different biology between these tumors in dogs. These results are the first to document canine MCT1 expression in canine tumors and suggest that increased MCT1 expression may provide a potential therapeutic target for oral melanoma.

  3. Frequency, antimicrobial susceptibility and clonal distribution of methicillin-resistant Staphylococcus pseudintermedius in canine clinical samples submitted to a veterinary diagnostic laboratory in Italy: A 3-year retrospective investigation

    DEFF Research Database (Denmark)

    Ventrella, G.; Moodley, A.; Grandolfo, E.

    2017-01-01

    In the last decade there has been a rapid global spread of methicillin-resistant Staphylococcus pseudintermedius (MRSP) clones displaying multidrug resistance in dogs. We investigated prevalence, antimicrobial susceptibility and clonal distribution of MRSP isolated from clinical canine samples be...

  4. Canine gastritis.

    Science.gov (United States)

    Webb, Craig; Twedt, David C

    2003-09-01

    Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.

  5. Varied clinico-radiological presentations of transmigrated canines

    Directory of Open Access Journals (Sweden)

    Ishita Gupta

    2015-01-01

    Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.

  6. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    Directory of Open Access Journals (Sweden)

    Helen L. Del Puerto

    2010-02-01

    Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

  7. Characterization of lipoproteins in human and canine cerebrospinal fluid (CSF)

    International Nuclear Information System (INIS)

    Pitas, R.E.; Weisgraber, K.H.; Boyles, J.K.; Lee, S.; Mahley, R.W.

    1986-01-01

    Previously the authors demonstrated that rat brain astrocytes in vitro synthesize and secrete apo-E and possess apo-B,E(LDL) receptors. The apo-E secreted by astrocytes and apo-E in rat brain extracts differed from serum apo-E in two respects. Brain apo-E had a higher apparent molecular weight and a higher percentage of more acidic isoforms. To characterize further the apo-E within the central nervous system, apo-E in human and canine CSF was investigated. Compared to plasma apo-E, CSF apo-E had a higher apparent M/sub r/ and a higher percentage of acidic isoforms which were sialylated, as shown by neuraminidase digestion. The apo-E in human CSF was approx.5-10% of the plasma level. In CSF 60-80% of the apo-E was in lipoproteins with d = 1.09-1.15. The remainder of the apo-E was in the d > 1.21 fraction. Human CSF lipoproteins were primarily spherical (110-190 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) and spheres (100-150 A). The CSF also contained apo-AI in the d = 1.09-1.15 g/ml fraction. Human CSF lipoproteins containing both apo-E and apo-AI were isolated on an anti-apo-E affinity column, suggesting that apo-E and AI occurred in the same particles. The CSF apo-E-containing lipoproteins competed for binding of 125 I-LDL to the apo-B,E(LDL) receptor. There was no detectable apo-B in CSF. These data suggest that CSF lipoproteins might transport lipid and regulate lipid homeostasis within the brain

  8. On-line Automated Sample Preparation-Capillary Gas Chromatography for the Analysis of Plasma Samples.

    NARCIS (Netherlands)

    Louter, A.J.H.; van der Wagt, R.A.C.A.; Brinkman, U.A.T.

    1995-01-01

    An automated sample preparation module, (the automated sample preparation with extraction columns, ASPEC), was interfaced with a capillary gas chromatograph (GC) by means of an on-column interface. The system was optimised for the determination of the antidepressant trazodone in plasma. The clean-up

  9. Canine distemper virus detection by different methods of One-Step RT-qPCR

    Directory of Open Access Journals (Sweden)

    Claudia de Camargo Tozato

    2016-01-01

    Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

  10. Ghrelin-stimulation test in the diagnosis of canine pituitary dwarfism.

    Science.gov (United States)

    Bhatti, S F M; De Vliegher, S P; Mol, J A; Van Ham, L M L; Kooistra, H S

    2006-08-01

    This study investigated whether ghrelin, a potent releaser of growth hormone (GH) secretion, is a valuable tool in the diagnosis of canine pituitary dwarfism. The effect of intravenous administration of ghrelin on the release of GH and other adenohypophyseal hormones was investigated in German shepherd dogs with congenital combined pituitary hormone deficiency and in healthy Beagles. Analysis of the maximal increment (i.e. difference between pre- and maximal post-ghrelin plasma hormone concentration) indicated that the GH response was significantly lower in the dwarf dogs compared with the healthy dogs. In none of the pituitary dwarfs, the ghrelin-induced plasma GH concentration exceeded 5 microg/l at any time. However, this was also true for 3 healthy dogs. In all dogs, ghrelin administration did not affect the plasma concentrations of ACTH, cortisol, TSH, LH and PRL . Thus, while a ghrelin-induced plasma GH concentration above 5 microg/l excludes GH deficiency, false-negative results may occur.

  11. Long-lived immunity to canine core vaccine antigens in UK dogs as assessed by an in-practice test kit.

    Science.gov (United States)

    Killey, R; Mynors, C; Pearce, R; Nell, A; Prentis, A; Day, M J

    2018-01-01

    To determine the utility of an in-practice test kit to detect protective serum antibody against canine distemper virus, canine adenovirus and canine parvovirus type 2 in a sample of the UK dog population. Serum samples from 486 dogs, last vaccinated between less than 1 month and 124 months previously, were tested with the VacciCheck™ test kit for protective antibodies against distemper, adenovirus and parvovirus type 2. A high proportion of the dogs tested (93·6%) had protective antibody against all three of the core vaccine antigens: 95·7% of the dogs were seropositive against canine distemper virus, 97·3% against canine adenovirus and 98·5% against canine parvovirus type 2. The small number of dogs that were seronegative for one or more of the antigens (n = 31) may have had waning of previous serum antibody or may have been rare genetic non-responders to that specific antigen. UK veterinarians can be reassured that triennial revaccination of adult dogs with core vaccines provides long-lived protective immunity. In-practice serological test kits are a valuable tool for informing decision-making about canine core revaccination. © 2017 British Small Animal Veterinary Association.

  12. Plasma creatinine in dogs: intra- and inter-laboratory variation in 10 European veterinary laboratories

    Directory of Open Access Journals (Sweden)

    Ulleberg Thomas

    2011-04-01

    Full Text Available Abstract Background There is substantial variation in reported reference intervals for canine plasma creatinine among veterinary laboratories, thereby influencing the clinical assessment of analytical results. The aims of the study was to determine the inter- and intra-laboratory variation in plasma creatinine among 10 veterinary laboratories, and to compare results from each laboratory with the upper limit of its reference interval. Methods Samples were collected from 10 healthy dogs, 10 dogs with expected intermediate plasma creatinine concentrations, and 10 dogs with azotemia. Overlap was observed for the first two groups. The 30 samples were divided into 3 batches and shipped in random order by postal delivery for plasma creatinine determination. Statistical testing was performed in accordance with ISO standard methodology. Results Inter- and intra-laboratory variation was clinically acceptable as plasma creatinine values for most samples were usually of the same magnitude. A few extreme outliers caused three laboratories to fail statistical testing for consistency. Laboratory sample means above or below the overall sample mean, did not unequivocally reflect high or low reference intervals in that laboratory. Conclusions In spite of close analytical results, further standardization among laboratories is warranted. The discrepant reference intervals seem to largely reflect different populations used in establishing the reference intervals, rather than analytical variation due to different laboratory methods.

  13. Development of the canine tooth in the beagle

    International Nuclear Information System (INIS)

    Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.

    1993-01-01

    The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla

  14. Ion sampling and transport in Inductively Coupled Plasma Mass Spectrometry

    Science.gov (United States)

    Farnsworth, Paul B.; Spencer, Ross L.

    2017-08-01

    Quantitative accuracy and high sensitivity in inductively coupled plasma mass spectrometry (ICP-MS) depend on consistent and efficient extraction and transport of analyte ions from an inductively coupled plasma to a mass analyzer, where they are sorted and detected. In this review we examine the fundamental physical processes that control ion sampling and transport in ICP-MS and compare the results of theory and computerized models with experimental efforts to characterize the flow of ions through plasma mass spectrometers' vacuum interfaces. We trace the flow of ions from their generation in the plasma, into the sampling cone, through the supersonic expansion in the first vacuum stage, through the skimmer, and into the ion optics that deliver the ions to the mass analyzer. At each stage we consider idealized behavior and departures from ideal behavior that affect the performance of ICP-MS as an analytical tool.

  15. Three-year duration of immunity in dogs following vaccination against canine adenovirus type-1, canine parvovirus, and canine distemper virus.

    Science.gov (United States)

    Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

    2005-01-01

    A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.

  16. Booster effect of canine distemper, canine parvovirus infection and infectious canine hepatitis combination vaccine in domesticated adult dogs.

    Science.gov (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki

    2012-08-01

    Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

  17. Experimental research of covered stent implanted in canine hepatic artery

    International Nuclear Information System (INIS)

    Zhou Bing; Liu Linxiang; Li Minghua; Wang Yongli; Cheng Yongde

    2007-01-01

    Objective: To evaluate the feasibility of success rate of implantation, post-procedure stenosis rate, apposition ability and endothelialization level, etc. for implantation with balloon-expandable covered stent in canine hepatic artery. Methods: 8 adult canines were implanted with balloon-expendable stents covered by expandable poly Teflon ester membrane (e-PTFEM). Follow-up DSA was performed immediately, 2, 4 and 12 wk after the procedure. The canines were sacrificed for histopathologic examination and statistical analysis with correlation of implantation manenvor and angiographic manifestations. Results: 8 cases were all implanted with the covered stents in proper hepatic artery/right hepatic artery successfully; showing good apposition ability and non-opacification of the separated branches. 2 cases showed intraluminal obvious stenosis( > 50%)of the stent at 2 weeks follow-up, so did 3 cases at 12 weeks follow-up, and the total stenosis rate was 37.5% and 5 cases manifested full endothelialization (3 different locations of the sample all manifested full endothelialization), 3 cased manifested partial endothelialization (at least 1 location of the sample didn't show full endothelialization), and the two terminal parts were easier to get endothelialization than the central part. Before and after the stent implantation, hepatic function of all cases didn't demonstrate any obvious changes. Conclusions: Balloon-expandable covered stent can be implanted in canine hepatic artery. successfully, with good apposition ability, full endothelialization, and no influence on hepatic function. (authors)

  18. Characterization of Canine parvovirus 2 variants circulating in Greece.

    Science.gov (United States)

    Ntafis, Vasileios; Xylouri, Eftychia; Kalli, Iris; Desario, Costantina; Mari, Viviana; Decaro, Nicola; Buonavoglia, Canio

    2010-09-01

    The aim of the present study was to characterize Canine parvovirus 2 (CPV-2) variants currently circulating in Greece. Between March 2008 and March 2009, 167 fecal samples were collected from diarrheic dogs from different regions of Greece. Canine parvovirus 2 was detected by standard polymerase chain reaction, whereas minor groove binder probe assays were used to distinguish genetic variants and discriminate between vaccine and field strains. Of 84 CPV-2-positive samples, 81 CPV-2a, 1 CPV-2b, and 2 CPV-2c were detected. Vaccine strains were not detected in any sample. Sequence analysis of the VP2 gene of the 2 CPV-2c viruses revealed up to 100% amino acid identity with the CPV-2c strains previously detected in Europe. The results indicated that, unlike other European countries, CPV-2a remains the most common variant in Greece, and that the CPV-2c variant found in Europe is also present in Greece.

  19. Canine oral mucosa evaluation as a potential autograft tissue for the treatment of unresponsive keratoconjunctivitis sicca.

    Science.gov (United States)

    Cherry, Rose L; Smith, Jodi D; Ben-Shlomo, Gil

    2018-01-01

    Labial mucosa transplantation for the treatment of canine keratoconjunctivitis sicca (KCS) has been reported recently. Postoperative alleviation of clinical signs was noted and assumed to be the result of labial salivary glands providing lubrication to the ocular tissue. The aim of this study was to evaluate the presence of minor salivary glands (MSG) in the canine oral mucosa. Oral mucosal biopsies were collected from six dogs that died (n = 1) or were euthanized (n = 5) for reasons unrelated to this study. The breeds included were two Doberman Pinschers, one Labrador Retriever, one Portuguese Water Dog, one German Shepherd Dog, and one mixed canine. Three were spayed females, and three were castrated males with the median age of 9 years (range, 6-13 years). Samples were obtained by an 8-mm punch biopsy at the following locations of the canine oral cavity: upper rostral labial mucosa at midline, lower rostral labial mucosa at midline, upper labial mucosa near the commissure, lower labial mucosa near the commissure, and buccal mucosa approximately 1 cm caudal to the commissure. Samples were routinely processed with hematoxylin and eosin, and periodic acid-Schiff stains. Samples were evaluated by light microscopy. At the selected locations, no MSG or other secreting cells were detected. Minor salivary glands are not associated with alleviation of canine KCS symptoms following labial mucosa transplantation. Further studies are needed to determine the mechanism leading to the transient improvement of KCS symptoms in canine patients following labial mucosa transplantation. © 2017 American College of Veterinary Ophthalmologists.

  20. Bilateral supernumerary primary maxillary canines

    Directory of Open Access Journals (Sweden)

    Santanu Mukhopadhyay

    2018-01-01

    Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.

  1. Does canine inflammatory bowel disease influence gut microbial profile and host metabolism?

    Science.gov (United States)

    Xu, Jia; Verbrugghe, Adronie; Lourenço, Marta; Janssens, Geert P J; Liu, Daisy J X; Van de Wiele, Tom; Eeckhaut, Venessa; Van Immerseel, Filip; Van de Maele, Isabel; Niu, Yufeng; Bosch, Guido; Junius, Greet; Wuyts, Brigitte; Hesta, Myriam

    2016-06-16

    Inflammatory bowel disease (IBD) refers to a diverse group of chronic gastrointestinal diseases, and gut microbial dysbiosis has been proposed as a modulating factor in its pathogenesis. Several studies have investigated the gut microbial ecology of dogs with IBD but it is yet unclear if this microbial profile can alter the nutrient metabolism of the host. The aim of the present study was to characterize the faecal bacterial profile and functionality as well as to determine host metabolic changes in IBD dogs. Twenty-three dogs diagnosed with IBD and ten healthy control dogs were included. Dogs with IBD were given a clinical score using the canine chronic enteropathy clinical activity index (CCECAI). Faecal short-chain fatty acids (SCFA) and ammonia concentrations were measured and quantitative PCR was performed. The concentration of plasma amino acids, acylcarnitines, serum folate, cobalamin, and indoxyl sulfate was determined. No significant differences in the abundance of a selection of bacterial groups and fermentation metabolites were observed between the IBD and control groups. However, significant negative correlations were found between CCECAI and the faecal proportion of Lactobacillus as well as between CCECAI and total SCFA concentration. Serum folate and plasma citrulline were decreased and plasma valine was increased in IBD compared to control dogs. Increased plasma free carnitine and total acylcarnitines were observed in IBD compared with control dogs, whereas short-chain acylcarnitines (butyrylcarnitine + isobutyrylcarnitine and, methylmalonylcarnitine) to free carnitine ratios decreased. Dogs with IBD had a higher 3-hydroxyisovalerylcarnitine + isovalerylcarnitine to leucine ratio compared to control dogs. Canine IBD induced a wide range of changes in metabolic profile, especially for the plasma concentrations of short-chain acylcarnitines and amino acids, which could have evolved from tissue damage and alteration in host metabolism. In

  2. Molecular detection of canine parvovirus in flies (Diptera) at open and closed canine facilities in the eastern United States.

    Science.gov (United States)

    Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan

    2014-06-01

    More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year

  3. Plasma androgen concentrations in initial samples from spotted ...

    African Journals Online (AJOL)

    1990-01-31

    Jan 31, 1990 ... initial samples, the immobilization stress response and the response to exogenous GnRH administration, for ... the sex-specific differences in plasma androgens is confounded by other variables such as the reproductive.

  4. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies

    OpenAIRE

    J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides

    2002-01-01

    Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...

  5. Characterization of the canine urinary proteome.

    Science.gov (United States)

    Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E

    2014-06-01

    Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.

  6. Canine distemper in Siberian tiger cubs from Zagreb ZOO: case report

    Directory of Open Access Journals (Sweden)

    Dean Konjević

    2011-01-01

    Full Text Available Canine distemper is a contagious, potentially lethal disease of mainly domestic and wild canids, but also of many other mammalian species including large felids. In February 2004, two Siberian tiger (Panthera tigris altaica cubs at the age of six months died at the Zagreb ZOO. The animals were presented for necropsy with two days history of severe digestive disorders, characterized mainly by haemathemesis. Dissections revealed catarrhal to pseudomembranous gastroenteritis (depending on the animal accompanied with haemorrhagic oedema of the lungs. Necrotic tonsillitis and disseminated depletion of the lymphocytes were the most prominent histological findings in both examined animals, while intranuclear and intracytoplasmatic inclusion bodies were found in the samples of the tongues and intestines. Representative portions of the livers, intestines, tonsils and lymph nodes were submitted for bacteriological and mycological analysis. The presence of Clostridium spp., Campylobacter coli and Escherichia coli was detected in gut samples, coli-like bacteria were found in samples of liver, tonsils and lymph nodes, while Candida sp. was found in the gut and pharynx samples. Toxicological analysis excluded anticoagulant and organophosphorous intoxication as the cause of death. Immunohistochemical analysis was positive for canine distemper virus. Based on all this, epizootiological, clinical and additional findings, canine distemper was recognized as the cause of the observed condition in these animals.

  7. Molecular and Cellular Mechanisms of Septic Shock

    Science.gov (United States)

    1988-03-01

    due to gastric dilation - volvulus (6Y). The LAL-chromogenic procedure iýs sensitive and reliable for detecting plasma LPS. LPS has a short initial T 1/2...portal injections of endotoxin. and intestinal ischemia. Endotoxin (LPS) was quantitated in canine plasma using the Limulus amebocyte lysate (LAL...CV=1O), and stability of diluted, heat-treated, frozen samples (at least 8 wk). Analysis of canine plasma samples following sublethal IV (jugular or

  8. Phylogenetic characterization of Canine Parvovirus VP2 partial sequences from symptomatic dogs samples.

    Science.gov (United States)

    Zienius, D; Lelešius, R; Kavaliauskis, H; Stankevičius, A; Šalomskas, A

    2016-01-01

    The aim of the present study was to detect canine parvovirus (CPV) from faecal samples of clinically ill domestic dogs by polymerase chain reaction (PCR) followed by VP2 gene partial sequencing and molecular characterization of circulating strains in Lithuania. Eleven clinically and antigen-tested positive dog faecal samples, collected during the period of 2014-2015, were investigated by using PCR. The phylogenetic investigations indicated that the Lithuanian CPV VP2 partial sequences (3025-3706 cds) were closely related and showed 99.0-99.9% identity. All Lithuanian sequences were associated with one phylogroup, but grouped in different clusters. Ten of investigated Lithuanian CPV VP2 sequences were closely associated with CPV 2a antigenic variant (99.4% nt identity). Five CPV VP2 sequences from Lithuania were related to CPV-2a, but were rather divergent (6.8 nt differences). Only one CPV VP2 sequence from Lithuania was associated (99.3% nt identity) with CPV-2b VP2 sequences from France, Italy, USA and Korea. The four of eleven investigated Lithuanian dogs with CPV infection symptoms were vaccinated with CPV-2 vaccine, but their VP2 sequences were phylogenetically distantly associated with CPV vaccine strains VP2 sequences (11.5-15.8 nt differences). Ten Lithuanian CPV VP2 sequences had monophyletic relations among the close geographically associated samples, but five of them were rather divergent (1.0% less sequence similarity). The one Lithuanian CPV VP2 sequence was closely related with CPV-2b antigenic variant. All the Lithuanian CPV VP2 partial sequences were conservative and phylogenetically low associated with most commonly used CPV vaccine strains.

  9. Assessment of Canine Autologous Conditioned PlasmaTM Cellular and Transforming Growth Factor-β1 Content

    Directory of Open Access Journals (Sweden)

    Samuel P. Franklin

    2018-06-01

    Full Text Available To evaluate (1 the cellular composition of canine ACP™ including using two different preparation protocols with variations on centrifugation time, (2 the effect of different activation protocols on the transforming growth factor (TGF-β1 content in the ACP, and (3 patient factors that might influence platelet concentration of the ACP.ACP was made with blood from 15 dogs using a manufacturer-recommended protocol[1]. Each ACP sample was divided into three aliquots that were activated with calcium chloride (CaCl2, human γ-thrombin (HGT, or not activated. TGF-β1 was quantified in each aliquot using an ELISA and comparisons among activation protocols were performed using a Skillings-Mack test. Correlations between platelet and TGF-β1 concentration were assessed with a Pearson correlation coefficient. ACP was subsequently prepared from an additional 17 dogs using a slightly modified centrifugation protocol and cellular composition was assessed. Effects of dog age, body weight, and hematocrit were assessed for their potential impact on ACP platelet concentration using a multiple linear regression analysis.The mean increase in platelet concentration in the ACP above that in the whole blood was 1.2× (±std 0.62 and leukocyte concentration was a mean of 26% (0.37 that in the whole blood using the standard protocol. There was a significant (p < 0.01 effect of activation on TGF-β1 concentrations with mean concentrations of 4,538 (2,317, 14,948 (13,784, and 14,096 (15,210 pg/ml in aliquots that were not activated or were activated with thrombin or CaCl2 respectively. There were significant correlations between the platelet concentration and TGF-β1 concentration in aliquots that were activated with either thrombin (r = 0.66; p < 0.01 or CaCl2 (r = 0.86, p < 0.0001. The mean increase in platelet concentration was 1.4× (0.62 and the leukocyte concentration was 0.28× (0.13 that in whole blood using the modified ACP preparation protocol. Dog age

  10. Investigation of Peri-Implant Bone Healing Using Autologous Plasma Rich in Growth Factors in the Canine Mandible After 12 Weeks: A Pilot Study

    Science.gov (United States)

    Birang, Reza; Tavakoli, Mohammad; Shahabouei, Mohammad; Torabi, Alireza; Dargahi, Ali; Soolari, Ahmad

    2011-01-01

    Introduction: Faster reconstruction of patients’ masticatory systems is the aim of modern dentistry. A number of studies have indicated that application of growth factors to the surface of a dental implant leads to accelerated and enhanced osseointegration. The objective of the present study was to investigate the effect of plasma rich in growth factors on peri-implant bone healing. Materials and Methods: For the purpose of this study, two healthy, mixed-breed canines were selected, and the premolars were extracted from both sides of the mandible. Three months after premolar removal, 12 implants, each 5 mm in diameter and 10 mm in length, were placed in osteotomy sites on both sides of the mandible. Prior to placement, plasma rich in growth factors was applied to the surfaces of six implants, while the other six were used without plasma rich in growth factors. The implants were removed after 12 weeks along with the bone surrounding the sites using a trephine bur. One mesiodistal section containing the surrounding bone from each implant block, 50 µm in diameter, was prepared for histologic and histomorphometric investigation with an optical microscope. Results: The sites with implants treated with plasma rich in growth factors showed more bone-to-implant contact compared to control sites. Also, higher values for bone trabecular thickness and bone maturity were recorded for the PRGF-treated sites than for the control sites. Conclusion: Application of plasma rich in growth factors to the surface of an implant may enhance the bone healing process as well as bone-to-implant contact, thereby helping to achieve faster osseointegration. PMID:22145011

  11. Antibody titers for canine parvovirus type-2, canine distemper virus, and canine adenovirus type-1 in adult household dogs.

    Science.gov (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki

    2011-09-01

    Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.

  12. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  13. Coryneform bacteria associated with canine otitis externa

    DEFF Research Database (Denmark)

    Aalbæk, Bent; Bemis, David A.; Schjærff, Mette

    2010-01-01

    This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...

  14. Comparative analysis of the surface exposed proteome of two canine osteosarcoma cell lines and normal canine osteoblasts.

    Science.gov (United States)

    Milovancev, Milan; Hilgart-Martiszus, Ian; McNamara, Michael J; Goodall, Cheri P; Seguin, Bernard; Bracha, Shay; Wickramasekara, Samanthi I

    2013-06-13

    Osteosarcoma (OSA) is the most common primary bone tumor of dogs and carries a poor prognosis despite aggressive treatment. An improved understanding of the biology of OSA is critically needed to allow for development of novel diagnostic, prognostic, and therapeutic tools. The surface-exposed proteome (SEP) of a cancerous cell includes a multifarious array of proteins critical to cellular processes such as proliferation, migration, adhesion, and inter-cellular communication. The specific aim of this study was to define a SEP profile of two validated canine OSA cell lines and a normal canine osteoblast cell line utilizing a biotinylation/streptavidin system to selectively label, purify, and identify surface-exposed proteins by mass spectrometry (MS) analysis. Additionally, we sought to validate a subset of our MS-based observations via quantitative real-time PCR, Western blot and semi-quantitative immunocytochemistry. Our hypothesis was that MS would detect differences in the SEP composition between the OSA and the normal osteoblast cells. Shotgun MS identified 133 putative surface proteins when output from all samples were combined, with good consistency between biological replicates. Eleven of the MS-detected proteins underwent analysis of gene expression by PCR, all of which were actively transcribed, but varied in expression level. Western blot of whole cell lysates from all three cell lines was effective for Thrombospondin-1, CYR61 and CD44, and indicated that all three proteins were present in each cell line. Semi-quantitative immunofluorescence indicated that CD44 was expressed at much higher levels on the surface of the OSA than the normal osteoblast cell lines. The results of the present study identified numerous differences, and similarities, in the SEP of canine OSA cell lines and normal canine osteoblasts. The PCR, Western blot, and immunocytochemistry results, for the subset of proteins evaluated, were generally supportive of the mass spectrometry data

  15. Resident Macrophages and Lymphocytes in the Canine Endometrium.

    Science.gov (United States)

    Pires, M A; Payan-Carreira, R

    2015-10-01

    Resident immune cells play a major role in endometrial immunity and in tissue homoeostasis. This study aimed to analyse the distribution of macrophages, B and T lymphocytes (respectively, Mø, B-Lym and T-Lym) in the canine endometrium throughout the oestrous cycle and in late involution (at the proestrus stage post-parturition). An immunohistochemistry technique was used on samples from 50 post-pubertal healthy female dogs, of which five in late post-partum. The distribution of resident immune cells was analysed in three endometrial layers (superficial, intermediate and basal areas). Mø, B-Lym and T-Lym were demonstrated to reside in the endometrium in all the stages of the canine cycle; their numbers being considerably higher during late involution. T-Lym were scattered in the stroma or amidst the glandular epithelium, constituting the predominant immune cell population in anestrus and proestrus, but decreased in number at all other stages. Endometrial B-Lym remained fairly constant during the canine cycle, although its numbers were higher in late involution. Mø counts were higher during anestrus compared to the other stages, the cells being displaced into the superficial endometrial layer. Mø demonstrated the highest level in late involution samples, forming small aggregates below the surface epithelium. The number of immune cells was not normally distributed, suggesting the influence of individual factors, such as age or parity, not explored herein due to limited sample availability. Still, this study provides important information for the interpretation of endometrial biopsies in dogs and for the understanding of the increased susceptibility to uterine infection during dioestrus found in the bitch. © 2015 Blackwell Verlag GmbH.

  16. Comparison of measurement of 99mTc-MAG3 plasma clearance by single plasma sample and renal uptake ratio

    International Nuclear Information System (INIS)

    Ushijima, Yo; Sugihara, Hiroki; Okuyama, Chio; Okitsu, Sigeyuki; Nii, Takeshi; Nishida, Takuji; Okamoto, Kunio; Maeda, Tomoho

    1997-01-01

    Measurement of 99m Tc-MAG 3 plasma clearance based on one-compartment model (MPC method) is a non-invasive method using the renal uptake ratio. We evaluated the clinical usefulness of this method, compared with effective renal plasma flow (ERPF) using 123 I-OIH and two single-plasma sample methods using 99m Tc-MAG 3 (Russell method and Bubeck method). The ratio of 99m Tc-MAG 3 clearance to ERPF was 1.00±0.26. MPC method correlated well with Russell and Bubeck methods (r=0.904, r=0.897). We conclude that MPC method is a suitable replacement for single-plasma sample method in routine clinical use. (author)

  17. Occurrence of filaria in domestic dogs of Samburu pastoralists in Northern Kenya and its associations with canine distemper.

    Science.gov (United States)

    Albrechtová, Kateřina; Sedlák, Kamil; Petrželková, Klára J; Hlaváč, Jan; Mihalca, Andrei D; Lesingirian, Alison; Kanyari, Paul W N; Modrý, David

    2011-12-15

    Samples of blood (serum, smears and blood preserved with ethanol) were collected from dogs during a vaccination campaign in northern Kenya in the years 2006 and 2007. Blood was screened for filarial parasites using molecular and microscopy methods and sera were tested for antibodies against canine distemper virus (CDV). Parasitological examination revealed the presence of two species of canine filariae: Acanthocheilonema dracunculoides and A. reconditum. The DNA from the former species was detected in 58% dogs sampled in 2006 and 36% dogs sampled in 2007, whereas the latter was found only in 4.2% samples collected in 2007. Microfilariae were found in 33.8% blood smears collected in 2006 and 10.6% blood smears collected in 2007. The seroprevalence of CDV was 33.4% in 2006 and 11.2% in 2007. The effect of sex, age and CDV-seropositivity/seronegativity on the occurrence of A. dracunculoides was evaluated. Infection by A. dracunculoides was more common in males and in dogs with a positive antibody titer for canine distemper, but evenly distributed among different age groups. The difference in the prevalence of A. dracunculoides in two isolated mountain ranges was not statistically significant. Methodologies available for detection and determination of canine filariae are compared, underlining methodical pitfalls arising through the determination of less common filarial species. The role of single epidemiological factors and possible association between canine distemper and filariasis are discussed. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Vitamin E supplementation in canine atopic dermatitis: improvement of clinical signs and effects on oxidative stress markers.

    Science.gov (United States)

    Plevnik Kapun, A; Salobir, J; Levart, A; Tavčar Kalcher, G; Nemec Svete, A; Kotnik, T

    2014-12-06

    Low levels of plasma vitamin E concentrations were found in canine atopic dermatitis (CAD). The present study was aimed at determining the effect of an eight-week vitamin E supplementation on clinical response (Canine Atopic Dermatitis Extent and Severity Index (CADESI-03) scores and pruritus intensity) in dogs with atopic dermatitis. Levels of oxidative stress markers (plasma malondialdehyde and total antioxidant capacity (TAC), blood glutathione peroxidase and erythrocyte superoxide dismutase, plasma and skin vitamin E concentrations) were also determined. Twenty-nine dogs with CAD were included in the study. Fourteen received vitamin E (8.1 IU/kg once daily, orally) and 15 received mineral oil as placebo (orally). All dogs were treated with antihistamine fexofenadine. Levels of oxidative stress markers (with the exception of skin vitamin E), CADESI-03 and pruritus intensity were determined at the beginning, then every two weeks. Skin vitamin E was determined at the beginning and at the end of the treatment. Significantly higher plasma levels of vitamin E and TAC were observed in the vitamin E group than in the placebo group. CADESI-03 scores determined throughout the treatment in the vitamin E group were significantly lower than in the placebo group. The findings of this study support the supplementation of vitamin E in dogs with atopic dermatitis. British Veterinary Association.

  19. Quantitative PCR and immunohistochemical analyses of HMGB1 and RAGE expression in canine disseminated histiocytic sarcoma (malignant histiocytosis).

    Science.gov (United States)

    Sterenczak, Katharina A; Kleinschmidt, Sven; Wefstaedt, Patrick; Eberle, Nina; Hewicker-Trautwein, Marion; Bullerdiek, Jörn; Nolte, Ingo; Murua Escobar, Hugo

    2011-05-01

    Disorders of histiocytic origin affecting humans and dogs share various similarities. Canine disseminated histiocytic sarcoma (DHS) (formerly known as malignant histiocytosis) is an aggressive neoplasm of interstitial dendritic cells (DCs). The receptor for glycation end products (RAGE) and the high mobility group box1 protein (HMGB1) have been shown to be required for the maturation and migration of DCs. Thus, deregulation of the expression of these genes could have a major effect on the progression of histiocytic disorders. Neoplastic canine DHS samples and non-neoplastic control samples were analysed immunohistochemically and via real-time PCR. Significant down-regulation of RAGE in the lung tumour samples and down-regulation of HMGB1 in the lung, lymph node and spleen tumour samples were detected compared to their non-neoplastic counterparts. RAGE and HMGB1 expression down-regulation in canine DHS points to a role in the progression of histiocytic disorders.

  20. New and emerging pathogens in canine infectious respiratory disease.

    Science.gov (United States)

    Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J

    2014-03-01

    Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.

  1. Pre-storage centrifugation conditions have significant impact on measured microRNA levels in biobanked EDTA plasma samples

    DEFF Research Database (Denmark)

    Binderup, Helle Glud; Houlind, Kim; Madsen, Jonna Skov

    2016-01-01

    in platelets this may partly be explained by residual platelets in the plasma samples used. When collecting fresh plasma samples, it is possible to produce cell-free/platelet-poor plasma by centrifugation. In this study, we systematically investigated whether biobanked EDTA plasma samples could be processed...... to be suitable for miRNA analysis. Materials and methods: Blood samples were collected from ten healthy volunteers and centrifuged to produce platelet-poor-plasma (PPP) and standard biobank plasma. After one week at -80 °C the biobanked EDTA plasma was re-centrifuged by different steps to remove residual...... platelets. Using RT-qPCR the levels of 14 miRNAs in the different plasma preparations were compared to that of PPP. Results: We were able to remove residual platelets from biobanked EDTA plasma by re-centrifugation of the thawed samples. Nevertheless, for most of the investigated miRNAs, the miRNA level...

  2. Genetics of Human and Canine Dilated Cardiomyopathy.

    Science.gov (United States)

    Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S

    2015-01-01

    Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

  3. 9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...

  4. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    Science.gov (United States)

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  5. Three-dimensional localization of impacted canines and root resorption assessment using cone beam computed tomography.

    Science.gov (United States)

    Almuhtaseb, Eyad; Mao, Jing; Mahony, Derek; Bader, Rawan; Zhang, Zhi-xing

    2014-06-01

    The purpose of this study was to develop a new way to localize the impacted canines from three dimensions and to investigate the root resorption of the adjacent teeth by using cone beam computed tomography (CBCT). Forty-six patients undergoing orthodontic treatments and having impacted canines in Tongji Hospital were examined. The images of CBCT scans were obtained from KaVo 3D exam vision. Angular and linear measurements of the cusp tip and root apex according to the three planes (mid-sagittal, occlusal and frontal) have been taken using the cephalometric tool of the InVivo Dental Anatomage Version 5.1.10. The measurements of the angular and linear coordinates of the maxillary and mandibular canines were obtained. Using this technique the operators could envision the location of the impacted canine according to the three clinical planes. Adjacent teeth root resorption of 28.26 % was in the upper lateral incisors while 17.39% in upper central incisors, but no lower root resorption was found in our samples. Accurate and reliable localization of the impacted canines could be obtained from the novel analysis system, which offers a better surgical and orthodontic treatment for the patients with impacted canines.

  6. Canine Platelet Lysate Is Inferior to Fetal Bovine Serum for the Isolation and Propagation of Canine Adipose Tissue- and Bone Marrow-Derived Mesenchymal Stromal Cells

    Science.gov (United States)

    Russell, Keith A.; Gibson, Thomas W. G.; Chong, Andrew; Co, Carmon; Koch, Thomas G.

    2015-01-01

    Background Mesenchymal stromal cells (MSC) are increasingly investigated for their clinical utility in dogs. Fetal bovine serum (FBS) is a common culture supplement used for canine MSC expansion. However, FBS content is variable, its clinical use carries risk of an immune response, and its cost is increasing due to global demand. Platelet lysate (PL) has proven to be a suitable alternative to FBS for expansion of human MSC. Hypothesis and Objectives We hypothesized that canine adipose tissue (AT) and bone marrow (BM) MSC could be isolated and expanded equally in PL and FBS at conventionally-used concentrations with differentiation of these MSC unaffected by choice of supplement. Our objectives were to evaluate the use of canine PL in comparison with FBS at four stages: 1) isolation, 2) proliferation, 3) spontaneous differentiation, and 4) directed differentiation. Results 1) Medium with 10% PL was unable to isolate MSC. 2) MSC, initially isolated in FBS-supplemented media, followed a dose-dependent response with no significant difference between PL and FBS cultures at up to 20% (AT) or 30% (BM) enrichment. Beyond these respective peaks, proliferation fell in PL cultures only, while a continued dose-dependent proliferation response was noted in FBS cultures. 3) Further investigation indicated PL expansion culture was inducing spontaneous adipogenesis in concentrations as low as 10% and as early as 4 days in culture. 4) MSC isolated in FBS, but expanded in either FBS or PL, maintained ability to undergo directed adipogenesis and osteogenesis, but not chondrogenesis. Conclusions/Significance Canine PL did not support establishment of MSC colonies from AT and BM, nor expansion of MSC, which appear to undergo spontaneous adipogenesis in response to PL exposure. In vivo studies are warranted to determine if concurrent use of MSC with any platelet-derived products such as platelet-rich plasma are associated with synergistic, neutral or antagonistic effects. PMID:26353112

  7. Canine Platelet Lysate Is Inferior to Fetal Bovine Serum for the Isolation and Propagation of Canine Adipose Tissue- and Bone Marrow-Derived Mesenchymal Stromal Cells.

    Directory of Open Access Journals (Sweden)

    Keith A Russell

    Full Text Available Mesenchymal stromal cells (MSC are increasingly investigated for their clinical utility in dogs. Fetal bovine serum (FBS is a common culture supplement used for canine MSC expansion. However, FBS content is variable, its clinical use carries risk of an immune response, and its cost is increasing due to global demand. Platelet lysate (PL has proven to be a suitable alternative to FBS for expansion of human MSC.We hypothesized that canine adipose tissue (AT and bone marrow (BM MSC could be isolated and expanded equally in PL and FBS at conventionally-used concentrations with differentiation of these MSC unaffected by choice of supplement. Our objectives were to evaluate the use of canine PL in comparison with FBS at four stages: 1 isolation, 2 proliferation, 3 spontaneous differentiation, and 4 directed differentiation.1 Medium with 10% PL was unable to isolate MSC. 2 MSC, initially isolated in FBS-supplemented media, followed a dose-dependent response with no significant difference between PL and FBS cultures at up to 20% (AT or 30% (BM enrichment. Beyond these respective peaks, proliferation fell in PL cultures only, while a continued dose-dependent proliferation response was noted in FBS cultures. 3 Further investigation indicated PL expansion culture was inducing spontaneous adipogenesis in concentrations as low as 10% and as early as 4 days in culture. 4 MSC isolated in FBS, but expanded in either FBS or PL, maintained ability to undergo directed adipogenesis and osteogenesis, but not chondrogenesis.Canine PL did not support establishment of MSC colonies from AT and BM, nor expansion of MSC, which appear to undergo spontaneous adipogenesis in response to PL exposure. In vivo studies are warranted to determine if concurrent use of MSC with any platelet-derived products such as platelet-rich plasma are associated with synergistic, neutral or antagonistic effects.

  8. Mass spectrometric identification of diagnostic markers for chronic prostatitis in seminal plasma by analysis of seminal plasma protein clinical samples.

    Science.gov (United States)

    Rokka, A; Mehik, A; Tonttila, P; Vaarala, M

    2017-08-15

    There are few specific diagnostic markers for chronic prostatitis. Therefore, we used mass spectrometry to evaluate differences in seminal plasma protein expression among patients with prostatitis and young and middle-aged healthy controls. We analysed pooled seminal plasma protein samples from four prostatitis patients (two pools), three young controls (one pool), and three middle-aged controls (one pool). The samples were analysed by liquid chromatography-tandem mass spectrometry. Of the 349 proteins identified, 16 were differentially expressed between the two control pools. Five proteins were up- or down-regulated in both of the prostatitis pools compared to middle-aged controls but not between young and middle-aged pools. Progestagen-associated endometrial protein (PAEP) was over-expressed in prostatitis samples compared to young and middle-aged controls. Our findings and those of previous studies indicate that PAEP is a potential seminal plasma marker for chronic prostatitis. In conclusion, we found age-related changes in seminal plasma protein expression. PAEP expression in seminal plasma should be investigated further to evaluate its potential as a diagnostic marker for chronic prostatitis.

  9. Clinical and serological response of wild dogs (Lycaon pictus to vaccination against canine distemper, canine parvovirus infection and rabies

    Directory of Open Access Journals (Sweden)

    J. Van Heerden

    2002-07-01

    Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

  10. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies.

    Science.gov (United States)

    van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E

    2002-03-01

    Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

  11. 9 CFR 113.317 - Parvovirus Vaccine (Canine).

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...

  12. Application of xenogeneic anti-canine distemper virus antibodies in treatment of canine distemper puppies.

    Science.gov (United States)

    Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L

    2016-11-01

    The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.

  13. Genetics of Human and Canine Dilated Cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Siobhan Simpson

    2015-01-01

    Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

  14. A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article

    Directory of Open Access Journals (Sweden)

    S. Gur

    2009-05-01

    Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.

  15. Proteomic Biomarker Discovery in 1000 Human Plasma Samples with Mass Spectrometry.

    Science.gov (United States)

    Cominetti, Ornella; Núñez Galindo, Antonio; Corthésy, John; Oller Moreno, Sergio; Irincheeva, Irina; Valsesia, Armand; Astrup, Arne; Saris, Wim H M; Hager, Jörg; Kussmann, Martin; Dayon, Loïc

    2016-02-05

    The overall impact of proteomics on clinical research and its translation has lagged behind expectations. One recognized caveat is the limited size (subject numbers) of (pre)clinical studies performed at the discovery stage, the findings of which fail to be replicated in larger verification/validation trials. Compromised study designs and insufficient statistical power are consequences of the to-date still limited capacity of mass spectrometry (MS)-based workflows to handle large numbers of samples in a realistic time frame, while delivering comprehensive proteome coverages. We developed a highly automated proteomic biomarker discovery workflow. Herein, we have applied this approach to analyze 1000 plasma samples from the multicentered human dietary intervention study "DiOGenes". Study design, sample randomization, tracking, and logistics were the foundations of our large-scale study. We checked the quality of the MS data and provided descriptive statistics. The data set was interrogated for proteins with most stable expression levels in that set of plasma samples. We evaluated standard clinical variables that typically impact forthcoming results and assessed body mass index-associated and gender-specific proteins at two time points. We demonstrate that analyzing a large number of human plasma samples for biomarker discovery with MS using isobaric tagging is feasible, providing robust and consistent biological results.

  16. First detection of canine parvovirus type 2c in Brazil.

    OpenAIRE

    Streck, André Felipe; Souza, Carine Kunzler; Gonçalves, K. R.; Zang, Luciana; Pinto, Luciane Dubina; Canal, Cláudio Wageck

    2009-01-01

    The presence of canine parvovirus type 2 (CPV-2), 2a and 2b has been described in Brazil, however, the type 2c had not been reported until now. In the current study, seven out of nine samples from dogs with diarrhea were characterized as CPV-2c, indicating that this virus is already circulating in the Brazilian canine population.No Brasil, a presença do parvovírus canino do tipo 2 (CPV-2), 2a e 2b já havia sido descrita, contudo, ainda não havia sido verificada a presença do tipo 2c. No prese...

  17. Enhancement of abdominal wall defect repair using allogenic platelet-rich plasma with commercial polyester/cotton fabric (Damour) in a canine model

    Science.gov (United States)

    ABOUELNASR, Khaled; HAMED, Mohamed; LASHEN, Samah; EL-ADL, Mohamed; ELTAYSH, Rasha; TAGAWA, Michihito

    2017-01-01

    Platelet-rich plasma (PRP) has an important role in musculoskeletal surgery; however, it has been underutilized for accelerating the healing of abdominal wall defects in veterinary practice. Therefore, the aim of this study was to evaluate the use of commercial polyester/cotton fabric (Damour) as a new composite mesh for the repair of experimentally induced abdominal wall defects in canine models, and to investigate the possible role of PRP for improving such repair and reducing allied complications. For this purpose, abdominal wall defects were created in 24 healthy mongrel dogs and then repaired with mesh alone (control group) or mesh and allogenic PRP (PRP group). Dogs were euthanized after 2 or 4 months for gross examination of implantation site, detection of adhesion score and hernia recurrence. Moreover, tissue samples were collected for histological and gene expression analyses for neovascularization, collagen formation and tissue incorporation. Hernia recurrence was not recorded in PRP-treated dogs that also displayed significantly more neovascularization and less severe adhesion to the underlings (1.08 ± 0.51) in comparison to control group (2.08 ± 0.99). Histological and molecular evaluation confirmed the gross findings that collagen deposition, new vessel formation, and overexpression of angiogenic and myofibroplastic genes (COL1α1, COL3α1, VEGF and TGFβ1) were observed more frequently in the PRP group, at both time points. In conclusion, we found that addition of allogenic PRP to Damour mesh enhanced neovessel formation, and increased tissue deposition and incorporation, with subsequent reduction of peritoneal adhesion and recurrence rate. PMID:28603214

  18. High-mobility group B1 (HMGB1) and receptor for advanced glycation end-products (RAGE) expression in canine lymphoma.

    Science.gov (United States)

    Sterenczak, Katharina A; Joetzke, Alexa E; Willenbrock, Saskia; Eberle, Nina; Lange, Sandra; Junghanss, Christian; Nolte, Ingo; Bullerdiek, Jörn; Simon, Daniela; Murua Escobar, Hugo

    2010-12-01

    Canine lymphoma is a commonly occurring, spontaneously developing neoplasia similar to human non-Hodgkin's lymphoma and, thus, is used as a valuable model for human malignancy. HMGB1 and RAGE are strongly associated with tumour progression and vascularisation. Consequently, deregulated RAGE and HMGB1 may play an important role in the mechanisms involved in lymphoma progression. Expression patterns of HMGB1 and RAGE were analysed in 22 canine lymphoma and three canine non-neoplastic control samples via real time PCR and canine beta-glucuronidase gene (GUSB) as endogenous control. HMGB1 was up-regulated in the neoplastic samples, while RAGE expression remained inconspicuous. This study demonstrated similar mechanisms in lymphoma progression in humans and dogs due to overexpression of HMGB1, which was described in human lymphomas. RAGE remained stable in terms of expression indicating that the extracellular HMGB1-induced effects are regulated by HMGB1 itself.

  19. Three-phase double-arc plasma for spectrochemical analysis of environmental samples.

    Science.gov (United States)

    Mohamed, M M; Ghatass, Z F; Shalaby, E A; Kotb, M M; El-Raey, M

    2000-12-01

    A new instrument, which uses a three-phase current to support a double-arc argon plasma torch for evaporation, atomization and excitation of solid or powder samples, is described. The sampling arc is ignited between the first and second electrode while the excitation arc is ignited between the second and third electrode. Aerosol generated from the sample (first electrode) is swept by argon gas, through a hole in the second electrode (carbon tubing electrode), into the excitation plasma. A tangential stream of argon gas is introduced through an inlet orifice as a coolant gas for the second electrode. This gas stream forces the excitation arc discharge to rotate reproducibly around the electrode surface. Discharge rotation increases the stability of the excitation plasma. Spectroscopic measurements are made directly in the current-carrying region of the excitation arc. An evaluation of each parameter influencing the device performance was performed. Analytical calibration curves were obtained for Fe, Al, K, and Pb. Finally, the present technique was applied for the analysis of environmental samples. The present method appears to have significant, low cost analytical utility for environmental measurements.

  20. Reliability of mandibular canines as indicators for sexual dichotomy.

    Science.gov (United States)

    Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa

    2013-02-01

    Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.

  1. Approaches to canine health surveillance.

    Science.gov (United States)

    O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C

    2014-01-01

    Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.

  2. When Veterinarians Support Canine Therapy: Bidirectional Benefits for Clinics and Therapy Programs

    Directory of Open Access Journals (Sweden)

    John-Tyler Binfet

    2018-01-01

    Full Text Available This paper proposes a mutually beneficial model of collaboration between veterinarians and canine therapy programs. Veterinarians and the clinics for whom they work routinely establish collaborations with multiple and varied stakeholders. This might include a laboratory for processing samples and the corresponding courier company needed to deliver samples to the lab or a partnership with a local dog rescue organization for whom discounted rates are offered. One community partnership that stands to benefit both the clinic and the community agency, is for veterinarians to work in tandem with a local canine-assisted therapy program. The benefits to such an alliance are multifold and address aspects of veterinary medicine including client recruitment, community education, and access to a network of devoted dog enthusiasts.

  3. Relative Abundance of Proteins in Blood Plasma Samples from Patients with Chronic Cerebral Ischemia.

    Science.gov (United States)

    Kaysheva, Anna L; Kopylov, Artur T; Ponomarenko, Elena A; Kiseleva, Olga I; Teryaeva, Nadezhda B; Potapov, Alexander A; Izotov, Alexander А; Morozov, Sergei G; Kudryavtseva, Valeria Yu; Archakov, Alexander I

    2018-03-01

    A comparative protein profile analysis of 17 blood plasma samples from patients with ischemia and 20 samples from healthy volunteers was carried out using ultra-high resolution mass spectrometry. The analysis of measurements was performed using the proteomics search engine OMSSA. Normalized spectrum abundance factor (NSAF) in the biological samples was assessed using SearchGUI. The findings of mass spectrometry analysis of the protein composition of blood plasma samples demonstrate that the depleted samples are quite similar in protein composition and relative abundance of proteins. By comparing them with the control samples, we have found a small group of 44 proteins characteristic of the blood plasma samples from patients with chronic cerebral ischemia. These proteins contribute to the processes of homeostasis maintenance, including innate immune response unfolding, the response of a body to stress, and contribution to the blood clotting cascade.

  4. Rabies, canine distemper, and canine parvovirus exposure in large carnivore communities from two Zambian ecosystems.

    Science.gov (United States)

    Berentsen, Are R; Dunbar, Mike R; Becker, Matthew S; M'soka, Jassiel; Droge, Egil; Sakuya, Nicholas M; Matandiko, Wigganson; McRobb, Rachel; Hanlon, Cathleen A

    2013-09-01

    Disease transmission within and among wild and domestic carnivores can have significant impacts on populations, particularly for threatened and endangered species. We used serology to evaluate potential exposure to rabies virus, canine distemper virus (CDV), and canine parvovirus (CPV) for populations of African lions (Panthera leo), African wild dogs (Lycaon pictus), and spotted hyenas (Crocuta crocuta) in Zambia's South Luangwa National Park (SLNP) and Liuwa Plain National Park (LPNP) as well as community lands bordering these areas. In addition, domestic dogs in the study region were evaluated for exposure to CDV and rabies. We provide the first comprehensive disease exposure data for these species in these ecosystems. Twenty-one lions, 20 hyenas, 13 wild dogs, and 38 domestic dogs were sampled across both regions from 2009 to 2011. Laboratory results show 10.5% of domestic dogs, 5.0% of hyenas, and 7.7% of wild dogs sampled were positive for CDV exposure. All lions were negative. Exposure to CPV was 10.0% and 4.8% for hyenas and lions, respectively. All wild dogs were negative, and domestic dogs were not tested due to insufficient serum samples. All species sampled were negative for rabies virus neutralizing antibodies except lions. Forty percent of lions tested positive for rabies virus neutralizing antibodies. Because these lions appeared clinically healthy, this finding is consistent with seroconversion following exposure to rabies antigen. To our knowledge, this finding represents the first ever documentation of rabies virus neutralizing antibodies consistent with rabies exposure that did not lead to clinical disease in free-ranging African lions from this region. With ever-increasing human pressure on these ecosystems, understanding disease transmission dynamics is essential for proper management and conservation of these carnivore species.

  5. Effects of blood sample handling procedures on measurable inflammatory markers in plasma, serum and dried blood spot samples

    DEFF Research Database (Denmark)

    Skogstrand, K.; Thorsen, P.; Vogel, I.

    2008-01-01

    of whole blood samples at low temperatures and rapid isolation of plasma and serum. Effects of different handling procedures for all markers studied are given. DBSS proved to be a robust and convenient way to handle samples for immunoassay analysis of inflammatory markers in whole blood Udgivelsesdato......The interests in monitoring inflammation by immunoassay determination of blood inflammatory markers call for information on the stability of these markers in relation to the handling of blood samples. The increasing use of stored biobank samples for such ventures that may have been collected...... and stored for other purposes, justifies the study hereof. Blood samples were stored for 0, 4, 24, and 48 h at 4 degrees C, room temperature (RT), and at 35 degrees C, respectively, before they were separated into serum or plasma and frozen. Dried blood spot samples (DBSS) were stored for 0, 1, 2, 3, 7...

  6. Radionuclide determination in environmental samples by inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Lariviere, Dominic; Taylor, Vivien F.; Evans, R. Douglas; Cornett, R. Jack

    2006-01-01

    The determination of naturally occurring and anthropogenic radionuclides in the environment by inductively coupled plasma mass spectrometry has gained recognition over the last fifteen years, relative to radiometric techniques, as the result of improvement in instrumental performance, sample introduction equipment, and sample preparation. With the increase in instrumental sensitivity, it is now possible to measure ultratrace levels (fg range) of many radioisotopes, including those with half-lives between 1 and 1000 years, without requiring very complex sample pre-concentration schemes. However, the identification and quantification of radioisotopes in environmental matrices is still hampered by a variety of analytical issues such as spectral (both atomic and molecular ions) and non-spectral (matrix effect) interferences and instrumental limitations (e.g., abundance sensitivity). The scope of this review is to highlight recent analytical progress and issues associated with the determination of radionuclides by inductively coupled plasma mass spectrometry. The impact of interferences, instrumental limitations (e.g., degree of ionization, abundance sensitivity, detection limits) and low sample-to-plasma transfer efficiency on the measurement of radionuclides by inductively coupled plasma mass spectrometry will be described. Solutions that overcome these issues will be discussed, highlighting their pros and cons and assessing their impact on the measurement of environmental radioactivity. Among the solutions proposed, mass and chemical resolution through the use of sector-field instruments and chemical reactions/collisions in a pressurized cell, respectively, will be described. Other methods, such as unique sample introduction equipment (e.g., laser ablation, electrothermal vaporisation, high efficiency nebulization) and instrumental modifications/optimizations (e.g., instrumental vacuum, radiofrequency power, guard electrode) that improve sensitivity and performance

  7. Establishment of Demodex canis on canine skin engrafted onto scid-beige mice.

    Science.gov (United States)

    Caswell, J L; Yager, J A; Barta, J R; Parker, W

    1996-12-01

    A small animal model of canine demodicosis is described. Normal canine skin was engrafted onto scid (severe combined immunodeficient)-beige mice, which lack functional B and T lymphocytes and have reduced natural killer cell activity. The xenografts were later infected with Demodex canis collected from a dog with demodicosis. At 30-112 days following infection, mites were seen histologically in the canine hair follicles of the engrafted skin. Demodex canis adults, nymphs, larvae, and eggs were present in samples macerated in sodium hydroxide. Mite infestations could not be demonstrated in the mouse skin, nor were mites passed from the infected graft to uninfected skin grafts on in-contact mice. This model may be utilized to assess the efficacy of miticidal treatments, to evaluate the importance of specific components of the immune response, and to study the biology of D. canis.

  8. Tumor-promoting phorbol esters effect alkalinization of canine renal proximal tubular cells

    International Nuclear Information System (INIS)

    Mellas, J.; Hammerman, M.R.

    1986-01-01

    We have demonstrated the presence of specific receptors for tumor-promoting phorbol esters in the plasma membrane of the canine renal proximal tubular cell. These compounds affect proximal tubular metabolism in vitro. For example, we have shown that they inhibit gluconeogenesis in canine renal proximal tubular segments. Tumor-promoting phorbol esters have been shown to effect alkalinization of non-renal cells, by enhancing Na + -H + exchange across the plasma membrane. To determine whether the actions of tumor-promoting phorbol esters in proximal tubular segments might be mediated by a similar process, we incubated suspensions of segments from dog kidney with these compounds and measured changes in intracellular pH using [ 14 C]-5,5-dimethoxazoladine-2-4-dione (DMO) and flow dialysis. Incubation of segments with phorbol 12,13 dibutyrate, but not inactive phorbol ester, 4 γ phorbol, effected alkalinization of cells within the segments in a concentration-dependent manner. Alkalinization was dependent upon the presence of extracellular [Na + ] > intracellular [Na + ], was prevented by amiloride and was demonstrable in the presence of SITS. Our findings suggest that tumor-promoting esters stimulate the Na + -H + exchanger known to be present in the brush border membrane of the renal proximal tubular cell. It is possible that the stimulation reflects a mechanism by which phorbol esters affect metabolic processes in these cells

  9. Typing of Canine Parvovirus Strains Circulating in North-East China.

    Science.gov (United States)

    Zhao, H; Wang, J; Jiang, Y; Cheng, Y; Lin, P; Zhu, H; Han, G; Yi, L; Zhang, S; Guo, L; Cheng, S

    2017-04-01

    Canine parvovirus (CPV) is highly contagious and is a major cause of haemorrhagic enteritis and myocarditis in dogs. We investigated the genetic variation of emerging CPV strains by sequencing 64 CPV VP2 genes from 216 clinical samples of dogs from Heilongjiang, Jilin, Liaoning, Shandong and Hebei in 2014. Genetic analysis revealed that CPV-2b was predominant in Hebei and CPV-2a was predominant in the other four provinces. In addition, a CPV-2c strain has emerged in Shandong province. All samples had a Ser-Ala substitution at residue 297 and an Ile-Arg substitution at residue 324. Interestingly, in five separate canine samples, we found a mutation of Gln370 to Arg, until now detected only in isolates from pandas. The phylogenetic analysis showed clear distinctions between epidemic isolates and vaccine strains and between Chinese CPV-2c strains and CPV-2c strains found in other countries. Monitoring recent incidence of CPV strains enables evaluation and implementation of disease control strategies. © 2015 Blackwell Verlag GmbH.

  10. 9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...

  11. The detection and differentiation of canine respiratory pathogens using oligonucleotide microarrays.

    Science.gov (United States)

    Wang, Lih-Chiann; Kuo, Ya-Ting; Chueh, Ling-Ling; Huang, Dean; Lin, Jiunn-Horng

    2017-05-01

    Canine respiratory diseases are commonly seen in dogs along with co-infections with multiple respiratory pathogens, including viruses and bacteria. Virus infections in even vaccinated dogs were also reported. The clinical signs caused by different respiratory etiological agents are similar, which makes differential diagnosis imperative. An oligonucleotide microarray system was developed in this study. The wild type and vaccine strains of canine distemper virus (CDV), influenza virus, canine herpesvirus (CHV), Bordetella bronchiseptica and Mycoplasma cynos were detected and differentiated simultaneously on a microarray chip. The detection limit is 10, 10, 100, 50 and 50 copy numbers for CDV, influenza virus, CHV, B. bronchiseptica and M. cynos, respectively. The clinical test results of nasal swab samples showed that the microarray had remarkably better efficacy than the multiplex PCR-agarose gel method. The positive detection rate of microarray and agarose gel was 59.0% (n=33) and 41.1% (n=23) among the 56 samples, respectively. CDV vaccine strain and pathogen co-infections were further demonstrated by the microarray but not by the multiplex PCR-agarose gel. The oligonucleotide microarray provides a highly efficient diagnosis alternative that could be applied to clinical usage, greatly assisting in disease therapy and control. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Recombinant canine distemper virus serves as bivalent live vaccine against rabies and canine distemper.

    Science.gov (United States)

    Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao

    2012-07-20

    Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War

    Science.gov (United States)

    1981-06-05

    anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges

  14. PIXE elemental analysis of erythrocyte and blood plasma samples from human pregnancies

    International Nuclear Information System (INIS)

    Borbely-Kiss, I.; Koltay, E.; Laszlo, S.; Szabo, Gy.

    1984-01-01

    Elemental concentrations of P, S, Cl, K, Ca, Fe, Ni, Cu, Zn, Br, Rb have been determined in erythrocyte and blood plasma samples from normal and diabetic human pregnancies. Average values, the dependence of the concentrations on the time during gestation period, the correlation coefficients for pairs of elements as well as for the same elements in plasma and erythrocyte samples are given. A marked difference appeared in a number of cases between normal and diabetic pregnancies. (author)

  15. PIXE elemental analysis of erythrocyte and blood plasma samples from human pregnancies

    Energy Technology Data Exchange (ETDEWEB)

    Borbely-Kiss, I; Koltay, E; Laszlo, S; Szabo, Gy [Magyar Tudomanyos Akademia, Debrecen. Atommag Kutato Intezete; Goedeny, S [Orvostudomanyi Egyetem, Szeged (Hungary). Szueleszeti es Noegyogyaszati Klinika; Seif El-Nasr, S [Teachers' Coll. for Women, Samia (Kuwait)

    1984-07-01

    Elemental concentrations of P, S, Cl, K, Ca, Fe, Ni, Cu, Zn, Br, Rb have been determined in erythrocyte and blood plasma samples from normal and diabetic human pregnancies. Average values, the dependence of the concentrations on the time during gestation period, the correlation coefficients for pairs of elements as well as for the same elements in plasma and erythrocyte samples are given. A marked difference appeared in a number of cases between normal and diabetic pregnancies. 11 refs.

  16. Canine C-peptide for characterization of experimental diabetes in dogs

    International Nuclear Information System (INIS)

    Fischer, U.; Besch, W.; Freyse, E.-J.

    1985-01-01

    Radioimmunoassay of canine C-peptide (CCP) was developed for the characterization of endogenous beta cell function in experimentally diabetic dogs. The animals were rendered diabetic by subtotal pancreatectomy and intrasurgical infusion of 2 mg/kg streptozotocin into the superior pancreaticoduodenal artery. After an average duration of diabetes of 5 months the animals showed zero peripheral venous fasting CCP levels with no response to feeding, OGTT/i.v. glucagon loading or i.v. glucose tolerance testing. The data on CCP levels entirely coincided with simultaneously measured plasma IRI levels. In non-diabetic control animals clear-cut CCP increases were observed after all stimuli. The experimental model provided an IDDM-type diabetes without toxic symptoms but with a sufficient exocrine pancreatic function. The comparison showed that plasma IRI analyses would also allow reliable characterization of insulinogenic functions in these animals. (author)

  17. Moderate plasma activated media suppresses proliferation and migration of MDCK epithelial cells

    International Nuclear Information System (INIS)

    Mohades, Soheila; Laroussi, Mounir; Maruthamuthu, Venkat

    2017-01-01

    Low-temperature plasma has been shown to have diverse biomedical uses, including its applications in cancer and wound healing. One recent approach in treating mammalian cells with plasma is through the use of plasma activated media (PAM), which is produced by exposing cell culture media to plasma. While the adverse effects of PAM treatment on cancerous epithelial cell lines have been recently studied, much less is known about the interaction of PAM with normal epithelial cells. In this paper, non-cancerous canine kidney MDCK (Madin-Darby Canine Kidney) epithelial cells were treated by PAM and time-lapse microscopy was used to directly monitor their proliferation and random migration upon treatment. While longer durations of PAM treatment led to cell death, we found that moderate levels of PAM treatment inhibited proliferation in these epithelial cells. We also found that PAM treatment reduced random cell migration within epithelial islands. Immunofluorescence staining showed that while there were no major changes in the actin/adhesion apparatus, there was a significant change in the nuclear localization of proliferation marker Ki-67, consistent with our time-lapse results. (paper)

  18. Frequency and Clinical Epidemiology of Canine Monocytic Ehrlichiosis in Dogs Infested with Ticks from Sinaloa, Mexico

    Directory of Open Access Journals (Sweden)

    Carolina Guadalupe Sosa-Gutierrez

    2013-01-01

    Full Text Available Ehrlichia canis is a rickettsial intracellular obligate bacterial pathogen and agent of canine monocytic ehrlichiosis. The prevalence of this disease in veterinary medicine can vary depending on the diagnostic method used and the geographic location. One hundred and fifty-two canine blood samples from six veterinary clinics and two shelters from Sinaloa State (Mexico were analyzed in this study. All animals were suspected of having Canine Monocytic Ehrlichiosis (CME. The diagnostic methods used were the ELISA (Snap4Dx, IDEXX together with blood smear and platelet count. From all dogs blood samples analyzed, 74.3% were positive to E. canis by ELISA and 40.1% were positive by blood smear. The sensitivity and specificity observed in the ELISA test were 78.8% and 86.7%. In addition, thrombocytopenia was presented in 87.6% of positive dogs. The predominant clinical manifestations observed were fever, anorexia, depression, lethargy, and petechiae. Consequently, this is the first report in which the morulae were visualized in the blood samples, and E. canis-specific antibodies were detected in dogs from Sinaloa, Northwest of Mexico.

  19. An evaluation of multiplex bead-based analysis of cytokines and soluble proteins in archived lithium heparin plasma, EDTA plasma and serum samples

    DEFF Research Database (Denmark)

    Brøndum, Line; Sørensen, Brita Singers; Eriksen, Jesper Grau

    2016-01-01

    -13, and VEGF, LH plasma levels vs. EDTA plasma: IL-2 and IL-4. CONCLUSION: Stored serum, LH plasma, and EDTA plasma from clinical trials can be used for analysis of circulating cytokines and proteins. Variations in measurements occur, but are within reasonable ranges. The optimal type of media...... in plasma and serum from 86 head and neck cancer patients and 33 controls were evaluated: EGFR, leptin, OPN, VEGFR-1, VEGFR-2, IL-2, IL-13, PDGF-bb, TNF, PAI-1, SDF-1a, IL-4, IL-6, IL-8, eotaxin, G-CSF, VEGF, GRO-a, and HGF. RESULTS: The correlation between measurements of the same samples analyzed...... on different dates was reasonable. However, samples run on different dates could exhibit different absolute values. The 75th percentile of the fold differences for samples run on different dates was 2.2. No significant difference was found between one and four freeze-thaw cycles (except for HGF...

  20. Cytotoxic action of Brazilian propolis in vitro on canine osteosarcoma cells.

    Science.gov (United States)

    Cinegaglia, N C; Bersano, P R O; Búfalo, M C; Sforcin, J M

    2013-09-01

    Osteosarcoma (OSA) is a primary bone neoplasm frequently diagnosed in dogs. The biology of OSA in pet dogs is identical to that of pediatric patients, and it has been considered an excellent model in vivo to study human OSA. Since the individual response to chemotherapy is unpredictable and considering that propolis is a natural product with several biological properties, this work evaluated the cytotoxic action of propolis on canine OSA cells. The primary cell culture of canine OSA was obtained from the tumor of a dog with OSA. Cell viability was assessed after incubation with propolis, 70% ethanol (propolis solvent), and carboplatin after 6, 24, 48, and 72 h. Cell viability was analyzed by the crystal violet method. Data showed that canine OSA cells were sensitive to propolis in a dose- and time-dependent manner and had a distinct morphology compared to control. Its solvent (70% ethanol) had no effect on cell viability, suggesting that the cytotoxic action was exclusively due to propolis. Our propolis sample exerted a cytotoxic effect on canine OSA cells, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment. Copyright © 2012 John Wiley & Sons, Ltd.

  1. Inductively coupled plasma mass spectrometry in the analysis of biological samples and pharmaceutical drugs

    Science.gov (United States)

    Ossipov, K.; Seregina, I. F.; Bolshov, M. A.

    2016-04-01

    Inductively coupled plasma mass spectrometry (ICP-MS) is widely used in the analysis of biological samples (whole blood, serum, blood plasma, urine, tissues, etc.) and pharmaceutical drugs. The shortcomings of this method related to spectral and non-spectral interferences are manifested in full measure in determination of the target analytes in these complex samples strongly differing in composition. The spectral interferences are caused by similarity of masses of the target component and sample matrix components. Non-spectral interferences are related to the influence of sample matrix components on the physicochemical processes taking place during formation and transportation of liquid sample aerosols into the plasma, on the value and spatial distribution of plasma temperature and on the transmission of the ion beam from the interface to mass spectrometer detector. The review is devoted to analysis of different mechanisms of appearance of non-spectral interferences and to ways for their minimization or elimination. Special attention is paid to the techniques of biological sample preparation, which largely determine the mechanisms of the influence of sample composition on the results of element determination. The ways of lowering non-spectral interferences by instrumental parameter tuning and application of internal standards are considered. The bibliography includes 189 references.

  2. Canine Visceral Leishmaniasis in Wild Canines (Fox, Jackal, and Wolf in Northeastern Iran Using Parasitological, Serological, and Molecular Methods

    Directory of Open Access Journals (Sweden)

    Mehdi Mohebali

    2016-10-01

    Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.

  3. Centrifugation protocols: tests to determine optimal lithium heparin and citrate plasma sample quality.

    Science.gov (United States)

    Dimeski, Goce; Solano, Connie; Petroff, Mark K; Hynd, Matthew

    2011-05-01

    Currently, no clear guidelines exist for the most appropriate tests to determine sample quality from centrifugation protocols for plasma sample types with both lithium heparin in gel barrier tubes for biochemistry testing and citrate tubes for coagulation testing. Blood was collected from 14 participants in four lithium heparin and one serum tube with gel barrier. The plasma tubes were centrifuged at four different centrifuge settings and analysed for potassium (K(+)), lactate dehydrogenase (LD), glucose and phosphorus (Pi) at zero time, poststorage at six hours at 21 °C and six days at 2-8°C. At the same time, three citrate tubes were collected and centrifuged at three different centrifuge settings and analysed immediately for prothrombin time/international normalized ratio, activated partial thromboplastin time, derived fibrinogen and surface-activated clotting time (SACT). The biochemistry analytes indicate plasma is less stable than serum. Plasma sample quality is higher with longer centrifugation time, and much higher g force. Blood cells present in the plasma lyse with time or are damaged when transferred in the reaction vessels, causing an increase in the K(+), LD and Pi above outlined limits. The cells remain active and consume glucose even in cold storage. The SACT is the only coagulation parameter that was affected by platelets >10 × 10(9)/L in the citrate plasma. In addition to the platelet count, a limited but sensitive number of assays (K(+), LD, glucose and Pi for biochemistry, and SACT for coagulation) can be used to determine appropriate centrifuge settings to consistently obtain the highest quality lithium heparin and citrate plasma samples. The findings will aid laboratories to balance the need to provide the most accurate results in the best turnaround time.

  4. Clinical and Statistical Study on Canine Impaction

    Directory of Open Access Journals (Sweden)

    Adina-Simona Coșarcă

    2013-08-01

    Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic

  5. Proteomic biomarker discovery in 1000 human plasma samples with mass spectrometry

    DEFF Research Database (Denmark)

    Cominetti, Ornella; Núñez Galindo, Antonio; Corthésy, John

    2016-01-01

    automated proteomic biomarker discovery workflow. Herein, we have applied this approach to analyze 1000 plasma samples from the multicentered human dietary intervention study "DiOGenes". Study design, sample randomization, tracking, and logistics were the foundations of our large-scale study. We checked...

  6. Stereospecific effects of morphine on plasma opioid peptide levels and nociception in dogs

    Energy Technology Data Exchange (ETDEWEB)

    Adams, M.L.; Morris, D.L.; Dewey, W.L.

    1986-03-05

    ..beta..-endorphin, (met)enkephalin, and (leu)enkephalin were quantitated in canine plasma by radioimmunoassay (RIA) after extraction of the peptides on Sep Pak C18 cartridges. Plasma samples were taken one hour after a 10 mg/kg s.c. injection of (-)-morphine SO/sub 4/ or (+)-morphine HBr. Antinociception, measured by a dog tail-flick test, and morphine-induced emesis, salivation, diarrhea, and ataxia were quantitated before sampling. Control levels for each dog were taken one week earlier at the same time of day after saline injections. Antinociception, morphine signs, and opioid peptide levels in plasma were significantly increased by (-)-morphine. Antinociception increased from zero to 83.54 +/- 11.0%. The number of morphine signs increased from zero to 2.9 +/- 0.28 per dog. ..beta..-endorphin levels increased from 44.52 +/- 4.25 to 90.6 +/- 7.38 pg/ml; (met)enkephalin levels increased from 253.56 +/- 22.04 to 497.1 +/- 58.12 pg/ml; (leu)-enkephalin increased from 141.65 +/- 12.9 to 313.24 +/- 35.95 pg/ml. None of these effects were observed in the dogs that received (+)-morphine. The conclude that morphine stereospecifically inhibits nociception, induces observable signs, and increases plasma opioid peptide levels in dogs.

  7. Stereospecific effects of morphine on plasma opioid peptide levels and nociception in dogs

    International Nuclear Information System (INIS)

    Adams, M.L.; Morris, D.L.; Dewey, W.L.

    1986-01-01

    β-endorphin, [met]enkephalin, and [leu]enkephalin were quantitated in canine plasma by radioimmunoassay (RIA) after extraction of the peptides on Sep Pak C18 cartridges. Plasma samples were taken one hour after a 10 mg/kg s.c. injection of (-)-morphine SO 4 or (+)-morphine HBr. Antinociception, measured by a dog tail-flick test, and morphine-induced emesis, salivation, diarrhea, and ataxia were quantitated before sampling. Control levels for each dog were taken one week earlier at the same time of day after saline injections. Antinociception, morphine signs, and opioid peptide levels in plasma were significantly increased by (-)-morphine. Antinociception increased from zero to 83.54 +/- 11.0%. The number of morphine signs increased from zero to 2.9 +/- 0.28 per dog. β-endorphin levels increased from 44.52 +/- 4.25 to 90.6 +/- 7.38 pg/ml; [met]enkephalin levels increased from 253.56 +/- 22.04 to 497.1 +/- 58.12 pg/ml; [leu]-enkephalin increased from 141.65 +/- 12.9 to 313.24 +/- 35.95 pg/ml. None of these effects were observed in the dogs that received (+)-morphine. The conclude that morphine stereospecifically inhibits nociception, induces observable signs, and increases plasma opioid peptide levels in dogs

  8. Podoplanin Expression in Canine Melanoma.

    Science.gov (United States)

    Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

    2016-12-01

    A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.

  9. Panoramic radiological study to identify locally displaced maxillary canines in Bangladeshi population

    International Nuclear Information System (INIS)

    Alif, Sheikh Mohammad; Haque, Sejuty; Nimmi, Naima; Ashraf, Ali; Khan, Saeed Hossain; Khan, Mahfujul Haq

    2011-01-01

    This study was performed to determine the prevalence of maxillary canine impaction on a basis of a single panoramic radiograph in Bangladeshi population. A random sample of seven hundred panoramic radiographs was collected from the patient record of a dental clinic. All the selected panoramic radiographs were taken from January 2009 to August 2010 by a single panoramic radiograph machine with the same exposure time (19 seconds) for all radiographs. One hundred and twenty panoramic radiographs were excluded to minimize the selection bias. In a dim lit room, an observer assessed the radiographs on a standard radiographic light box. The position of the impacted maxillary canine was recorded in line with the longitudinal axis of a tooth using the edge of a metal ruler. Data were subsequently put on SPSS 11.5 software and chi-square (x 2 ) tests were applied to find out the association. Among 580 panoramic radiographs it was found that impacted maxillary canines were present in only 7 (1.2%) radiographs. A statistical significant difference was found between the age of the patients and the vertical position of the impacted canines (p=0.000) and between the age of the patients and the horizontal position of the impacted canines (p=0.003). The prevalence was found to be low compared with the present study from the limitation of panoramic image. Further study needs to include three-dimensional imaging modality.

  10. Simulation of rarefied low pressure RF plasma flow around the sample

    Science.gov (United States)

    Zheltukhin, V. S.; Shemakhin, A. Yu

    2017-01-01

    The paper describes a mathematical model of the flow of radio frequency plasma at low pressure. The hybrid mathematical model includes the Boltzmann equation for the neutral component of the RF plasma, the continuity and the thermal equations for the charged component. Initial and boundary conditions for the corresponding equations are described. The electron temperature in the calculations is 1-4 eV, atoms temperature in the plasma clot is (3-4) • 103 K, in the plasma jet is (3.2-10) • 102 K, the degree of ionization is 10-7-10-5, electron density is 1015-1019 m-3. For calculations plasma parameters is developed soft package on C++ program language, that uses the OpenFOAM library package. Simulations for the vacuum chamber in the presence of a sample and the free jet flow were carried out.

  11. Vaccines for canine leishmaniasis

    Directory of Open Access Journals (Sweden)

    Clarisa B. Palatnik-De-Sousa

    2012-04-01

    Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans

  12. Expression of platelet-derived growth factor BB, erythropoietin and erythropoietin receptor in canine and feline osteosarcoma.

    Science.gov (United States)

    Meyer, F R L; Steinborn, R; Grausgruber, H; Wolfesberger, B; Walter, I

    2015-10-01

    The discovery of expression of the erythropoietin receptor (EPO-R) on neoplastic cells has led to concerns about the safety of treating anaemic cancer patients with EPO. In addition to its endocrine function, the receptor may play a role in tumour progression through an autocrine mechanism. In this study, the expression of EPO, EPO-R and platelet-derived growth factor BB (PDGF-BB) was analysed in five feline and 13 canine osteosarcomas using immunohistochemistry (IHC) and reverse transcription polymerase chain reaction (RT-PCR). EPO expression was positive in all tumours by IHC, but EPO mRNA was only detected in 38% of the canine and 40% of the feline samples. EPO-R was expressed in all samples by quantitative RT-PCR (RT-qPCR) and IHC. EPO-R mRNA was expressed at higher levels in all feline tumours, tumour cell lines, and kidney when compared to canine tissues. PDGF-BB expression was variable by IHC, but mRNA was detected in all samples. To assess the functionality of the EPO-R on tumour cells, the proliferation of canine and feline osteosarcoma cell lines was evaluated after EPO administration using an alamarBlue assay and Ki67 immunostaining. All primary cell lines responded to EPO treatment in at least one of the performed assays, but the effect on proliferation was very low indicating only a weak responsiveness of EPO-R. In conclusion, since EPO and its receptor are expressed by canine and feline osteosarcomas, an autocrine or paracrine tumour progression mechanism cannot be excluded, although in vitro data suggest a minimal role of EPO-R in osteosarcoma cell proliferation. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Telomere length in normal and neoplastic canine tissues.

    Science.gov (United States)

    Cadile, Casey D; Kitchell, Barbara E; Newman, Rebecca G; Biller, Barbara J; Hetler, Elizabeth R

    2007-12-01

    To determine the mean telomere restriction fragment (TRF) length in normal and neoplastic canine tissues. 57 solid-tissue tumor specimens collected from client-owned dogs, 40 samples of normal tissue collected from 12 clinically normal dogs, and blood samples collected from 4 healthy blood donor dogs. Tumor specimens were collected from client-owned dogs during diagnostic or therapeutic procedures at the University of Illinois Veterinary Medical Teaching Hospital, whereas 40 normal tissue samples were collected from 12 control dogs. Telomere restriction fragment length was determined by use of an assay kit. A histologic diagnosis was provided for each tumor by personnel at the Veterinary Diagnostic Laboratory at the University of Illinois. Mean of the mean TRF length for 44 normal samples was 19.0 kilobases (kb; range, 15.4 to 21.4 kb), and the mean of the mean TRF length for 57 malignant tumors was 19.0 kb (range, 12.9 to 23.5 kb). Although the mean of the mean TRF length for tumors and normal tissues was identical, tumor samples had more variability in TRF length. Telomerase, which represents the main mechanism by which cancer cells achieve immortality, is an attractive therapeutic target. The ability to measure telomere length is crucial to monitoring the efficacy of telomerase inhibition. In contrast to many other mammalian species, the length of canine telomeres and the rate of telomeric DNA loss are similar to those reported in humans, making dogs a compelling choice for use in the study of human anti-telomerase strategies.

  14. MicroRNAs as tumour suppressors in canine and human melanoma cells and as a prognostic factor in canine melanomas.

    Science.gov (United States)

    Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y

    2013-06-01

    Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.

  15. Rapid and sensitive detection of canine distemper virus by real-time reverse transcription recombinase polymerase amplification.

    Science.gov (United States)

    Wang, Jianchang; Wang, Jinfeng; Li, Ruiwen; Liu, Libing; Yuan, Wanzhe

    2017-08-15

    Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious and fatal systemic disease in free-living and captive carnivores worldwide. Recombinase polymerase amplification (RPA), as an isothermal gene amplification technique, has been explored for the molecular detection of diverse pathogens. A real-time reverse transcription RPA (RT-RPA) assay for the detection of canine distemper virus (CDV) using primers and exo probe targeting the CDV nucleocapsid protein gene was developed. A series of other viruses were tested by the RT-RPA.Thirty-two field samples were further tested by RT-RPA, and the resuts were compared with those obtained by the real-time RT-PCR. The RT-RPA assay was performed successfully at 40 °C, and the results were obtained within 3 min-12 min. The assay could detect CDV, but did not show cross-detection of canine parvovirus-2 (CPV-2), canine coronavirus (CCoV), canine parainfluenza virus (CPIV), pseudorabies virus (PRV) or Newcastle disease virus (NDV), demonstrating high specificity. The analytical sensitivity of RT-RPA was 31.8 copies in vitro transcribed CDV RNA, which is 10 times lower than the real-time RT-PCR. The assay performance was validated by testing 32 field samples and compared to real-time RT-PCR. The results indicated an excellent correlation between RT-RPA and a reference real-time RT-PCR method. Both assays provided the same results, and R 2 value of the positive results was 0.947. The results demonstrated that the RT-RPA assay offers an alternative tool for simple, rapid, and reliable detection of CDV both in the laboratory and point-of-care facility, especially in the resource-limited settings.

  16. The administration of a single dose of a multivalent (DHPPiL4R) vaccine prevents clinical signs and mortality following virulent challenge with canine distemper virus, canine adenovirus or canine parvovirus

    OpenAIRE

    Stephen Wilson; Joanna Illambas; Elisabeth Siedek; Anne Thomas; Vickie King; Catrina Stirling; Edita Plevová; Jeremy Salt; Gordon Sture

    2014-01-01

    Four challenge studies following vaccination of dogs with a multivalent vaccine containing canine parvovirus (CPV-2b), adenovirus (CAV-1/-2) and distemper (CDV) are described. Six week old puppies received a single vaccination while non-vaccinated control dogs received water. In each respective trial, groups of dogs were challenged 21 days after vaccination with heterologous viral isolates. Clinical observations, rectal temperature measurements, and blood and swab samples for analysis were co...

  17. A random sampling approach for robust estimation of tissue-to-plasma ratio from extremely sparse data.

    Science.gov (United States)

    Chu, Hui-May; Ette, Ene I

    2005-09-02

    his study was performed to develop a new nonparametric approach for the estimation of robust tissue-to-plasma ratio from extremely sparsely sampled paired data (ie, one sample each from plasma and tissue per subject). Tissue-to-plasma ratio was estimated from paired/unpaired experimental data using independent time points approach, area under the curve (AUC) values calculated with the naïve data averaging approach, and AUC values calculated using sampling based approaches (eg, the pseudoprofile-based bootstrap [PpbB] approach and the random sampling approach [our proposed approach]). The random sampling approach involves the use of a 2-phase algorithm. The convergence of the sampling/resampling approaches was investigated, as well as the robustness of the estimates produced by different approaches. To evaluate the latter, new data sets were generated by introducing outlier(s) into the real data set. One to 2 concentration values were inflated by 10% to 40% from their original values to produce the outliers. Tissue-to-plasma ratios computed using the independent time points approach varied between 0 and 50 across time points. The ratio obtained from AUC values acquired using the naive data averaging approach was not associated with any measure of uncertainty or variability. Calculating the ratio without regard to pairing yielded poorer estimates. The random sampling and pseudoprofile-based bootstrap approaches yielded tissue-to-plasma ratios with uncertainty and variability. However, the random sampling approach, because of the 2-phase nature of its algorithm, yielded more robust estimates and required fewer replications. Therefore, a 2-phase random sampling approach is proposed for the robust estimation of tissue-to-plasma ratio from extremely sparsely sampled data.

  18. Automation of gender determination in human canines using artificial intelligence

    Directory of Open Access Journals (Sweden)

    F. Fidya

    2017-09-01

    Full Text Available Background: Gender determination is an important aspect of the identification process. The tooth represents a part of the human body that indicates the nature of sexual dimorphism. Artificial intelligence enables computers to perform to the same standard the same tasks as those carried out by humans. Several methods of classification exist within an artificial intelligence approach to identifying sexual dimorphism in canines. Purpose: This study aimed to quantify the respective accuracy of the Naive Bayes, decision tree, and multi-layer perceptron (MLP methods in identifying sexual dimorphism in canines. Methods: A sample of results derived from 100 measurements of the diameter of mesiodistal, buccolingual, and diagonal upper and lower canine jaw models of both genders were entered into an application computer program that implements the algorithm (MLP. The analytical process was conducted by the program to obtain a classification model with testing being subsequently carried out in order to obtain 50 new measurement results, 25 each for males and females. A comparative analysis was conducted on the program-generated information. Results: The accuracy rate of the Naive Bayes method was 82%, while that of the decision tree and MLP amounted to 84%. The MLP method had an absolute error value lower than that of its decision tree counterpart. Conclusion: The use of artificial intelligence methods produced a highly accurate identification process relating to the gender determination of canine teeth. The most appropriate method was the MLP with an accuracy rate of 84%.

  19. Validation and determination of a reference interval for canine HbA1c using an immunoturbidimetric assay.

    Science.gov (United States)

    Goemans, Anne F; Spence, Susanna J; Ramsey, Ian K

    2017-06-01

    Hemoglobin A1c (HbA1c) provides a reliable measure of glycemic control over 2-3 months in human diabetes mellitus. In dogs, presence of HbA1c has been demonstrated, but there are no validated commercial assays. The purpose of the study was to validate a commercially available automated immunoturbidimetric assay for canine HbA1c and determine an RI in a hospital population. The specificity of the assay was assessed by inducing glycosylation in vitro using isolated canine hemoglobin, repeatability by measuring canine samples 5 times in succession, long term inter-assay imprecision by measuring supplied control materials, stability using samples stored at 4°C over 5 days and -20°C over 8 weeks, linearity by mixing samples of known HbA1c in differing proportions, and the effect of anticoagulants with paired samples. An RI was determined using EDTA-anticoagulated blood samples from 60 nondiabetic hospitalized animals of various ages and breeds. Hemoglobin A1c was also measured in 10 diabetic dogs. The concentration of HbA1c increased proportionally with glucose concentration in vitro. For repeat measurements, the CV was 4.08% (range 1.16-6.10%). Samples were stable for 5 days at 4°C. The assay was linear within the assessed range. Heparin- and EDTA-anticoagulated blood provided comparable results. The RI for HbA1c was 9-18.5 mmol/mol. There was no apparent effect of age or breed on HbA1c. In diabetic dogs, HbA1c ranged from 14 to 48 mmol/mol. The assay provides a reliable method for canine HbA1c measurement with good analytic performance. © 2017 American Society for Veterinary Clinical Pathology.

  20. Simulation of rarefied low pressure RF plasma flow around the sample

    International Nuclear Information System (INIS)

    Zheltukhin, V S; Shemakhin, A Yu

    2017-01-01

    The paper describes a mathematical model of the flow of radio frequency plasma at low pressure. The hybrid mathematical model includes the Boltzmann equation for the neutral component of the RF plasma, the continuity and the thermal equations for the charged component. Initial and boundary conditions for the corresponding equations are described. The electron temperature in the calculations is 1-4 eV, atoms temperature in the plasma clot is (3-4) • 10 3 K, in the plasma jet is (3.2-10) • 10 2 K, the degree of ionization is 10 -7 -10 -5 , electron density is 10 15 -10 19 m -3 . For calculations plasma parameters is developed soft package on C++ program language, that uses the OpenFOAM library package. Simulations for the vacuum chamber in the presence of a sample and the free jet flow were carried out. (paper)

  1. Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review

    Directory of Open Access Journals (Sweden)

    Parviz Torkzaban

    2016-09-01

    Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.

  2. Isolation and characterization of canine parvovirus type 2c (CPV-2c from symptomatic puppies

    Directory of Open Access Journals (Sweden)

    R Puentes

    2012-09-01

    Full Text Available Canine parvovirus type 2 (CPV-2 is a leading cause of diarrhea in puppies in several parts of the world. In this study CPV-2 was detected and recovered from puppies showing clinical disease from Montevideo, Uruguay. Samples were processed and used to infect CRFK and MDCK cells in order to isolate the virus. Out of twelve, two samples were positive for CPV-2. A genomic region of 583 bp was amplified and the molecular characterization was performed by sequencing, phylogenetic analysis and Restriction Fragment Length Polymorphism (RFLP. Two isolated viruses (UY1 and UY2 were CPV-2c-like viruses. The comparison between the cytophatic effect (CPE of CPV-2 (vaccinal virus and CPV-2c (isolated virus on primary canine cells cultures and on CRFK line cells, demonstrated that CPV-2c is less citopathogenic in CRFK than in primary cultures. Our study represents the first report on isolation and characterization of canine parvovirus type 2c (CPV-2c in cell cultures from South American dogs.

  3. 9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).

    Science.gov (United States)

    2010-01-01

    ... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...

  4. TaqMan probe real-time polymerase chain reaction assay for the quantification of canine DNA in chicken nugget.

    Science.gov (United States)

    Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub

    2016-01-01

    This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.

  5. Orthodontic Traction of Impacted Canine Using Cantilever

    Directory of Open Access Journals (Sweden)

    Cláudia Nakandakari

    2016-01-01

    Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.

  6. Transmigration of mandibular canine – case report

    International Nuclear Information System (INIS)

    Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia

    2014-01-01

    Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation

  7. Canine Parvovirus: Current Perspective

    OpenAIRE

    Nandi, S.; Kumar, Manoj

    2010-01-01

    Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...

  8. Effects of fusion relevant transient energetic radiation, plasma and thermal load on PLANSEE double forged tungsten samples in a low-energy plasma focus device

    Science.gov (United States)

    Javadi, S.; Ouyang, B.; Zhang, Z.; Ghoranneviss, M.; Salar Elahi, A.; Rawat, R. S.

    2018-06-01

    Tungsten is the leading candidate for plasma facing component (PFC) material for thermonuclear fusion reactors and various efforts are ongoing to evaluate its performance or response to intense fusion relevant radiation, plasma and thermal loads. This paper investigates the effects of hot dense decaying pinch plasma, highly energetic deuterium ions and fusion neutrons generated in a low-energy (3.0 kJ) plasma focus device on the structure, morphology and hardness of the PLANSEE double forged tungsten (W) samples surfaces. The tungsten samples were provided by Forschungszentrum Juelich (FZJ), Germany via International Atomic Energy Agency, Vienna, Austria. Tungsten samples were irradiated using different number of plasma focus (PF) shots (1, 5 and 10) at a fixed axial distance of 5 cm from the anode top and also at various distances from the top of the anode (5, 7, 9 and 11 cm) using fixed number (5) of plasma focus shots. The virgin tungsten sample had bcc structure (α-W phase). After PF irradiation, the XRD analysis showed (i) the presence of low intensity new diffraction peak corresponding to β-W phase at (211) crystalline plane indicating the partial structural phase transition in some of the samples, (ii) partial amorphization, and (iii) vacancy defects formation and compressive stress in irradiated tungsten samples. Field emission scanning electron microscopy showed the distinctive changes to non-uniform surface with nanometer sized particles and particle agglomerates along with large surface cracks at higher number of irradiation shots. X-ray photoelectron spectroscopy analysis demonstrated the reduction in relative tungsten oxide content and the increase in metallic tungsten after irradiation. Hardness of irradiated samples initially increased for one shot exposure due to reduction in tungsten oxide phase, but then decreased with increasing number of shots due to increasing concentration of defects. It is demonstrated that the plasma focus device provides

  9. High throughput pyrosequencing technology for molecular differential detection of Babesia vogeli, Hepatozoon canis, Ehrlichia canis and Anaplasma platys in canine blood samples.

    Science.gov (United States)

    Kaewkong, Worasak; Intapan, Pewpan M; Sanpool, Oranuch; Janwan, Penchom; Thanchomnang, Tongjit; Kongklieng, Amornmas; Tantrawatpan, Chairat; Boonmars, Thidarut; Lulitanond, Viraphong; Taweethavonsawat, Piyanan; Chungpivat, Sudchit; Maleewong, Wanchai

    2014-06-01

    Canine babesiosis, hepatozoonosis, ehrlichiosis, and anaplasmosis are tick-borne diseases caused by different hemopathogens. These diseases are causes of morbidity and mortality in dogs. The classic method for parasite detection and differentiation is based on microscopic observation of blood smears. The limitations of the microscopic method are that its performance requires a specially qualified person with professional competence, and it is ineffective in differentiating closely related species. This study applied PCR amplification with high throughput pyrosequencing for molecular differential detection of the following 4 hemoparasites common to tropical areas in dog blood samples: Babesia vogeli, Hepatozoon canis, Ehrlichia canis, and Anaplasma platys. PCR was initially used to amplify specific target regions of the ribosomal RNA genes of each parasite using 2 primer pairs that included 18S rRNA for protozoa (B. vogeli and H. canis) and 16S rRNA for rickettsia (E. canis and A. platys). Babesia vogeli and H. canis were discriminated using 9 nucleotide positions out of 30 base pairs, whereas E. canis and A. platys were differentiated using 15 nucleotide positions out of 34 base pairs that were determined from regions adjacent to 3' ends of the sequencing primers. This method provides a challenging alternative for a rapid diagnosis and surveillance of these tick-borne diseases in canines. Copyright © 2014 Elsevier GmbH. All rights reserved.

  10. Effects of Carbenoxolone on the Canine Pituitary-Adrenal Axis.

    Science.gov (United States)

    Teshima, Takahiro; Matsumoto, Hirotaka; Okusa, Tomoko; Nakamura, Yumi; Koyama, Hidekazu

    2015-01-01

    Cushing's disease caused by pituitary corticotroph adenoma is a common endocrine disease in dogs. A characteristic biochemical feature of corticotroph adenomas is their relative resistance to suppressive negative feedback by glucocorticoids. The abnormal expression of 11beta-hydroxysteroid dehydrogenase (11HSD), which is a cortisol metabolic enzyme, is found in human and murine corticotroph adenomas. Our recent studies demonstrated that canine corticotroph adenomas also have abnormal expression of 11HSD. 11HSD has two isoforms in dogs, 11HSD type1 (HSD11B1), which converts cortisone into active cortisol, and 11HSD type2 (HSD11B2), which converts cortisol into inactive cortisone. It has been suggested that glucocorticoid resistance in corticotroph tumors is related to the overexpression of HSD11B2. Therefore it was our aim to investigate the effects of carbenoxolone (CBX), an 11HSD inhibitor, on the healthy dog's pituitary-adrenal axis. Dogs were administered 50 mg/kg of CBX twice each day for 15 days. During CBX administration, no adverse effects were observed in any dogs. The plasma adrenocorticotropic hormone (ACTH), and serum cortisol and cortisone concentrations were significantly lower at day 7 and 15 following corticotropin releasing hormone stimulation. After completion of CBX administration, the HSD11B1 mRNA expression was higher, and HSD11B2 mRNA expression was significantly lower in the pituitaries. Moreover, proopiomelanocortin mRNA expression was lower, and the ratio of ACTH-positive cells in the anterior pituitary was also significantly lower after CBX treatment. In adrenal glands treated with CBX, HSD11B1 and HSD11B2 mRNA expression were both lower compared to normal canine adrenal glands. The results of this study suggested that CBX inhibits ACTH secretion from pituitary due to altered 11HSD expressions, and is potentially useful for the treatment of canine Cushing's disease.

  11. Plasma metanephrine for assessing the selectivity of adrenal venous sampling

    NARCIS (Netherlands)

    Dekkers, T.; Deinum, J.; Schultze Kool, L.J.; Blondin, D.; Vonend, O.; Hermus, A.R.M.M.; Peitzsch, M.; Rump, L.C.; Antoch, G.; Sweep, F.C.; Bornstein, S.R.; Lenders, J.W.M.; Willenberg, H.S.; Eisenhofer, G.

    2013-01-01

    Adrenal vein sampling is used to establish the origins of excess production of adrenal hormones in primary aldosteronism. Correct catheter positioning is confirmed using adrenal vein measurements of cortisol, but this parameter is not always reliable. Plasma metanephrine represents an alternative

  12. Transcutaneous glomerular filtration rate measurement in a canine animal model of chronic kidney disease.

    Science.gov (United States)

    Mondritzki, Thomas; Steinbach, Sarah M L; Boehme, Philip; Hoffmann, Jessica; Kullmann, Maximilian; Schock-Kusch, Daniel; Vogel, Julia; Kolkhof, Peter; Sandner, Peter; Bischoff, Erwin; Hüser, Jörg; Dinh, Wilfried; Truebel, Hubert

    Quantitative assessment of renal function by measurement of glomerular filtration rate (GFR) is an important part of safety and efficacy evaluation in preclinical drug development. Existing methods are often time consuming, imprecise and associated with animal burden. Here we describe the comparison between GFR determinations with sinistrin (PS-GFR) and fluorescence-labelled sinistrin-application and its transcutaneous detection (TD-GFR) in a large animal model of chronic kidney disease (CKD). TD-GFR measurements compared to a standard method using i.v. sinistrin were performed in a canine model. Animals were treated with one-sided renal wrapping (RW) followed by renal artery occlusion (RO). Biomarker and remote hemodynamic measurements were performed. Plasma sinistrin in comparison to transcutaneous derived GFR data were determined during healthy conditions, after RW and RW+RO. RW alone did not led to any significant changes in renal function, neither with PS-GFR nor TD-GFR. Additional RO showed a rise in blood pressure (+68.0mmHg), plasma urea (+28.8mmol/l), creatinine (+224,4μmol/l) and symmetric dimethylarginine (SDMA™; +12.6μg/dl). Plasma sinistrin derived data confirmed the expected drop (-44.7%, p<0.0001) in GFR. The calculated transcutaneous determined Fluorescein Isothiocyanate (FITC)-sinistrin GFR showed no differences to plasma sinistrin GFR at all times. Both methods were equaly sensitive to diagnose renal dysfunction in the affected animals. Renal function assessment using TD-GFR is a valid method to improve preclinical drug discovery and development. Furthermore, TD-GFR method offers advantages in terms of reduced need for blood sampling and thus decreasing animal burden compared to standard procedures. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Evaluation of P16 expression in canine appendicular osteosarcoma.

    Science.gov (United States)

    Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K

    2017-06-20

    Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.

  14. Cone beam computed tomography findings of impacted upper canines

    Energy Technology Data Exchange (ETDEWEB)

    Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)

    2014-12-15

    To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

  15. Cone beam computed tomography findings of impacted upper canines

    International Nuclear Information System (INIS)

    Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio

    2014-01-01

    To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

  16. Development of a dipstick assay for detection of Leishmania-specific canine antibodies

    NARCIS (Netherlands)

    Schallig, Henk D. F. H.; Cardoso, Luís; Hommers, Marieke; Kroon, Nel; Belling, Guus; Rodrigues, Manuela; Semião-Santos, Saul J.; Vetter, Hans

    2004-01-01

    A dipstick assay, based on Leishmania infantum antigen, for the rapid detection of Leishmania-specific antibodies in canine serum samples was developed and evaluated. After determination of optimal dipstick test conditions, test performance was compared with two existing serological tests, i.e., the

  17. Efficient discrimination and removal of phospholipids during electromembrane extraction from human plasma samples

    DEFF Research Database (Denmark)

    Vårdal, Linda; Gjelstad, Astrid; Huang, Chuixiu

    2017-01-01

    to be highly efficient for providing phospholipid-free extracts. CONCLUSION: Ultra-HPLC-MS/MS analysis of the donor solutions revealed that the phospholipids principally remained in the plasma samples. This proved that the phospholipids did not migrate in the electrical field and they were prevented from......AIM: For the first time, extracts obtained from human plasma samples by electromembrane extraction (EME) were investigated comprehensively with particular respect to phospholipids using ultra-high-performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS). Thhe purpose...

  18. Seroprevalence of Canine Parvovirus in Dogs in Lusaka District, Zambia

    OpenAIRE

    Saasa, Ngonda; Nalubamba, King Shimumbo; M’kandawire, Ethel; Siwila, Joyce

    2016-01-01

    Canine parvovirus (CPV) enteritis is a highly contagious enteric disease of young dogs. Limited studies have been done in Zambia to investigate the prevalence of CPV in dogs. Blood was collected from dogs from three veterinary clinics (clinic samples, n = 174) and one township of Lusaka (field samples, n = 56). Each dog's age, sex, breed, and vaccination status were recorded. A haemagglutination assay using pig erythrocytes and modified live parvovirus vaccine as the antigen was used. Antibod...

  19. Influence of sample temperature on the expansion dynamics and the optical emission of laser-induced plasma

    Energy Technology Data Exchange (ETDEWEB)

    Eschlböck-Fuchs, S.; Haslinger, M.J.; Hinterreiter, A.; Kolmhofer, P.; Huber, N. [Christian Doppler Laboratory for Laser-Assisted Diagnostics, Institute of Applied Physics, Johannes Kepler University Linz, A-4040 Linz (Austria); Rössler, R. [voestalpine Stahl GmbH, A-4031 Linz (Austria); Heitz, J. [Christian Doppler Laboratory for Laser-Assisted Diagnostics, Institute of Applied Physics, Johannes Kepler University Linz, A-4040 Linz (Austria); Pedarnig, J.D., E-mail: johannes.pedarnig@jku.at [Christian Doppler Laboratory for Laser-Assisted Diagnostics, Institute of Applied Physics, Johannes Kepler University Linz, A-4040 Linz (Austria)

    2013-09-01

    We investigate the influence of sample temperature on the dynamics and optical emission of laser induced plasma for various solid materials. Bulk aluminum alloy, silicon wafer, and metallurgical slag samples are heated to temperature T{sub S} ≤ 500 °C and ablated in air by Nd:YAG laser pulses (wavelength 1064 nm, pulse duration approx. 7 ns). The plasma dynamics is investigated by fast time-resolved photography. For laser-induced breakdown spectroscopy (LIBS) the optical emission of plasma is measured by Echelle spectrometers in combination with intensified CCD cameras. For all sample materials the temporal evolution of plume size and broadband plasma emission vary systematically with T{sub S}. The size and brightness of expanding plumes increase at higher T{sub S} while the mean intensity remains independent of temperature. The intensity of emission lines increases with temperature for all samples. Plasma temperature and electron number density do not vary with T{sub S}. We apply the calibration-free LIBS method to determine the concentration of major oxides in slag and find good agreement to reference data up to T{sub S} = 450 °C. The LIBS analysis of multi-component materials at high temperature is of interest for technical applications, e.g. in industrial production processes. - Highlights: • Size and emission of laser-induced plasma increase with sample temperature Ts. • Mean optical intensity of plasma is independent of Ts. • Plasma temperature and electron number density do not vary with Ts. • Major oxides in steel slag are quantified up to Ts = 450 °C. • Industrial steel slags are analyzed by calibration-free LIBS method.

  20. Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.

    Science.gov (United States)

    Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano

    2004-10-01

    This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.

  1. Skeletal maturity assessment using mandibular canine calcification stages

    Directory of Open Access Journals (Sweden)

    Vildana Džemidžić

    2016-11-01

    Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.

  2. A technique for separation of canine lymphocytes and their use in the lymphocytotoxic, blastogenic, and rosette assys.

    Science.gov (United States)

    Whitacre, C C; Lang, R W

    1975-01-01

    When the techniques established for preparing lymphocytes from human blood were applied to canine blood, the resulting preparations were contaminated with significant numbers of other blood cells. A three-step technique is described here for the separation of canine lymphocytes from blood which eliminates most granulocytes, platelets, and erythrocytes. Defibrinated blood is incubated with iron particles to allow phagocytosis by granulocytes. When mixed with Plasmagel, erythrocytes and iron-containing granulocytes sediment rapidly, leaving a lymphocyte-rich supernate plasma which is recovered and banded by centrifugation on a Ficoll-Hypaque gradient. Any erythrocytes remaining in the lymphocyte suspension aspirated from the gradient are eliminated by hypotonic lysis and centrifugation. The resulting preparation, representing 30 per cent recovery of the circulating lymphocytes, contained 85 to 94 per cent lymphocytes with a cell viability of 99 per cent. The functional capacity of the lymphocyte preparation was tested in three assays: 1) lymphoblastic transformation using phytohemagglutinin and pokeweed mitogen, 2) E rosette formation with human erythrocytes showed a mean 5 per cent rosette forming lymphocytes, 3) antibody-mediated lymphocytotoxicity using a canine anti-lymphocyte serum showed titers reproducible within one tube dilution.

  3. Mechanisms of cell death in canine parvovirus-infected cells provide intuitive insights to developing nanotools for medicine

    Directory of Open Access Journals (Sweden)

    Jonna Nykky

    2010-06-01

    Full Text Available Jonna Nykky, Jenni E Tuusa, Sanna Kirjavainen, Matti Vuento, Leona GilbertNanoscience Center and Department of Biological and Environmental Science, University of Jyväskylä, FinlandAbstract: Viruses have great potential as nanotools in medicine for gene transfer, targeted gene delivery, and oncolytic cancer virotherapy. Here we have studied cell death mechanisms of canine parvovirus (CPV to increase the knowledge on the CPV life cycle in order to facilitate the development of better parvovirus vectors. Morphological studies of CPV-infected Norden laboratory feline kidney (NLFK cells and canine fibroma cells (A72 displayed characteristic apoptotic events. Apoptosis was further confirmed by activation of caspases and cellular DNA damage. However, results from annexin V-propidium iodide (PI labeling and membrane polarization assays indicated disruption of the plasma membrane uncommon to apoptosis. These results provide evidence that secondary necrosis followed apoptosis. In addition, two human cancer cell lines were found to be infected by CPV. This necrotic event over apoptotic cell death and infection in human cells provide insightful information when developing CPV as a nanotool for cancer treatments.Keywords: canine parvovirus, apoptosis, necrosis, nanoparticle, virotherapy

  4. A new method for rapid Canine retraction

    Directory of Open Access Journals (Sweden)

    "Khavari A

    2001-06-01

    Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.

  5. Simultaneous canine distemper encephalitis and canine parvovirus infection with distemper-associated cardiac necrosis in a pup

    OpenAIRE

    Headley,Selwyn Arlington; Saito,Taís Berelli

    2003-01-01

    Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...

  6. Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

    Directory of Open Access Journals (Sweden)

    Jobin Thomas

    2014-11-01

    Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

  7. The Spectral Emission Characteristics of Laser Induced Plasma on Tea Samples

    International Nuclear Information System (INIS)

    Zheng Peichao; Shi Minjie; Wang Jinmei; Liu Hongdi

    2015-01-01

    Laser induced breakdown spectroscopy (LIBS) provides a useful technique for food security as well as determining nutrition contents. In this paper, optical emission studies of laser induced plasma on commercial tea samples were carried out. The spectral intensities of Mg, Mn, Ca, Al, C and CN vibration bands varying with laser energy and the detection delay time of an intensified charge coupled device were studied. In addition, the relative concentrations of six microelements, i.e., Mg, Mn, Ca, Al, Na and K, were analyzed semi-quantitatively as well as H, for four kinds of tea samples. Moreover, the plasma parameters were explored, including electron temperature and electron number density. The electron temperature and electron number density were around 11000 K and 10 17 cm −3 , respectively. The results show that it is reasonable to consider the LIBS technique as a new method for analyzing the compositions of tea leaf samples. (paper)

  8. Podoplanin Expression in Canine Melanoma

    OpenAIRE

    Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

    2016-01-01

    A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...

  9. Root length and alveolar bone level of impacted canines and adjacent teeth after orthodontic traction: a long-term evaluation

    Science.gov (United States)

    da SILVA, Aldir Cordeiro; CAPISTRANO, Anderson; de ALMEIDA-PEDRIN, Renata Rodrigues; CARDOSO, Maurício de Almeida; CONTI, Ana Cláudia de Castro Ferreira; CAPELOZZA, Leopoldino

    2017-01-01

    Abstract Objective The aim of this retrospective study was to evaluate the long-term effects of orthodontic traction on root length and alveolar bone level in impacted canines and adjacent teeth. Material and Methods Sample consisted of 16 patients (nine males and seven females), mean initial age 11 years and 8 months presenting with unilaterally maxillary impacted canines, palatally displaced, treated with the same surgical and orthodontic approach. Teeth from the impacted-canine side were assigned as Group I (GI), and contralateral teeth as control, Group II (GII). The mean age of patients at the end of orthodontic treatment was 14 years and 2 months and the mean post-treatment time was 5 years and 11 months. Both contralateral erupted maxillary canines and adjacent teeth served as control. Root length and alveolar bone level (buccal and palatal) were evaluated on cone-beam computed tomography (CBCT) images. The comparison of root length and alveolar bone level changes between groups were assessed by applying paired t-test, at a significance level of 5% (p<0.05). Results There were no statistically significant differences in root length and buccal and palatal bone levels of canines and adjacent teeth among groups. Conclusions Impacted canine treatment by closed-eruption technique associated with canine crown perforation, has a minimal effect on root length and buccal and palatal alveolar bone level in both canine and adjacent teeth, demonstrating that this treatment protocol has a good long-term prognosis. PMID:28198979

  10. Finite element analysis of rapid canine retraction through reducing resistance and distraction

    Directory of Open Access Journals (Sweden)

    Junjie XUE

    2014-01-01

    Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.

  11. High-fat diet-induced insulin resistance does not increase plasma anandamide levels or potentiate anandamide insulinotropic effect in isolated canine islets.

    Directory of Open Access Journals (Sweden)

    Orison O Woolcott

    Full Text Available Obesity has been associated with elevated plasma anandamide levels. In addition, anandamide has been shown to stimulate insulin secretion in vitro, suggesting that anandamide might be linked to hyperinsulinemia.To determine whether high-fat diet-induced insulin resistance increases anandamide levels and potentiates the insulinotropic effect of anandamide in isolated pancreatic islets.Dogs were fed a high-fat diet (n = 9 for 22 weeks. Abdominal fat depot was quantified by MRI. Insulin sensitivity was assessed by the euglycemic-hyperinsulinemic clamp. Fasting plasma endocannabinoid levels were analyzed by liquid chromatography-mass spectrometry. All metabolic assessments were performed before and after fat diet regimen. At the end of the study, pancreatic islets were isolated prior to euthanasia to test the in vitro effect of anandamide on islet hormones. mRNA expression of cannabinoid receptors was determined in intact islets. The findings in vitro were compared with those from animals fed a control diet (n = 7.Prolonged fat feeding increased abdominal fat content by 81.3±21.6% (mean±S.E.M, P<0.01. In vivo insulin sensitivity decreased by 31.3±12.1% (P<0.05, concomitant with a decrease in plasma 2-arachidonoyl glycerol (from 39.1±5.2 to 15.7±2.0 nmol/L but not anandamide, oleoyl ethanolamide, linoleoyl ethanolamide, or palmitoyl ethanolamide. In control-diet animals (body weight: 28.8±1.0 kg, islets incubated with anandamide had a higher basal and glucose-stimulated insulin secretion as compared with no treatment. Islets from fat-fed animals (34.5±1.3 kg; P<0.05 versus control did not exhibit further potentiation of anandamide-induced insulin secretion as compared with control-diet animals. Glucagon but not somatostatin secretion in vitro was also increased in response to anandamide, but there was no difference between groups (P = 0.705. No differences in gene expression of CB1R or CB2R between groups were found.In canines, high-fat diet

  12. Prediction of the size of unerupted canines and premolars in an Iranian population

    Directory of Open Access Journals (Sweden)

    Mashaallah Khanehmasjedi

    2013-01-01

    Full Text Available Background and Aim: One of the important aspects of diagnosis and treatment planning in the mixed dentition is estimation of the size of unerupted permanent canines and premolars. One of the most commonly used the prediction methods are Tanaka and Johnston, which are based on data from a sample of Northern European descent children. The accuracy of this method when applied to a different ethnic population is questionable. The aim of this study was to determine the modified equations from Tanaka and Johnston for Iranian population. Materials and Methods: This study was an analytic and cross-sectional investigation with the randomized cluster sampling in Ahwaz. Fifty four students of 14-18 years age (32 girls, 22 boys were selected between 320 students and plaster models of their maxillary and mandibular arches were prepared. Subjects had fully erupted teeth, class I canine and molar relationship and presented no proximal caries or fillings, morphological anomalies, missing teeth or occlusal abrasion, and bruxism. The mesiodistal crown diameters of the permanent teeth were measured with using the sharpened boley gauge (accuracy 0.01 mm. The data were analyzed by using the regression correlation analyses and t-test. Results: The size of permanent canines and premolars were larger in maxilla than mandible and males than females. These values in Iran were different from other countries. Conclusion: In this study to predict the space (in mm required for alignment of unerupted canine and premolars in Iranian children, halve the sum of mesiodistal dimension of the four mandibular incisors and add the respective constants 10.5 for upper jaw and 10 for lower jaw.

  13. Limited sampling strategy for determining metformin area under the plasma concentration-time curve

    DEFF Research Database (Denmark)

    Santoro, Ana Beatriz; Stage, Tore Bjerregaard; Struchiner, Claudio José

    2016-01-01

    AIM: The aim was to develop and validate limited sampling strategy (LSS) models to predict the area under the plasma concentration-time curve (AUC) for metformin. METHODS: Metformin plasma concentrations (n = 627) at 0-24 h after a single 500 mg dose were used for LSS development, based on all su...

  14. Long-term periodontal response to orthodontic treatment of palatally impacted maxillary canines.

    Science.gov (United States)

    Caprioglio, Alberto; Vanni, Arianna; Bolamperti, Laura

    2013-06-01

    One of the most important aspects to take into consideration when evaluating the outcome of treatment of impacted maxillary canines is the final periodontal status. The aim of the present study was to evaluate the long-term periodontal response of palatally impacted maxillary canines aligned using a codified procedure and the 'Easy Cuspid' compared with contralateral spontaneously erupted teeth. The periodontal conditions of the adjacent teeth were also considered. From an initial sample of 124 patients, 33 patients (24 females and 9 males) were selected. All patients who had undergone surgical orthodontic treatment conducted in accordance with a standardized protocol were recalled for follow-up at an average of 4.6 years after the end of treatment. The average treatment time was 29 months and the mean eruption time of the previously impacted tooth was 3.1 months. The average probing depth values showed no significant clinical differences. Probing depths recorded at the vestibular surface of the lateral incisor (P alignment of palatally impacted canines without damage to the periodontium.

  15. Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification.

    Science.gov (United States)

    Wang, Jianchang; Liu, Libing; Li, Ruiwen; Wang, Jinfeng; Fu, Qi; Yuan, Wanzhe

    2016-04-01

    A novel recombinase polymerase amplification (RPA)-based method for detection of canine parvovirus type 2 (CPV-2) was developed. Sensitivity analysis showed that the detection limit of RPA was 10 copies of CPV-2 genomic DNA. RPA amplified both CPV-2a and -2b DNA but did not amplify the template of other important dog viruses (CCoV, PRV or CDV), demonstrating high specificity. The method was further validated with 57 canine fecal samples. An outstanding advantage of RPA is that it is an isothermal reaction and can be performed in a water bath, making RPA a potential alternative method for CPV-2 detection in resource-limited settings.

  16. Etching of Niobium Sample Placed on Superconducting Radio Frequency Cavity Surface in Ar/CL2 Plasma

    International Nuclear Information System (INIS)

    Upadhyay, Janardan; Phillips, Larry; Valente, Anne-Marie

    2011-01-01

    Plasma based surface modification is a promising alternative to wet etching of superconducting radio frequency (SRF) cavities. It has been proven with flat samples that the bulk Niobium (Nb) removal rate and the surface roughness after the plasma etchings are equal to or better than wet etching processes. To optimize the plasma parameters, we are using a single cell cavity with 20 sample holders symmetrically distributed over the cell. These holders serve the purpose of diagnostic ports for the measurement of the plasma parameters and for the holding of the Nb sample to be etched. The plasma properties at RF (100 MHz) and MW (2.45 GHz) frequencies are being measured with the help of electrical and optical probes at different pressures and RF power levels inside of this cavity. The niobium coupons placed on several holders around the cell are being etched simultaneously. The etching results will be presented at this conference.

  17. Etching of Niobium Sample Placed on Superconducting Radio Frequency Cavity Surface in Ar/CL2 Plasma

    Energy Technology Data Exchange (ETDEWEB)

    Janardan Upadhyay, Larry Phillips, Anne-Marie Valente

    2011-09-01

    Plasma based surface modification is a promising alternative to wet etching of superconducting radio frequency (SRF) cavities. It has been proven with flat samples that the bulk Niobium (Nb) removal rate and the surface roughness after the plasma etchings are equal to or better than wet etching processes. To optimize the plasma parameters, we are using a single cell cavity with 20 sample holders symmetrically distributed over the cell. These holders serve the purpose of diagnostic ports for the measurement of the plasma parameters and for the holding of the Nb sample to be etched. The plasma properties at RF (100 MHz) and MW (2.45 GHz) frequencies are being measured with the help of electrical and optical probes at different pressures and RF power levels inside of this cavity. The niobium coupons placed on several holders around the cell are being etched simultaneously. The etching results will be presented at this conference.

  18. Apical root resorption of incisors after orthodontic treatment of impacted maxillary canines: a radiographic study.

    Science.gov (United States)

    Brusveen, Elin Marie Gravdal; Brudvik, Pongsri; Bøe, Olav Egil; Mavragani, Maria

    2012-04-01

    The purpose of the study was to evaluate impacted maxillary canines as risk factor for orthodontic apical root resorption. The sample comprised 66 patients treated with fixed appliances. Thirty-two patients with a unilateral impacted maxillary canine, which was distanced from the roots of the incisors at a preliminary phase of treatment before bonding, formed the impaction group, and 34 patients without impactions served as the controls. Root shortening was calculated by using pretreatment and posttreatment intraoral radiographs. Inclination of the eruption path of the impacted canine relative to the midline, axis of the lateral incisor, and nasal line, root development, and the medial and vertical positions of the impacted tooth were recorded on orthopantomograms and lateral cephalometric films. The follicle/tooth ratio was evaluated by using periapical radiographs. No significant difference in apical resorption of the maxillary incisors was detected between the impaction and control groups, or between the incisors of the impacted and contralateral sides in the same subject. Likewise, no difference in the severity of root resorption was found between the incisors of impacted side alone and the incisors of the control group. Mesial and vertical inclinations of the impacted canines were negatively related to a lateral incisor's root resorption. No correlations were found between resorption and medial or vertical position of the crown of the canine. The follicle/tooth ratio was significantly related to the mesial inclination of the impacted canine, but not to root resorption. An impacted maxillary canine, after being distanced from the incisor roots, does not seem to be a risk factor for apical root resorption during orthodontic treatment. Copyright © 2012 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

  19. First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh

    DEFF Research Database (Denmark)

    Sharma, Shalini; Dhar, Prasenjit; Thakur, Aneesh

    2016-01-01

    AIM: The present study was conducted to detect the presence of canine parvovirus (CPV) among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. MATERIALS AND METHODS: A total of 102 fecal...... for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK) cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. RESULTS: No sample was found...

  20. Prevalence of antibodies against canine distemper virus among red foxes in Luxembourg

    NARCIS (Netherlands)

    B.C. Damien; S. Losch; J. Mossong; C.P. Muller (Claude); A.D.M.E. Osterhaus (Albert); B.E.E. Martina (Byron)

    2002-01-01

    textabstractCanine distemper virus (CDV) has a wide host spectrum, and during the past years, distemper has been observed in species that were previously not considered to be susceptible. In this study, we investigated the prevalence of CDV-specific antibodies in red foxes (Vulpes vulpes) sampled

  1. Prevalence of antibodies against canine distemper virus among red foxes in Luxembourg.

    NARCIS (Netherlands)

    B.C. Damien; B.E.E. Martina (Byron); S. Losch; A.D.M.E. Osterhaus (Albert); C.P. Muller (Claude)

    2002-01-01

    textabstractCanine distemper virus (CDV) has a wide host spectrum, and during the past years, distemper has been observed in species that were previously not considered to be susceptible. In this study, we investigated the prevalence of CDV-specific antibodies in red foxes (Vulpes vulpes) sampled

  2. Evaluation of the efficacy and duration of immunity of a canine combination vaccine against virulent parvovirus, infectious canine hepatitis virus, and distemper virus experimental challenges.

    Science.gov (United States)

    Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald

    2004-01-01

    The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.

  3. The effect of buccal corticotomy on accelerating orthodontic tooth movement of maxillary canine

    Science.gov (United States)

    Jahanbakhshi, Mohammad Reza; Motamedi, Ali Mohammad Kalantar; Feizbakhsh, Masoud; Mogharehabed, Ahmad

    2016-01-01

    Background: Selective alveolar corticotomy is defined as an intentional injury to cortical bone. This technique is an effective means of accelerating orthodontic tooth movement. The aim of this study is to evaluate the effect of buccal corticotomy in accelerating maxillary canine retraction. Materials and Methods: The sample in this clinical trial study consisted of 15 adult female patients with therapeutic need for extraction of maxillary first premolars and maximum canine retraction. By use of split-mouth design, at the time of premolars extraction, buccal corticotomy was performed around the maxillary first premolar, randomly on one side of maxilla, and the other side was reserved as the control side. Canine retraction was performed by use of friction – less mechanic with simple vertical loop. Every 2 weeks, distance between canines and second premolars was measured until complete space closure. The velocity of space closure was calculated to evaluate the effect of this technique in accelerating orthodontic tooth movement. The obtained data were statistically analyzed using independent t-test, and the significance was set at 0.05. Results: The rate of canine retraction was significantly higher on the corticotomy side than the control side by an average of 1.8 mm/month versus 1.1 mm/month in the corticotomy side and control side, respectively (P orthodontic tooth movement about two times faster than conventional orthodontics and it is significant in early stages after surgical porsedure. Therefore Buccal corticotomy is a useful adjunct technique for accelerating orthodontic tooth movement. PMID:27605986

  4. A rare case of canine anomaly - a possible algorithm for treating it.

    Science.gov (United States)

    Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore

    2014-01-01

    Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.

  5. Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.

    Science.gov (United States)

    Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong

    2017-06-01

    Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.

  6. Surgical considerations and management of bilateral labially impacted canines

    Directory of Open Access Journals (Sweden)

    Yu-Shan Huang

    2016-06-01

    Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.

  7. Immunohistochemical Characterization of Canine Lymphomas

    Directory of Open Access Journals (Sweden)

    Roxana CORA

    2017-11-01

    Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.

  8. Establishment of reverse transcription loop-mediated isothermal amplification for rapid detection and differentiation of canine distemper virus infected and vaccinated animals.

    Science.gov (United States)

    Liu, Da-Fei; Liu, Chun-Guo; Tian, Jin; Jiang, Yi-Tong; Zhang, Xiao-Zhan; Chai, Hong-Liang; Yang, Tian-Kuo; Yin, Xiu-Chen; Zhang, Hong-Ying; Liu, Ming; Hua, Yu-Ping; Qu, Lian-Dong

    2015-06-01

    Although widespread vaccination against canine distemper virus (CDV) has been conducted for many decades, several canine distemper outbreaks in vaccinated animals have been reported frequently. In order to detect and differentiate the wild-type and vaccine strains of the CDV from the vaccinated animals, a novel reverse transcription loop-mediated isothermal amplification (RT-LAMP) method was developed. A set of four primers-two internal and two external-were designed to target the H gene for the specific detection of wild-type CDV variants. The CDV-H RT-LAMP assay rapidly amplified the target gene, within 60 min, using a water bath held at a constant temperature of 65°C. The assay was 100-fold more sensitive than conventional RT-PCR, with a detection limit of 10(-1)TCID50ml(-1). The system showed a preference for wild-type CDV, and exhibited less sensitivity to canine parvovirus, canine adenovirus type 1 and type 2, canine coronavirus, and canine parainfluenza virus. The assay was validated using 102 clinical samples obtained from vaccinated dog farms, and the results were comparable to a multiplex nested RT-PCR assay. The specific CDV-H RT-LAMP assay provides a simple, rapid, and sensitive tool for the detection of canines infected with wild-type CDV from canines vaccinated with attenuated vaccine. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Investigation of nanodiamonds interactions in canine blood

    Science.gov (United States)

    WÄ sowicz, Michał; Marek, Kulka; Cićkiewicz, Maciej; Cymerman, Magdalena

    2017-02-01

    The whole blood contains red cells, white cells, and platelets suspended in plasma. In the following study we investigated an impact of nanodiamond particles on blood elements over various periods of time.The material used in the study consisted of samples taken from ten healthy canines (Canis lupus f. domestica) of various age, different blood types and both sexes. The markings were conducted by adding to the blood unmodified diamonds (SND), modified O2 (SO2) suspended in 0,9% NaCl. The blood was put under an impact of two diamond concentrations: 20μl and 100μl. The amount of abnormal cells increased with time. The percentage of echinocytes as a result of interaction with nanodiamonds in various time periods for individual specimens was scarce. In the examined microscopic image a summary was made for 100 white blood cells. Following cells were included in said group: band neutrophils, segmented neutrophils, eosinophils, basophils, lymphocytes, monocytes, lymphocytes with granulates, stimulated lymphocytes, lymphocytes with vacuoles, metamielocytes and smudge cells. The impact of the three diamond types had no clinical importance on red blood cells. After the diamonds mixed with white blood cells, atypical cells came into being, in the range of agranulocytes in stimulated form or with granulates and/or vacuoles. It is supposed that as a result of longlasting exposure a stimulation and vacuolisation takes place, because of the function of the cells.

  10. Stem Cell-Associated Marker Expression in Canine Hair Follicles.

    Science.gov (United States)

    Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J

    2016-03-01

    Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.

  11. MT-PCR panel detection of canine parvovirus (CPV-2): Vaccine and wild-type CPV-2 can be difficult to differentiate in canine diagnostic fecal samples.

    Science.gov (United States)

    Meggiolaro, Maira N; Ly, Anna; Rysnik-Steck, Benjamin; Silva, Carolina; Zhang, Joshua; Higgins, Damien P; Muscatello, Gary; Norris, Jacqueline M; Krockenberger, Mark; Šlapeta, Jan

    2017-06-01

    Canine parvovirus (CPV-2) remains an important cause of devastating enteritis in young dogs. It can be successfully prevented with live attenuated CPV-2 vaccines when given at the appropriate age and in the absence of maternal antibody interference. Rapid diagnosis of parvoviral enteritis in young dogs is essential to ensuring suitable barrier nursing protocols within veterinary hospitals. The current diagnostic trend is to use multiplexed PCR panels to detect an array of pathogens commonly responsible for diarrhea in dogs. The multiplexed PCR assays do not distinguish wild from vaccine CPV-2. They are highly sensitive and detect even a low level of virus shedding, such as those caused by the CPV-2 vaccine. The aim of this study was to identify the CPV-2 subtypes detected in diagnostic specimens and rule out occult shedding of CPV-2 vaccine strains. For a total of 21 samples that tested positive for CPV-2 in a small animal fecal pathogens diagnostic multiplexed tandem PCR (MT-PCR) panel during 2014-2016 we partially characterized the VP2 gene of CPV-2. Vaccine CPV-2 strain, wild type CPV-2a subtypes and vaccine-like CPV-2b subtypes were detected. High copy number was indicative of wild-type CPV-2a presence, but presence of vaccine-like CPV-2b had a variable copy number in fecal samples. A yardstick approach to a copy number or C t -value to discriminate vaccine strain from a wild type virus of CPV-2 can be, in some cases, potentially misleading. Therefore, discriminating vaccine strain from a wild type subtype of CPV-2 remains ambitious. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. A compendium of canine normal tissue gene expression.

    Directory of Open Access Journals (Sweden)

    Joseph Briggs

    Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.

  13. An experimental in-vivo canine model for adult shunt infection

    Directory of Open Access Journals (Sweden)

    Procop Gary

    2008-10-01

    Full Text Available Abstract Background Detailed human studies of the mechanisms and development of shunt infection in real time are not possible, and we have developed a canine hydrocephalus model to overcome this. The intention of this pilot study was to show that the canine hydrocephalus model could be shunted using conventional "human" shunts, and that a shunt infection could be established so that further studies could then be planned. Methods Hydrocephalus was induced in seven dogs (Canis familiaris by fourth ventricle obstruction. Four weeks later they were shunted using a Hakim Precision valve. Four of the dogs received shunts whose ventricular catheter had been inoculated with Staphylococcus epidermidis, and three were uninoculated controls. Four weeks after shunting the dogs were sacrificed and necropsy was performed. Removed shunts and tissue samples were examined microbiologically and isolates were subjected to detailed identification and genomic comparison. Results All the dogs remained well after shunting. Examination of removed shunt components revealed S. epidermidis in the brain and throughout the shunt system in the four inoculated animals, but in two of these Staphylococcus intermedius was also found. S. intermedius was also isolated from all three "negative" controls. There were slight differences between S. intermedius strains suggesting endogenous infection rather than cross- infection from a point source. Conclusion Shunt infection was established in the canine model, and had the experiment been extended beyond four weeks the typical microbiological, pathological and clinical features might have appeared. The occurrence of unplanned shunt infections in control animals due to canine normal skin flora reflects human clinical experience and underlines the usual source of bacteria causing shunt infection.

  14. Quantification of isotope-labelled and unlabelled folates in plasma, ileostomy and food samples.

    Science.gov (United States)

    Büttner, Barbara E; Öhrvik, Veronica E; Witthöft, Cornelia M; Rychlik, Michael

    2011-01-01

    New stable isotope dilution assays were developed for the simultaneous quantitation of [(13)C(5)]-labelled and unlabelled 5-methyltetrahydrofolic acid, 5-formyltetrahydrofolic acid, folic acid along with unlabelled tetrahydrofolic acid and 10-formylfolic acid in clinical samples deriving from human bioavailability studies, i.e. plasma, ileostomy samples, and food. The methods were based on clean-up by strong anion exchange followed by LC-MS/MS detection. Deuterated analogues of the folates were applied as the internal standards in the stable isotope dilution assays. Assay sensitivity was sufficient to detect all relevant folates in the respective samples as their limits of detection were below 0.62 nmol/L in plasma and below 0.73 μg/100 g in food or ileostomy samples. Quantification of the [(13)C(5)]-label in clinical samples offers the possibility to differentiate between folate from endogenous body pools and the administered dose when executing bioavailability trials.

  15. Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.

    Science.gov (United States)

    Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H

    2016-06-01

    Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.

  16. Canine index – A tool for sex determination

    Directory of Open Access Journals (Sweden)

    Shankar M. Bakkannavar

    2015-12-01

    Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.

  17. Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.

    Science.gov (United States)

    Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara

    2018-04-01

    Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.

  18. Rate of retraction of anterior teeth after canine distraction

    Directory of Open Access Journals (Sweden)

    Litesh Singla

    2017-01-01

    Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.

  19. Canine tooth size and fitness in male mandrills (Mandrillus sphinx).

    Science.gov (United States)

    Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean

    2008-07-01

    Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.

  20. Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature

    Directory of Open Access Journals (Sweden)

    Gaurav Sharma

    2011-01-01

    Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.

  1. Dose-effective investigation of intraarterial r-Sak in canine model with acute cerebral infarctions

    International Nuclear Information System (INIS)

    Liu Sheng; Shi Haibin; Zhang Peng; Wang Chenghu; Zhou Chunguo; Li Linsun

    2007-01-01

    Objective: To compare the effect and complications of intraarterial thrombolysis with different doses of recombinant-staphylokinase (r-Sak) in canine model with acute cerebral infarction, and then to find out the most properly appropriate effective dose. Methods: The model with left cerebral embolism was established with interventional technique in 24 beagle adult dogs. They were randomly divided into 4 groups including control group(saline, 10 ml), group of low dose(r-Sak, 5 000 u/kg), middle dose(r-Sak, 10 000 u/kg) and high dose(r-Sak, 20 000 u/kg). Angiography and intraarterial thrombolysis were performed within 30 minutes after the embolization. Microcatheter was superselectively inserted into left carotid artery. Five hour's later with a repeated angiography at half, 1 and 2 hours after thrombolysis to observe the recanalization. Blood samples were collected at a series of time pre-and post-thrombolysis to test the plasma levels of PT, APTT and D-dimer. These canines were sacrificed, and their cerebri were taken out for pathologic study by the end of 24 hours. Results: The rates of efficacy within 2 hours after thrombolysis were 10.0% (1/10) in control group, 40.0% (4/10) in low dose group, 90.9% (10/11) in middle dose group and 100% (9/9) in high dose group. The rates of complete recanalization were 0, 10% (1/10), 36.4% (4/11) and 66.7% (6/9), correspondingly and respectively. There were statistically obvious differences between the 3 groups (P 0.05). Death occurred in 1 canine(high dose group) within 24 hours after thrombolysis with hemorrhagic lesion in parietal lobe of brain. No other severe complications ocurred. Conclusions: (1) Intraarterial thrombolysis with r-Sak within 5 hours after onset of thrombosis is effective and feasible. Intraarterial r-Sak shows strong thrombolytic effect for white thrombus including a few platelets. There is relative high rate of recanalization with no less than 10 000U/kg of r-Sak but accompanied with high risk of

  2. Asymmetry in development (mineralisation of permanent mandibular canine roots

    Directory of Open Access Journals (Sweden)

    Burić Mirjana V.

    2012-01-01

    Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.

  3. Plasma Rich in Growth Factors Induces Cell Proliferation, Migration, Differentiation, and Cell Survival of Adipose-Derived Stem Cells.

    Science.gov (United States)

    Mellado-López, Maravillas; Griffeth, Richard J; Meseguer-Ripolles, Jose; Cugat, Ramón; García, Montserrat; Moreno-Manzano, Victoria

    2017-01-01

    Adipose-derived stem cells (ASCs) are a promising therapeutic alternative for tissue repair in various clinical applications. However, restrictive cell survival, differential tissue integration, and undirected cell differentiation after transplantation in a hostile microenvironment are complications that require refinement. Plasma rich in growth factors (PRGF) from platelet-rich plasma favors human and canine ASC survival, proliferation, and delaying human ASC senescence and autophagocytosis in comparison with serum-containing cultures. In addition, canine and human-derived ASCs efficiently differentiate into osteocytes, adipocytes, or chondrocytes in the presence of PRGF. PRGF treatment induces phosphorylation of AKT preventing ASC death induced by lethal concentrations of hydrogen peroxide. Indeed, AKT inhibition abolished the PRGF apoptosis prevention in ASC exposed to 100  μ M of hydrogen peroxide. Here, we show that canine ASCs respond to PRGF stimulus similarly to the human cells regarding cell survival and differentiation postulating the use of dogs as a suitable translational model. Overall, PRGF would be employed as a serum substitute for mesenchymal stem cell amplification to improve cell differentiation and as a preconditioning agent to prevent oxidative cell death.

  4. Viral type characterization and clinical aspects of canine parvovirus in naturally infected dogs in São Paulo State, Brazil

    Directory of Open Access Journals (Sweden)

    Kyssia Monteiro

    Full Text Available ABSTRACT: Since the first isolation of canine parvovirus type 2 (CPV-2 in late 70’s new virus types as CPV-2a and CPV-2b have been emerged and becoming prevalent in natural canine population and more recently, a third subtype was identified , CPV-2c. The main purpose of this study was to detect and characterize canine parvovirus currently present in Central-West region of São Paulo state, in Brazil. Fecal samples were collected of vaccinated and non-vaccinated dogs, clinically suspected of having CPV infection brought to the Infectious Diseases Service, Veterinary Hospital of FMVZ-UNESP. All samples (n=30 were screening for canine parvovirus through hemagglutination test and those resulting as positive (n=20 were submitted to PCR and the products were subsequently sequenced for subtype characterization. Results were tested for association with age, hematological values, viral hemagglutination titers in the feces, vaccination status and survival. Leukopenia was found in all animals, death occurred in 30% of unvaccinated dogs and in 42% of vaccinated ones. In a total of 20 positive sequenced samples, 18 were classified as CPV-2b, one as CPV-2c, and one as CPV-2a, being CPV2a and CPV2c detected in unvaccinated puppies. Compared to the reference samples amino acid change at position 426 in those circling virus was identified. The study results demonstrate the predominance of CPV-2b and the presence of CPV-2a and CPV-2c in naturally infected, vaccinated and unvaccinated dogs in in São Paulo region.

  5. Orthodontic management of buccally erupted ectopic canine with two case reports

    Directory of Open Access Journals (Sweden)

    Avesh Sachan

    2012-01-01

    Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.

  6. Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel

    International Nuclear Information System (INIS)

    Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.

    2005-01-01

    Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old

  7. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Directory of Open Access Journals (Sweden)

    Cui Shang-jin

    2010-05-01

    Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.

  8. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Science.gov (United States)

    2010-01-01

    A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

  9. Antibodies against canine parvovirus of wolves of Minnesota: A serologic study from 1975 through 1985

    Science.gov (United States)

    Goyal, S.M.; Mech, L.D.; Rademacher, R.A.; Khan, M.A.; Seal, U.S.

    1986-01-01

    Serum samples (n = 137) from 47 wild wolves (Canis lupus; 21 pups and 26 adults) were evaluated from 1975 to 1985 for antibodies against canine parvovirus, using the hemagglutination inhibition (HI) test. In addition, several blood samples (n = 35) from 14 of these wolves (6 pups and 8 adults) were evaluated simultaneously for erythrocyte and leukocyte counts, and for hemoglobin and blood urea nitrogen concentrations. Sixty-nine (50%) of the serum samples (35 wolves) had HI titers of greater than or equal to 256, whereas 68 (50%) of the samples (16 wolves) had HI titers of less than or equal to 128. Significant differences in the geometric mean titers were not found between pups and adults or between males and females. Of the 47 wolves evaluated, 12 (25%) developed a greater than or equal to fourfold increase in antibody titers during the 11-year period, with 2 wolves developing serologic conversions in 1976. The data indicate that canine parvovirus may have begun infecting wolves before or at the same time that it began infecting the dog population in the United States.

  10. Canine parvovirus: current perspective.

    Science.gov (United States)

    Nandi, S; Kumar, Manoj

    2010-06-01

    Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.

  11. Consequences of crown shortening canine teeth in Greenland sled dogs

    DEFF Research Database (Denmark)

    Kortegaard, H E; Anthony Knudsen, T; Dahl, S

    2015-01-01

    OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...

  12. Dental anomalies associated with buccally- and palatally-impacted maxillary canines.

    Science.gov (United States)

    Sajnani, Anand K; King, Nigel M

    2014-08-01

    The aim of the present study was to determine the association of both buccally- and palatally-impacted canines with other dental anomalies. This retrospective study was conducted on a population of 533 southern Chinese children and adolescents who had impacted maxillary canines that had been treated in the Paediatric Dentistry and Orthodontics Clinic, Prince Philip Dental Hospital, The University of Hong Kong, Hong Kong. Descriptions of the impacted canine and other associated anomalies were obtained from the case notes and radiographs. Clinical photographs and study casts were used, where available. A total of 253 (47.5%) patients with impacted maxillary canines were diagnosed with other dental anomalies. Microdontia was the most frequently-occurring anomaly reported in these patients, with the maxillary lateral incisor the most commonly affected tooth. Other odontogenic anomalies that were associated with both buccally- and palatally-impacted canines included hypodontia, supernumerary teeth, transposition of other teeth, enamel hypoplasia, other impacted teeth, and dens invaginatus. Both buccally- and palatally-impacted canines were found to be associated with other odontogenic anomalies. © 2013 Wiley Publishing Asia Pty Ltd.

  13. Norepinephrine accumulation by the rat caudal artery in the presence of hypertensive plasma

    International Nuclear Information System (INIS)

    Freas, W.; Thompson, D.A.; Hart, J.L.; Muldoon, S.M.

    1986-01-01

    We have partially isolated endogenous factors from canine plasma which inhibit 3 H-norepinephrine (NE) accumulation by the canine saphenous vein. The purpose of this study is to determine if these circulating factors may account for the observed differences in 3 H-NE uptake by hypertensive and normotensive blood vessels. Three models of hypertension were examined in this study. Blood vessels were compared from SHR and WKY rats, deoxycorticosterone acetate (DOCA) and control rats, and reduced renal mass (RRM) and control rats. There was no significant difference in 3 H-NE accumulation between blood vessels obtained from RRM and paired control rats. However, both the SHR and DOCA hypertensive caudal arteries and aorta accumulated significantly more 3 H-NE than their corresponding control tissues. There was not a significant change in 3 H-NE accumulation between hypertensive and control vena cava and mesenteric arteries. Normotensive and hypertensive plasma inhibited 3 H-NE accumulation by the rat caudal artery. However, there was not a correlation between blood pressure of plasma donor rats and accumulation of 3 H-NE. Therefore, although there are differences in 3 H-NE accumulation between hypertensive and normotensive blood vessels, plasma does not contain a factor responsible for this observed difference

  14. Plasma creatinine in dogs: intra- and inter-laboratory variation in 10 European veterinary laborat

    NARCIS (Netherlands)

    Mrs. Ulleberg, T.; Robben, J.H.; Nordahl, K.; Mr. Ulleberg, T.; Heiene, R.

    2011-01-01

    Abstract BACKGROUND: There is substantial variation in reported reference intervals for canine plasma creatinine among veterinary laboratories, thereby influencing the clinical assessment of analytical results. The aims of the study was to determine the inter- and intra-laboratory variation in

  15. Association of canine juvenile generalized demodicosis with the dog leukocyte antigen system.

    Science.gov (United States)

    It, V; Barrientos, L; López Gappa, J; Posik, D; Díaz, S; Golijow, C; Giovambattista, G

    2010-07-01

    Demodectic mange is a well-known parasitic skin disease characterized by the presence of a larger than normal number of Demodex mites (Demodex canis) in the skin of dogs. Recent research has suggested that major histocompatibility complex (MHC) class II expression is higher in the skin of dogs suffering from demodicosis than in normal ones. We have investigated whether canine Dog Leukocyte Antigen (DLA) class II alleles are associated with canine juvenile generalized demodicosis (JGD). In the present study, the analysis of microsatellite markers (FH2202, FH2975 and FH2054) linked to DLA was made in Boxer, Argentinean Mastiff and mixed breed dogs. DNA samples from 56 dogs affected with the disease and 60 breed-matched controls collected in Argentina were analysed. A highly significant association, in some of the analysed markers, in all breeds with the presence of demodicosis was observed with P or =5. The results of this study suggest that an underlying DLA association exists with demodicosis in dogs and that this may represent an important immunological risk factor in the aetiology of this condition. This information could be used in the future to develop diagnostic tests to prevent canine JGD.

  16. Energy metabolism in mobile, wild-sampled sharks inferred by plasma lipids.

    Science.gov (United States)

    Gallagher, Austin J; Skubel, Rachel A; Pethybridge, Heidi R; Hammerschlag, Neil

    2017-01-01

    Evaluating how predators metabolize energy is increasingly useful for conservation physiology, as it can provide information on their current nutritional condition. However, obtaining metabolic information from mobile marine predators is inherently challenging owing to their relative rarity, cryptic nature and often wide-ranging underwater movements. Here, we investigate aspects of energy metabolism in four free-ranging shark species ( n  = 281; blacktip, bull, nurse, and tiger) by measuring three metabolic parameters [plasma triglycerides (TAG), free fatty acids (FFA) and cholesterol (CHOL)] via non-lethal biopsy sampling. Plasma TAG, FFA and total CHOL concentrations (in millimoles per litre) varied inter-specifically and with season, year, and shark length varied within a species. The TAG were highest in the plasma of less active species (nurse and tiger sharks), whereas FFA were highest among species with relatively high energetic demands (blacktip and bull sharks), and CHOL concentrations were highest in bull sharks. Although temporal patterns in all metabolites were varied among species, there appeared to be peaks in the spring and summer, with ratios of TAG/CHOL (a proxy for condition) in all species displaying a notable peak in summer. These results provide baseline information of energy metabolism in large sharks and are an important step in understanding how the metabolic parameters can be assessed through non-lethal sampling in the future. In particular, this study emphasizes the importance of accounting for intra-specific and temporal variability in sampling designs seeking to monitor the nutritional condition and metabolic responses of shark populations.

  17. Overexpression of vimentin in canine prostatic carcinoma

    DEFF Research Database (Denmark)

    Rodrigues, M M P; Rema, A; Gärtner, F

    2011-01-01

    Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....

  18. Plasma functionalization of powdery nanomaterials using porous filter electrode and sample circulation

    Science.gov (United States)

    Lee, Deuk Yeon; Choi, Jae Hong; Shin, Jung Chul; Jung, Man Ki; Song, Seok Kyun; Suh, Jung Ki; Lee, Chang Young

    2018-06-01

    Compared with wet processes, dry functionalization using plasma is fast, scalable, solvent-free, and thus presents a promising approach for grafting functional groups to powdery nanomaterials. Previous approaches, however, had difficulties in maintaining an intimate sample-plasma contact and achieving uniform functionalization. Here, we demonstrate a plasma reactor equipped with a porous filter electrode that increases both homogeneity and degree of functionalization by capturing and circulating powdery carbon nanotubes (CNTs) via vacuum and gas blowing. Spectroscopic measurements verify that treatment with O2/air plasma generates oxygen-containing groups on the surface of CNTs, with the degree of functionalization readily controlled by varying the circulation number. Gas sensors fabricated using the plasma-treated CNTs confirm alteration of molecular adsorption on the surface of CNTs. A sequential treatment with NH3 plasma following the oxidation pre-treatment results in the functionalization with nitrogen species of up to 3.2 wt%. Our approach requiring no organic solvents not only is cost-effective and environmentally friendly, but also serves as a versatile tool that applies to other powdery micro or nanoscale materials for controlled modification of their surfaces.

  19. Vaccines for Canine Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Faeze Foroughi-Parvar

    2014-01-01

    Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

  20. BACTERIAL PROFILE OF NECROTIC PULPS IN CHEETAH (ACINONYX JUBATUS) CANINE TEETH.

    Science.gov (United States)

    Almansa Ruiz, José C; Bosman, Anna-Mari; Steenkamp, Gerhard

    2016-03-01

    The role of microbes and their antimicrobial susceptibilities in both acute and chronic infections of the dental pulp in humans has been well studied. Presently, no data are available on endodontic pathogens in cheetahs (Acinonyx jubatus). The aim of this study was to isolate and identify the bacteria found in the canine teeth of cheetahs, where the pulp was necrotic and exposed due to a complicated crown fracture. Thirty-six microbiologic samples were taken from root canals (RCs) of the canine teeth of 19 cheetahs: one pulp sample was taken from 10 cheetahs, four samples from 2 cheetahs, two samples from 3 cheetahs, and three samples from 4 cheetahs. Exposed pulps were cultured for aerobic and anaerobic bacteria; an additional screening with a 16S rRNA-specific polymerase chain reaction (PCR) was used for the last six samples. Antimicrobial susceptibility of isolates was determined by use of the Kirby-Bauer diffusion test. In total, 59 cultivable isolates belonging to 19 microbial species and 13 genera were recovered from the 36 RCs sampled. Only two samples yielded no cultivable bacteria. Thirty-two (54.49%) of the cultivable isolates were Gram positive and 27 (45.71%) were Gram negative. The maximum number of isolates cultivated from an individual RC was six. Facultative anaerobes (62.72%) were the most common bacteria of the RCs that yielded cultivable bacteria. Of the isolates, 28.81% were aerobic and 8.47% were strict anaerobes. The antimicrobials that showed the greatest efficacy in vitro against the different bacteria isolates were amikacin and gentamicin. The more common bacterial species isolated by PCR were anaerobes (60.8%), facultative anaerobes (30.2%), and aerobes (8.6%).

  1. Upper canine inclination influences the aesthetics of a smile.

    Science.gov (United States)

    Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S

    2015-02-01

    This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.

  2. Field desorption and field ion surface studies of samples exposed to the plasmas of PLT and ISX

    International Nuclear Information System (INIS)

    Kellogg, G.L.; Panitz, J.A.

    1978-01-01

    Modifications to the surface of field-ion specimens exposed to plasma discharges in PLT and ISX determined by Imaging Probe, Field Ion Microscope, and Transmission Electron Microscope analysis have in the past shown several consistent features. Surface films consisting primarily of limiter material with trapped plasma and impurity species have been found to reside on samples with direct line of sight exposure to the plasma during the discharges. Control specimens placed in the tokamak, but shielded from the plasma, on the other hand, remained free of deposits. When exposed to only high power plasma discharges, samples placed at the wall position in PLT and ISX have survived the exposures with no evidence of damage or implantation. In this paper we describe the results of a recent exposure in PLT in which for the first time samples of stainless steel were included for High-Field Surface Analysis. Tokamak operating conditions, including stainless-steel limiters, titanium gettering between discharges, and the occurrence of a disruption, also distinguished this exposure from those carried out previously. Surprisingly, even with stainless-steel limiters, carbon films were found to be deposited on the samples at a rate

  3. Survey of canine tick-borne diseases in Lábrea, Brazilian Amazon: ‘accidental’ findings of Dirofilaria immitis infection

    Directory of Open Access Journals (Sweden)

    Herbert Sousa Soares

    2014-12-01

    Full Text Available Blood samples were collected from 99 domestic dogs from the urban and rural areas of the Lábrea municipality, state of Amazonas, Brazil. Canine serum samples were tested by immunofluorescence assay against Rickettsia spp., which revealed that only 3.0% (1/33 and 7.6% (5/66 of the dogs from urban and rural areas, respectively, reacted positively to at least one Rickettsia species. DNA was extracted from canine blood and tested by a battery of PCR assays targeting protozoa of the genera Babesia and Hepatozoon, and bacteria of the genera Rickettsia and Ehrlichia and family Anaplasmataceae. All samples were negative in the PCR assays targeting the genera Babesia, Hepatozoon, Ehrlichia and Rickettsia. For Anaplasmataceae, 3% (1/33 and 39.4% (26/66 of the urban and rural dogs, respectively, yielded amplicons that generated DNA sequences 100% identical to the corresponding sequence of Wolbachia endosymbiont of Dirofilaria immitis. Because of these results, all canine DNA samples were further tested in a PCR assay targeting filarial nematodes, which was positive for 18.2% (6/33 and 57.6% (38/66 urban and rural dogs, respectively. Filarial-PCR products generated DNA sequences 100% identical to D. immitis. While tick-borne infections were rare in Lábrea, D. immitis infection rates were among the highest reported in South America.

  4. Treatment modalities of palatal impacted canines

    OpenAIRE

    Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona

    2012-01-01

    Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...

  5. Health of periodontal tissues and resorption status after orthodontic treatment of impacted maxillary canines.

    Science.gov (United States)

    Oz, A Z; Ciger, S

    2018-03-01

    The aim of the present study was to evaluate the changes of incisor root resorption associated with impacted maxillary canines and health of periodontal tissues around maxillary canines erupted with orthodontic treatment. Twenty patients with a unilateral palatally impacted maxillary canine were included in the study. Cone-beam computed tomography images taken before and after orthodontic treatment were compared with the contralateral canines serving as control teeth. Root resorption was present in 10% of central and 40% of lateral incisors before treatment. After treatment, the incidence of resorption decreased. The thickness of the buccal bone surrounding the impacted canines was similar to that surrounding the contralateral canines, except in the apical area. Periodontal pocket depth and alveolar bone loss were greater for the impacted canine teeth than for the contralateral canines. Incisor root resorption associated with impacted canine teeth showed signs of repair after orthodontic treatment. Slight differences related to periodontal health were found between the previously impacted teeth and contralateral canine teeth.

  6. The relationship between the Southern Oscillation Index, rainfall and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia.

    Science.gov (United States)

    Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P

    2015-07-01

    The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Molecular characterization of canine parvovirus (CPV) infection in dogs in Turkey.

    Science.gov (United States)

    Timurkan, Mehmet; Oğuzoğlu, Tuba

    2015-01-01

    This study provides data about canine parvovirus (CPV) types circulating among dogs in Turkey. Sixty-five samples from dogs with and without clinical signs of parvovirus infection were collected between April 2009 and February 2010. The samples were subsequently tested for CPV using polymerase chain reaction (PCR). Twenty-five samples (38.4%) were positive; when positive samples were characterized by sequence analysis, results showed that both CPV-2a (17/25, 68%) and CPV-2b (8/25, 32%) strains are circulating among domestic dogs in Turkey. This is the first molecular characterization study of CPVs from dogs based on partial VP2 gene sequences in Turkey.

  8. Expression of relaxin receptor LRG7, canine relaxin, and relaxin-like factor in the pelvic diaphragm musculature of dogs with and without perineal hernia.

    Science.gov (United States)

    Merchav, Ronit; Feuermann, Yonatan; Shamay, Avi; Ranen, Eyal; Stein, Uri; Johnston, Dudley E; Shahar, Ron

    2005-01-01

    To compare the expression of canine relaxin, relaxin-like factor (RLF), and relaxin receptors within the muscles of the pelvic diaphragm of dogs with perineal hernia (PH) and clinically normal dogs. In vivo comparative study. Fifteen client-owned intact male dogs with PH were studied. Four mature intact male dogs with no evidence of perineal pathology served as controls. Biopsy samples from the levator ani, coccygeus, and internal obturator muscles were obtained. RNA samples were reverse transcribed and analyzed by real-time PCR for the expression of canine relaxin receptor LRG7, relaxin, and RLF. Significantly higher expression levels of canine relaxin receptors occurred in the musculature of the pelvic diaphragm and internal obturator muscle in dogs with PH compared with normal dogs. Expression of canine RLF revealed no significant difference between dogs with PH and controls. The difference in the expression of canine relaxin between groups was not statistically significant. Relaxin receptor up-regulation occurs in the coccygeus, levator ani, and internal obturator muscles of dogs with PH. The higher expression of relaxin receptors within the muscles of the pelvic diaphragm in dogs with PH suggests that relaxin might play a role in the pathogenesis of PH. Atrophy of these muscles, which predisposes to PH, may be attributable to increased relaxin activity.

  9. Interceptive treatment of palatal impaction of maxillary canines with rapid maxillary expansion: a randomized clinical trial.

    Science.gov (United States)

    Baccetti, Tiziano; Mucedero, Manuela; Leonardi, Maria; Cozza, Paola

    2009-11-01

    Our aim in this prospective randomized clinical study was to assess the prevalence rate of eruption of palatally displaced canines, diagnosed at an early developmental stage with posteroanterior radiographs and consequently treated by rapid maxillary expansion. A sample of 60 subjects in the early mixed dentition with palatally displaced canines diagnosed on posteroanterior radiographs was enrolled in the trial. Their age range at the first observation (T1) was 7.6 to 9.6 years, with a prepubertal stage of skeletal maturity (CS1 or CS2). The 60 subjects were randomly allocated to the treatment group (TG, 35 subjects) or the no-treatment group (NTG, 25 subjects). The TG was treated with a banded rapid maxillary expander; after expansion, all patients were retained with the expander in place for 6 months. Thereafter, the expander was removed, and the patients wore a retention plate at night for a year. The NTG received no treatment. All subjects were reevaluated in the early permanent dentition (T2) (postpubertal CS4). The number of dropouts was recorded. The main outcome recorded at T2 was successful or unsuccessful eruption of the maxillary permanent canines. The starting forms at T1 for measurements on posteroanterior and panoramic films were compared in the 2 groups with the Mann-Whitney U test (P <0.05). The prevalence rates of successful and unsuccessful treatments in the TG were compared with those in NTG with chi-square tests (P <0.05). From T1 to T2, there were 3 dropouts in each group. The final sample comprised 32 subjects in the TG and 22 subjects in the NTG. No statistically significant differences were found for any variable at T1. The prevalence rates of successful eruption of the maxillary canines were 65.7% (21 subjects) in the TG and 13.6% (3 subjects) in the NTG. The comparison was statistically significant (chi-square = 12.4; P <0.001). Subjects with palatally displaced canines in the early mixed dentition do not have transverse deficiency of the

  10. Development of a Vaccine Incorporating Killed Virus of Canine Origin for the Prevention of Canine Parvovirus Infection

    OpenAIRE

    Povey, C.

    1982-01-01

    A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...

  11. Molecular differentiation of three canine and feline hookworms in South China through HRM analysis.

    Science.gov (United States)

    Wang, M W; Yan, X X; Hang, J X; Shi, X L; Fu, Y Q; Zhang, P; Yang, F; Pan, W D; Li, G Q

    2018-02-05

    To investigate the prevalence of canine and feline hookworms in South China, and to assess the risk of zoonotic hookworms to humans, one pair of primers (HRM-F/HRM-R) was designed to establish a high-resolution melting (HRM) method based on internal transcribed spacer 1 (ITS-1) rDNA for the detection of Ancylostoma ceylanicum, A. caninum and A. tubaeforme infection. The results showed that the HRM for the three hookworms produced different melting-curve profiles, where melting temperature (T m) values were 84.50°C for A. ceylanicum, 82.25°C for A. caninum and 81.73°C for A. tubaeforme, respectively. The reproducibility of intra- and inter-assay melting curves was almost perfect. The lowest concentration detected was about 5.69 ×10-4 g/μl. The HRM detection results from 18 canine and feline hookworm samples were in complete accordance with their sequencing results. The HRM method was more sensitive than the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique in the detection of 98 clinical samples. It is concluded that the HRM method can differentiate between A. ceylanicum, A. caninum, A. tubaeforme and their mixed infections, which may provide important technical support for the zoonotic risk assessment and molecular epidemiological survey of canine and feline hookworms.

  12. Evaluation of post-vaccination immunity to canine distemper and ...

    African Journals Online (AJOL)

    SERVER

    2007-08-20

    Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...

  13. Determination of free and total cyst(e)ine in plasma of dogs and cats.

    Science.gov (United States)

    Tôrres, Cristina L; Miller, Joshua W; Rogers, Quinton R

    2004-01-01

    In human blood, the amino acid cysteine forms disulfide bonds with itself and with other sulfhydryl compounds in their free form and with sulfhydryls in protein. Protein-bound cysteine is lost when plasma proteins are removed before amino acid analysis. The purpose of this study was to assess the time course and extent of cyst(e)ine (cysteine + half-cystine) loss in dog and cat plasma. An equal volume of 6% sulfosalicylic acid was added to plasma aliquots at 0, 2, 4, 10, 16, 24, 36, 48, 60, and 72 hours after separation of blood cells. Tris-2-carboxyethyl-phosphine hydrochloride (TCEP - HCl), a reducing agent, was used to regenerate total plasma cyst(e)ine after 3 months of sample storage (-20 degrees C). Initial free cyst(e)ine concentrations (mean +/- SEM) were higher in canine plasma (77 +/- 4 micromol/L) than in feline plasma (37 +/- 3 micromol/L). Free plasma cyst(e)ine concentrations in dogs and cats decreased after first-order kinetics, with a half-life of 23 and 69 hours, respectively. Total plasma cysteine after TCEP - HCl treatment was similar for dogs (290 micromol/L) and cats (296 micromol/L), but the percentage of free cysteine was higher (P = .02) in dogs (27%) than in cats (13%). Over half of the cyst(e)ine, homocysteine, cysteinylglycine, and glutathione were bound in vivo to plasma proteins. These results emphasize the importance of removing plasma proteins within 1 hour after blood collection for reliable assay of free plasma cyst(e)ine.

  14. Canine as a biomedical research model: immunological, hematological, and oncological aspects

    International Nuclear Information System (INIS)

    Shifrine, M.; Wilson, F.D.

    1980-01-01

    The canine has been used as a biomedical research model in radiation studies by a number of laboratories supported primarily by the US Department of Energy and its predecessors. These studies were unique in that they covered the life spans of the canines and permitted the collection of data from birth to death under controlled conditions. Since these were multiparametric studies, an extensive data base has been established, not the least of which are normative values covering all biologic systems, including immunohematology. The canine model has also been extensively used by other groups, such as transplantation biologists. The virtues of the canine as a model in these and many other endeavors are becoming increasingly more apparent with the passing of time. One of the primary goals of this volume was to compile the knowledge and experience of researchers using the canine model and to focus their expertise on furthering the use of the canine for studies in immunology, hematology, and oncology. We have attempted to present some of the contemporary, diverse uses of the canine in biomedical research, emphasizing immunologic endpoints, and also to present in detail some of the latest technology used in such studies

  15. Canine tumor cross-species genomics uncovers targets linked to osteosarcoma progression

    Science.gov (United States)

    2009-01-01

    Background Pulmonary metastasis continues to be the most common cause of death in osteosarcoma. Indeed, the 5-year survival for newly diagnosed osteosarcoma patients has not significantly changed in over 20 years. Further understanding of the mechanisms of metastasis and resistance for this aggressive pediatric cancer is necessary. Pet dogs naturally develop osteosarcoma providing a novel opportunity to model metastasis development and progression. Given the accelerated biology of canine osteosarcoma, we hypothesized that a direct comparison of canine and pediatric osteosarcoma expression profiles may help identify novel metastasis-associated tumor targets that have been missed through the study of the human cancer alone. Results Using parallel oligonucleotide array platforms, shared orthologues between species were identified and normalized. The osteosarcoma expression signatures could not distinguish the canine and human diseases by hierarchical clustering. Cross-species target mining identified two genes, interleukin-8 (IL-8) and solute carrier family 1 (glial high affinity glutamate transporter), member 3 (SLC1A3), which were uniformly expressed in dog but not in all pediatric osteosarcoma patient samples. Expression of these genes in an independent population of pediatric osteosarcoma patients was associated with poor outcome (p = 0.020 and p = 0.026, respectively). Validation of IL-8 and SLC1A3 protein expression in pediatric osteosarcoma tissues further supported the potential value of these novel targets. Ongoing evaluation will validate the biological significance of these targets and their associated pathways. Conclusions Collectively, these data support the strong similarities between human and canine osteosarcoma and underline the opportunities provided by a comparative oncology approach as a means to improve our understanding of cancer biology and therapies. PMID:20028558

  16. Canine tumor cross-species genomics uncovers targets linked to osteosarcoma progression

    Directory of Open Access Journals (Sweden)

    Triche Timothy

    2009-12-01

    Full Text Available Abstract Background Pulmonary metastasis continues to be the most common cause of death in osteosarcoma. Indeed, the 5-year survival for newly diagnosed osteosarcoma patients has not significantly changed in over 20 years. Further understanding of the mechanisms of metastasis and resistance for this aggressive pediatric cancer is necessary. Pet dogs naturally develop osteosarcoma providing a novel opportunity to model metastasis development and progression. Given the accelerated biology of canine osteosarcoma, we hypothesized that a direct comparison of canine and pediatric osteosarcoma expression profiles may help identify novel metastasis-associated tumor targets that have been missed through the study of the human cancer alone. Results Using parallel oligonucleotide array platforms, shared orthologues between species were identified and normalized. The osteosarcoma expression signatures could not distinguish the canine and human diseases by hierarchical clustering. Cross-species target mining identified two genes, interleukin-8 (IL-8 and solute carrier family 1 (glial high affinity glutamate transporter, member 3 (SLC1A3, which were uniformly expressed in dog but not in all pediatric osteosarcoma patient samples. Expression of these genes in an independent population of pediatric osteosarcoma patients was associated with poor outcome (p = 0.020 and p = 0.026, respectively. Validation of IL-8 and SLC1A3 protein expression in pediatric osteosarcoma tissues further supported the potential value of these novel targets. Ongoing evaluation will validate the biological significance of these targets and their associated pathways. Conclusions Collectively, these data support the strong similarities between human and canine osteosarcoma and underline the opportunities provided by a comparative oncology approach as a means to improve our understanding of cancer biology and therapies.

  17. Identification of quantitative trait loci (QTL for canine hip dysplasia and canine elbow dysplasia in Bernese mountain dogs.

    Directory of Open Access Journals (Sweden)

    Sophia Pfahler

    Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.

  18. Feeding ecology and morphology of the upper canines in bears (carnivora: Ursidae).

    Science.gov (United States)

    Christiansen, Per

    2008-07-01

    The morphology and mechanical strength of the upper canines in all eight extant species of ursids is analyzed, and the findings are discussed in relation to feeding ecology. Ursids have proportionally smaller canines than other large carnivores with a specialized feeding ecology, such as large felids, and the upper canine morphology is both canid-like and felid-like. The giant panda is the most divergent species, and its short, blunt, and cone-like canines appear well adapted for tearing into bamboo. The almost equally herbivorous spectacled bear has a less derived canine morphology. The large canines of the sun bear are divergent from other ursine ursids, and may be an adaptation for tearing open tree trunks in search of insects. Discriminant Analysis is successful in separating ursid species on the basis of canine morphology, but the canines of ursine ursids, and also of the spectacled bear, show greater resemblance among the species than the marked differences in feeding ecology would suggest. This could be in part due to a short evolutionary history, and in part due to canines not having been subjected to much evolutionary selection as has been the case among other large carnivores, such as large felids. Ursids are probably evolutionarily and ecologically successful due to physical size and strength rather than a derived craniodental anatomy. Copyright 2008 Wiley-Liss, Inc.

  19. Canine length in wild male baboons: maturation, aging and social dominance rank.

    Directory of Open Access Journals (Sweden)

    Jordi Galbany

    Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.

  20. Effects of body weight on antibody titers against canine parvovirus type 2, canine distemper virus, and canine adenovirus type 1 in vaccinated domestic adult dogs.

    Science.gov (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki

    2012-10-01

    The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.

  1. IQGAP1 is an oncogenic target in canine melanoma.

    Directory of Open Access Journals (Sweden)

    Becky H Lee

    Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.

  2. Prevalence of canine hepatozoonosis in Areia, Paraíba, Brazil

    Directory of Open Access Journals (Sweden)

    Maria das Graças da Silva Bernardino

    2016-02-01

    Full Text Available Canine hepatozoonosis is a parasitic disease of debilitating nature. Also, it is immunosuppressive and difficult to diagnose clinically. The prevalence of the disease in dogs has been described in several Brazilian states, but studies are still scarce in the Northeast region. Accordingly, this study aimed to determine the prevalence of canine hepatozoonosis in Areia, Paraíba, Brazil. The dogs were clinically examined, and peripheral blood samples were obtained from the tip of the ear. Of the 151 dogs analyzed, 9.3% were positive for Hepatozoon canis by the demonstration of gamonts parasitizing neutrophils. The degree of parasitemia ranged from mild to intense. The observed hematological changes were different between animals and showed no pattern of response to infection. The subclinical form was observed in 50% of dogs and the others had nonspecific clinical signs. We conclude that hepatozoonosis occurs in dogs in the urban area of the city studied and that dogs infected with H. canis show hematological changes and nonspecific clinical signs.

  3. Expression and function of survivin in canine osteosarcoma.

    Science.gov (United States)

    Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H

    2012-01-01

    Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.

  4. Urine neutrophil gelatinase-associated lipocalin (NGAL as a biomarker for acute canine kidney injury

    Directory of Open Access Journals (Sweden)

    Lee Ya-Jane

    2012-12-01

    Full Text Available Abstract Background Biomarkers for the early prediction of canine acute kidney injury (AKI are clinically important. Recently, neutrophil gelatinase-associated lipocalin (NGAL was found to be a sensitive biomarker for the prediction of human AKI at a very early stage and the development of AKI after surgery. However, NGAL has not yet been studied with respect to dog kidney diseases. The application of NGAL canine AKI was investigated in this study. Results The canine NGAL gene was successfully cloned and expressed. Polyclonal antibodies against canine NGAL were generated and used to develop an ELISA for measuring NGAL protein in serum and urine samples that were collected from 39 dogs at different time points after surgery. AKI was defined by the standard method, namely a serum creatinine increase of greater than or equal to 26.5 μmol/L from baseline within 48 h. At 12 h after surgery, compared to the group without AKI (12 dogs, the NGAL level in the urine of seven dogs with AKI was significantly increased (median 178.4 pg/mL vs. 88.0 pg/mL, and this difference was sustained to 72 h. Conclusion As the increase in NGAL occurred much earlier than the increase in serum creatinine, urine NGAL seems to be able to serve as a sensitive and specific biomarker for the prediction of AKI in dogs.

  5. American Canine Hepatozoonosis

    Science.gov (United States)

    Ewing, S. A.; Panciera, R. J.

    2003-01-01

    American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294

  6. National clinical guidelines for management of the palatally ectopic maxillary canine.

    Science.gov (United States)

    Husain, J; Burden, D; McSherry, P; Morris, D; Allen, M

    2012-08-01

    This review summarises updated clinical guidelines produced by the Clinical Standards Committee of the Faculty of Dental Surgery, Royal College of Surgeons of England (FDSRCS). This guideline on the management of the palatally ectopic maxillary canine illustrates the information contained in the recently updated online version. The timely recognition of ectopic canines is important for the overall management of the dentition. This review illustrates five management strategies for ectopic permanent canines: interceptive treatment by extraction of the deciduous canine, surgical exposure and orthodontic alignment, surgical removal of the palatally ectopic permanent canine, auto-transplantation and no active treatment/leave and observe. The current available evidence for each of these management options has been evaluated and awarded a grade used by the Scottish Intercollegiate Guidelines Network.

  7. Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report.

    Science.gov (United States)

    Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka

    2016-07-01

    Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.

  8. Examination of anonymous canine faecal samples provides data on endoparasite prevalence rates in dogs for comparative studies.

    Science.gov (United States)

    Hinney, Barbara; Gottwald, Michaela; Moser, Jasmine; Reicher, Bianca; Schäfer, Bhavapriya Jasmin; Schaper, Roland; Joachim, Anja; Künzel, Frank

    2017-10-15

    Several endoparasites of dogs cannot only be detrimental to their primary host but might also represent a threat to human health because of their zoonotic potential. Due to their high dog population densities, metropolitan areas can be highly endemic for such parasites. We aimed to estimate the prevalence of endoparasites in dogs in the Austrian capital of Vienna by examining a representative number of canine faecal samples and to compare the prevalences with two neighbouring peri-urban and rural regions. In addition we analysed whether the density of dog populations and cleanliness of dog zones correlated with parasite occurrence. We collected 1001 anonymous faecal samples from 55 dog zones from all 23 districts of the federal state of Vienna, as well as 480 faecal samples from the Mödling district and Wolkersdorf with a peri-urban and rural character, respectively. Faeces were examined by flotation and by Baermann technique. Additionally we evaluated 292 Viennese, 102 peri-urban and 50 rural samples for Giardia and Cryptosporidium by GiardiaFASTest ® and CryptoFASTest ® . Samples from "clean" dog zones were compared to samples from "dirty" zones. The infection rate of Toxocara was surprisingly low, ranging from 0.6% to 1.9%. Trichuris was the most frequent helminth (1.8-7.5%) and Giardia the most frequent protozoan (4.0-10.8%). Ancylostomatidae, Crenosoma, Capillaria, Taeniidae, Cystoisospora and Sarcocystis were found in 1.8-2.2%, 0-0.9%, 0-0.9%, 0-0.6%, 0.3-3.1% and 0-0.6% of the samples, respectively. Samples from "dirty" dog zones in Vienna showed a significantly higher rate of parasites overall (p=0.003) and of Trichuris (p=0.048) compared to samples from "clean" dog zones. There were no statistically significant differences in densely vs. less densely populated areas of Vienna. Samples from the rural region of Wolkersdorf had significantly higher overall parasite, Trichuris and Cystoisospora prevalences than the peri-urban Mödling district and Vienna (p

  9. Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.

    Directory of Open Access Journals (Sweden)

    Emily J Shields

    Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.

  10. Severe canine distemper outbreak in unvaccinated dogs in Mozambique

    Directory of Open Access Journals (Sweden)

    Julieta Zacarias

    2016-07-01

    Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

  11. Management of an Unusual Ectopic Eruption of Maxillary Canine.

    Science.gov (United States)

    Aileni, Kaladhar Reddy; Rachala, Madhukar Reddy; Prathima, Chintakunta Reddy; Naveen, Pitalla Kumar; Soujanya, Donthula

    2017-05-01

    Transposition of teeth is a rare condition, with a prevalence of 0.3-0.4% in general population. They are more commonly observed in females, and may occur unilaterally/bilaterally with greater frequency of left side occurrence in unilateral transposition cases. A 17-year-old female patient reported with the chief complaint of unaesthetic smile. On clinical examination the patient was diagnosed with Angle's class I malocclusion with an ectopically erupted maxillary left canine labial to the left central incisor with retained deciduous canine. The treatment plan decided was to extract the retained deciduous canine, level and align the ectopic canine using an R-loop. The treatment for the patient was finished in 14 months and was retained using a fixed lingual retainer in the upper and lower arches.

  12. The Ondersteport Canine distemper virus strain and measles ...

    African Journals Online (AJOL)

    Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...

  13. Management of an impacted and transposed maxillary canine

    Directory of Open Access Journals (Sweden)

    Deepti A

    2010-03-01

    Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.

  14. Genotyping and pathobiologic characterization of canine parvovirus circulating in Nanjing, China.

    Science.gov (United States)

    Zhao, Yanbing; Lin, Yan; Zeng, Xujian; Lu, Chengping; Hou, Jiafa

    2013-08-29

    Canine parvovirus (CPV) is an important pathogen that causes acute enteric disease in dogs. It has mutated and spread throughout the world in dog populations. We provide an update on the molecular characterization of CPV that circulated in Nanjing, a provincial capital in China between 2009 and 2012. Seventy rectal swab samples were collected from the dogs diagnosed with CPV infection in 8 animal hospitals of Nanjing. Sequence analysis of VP2 genes of 31 samples revealed that 29 viral strains belonged to CPV-2a subtype, while other two strains were classified into CPV-2b. To investigate the pathogenicity of the prevalent virus, we isolated CPV-2a and performed the animal experiment. Nine beagles were inoculated with 105.86 of 50% tissue culture infectious doses (TCID50) of the virus. All the experimentally infected beagles exhibited mild to moderate mucoid or watery diarrhea on day 4 post-infection (p.i.). On day 9 p.i., characteristic histopathological lesions were clearly observed in multiple organs of infected dogs, including liver, spleen, kidney, brain and all segments of the small and large intestines, while viral DNA and antigen staining could be detected in the sampled tissues. It is notable that canine parvovirus was isolated in one from two brain samples processed. Our results indicated that CPV-2a is the predominant subtype in Nanjing of China. And this virus caused extensive lesions in a variety of tissues, including the brain.

  15. Growth hormone concentrations in mammary secretions and plasma of the periparturient bitch and in plasma of the neonate.

    Science.gov (United States)

    Schoenmakers, I; Kooistra, H S; Okkens, A C; Hazewinkel, H A; Bevers, M M; Mol, J A

    1997-01-01

    The presence of growth hormone (GH) in mammary secretions of bitches was investigated in relation to plasma GH concentrations at about the time of parturition and during the first weeks of lactation. Plasma GH concentrations in neonates were measured during the first weeks of lactation, to determine whether GH in maternal milk contributes to plasma concentrations of GH in the neonate. Gastrointestinal uptake of GH was studied by measurement of plasma bovine GH (bGH) concentrations after intragastric administration of bGH. High concentrations of GH were found in the mammary secretions of the bitches, particularly before parturition and in colostrum, exceeding maternal plasma concentration up to 100-1000 times. GH concentrations in milk were not not significantly correlated with GH concentrations in plasma of bitches or neonates. Bovine GH could not be detected in neonatal plasma for 4 h after intragastric administration of bGH. The presence of high concentrations of canine GH (cGH) in ante-partum and colostral mammary secretions is consistent with the progesterone-induced mammary biosynthesis of GH. GH in milk is probably not absorbed from the gastrointestinal tract into the blood circulation of the newborn in its intact form.

  16. Aspects and clinical procedures of eruptive changes of permanent upper canines

    Directory of Open Access Journals (Sweden)

    Sheila Marcia Francisco

    2012-04-01

    Full Text Available INTRODUCTION: Even though the upper canine is the tooth that presents most eruption anomalies, after the third molars, canine retention prevalence in the population is quite low. Local, physiologic and pathologic factors can provide difficulties for the tooth eruptive process. The correct diagnosis in trying to prevent upper canine retention with ectopic eruption is fundamental to choose the ideal treatment, which can be performed by various methods. OBJECTIVE: The present paper has the purpose of approaching aspects related to impacted upper permanent canines by a literature review, including localization and treatment conducts.

  17. Chemical and canine analysis as complimentary techniques for the identification of active odors of the invasive fungus, Raffaelea lauricola.

    Science.gov (United States)

    Simon, Alison G; Mills, DeEtta K; Furton, Kenneth G

    2017-06-01

    Raffaelea lauricola, a fungus causing a vascular wilt (laurel wilt) in Lauraceae trees, was introduced into the United States in the early 2000s. It has devastated forests in the Southeast and has now moved into the commercial avocado groves in southern Florida. Trained detection canines are currently one of the few successful methods for early detection of pre-symptomatic diseased trees. In order to achieve the universal and frequent training required to have successful detection canines, it is desirable to create accessible, safe, and long-lasting training aids. However, identification of odorants and compounds is limited by several factors, including both the availability of chemicals and the need to present chemicals individually and in combination to detection canines. A method for the separation and identification of volatile organic compounds (VOCs) from environmental substances for the creation of such a canine training aid is presented here. Headspace solid phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS) was used to identify the odors present in avocado trees infected with the R. lauricola phytopathogen. Twenty-eight compounds were detected using this method, with nine present in greater than 80% of samples. The majority of these compounds were not commercially available as standard reference materials, and a canine trial was designed to identify the active odors without the need of pure chemical compounds. To facilitate the creation of a canine training aid, the VOCs above R. lauricola were separated by venting a 0.53mm ID solgel-wax gas chromatography column to the atmosphere. Ten minute fractions of the odor profile were collected on cotton gauze in glass vials and presented to the detection canines in a series of field trials. The canines alerted to the VOCs from the vials that correspond to a portion of the chromatogram containing the most volatile species from R. lauricola. This innovative fractionation and collection

  18. A New Assay for Measurement of Acetylcholinesterase and Butyrylcholinesterase in Canine Whole Blood Combining Specific Substrates and Ethopropazine Hydrochloride as a Selective Butyrylcholinesterase Inhibitor

    Directory of Open Access Journals (Sweden)

    F Tecles, A Tvarijonaviciute and JJ Cerón*

    2013-11-01

    Full Text Available In the present report, a new assay combining specific substrates and a selective BChE inhibitor (ethopropazine hydrochloride was used to measure both AChE and BChE in canine whole blood samples. Acetylthiocholine iodide (ATCI and butyrylthiocholine iodide (BTCI were used as substrates, whereas 2,2’-dithiodipiridine was used as chromophore. Ethopropazine concentration inhibiting over 95% BChE with minimum AChE inhibition was fixed at 0.3mM. The results confirmed that whole blood cholinesterase activity measured with BTCI in absence of ethopropazine corresponded with serum BChE, whereas whole blood cholinesterase analysed with ATCI in presence of ethopropazine reflected mainly erythrocytes and plasma AChE activity. This procedure showed good repeatability, it was easy and fast, and can be routinely used in veterinary laboratories.

  19. A randomized clinical study of two interceptive approaches to palatally displaced canines.

    Science.gov (United States)

    Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela

    2008-08-01

    This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.

  20. Automated processing of whole blood samples into microliter aliquots of plasma.

    Science.gov (United States)

    Burtis, C A; Johnson, W W; Walker, W A

    1988-01-01

    A rotor that accepts and automatically processes a bulk aliquot of a single blood sample into multiple aliquots of plasma has been designed and built. The rotor consists of a central processing unit, which includes a disk containing eight precision-bore capillaries. By varying the internal diameters of the capillaries, aliquot volumes ranging 1 to 10 mul can be prepared. In practice, an unmeasured volume of blood is placed in a centre well, and, as the rotor begins to spin, is moved radially into a central annular ring where it is distributed into a series of processing chambers. The rotor is then spun at 3000 rpm for 10 min. When the centrifugal field is removed by slowly decreasing the rotor speed, an aliquot of plasma is withdrawn by capillary action into each of the capillary tubes. The disk containing the eight measured aliquots of plasma is subsequently removed and placed in a modifed rotor for conventional centrifugal analysis. Initial evaluation of the new rotor indicates that it is capable of producing discrete, microliter volumes of plasma with a degree of accuracy and precision approaching that of mechanical pipettes.

  1. Use of a dry-plasma collection device to overcome problems with storage and transportation of blood samples for epidemiology studies in developing countries.

    Science.gov (United States)

    Nurgalieva, Z Z; Almuchambetova, R; Machmudova, A; Kapsultanova, D; Osato, M S; Peacock, J; Zoltek, R P; Marchildon, P A; Graham, D Y; Zhangabylov, A

    2000-11-01

    Studies are difficult in areas lacking modern facilities due to the inability to reliably collect, store, and ship samples. Thus, we sought to evaluate the use of a dry plasma collection device for seroepidemiology studies. Plasma was obtained by fingerstick using a commercial dry plasma collection device (Chemcard Plasma Collection Device) and serum (venipuncture) from individuals in Kazakhstan. Plasma samples were air dried for 15 min and then stored desiccated in foil zip-lock pouches at 4 to 6 degrees C and subsequently shipped to the United States by air at ambient temperature. Serum samples remained frozen at -20 degrees C until assayed. Helicobacter pylori status was determined by enzyme-linked immunosorbent assay (HM-CAP EIA) for the dry plasma and the serum samples. The results were concordant in 250 of the 289 cases (86.5%). In 25 cases (8.6%), the dry plasma samples gave indeterminate results and could not be retested because only one sample was collected. Five serum samples were positive, and the corresponding dry plasma samples were negative; one serum sample was negative, and the corresponding plasma sample was positive. The relative sensitivity and specificity of the Chemcard samples to serum were 97.6 and 97.9%, respectively, excluding those with indeterminate results. Repeated freeze-thawing had no adverse effect on the accuracy of the test. We found the dry plasma collection device to provide an accurate and practical alternative to serum when venipuncture may be difficult or inconvenient and sample storage and handling present difficulties, especially for seroepidemiologic studies in rural areas or developing countries and where freeze-thawing may be unavoidable.

  2. Epidemiology of canine distemper and canine parvovirus in domestic dogs in urban and rural areas of the Araucanía region in Chile.

    Science.gov (United States)

    Acosta-Jamett, G; Surot, D; Cortés, M; Marambio, V; Valenzuela, C; Vallverdu, A; Ward, M P

    2015-08-05

    To assess whether the seroprevalence of canine distemper virus (CDV) and canine parvovirus (CPV) in domestic dogs is higher in urban versus rural areas of the Araucanía region in Chile and risk factors for exposure, a serosurvey and questionnaire survey at three, urban-rural paired sites was conducted from 2009 to 2012. Overall, 1161 households were interviewed of which 71% were located in urban areas. A total of 501 blood samples were analysed. The overall CDV and CPV seroprevalences were 61% (CI 90%: 58-70%) and 47% (CI 90%: 40-49%), and 89% (CI 90%: 85-92%) and 72% (CI 90%: 68-76%) in urban and rural areas, respectively. The higher seroprevalence in domestic dogs in urban areas suggests that urban domestic dogs might be a maintenance host for both CDV and CPV in this region. Due to the presence of endangered wild canids populations in areas close to these domestic populations, surveillance and control of these pathogens in urban dog populations is needed a priority. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Studies on manifestations of canine distemper virus infection in an urban dog population.

    Science.gov (United States)

    Blixenkrone-Møller, M; Svansson, V; Have, P; Orvell, C; Appel, M; Pedersen, I R; Dietz, H H; Henriksen, P

    1993-10-01

    An upsurge of canine distemper was recognized at the beginning of 1991 in the urban dog population of the Copenhagen area. The outbreak had the characteristics of a virulent morbillivirus introduction in a partly immune population, where the disease primarily was manifested in young individuals. Testing of single serum samples for the presence of canine distemper virus (CDV) IgM antibodies using an IgM ELISA confirmed current and recent CDV infections in an urban dog population, where the use of attenuated CDV vaccines was widespread. In 49 out of 66 sera from clinical cases suspected of canine distemper we detected CDV IgM antibodies, as compared to the detection of viral antigen by indirect immunofluorescence in 27 of 65 specimens of conjunctival cells. The antigenic make-up of isolates from acute and subacute clinical cases was investigated with a panel of 51 monoclonal antibodies directed against CDV and the related phocine distemper virus. The isolates exhibited an homogeneous reaction pattern and shared overall antigenic characteristics of the CDV prototype. The majority of cases were diagnosed among unvaccinated dogs and individuals with unknown or obscure vaccination record. However, severe clinical cases were also diagnosed in vaccinated individuals.

  4. Design and Demonstration of a Material-Plasma Exposure Target Station for Neutron Irradiated Samples

    International Nuclear Information System (INIS)

    Rapp, Juergen; Aaron, A. M.; Bell, Gary L.; Burgess, Thomas W.; Ellis, Ronald James; Giuliano, D.; Howard, R.; Kiggans, James O.; Lessard, Timothy L.; Ohriner, Evan Keith; Perkins, Dale E.; Varma, Venugopal Koikal

    2015-01-01

    5-20 MW/m"2 and ion fluxes up to 10"2"4 m"-"2s"-"1. Since PFCs will have to withstand neutron irradiation displacement damage up to 50 dpa, the target station design must accommodate radioactive specimens (materials to be irradiated in HFIR or at SNS) to enable investigations of the impact of neutron damage on materials. Therefore, the system will have to be able to install and extract irradiated specimens using equipment and methods to avoid sample modification, control contamination, and minimize worker dose. Included in the design considerations will be an assessment of all the steps between neutron irradiation and post-exposure materials examination/characterization, as well as an evaluation of the facility hazard categorization. In particular, the factors associated with the acquisition of radioactive specimens and their preparation, transportation, experimental configuration at the plasma-specimen interface, post-plasma-exposure sample handling, and specimen preparation will be evaluated. Neutronics calculations to determine the dose rates of the samples were carried out for a large number of potential plasma-facing materials.

  5. Morphology of palatally impacted canines: A case-controlled cone-beam volumetric tomography study.

    Science.gov (United States)

    Hettiarachchi, Pilana Vithanage Kalani Shihanika; Olive, Richard John; Monsour, Paul

    2017-02-01

    The aim of this study was to investigate the relationships between an apical curvature or a hook and the crown/root ratio in subjects with and without palatally impacted maxillary canines. An experimental group of 44 patients (17 boys, 27 girls; mean age, 13.6 years) with 59 palatally impacted maxillary canines was selected from the records of patients referred to a radiology practice for cone-beam imaging. If a patient had bilateral palatally impacted canines, 1 canine was randomly selected for analysis. The palatally impacted canine group was matched for age and sex with 49 normal subjects (25 boys, 24 girls; mean age, 13.2 years) with 98 canines. Cone-beam DICOM files were imported into In Vivo imaging software (version 5.3; Anatomage, San Jose, Calif) for analysis. The angulations and linear variables of the maxillary canines were measured by using the software measurement tools. Chi-square and independent t tests were used to test for differences between the groups. The presence of a hook at the apical third and other root curvature were significantly different between the 2 groups (P <0.001 and P <0.05, respectively). Of the 44 palatally impacted canines, 16 (36.4%) had an apical hook and only 1 canine in the control group had an apical hook (1.0%). The mean root length of the palatally impacted canines was 2.66 mm shorter (P <0.001), and the mean crown/root ratio was significantly greater for the palatally impacted canines compared with the nonimpacted group (P <0.001). Palatally impacted canines have a greater tendency to develop apical hooks and are less likely to develop other root curvatures than are nonimpacted canines. Also, they have shorter roots resulting in larger crown/root ratios compared with the control group. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

  6. Canine detection of free-ranging brown treesnakes on Guam

    Science.gov (United States)

    Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.

    2011-01-01

    We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.

  7. Cryopreservation of microencapsulated canine sperm.

    Science.gov (United States)

    Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu

    2011-03-01

    The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. The timing of tooth eruption and root development of permanent canine and premolars in Korean children

    Energy Technology Data Exchange (ETDEWEB)

    Cheong, Chang Shin; Jung, Yun Hoa; Cho, Bong Hae [Department of Oral and Maxillofacial Radiology, School of Dentistry, Pusan National University, Pusan (Korea, Republic of)

    2010-09-15

    The aim of this study was to investigate the timing and sequence of eruption of permanent canine and premolars, and to evaluate tooth calcification stage on emergence in Korean children. The sample was comprised of 1,266 children (male 720, female 546) aged from 7-13 years. Tooth eruption and calcification stages were determined through oral and panoramic radiographic examination, respectively. Probit analysis was used to calculate the timing of tooth eruption and tooth calcification stage from these cross-sectional data. In both males and females, eruption occurred around the time when one third of tooth root or more was formed. The sequence was as follows: first premolar, canine, and second premolar in maxilla, and canine, first premolar and second premolar in mandible. Tooth eruption occurred earlier in girls compared with boys, averaging 0.63 years. Eruption sequence is identical in males and females with a trend for females to erupt earlier than males. Tooth eruption becomes earlier over the past decades in Korean children.

  9. The timing of tooth eruption and root development of permanent canine and premolars in Korean children

    International Nuclear Information System (INIS)

    Cheong, Chang Shin; Jung, Yun Hoa; Cho, Bong Hae

    2010-01-01

    The aim of this study was to investigate the timing and sequence of eruption of permanent canine and premolars, and to evaluate tooth calcification stage on emergence in Korean children. The sample was comprised of 1,266 children (male 720, female 546) aged from 7-13 years. Tooth eruption and calcification stages were determined through oral and panoramic radiographic examination, respectively. Probit analysis was used to calculate the timing of tooth eruption and tooth calcification stage from these cross-sectional data. In both males and females, eruption occurred around the time when one third of tooth root or more was formed. The sequence was as follows: first premolar, canine, and second premolar in maxilla, and canine, first premolar and second premolar in mandible. Tooth eruption occurred earlier in girls compared with boys, averaging 0.63 years. Eruption sequence is identical in males and females with a trend for females to erupt earlier than males. Tooth eruption becomes earlier over the past decades in Korean children.

  10. New high temperature plasmas and sample introduction systems for analytical atomic emission and mass spectrometry

    International Nuclear Information System (INIS)

    Montaser, A.

    1993-01-01

    In this research, new high-temperature plasmas and new sample introduction systems are explored for rapid elemental and isotopic analysis of gases, solutions, and solids using mass spectrometry and atomic emission spectrometry. During the period January 1993--December 1993, emphasis was placed on (a) analytical investigations of atmospheric-pressure helium inductively coupled plasma (He ICP) that are suitable for atomization, excitation, and ionization of elements possessing high excitation and ionization energies; (b) simulation and computer modeling of plasma sources to predict their structure and fundamental and analytical properties without incurring the enormous cost of experimental studies; (c) spectrosopic imaging and diagnostic studies of high-temperature plasmas; (d) fundamental studies of He ICP discharges and argon-nitrogen plasma by high-resolution Fourier transform spectrometry; and (e) fundamental and analytical investigation of new, low-cost devices as sample introduction systems for atomic spectrometry and examination of new diagnostic techniques for probing aerosols. Only the most important achievements are included in this report to illustrate progress and obstacles. Detailed descriptions of the authors' investigations are outlined in the reprints and preprints that accompany this report. The technical progress expected next year is briefly described at the end of this report

  11. Development of improved enzyme-based and lateral flow immunoassays for rapid and accurate serodiagnosis of canine brucellosis.

    Science.gov (United States)

    Cortina, María E; Novak, Analía; Melli, Luciano J; Elena, Sebastián; Corbera, Natalia; Romero, Juan E; Nicola, Ana M; Ugalde, Juan E; Comerci, Diego J; Ciocchini, Andrés E

    2017-09-01

    Brucellosis is a widespread zoonotic disease caused by Brucella spp. Brucella canis is the etiological agent of canine brucellosis, a disease that can lead to sterility in bitches and dogs causing important economic losses in breeding kennels. Early and accurate diagnosis of canine brucellosis is central to control the disease and lower the risk of transmission to humans. Here, we develop and validate enzyme and lateral flow immunoassays for improved serodiagnosis of canine brucellosis using as antigen the B. canis rough lipopolysaccharide (rLPS). The method used to obtain the rLPS allowed us to produce more homogeneous batches of the antigen that facilitated the standardization of the assays. To validate the assays, 284 serum samples obtained from naturally infected dogs and healthy animals were analyzed. For the B. canis-iELISA and B. canis-LFIA the diagnostic sensitivity was of 98.6%, and the specificity 99.5% and 100%, respectively. We propose the implementation of the B. canis-LFIA as a screening test in combination with the highly accurate laboratory g-iELISA. The B. canis-LFIA is a rapid, accurate and easy to use test, characteristics that make it ideal for the serological surveillance of canine brucellosis in the field or veterinary laboratories. Finally, a blind study including 1040 serum samples obtained from urban dogs showed a prevalence higher than 5% highlighting the need of new diagnostic tools for a more effective control of the disease in dogs and therefore to reduce the risk of transmission of this zoonotic pathogen to humans. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Liquid sampling-atmospheric pressure glow discharge as a secondary excitation source: Assessment of plasma characteristics

    Science.gov (United States)

    Manard, Benjamin T.; Gonzalez, Jhanis J.; Sarkar, Arnab; Dong, Meirong; Chirinos, Jose; Mao, Xianglei; Russo, Richard E.; Marcus, R. Kenneth

    The liquid sampling-atmospheric pressure glow discharge (LS-APGD) has been assessed as a secondary excitation source with a parametric evaluation regarding carrier gas flow rate, applied current, and electrode distance. With this parametric evaluation, plasma optical emission was monitored in order to obtain a fundamental understanding with regards to rotational temperature (Trot), excitation temperature (Texc), electron number density (ne), and plasma robustness. Incentive for these studies is not only for a greater overall fundamental knowledge of the APGD, but also in instrumenting a secondary excitation/ionization source following laser ablation (LA). Rotational temperatures were determined through experimentally fitting of the N2 and OH molecular emission bands while atomic excitation temperatures were calculated using a Boltzmann distribution of He and Mg atomic lines. The rotational and excitation temperatures were determined to be ~ 1000 K and ~ 2700 K respectively. Electron number density was calculated to be on the order of ~ 3 × 1015 cm- 3 utilizing Stark broadening effects of the Hα line of the Balmer series and a He I transition. In addition, those diagnostics were performed introducing magnesium (by solution feed and laser ablation) into the plasma in order to determine any perturbation under heavy matrix sampling. The so-called plasma robustness factor, derived by monitoring Mg II/Mg I emission ratios, is also employed as a reflection of potential perturbations in microplasma energetics across the various operation conditions and sample loadings. While truly a miniaturized source (laser ablation sample introduction.

  13. Three-year rabies duration of immunity in dogs following vaccination with a core combination vaccine against canine distemper virus, canine adenovirus type-1, canine parvovirus, and rabies virus.

    Science.gov (United States)

    Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

    2006-01-01

    Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.

  14. Management of impacted all canines with surgical exposure and alignment by orthodontic treatment

    Directory of Open Access Journals (Sweden)

    Radha Katiyar

    2013-01-01

    Full Text Available Canine impaction is a dental problem very often encountered in orthodontic practice. After the third molar, the canine is the most frequently impacted tooth. Bringing the impacted canine into a normal position is important for functional occlusion and the final esthetics of the orthodontic treatment. This article illustrates a peculiar case, in which all four permanent canines maintained their unerupted status at age of 16 years. All four impacted canines were surgically exposed, attachment bonded, traction given with K-9 spring and ideally positioned with fixed orthodontic mechanotherapy.

  15. Antimicrobial susceptibility profiles of Staphylococcus intermedius isolates from clinical cases of canine pyoderma in South Africa

    Directory of Open Access Journals (Sweden)

    Catherine A. Blunt

    2013-05-01

    Full Text Available Successful treatment of canine pyoderma has become compromised owing to the development of antimicrobial resistance with accompanying recurrence of infection. Canine skin samples submitted to a veterinary diagnostic laboratory for microbiological culture and sensitivity between January 2007 and June 2010, from which Staphylococcus intermedius was isolated, were selected for this investigation. Antimicrobial resistance of S. intermedius was most prevalent with reference to ampicillin followed by resistance to tetracycline and then potentiated sulphonamides. In general, antimicrobial resistance was low and very few methicillin-resistant isolates were detected. Temporal trends were not noted, except for ampicillin, with isolates becoming more susceptible, and potentiated sulphonamides (co-trimoxazole, with isolates becoming more resistant. In general, both the Kirby–Bauer disc diffusion and broth dilution minimum inhibitory concentration tests yielded similar results for the antimicrobial agents tested. The main difference was evident in the over-estimation of resistance by the Kirby–Bauer test for ampicillin, co-trimoxazole, penicillin and doxycycline. Knowledge of trends in bacterial resistance is important for veterinarians when presented with canine pyoderma. Analysis of antimicrobial susceptibility profiles of S. intermedius isolated from canine pyodermas will guide veterinarians’ use of the most appropriate agent and encourage prudent use of antimicrobials in companion animals.

  16. Plasma Rich in Growth Factors Induces Cell Proliferation, Migration, Differentiation, and Cell Survival of Adipose-Derived Stem Cells

    Directory of Open Access Journals (Sweden)

    Maravillas Mellado-López

    2017-01-01

    Full Text Available Adipose-derived stem cells (ASCs are a promising therapeutic alternative for tissue repair in various clinical applications. However, restrictive cell survival, differential tissue integration, and undirected cell differentiation after transplantation in a hostile microenvironment are complications that require refinement. Plasma rich in growth factors (PRGF from platelet-rich plasma favors human and canine ASC survival, proliferation, and delaying human ASC senescence and autophagocytosis in comparison with serum-containing cultures. In addition, canine and human-derived ASCs efficiently differentiate into osteocytes, adipocytes, or chondrocytes in the presence of PRGF. PRGF treatment induces phosphorylation of AKT preventing ASC death induced by lethal concentrations of hydrogen peroxide. Indeed, AKT inhibition abolished the PRGF apoptosis prevention in ASC exposed to 100 μM of hydrogen peroxide. Here, we show that canine ASCs respond to PRGF stimulus similarly to the human cells regarding cell survival and differentiation postulating the use of dogs as a suitable translational model. Overall, PRGF would be employed as a serum substitute for mesenchymal stem cell amplification to improve cell differentiation and as a preconditioning agent to prevent oxidative cell death.

  17. A liquid chromatography/tandem mass spectrometry assay for the analysis of atomoxetine in human plasma and in vitro cellular samples

    Science.gov (United States)

    Appel, David I.; Brinda, Bryan; Markowitz, John S.; Newcorn, Jeffrey H.; Zhu, Hao-Jie

    2012-01-01

    A simple, rapid and sensitive method for quantification of atomoxetine by liquid chromatography- tandem mass spectrometry (LC-MS/MS) was developed. This assay represents the first LC-MS/MS quantification method for atomoxetine utilizing electrospray ionization. Deuterated atomoxetine (d3-atomoxetine) was adopted as the internal standard. Direct protein precipitation was utilized for sample preparation. This method was validated for both human plasma and in vitro cellular samples. The lower limit of quantification was 3 ng/ml and 10 nM for human plasma and cellular samples, respectively. The calibration curves were linear within the ranges of 3 ng/ml to 900 ng/ml and 10 nM to 10 μM for human plasma and cellular samples, respectively (r2 > 0.999). The intra- and inter-day assay accuracy and precision were evaluated using quality control samples at 3 different concentrations in both human plasma and cellular lysate. Sample run stability, assay selectivity, matrix effect, and recovery were also successfully demonstrated. The present assay is superior to previously published LC-MS and LC-MS/MS methods in terms of sensitivity or the simplicity of sample preparation. This assay is applicable to the analysis of atomoxetine in both human plasma and in vitro cellular samples. PMID:22275222

  18. FLT3 mutations in canine acute lymphocytic leukemia

    International Nuclear Information System (INIS)

    Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L

    2011-01-01

    FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias

  19. Vaccine-induced canine distemper in a lesser panda.

    Science.gov (United States)

    Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J

    1976-11-01

    A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.

  20. Canine hip dysplasia: significance of early bony spurring

    International Nuclear Information System (INIS)

    Morgan, J.P.

    1987-01-01

    It is the purpose of this study to call attention to new bone production that often occurs early in the sequence of pathological changes associated with canine hip dysplasia. New bone production extending to bony remodeling, as well as femoral head subluxation, both occur in the sequence of pathologic changes associated with canine hip dysplasia. Subluxation is considered primary, while osteoarthrosis is a secondary feature, and both are used in the diagnosis of canine hip dysplasia. This report concerns the significance of the presence of a solitary bony osteophyte, or spur, that is frequently evident on the caudal aspect of the femoral neck as viewed on the conventional ventrodorsal projection. This report utilizes findings from pelvic radiographs of 605 dogs (five breeds). There was a greater frequency (54%)of this bony change in cases diagnosed radiographically as dysplastic than in cases diagnosed as normal(15%).Thus, it is suggested that this minimal radiographic change can be used as an indicator of early canine hip dysplasia, especially in the absence of subluxation of the femoral head

  1. Radiographic assessment of dental anomalies in patients with ectopic maxillary canines

    DEFF Research Database (Denmark)

    Sørensen, Helle Budtz; Artmann, Lone; Larsen, Helle Juul

    2008-01-01

    dental deviations in cases with either palatal or labial ectopic canines. Design. Panoramic and intra-oral radiographs from 50 patients with palatally located (38 females and 12 males) and 19 patients with labially located ectopic canines (11 females and 8 males), aged 10 years, 2 months-18 years, 1...... month, were analysed. Dental deviations registered were crown and root malformations, agenesis, and eruption deviations. Registrations were performed in the maxillary incisor field and in the dentition in general. Results. The study documented that palatally as well as labially located ectopic canines...... can occur in dentitions without other dental deviations. Dental deviations occurred in approximately two-thirds of all cases, more often in females and in cases with palatally located canines. More than half of the females with palatally located canines had deviations in the maxillary incisors...

  2. Canine Babesiosis in China Caused by Babesia gibsoni: A Molecular Approach.

    Directory of Open Access Journals (Sweden)

    Da-Wei Yao

    2014-06-01

    Full Text Available To provide a point of reference to study the epidemiology and clinical expression of canine babesiosis in China.A total of 30 dogs infected with canine babesiosis were evaluated by mean of clinical history, physical examination, hematological, restriction fragment length polymorphism of PCR products (PCR-RFLP and sequencing analysis.The most prevalent clinical abnormalities were lethargy (100%, anorexia (100%, pale or icteric mucous membranes (80%, fever (70% and dark urine (70%. Hematology parameters revealed that anemia and thrombocytopenia were the major abnormalities in blood of dogs infected with canine babesia. The results of PCR-RFLP and sequencing analysis indicated that B. gibsoni was the main species responsible for canine babesiosis cases at the time of the study in Nanjing, China.The results provide valuable information for better understanding of the epidemiology of canine babesiosis in China.

  3. Orthodontic-surgical treatment of bilateral maxillary canine impaction

    Directory of Open Access Journals (Sweden)

    Sumitra

    2012-01-01

    Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.

  4. Liquid sampling-atmospheric pressure glow discharge as a secondary excitation source: Assessment of plasma characteristics

    International Nuclear Information System (INIS)

    Manard, Benjamin T.; Gonzalez, Jhanis J.; Sarkar, Arnab; Dong, Meirong; Chirinos, Jose; Mao, Xianglei; Russo, Richard E.; Marcus, R. Kenneth

    2014-01-01

    The liquid sampling-atmospheric pressure glow discharge (LS-APGD) has been assessed as a secondary excitation source with a parametric evaluation regarding carrier gas flow rate, applied current, and electrode distance. With this parametric evaluation, plasma optical emission was monitored in order to obtain a fundamental understanding with regards to rotational temperature (T rot ), excitation temperature (T exc ), electron number density (n e ), and plasma robustness. Incentive for these studies is not only for a greater overall fundamental knowledge of the APGD, but also in instrumenting a secondary excitation/ionization source following laser ablation (LA). Rotational temperatures were determined through experimentally fitting of the N 2 and OH molecular emission bands while atomic excitation temperatures were calculated using a Boltzmann distribution of He and Mg atomic lines. The rotational and excitation temperatures were determined to be ∼ 1000 K and ∼ 2700 K respectively. Electron number density was calculated to be on the order of ∼ 3 × 10 15 cm −3 utilizing Stark broadening effects of the Hα line of the Balmer series and a He I transition. In addition, those diagnostics were performed introducing magnesium (by solution feed and laser ablation) into the plasma in order to determine any perturbation under heavy matrix sampling. The so-called plasma robustness factor, derived by monitoring Mg II/Mg I emission ratios, is also employed as a reflection of potential perturbations in microplasma energetics across the various operation conditions and sample loadings. While truly a miniaturized source ( 3 volume), the LS-APGD is shown to be quite robust with plasma characteristics and temperatures being unaffected upon introduction of metal species, whether by liquid or laser ablation sample introduction. - Highlights: • Liquid sampling-atmospheric pressure glow discharge (LS-APGD) • LS-APGD as a secondary excitation source for laser-ablated (LA

  5. Prostate histotripsy for BPH: initial canine results

    Science.gov (United States)

    Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.

    2009-02-01

    Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.

  6. Difficulties in estimating the human burden of canine rabies.

    Science.gov (United States)

    Taylor, Louise H; Hampson, Katie; Fahrion, Anna; Abela-Ridder, Bernadette; Nel, Louis H

    2017-01-01

    Current passive surveillance data for canine rabies, particularly for the regions where the burden is highest, are inadequate for appropriate decision making on control efforts. Poor enforcement of existing legislation and poor implementation of international guidance reduce the effectiveness of surveillance systems, but another set of problems relates to the fact that canine rabies is an untreatable condition which affects very poor sectors of society. This results in an unknown, but potentially large proportion of rabies victims dying outside the health system, deaths that are unlikely to be recorded by surveillance systems based on health center records. This article critically evaluates the potential sources of information on the number of human deaths attributable to canine rabies, and how we might improve the estimates required to move towards the goal of global canine rabies elimination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Life-long diseases need life-long treatment: long-term safety of ciclosporin in canine atopic dermatitis

    Science.gov (United States)

    Nuttall, Tim; Reece, Douglas; Roberts, Elizabeth

    2014-01-01

    Ciclosporin (Atopica; Novartis Animal Health) has been licensed for canine atopic dermatitis (AD) since 2002. Adverse events (AEs) have been reported in 55 per cent of 759 dogs in 15 clinical trials, but are rare in pharmacovigilance data (71.81 AEs/million capsules sold). Gastrointestinal reactions were most common, but were mild and rarely required intervention. Other AEs were rare (≤1 per cent in clinical trials; metabolism is not clinically significant for normal dogs. Concomitant treatment with most drugs is safe. Effects on cytochrome P450 and MDR1 P-glycoprotein activity may elevate plasma ciclosporin concentrations, but short-term changes are not clinically significant. Monitoring of complete blood counts, urinalysis or ciclosporin levels is not justified except with higher than recommended doses and/or long-term concurrent immunosuppressive drugs. Ciclosporin is not a contraindication for killed (including rabies) vaccines, but the licensed recommendation is that live vaccination is avoided during treatment. In conclusion, ciclosporin has a positive risk-benefit profile for the long-term management of canine AD. PMID:24682696

  8. Physiological effects of stress related to helicopter travel in Federal Emergency Management Agency search-and-rescue canines.

    Science.gov (United States)

    Perry, E; Gulson, N; Liu Cross, T-W; Swanson, K S

    2017-01-01

    Working canines are deployed by the Federal Emergency Management Agency (FEMA), as part of a National Disaster Response Plan. Stress associated with helicopter flight and the resulting physical effects on the dog are unknown. Our objective was to test the hypotheses that (1) helicopter travel affects the physiology and faecal microbiota of working canines, but that (2) physiological consequences of helicopter travel will not negatively affect their work performance. A total of nine FEMA canines were loaded onto helicopters and flown for 30 min in July 2015. Rectal temperature, behavioural stress indicators and saliva swabs (for cortisol) were collected at baseline, loading, mid-flight and post-flight. After flight, canines completed a standardised search exercise to monitor work performance. Faecal samples were collected for microbial DNA extraction and Illumina sequencing. All canines were on a standardised diet (CANIDAE ® Grain Free PURE Land ® ) for 3 weeks prior to the study. Visible indicators of stress were observed at loading and at mid-flight and corresponded with an increase ( P  travel did not affect search performance ( P  > 0·05). We found that α- and β-diversity measures of faecal microbiota were not affected ( P  > 0·05). Our data suggest that although helicopter travel may cause physiological changes that have been associated with stress in working dogs, it does not make an impact on their search performance or the stability of faecal microbiota.

  9. Comparison of ESR1 Mutations in Tumor Tissue and Matched Plasma Samples from Metastatic Breast Cancer Patients

    Directory of Open Access Journals (Sweden)

    Takashi Takeshita

    2017-10-01

    Full Text Available BACKGROUND: ESR1 mutation in circulating cell-free DNA (cfDNA is emerging as a noninvasive biomarker of acquired resistance to endocrine therapy, but there is a paucity of data comparing the status of ESR1 gene in cfDNA with that in its corresponding tumor tissue. The objective of this study is to validate the degree of concordance of ESR1 mutations between plasma and tumor tissue. METHODS: ESR1 ligand-binding domain mutations Y537S, Y537N, Y537C, and D538G were analyzed using droplet digital PCR in 35 patients with metastatic breast cancer (MBC (35 tumor tissue samples and 67 plasma samples. RESULTS: Of the 35 paired samples, 26 (74.3% were concordant: one patient had detectable ESR1 mutations both plasma (ESR1 Y537S/Y537N and tumor tissue (ESR1 Y537S/Y537C, and 25 had WT ESR1 alleles in both. Nine (25.7% had discordance between the plasma and tissue results: five had mutations detected only in their tumor tissue (two Y537S, one Y537C, one D538G, and one Y537S/Y537N/D538G, and four had mutations detected only in their plasma (one Y537S, one Y537N, and two Y537S/Y537N/D538G. Furthermore, longitudinal plasma samples from 19 patients were used to assess changes in the presence of ESR1 mutations during treatment. Eleven patients had cfDNA ESR1 mutations over the course of treatment. A total of eight of 11 patients with MBC with cfDNA ESR1 mutations (72.7% had the polyclonal mutations. CONCLUSION: We have shown the independent distribution of ESR1 mutations between plasma and tumor tissue in 35 patients with MBC.

  10. Display of neutralizing epitopes of Canine parvovirus and a T-cell epitope of the fusion protein of Canine distemper virus on chimeric tymovirus-like particles and its use as a vaccine candidate both against Canine parvo and Canine distemper.

    Science.gov (United States)

    Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar

    2009-12-10

    Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.

  11. Molecular characterization of canine parvovirus and canine enteric coronavirus in diarrheic dogs on the island of St. Kitts: First report from the Caribbean region.

    Science.gov (United States)

    Navarro, Ryan; Nair, Rajeev; Peda, Andrea; Aung, Meiji Soe; Ashwinie, G S; Gallagher, Christa A; Malik, Yashpal S; Kobayashi, Nobumichi; Ghosh, Souvik

    2017-08-15

    Although canine parvovirus (CPV) and canine enteric coronavirus (CCoV) are important enteric pathogens of dogs and have been studied extensively in different parts of the world, there are no reports on these viruses from the Caribbean region. During 2015-2016, a total of 104 diarrheic fecal samples were collected from puppies and adult dogs, with or without hemorrhagic gastroenteritis, on the Caribbean island of St. Kitts (KNA). By PCR, 25 (24%, n=104) samples tested positive for CPV. Based on analysis of the complete deduced VP2 amino acid sequences, 20 of the KNA CPV strains were assigned to new CPV-2a (also designated as CPV-2a-297A). On the other hand, the VP2 genes of the remaining 5 strains were partially characterized, or could not be sequenced. New CPV-2a was the predominant CPV variant in St. Kitts, contrasting the molecular epidemiology of CPV variants reported in most studies from nearby North and South American countries. By RT-PCR, CCoVs were detected in 5 samples (4.8%, n=104). Based on analysis of partial M-protein gene, the KNA CCoV strains were assigned to CCoV-I genotype, and were closely related to CCoV-I strains from Brazil. To our knowledge, this is the first report on detection and genetic diversity of CPV and CCoV in dogs from the Caribbean region, and underscores the importance of similar studies in the other Caribbean islands. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Analysis of bioethanol samples through Inductively Coupled Plasma Mass Spectrometry with a total sample consumption system

    Science.gov (United States)

    Sánchez, Carlos; Lienemann, Charles-Philippe; Todolí, Jose-Luis

    2016-10-01

    Bioethanol real samples have been directly analyzed through ICP-MS by means of the so called High Temperature Torch Integrated Sample Introduction System (hTISIS). Because bioethanol samples may contain water, experiments have been carried out in order to determine the effect of ethanol concentration on the ICP-MS response. The ethanol content studied went from 0 to 50%, because higher alcohol concentrations led to carbon deposits on the ICP-MS interface. The spectrometer default spray chamber (double pass) equipped with a glass concentric pneumatic micronebulizer has been taken as the reference system. Two flow regimes have been evaluated: continuous sample aspiration at 25 μL min- 1 and 5 μL air-segmented sample injection. hTISIS temperature has been shown to be critical, in fact ICP-MS sensitivity increased with this variable up to 100-200 °C depending on the solution tested. Higher chamber temperatures led to either a drop in signal or a plateau. Compared with the reference system, the hTISIS improved the sensitivities by a factor included within the 4 to 8 range while average detection limits were 6 times lower for the latter device. Regarding the influence of the ethanol concentration on sensitivity, it has been observed that an increase in the temperature was not enough to eliminate the interferences. It was also necessary to modify the torch position with respect to the ICP-MS interface to overcome them. This fact was likely due to the different extent of ion plasma radial diffusion encountered as a function of the matrix when working at high chamber temperatures. When the torch was moved 1 mm plasma down axis, ethanolic and aqueous solutions provided statistically equal sensitivities. A preconcentration procedure has been applied in order to validate the methodology. It has been found that, under optimum conditions from the point of view of matrix effects, recoveries for spiked samples were close to 100%. Furthermore, analytical concentrations for real

  13. Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough).

    Science.gov (United States)

    Glickman, L T; Appel, M J

    1981-08-01

    Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.

  14. Current practices and research updates on diabetes mellitus in canine

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar

    2014-11-01

    Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.

  15. Citizen science: a new direction in canine behavior research.

    Science.gov (United States)

    Hecht, Julie; Spicer Rice, Eleanor

    2015-01-01

    Researchers increasingly rely on members of the public to contribute to scientific projects-from collecting or identifying, to analyzing and disseminating data. The "citizen science" model proves useful to many thematically distinctive fields, like ornithology, astronomy, and phenology. The recent formalization of citizen science projects addresses technical issues related to volunteer participation--like data quality--so that citizen scientists can make longstanding, meaningful contributions to scientific projects. Since the late 1990s, canine science research has relied with greater frequency on the participation of the general public, particularly dog owners. These researchers do not typically consider the methods and technical issues that those conducting citizen science projects embrace and continue to investigate. As more canine science studies rely on public input, an in-depth knowledge of the benefits and challenges of citizen science can help produce relevant, high-quality data while increasing the general public's understanding of canine behavior and cognition as well as the scientific process. We examine the benefits and challenges of current citizen science models in an effort to enhance canine citizen science project preparation, execution, and dissemination. This article is part of a Special Issue entitled: Canine Behavior. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Antiviral effect of lithium chloride on infection of cells by canine parvovirus.

    Science.gov (United States)

    Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun

    2015-11-01

    Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.

  17. Magnetic permeability based diagnostic test for the determination of the canine C-reactive protein concentration in undiluted whole blood

    International Nuclear Information System (INIS)

    Ibraimi, Filiz; Kriz, Kirstin; Merin, Henrik; Kriz, Dario

    2009-01-01

    We describe an one-step 11-min magnetic permeability based two-site immunoassay for C-reactive protein (CRP) utilizing polyclonal anti-canine CRP antibody conjugated dextran iron oxide nanoparticles (79 nm) as superparamagnetic labels and polyclonal anti-canine CRP conjugated silica microparticles (15 to 40 μm) as carriers. An inductance based magnetic permeability reader was used to detect the target analyte, CRP, in 10 μL whole blood samples, by measuring the magnetic permeability increase of the silica microparticle sediment due to immuno complex superparamagnetic nanoparticles. Measurements on standards showed a linear response between 0 and 17.5 mg/L CRP. Measurements performed on 16 whole blood samples from mixed breeds showed good correlation with a commercially available ELISA assay.

  18. Exposure of pampas fox (Pseudalopex gymnocercus and crab-eating fox (Cerdocyon thous from the Southern region of Brazil to Canine distemper virus (CDV, Canine parvovirus (CPV and Canine coronavirus (CCoV

    Directory of Open Access Journals (Sweden)

    Silvia de Oliveira Hübner

    2010-06-01

    Full Text Available The exposure of 13 Brazilian free-ranging nondomestic canids (five pampas fox - Pseudalopex gymnocercus and eight crab-eating fox -Cerdocyon thous from Southern region of Brazil, to Canine distemper virus (CDV, canine parvovirus (CPV and Canine coronavirus (CCoV was investigated. Antibodies against CDV were detected in 38.5% (5/13 of the samples. There were anti-CDV antibodies in 60% (3/5 of P. gymnocercus and in 25% (2/8 of C. thous. The frequency was higher among the adults and males. Eleven canids (84.6% presented antibodies against CPV, 80% (4/5 were from P. gymnocercus and 87.5% (7/8 were from C. thous. There was no difference in positivity rate against CPV between gender and age. Antibodies against CCoV were detected in 38.5% (5/13 of the samples, with 60% (3/5 of positivity in P. gymnocercus and 25% (2/8 in C. thous. The frequency of antibodies against CCoV was higher among the adults and males. The study showed that these canids were exposed to CDV, CPV and CCoV.Foi investigada a ocorrência de exposição em 13 canídeos não domésticos de vida livre (cinco graxains-do-campo - Pseudalopex gymnocercus e oito graxains-do-mato - Cerdocyon thous da região sul do Brasil ao vírus da cinomose canina (CDV, parvovírus canino (CPV e coronavírus canino (CCoV. Anticorpos contra o CDV foram detectados em 38,5% (5/13 das amostras. Haviam anticorpos anti-CDV em 60% (3/5 dos P. gymnocercus e em 25% (2/8 dos C. thous. A freqüência foi maior entre machos e adultos. Para CPV, 11 canídeos (84,6% apresentaram anticorpos, 80% (4/5 eram da espécie P. gymnocercus e 87,5% (7/8 eram C. thous. Não houve diferença de positividade para o CPV entre sexos e idades. Anticorpos contra o CCoV foram detectados em 38,5% (5/13 das amostras, sendo 60% (3/5 de positividade entre os P. gymnocercus e 25% (2/8 entre os C. thous. A freqüência de anticorpos para CCoV foi maior entre os machos e adultos. O estudo revelou que estes canídeos foram expostos ao CDV, CPV

  19. Inductively coupled plasma mass-spectrometric determination of platinum in excretion products of client-owned pet dogs.

    Science.gov (United States)

    Janssens, T; Brouwers, E E M; de Vos, J P; de Vries, N; Schellens, J H M; Beijnen, J H

    2015-06-01

    Residues of antineoplastic drugs in canine excretion products may represent exposure risks to veterinary personnel, owners of pet dogs and other animal care-takers. The aim of this study was to measure the extent and duration of platinum (Pt) excretion in pet dogs treated with carboplatin. Samples were collected before and up to 21 days after administration of carboplatin. We used validated, ultra-sensitive, inductively coupled plasma-mass spectrometry assays to measure Pt in canine urine, faeces, saliva, sebum and cerumen. Results showed that urine is the major route of elimination of Pt in dogs. In addition, excretion occurs via faeces and saliva, with the highest amounts eliminated during the first 5 days. The amount of excreted Pt decreased over time but was still quantifiable at 21 days after administration of carboplatin. In conclusion, increased Pt levels were found in all measured excretion products up to 21 days after administration of carboplatin to pet dogs, with urine as the main route of excretion. These findings may be used to further adapt current veterinary guidelines on safe handling of antineoplastic drugs and treated animals. © 2013 Blackwell Publishing Ltd.

  20. Ultrasonographic evaluation of the canine shoulder.

    Science.gov (United States)

    Long, C D; Nyland, T G

    1999-01-01

    The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.

  1. The Comparative Diagnostic Features of Canine and Human Lymphoma

    Directory of Open Access Journals (Sweden)

    Davis M. Seelig

    2016-06-01

    Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

  2. The Comparative Diagnostic Features of Canine and Human Lymphoma.

    Science.gov (United States)

    Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A

    2016-06-01

    The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

  3. Porous Silicon Antibody Microarrays for Quantitative Analysis: Measurement of Free and Total PSA in Clinical Plasma Samples

    Science.gov (United States)

    Tojo, Axel; Malm, Johan; Marko-Varga, György; Lilja, Hans; Laurell, Thomas

    2014-01-01

    The antibody microarrays have become widespread, but their use for quantitative analyses in clinical samples has not yet been established. We investigated an immunoassay based on nanoporous silicon antibody microarrays for quantification of total prostate-specific-antigen (PSA) in 80 clinical plasma samples, and provide quantitative data from a duplex microarray assay that simultaneously quantifies free and total PSA in plasma. To further develop the assay the porous silicon chips was placed into a standard 96-well microtiter plate for higher throughput analysis. The samples analyzed by this quantitative microarray were 80 plasma samples obtained from men undergoing clinical PSA testing (dynamic range: 0.14-44ng/ml, LOD: 0.14ng/ml). The second dataset, measuring free PSA (dynamic range: 0.40-74.9ng/ml, LOD: 0.47ng/ml) and total PSA (dynamic range: 0.87-295ng/ml, LOD: 0.76ng/ml), was also obtained from the clinical routine. The reference for the quantification was a commercially available assay, the ProStatus PSA Free/Total DELFIA. In an analysis of 80 plasma samples the microarray platform performs well across the range of total PSA levels. This assay might have the potential to substitute for the large-scale microtiter plate format in diagnostic applications. The duplex assay paves the way for a future quantitative multiplex assay, which analyses several prostate cancer biomarkers simultaneously. PMID:22921878

  4. Immunohistochemical detection of estrogen receptors in canine mammary tumors

    Directory of Open Access Journals (Sweden)

    Elena Atanaskova Petrov

    2016-03-01

    Full Text Available Mammary tumors are among the most common neoplasms in intact female dogs.They have a complex morphology, usually affecting middle age and older bitches. Almost 50% of the mammary tumors in dogs are malignant neoplasms. Prognosis is based on several factors: stage, age, tumor size, metastasis, histopathology, ovariectomy status and hormone-receptor activity. Immunohistochemical (IHC measurement has become increasingly an important diagnostic and prognostic parameter, with the development of monoclonal antibodies against nuclear estrogen and progestin receptors. The aim of this study was to detect the presence of ER receptors in malignant canine mammary tumors and to identify their association with the clinical course of the tumor. Mammary tumor samples have been obtained by mastectomy from dogs presented at our clinic. Detailed clinical examination, CBC and basic serum biochemical profile were performed in all patients. Surgery was the only treatment. Histopathological examination and immunohistochemical detection of estrogen α receptors (ERα was performed on 8 formalin-fixed, paraffin-embedded tissue samples, using the PT LINK immunoperoxidase technique. Histopathological examination of the mammary tumor samples (n=11 revealed tubular adenocarcinoma (n=6,54.5% and ductal adenocarcinoma (n=3, 27.3%, one patient with benign adenoma and one with mastitis. Patients with positive ER tumors are alive, without remission, while 3 of the patients that were ER negative died due to lung metastases. According to our results, it can be concluded that the appearance and development of canine mammary tumors is highly connected with ovarian steroid hormones and that immunostaining of the tumors may be used as a good prognostic parameter in these patients.

  5. Genotoxicity studies in semiconductor industry. 1. In vitro mutagenicity and genotoxicity studies of waste samples resulting from plasma etching

    Energy Technology Data Exchange (ETDEWEB)

    Braun, R.; Huettner, E.M.; Merten, H.; Raabe, F. (Institute of Plant Genetics and Crop Plant Research, Gatersleben (Germany))

    1993-07-01

    Solid waste samples taken from the etching reactor, the turbo pump, and the waste air system of a plasma etching technology line in semiconductor production were studied as to their genotoxic properties in a bacterial repair test, in the Ames/Salmonella microsome assay, in the SOS chromotest, in primary mouse hepatocytes, and in Chinese hamster V79 cell cultures. All three waste samples were found to be active by inducing of unscheduled DNA-synthesis in mouse hepatocytes in vitro. In the bacterial rec-type repair test with Proteus mirabilis, waste samples taken from the turbo pump and the vacuum pipe system were not genotoxic. The waste sample taken from the chlorine-mediated plasma reactor was clearly positive in the bacterial repair assay and in the SOS chromotest with Escherichia coli. Mutagenic activity was demonstrated for all samples in the presence and absence of S9 mix made from mouse liver homogenate. Again, highest mutagenic activity was recorded for the waste sample taken from the plasma reactor, while samples collected from the turbo pump and from the waste air system before dilution and liberation of the air were less mutagenic. For all samples chromosomal damage in V79 cells was not detected, indicating absence of clastogenic activity in vitro. Altogether, these results indicate generation of genotoxic and mutagenic products as a consequence of chlorine-mediated plasma etching in the microelectronics industry and the presence of genotoxins even in places distant from the plasma reactor. Occupational exposure can be expected both from the precipitated wastes and from chemicals reaching the environment with the air stream.

  6. Fatal Canine Intoxications Linked to the Presence of Saxitoxins in Stranded Marine Organisms Following Winter Storm Activity

    Directory of Open Access Journals (Sweden)

    Andrew D. Turner

    2018-02-01

    Full Text Available At the start of 2018, multiple incidents of dog illnesses were reported following consumption of marine species washed up onto the beaches of eastern England after winter storms. Over a two-week period, nine confirmed illnesses including two canine deaths were recorded. Symptoms in the affected dogs included sickness, loss of motor control, and muscle paralysis. Samples of flatfish, starfish, and crab from the beaches in the affected areas were analysed for a suite of naturally occurring marine neurotoxins of dinoflagellate origin. Toxins causing paralytic shellfish poisoning (PSP were detected and quantified using two independent chemical testing methods in samples of all three marine types, with concentrations over 14,000 µg saxitoxin (STX eq/kg found in one starfish sample. Further evidence for PSP intoxication of the dogs was obtained with the positive identification of PSP toxins in a vomited crab sample from one deceased dog and in gastrointestinal samples collected post mortem from a second affected dog. Together, this is the first report providing evidence of starfish being implicated in a PSP intoxication case and the first report of PSP in canines.

  7. Establishment of sexual dimorphism in north indian population by odontometric study of permanent maxillary canine teeth

    Directory of Open Access Journals (Sweden)

    Shalini Gupta

    2014-01-01

    Full Text Available Aim: To investigate whether sexual dimorphism can be established by odontometric study of permanent maxillary canine teeth as well as inter-canine width in north Indian population. Study Design: The study was carried out at department of oral and maxillofacial pathology, King George′s Medical University, Lucknow, India on students and patients reporting at OPD. Out of total 180 subjects examined 90 subjects were female and 90 were male. Impressions of the upper arch were made using alginate and casts poured in dental stone. The mesiodistal diameter (MD of the crown of permanent maxillary canine both on right and left sides and inter-canine width were measured. From these measurements, maxillary canine index was calculated. The percentage of sexual dimorphism (SD was assessed for all the parameters. Results: In the present study, the MD of maxillary canine for both right (P = 0.001 and left side (P = 0.005 was significantly higher among male subjects than females, Similar observation was found for inter-canine width too (P = 0.0001. However, the maxillary canine index for right and left was almost similar (P > 0.05 for both male and female subjects. The SD in right and left MDs of maxillary canine was 4.2% and 3.6% respectively. For, inter-canine width it was maximum (13.7%. However, SD in right and left canine index showed negative values (−2.1% and -0.9% respectively. Conclusion: There was SD in MD and inter-canine width of permanent maxillary canine teeth. SD was more on right permanent maxillary canine teeth than left permanent maxillary canine.

  8. [Nonsurgical endodontic treatment of an invaginated canine].

    Science.gov (United States)

    Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P

    1989-01-01

    We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.

  9. Canine babesiosis: from molecular taxonomy to control

    Directory of Open Access Journals (Sweden)

    Irwin Peter J

    2009-03-01

    Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

  10. Genetic characterization of canine influenza A virus (H3N2) in Thailand.

    Science.gov (United States)

    Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn

    2014-02-01

    In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.

  11. Evaluation of microRNA stability in plasma and serum from healthy dogs

    DEFF Research Database (Denmark)

    Enelund, Lars; Nielsen, Lise Nikolic; Cirera, Susanna

    2017-01-01

    . METHODS: The levels of four microRNAs (cfa-let-7a, cfa-miR-16, cfa-miR-23a and cfa-miR-26a) known to be stably expressed from other canine studies, have been measured by real-time quantitative PCR. RESULTS: MicroRNA levels were found sufficiently stable for gene profiling in serum- and plasma stored...

  12. Plasma interaction with tungsten samples in the COMPASS tokamak in ohmic ELMy H-modes

    International Nuclear Information System (INIS)

    Dimitrova, M; Weinzettl, V; Matejicek, J; Dejarnac, R; Stöckel, J; Havlicek, J; Panek, R; Popov, Tsv; Marinov, S; Costea, S

    2016-01-01

    This paper reports experimental results on plasma interaction with tungsten samples with or without pre-grown He fuzz. Under the experimental conditions, arcing was observed on the fuzzy tungsten samples, resulting in localized melting of the fuzz structure that did not extend into the bulk. The parallel power flux densities were obtained from the data measured by Langmuir probes embedded in the divertor tiles on the COMPASS tokamak. Measurements of the current-voltage probe characteristics were performed during ohmic ELMy H-modes reached in deuterium plasmas at a toroidal magnetic field B T = 1.15 T, plasma current I p = 300 kA and line-averaged electron density n e = 5×10 19 m -3 . The data obtained between the ELMs were processed by the recently published first-derivative probe technique for precise determination of the plasma potential and the electron energy distribution function (EEDF). The spatial profile of the EEDF shows that at the high-field side it is Maxwellian with a temperature of 5 -- 10 eV. The electron temperatures and the ion-saturation current density obtained were used to evaluate the radial distribution of the parallel power flux density as being in the order of 0.05 -- 7 MW/m 2 . (paper)

  13. Glucosamine and chondroitin use in canines for osteoarthritis: A ...

    African Journals Online (AJOL)

    Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...

  14. Controversial results of therapy with mesenchymal stem cells in the acute phase of canine distemper disease.

    Science.gov (United States)

    Pinheiro, A O; Cardoso, M T; Vidane, A S; Casals, J B; Passarelli, D; Alencar, A L F; Sousa, R L M; Fantinato-Neto, P; Oliveira, V C; Lara, V M; Ambrósio, C E

    2016-05-23

    Distemper disease is an infectious disease reported in several species of domestic and wild carnivores. The high mortality rate of animals infected with canine distemper virus (CDV) treated with currently available therapies has driven the study of new efficacious treatments. Mesenchymal stem cell (MSC)-based therapy is a promising therapeutic option for many degenerative, hereditary, and inflammatory diseases. Therefore, the aim of this study was to characterize stem cells derived from the canine fetal olfactory epithelium and to assess the systemic response of animals infected with CDV to symptomatic therapy and treatment with MSCs. Eight domestic mongrel dogs (N = 8) were divided into two groups: support group (SG) (N = 5) and support group + cell therapy (SGCT) (N = 3), which were monitored over 15 days. Blood samples were collected on days 0, 6, 9, 12, and 15 to assess blood count and serum biochemistry (urea, creatinine, alanine transferase, alkaline phosphatase, gamma-glutamyl transferase, total protein, albumin, and globulin), and urine samples were obtained on days 0 and 15 for urinary evaluation (urine I). The results showed a high mortality rate (SG = 4 and SGCT = 2), providing inadequate data on the clinical course of CDV infection. MSC therapy resulted in no significant improvement when administered during the acute phase of canine distemper disease, and a prevalence of animals with high mortality rate was found in both groups due to the severity of symptoms.

  15. Canine neosporosis: perspectives on pathogenesis and management

    Directory of Open Access Journals (Sweden)

    Silva RC

    2016-04-01

    Full Text Available Rodrigo C Silva,1 Gustavo P Machado2 1Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Starkville, MS, USA; 2Department of Internal Medicine and Surgery of Small Animals, Dr Munhoz Veterinary Hospital, Itápolis, Brazil Abstract: Canine neosporosis is a worldwide disease caused by the obligate intracellular parasite protozoan Neospora caninum, manifesting mainly neurological symptoms. N. caninum has a heteroxenous life cycle and affects a wide range of warm-blooded animals. The domestic and wild canids are the definitive host of the parasite. They shed oocysts after ingestion of tissue cysts from infected intermediate hosts (ovine, equine, bovine, canine, and many other species, containing bradyzoites, or oocyst-contaminated water and food. The presence of dogs in farms is considered a risk factor for production animals. A wide range of diagnostic methods are currently available, but the most used is serology, ie, indirect fluorescent antibody test specific to the antibody detection in blood serum samples. No vaccine is available, but control strategies should be focused on the vertical and horizontal transmission of the parasite, ie, avoid feeding dogs with raw or undercooked meat, and taking care with water for human and animal consumption. No medicines to control the transplacental transmission are available yet. Keywords: neosporosis, Neospora caninum, pathogenesis, management, dogs

  16. A case of unusual root morphology: Maxillary canine with two roots

    Directory of Open Access Journals (Sweden)

    Nagesh Bolla

    2009-01-01

    Full Text Available The case describes a 3 months follow-up of the treatment of a maxillary canine with two roots. Clinical examination revealed a maxillary canine with a large carious lesion and an exaggerated response to cold thermal tests. Radiographic examination revealed a large distal carious lesion that appeared to invade the pulp chamber. The radiograph also revealed what appeared to be an extra root in this permanent maxillary canine.

  17. Prevalence rate and dentoskeletal features associated with buccally displaced maxillary canines.

    Science.gov (United States)

    Mucedero, Manuela; Ricchiuti, Maria Rosaria; Cozza, Paola; Baccetti, Tiziano

    2013-06-01

    The aim of the study was to analyse the prevalence and distribution of buccally displaced canines (BDCs) in subjects scheduled for orthodontic treatment and to investigate the association between BDC and sagittal, vertical, and transverse dentoskeletal relationships. A study sample of 1852 subjects was examined, and it was divided randomly into two groups. A first group of 252 subjects served as control group: the 'reference' prevalence rates for the examined parameters were calculated in this group. The remaining 1600 subjects comprised the sample from which the experimental BDC group was derived. Presence of unilateral or bilateral maxillary BDC, ANB, and SN GOGn angles for sagittal and vertical skeletal relationships, intercanine and intermolar distances, and tooth crowding at the maxillary arch were recorded for each subject. The statistical significance of differences between the BDC and the control groups in transverse relations and tooth crowding at the upper arch was tested by means of independent sample t-tests. Chi-square tests were performed to compare the prevalence rates of BDC and also sagittal and vertical skeletal features in the two groups. The prevalence rate of BDC was 3.06 per cent with a male-to-female ratio of 1:1. BDC subjects exhibited a significant association with hyperdivergent skeletal relationships (38.8%), reduced maxillary intercanine width, and crowding in the upper arch. The presence of specific dentoskeletal characteristics can be considered as a risk indicator for developing a buccal displacement of upper permanent canines.

  18. Purification and partial characterization of canine S100A12.

    Science.gov (United States)

    Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M

    2010-12-01

    Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the

  19. Impacted maxillary canines and root resorption of adjacent teeth: A retrospective observational study.

    Science.gov (United States)

    Guarnieri, R; Cavallini, C; Vernucci, R; Vichi, M; Leonardi, R; Barbato, E

    2016-11-01

    The prevalence of impacted maxillary canine is reported to be between 1% and 3%. The lack of monitoring and the delay in the treatment of the impacted canine can cause different complications such as: displacement of adjacent teeth, loss of vitality of neighbouring teeth, shortening of the dental arch, follicular cysts, canine ankylosis, recurrent infections, recurrent pain, internal resorption of the canine and the adjacent teeth, external resorption of the canine and the adjacent teeth, combination of these factors. An appropriate diagnosis, accurate predictive analysis and early intervention are likely to prevent such undesirable effects. The objective is to evaluate, by means of a retrospective observational study, the possibility of carrying out a predictive analysis of root resorption adjacent to the impacted canines by means of orthopantomographs, so as to limit the prescription of additional 3D radiography. 120 subjects with unilateral or bilateral maxillary impacted canine were examined and 50 patients with 69 impacted maxillary canine (22 male, 28 female; mean age: 11.7 years) satisfied the inclusion criteria of the study. These patients were subjected to a basic clinical and radiographic investigation (orthopantomographs and computerized tomography). All panoramic films were viewed under standardized conditions for the evaluation of two main variables: maxillary canine angulations (a, b, g angles) and the overlapping between the impacted teeth and the lateral incisor (Analysis of Lindauer). Binary logistic regression was used to estimate the likelihood of resorbed lateral incisors depending on sector location and angle measurements. Results indicated that b angle has the greatest influence on the prediction of root resorption (predictive value of b angle = 76%). If β angle <18° and Lindauer = I, the probability of resorption is 0.06. Evaluation of b angle and superimposition lateral incisor/impacted canine analysed on orthopantomographs could be one of

  20. Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.

    Science.gov (United States)

    von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H

    2008-05-01

    Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.

  1. Orthodontic Traction of Impacted Canine Using Cantilever

    OpenAIRE

    Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé

    2016-01-01

    The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...

  2. Comparison of the dental anomalies found in maxillary canine-first premolar transposition cases with those in palatally displaced canine cases.

    Science.gov (United States)

    Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon

    2016-02-01

    To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  3. Oncolytic virotherapy in veterinary medicine: current status and future prospects for canine patients

    Directory of Open Access Journals (Sweden)

    Patil Sandeep S

    2012-01-01

    Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.

  4. Canine and human gastrointestinal stromal tumors display similar mutations in c-KIT exon 11

    International Nuclear Information System (INIS)

    Gregory-Bryson, Emmalena; Bartlett, Elizabeth; Kiupel, Matti; Hayes, Schantel; Yuzbasiyan-Gurkan, Vilma

    2010-01-01

    Gastrointestinal stromal tumors (GISTs) are common mesenchymal neoplasms in the gastrointestinal tract of humans and dogs. Little is known about the pathogenesis of these tumors. This study evaluated the role of c-KIT in canine GISTs; specifically, we investigated activating mutations in exons 8, 9, 11, 13, and 17 of c-KIT and exons 12, 14, and 18 of platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), all of which have been implicated in human GISTs. Seventeen canine GISTs all confirmed to be positive for KIT immunostaining were studied. Exons 8, 9, 11, 13 and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA, were amplified from DNA isolated from formalin-fixed paraffin-embedded samples. Of these seventeen cases, six amplicons of exon 11 of c-KIT showed aberrant bands on gel electrophoresis. Sequencing of these amplicons revealed heterozygous in-frame deletions in six cases. The mutations include two different but overlapping six base pair deletions. Exons 8, 9, 13, and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA had no abnormalities detected by electrophoresis and sequencing did not reveal any mutations, other than synonymous single nucleotide polymorphisms (SNPs) found in exon 11 of c-KIT and exons 12 and 14 of PDGFRA. The deletion mutations detected in canine GISTs are similar to those previously found in the juxtamembrane domain of c-KIT in canine cutaneous mast cell tumors in our laboratory as well as to those reported in human GISTs. Interestingly, none of the other c-KIT or PDGFRA exons showed any abnormalities in our cases. This finding underlines the critical importance of c-KIT in the pathophysiology of canine GISTs. The expression of KIT and the identification of these activating mutations in c-KIT implicate KIT in the pathogenesis of these tumors. Our results indicate that mutations in c-KIT may be of prognostic significance and that targeting KIT may be a rational approach to treatment of these malignant tumors. This study further

  5. Survey of Borreliae in ticks, canines, and white-tailed deer from Arkansas, U.S.A.

    Directory of Open Access Journals (Sweden)

    Fryxell Rebecca T

    2012-07-01

    Full Text Available Abstract Background In the Eastern and Upper Midwestern regions of North America, Ixodes scapularis (L. is the most abundant tick species encountered by humans and the primary vector of B. burgdorferi, whereas in the southeastern region Amblyomma americanum (Say is the most abundant tick species encountered by humans but cannot transmit B. burgdorferi. Surveys of Borreliae in ticks have been conducted in the southeastern United States and often these surveys identify B. lonestari as the primary Borrelia species, surveys have not included Arkansas ticks, canines, or white-tailed deer and B. lonestari is not considered pathogenic. The objective of this study was to identify Borrelia species within Arkansas by screening ticks (n = 2123, canines (n = 173, and white-tailed deer (n = 228 to determine the identity and locations of Borreliae endemic to Arkansas using PCR amplification of the flagellin (flaB gene. Methods Field collected ticks from canines and from hunter-killed white-tailed were identified to species and life stage. After which, ticks and their hosts were screened for the presence of Borrelia using PCR to amplify the flaB gene. A subset of the positive samples was confirmed with bidirectional sequencing. Results In total 53 (21.2% white-tailed deer, ten (6% canines, and 583 (27.5% Ixodid ticks (252 Ixodes scapularis, 161 A. americanum, 88 Rhipicephalus sanguineus, 50 Amblyomma maculatum, 19 Dermacentor variabilis, and 13 unidentified Amblyomma species produced a Borrelia flaB amplicon. Of the positive ticks, 324 (22.7% were collected from canines (151 A. americanum, 78 R. sanguineus, 43 I. scapularis, 26 A. maculatum, 18 D. variabilis, and 8 Amblyomma species and 259 (37.2% were collected from white-tailed deer (209 I. scapularis, 24 A. maculatum, 10 A. americanum, 10 R. sanguineus, 1 D. variabilis, and 5 Amblyomma species. None of the larvae were PCR positive. A majority of the flaB amplicons were homologous with B

  6. Vertical periodontal ligament distraction--a new method for aligning ankylosed and displaced canines.

    Science.gov (United States)

    Wilmes, Benedict; Drescher, Dieter

    2009-05-01

    In the course of a clinical pilot study we tested the vertical periodontal ligament (V-PDL) distraction as a means of aligning ankylosed upper canines. The objective of this study was to analyze the appropriateness und effectiveness of this method. The ankylosed upper canines of five female patients aged between 16 und 19 years were surgically exposed, luxated, and after a latency period of 5 to 7 days, distracted at a rate of 0.5 mm per day. The installed distractors were borne by the periodontal-mucosa, the periodontal-mucosa and the bone, or by the bone exclusively. We evaluated the distraction distance and time and degree of hard and soft tissue generation present in the region surrounding the distracted teeth. All canines were aligned after a mean distraction period of 43.2 days (+/- 3.6 days). The mean distraction distance was 10.8 mm. Three canines had defects at the cemento-enamel junction, and one canine had to be extracted due to a large defect at the root. Vertical PDL distraction is a minimally-invasive therapy to align ankylosed impacted canines. Even if the long-term prognosis of distracted canines with defects is uncertain, the patient benefits from the vertical PDL distraction because both hard and soft tissues are generated in the vicinity of the distracted canine.

  7. Liquid sampling-atmospheric pressure glow discharge as a secondary excitation source: Assessment of plasma characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Manard, Benjamin T. [Department of Chemistry, Clemson University, Clemson, SC 29634 (United States); Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Gonzalez, Jhanis J. [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Sarkar, Arnab [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Fuel Chemistry Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Dong, Meirong; Chirinos, Jose; Mao, Xianglei; Russo, Richard E. [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Marcus, R. Kenneth [Department of Chemistry, Clemson University, Clemson, SC 29634 (United States)

    2014-04-01

    The liquid sampling-atmospheric pressure glow discharge (LS-APGD) has been assessed as a secondary excitation source with a parametric evaluation regarding carrier gas flow rate, applied current, and electrode distance. With this parametric evaluation, plasma optical emission was monitored in order to obtain a fundamental understanding with regards to rotational temperature (T{sub rot}), excitation temperature (T{sub exc}), electron number density (n{sub e}), and plasma robustness. Incentive for these studies is not only for a greater overall fundamental knowledge of the APGD, but also in instrumenting a secondary excitation/ionization source following laser ablation (LA). Rotational temperatures were determined through experimentally fitting of the N{sub 2} and OH molecular emission bands while atomic excitation temperatures were calculated using a Boltzmann distribution of He and Mg atomic lines. The rotational and excitation temperatures were determined to be ∼ 1000 K and ∼ 2700 K respectively. Electron number density was calculated to be on the order of ∼ 3 × 10{sup 15} cm{sup −3} utilizing Stark broadening effects of the Hα line of the Balmer series and a He I transition. In addition, those diagnostics were performed introducing magnesium (by solution feed and laser ablation) into the plasma in order to determine any perturbation under heavy matrix sampling. The so-called plasma robustness factor, derived by monitoring Mg II/Mg I emission ratios, is also employed as a reflection of potential perturbations in microplasma energetics across the various operation conditions and sample loadings. While truly a miniaturized source (< 1 mm{sup 3} volume), the LS-APGD is shown to be quite robust with plasma characteristics and temperatures being unaffected upon introduction of metal species, whether by liquid or laser ablation sample introduction. - Highlights: • Liquid sampling-atmospheric pressure glow discharge (LS-APGD) • LS-APGD as a secondary

  8. Early canine plaque biofilms: characterization of key bacterial interactions involved in initial colonization of enamel.

    Directory of Open Access Journals (Sweden)

    Lucy J Holcombe

    Full Text Available Periodontal disease (PD is a significant problem in dogs affecting between 44% and 63.6% of the population. The main etiological agent for PD is plaque, a microbial biofilm that colonizes teeth and causes inflammation of the gingiva. Understanding how this biofilm initiates on the tooth surface is of central importance in developing interventions against PD. Although the stages of plaque development on human teeth have been well characterized little is known about how canine plaque develops. Recent studies of the canine oral microbiome have revealed distinct differences between the canine and human oral environments and the bacterial communities they support, particularly with respect to healthy plaque. These differences mean knowledge about the nature of plaque formation in humans may not be directly translatable to dogs. The aim of this study was to identify the bacterial species important in the early stages of canine plaque formation in vivo and then use isolates of these species in a laboratory biofilm model to develop an understanding of the sequential processes which take place during the initial colonization of enamel. Supra-gingival plaque samples were collected from 12 dogs at 24 and 48 hour time points following a full mouth descale and polish. Pyrosequencing of the 16S rDNA identified 134 operational taxonomic units after statistical analysis. The species with the highest relative abundance were Bergeyella zoohelcum, Neisseria shayeganii and a Moraxella species. Streptococcal species, which tend to dominate early human plaque biofilms, had very low relative abundance. In vitro testing of biofilm formation identified five primary colonizer species, three of which belonged to the genus Neisseria. Using these pioneer bacteria as a starting point, viable two and three species communities were developed. Combining in vivo and in vitro data has led us to construct novel models of how the early canine plaque biofilm develops.

  9. Targeting HSP70 and GRP78 in canine osteosarcoma cells in combination with doxorubicin chemotherapy.

    Science.gov (United States)

    Asling, Jonathan; Morrison, Jodi; Mutsaers, Anthony J

    2016-11-01

    Heat shock proteins (HSPs) are molecular chaperones subdivided into several families based on their molecular weight. Due to their cytoprotective roles, these proteins may help protect cancer cells against chemotherapy-induced cell death. Investigation into the biologic activity of HSPs in a variety of cancers including primary bone tumors, such as osteosarcoma (OSA), is of great interest. Both human and canine OSA tumor samples have aberrant production of HSP70. This study assessed the response of canine OSA cells to inhibition of HSP70 and GRP78 by the ATP-mimetic VER-155008 and whether this treatment strategy could sensitize cells to doxorubicin chemotherapy. Single-agent VER-155008 treatment decreased cellular viability and clonogenic survival and increased apoptosis in canine OSA cell lines. However, combination schedules with doxorubicin after pretreatment with VER-155008 did not improve inhibition of cellular viability, apoptosis, or clonogenic survival. Treatment with VER-155008 prior to chemotherapy resulted in an upregulation of target proteins HSP70 and GRP78 in addition to the co-chaperone proteins Herp, C/EBP homologous transcription protein (CHOP), and BAG-1. The increased GRP78 was more cytoplasmic in location compared to untreated cells. Single-agent treatment also revealed a dose-dependent reduction in activated and total Akt. Based on these results, targeting GRP78 and HSP70 may have biologic activity in canine osteosarcoma. Further studies are required to determine if and how this strategy may impact the response of osteosarcoma cells to chemotherapy.

  10. Measurement of GFR by Tc-99m DTPA: Comparison of 5 plasma sample and 2 plasma sample methods in North Indian population

    International Nuclear Information System (INIS)

    Mittal, B.R.; Bhattacharya, A.; Singh, B.; Jha, V.; Sarika, Kumar R.

    2007-01-01

    Assessment of Glomerular filtration rate (GFR) has significant impact on both prognosis and treatment of patients with renal disease. In this study we compared the two-plasma-sample method (G2S) using a MS excel spreadsheet based program, with a manual five-plasmasample method (GS) used to measure GFR by determining Tc-99m-diethylenetriamine penta-acetic acid (Tc-99m DTPA) clearance in patients with chronic kidney disease (CKD) and healthy renal donors. The study was conducted in 148 subjects (64 men and 84 women; age range 14 to 70 yr); 59 patients of CKD and 89 prospective healthy kidney donors. Tc-99m DTPA (74-100 MBq) was injected intravenously and thereafter blood samples were obtained at 60, 90, 120, 150 and 180 min via the patent venflon. Radioactivity in the injection syringe and plasma was measured by means of a multi-well gamma counter. The correlation coefficient between the 2 methods was 0.9453, with a slope of 0.90 and an intercept of 14.72 mL/min. Bland Altman plot of disagreement showed that G2S underestimated the GFR values by 9.0 ml/min, 11.3 ml/min and 6.9 ml/min, in the entire study, CKD and healthy donor groups respectively. Our results indicate that in spite of good correlation between GS and G2S method, the G2S method constantly underestimated GFR in our study population. However, regression equation may be applied to the GFR values estimated by G2S method to match the GFR determined by GS method. (author)

  11. Direct determination of trace rare earth elements in ancient porcelain samples with slurry sampling electrothermal vaporization inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Xiang Guoqiang; Jiang Zucheng; He Man; Hu Bin

    2005-01-01

    A method for the direct determination of trace rare earth elements in ancient porcelain samples by slurry sampling fluorinating electrothermal vaporization inductively coupled plasma mass spectrometry was developed with the use of polytetrafluoroethylene as fluorinating reagent. It was found that Si, as a main matrix element in ancient porcelain sample, could be mostly removed at the ashing temperature of 1200 deg. C without considerable losses of the analytes. However, the chemical composition of ancient porcelain sample is very complicated, which makes the influences resulting from other matrix elements not be ignored. Therefore, the matrix effect of ancient porcelain sample was also investigated, and it was found that the matrix effect is obvious when the matrix concentration was larger than 0.8 g l -1 . The study results of particle size effect indicated that when the sample particle size was less than 0.057 mm, the particle size effect is negligible. Under the optimized operation conditions, the detection limits for rare earth elements by fluorinating electrothermal vaporization inductively coupled plasma mass spectrometry were 0.7 ng g -1 (Eu)-33.3 ng g -1 (Nd) with the precisions of 4.1% (Yb)-10% (La) (c = 1 μg l -1 , n = 9). The proposed method was used to directly determine the trace rare earth elements in ancient porcelain samples produced in different dynasty (Sui, Ming and Qing), and the analytical results are satisfactory

  12. Design and Demonstration of a Material-Plasma Exposure Target Station for Neutron Irradiated Samples

    Energy Technology Data Exchange (ETDEWEB)

    Rapp, Juergen [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Aaron, A. M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Bell, Gary L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Burgess, Thomas W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ellis, Ronald James [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Giuliano, D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Howard, R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Kiggans, James O. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Lessard, Timothy L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ohriner, Evan Keith [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Perkins, Dale E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Varma, Venugopal Koikal [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2015-10-20

    -state heat fluxes of 5–20 MW/m2 and ion fluxes up to 1024 m-2s-1. Since PFCs will have to withstand neutron irradiation displacement damage up to 50 dpa, the target station design must accommodate radioactive specimens (materials to be irradiated in HFIR or at SNS) to enable investigations of the impact of neutron damage on materials. Therefore, the system will have to be able to install and extract irradiated specimens using equipment and methods to avoid sample modification, control contamination, and minimize worker dose. Included in the design considerations will be an assessment of all the steps between neutron irradiation and post-exposure materials examination/characterization, as well as an evaluation of the facility hazard categorization. In particular, the factors associated with the acquisition of radioactive specimens and their preparation, transportation, experimental configuration at the plasma-specimen interface, post-plasma-exposure sample handling, and specimen preparation will be evaluated. Neutronics calculations to determine the dose rates of the samples were carried out for a large number of potential plasma-facing materials.

  13. High plasma corticosterone levels persist during frequent automatic blood sampling in rats

    DEFF Research Database (Denmark)

    Abelson, Klas S P; Adem, Bashir; Royo, Felix

    2005-01-01

    Corticosterone levels in blood may be used as a marker of stress in rodents, provided that the blood sampling procedure itself is non-stressful. Automated blood sampling equipment (Accusampler) allows blood sampling without any interference with the animal and might be useful as a tool for an on......-line measurement of stress markers in blood. However, the impact of the blood sampling itself on the corticosterone levels in blood is unknown. The present study was designed to evaluate whether the frequency of blood sampling influences the plasma corticosterone levels in male and female rats. During anaesthesia...... the importance of considering the frequency of blood withdrawal during automated blood sampling. This parameter may have an impact on the experimental results when using blood corticosterone levels as a stress marker, but also during any in vivo study where blood is collected, since high corticosterone levels...

  14. Genetics of Human and Canine Dilated Cardiomyopathy

    OpenAIRE

    Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland

    2015-01-01

    Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...

  15. Independent evaluation of a canine Echinococcosis Control Programme in Hobukesar County, Xinjiang, China.

    Science.gov (United States)

    van Kesteren, Freya; Qi, Xinwei; Tao, Jiang; Feng, Xiaohui; Mastin, Alexander; Craig, Philip S; Vuitton, Dominique A; Duan, Xinyu; Chu, Xiangdong; Zhu, Jinlong; Wen, Hao

    2015-05-01

    The Xinjiang Uyghur Autonomous Region in northwest China is one of the world's most important foci for cystic echinococcosis. Domestic dogs are the main source for human infection, and previous studies in Xinjiang have found a canine Echinococcus spp. coproELISA prevalence of between 36% and 41%. In 2010 the Chinese National Echinococcosis Control Programme was implemented in Xinjiang, and includes regular dosing of domestic dogs with praziquantel. Six communities in Hobukesar County, northwest Xinjiang were assessed in relation to the impact of this control programme through dog necropsies, dog Echinococcus spp. coproantigen surveys based on Lot Quality Assurance Sampling (LQAS) and dog owner questionnaires. We found that 42.1% of necropsied dogs were infected with Echinococcus granulosus, and coproELISA prevalences were between 15% and 70% in the communities. Although approximately half of all dog owners reported dosing their dogs within the 12 months prior to sampling, coproELISA prevalence remained high. Regular praziquantel dosing of owned dogs in remote and semi-nomadic communities such as those in Hobukesar County is logistically very difficult and additional measures should be considered to reduce canine echinococcosis. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  16. Analyses of metallic first mirror samples after long term plasma exposure in Tore Supra

    International Nuclear Information System (INIS)

    Lipa, M.; Schunke, B.; Gil, Ch.; Bucalossi, J.; Voitsenya, V.S.; Konovalov, V.; Vukolov, K.; Balden, M.; De Temmerman, G.; Oelhafen, P.; Litnovsky, A.; Wienhold, P.

    2006-01-01

    Metallic mirrors are foreseen in ITER diagnostic systems as optical elements directly viewing the plasma radiation. In the frame of an EFDA contract, metallic mirror samples have been exposed for long pulse plasma discharges in Tore Supra (TS) in order to investigate surface modifications caused by erosion and re-deposition processes. Three different materials have been selected: mono-crystalline molybdenum (mc-Mo), polycrystalline stainless steel (SS) and copper (Cu). The mc-Mo samples showed after TS exposure almost no surface roughness modifications and the lowest net-erosion. A slight reflectivity reduction, most pronounced in the near UV, is attributed to light absorption in a thin carbon deposit. Cu mirrors showed by far the highest surface roughness, erosion and diffusive reflectivity. Comparative laboratory glow discharge experiments with virgin reference samples and numerical simulations of erosion/deposition confirm the dominant contribution of conditioning procedures to erosion of mirrors exposed (without shutter protection) in Tore Supra

  17. Orthodontic treatment of a complete transposed impacted maxillary canine

    Directory of Open Access Journals (Sweden)

    Pi-Huei Liu

    2015-03-01

    Full Text Available Tooth transposition is a positional interchange of two adjacent teeth. Transposition most often occurs at maxillary canine. Moving transposed teeth to their normal positions is challenging because this requires bodily movement and translation of one tooth to pass another. This procedure may cause damage to the teeth or supporting structures. We report a case of complete transposition of maxillary canine and lateral incisor. Transposed teeth were successfully moved orthodontically to their normal positions. Multiple mechanics were meticulously applied to achieve complete correction of the tooth positions and to minimize root resorption and/or periodontal defects of canine and lateral incisors. Factors concerning treatment planning for transposed teeth are discussed.

  18. Prediction of two-sample 99mTc-diethylene triamine pentaacetic acid plasma clearance from single-sample method

    International Nuclear Information System (INIS)

    Zuo Li; Ma Ying-Chun; Wang Mei; Zhang Chun-Li; Wang Rong-Fu; Wang Hai-Yan

    2005-01-01

    The objective of this study was to develop an equation to predict dual plasma sample method (DPSM) 99m Tc-diethylene triamine pentaacetic acid ( 99m Tc-DTPA) plasma clearance from single plasma sample method (SPSM), and to clarify the condition in which DPSM can be substituted by SPSM in measurement of glomerular filtration rate (GFR). Patients with chronic kidney disease (CKD) were selected. Watson modified Christensen and Groth equation was used to calculate 99m Tc-DTPA plasma clearance by SPSM (sGFR). The equation recommended by the Nephrourology Committee of the Society of Nuclear Medicine was used to calculate 99m Tc-DTPA plasma clearance by DPSM (tGFR) in each patient. The difference between sGFR and tGFR was expressed as percent of the average of these two methods, and tGFR was predicted from sGFR. Plasma creatinine was measured by the kinetic picrate method, and GFR estimated by abbreviated modification of diet in renal disease (MDRD) equation (aGFR) and Cockcroft-Gault equation (cGFR) were evaluated as criteria in selection of DPSM and SPSM. Three hundred and sixty-nine patients with CKD were selected (208 male and 161 female). The average age and body weight were 51.4±15.5 years and 67.2±12.5 kg, respectively. The causes of CKD were glomerular disease, renal arterial stenosis, chronic tubulointerstitial disease, and other causes or causes unknown. The average tGFR was 62.9±36.5 ml/min/1.73 m 2 , ranging from 1-180 ml/min/1.73 m 2 . sGFR was significantly correlated with tGFR (r=0.9194, p 2 ; in contrast, then tGFR was±30 ml/min/1.73 m 2 , the difference was constant (-1.1%, 95% confidence interval -18.3%, 16.1%), and tGFR could be predicted from sGFR using the equation: predicted tGFR (ml/min/1.73 m 2 )=7 4244+0.7318 x sGFR+0.0022 x sGFR 2 (n=299, r 2 =0.9428, p 2 , the diagnostic sensitivity of a cut off value of aGFR=45 ml/min/1.73 m 2 was 91.8%, and recommended as a criterion in the selection of DPSM and SPSM. When GFR ≥30 ml/min/1.73 m 2 , t

  19. Tooth fractures in canine clinical practice

    International Nuclear Information System (INIS)

    Capik, I.; Ledecky, V.; Sevcik, A.

    2001-01-01

    Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients

  20. Current state of knowledge: the canine gastrointestinal microbiome.

    Science.gov (United States)

    Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S

    2012-06-01

    Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.

  1. Increased expression of insulin-like growth factor-1 receptor is correlated with worse survival in canine appendicular osteosarcoma.

    Science.gov (United States)

    Maniscalco, Lorella; Iussich, Selina; Morello, Emanuela; Martano, Marina; Gattino, Francesca; Miretti, Silvia; Biolatti, Bartolomeo; Accornero, Paolo; Martignani, Eugenio; Sánchez-Céspedes, Raquel; Buracco, Paolo; De Maria, Raffaella

    2015-08-01

    Insulin-like growth factor 1 receptor (IGF-1R) is a cell membrane receptor widely expressed in tissues and involved in different cancers in humans. IGF-1R expression in human osteosarcoma has been associated with the development of tumour metastasis and with prognosis, and represents an attractive therapeutic target. The goal of this study was to investigate the expression of IGF-1R in canine osteosarcoma tissues and cell lines and assess its role and prognostic value. Samples from 34 dogs were examined by immunohistochemistry for IGF-1R expression. IGF-1R/AKT/MAPK signalling was evaluated by western blot and quantitative polymerase chain reaction in the cell lines. In addition, the in vitro inhibition of IGF-1R with pycropodophillin (PPP) was used to evaluate molecular and biological effects. Immunohistochemical data showed that IGF-1R was expressed in 71% of the analysed osteosarcoma samples and that dogs with higher levels of IGF-IR expression (47% of cases) had decreased survival (P canine osteosarcoma IGF-IR is activated by IGF-1 mostly in a paracrine or endocrine (rather than autocrine) manner, leading to activation of AKT/MAPK signalling. PPP caused p-IGF-1R dephosphorylation with partial blocking of p-MAPK and p-AKT, as well as apoptosis. It was concluded that IGF-1R is expressed and plays a role in canine osteosarcoma and that its expression is correlated with a poor prognosis. As in humans, IGF-1R may represent a good therapeutic target and a prognostic factor for canine osteosarcoma. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Molecular surveillance of traditional and emerging pathogens associated with canine infectious respiratory disease.

    Science.gov (United States)

    Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio

    2016-08-30

    A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Comparison of canine retraction using single and Siamese edgewise brackets: An in vivo study

    Directory of Open Access Journals (Sweden)

    Zeeshan Iqbal Bhat

    2013-01-01

    Full Text Available Objectives: The purpose of this study was to check the rate of canine retraction with bodily mechanics using two different pre-adjusted edgewise bracket Systems. Materials and Methods: A split mouth study with twenty patients who were randomly selected and allotted to a single operator. Duration of canine retraction, angulation of canine during its retraction, degree of Rotation, anchorage Loss, distance between canine and premolar at different time intervals were then evaluated, pre- (To, 3 months- (T1 and canine tip touches the second premolar- (T2. Descriptive statistics including mean values and standard deviations were calculated. Paired and unpaired t-test was performed to evaluate the differences between the groups. Results: Rotation and angulation of the canines did not show significant difference in both the systems. There was statistically significant difference (P<0.01 in anchorage loss between single wing and Siamese bracket being 2.65 ±1.41 mm and 1.31 ± 0.93 respectively. There was statistically significant intergroup difference (P<0.01 in canine movement i.e distance between canine and premolar was recorded as 4.72mm (15.06 ± 1.69 to 10.34 ± 1.68mm in single wing bracket and 6.25mm in Siamese (15.52 ± 1.41 to 9.27 ± 1.94. Conclusion: In cases where high anchorage is required and the rate of canine retraction is a concern, Siamese brackets pose a definite advantage over Single wing brackets.

  4. Validation of anti-FXR1 antibodies in the canine species and application to an immunohistochemical study of canine oral melanomas

    Directory of Open Access Journals (Sweden)

    Laura Nordio

    2017-05-01

    Full Text Available FXR1 (Fragile X mental retardation-related protein 1 is a cytoplasmic RNA binding protein, which genetic expression has been related to metastatic potential in human melanoma. The aims of the present study were: the validation of two commercially available clones of polyclonal anti-human FXR1 antibody in dogs; their application to investigate FXR1 expression in a group of canine oral melanomas. Anti-FXR1 antibody was not previously validated in the canine species. Two different commercially available polyclonal anti-FXR1 antibodies (respectively made in goat and in rabbit were used. FXR1 protein in canine serum was identified by western blot after SDS-PAGE, using human serum as control. FXR1 immunohistochemical expression was tested in a series of normal tissues, that are expected to express FXR1, and in 31 cases of oral melanomas. The final immunohistochemical protocol used heat-induced unmasking and overnight incubation. FXR1 protein bands in canine serum were detected by tested antibodies, in a more specific way by the rabbit antibody. FXR1 immunohistochemical staining was positive in all tested organs, with different levels of expression. FXR1 was also expressed in 31/31 tested melanomas, with variable intensity and percentage of positive cells (Figure 1. Equal results were achieved with the two antibodies in 8 cases of melanoma, whereas there were variable differences in 22, and one case stained only with goat antibody. The rabbit antibody gave less background staining. This study validated anti-FXR1 antibodies for use in the canine species. This protein was expressed in various normal tissues, as well as in the tested neoplasms. Significance of different level of expression is undergoing evaluation with further studies.

  5. Models of experimental saccular aneurysms of carotid arteries in canine

    International Nuclear Information System (INIS)

    Zhang Haixia; Cheng Yingsheng; Li Minghua

    2006-01-01

    Objective: To study the availability by making experimental saccular aneurysm models of carotid arteries in canine similar to human intracranial aneurysms. Methods: Twenty healthy canines with experimental saccular side-wall aneurysms of carotid arteries were created successfully by surgery. Results: Forty experimental saccular side-wall aneurysms of carotid arteries were created successfully with 36 aneurysms and parent arteries maintaining patency with each other and four spontaneously occluded confirmed by angiography. Model successful rate reached 90%. Conclusions: Experimental saccular side-wall aneurysms of carotid arteries in canines were one of best models created for simulating human intracranial aneurysms. (authors)

  6. Testosterone biotransformation by the isolated perfused canine pancreas

    International Nuclear Information System (INIS)

    Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G.

    1991-01-01

    There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis

  7. Testosterone biotransformation by the isolated perfused canine pancreas

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))

    1991-01-01

    There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.

  8. Alkaline phosphatase activity in gingival crevicular fluid during canine retraction.

    Science.gov (United States)

    Batra, P; Kharbanda, Op; Duggal, R; Singh, N; Parkash, H

    2006-02-01

    The aim of the study was to investigate alkaline phosphatase activity in the gingival crevicular fluid (GCF) during orthodontic tooth movement in humans. Postgraduate orthodontic clinic. Ten female patients requiring all first premolar extractions were selected and treated with standard edgewise mechanotherapy. Canine retraction was done using 100 g sentalloy springs. Maxillary canine on one side acted as experimental site while the contralateral canine acted as control. Gingival crevicular fluid was collected from mesial and distal of canines before initiation of canine retraction (baseline), immediately after initiation of retraction, and on 1st, 7th, 14th and 21st day and the alkaline phosphatase activity was estimated. The results show significant (p < 0.05) changes in alkaline phosphatase activity on the 7th, 14th and 21st day on both mesial and distal aspects of the compared experimental and control sides. The peak in enzyme activity occurred on the 14th day of initiation of retraction followed by a significant fall in activity especially on the mesial aspect. The study showed that alkaline phosphatase activity could be successfully estimated in the GCF using calorimetric estimation assay kits. The enzyme activity showed variation according to the amount of tooth movement.

  9. Comparative Aspects of Human, Canine, and Feline Obesity and Factors Predicting Progression to Diabetes

    Directory of Open Access Journals (Sweden)

    Margarethe Hoenig

    2014-08-01

    Full Text Available Obesity and diabetes mellitus are common diseases in humans, dogs and cats and their prevalence is increasing. Obesity has been clearly identified as a risk factor for type 2 diabetes in humans and cats but recent data are missing in dogs, although there is evidence that the unprecedented rise in canine obesity in the last decade has led to a rise in canine diabetes of similar magnitude. The insulin resistance of obesity has often been portrayed as major culprit in the loss of glucose control; however, insulin resistance alone is not a good indicator of progression to diabetes in people or pets. A loss of beta cell function is necessary to provide the link to impaired fasting and post-prandial plasma glucose. Increased endogenous glucose output by the liver is also a prerequisite for the increase in fasting blood glucose when non-diabetic obese humans and pets develop diabetes. This may be due to decreased hepatic insulin sensitivity, decreased insulin concentrations, or a combination of both. While inflammation is a major link between obesity and diabetes in humans, there is little evidence that a similar phenomenon exists in cats. In dogs, more studies are needed to examine this important issue.

  10. Identification of 5α-reductase isoenzymes in canine skin.

    Science.gov (United States)

    Bernardi de Souza, Lucilene; Paradis, Manon; Zamberlam, Gustavo; Benoit-Biancamano, Marie-Odile; Price, Christopher

    2015-10-01

    Alopecia X in dogs is a noninflammatory alopecia that may be caused by a hormonal dysfunction. It may be similar to androgenic alopecia in men that is caused by the effect of dihydrotestosterone (DHT). The 5α-reductase isoenzymes, 5αR1 and 5αR2, and a recently described 5αR3, are responsible for the conversion of testosterone into DHT. However, which 5α-reductases are present in canine skin has not yet been described. The main objective of this study was to determine the pattern of expression of 5α-reductase genes in canine skin. Skin biopsies were obtained from healthy, intact young-mature beagles (three males, four females) at three anatomical sites normally affected by alopecia X (dorsal neck, back of thighs and base of tail) and two sites generally unaffected (dorsal head and ventral thorax). Prostate samples (n = 3) were collected as positive controls for 5α-reductase mRNA abundance measurement by real-time PCR. We detected mRNA encoding 5αR1 and 5αR3 but not 5αR2. There were no significant differences in 5αR1 and 5αR3 mRNA levels between the different anatomical sites, irrespective of gender (P > 0.05). Moreover, the mean mRNA abundance in each anatomical site did not differ between males and females (P > 0.05). To the best of the authors' knowledge, this is the first study demonstrating the expression of 5α-reductases in canine skin and the expression of 5αR3 in this tissue. These results may help to elucidate the pathogenesis of alopecia X and to determine more appropriate treatments for this disorder. © 2015 ESVD and ACVD.

  11. Orthodontic-surgical treatment of bilateral maxillary canine impaction

    OpenAIRE

    Sumitra

    2012-01-01

    A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle's Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth an...

  12. Development of a Vaccine Incorporating Killed Virus of Canine Origin for the Prevention of Canine Parvovirus Infection

    Science.gov (United States)

    Povey, C.

    1982-01-01

    A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted form was immunogenic in 20 of 20 vaccinated dogs. The double adjuvanted vaccine is selected as the one of choice on the basis of best and most persistent seriological response. PMID:7039811

  13. MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.

    Science.gov (United States)

    Lopez, Cecilia M; Yu, Peter Y; Zhang, Xiaoli; Yilmaz, Ayse Selen; London, Cheryl A; Fenger, Joelle M

    2018-01-01

    Osteosarcoma (OSA) is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease. RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes. These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.

  14. MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.

    Directory of Open Access Journals (Sweden)

    Cecilia M Lopez

    Full Text Available Osteosarcoma (OSA is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease.RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes.These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.

  15. Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs.

    Science.gov (United States)

    Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio

    2012-01-01

    A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.

  16. Stability of BDNF in Human Samples Stored Up to 6 Months and Correlations of Serum and EDTA-Plasma Concentrations.

    Science.gov (United States)

    Polyakova, Maryna; Schlögl, Haiko; Sacher, Julia; Schmidt-Kassow, Maren; Kaiser, Jochen; Stumvoll, Michael; Kratzsch, Jürgen; Schroeter, Matthias L

    2017-06-03

    Brain-derived neurotrophic factor (BDNF), an important neural growth factor, has gained growing interest in neuroscience, but many influencing physiological and analytical aspects still remain unclear. In this study we assessed the impact of storage time at room temperature, repeated freeze/thaw cycles, and storage at -80 °C up to 6 months on serum and ethylenediaminetetraacetic acid (EDTA)-plasma BDNF. Furthermore, we assessed correlations of serum and plasma BDNF concentrations in two independent sets of samples. Coefficients of variations (CVs) for serum BDNF concentrations were significantly lower than CVs of plasma concentrations ( n = 245, p = 0.006). Mean serum and plasma concentrations at all analyzed time points remained within the acceptable change limit of the inter-assay precision as declared by the manufacturer. Serum and plasma BDNF concentrations correlated positively in both sets of samples and at all analyzed time points of the stability assessment ( r = 0.455 to r s = 0.596; p plasma up to 6 months. Due to a higher reliability, we suggest favoring serum over EDTA-plasma for future experiments assessing peripheral BDNF concentrations.

  17. A survey of canine haemoprotozoan parasites from Turkey, including molecular evidence of an unnamed Babesia.

    Science.gov (United States)

    Aktas, Munir; Ozubek, Sezayi

    2017-06-01

    Canine tick-borne apicomplexan parasites have emerged in recent years, showing a wider geographic distribution and increased global prevalence. A reverse line blot assay was performed on 219 blood samples collected from domestic dogs for simultaneous detection of all named canine piroplasm species as well as Hepatozoon canis. Ten samples hybridized to the Theileria/Babesia and Babesia catch all probes but did not hybridize to any species-specific probe tested, suggesting the presence of an unrecognized Babesia species or genotype. Sequencing results showed 91.5%, 91.9%, 92.4%, 92.4%, and 89.2% similarity to B. canis, B. vogeli, B. rossi, B. gibsoni, and B. conradae, respectively. The highest homology (98.1-98.5%) observed was with unnamed Babesia sp. isolates (Ludhiana and Malbazar) described in dogs, Babesia sp. of buffalo origin, Babesia sp. Kashi 2, and Babesia orientalis, along with Babesia occultans of cattle origin. The partial cox1 sequence indicated that this isolate was most similar to Babesia sp. 1 HG-2012, with an identity of 86.5%. The survey revealed high prevalence of haemoprotozoans in domestic dogs (57.5%, CI 50.7-64.2), with Hepatozoon canis the most prevalent (54.3%, CI 47.5-61.117%), followed by Babesia sp. (4.6%, CI 2.2-8.2), B. vogeli (1.4%; CI 0.3-3.9), and B. canis (0.4%, CI 0-2.5). Combined infection of Hepatozoon canis and Babesia sp. was detected in five (2.3%, CI 0.7-5.2) samples and of H. canis and B. vogeli in two (0.9%, CI 0.1-3.2) dogs. The study contributes insight into the distribution and phylogenetic diversity of canine piroplasms in Turkey. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Evaluation of dental age and associated developmental anomalies in subjects with impacted mandibular canines.

    Science.gov (United States)

    Jain, Shikha; Shetty, K Sadashiva; Jain, Shweta; Jain, Sachin; Prakash, A T; Agrawal, Mamta

    2015-07-01

    To assess the null hypothesis that there is no difference in the rate of dental development and the occurrence of selected developmental anomalies related to shape, number, structure, and position of teeth between subjects with impacted mandibular canines and those with normally erupted canines. Pretreatment records of 42 subjects diagnosed with mandibular canines impaction (impaction group: IG) were compared with those of 84 subjects serving as a control reference sample (control group: CG). Independent t-tests were used to compare mean dental ages between the groups. Intergroup differences in distribution of subjects based on the rate of dental development and occurrence of selected dental anomalies were assessed using χ(2) tests. Odds of late, normal, and early developers and various categories of developmental anomalies between the IG and the CG were evaluated in terms of odds ratios. Mean dental age for the IG was lower than that for the CG in general. Specifically, this was true for girls (P dental development and occurrence of positional anomalies also reached statistical significance (P anomalies compared with controls (odds ratios 3.00 and 2.82, respectively; P dental development compared with the female orthodontic patients. Increased frequency of positional developmental anomalies was also remarkable in the IG.

  19. Radiographic, densitometric, and biomechanical effects of recombinant canine somatotropin in an unstable ostectomy gap model of bone healing in dogs

    International Nuclear Information System (INIS)

    Millis, D.L.; Wilkens, B.E.; Daniel, G.B.; Hubner, K.; Mathews, A.; Buonomo, F.C.; Patell, K.R.; Weigel, J.P.

    1998-01-01

    Objective: To determine the effect of recombinant canine somatotropin (STH) on radiographic, densitometric, and biomechanical aspects of bone healing using an unstable ostectomy gap model. Study Design: After an ostectomy of the midshaft radius, bone healing was evaluated over an 8-week period in control dogs (n = 4) and dogs receiving recombinant canine STH (n = 4). Animals Or Sample Population: Eight sexually intact female Beagle dogs, 4 to 5 years old. Methods: Bone healing was evaluated by qualitative and quantitative evaluation of serial radiographs every 2 weeks. Terminal dual-energy x-ray absorptiometry and three-point bending biomechanical testing were also performed. Results: Dogs receiving STH had more advanced radiographic healing of ostectomy sites. Bone area, bone mineral content, and bone density were two to five times greater at the ostectomy sites of treated dogs. Ultimate load at failure and stiffness were three and five times greater in dogs receiving STH. Conclusions: Using the ostectomy gap model, recombinant canine STH enhanced the radiographic, densitometric, and biomechanical aspects of bone healing in dogs. Clinical Relevance: Dogs at risk for delayed healing of fractures may benefit from treatment with recombinant canine STH

  20. Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus

    Directory of Open Access Journals (Sweden)

    Lourdes M. B. Pessoa

    2016-01-01

    Full Text Available The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.

  1. Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus)

    OpenAIRE

    Pessoa, Lourdes M. B.; Roza, Marcello; Farias, Anderson; Jesus, Pedro Henrique de; Campbell, Rita de Cassia; Pinho, Mariângela Pereira de

    2016-01-01

    The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.

  2. Radiometric-microbiologic assay fo vitamin B-6: analysis of plasma samples

    International Nuclear Information System (INIS)

    Guilarte, T.R.; McIntyre, P.A.

    1981-01-01

    A radiometric microbiologic assay for the analysis of vitamin B-6 in plasma was developed. The method is based on the measurement of 14CO2 generated from the metabolism of DL-l-14C-valine (L-l-14C-valine) by Kloeckera brevis. The assay is specific for the biologically active forms of the vitamin, that is, pyridoxine, pyridoxal and pyridoxamine, and their respective phosphorylated forms. The biologically inert vitamin B-6 metabolite (4-pyridoxic acid) did not generate a response at concentrations tested. The radiometric technique was shown to be sensitive to the 1 nanogram level. Reproducibility and recovery studies gave good results. Fifteen plasma samples were assayed using the radiometric and turbidimetric techniques. The correlation coefficient was r . 0.98. Turbid material or precipitated debris did not interfere with the radiometric microbiologic assay, thus allowing for simplification of assay procedure

  3. Flow induced dispersion analysis rapidly quantifies proteins in human plasma samples

    DEFF Research Database (Denmark)

    Poulsen, Nicklas N; Andersen, Nina Z; Østergaard, Jesper

    2015-01-01

    Rapid and sensitive quantification of protein based biomarkers and drugs is a substantial challenge in diagnostics and biopharmaceutical drug development. Current technologies, such as ELISA, are characterized by being slow (hours), requiring relatively large amounts of sample and being subject...... to cumbersome and expensive assay development. In this work a new approach for quantification based on changes in diffusivity is presented. The apparent diffusivity of an indicator molecule interacting with the protein of interest is determined by Taylor Dispersion Analysis (TDA) in a hydrodynamic flow system...... in a blood plasma matrix), fully automated, and being subject to a simple assay development. FIDA is demonstrated for quantification of the protein Human Serum Albumin (HSA) in human plasma as well as for quantification of an antibody against HSA. The sensitivity of the FIDA assay depends on the indicator...

  4. Canine serum protein patterns using high-resolution electrophoresis (HRE).

    Science.gov (United States)

    Abate, O; Zanatta, R; Malisano, T; Dotta, U

    2000-03-01

    Serum protein values were determined in 26 healthy dogs using agarose gel electrophoresis (SPE), splitting the electrophoretic separation into six regions: albumin, alpha(1), alpha(2), beta(1), beta(2)and gamma globulins. High-resolution electrophoresis (HRE) was used to separate single proteins. Serum proteins from dogs (26 healthy and 20 affected by various diseases) were then characterized by electrophoretic immunofixation (IFE) and Sudan black staining on HRE film. Haemoglobin and normal canine plasma and serum were used to identify haptoglobin and fibrinogen, respectively. In the standard pattern, determined by HRE, the following proteins were identified: albumin, alpha(1)-lipoprotein (alpha(1)-region), haptoglobin and alpha(2)-macroglobulin (alpha(2)-region), beta -lipoprotein and C3 (beta(1)-region), transferrin and IgM (beta(2)-region), IgG (mostly in gamma -region and partly in beta(2)-region). The HRE pattern shown by healthy dogs could be compared with those of dogs affected by various diseases to obtain clinical information. Copyright 2000 Harcourt Publishers Ltd.

  5. PMab-38 Recognizes Canine Podoplanin of Squamous Cell Carcinomas.

    Science.gov (United States)

    Kaneko, Mika K; Honma, Ryusuke; Ogasawara, Satoshi; Fujii, Yuki; Nakamura, Takuro; Saidoh, Noriko; Takagi, Michiaki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

    2016-10-01

    Podoplanin, a type I transmembrane protein, is expressed in lymphatic endothelial cells. Although we previously developed an anticanine podoplanin monoclonal antibody (mAb), PMab-38, immunohistochemistry (IHC) showed that it did not react with canine lymphatic endothelial cells. Here, we determined whether PMab-38 recognizes canine podoplanin of squamous cell carcinomas (SCCs) and clarified its epitope. In IHC, PMab-38 reacted with 83% of SCCs (15/18 cases). Flow cytometry showed that the epitope of PMab-38 was different from that of the platelet aggregation-stimulating domain of the N-terminus, which was detected by almost all antipodoplanin mAbs such as D2-40 or NZ-1. PMab-38 is expected to be useful for investigating the function of podoplanin in canine tumors.

  6. Severe canine distemper outbreak in unvaccinated dogs in Mozambique.

    Science.gov (United States)

    Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G

    2016-07-15

    Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.

  7. Serotonin concentrations in platelets, plasma, mitral valve leaflet, and left ventricular myocardial tissue in dogs with myxomatous mitral valve disease

    DEFF Research Database (Denmark)

    Cremer, Signe Emilie; Singletary, G.E.; Olsen, Lisbeth Høier

    2014-01-01

    HYPOTHESIS/OBJECTIVES: Altered serotonin (5-hydroxytryptamine, 5HT) signaling is postulated in development and progression of canine myxomatous mitral valve disease (MMVD). Little is known regarding platelet, plasma, valvular, or myocardial 5HT concentration ([5HT]) in affected dogs. We quantifie...

  8. Canine olfaction as an alternative to analytical instruments for disease diagnosis: understanding 'dog personality' to achieve reproducible results

    Science.gov (United States)

    Recent literature has touted the use of canine olfaction as a diagnostic tool for identifying pre-clinical disease status, especially cancer and infection from biological media samples. Studies have shown a wide range of outcomes, ranging from almost perfect discrimination, all t...

  9. Joint Genomic Prediction of Canine Hip Dysplasia in UK and US Labrador Retrievers

    Directory of Open Access Journals (Sweden)

    Stefan M. Edwards

    2018-03-01

    Full Text Available Canine hip dysplasia, a debilitating orthopedic disorder that leads to osteoarthritis and cartilage degeneration, is common in several large-sized dog breeds and shows moderate heritability suggesting that selection can reduce prevalence. Estimating genomic breeding values require large reference populations, which are expensive to genotype for development of genomic prediction tools. Combining datasets from different countries could be an option to help build larger reference datasets without incurring extra genotyping costs. Our objective was to evaluate genomic prediction based on a combination of UK and US datasets of genotyped dogs with records of Norberg angle scores, related to canine hip dysplasia. Prediction accuracies using a single population were 0.179 and 0.290 for 1,179 and 242 UK and US Labrador Retrievers, respectively. Prediction accuracies changed to 0.189 and 0.260, with an increased bias of genomic breeding values when using a joint training set (biased upwards for the US population and downwards for the UK population. Our results show that in this study of canine hip dysplasia, little or no benefit was gained from using a joint training set as compared to using a single population as training set. We attribute this to differences in the genetic background of the two populations as well as the small sample size of the US dataset.

  10. [Biological characteristics of a chimeric rabies virus expressing canine parvovirus VP2 protein].

    Science.gov (United States)

    Niu, Xue-Feng; Liu, Xiao-Hui; Sun, Zhao-Jin; Shi, He-He; Chen, Jing; Jiang, Bido; Sun, Jing-Chen; Guo, Xiao-Feng

    2009-09-01

    To obtain a bivalence vaccine against canine rabies virus and canine parvovirus, a chimeric rabies virus expressing canine parvovirus VP2 protein was generated by the technique of reverse genetics. It was shown that the chimeric virus designated as HEP-Flury (VP2) grew well on BHK-21 cells and the VP2 gene could still be stably expressed after ten passages on BHK-21 cells. Experiments on the mice immunized with the chimeric virus HEP-Flury (VP2) demonstrated that specific antibodies against rabies virus and canine parvovirus were induced in immunized mice after vaccination with the live chimeric virus.

  11. Cellular endocytic compartment localization of expressed canine CD1 molecules

    DEFF Research Database (Denmark)

    Schjærff, Mette; Keller, Stefan M.; Affolter, Verena K.

    2016-01-01

    CD1 molecules are glycoproteins present primarily on dendritic cells (DCs), which recognize and presenta variety of foreign- and self-lipid antigens to T-cells. Humans have five different CD1 isoforms that sur-vey distinct cellular compartments allowing for recognition of a large repertoire...... onlya diminished GFP expression. In conclusion, canine CD1 transfectants show distinct localization patternsthat are similar to human CD1 proteins with the exception of the canine CD1d isoform, which most likelyis non-functional. These findings imply that canine CD1 localization overall resembles human...... CD1 traf-ficking patterns. This knowledge is important for the understanding of lipid antigen-receptor immunityin the dog....

  12. Canine Gouging: A Taboo Resurfacing in Migrant Urban Population.

    Science.gov (United States)

    Noman, Anila Virani; Wong, Ferranti; Pawar, Ravikiran Ramakrishna

    2015-01-01

    Cosmopolitan cities have become a pool of migrants from different parts of the world, who carry their cultural beliefs and superstitions with them around the globe. Canine gouging is a kind of infant oral mutilation (IOM) which is widely practiced among rural population of Africa where the primary tooth bud of the deciduous canine is enucleated. The belief is that the life threatening illnesses in children like vomiting, diarrhoea, and fevers are caused by worms which infest on tooth buds. This case report is of a 15-year-old Somalian born boy, who presented at the dental institute with intermittent pain in his lower right permanent canine which was associated with a discharging intra oral buccal sinus. The tooth was endodontically treated and then restored with composite. General dental practitioners need to be vigilant when encountered with tooth presenting unusual morphology, unilateral missing tooth, and shift in the midline due to early loss of deciduous/permanent canines. Identification of any such dental mutilation practice will need further counselling of the individual and family members. It is the duty of every dental professional to educate and safeguard the oral and dental health of general public.

  13. Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman

    2011-01-01

    Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.

  14. Immunophenotypical characterization of canine mesenchymal stem cells from perivisceral and subcutaneous adipose tissue by a species-specific panel of antibodies.

    Science.gov (United States)

    Ivanovska, Ana; Grolli, Stefano; Borghetti, Paolo; Ravanetti, Francesca; Conti, Virna; De Angelis, Elena; Macchi, Francesca; Ramoni, Roberto; Martelli, Paolo; Gazza, Ferdinando; Cacchioli, Antonio

    2017-10-01

    Immunophenotypical characterization of mesenchymal stem cells is fundamental for the design and execution of sound experimental and clinical studies. The scarce availability of species-specific antibodies for canine antigens has hampered the immunophenotypical characterization of canine mesenchymal stem cells (MSC). The aim of this study was to select a panel of species-specific direct antibodies readily useful for canine mesenchymal stem cells characterization. They were isolated from perivisceral and subcutaneous adipose tissue samples collected during regular surgeries from 8 dogs. Single color flow cytometric analysis of mesenchymal stem cells (P3) deriving from subcutaneous and perivisceral adipose tissue with a panel of 7 direct anti-canine antibodies revealed two largely homogenous cell populations with a similar pattern: CD29 + , CD44 + , CD73 + , CD90 + , CD34 - , CD45 - and MHC-II - with no statistically significant differences among them. Antibody reactivity was demonstrated on canine peripheral blood mononuclear cells. The similarities are reinforced by their in vitro cell morphology, trilineage differentiation ability and RT-PCR analysis (CD90 + , CD73 + , CD105 + , CD44 + , CD13 + , CD29 + , Oct-4 + gene and CD31 - and CD45 - expression). Our results report for the first time a comparison between the immunophenotypic profile of canine MSC deriving from perivisceral and subcutaneous adipose tissue. The substantial equivalence between the two populations has practical implication on clinical applications, giving the opportunity to choose the source depending on the patient needs. The results contribute to routine characterization of MSC populations grown in vitro, a mandatory process for the definition of solid and reproducible laboratory and therapeutic procedures. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Orthodontic management of bilaterally impacted mandibular canines in a growing patient

    Directory of Open Access Journals (Sweden)

    Rajaganesh J Gautam

    2016-01-01

    Full Text Available KK, an 11.9-year-old male patient, presented with the chief complaint of forwardly placed upper front teeth. Diagnosis revealed a Class II subdivision right malocclusion on an underlying Class I skeletal base with a horizontal growth pattern, bimaxillary proclination, crowding in the lower arch, over retained deciduous canines in the upper right and lower quadrants, an unerupted maxillary right permanent canine, and bilaterally impacted mandibular permanent canines, an increased overjet, and a deep overbite. He had a mild convex profile, a toothy smile with a nonconsonant smile arc and mildly protrusive lips. Treatment with a nonextraction treatment plan, which included surgical uncovering and orthodontic eruptive guidance of the impacted mandibular canines, with multibracket metallic fixed appliances, solved the patient′s complaints and achieved an esthetically pleasing and functionally adequate occlusal result.

  16. Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.

    OpenAIRE

    McMaster, G K; Tratschin, J D; Siegl, G

    1981-01-01

    The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.

  17. Detection of hemophilia A carriers by use of frozen plasma samples

    International Nuclear Information System (INIS)

    Yang, H.C.; Hardin, J.; Vaudreuil, C.

    1978-01-01

    The efficacy of using promptly frozen plasma samples in the diagnosis of the carrier state for hemophilia A was evaluated by simultaneous measurement of factor VIII activity and antigen in 20 normal women and 20 obligate carriers. Factor VIII antigen was measured by two methods, electroimmunoassay and immunoradiometric assay. When the factor VIII activity and antigen data were evaluated by regression analysis, 94% of the carriers were correctly identified at the 95% confidence level

  18. Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus

    Directory of Open Access Journals (Sweden)

    Sudarisman

    2006-03-01

    Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.

  19. Comparative photoelastic study of dental and skeletal anchorages in the canine retraction

    Directory of Open Access Journals (Sweden)

    Cristiane Aparecida de Assis Claro

    2014-01-01

    Full Text Available OBJECTIVE: To compare dental and skeletal anchorages in mandibular canine retraction by means of a stress distribution analysis. METHODS: A photoelastic model was produced from second molar to canine, without the first premolar, and mandibular canine retraction was simulated by a rubber band tied to two types of anchorage: dental anchorage, in the first molar attached to adjacent teeth, and skeletal anchorage with a hook simulating the mini-implant. The forces were applied 10 times and observed in a circular polariscope. The stresses located in the mandibular canine were recorded in 7 regions. The Mann-Whitney test was employed to compare the stress in each region and between both anchorage systems. The stresses in the mandibular canine periradicular regions were compared by the Kruskal-Wallis test. RESULTS: Stresses were similar in the cervical region and the middle third. In the apical third, the stresses associated with skeletal anchorage were higher than the stresses associated with dental anchorage. The results of the Kruskal-Wallis test showed that the highest stresses were identified in the cervical-distal, apical-distal, and apex regions with the use of dental anchorage, and in the apical-distal, apical-mesial, cervical-distal, and apex regions with the use of skeletal anchorage. CONCLUSIONS: The use of skeletal anchorage in canine retraction caused greater stress in the apical third than the use of dental anchorage, which indicates an intrusive component resulting from the direction of the force due to the position of the mini-implant and the bracket hook of the canine.

  20. Liquid-based cytology and cell block immunocytochemistry in veterinary medicine: comparison with standard cytology for the evaluation of canine lymphoid samples.

    Science.gov (United States)

    Fernandes, N C C A; Guerra, J M; Réssio, R A; Wasques, D G; Etlinger-Colonelli, D; Lorente, S; Nogueira, E; Dagli, M L Z

    2016-08-01

    Liquid-based Cytology (LBC) consists of immediate wet cell fixation with automated slide preparation. We applied LBC, cell block (CB) and immunocytochemistry to diagnose canine lymphoma and compare results with conventional cytology. Samples from enlarged lymph nodes of 18 dogs were collected and fixed in preservative solution for automated slide preparation (LBC), CB inclusion and immunophenotyping. Two CB techniques were tested: fixed sediment method (FSM) and agar method (AM). Anti-CD79a, anti-Pax5, anti-CD3 and anti-Ki67 were used in immunocytochemistry. LBC smears showed better nuclear and nucleolar definition, without cell superposition, but presented smaller cell size and worse cytoplasmic definition. FSM showed consistent cellular groups and were employed for immunocytochemistry, while AM CBs presented sparse groups of lymphocytes, with compromised analysis. Anti-Pax-5 allowed B-cell identification, both in reactive and neoplastic lymph nodes. Our preliminary report suggests that LBC and FSM together may be promising tools to improve lymphoma diagnosis through fine-needle aspiration. © 2015 John Wiley & Sons Ltd.

  1. Permanent maxillary canines - review of eruption pattern and local etiological factors leading to impaction.

    Science.gov (United States)

    Sajnani, Anand K

    2015-02-01

    The position of the permanent maxillary canine at the angle of the mouth is strategically significant in maintaining the harmony and symmetry of the occlusal relationship. However, the maxillary canine is the second most frequently impacted tooth, with prevalence reported to be between 1% and 2%. Moreover, treatment of this condition is often complex and involves substantial time and financial cost. Hence, it is only prudent to monitor the eruption and identify the etiological factors that lead to impaction of the maxillary canine. Numerous researchers have tried to identify specific and nonspecific etiological factors responsible for displacement of canines. The purpose of this review was to track the development processes of maxillary canines and determine the hindrances that affect the eruption at different ages. Awareness of the eruption process and etiology of noneruption will help to reduce the incidence of impacted canines by allowing for early recognition and interceptive treatment. © 2013 Wiley Publishing Asia Pty Ltd.

  2. Tumor microvessel density–associated mast cells in canine nodal lymphoma

    Science.gov (United States)

    Mann, Elizabeth; Whittington, Lisa

    2014-01-01

    Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4) was significantly higher (p < 0.05) than that in the control (0.83 ± 0.3) and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009). Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended. PMID:26770752

  3. Tumor microvessel density–associated mast cells in canine nodal lymphoma

    Directory of Open Access Journals (Sweden)

    Moges Woldemeskel

    2014-11-01

    Full Text Available Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4 was significantly higher (p < 0.05 than that in the control (0.83 ± 0.3 and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009. Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended.

  4. Constitutive activation of alternative nuclear factor kappa B pathway in canine diffuse large B-cell lymphoma contributes to tumor cell survival and is a target of new adjuvant therapies.

    Science.gov (United States)

    Seelig, Davis M; Ito, Daisuke; Forster, Colleen L; Yoon, Una A; Breen, Matthew; Burns, Linda J; Bachanova, Veronika; Lindblad-Toh, Kerstin; O'Brien, Timothy D; Schmechel, Stephen C; Rizzardi, Anthony E; Modiano, Jaime F; Linden, Michael A

    2017-07-01

    Activation of the classical nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) pathway is a common molecular event observed in both human and canine diffuse large B-cell lymphoma (DLBCL). Although the oncogenic potential of the alternative NFκB pathway (ANFκBP) has also been recently identified in DLBCL, its precise role in tumor pathogenesis and potential as a treatment target is understudied. We hypothesized that up-regulation of the ANFκBP plays an important role in the proliferation and survival of canine DLBCL cells, and we demonstrate that the ANFκBP is constitutively active in primary canine DLBCL samples and a cell line (CLBL1). We further demonstrate that a small interfering RNA inhibits the activation of the NFκB pathway and induces apoptosis in canine DLBCL cells. In conclusion, the ANFκBP facilitates survival of canine DLBCL cells, and thus, dogs with spontaneous DLBCL can provide a useful large animal model to study therapies targeting the ANFκBP.

  5. How far is the root apex of a unilateral impacted canine from the root apices' arch form?

    Science.gov (United States)

    Kim, Sung-Hun; Kim, You-Min; Oh, Sewoong; Kim, Seong-Sik; Park, Soo-Byung; Son, Woo-Sung; Kim, Yong-Il

    2017-02-01

    The purpose of this study was to determine the arch form of the root apices of normally erupting teeth and then determine the differences in the location of the apex of impacted canines relative to normally erupting canines. In addition, we sought to determine whether the labiopalatal position of the impacted canines influences the position of the apices. The study included 21 patients with unerupted canines that subsequently had a normal eruption, 21 patients with palatally impacted canines, 27 patients with labially impacted canines, and 17 patients with midalveolus impacted canines. Images were obtained using cone beam computed tomography, and the x, y, and z coordinates of the root apices were determined using Ondemand3D software (Cybermed Co., Seoul, Korea). Two-dimensional coordinates were converted from acquired 3-dimensional coordinates via projection on a palatal plane, and the Procrustes method was used to process the converted 2-dimensional coordinates and to draw the arch forms of the root apices. Finally, we measured the extent of root apex deviation from the arch forms of the root apices. Normally erupting canines showed that even though calcifications may be immature, their positions were aligned with a normal arch form. The root apices of the impacted canines were an average of 6.572 mm away from the root apices' arch form, whereas those of the contralateral nonimpacted canines were an average distance of 2.221 mm away, a statistically significant difference. The palatally impacted canines' root apices distribution tended toward the first premolar root apices. Incompletely calcified, unerupted teeth with a subsequent normal eruption showed a normal arch form of the root apices. The root apices of impacted canines were farther from the arch forms than were the nonimpacted canines. Also, the root apices of impacted canines in the palatal area showed distributions different from those of the other impacted canine groups. Copyright © 2017 American

  6. The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.

    Science.gov (United States)

    Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki

    2015-04-17

    Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Automated tru-cut imaging-guided core needle biopsy of canine ...

    African Journals Online (AJOL)

    The purpose of this study was to evaluate the diagnostic value of imaging-guided core needle biopsy for canine orbital mass diagnosis. A second excisional biopsy obtained during surgery or necropsy was used as the reference standard. A prospective feasibility study was conducted in 23 canine orbital masses at a single ...

  8. Biochemical characterization of prostate-specific membrane antigen from canine prostate carcinoma cells.

    Science.gov (United States)

    Wu, Lisa Y; Johnson, Jacqueline M; Simmons, Jessica K; Mendes, Desiree E; Geruntho, Jonathan J; Liu, Tiancheng; Dirksen, Wessel P; Rosol, Thomas J; Davis, William C; Berkman, Clifford E

    2014-05-01

    Prostate-specific membrane antigen (PSMA) remains an important target for diagnostic and therapeutic application for human prostate cancer. Model cell lines have been recently developed to study canine prostate cancer but their PSMA expression and enzymatic activity have not been elucidated. The present study was focused on determining PSMA expression in these model canine cell lines and the use of fluorescent small-molecule enzyme inhibitors to detect canine PSMA expression by flow cytometry. Western blot and RT-PCR were used to determine the transcriptional and translational expression of PSMA on the canine cell lines Leo and Ace-1. An endpoint HPLC-based assay was used to monitor the enzymatic activity of canine PSMA and the potency of enzyme inhibitors. Flow cytometry was used to detect the PSMA expressed on Leo and Ace-1 cells using a fluorescently tagged PSMA enzyme inhibitor. Canine PSMA expression on the Leo cell line was confirmed by Western blot and RT-PCR, the enzyme activity, and flow cytometry. Kinetic parameters Km and Vmax of PSMA enzymatic activity for the synthetic substrate (PABGγG) were determined to be 393 nM and 220 pmol min(-1)  mg protein(-1) , respectively. The inhibitor core 1 and fluorescent inhibitor 2 were found to be potent reversible inhibitors (IC50  = 13.2 and 1.6 nM, respectively) of PSMA expressed on the Leo cell line. Fluorescent labeling of Leo cells demonstrated that the fluorescent PSMA inhibitor 2 can be used for the detection of PSMA-positive canine prostate tumor cells. Expression of PSMA on Ace-1 was low and not detectable by flow cytometry. The results described herein have demonstrated that PSMA is expressed on canine prostate tumor cells and exhibits similar enzymatic characteristics as human PSMA. The findings show that the small molecule enzyme inhibitors currently being studied for use in diagnosis and therapy of human prostate cancer can also be extended to include canine prostate cancer. Importantly

  9. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    International Nuclear Information System (INIS)

    Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma

    2006-01-01

    Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs

  10. Feline and canine coronaviruses: common genetic and pathobiological features.

    Science.gov (United States)

    Le Poder, Sophie

    2011-01-01

    A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP) and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV) will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

  11. Effect of albumin and polyvinyl alcohol on the vitality, motility and acrosomal integrity of canine spermatozoa incubated in vitro.

    Science.gov (United States)

    Risopatrón, J; Catalán, S; Miska, W; Schill, W-B; Sánchez, R

    2002-12-01

    Sperm culture media used for in vitro fertilization (IVF) procedures are important factors concerning the viability, motility and acrosomal integrity of spermatozoa. The aim of this study was to investigate the effects of three different sperm diluting media, tissue culture medium (TCM-199), sperm culture medium (Sp-TALP) and human tubular fluid (HTF) supplemented with varying concentrations of bovine serum albumin (1, 4 and 6%) or polyvinyl alcohol (0.8%) on the acrosomal integrity, motility and viability of canine spermatozoa. Ejaculates collected from four dogs were diluted in all media and spermatozoa were separated from seminal plasma by the swim-up technique. Sperm progressive motility was assessed using a phase contrast microscope. Viability and acrosomal integrity were evaluated using a dual stain technique (Giemsa-Trypan blue). The results demonstrated that the number of live canine spermatozoa was similar in culture media supplemented or not supplemented with macromolecules. A minimal concentration of albumin (1%) in the three media showed similar effects on vitality, motility and acrosomal integrity, as had higher concentrations (4 and 6%). The percentage of acrosome-intact spermatozoa was markedly higher after HTF (94.1%) than after TCM-199 (70.1%) or Sp-TALP (71.0%) without supplementation. It is concluded that serum bovine albumin, irrespective of the concentration, preserved sperm viability and function, and HTF is the most suitable medium for preserving the acrosome in canine spermatozoa prepared for in vitro manipulation through short incubation.

  12. Comparative proteomic investigation of metastatic and non-metastatic osteosarcoma cells of human and canine origin.

    Directory of Open Access Journals (Sweden)

    Jahnabi Roy

    Full Text Available Osteosarcoma is the most common bone cancer in dogs and people. In order to improve clinical outcomes, it is necessary to identify proteins that are differentially expressed by metastatic cells. Membrane bound proteins are responsible for multiple pro-metastatic functions. Therefore characterizing the differential expression of membranous proteins between metastatic and non-metastatic clonal variants will allow the discovery of druggable targets and consequently improve treatment methodology. The objective of this investigation was to systemically identify the membrane-associated proteomics of metastatic and non-metastatic variants of human and canine origin. Two clonal variants of divergent in vivo metastatic potential from human and canine origins were used. The plasma membranes were isolated and peptide fingerprinting was used to identify differentially expressed proteins. Selected proteins were further validated using western blotting, flow cytometry, confocal microscopy and immunohistochemistry. Over 500 proteins were identified for each cell line with nearly 40% of the proteins differentially regulated. Conserved between both species, metastatic variants demonstrated significant differences in expression of membrane proteins that are responsible for pro-metastatic functions. Additionally, CD147, CD44 and vimentin were validated using various biochemical techniques. Taken together, through a comparative proteomic approach we have identified several differentially expressed cell membrane proteins that will help in the development of future therapeutics.

  13. Comparative proteomic investigation of metastatic and non-metastatic osteosarcoma cells of human and canine origin.

    Science.gov (United States)

    Roy, Jahnabi; Wycislo, Kathryn L; Pondenis, Holly; Fan, Timothy M; Das, Aditi

    2017-01-01

    Osteosarcoma is the most common bone cancer in dogs and people. In order to improve clinical outcomes, it is necessary to identify proteins that are differentially expressed by metastatic cells. Membrane bound proteins are responsible for multiple pro-metastatic functions. Therefore characterizing the differential expression of membranous proteins between metastatic and non-metastatic clonal variants will allow the discovery of druggable targets and consequently improve treatment methodology. The objective of this investigation was to systemically identify the membrane-associated proteomics of metastatic and non-metastatic variants of human and canine origin. Two clonal variants of divergent in vivo metastatic potential from human and canine origins were used. The plasma membranes were isolated and peptide fingerprinting was used to identify differentially expressed proteins. Selected proteins were further validated using western blotting, flow cytometry, confocal microscopy and immunohistochemistry. Over 500 proteins were identified for each cell line with nearly 40% of the proteins differentially regulated. Conserved between both species, metastatic variants demonstrated significant differences in expression of membrane proteins that are responsible for pro-metastatic functions. Additionally, CD147, CD44 and vimentin were validated using various biochemical techniques. Taken together, through a comparative proteomic approach we have identified several differentially expressed cell membrane proteins that will help in the development of future therapeutics.

  14. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    Directory of Open Access Journals (Sweden)

    Otávio Valério Carvalho

    2012-01-01

    Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.

  15. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    Science.gov (United States)

    Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo

    2012-01-01

    Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403

  16. Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

    International Nuclear Information System (INIS)

    Gebara, C.M.S.; Wosiachi, S.R.; Negrao, F.J.; Oliveira, D.B. de; Beloni, S.N.E.; Alfieri, A.A.; Alfieri, A.F.

    2004-01-01

    The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV) nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control) included 20 assymptomatic dogs. A c2 was used to test RT-PCR results according to clinical form and hematological characteristics. The RT-PCR was positive for CDV in 47% (41/87) of the urine samples from dogs with clinical signs. All samples from assymptomatic dogs were RT-PCR negatives. Positive samples were found in all groups of dogs with distemper symptoms according to the following propositions: 51.2% (21/41), 29% (11/37) and 100% (9/9) for groups A, B and C, respectively. In all clinical forms (groups A, B and C) leucocytosis was the most frequent observed hematological alteration. No relationship between RT-PCR results and hematological changes was observed. The results showed that independently of the clinical stage of the illness the RT-PCR based on urine sample can be applied for ante mortem diagnosis of CDV

  17. Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia

    Directory of Open Access Journals (Sweden)

    Víctor Acero P

    2015-09-01

    Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.

  18. European surveillance of emerging pathogens associated with canine infectious respiratory disease.

    Science.gov (United States)

    Mitchell, Judy A; Cardwell, Jacqueline M; Leach, Heather; Walker, Caray A; Le Poder, Sophie; Decaro, Nicola; Rusvai, Miklos; Egberink, Herman; Rottier, Peter; Fernandez, Mireia; Fragkiadaki, Eirini; Shields, Shelly; Brownlie, Joe

    2017-12-01

    Canine infectious respiratory disease (CIRD) is a major cause of morbidity in dogs worldwide, and is associated with a number of new and emerging pathogens. In a large multi-centre European study the prevalences of four key emerging CIRD pathogens; canine respiratory coronavirus (CRCoV), canine pneumovirus (CnPnV), influenza A, and Mycoplasma cynos (M. cynos); were estimated, and risk factors for exposure, infection and clinical disease were investigated. CIRD affected 66% (381/572) of the dogs studied, including both pet and kennelled dogs. Disease occurrence and severity were significantly reduced in dogs vaccinated against classic CIRD agents, canine distemper virus (CDV), canine adenovirus 2 (CAV-2) and canine parainfluenza virus (CPIV), but substantial proportions (65.7%; 201/306) of vaccinated dogs remained affected. CRCoV and CnPnV were highly prevalent across the different dog populations, with overall seropositivity and detection rates of 47% and 7.7% for CRCoV, and 41.7% and 23.4% for CnPnV, respectively, and their presence was associated with increased occurrence and severity of clinical disease. Antibodies to CRCoV had a protective effect against CRCoV infection and more severe clinical signs of CIRD but antibodies to CnPnV did not. Involvement of M. cynos and influenza A in CIRD was less apparent. Despite 45% of dogs being seropositive for M. cynos, only 0.9% were PCR positive for M. cynos. Only 2.7% of dogs were seropositive for Influenza A, and none were positive by PCR. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Canine obesity: an overview.

    Science.gov (United States)

    Gossellin, J; Wren, J A; Sunderland, S J

    2007-08-01

    Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.

  20. Peracute Infectious Canine Hepatitis

    Directory of Open Access Journals (Sweden)

    A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam

    2012-05-01

    Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.

  1. Radioresistant canine hematopoietic cells

    International Nuclear Information System (INIS)

    Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.

    1987-01-01

    Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells

  2. Genotyping of canine distemper virus strains circulating in Brazil from 2008 to 2012.

    Science.gov (United States)

    Budaszewski, Renata da Fontoura; Pinto, Luciane Dubina; Weber, Matheus Nunes; Caldart, Eloiza Teles; Alves, Christian Diniz Beduschi Travassos; Martella, Vito; Ikuta, Nilo; Lunge, Vagner Ricardo; Canal, Cláudio Wageck

    2014-02-13

    Canine distemper virus (CDV) is a major pathogen of dogs and represents a serious threat to both unvaccinated and vaccinated animals. This study surveyed dogs with or without clinical signs related to canine distemper from different regions of Brazil from 2008 to 2012. A total of 155 out of 386 animals were found to be CDV positive by RT-PCR; 37 (23.8%) dogs were asymptomatic at the time of sampling, and 90 (58%) displayed clinical signs suggestive of distemper. Nineteen (12.2%) dogs had a record of complete vaccination, 15 (9.6%) had an incomplete vaccination protocol, and 76 (49%) had no vaccination record. Based on the sequence analysis of the complete hemagglutinin gene of 13 samples, 12 of the strains were characterized as Genotype South America-I/Europe. Considering criteria of at least 95% nucleotide identity to define a genotype and 98% to define a subgenotype, South America-I/Europe sequences segregated into eight different phylogenetically well-defined clusters that circulated or co-circulated in distinct geographical areas. Together, these findings highlight the relevance of CDV infection in Brazilian dogs, demonstrate the predominance of one genotype in Brazil and support the need to intensify the current control measures. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Multi-elemental analysis of aqueous geochemical samples by quadrupole inductively coupled plasma-mass spectrometry (ICP-MS)

    Science.gov (United States)

    Wolf, Ruth E.; Adams, Monique

    2015-01-01

    Typically, quadrupole inductively coupled plasma-mass spectrometry (ICP-MS) is used to determine as many as 57 major, minor, and trace elements in aqueous geochemical samples, including natural surface water and groundwater, acid mine drainage water, and extracts or leachates from geological samples. The sample solution is aspirated into the inductively coupled plasma (ICP) which is an electrodeless discharge of ionized argon gas at a temperature of approximately 6,000 degrees Celsius. The elements in the sample solution are subsequently volatilized, atomized, and ionized by the ICP. The ions generated are then focused and introduced into a quadrupole mass filter which only allows one mass to reach the detector at a given moment in time. As the settings of the mass analyzer change, subsequent masses are allowed to impact the detector. Although the typical quadrupole ICP-MS system is a sequential scanning instrument (determining each mass separately), the scan speed of modern instruments is on the order of several thousand masses per second. Consequently, typical total sample analysis times of 2–3 minutes are readily achievable for up to 57 elements.

  4. Chromium-51-EDTA clearance in adults with a single-plasma sample.

    Science.gov (United States)

    Mårtensson, J; Groth, S; Rehling, M; Gref, M

    1998-12-01

    In 1996, a committee on renal clearance recommended a mean sojourn time-based methodology for single-sample determination of plasma clearance of 99mTc-diethylenetriamine pentaacetic acid (DTPA) to be used on adults if the patient's glomerular filtration rate (GFR) is suspected to be >30 ml/min. The main purpose of this study was to derive a mean sojourn time-based formula for calculation of 51Cr-ethylenediamine tetraacetic acid (EDTA) clearance in adults. Two groups of patients with 51Cr-EDTA clearance (Cl) between 16 and 172 ml/min were studied. In Group I (n = 46), reference Cl was determined as a multiplasma sample, single-injection method (ClSM). Sixteen blood samples were drawn from 0 until 5 hr after a single intravenous injection of 51Cr-EDTA. In Group II (n = 1046), reference Cl was determined by the Brøchner-Mortensen four-sample clearance method (ClBM). The plasma time-activity curves of Group I were used to derive two mean sojourn time-based formulas (Formulas 1 and 2) for calculation of a single-sample clearance. Formula 1 was derived from the entire time-activity curve, whereas the derivation of Formula 2 used only the final slope of the time-activity curve. The accuracy of the two formulas and the Christensen and Groth 99mTc-DTPA formula was tested on Group II. Chromium-51-EDTA Cl calculated by Formula 1 was almost identical to the Cl calculated by the reference Cl method (r = 0.982; SDdiff = 5.82 ml/min). Both 51Cr-EDTA Cl calculated by Formula 2 and by the 99mTc-DTPA formula showed close correlation with the reference method (r = 0.976, r = 0.985, respectively) but systematically overestimated GFR for the whole range of clearance values by 3.5 and 3.2 ml/min (ptime methodology. The determination is marginally more accurate (ptime-activity curve than from only the final slope. The single-sample formula derived for determination of 99mTc-DTPA Cl tends slightly to overestimate GFR if used to calculate 51Cr-EDTA Cl.

  5. Canine Distemper Virus in Wild Felids of Costa Rica.

    Science.gov (United States)

    Avendaño, Roberto; Barrueta, Flor; Soto-Fournier, Sofía; Chavarría, Max; Monge, Otto; Gutiérrez-Espeleta, Gustavo A; Chaves, Andrea

    2016-04-28

    Several highly infectious diseases can be transmitted through feces and cause elevated mortality among carnivore species. One such infectious agent, canine distemper virus (CDV; Paramyxoviridae: Morbillivirus), has been reported to affect wild carnivores, among them several felid species. We screened free-ranging and captive wild carnivores in Costa Rica for CDV. Between 2006 and 2012, we collected 306 fecal samples from 70 jaguars (Panther onca), 71 ocelots ( Leopardus pardalis ), five jaguarundis (Puma yaguaroundi), 105 pumas ( Puma concolor ), five margays ( Leopardus wiedii ), 23 coyotes ( Canis latrans ), and 27 undetermined Leopardus spp. We found CDV in six individuals: one captive jaguarundi (rescued in 2009), three free-ranging ocelots (samples collected in 2012), and two free-ranging pumas (samples collected in 2007). Phylogenetic analyses were performed using sequences of the phosphoprotein (P) gene. We provide evidence of CDV in wild carnivores in Costa Rica and sequence data from a Costa Rican CDV isolate, adding to the very few sequence data available for CDV isolates from wild Central American carnivores.

  6. Study of aerosol sample interaction with dc plasma in the presence of oscillating magnetic field

    International Nuclear Information System (INIS)

    Stoiljkovic, M.M.; Pavlovic, M.S.; Savovic, J.; Kuzmanovic, M.; Marinkovic, M.

    2005-01-01

    Oscillating magnetic field was used to study the efficiency of the aerosol sample introduction into the dc plasma. At atmospheric plasmas, the effect of magnetic field is reduced to Lorentz forces on the current carrying plasma, which produces motion of the plasma. The motion velocity of dc plasma caused by oscillating magnetic field was correlated to spectral emission enhancement of analytes introduced as aerosols. Emission enhancement is the consequence of the reduced barrier to introduction of analyte species and aerosol particles into the hot plasma region. Two hypotheses described in the literature for the origin of the barrier are considered: (i) barrier induced by temperature field is based upon the thermophoretic forces on the aerosol particles when their radius is comparable to the molecular free path in the surrounding gas and (ii) barrier induced by radial electric field, recently described, that originates from gradients of charged particles in radial direction. Correlation between ionization energy of the analyte atoms with experimental emission enhancement obtained by the use of oscillating magnetic field indicates that mechanism (ii) based upon the radial electric field is predominant. The ultimate emission enhancement and possible analytical advantage is discussed

  7. Elemental analysis of bead samples using a laser-induced plasma at low pressure

    International Nuclear Information System (INIS)

    Lie, Tjung Jie; Kurniawan, Koo Hendrik; Kurniawan, Davy P.; Pardede, Marincan; Suliyanti, Maria Margaretha; Khumaeni, Ali; Natiq, Shouny A.; Abdulmadjid, Syahrun Nur; Lee, Yong Inn; Kagawa, Kiichiro; Idris, Nasrullah; Tjia, May On

    2006-01-01

    An Nd:YAG laser (1064 nm, 8 ns, 30 mJ) was focused on various types of fresh, fossilized white coral and giant shell samples, including samples of imitation shell and marble. Such samples are extremely important as material for preparing prayer beads that are extensively used in the Buddhist faith. The aim of this research was to develop a non-destructive method to distinguish original beads from their imitations by means of spectral measurements of the carbon, hydrogen, sodium and magnesium emission intensities and by measuring the hardness of the sample using the ratio between Ca (II) 396.8 nm and Ca (I) 422.6 nm. Based on these measurements, original fresh coral beads can be distinguished from any imitation made from hard wood. The same technique was also effective in distinguishing beads made of shell from its imitation. A spectral analysis of bead was also performed on a fossilized white coral sample and the result can be used to distinguish to some extent the fossilized white coral beads from any imitation made from marble. It was also found that the plasma plume should be generated at low ambient pressure to significantly improve the hydrogen and carbon emission intensity and also to avoid energy loss inside the crater during laser irradiation at atmospheric pressure. The results of this study confirm that operating the laser-induced plasma spectroscopy at reduced ambient pressure offers distinct advantage for bead analysis over the conventional laser-induced breakdown spectroscopy (LIBS) technique operated at atmospheric pressure

  8. Elemental analysis of bead samples using a laser-induced plasma at low pressure

    Energy Technology Data Exchange (ETDEWEB)

    Lie, Tjung Jie [Research Center of Maju Makmur Mandiri Foundation, 40 Srengseng Raya, Kembangan, Jakarta Barat 11630 (Indonesia); Kurniawan, Koo Hendrik [Research Center of Maju Makmur Mandiri Foundation, 40 Srengseng Raya, Kembangan, Jakarta Barat 11630 (Indonesia)]. E-mail: kurnia18@cbn.net.id; Kurniawan, Davy P. [Research Center of Maju Makmur Mandiri Foundation, 40 Srengseng Raya, Kembangan, Jakarta Barat 11630 (Indonesia); Pardede, Marincan [Research Center of Maju Makmur Mandiri Foundation, 40 Srengseng Raya, Kembangan, Jakarta Barat 11630 (Indonesia); Suliyanti, Maria Margaretha [Graduate Program in Opto Electrotechniques and Laser Applications, Faculty of Engineering, The University of Indonesia, 4 Salemba Raya, Jakarta 10430 (Indonesia); Khumaeni, Ali [Department of Physics, Faculty of Mathematics and Natural Sciences, Diponegoro University, Tembalang Campus, Semarang 50275 (Indonesia); Natiq, Shouny A. [Department of Physics, Faculty of Mathematics and Natural Sciences, Diponegoro University, Tembalang Campus, Semarang 50275 (Indonesia); Abdulmadjid, Syahrun Nur [Department of Physics, Faculty of Mathematics and Natural Sciences, Syiah Kuala University, Darussalam, Banda Aceh 23116 (Indonesia); Lee, Yong Inn [Physics Department, Chonbuk National University, Chonju 561-756, South Korea (Korea); Kagawa, Kiichiro [Department of Physics, Faculty of Education and Regional Studies, Fukui University, 9-1 bunkyo 3-chome, Fukui 910-8507 (Japan); Idris, Nasrullah [Department of Physics, Faculty of Education and Regional Studies, Fukui University, 9-1 bunkyo 3-chome, Fukui 910-8507 (Japan); Tjia, May On [Department of Physics, Faculty of Mathematics and Natural Sciences, Bandung Institute of Technology, 10 Ganesha, Bandung 40132 (Indonesia)

    2006-01-15

    An Nd:YAG laser (1064 nm, 8 ns, 30 mJ) was focused on various types of fresh, fossilized white coral and giant shell samples, including samples of imitation shell and marble. Such samples are extremely important as material for preparing prayer beads that are extensively used in the Buddhist faith. The aim of this research was to develop a non-destructive method to distinguish original beads from their imitations by means of spectral measurements of the carbon, hydrogen, sodium and magnesium emission intensities and by measuring the hardness of the sample using the ratio between Ca (II) 396.8 nm and Ca (I) 422.6 nm. Based on these measurements, original fresh coral beads can be distinguished from any imitation made from hard wood. The same technique was also effective in distinguishing beads made of shell from its imitation. A spectral analysis of bead was also performed on a fossilized white coral sample and the result can be used to distinguish to some extent the fossilized white coral beads from any imitation made from marble. It was also found that the plasma plume should be generated at low ambient pressure to significantly improve the hydrogen and carbon emission intensity and also to avoid energy loss inside the crater during laser irradiation at atmospheric pressure. The results of this study confirm that operating the laser-induced plasma spectroscopy at reduced ambient pressure offers distinct advantage for bead analysis over the conventional laser-induced breakdown spectroscopy (LIBS) technique operated at atmospheric pressure.

  9. Surgical innovations in canine gonadectomy

    NARCIS (Netherlands)

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated

  10. Developmental and radiobiologic characteristics of canine multinucleated, osteoclast-like cells generated in vitro from canine bone marrow

    International Nuclear Information System (INIS)

    Seed, T.M.; Kaspar, L.V.; Domann, F.; Niiro, G.K.; LeBuis, D.A.

    1988-01-01

    We report here our initial observations on the growth and morphology, and developmental radiosensitivity of giant, multinucleated, osteoclast-like cells (MN-OS) generated through in vitro cultivation of hematopoietic progenitor-enriched canine bone marrow samples. Maximum cell densities of 5.5 x 10(3) to 6.5 x 10(3) MN-OS per cm2 of growth area were achieved following 10 to 14 days of culture at 37 degrees C. Acute gamma irradiation of the initial marrow inocula resulted in significant, dose-dependent perturbations of MN-OS formation, growth, and development. Attempts to estimate radiosensitivity of MN-OS progenitors from canine marrow yielded a range of Do values from a low of 212 cGy measured at six days of culture to higher values of 405 to 542 cGy following 10 to 22 days of culture. At the intermediate times of culture (10 to 14 days), the radiation-induced responses were clearly biphasic, reflecting either (a) the presence of multiple subpopulations of MN-OS progenitors with varying degrees of radiosensitivity or (b) the inherent biphasic nature of MN-OS development involving early progenitor cell proliferation followed by maturation and subsequent fusion. Morphologically, MN-OS generated from irradiated marrow inocula appeared only marginally altered, with alterations expressed largely in a biphasic, dose-dependent fashion in terms of smaller cell size, reduced number of nuclei, increased expression of both surface microprojections, and a unique set of crystalloid cytoplasmic inclusions. Functionally, MN-OS appeared to be impaired by irradiation of marrow progenitors, as evidenced by failure to initiate resorptive attachments to devitalized bone spicules in vitro

  11. Comparison of Three Sample Preparation Procedures for the Quantification of L-Arginine, Asymmetric Dimethylarginine, and Symmetric Dimethylarginine in Human Plasma Using HPLC-FLD

    DEFF Research Database (Denmark)

    Schou-Pedersen, Anne Marie Voigt; Lykkesfeldt, Jens

    2018-01-01

    Increased asymmetric dimethylarginine (ADMA) in human plasma has been associated with reduced generation of nitric oxide, leading to atherosclerotic diseases. ADMA may therefore be an important biomarker for cardiovascular disease. In the present study, three sample preparation techniques were co...... sample preparation of human plasma samples before HPLC-FLD in providing important information regarding elevated ADMA concentrations.......Increased asymmetric dimethylarginine (ADMA) in human plasma has been associated with reduced generation of nitric oxide, leading to atherosclerotic diseases. ADMA may therefore be an important biomarker for cardiovascular disease. In the present study, three sample preparation techniques were...... compared regarding the quantification of L-arginine and ADMA in human plasma: (A) protein precipitation (PP) based on aqueous trichloroacetic acid (TCA), (B) PP using a mixture of ammonia and acetonitrile, and (C) solid-phase extraction (SPE). The samples were analysed by using high-performance liquid...

  12. Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

    NARCIS (Netherlands)

    Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2007-01-01

    Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

  13. Maxillary canine displacement and genetically determined predisposition to disturbed development of the dentition.

    Science.gov (United States)

    Stahl, Franka; Grabowski, Rosemarie

    2003-05-01

    The relationship between maxillary canine displacement and the simultaneous occurrence of "genetically determined predisposition to disturbed development of the dentition" as defined by Hoffmeister was investigated in 675 patients. Panoramic radiographs taken of each patient during the first and the second mixed dentition periods were evaluated. Canine inclination and the distance between the tip of the canine and a line connecting the cusps of the molars were computed in five different age groups according to Dausch-Neumann. Statistical analysis revealed 34 patients with "potential canine displacement", who exhibited further symptoms of "genetically determined predisposition to disturbed development of the dentition" significantly more frequently than the total group. The symptoms concerned were agenesia, displaced tooth buds, rotated or tilted incisors, aplasia and microdontia of lateral incisors. Careful follow-ups in patients with a predisposition to disturbed dental development enables risks to be anticipated and canine displacement to be detected at an early stage.

  14. Genotyping of Canine parvovirus in western Mexico.

    Science.gov (United States)

    Pedroza-Roldán, César; Páez-Magallan, Varinia; Charles-Niño, Claudia; Elizondo-Quiroga, Darwin; De Cervantes-Mireles, Raúl Leonel; López-Amezcua, Mario Alberto

    2015-01-01

    Canine parvovirus (CPV) is one of the most common infectious agents related to high morbidity rates in dogs. In addition, the virus is associated with severe gastroenteritis, diarrhea, and vomiting, resulting in high death rates, especially in puppies and nonvaccinated dogs. To date, there are 3 variants of the virus (CPV-2a, CPV-2b, and CPV-2c) circulating worldwide. In Mexico, reports describing the viral variants circulating in dog populations are lacking. In response to this deficiency, a total of 41 fecal samples of suspected dogs were collected from October 2013 through April 2014 in the Veterinary Hospital of the University of Guadalajara in western Mexico. From these, 24 samples resulted positive by polymerase chain reaction, and the viral variant was determined by restriction fragment length polymorphism. Five positive diagnosed samples were selected for partial sequencing of the vp2 gene and codon analysis. The results demonstrated that the current dominant viral variant in Mexico is CPV-2c. The current study describes the genotyping of CPV strains, providing valuable evidence of the dominant frequency of this virus in a dog population from western Mexico. © 2014 The Author(s).

  15. Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features

    Directory of Open Access Journals (Sweden)

    Sophie Le Poder

    2011-01-01

    Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

  16. Impact of synthetic canine cerumen on in vitro penetration of auricular skin of dogs by florfenicol, terbinafine, and betamethasone acetate.

    Science.gov (United States)

    Ehling, Sarah; Baynes, Ronald E; Bäumer, Wolfgang

    2018-03-01

    OBJECTIVE To determine the pharmacokinetics of florfenicol, terbinafine, and betamethasone acetate after topical application to canine auricular skin and the influence of synthetic canine cerumen on pharmacokinetics. SAMPLE Auricular skin from 6 euthanized shelter dogs (3 females and 3 neutered males with no visible signs of otitis externa). PROCEDURES Skin adjacent to the external opening of the ear canal was collected and prepared for use in a 2-compartment flow-through diffusion cell system to evaluate penetration of an otic gel containing florfenicol, terbinafine, and betamethasone acetate over a 24-hour period. Radiolabeled 14 C-terbinafine hydrochloride and 3 H-betamethasone acetate were added to the gel to determine dermal penetration and distribution. Florfenicol absorption was determined by use of high-performance liquid chromatography-UV detection. Additionally, the effect of synthetic canine cerumen on the pharmacokinetics of all compounds was evaluated. RESULTS During the 24-hour experiment, mean ± SD percentage absorption without the presence of synthetic canine cerumen was 0.28 ± 0.09% for 3H-betamethasone acetate, 0.06 ± 0.06% for florfenicol, and 0.06 ± 0.02% for 14C-terbinafine hydrochloride. Absorption profiles revealed no impact of synthetic canine cerumen on skin absorption for all 3 active compounds in the gel or on skin distribution of 3 H-betamethasone acetate and 14 C-terbinafine hydrochloride. CONCLUSIONS AND CLINICAL RELEVANCE 3 H-betamethasone acetate, 14 C-terbinafine hydrochloride, and florfenicol were all absorbed in vitro through healthy auricular skin specimens within the first 24 hours after topical application. Synthetic canine cerumen had no impact on dermal absorption in vitro, but it may serve as a temporary reservoir that prolongs the release of topical drugs.

  17. Two-compartment, two-sample technique for accurate estimation of effective renal plasma flow: Theoretical development and comparison with other methods

    International Nuclear Information System (INIS)

    Lear, J.L.; Feyerabend, A.; Gregory, C.

    1989-01-01

    Discordance between effective renal plasma flow (ERPF) measurements from radionuclide techniques that use single versus multiple plasma samples was investigated. In particular, the authors determined whether effects of variations in distribution volume (Vd) of iodine-131 iodohippurate on measurement of ERPF could be ignored, an assumption implicit in the single-sample technique. The influence of Vd on ERPF was found to be significant, a factor indicating an important and previously unappreciated source of error in the single-sample technique. Therefore, a new two-compartment, two-plasma-sample technique was developed on the basis of the observations that while variations in Vd occur from patient to patient, the relationship between intravascular and extravascular components of Vd and the rate of iodohippurate exchange between the components are stable throughout a wide range of physiologic and pathologic conditions. The new technique was applied in a series of 30 studies in 19 patients. Results were compared with those achieved with the reference, single-sample, and slope-intercept techniques. The new two-compartment, two-sample technique yielded estimates of ERPF that more closely agreed with the reference multiple-sample method than either the single-sample or slope-intercept techniques

  18. THE REDUCED CANINE PANCREAS TO STUDY THE EFFECTS OF INTRAOPERATIVE RADIOTHERAPY

    NARCIS (Netherlands)

    HEIJMANS, HJ; MEHTA, D; KLEIBEUKER, JH; SLUITER, WJ; HOEKSTRA, HJ

    1993-01-01

    A canine model is described to study the tolerance of the pancreas to intra-operative radiotherapy (IORT). The canine pancreas is a horseshoe-shaped organ. To create a homogeneous delivery of IORT to the whole pancreas surgical manipulation is necessary which may induce pancreatitis. A resection of

  19. An attempt to validate serum and plasma as sample matrices for analyses of polychlorobiphenylols

    Energy Technology Data Exchange (ETDEWEB)

    Weiss, J.; Bergman, Aa. [Stockholm Univ. (Sweden). Dept. of Environmental Chemistry; Bignert, A. [Museum of Natural History (Sweden)

    2004-09-15

    Polychlorinated biphenyls (PCBs) form hydroxylated metabolites (OH-PCBs), as reported both from wildlife and from experimental animal studies already in the early 1970s'. However, the interest increased in OH-PCBs from the mid 1990s' depending on the discovery that some OHPCB congeners are strongly retained in the blood of birds, fish and mammals, including humans. The interest is linked to the fact that OH-PCBs is strongly, but reversibly, bound to the blood protein transthyretin (TTR). It is reasonable to believe that the strong TTR binding may have toxicological impact, probably related to endocrine type effects. Importantly, OH-PCBs are present in blood at far higher concentrations than in any other compartment in the body, which is dependent on the physico-chemical characteristics of the phenols. Analyses of OH-PCBs have thus been concentrated to whole blood, plasma or serum. Still there is no comparison between the three sample types even though it is clear that whole blood is not optimal due to the large proportion of haemoglobin in the sample that make the clean up more difficult than if plasma or serum is selected for analysis. In the present study we have addressed two questions: First we have looked at any potential differences in the analytical results of OH-PCBs when using serum and plasma for extraction and clean up; Second, the serum and plasma applied in the validation has been unfrozen, frozen (at -20 C) for two months and frozen for twenty months, respectively.

  20. Laparoscopic radical prostatectomy in the canine model.

    Science.gov (United States)

    Price, D T; Chari, R S; Neighbors, J D; Eubanks, S; Schuessler, W W; Preminger, G M

    1996-12-01

    The purpose of this study was to determine the feasibility of performing laparoscopic radical prostatectomy in a canine model. Laparoscopic radical prostatectomy was performed on six adult male canines. A new endoscopic needle driver was used to construct a secure vesicourethral anastomosis. Average operative time required to complete the procedure was 304 min (range 270-345 min). Dissection of the prostate gland took an average of 67 min (range 35-90 min), and construction of the vesicourethral anastomosis took 154 min (rage 80-240 min). There were no intraoperative complications and only one postoperative complication (anastomotic leak). Five of the six animals recovered uneventfully from the procedure, and their foley catheters were removed 10-14 days postoperatively after a retrograde cystourethrogram demonstrated an intact vesicourethral anastomosis. Four (80%) of the surviving animals were clinically continent within 10 days after catheter removal. Post mortem examination confirmed that the vesicourethral anastomosis was intact with no evidence of urine extravasation. These data demonstrate the feasibility of laparoscopic radical prostatectomy in a canine model, and suggest that additional work with this technique should be continued to develop its potential clinical application.