WorldWideScience

Sample records for canine nasal tumors

  1. Use of an image-guided robotic radiosurgery system for the treatment of canine nonlymphomatous nasal tumors.

    Science.gov (United States)

    Glasser, Seth A; Charney, Sarah; Dervisis, Nikolaos G; Witten, Matthew R; Ettinger, Susan; Berg, Jason; Joseph, Richard

    2014-01-01

    An image-guided robotic stereotactic radiosurgery (SRS) system can be used to deliver curative-intent radiation in either single fraction or hypofractionated doses. Medical records for 19 dogs with nonlymphomatous nasal tumors treated with hypofractionated image-guided robotic stereotactic body radiotherapy (SBRT), either with or without adjunctive treatment, were retrospectively analyzed for survival and prognostic factors. Median survival time (MST) was evaluated using Kaplan-Meier survival curves. Age, breed, tumor type, stage, tumor size, prescribed radiation dose, and heterogeneity index were analyzed for prognostic significance. Dogs were treated with three consecutive-day, 8-12 gray (Gy) fractions of image-guided robotic SBRT. Overall MST was 399 days. No significant prognostic factors were identified. Acute side effects were rare and mild. Late side effects included one dog with an oronasal fistula and six dogs with seizures. In three of six dogs, seizures were a presenting complaint prior to SBRT. The cause of seizures in the remaining three dogs could not be definitively determined due to lack of follow-up computed tomography (CT) imaging. The seizures could have been related to either progression of disease or late radiation effect. Results indicate that image-guided robotic SBRT, either with or without adjunctive therapy, for canine nonlymphomatous nasal tumors provides comparable survival times (STs) to daily fractionated megavoltage radiation with fewer required fractions and fewer acute side effects. PMID:24446402

  2. Molecular Imaging Biomarkers of Resistance to Radiation Therapy for Spontaneous Nasal Tumors in Canines

    International Nuclear Information System (INIS)

    Purpose: Imaging biomarkers of resistance to radiation therapy can inform and guide treatment management. Most studies have so far focused on assessing a single imaging biomarker. The goal of this study was to explore a number of different molecular imaging biomarkers as surrogates of resistance to radiation therapy. Methods and Materials: Twenty-two canine patients with spontaneous sinonasal tumors were treated with accelerated hypofractionated radiation therapy, receiving either 10 fractions of 4.2 Gy each or 10 fractions of 5.0 Gy each to the gross tumor volume. Patients underwent fluorodeoxyglucose (FDG)-, fluorothymidine (FLT)-, and Cu(II)-diacetyl-bis(N4-methylthiosemicarbazone) (Cu-ATSM)-labeled positron emission tomography/computed tomography (PET/CT) imaging before therapy and FLT and Cu-ATSM PET/CT imaging during therapy. In addition to conventional maximum and mean standardized uptake values (SUVmax; SUVmean) measurements, imaging metrics providing response and spatiotemporal information were extracted for each patient. Progression-free survival was assessed according to response evaluation criteria in solid tumor. The prognostic value of each imaging biomarker was evaluated using univariable Cox proportional hazards regression. Multivariable analysis was also performed but was restricted to 2 predictor variables due to the limited number of patients. The best bivariable model was selected according to pseudo-R2. Results: The following variables were significantly associated with poor clinical outcome following radiation therapy according to univariable analysis: tumor volume (P=.011), midtreatment FLT SUVmean (P=.018), and midtreatment FLT SUVmax (P=.006). Large decreases in FLT SUVmean from pretreatment to midtreatment were associated with worse clinical outcome (P=.013). In the bivariable model, the best 2-variable combination for predicting poor outcome was high midtreatment FLT SUVmax (P=.022) in combination with large FLT response from

  3. Molecular Imaging Biomarkers of Resistance to Radiation Therapy for Spontaneous Nasal Tumors in Canines

    Energy Technology Data Exchange (ETDEWEB)

    Bradshaw, Tyler J. [Department of Medical Physics, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States); Bowen, Stephen R. [Departments of Radiation Oncology and Radiology, University of Washington, Seattle, Washington (United States); Deveau, Michael A. [Department of Small Animal Clinical Sciences, Texas A& M University, College Station, Texas (United States); Kubicek, Lyndsay [Angell Animal Medical Center, Boston, Massachusetts (United States); White, Pamela [Department of Surgical Sciences, School of Veterinary Medicine, University of Wisconsin-Madison, Madison, Wisconsin (United States); Bentzen, Søren M. [Division of Biostatistics and Bioinformatics, University of Maryland Greenebaum Cancer Center, and Department of Epidemiology and Public Health, University of Maryland School of Medicine, Baltimore, Maryland (United States); Chappell, Richard J. [Department of Biostatistics and Medical Informatics, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States); Forrest, Lisa J. [Department of Surgical Sciences, School of Veterinary Medicine, University of Wisconsin-Madison, Madison, Wisconsin (United States); Jeraj, Robert, E-mail: rjeraj@wisc.edu [Department of Medical Physics, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States); Department of Human Oncology, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States)

    2015-03-15

    Purpose: Imaging biomarkers of resistance to radiation therapy can inform and guide treatment management. Most studies have so far focused on assessing a single imaging biomarker. The goal of this study was to explore a number of different molecular imaging biomarkers as surrogates of resistance to radiation therapy. Methods and Materials: Twenty-two canine patients with spontaneous sinonasal tumors were treated with accelerated hypofractionated radiation therapy, receiving either 10 fractions of 4.2 Gy each or 10 fractions of 5.0 Gy each to the gross tumor volume. Patients underwent fluorodeoxyglucose (FDG)-, fluorothymidine (FLT)-, and Cu(II)-diacetyl-bis(N4-methylthiosemicarbazone) (Cu-ATSM)-labeled positron emission tomography/computed tomography (PET/CT) imaging before therapy and FLT and Cu-ATSM PET/CT imaging during therapy. In addition to conventional maximum and mean standardized uptake values (SUV{sub max}; SUV{sub mean}) measurements, imaging metrics providing response and spatiotemporal information were extracted for each patient. Progression-free survival was assessed according to response evaluation criteria in solid tumor. The prognostic value of each imaging biomarker was evaluated using univariable Cox proportional hazards regression. Multivariable analysis was also performed but was restricted to 2 predictor variables due to the limited number of patients. The best bivariable model was selected according to pseudo-R{sup 2}. Results: The following variables were significantly associated with poor clinical outcome following radiation therapy according to univariable analysis: tumor volume (P=.011), midtreatment FLT SUV{sub mean} (P=.018), and midtreatment FLT SUV{sub max} (P=.006). Large decreases in FLT SUV{sub mean} from pretreatment to midtreatment were associated with worse clinical outcome (P=.013). In the bivariable model, the best 2-variable combination for predicting poor outcome was high midtreatment FLT SUV{sub max} (P=.022) in

  4. Canine and feline nasal neoplasia.

    Science.gov (United States)

    Malinowski, Christine

    2006-05-01

    Dogs and cats of our society have outgrown their status as merely pets and are now considered our close companions and even family members. This shift in their roles has led to pet owners seeking improved preventative medicine for their four-legged friends. Subsequently, dogs and cats are living longer lives than ever before and developing more old-age-related diseases. One of the most devastating diseases of older animals is cancer. Once a veterinarian has detected cancer in a pet, pet owners seek advice on their next course of action. This article is intended to provide concise information regarding the diagnosis and treatment of intranasal tumors of the dog and cat. This article outlines the forms of nasal tumors that are the most common, the recommended imaging and biopsy techniques to diagnose the tumor, and the most appropriate treatments of them. PMID:16711615

  5. Canine mast cell tumors.

    Science.gov (United States)

    Macy, D W

    1985-07-01

    Despite the fact that the mast cell tumor is a common neoplasm of the dog, we still have only a meager understanding of its etiology and biologic behavior. Many of the published recommendations for treatment are based on opinion rather than facts derived from careful studies and should be viewed with some skepticism. Because of the infrequent occurrence of this tumor in man, only a limited amount of help can be expected from human oncologists; therefore, burden of responsibility for progress in predicting behavior and developing treatment effective for canine mast cell tumors must fall on the shoulders of the veterinary profession. PMID:3929444

  6. CT findings of malignant nasal cavity tumors

    International Nuclear Information System (INIS)

    To evaluate the CT findings of malignant nasal cavity tumors. Retrospective analysis was performed on 20 patients with pathologically-proven malignant nasal cavity tumors. Using CT, we analysed their location, extent of bone destruction and of involvement of adjacent structures, and enhancing pattern. A total of 20 cases included nine squamous cell carcinomas, three olfactory neuroblastomas, three lymphomas, two polymorphic reticulosis, one adenoid cystic carcinoma, one undifferentiated carcinoma and one metastasis from renal cell carcinoma. All cases except one adenoid cystic carcinoma and one squamous cell carcinoma revealed bone destruction or erosion. Aggressive bone destruction and irregular enhancement were seen in eight cases of squamous cell carcinoma, seven cases of which showed involvement of the adjacent paranasal sinuses, nasopharynx, and orbit. Olfactory neuroblastomas were centered in the superior nasal cavity and the adjacent ethmoid sinus, and erosion or destruction of the cribriform plate had occurred. Lymphomas showed bilateral involvement, with uniform contrast enhancement. Polymorphic reticuloses showed perforation or erosion of the nasal septum, with bilateral involvement of the nasal cavity. The location, presence of bone destruction, involvement of adjacent structures, and enhancement pattern of tumor on CT can be helpful for the differential diagnosis of malignant nasal cavity tumors

  7. Tumor relapse present in oncologic nasal repair

    International Nuclear Information System (INIS)

    Introduction: Tumor relapse is one of the more fearsome complications of the oncologic course and also to obscure the life prognosis, causing the loss of many reconstructions and of exhausting the repairing surgical possibilities. The aim of this study was to determine the relapse frequency, the repercussion on the repair and the subsequent medical course of patients operated on malign nasal tumors. Methods: We made a retrospective and descriptive study in 20 patients operated on malign nasal tumors with immediate repair using frontal flap. Patients came from National Institute of Oncology and Radiobiology (NIOR), where they were seen from 2002 and 2007. Results: There were two relapses in 5 patients (25% of total), and the 80% of these were an epidermoid carcinoma. All patients with relapse lost the repaired tissues and received radiotherapy. Only it was possible to repair the defect in one of the patients; two of remained deceased, and were alive, without tumor relapse but without possibilities of repair. Conclusions: Considering the relapse frequency of nasal epidermoid carcinomas and of its repercussions when the Mhos histography technique is not available, it is advisable to delay the nasal repair until will be possible to confirm completely the histology of tumor exeresis. (author)

  8. Canine mammary tumors - clinical survey

    Directory of Open Access Journals (Sweden)

    Elena Atanaskova Petrov

    2014-10-01

    Full Text Available Mammary tumours are the second most frequent neoplasia in dogs, mainly affecting older female patients. Approximately 50% of the mammary tumours are malignant with high percentage of mortality if not treated in time. The aim of this study was to analyze the data of canine patients with mammary tumours, to evaluate the type of tumours, as well as the relationship between tumour incidence and dogs’ age, reproductive cycle and sterilization. The survey was used to retrieve the information in the period of two years from the patient data base of the University Veterinary Hospital at the Faculty of Veterinary medicine in Skopje. Patients included in this survey were subjected to routine clinical investigation and additional laboratory tests (cytological examination, x-rays imaging, CBC and biochemical profile, histopathology of the tumor samples. Aged female patients (12 – 13 years are the most susceptible category for development of mammary tumours. The reproductive history showed that five of the patients with malignant mammary tumourshave never whelped and were not treated with any exogenous hormones. Malignant tumours (adenocarcinoma were diagnosed in 90% of the patients. Three patients died due to lung metastasis. Late diagnosis is one of the major problems that results in lethal outcome due to lung metastases. Since ovarian steroids play an important role in the aetiology, the most effective prevention of mammary tumoursis elective ovariectomy of the bitch at an early age.

  9. TVT NASALTumor Venéreo Transmissível- um caso clínico

    Directory of Open Access Journals (Sweden)

    CANAL, Ivo Hellmeister; DAGLI, Maria Lucia Zaidan; TORRES, Luciana Neves; PIVETA , Lidiana Cândida; CANAL, Raoní Bertelli.

    2005-02-01

    Full Text Available The authors do a revision of CTVT - Canine Transmissible Venereal Tumor – clinic, diagnostic and treatment from a clinical case in nasal cavity and describes a complete protocol for the treatment using biotechniques and anti-tumor medication. Vincristine and ciclofosfamide like chemotherapeutic management and anti-tumor medication, and Interferon in low and oral doses with Levamisol, immune modulator, like a biotherapy. A bibliography revision. This description is the most recent and complete treatment used by the clinic.

  10. Canine mammary tumors - clinical survey

    OpenAIRE

    Elena Atanaskova Petrov; Ksenija Ilievska; Plamen Trojacanec; Irena Celeska; Goran Nikolovski; Ivica Gjurovski; Toni Dovenski

    2014-01-01

    Mammary tumours are the second most frequent neoplasia in dogs, mainly affecting older female patients. Approximately 50% of the mammary tumours are malignant with high percentage of mortality if not treated in time. The aim of this study was to analyze the data of canine patients with mammary tumours, to evaluate the type of tumours, as well as the relationship between tumour incidence and dogs’ age, reproductive cycle and sterilization. The survey was used to retrieve the information in the...

  11. Computed tomographic anatomy of the canine nasal passages

    International Nuclear Information System (INIS)

    A normal German shepherd dog underwent CT imaging with contiguous 10 mm thick images made of the nasal cavity from the caudal limit of the frontal sinuses to the rostral aspect of the nose. Normal structures were identified. This normal anatomic information will be of use in assessing CT images of dogs suspected of having nasal cavity disease

  12. Complete Sequence of Enzootic Nasal Tumor Virus, a Retrovirus Associated with Transmissible Intranasal Tumors of Sheep

    OpenAIRE

    Cousens, Christina; Minguijon, Esmeralda; Dalziel, Robert G.; Ortin, Aurora; Garcia, Mercedes; Park, Jane; Gonzalez, Lorenzo; Sharp, J. Michael; De las Heras, Marcelo

    1999-01-01

    The sequence of the complete genome of ovine enzootic nasal tumor virus, an exogenous retrovirus associated exclusively with contagious intranasal tumors of sheep, was determined. The genome is 7,434 nucleotides long and exhibits a genetic organization characteristic of type B and D oncoviruses. Enzootic nasal tumor virus is closely related to the Jaagsiekte sheep retrovirus and to sheep endogenous retroviruses.

  13. Squamous cell carcinoma of the canine nasal cavity and frontal sinus: eight cases

    International Nuclear Information System (INIS)

    Squamous cell carcinoma of the canine nasal cavity and frontal sinus was diagnosed in eight cases between May 1988 and April 1994. The most common presenting complaints were nasal discharge, including epistaxis; sneezing; and facial deformity or exophthalmos. Metastasis was not identified in any case, but bone lysis and invasion into tissues outside the nasal cavity were noted in five cases. Computed tomograms were performed in five cases and were more useful than radiographs in determining the extent of neoplastic involvement. Euthanasia was performed within one week of diagnosis in three cases at the owner's request; one case died at home within one month; and the remaining four cases were euthanized within eight months due to progressive clinical signs. The mean survival time in these eight cases was three months, with a range of zero weeks to eight months

  14. Alpha basic crystallin expression in canine mammary tumors

    OpenAIRE

    Guvenc, Tolga; Gulbahar, Mustafa Yavuz; YARIM, Murat; Kabak, Yonca Betil; Karayigit, Onder; Sozmen, Mahmut

    2012-01-01

    The aim of this study was to evaluate prognostic and/or diagnostic factors of canine mammary tumors by immunohistochemically analyzing the expression of alpha basic crystallin (αB-c). For this, formalin-fixed, paraffin-embedded blocks of 51 naturally-occurring canine mammary tumors (11 benign and 40 malignant) were used. Tissue from eight normal canine mammary glands were served as a control. Immunohistochemically, in the control mammary tissues, a few luminal epithelial cells were αB-c posit...

  15. Classification and grading of canine malignant mammary tumors

    OpenAIRE

    Abbas Tavasoly; Hannaneh Golshahi; Annahita Rezaie; Mohammad Farhadi

    2013-01-01

    Histological grading is a good parameter to stratify tumors according to their biological aggressiveness. The Elston and Ellis grading method in humans, invasive ductal breast carcinomas and other invasive tumors are routinely used. The aims of this study were classification of mammary gland tumors and also application of a human grading method in canine mammary carcinoma. The samples included 37 tumors of mammary glands. Mammary tumors were carcinomas (n = 32) and sarcomas (n = 5). The carci...

  16. Retrospective study of canine epithelial and melanocytic tumors

    OpenAIRE

    Aleksić-Kovačević Sanja; Kukolj V.; Marinković D.; Knežević Milijana A.

    2005-01-01

    Out of the total number of canine tumors examined at the Department of pathology based on biopsy and section materials over the last five years skin tumors and mammary gland tumors were proved to be the two largest groups diagnosed in 33.4% and 36% of cases, respectively. Cutaneous tumors were diagnosed in 211 cases, i.e., in 123 (58.3%) male dogs and 88 (41.7%) bitches, of different breeds, on average 7 years old. Among the total number of 211 skin tumors, 32 types of cutaneous neoplasms wer...

  17. Electrogene therapy with interleukin-12 in canine mast cell tumors

    International Nuclear Information System (INIS)

    Mast cell tumors (MCT) are the most common malignant cutaneous tumors in dogs with extremely variable biological behaviour. Different treatment approaches can be used in canine cutaneous MCT, with surgical excision being the treatment of choice. In this study, electrogene therapy (EGT) as a new therapeutic approach to canine MCTs, was established. Eight dogs with a total of eleven cutaneous MCTs were treated with intratumoral EGT using DNA plasmid encoding human interleukin-12 (IL-12). The local response to the therapy was evaluated by repeated measurements of tumor size and histological examination of treated tumors. A possible systemic response was assessed by determination of IL-12 and interferon- γ (IFN-γ) in patients’ sera. The occurence of side effects was monitored with weekly clinical examinations of treated animals and by performing basic bloodwork, consisting of the complete bloodcount and determination of selected biochemistry parameters. Intratumoral EGT with IL-12 elicits significant reduction of treated tumors’ size, ranging from 13% to 83% (median 50%) of the initial tumor volume. Additionally, a change in the histological structure of treated nodules was seen. There was a reduction in number of malignant mast cells and inflammatory cell infiltration of treated tumors. Systemic release of IL-12 in four patients was detected, without any noticeable local or systemic side effects. These data suggest that intratumoral EGT with plasmid encoding IL-12 may be useful in the treatment of canine MCTs, exerting a local antitumor effect

  18. Cytological diagnostic of canine transmissible venereal tumor - Case report

    Directory of Open Access Journals (Sweden)

    Ulčar Igor

    2012-01-01

    Full Text Available Canine Transmissible Venereal Tumor (CTVT is a benign reticuloendothelial (histiocytic tumor of the dog that mainly affects the external genitalia. This tumor was found in male 2 years old mongrel dog. According the anamnestic data, there was no visible change of its general clinical status, except spontaneous bleeding with blood drops on the praeputium and the presence of blood in the urine. With clinical examination a multilobular mass on radix penis mucosa was found, which actually caused pseudohemorrhagia. The material for cytological diagnostic was taken with the imprint method and 4 cytological films were prepared and strained. The conclusion of the cytological diagnosis was CTVT. The tumor cause only local disturbances, and the differential diagnosis of the other "round cells tumors", histiocytomas, plasmacytomas, lymphoma, some melanomas and especially lymphosarcomas, which could be located on the external genitalia, had a big significance. Although some authors are mentioning spontaneous regression, however, because this is invasive tumor, a complete chirurgical excision was made.

  19. Survivin and related proteins in canine mammary tumors: immunohistochemical expression.

    Science.gov (United States)

    Bongiovanni, L; Romanucci, M; Malatesta, D; D'Andrea, A; Ciccarelli, A; Della Salda, L

    2015-03-01

    Survivin is reexpressed in most human breast cancers, where its expression has been associated with tumor aggressiveness, poor prognosis, and poor response to therapy. Survivin expression was evaluated in 41 malignant canine mammary tumors (CMTs) by immunohistochemistry, in relation to histological grade and stage, and correlated with that of some related molecules (β-catenin, caspase 3, heat shock proteins) to understand their possible role in canine mammary tumorigenesis. An increase in nuclear survivin expression, compared with healthy mammary glands, was observed in CMTs, where nuclear immunolabeling was related to the presence of necrosis. No statistically significant relation was found between the expression of the investigated molecules and the histological grade or stage. The present study may suggest an important involvement of survivin in CMT tumorigenesis. Its overexpression in most of the cases evaluated might suggest that targeting survivin in CMTs may be a valid anticancer therapy. PMID:24686389

  20. Retrospective study of canine epithelial and melanocytic tumors

    Directory of Open Access Journals (Sweden)

    Aleksić-Kovačević Sanja

    2005-01-01

    Full Text Available Out of the total number of canine tumors examined at the Department of pathology based on biopsy and section materials over the last five years skin tumors and mammary gland tumors were proved to be the two largest groups diagnosed in 33.4% and 36% of cases, respectively. Cutaneous tumors were diagnosed in 211 cases, i.e., in 123 (58.3% male dogs and 88 (41.7% bitches, of different breeds, on average 7 years old. Among the total number of 211 skin tumors, 32 types of cutaneous neoplasms were diagnosed, with epithelial and melanocytic tumors being the most predominant, followed by hematopoietic tumors and mesenchymal tumors of the skin and soft tissues. In our bioptic and section materials, epithelial and melanocytic skin tumors were the most frequent -123 cases (58.75% with four subgroups within the group tumors with adnexal differentiation - 66 cases (53.23% of all epithelial and melanocytic skin tumors, epidermal tumors - 25 cases (20.16% of all epithelial and melanocytic skin tumors, tumors without squamous or adnexal differentiation -16 cases (12.90% of all epithelial and melanocytic skin tumors and finally melanocytic tumors -14 cases (11.29% of all epithelial and melanocytic skin tumors. The age of dogs with epithelial and melanocytic cutaneous tumors ranged between 5 months to 15 years. The fact that the number of skin tumors diagnosed in 1999 was doubled in 2002 is of particular importance, which may be, the result of increasingly high interest of clinicians for biopsy-based diagnosis.

  1. ULTRASONOGRAPHIC FEATURES OF CANINE GASTROINTESTINAL STROMAL TUMORS COMPARED TO OTHER GASTROINTESTINAL SPINDLE CELL TUMORS.

    Science.gov (United States)

    Hobbs, Joshua; Sutherland-Smith, James; Penninck, Dominique; Jennings, Samuel; Barber, Lisa; Barton, Bruce

    2015-01-01

    Canine gastrointestinal stromal tumors (GISTs) are a recent subtype of gastrointestinal spindle cell tumor recognized with the increasing use of immunohistochemistry. To our knowledge, no imaging features have been described in immunostochemically confirmed canine GISTs. The objective of this retrospective, cross-sectional study was to describe ultrasonographic features of canine GISTs compared with other spindle cell tumors. Thirty-seven dogs with an ultrasonographically visible gastrointestinal mass and a histopathologic diagnosis of spindle cell neoplasia were examined. Immunohistochemistry staining was performed for retrieved tissue samples to further differentiate the tumor type and each sample was interpreted by a single veterinary pathologist. Ultrasonographic features recorded examined included mass echogenicity, homogeneity, presence of cavitation, layer of origin, bowel wall symmetry, and loss of wall layering, location, size, vascularity, and evidence of perforation or ulceration. Tumor types included 19 GISTs, eight leiomyosarcomas, six leiomyomas, and four nonspecified sarcomas. Gastrointestinal stromal tumors were significantly more likely to be associated (P < 0.03) with abdominal effusion than other tumor types. There was overlap between the anatomical locations of all tumors types with the exception of the cecum where all eight tumors identified were GISTs. Besides location, there were no unique ultrasound features of GISTs that would allow distinction from other gastrointestinal spindle cell tumors. Similar to previous studies, GISTs appeared to be the most common spindle cell tumor associated with the cecum in our sample of dogs. The high frequency of abdominal effusion with GIST's was of unknown etiology could possibly have been due to septic peritonitis. PMID:25846814

  2. Immunohistochemical detection of estrogen receptors in canine mammary tumors

    Directory of Open Access Journals (Sweden)

    Elena Atanaskova Petrov

    2016-03-01

    Full Text Available Mammary tumors are among the most common neoplasms in intact female dogs.They have a complex morphology, usually affecting middle age and older bitches. Almost 50% of the mammary tumors in dogs are malignant neoplasms. Prognosis is based on several factors: stage, age, tumor size, metastasis, histopathology, ovariectomy status and hormone-receptor activity. Immunohistochemical (IHC measurement has become increasingly an important diagnostic and prognostic parameter, with the development of monoclonal antibodies against nuclear estrogen and progestin receptors. The aim of this study was to detect the presence of ER receptors in malignant canine mammary tumors and to identify their association with the clinical course of the tumor. Mammary tumor samples have been obtained by mastectomy from dogs presented at our clinic. Detailed clinical examination, CBC and basic serum biochemical profile were performed in all patients. Surgery was the only treatment. Histopathological examination and immunohistochemical detection of estrogen α receptors (ERα was performed on 8 formalin-fixed, paraffin-embedded tissue samples, using the PT LINK immunoperoxidase technique. Histopathological examination of the mammary tumor samples (n=11 revealed tubular adenocarcinoma (n=6,54.5% and ductal adenocarcinoma (n=3, 27.3%, one patient with benign adenoma and one with mastitis. Patients with positive ER tumors are alive, without remission, while 3 of the patients that were ER negative died due to lung metastases. According to our results, it can be concluded that the appearance and development of canine mammary tumors is highly connected with ovarian steroid hormones and that immunostaining of the tumors may be used as a good prognostic parameter in these patients.

  3. DCEMRI of spontaneous canine tumors during fractionated radiotherapy: A pharmacokinetic analysis

    International Nuclear Information System (INIS)

    Purpose: To estimate pharmacokinetic parameters from dynamic contrast-enhanced magnetic resonance (DCEMR) images of spontaneous canine tumors taken during the course of fractionated radiotherapy, and to quantify treatment-induced changes in these parameters. Materials and methods: Six dogs with tumors in the oral or nasal cavity received fractionated conformal radiotherapy with 54 Gy given in 18 fractions. T1-weighted DCEMR imaging was performed prior to each treatment fraction. Time-intensity curves in the tumor were extracted voxel-by-voxel, and were fitted to the Brix pharmacokinetic model. The dependence of the pharmacokinetic parameters on the accumulated radiation dose was calculated. Results: The Brix model reproduced the time-intensity curves well. A reduction in the kep parameter with accumulated radiation dose was found for five (three significant) out of six cases, while the results for the A parameter were less consistent. Both pre-treatment kep and the change in kep with accumulated dose correlated significantly with tumor regression. Conclusions: Pharmacokinetic parameters derived from DCEMR images taken during fractionated radiotherapy may predict response to radiotherapy. This may potentially impact on patient stratification and monitoring of treatment response for image-guided treatment strategies.

  4. Comparative expression pathway analysis of human and canine mammary tumors

    Directory of Open Access Journals (Sweden)

    Marconato Laura

    2009-03-01

    Full Text Available Abstract Background Spontaneous tumors in dog have been demonstrated to share many features with their human counterparts, including relevant molecular targets, histological appearance, genetics, biological behavior and response to conventional treatments. Mammary tumors in dog therefore provide an attractive alternative to more classical mouse models, such as transgenics or xenografts, where the tumour is artificially induced. To assess the extent to which dog tumors represent clinically significant human phenotypes, we performed the first genome-wide comparative analysis of transcriptional changes occurring in mammary tumors of the two species, with particular focus on the molecular pathways involved. Results We analyzed human and dog gene expression data derived from both tumor and normal mammary samples. By analyzing the expression levels of about ten thousand dog/human orthologous genes we observed a significant overlap of genes deregulated in the mammary tumor samples, as compared to their normal counterparts. Pathway analysis of gene expression data revealed a great degree of similarity in the perturbation of many cancer-related pathways, including the 'PI3K/AKT', 'KRAS', 'PTEN', 'WNT-beta catenin' and 'MAPK cascade'. Moreover, we show that the transcriptional relationships between different gene signatures observed in human breast cancer are largely maintained in the canine model, suggesting a close interspecies similarity in the network of cancer signalling circuitries. Conclusion Our data confirm and further strengthen the value of the canine mammary cancer model and open up new perspectives for the evaluation of novel cancer therapeutics and the development of prognostic and diagnostic biomarkers to be used in clinical studies.

  5. Selective intra arterial infusion chemotherapy for malignant nasal and paranasal sinus tumors

    International Nuclear Information System (INIS)

    Since 1998, we have treated 14 malignant nasal and paranasal sinus tumor patients with selective intra arterial infusion chemotherapy. We report results for 7 of maxillary sinus, 3 of sphenoid sinus 1 of ethmoid sinus, and 3 of the nasal cavity. Only 1 maxillary sinus case involved recurrence. Intra arterial infusions of cisplatin (100 mg/body) was delivered rapidly to the tumor and usually repeated for 4 times. Conventional external-beam irradiation (2 Gy per fraction x 30) was also used. Complete response cases were 9 of 14 and control of the local lesion found in all new cases. These results indicate that intra arterial infusion therapy is effective against advanced malignant nasal and paranasal sinus tumors. (author)

  6. Development of brachytherapy technique for nasal tumors in dogs

    International Nuclear Information System (INIS)

    Two groups of 4 dogs underwent nasal and ethmoidal turbinectomies followed by irradiation (mean minimal) doses of 5,390 and 6,550 cGy of radiation, respectively from implanted intracavitary sources of iridium 192. Two dogs from each group were euthanatized for histologic evaluation at 3 months after irradiation. The remaining 2 dogs from each group were euthanatized for similar evaluation at 6 months after irradiation. During the course of the study, few clinical complications were encountered. Histologic evaluation of the tissues forming the nasal passages revealed loss of epithelial lining and fibrous tissue replacement of surrounding bone. A direct correlation of pathologic changes could not be associated with the amount of radiation received, but there seemed to be a tendency for greater change in those dogs given higher doses and those kept alive for 6 months

  7. Retrospective canine skin peripheral nerve sheath tumors data with emphasis on histologic, immunohistochemical and prognostic factors

    OpenAIRE

    Gisele S. Boos; Daniele M. Bassuino; Fabiana Wurster; Neusa B. Castro; Tatiane T.N. Watanabe; Gustavo S. Silva; Luciana Sonne; David Driemeier

    2015-01-01

    Abstract: In this retrospective study was determined the frequency of canine skin peripheral nerve sheath tumors (PNST) in cases diagnosed by the Setor de Patologia Veterinária of the Universidade Federal do Rio Grande do Sul (SPV-UFRGS), Brazil, between the years 2000 and 2012. The canine profiles, as well as histological, immunohistochemical and prognostic aspects of the tumors were based on 70 samples, comprising 40 females, 29 males and one unspecified sample. Between 2000 and 2012, 2,984...

  8. Canine parvovirus NS1 protein exhibits anti-tumor activity in a mouse mammary tumor model.

    Science.gov (United States)

    Gupta, Shishir Kumar; Yadav, Pavan Kumar; Gandham, Ravi Kumar; Sahoo, A P; Harish, D R; Singh, Arvind Kumar; Tiwari, A K

    2016-02-01

    Many viral proteins have the ability to kill tumor cells specifically without harming the normal cells. These proteins, on ectopic expression, cause lysis or induction of apoptosis in the target tumor cells. Parvovirus NS1 is one of such proteins, which is known to kill high proliferating tumor cells. In the present study, we assessed the apoptosis inducing ability of canine parvovirus type 2 NS1 protein (CPV2.NS1) in vitro in 4T1 cells, and found it to cause significant cell death due to induction of apoptosis through intrinsic or mitochondrial pathway. Further, we also evaluated the oncolytic activity of CPV2.NS1 protein in a mouse mammary tumor model. The results suggested that CPV2.NS1 was able to inhibit the growth of 4T1 induced mouse mammary tumor as indicated by significantly reduced tumor volume, mitotic, AgNOR and PCNA indices. Further, inhibition of tumor growth was found to be because of induction of apoptosis in the tumor cells, which was evident by a significant increase in the number of TUNEL positive cells. Further, CPV2.NS1 was also able to stimulate the immune cells against the tumor antigens as indicated by the increased CD4+ and CD8+ counts in the blood of CVP2.NS1 treated mice. Further optimization of the delivery of NS1 protein and use of an adjuvant may further enhance its anti-tumor activity. PMID:26739427

  9. Orthovoltage radiation of normal canine nasal passages: assessment of depth dose

    International Nuclear Information System (INIS)

    Frozen heads of 9 clinically normal dogs were irradiated with orthovoltage x-rays. Surface doses and nasal cavity depth doses were measured, and the percentage of surface dose (depth dose) was calculated at random depths from the dorsal cutaneous surface in transverse planes through the medial and lateral canthi. Depth dose of 2 orthovoltage x-ray beams having half-value layers of 1.5 mm of Cu (96 keV) and 2.6 mm of Cu (134 keV) were compared with and found to resemble that reported in depth dose tables based on soft tissue equivalent material. Any differences (identified graphically) in depth dose, compared with that described using a uniform (soft tissue equivalent) phantom, were explained by the variations in tissue composition and the presence of air within the normal nasal and paranasal cavities

  10. Characterization of alpha-adrenoceptors in the vasculature of the canine nasal mucosa.

    OpenAIRE

    Berridge, T L; Roach, A G

    1986-01-01

    alpha-Adrenoceptors present in the vasculature of the nasal mucosa in beta-adrenoceptor blocked dogs have been characterized pharmacologically using selective alpha 1- and alpha 2-adrenoceptor agonists and antagonists. In pentobarbitone-anaesthetized dogs, intra-arterial (i.a.) administration of the selective alpha 1-agonists cirazoline and phenylephrine, the selective alpha 2-agonist UK-14,304 and the mixed alpha 1/alpha 2-agonists adrenaline, noradrenaline and oxymetazoline produced dose-re...

  11. A case of nasal malignant peripheral nerve sheath tumor%鼻腔恶性外周神经鞘肿瘤1例

    Institute of Scientific and Technical Information of China (English)

    张晓松; 丁锋

    2013-01-01

    The 52-year-old female patient complained of persistent and progressive obstruction in left nasal cavity for more than 1 years. A grey, hard and smooth tumor with telangiectasia, were seen plugged in left post-nostrils and nasopharynx. CT scanning showed a tumor in the left nasal cavity . Post-operational pathologic diagnosis was peripheral nerve sheath tumors of nasal cavity.

  12. Expression of EBV-encoded oncogenes and EBV-like virions in multiple canine tumors.

    Science.gov (United States)

    Chiu, Hung-Chuan; Chow, Kuan-Chih; Fan, Yi-Hsin; Chang, Shih-Chieh; Chiou, Shiow-Her; Chiang, Shu-Fen; Chiou, Che-Hao; Wu, Guo-Hua; Yang, Hsiu-Ching; Ho, Shu-Peng; Chen, Yuh-Kun; Lee, Wei-Cheng; Sun, H Sunny

    2013-04-12

    Epstein-Barr virus (EBV) is a ubiquitous human oncovirus. Previous studies by us and others have indicated that pet dogs frequently encounter EBV or EBV-related viral infection. In this study, we explored whether EBV is involved in canine malignancies in dogs. EBV-specific BamHI W sequence was detected by polymerase chain reaction (PCR) in 10 of 12 canine tumor specimens, including 8 of 10 oral tumors. Using reverse transcription-PCR, gene expressions of latent membrane protein 1 (LMP 1) and BamHI H rightward reading frame 1 (BHRF1) were identified in 8 and 7 of 12 specimens, respectively. A novel LMP1 variant, T0905, was predominant in 5 canine tumor specimens and found to exist in EBV positive human BC-2 cells. Another LMP1 variant, T0902, was similar to human tumor variant JB7. The BHRF1 sequence identified from these canine tumors was identical to that of the B95-8 viral strain. LMP1 protein and EBV-encoded RNA (EBER) were detected by immunohistochemistry and fluorescent in situ hybridization, respectively, in several tumors, particularly in tumor nests of oral amelanotic melanomas. Furthermore, EBV-like virions adopting a herpesvirus egress pathway were detected in a canthal fibroblastic osteosarcoma and an oral amelanotic melanoma. In conclusion, we report the expressions of BHRF1 transcript (a viral anti-apoptotic protein), LMP1 (a viral oncoprotein) transcript and protein, EBER (a viral oncogenic RNA), and EBV-like virions in multiple canine tumors. The identity of BHRF1 and the resemblance of LMP1 variants between canine and human tumors indicate either a close evolutionary relationship between canine and human EBV, or the possibility of zoonotic transmission. PMID:23380461

  13. Prevalence of the Prefoldin Subunit 5 Gene Deletion in Canine Mammary Tumors

    OpenAIRE

    Silvia Hennecke; Julia Beck; Kirsten Bornemann-Kolatzki; Stephan Neumann; Hugo Murua Escobar; Ingo Nolte; Susanne Conradine Hammer; Marion Hewicker-Trautwein; Johannes Junginger; Franz-Josef Kaup; Bertram Brenig; Ekkehard Schütz

    2015-01-01

    Background A somatic deletion at the proximal end of canine chromosome 27 (CFA27) was recently reported in 50% of malignant mammary tumors. This region harbours the tumor suppressor gene prefoldin subunit 5 (PFDN5) and the deletion correlated with a higher Ki-67 score. PFDN5 has been described to repress c-MYC and is, therefore, a candidate tumor-suppressor and cancer-driver gene in canine mammary cancer. Aim of this study was to confirm the recurrent deletion in a larger number of tumors. Me...

  14. Malignant tumors of the nasal cavity: computed tomography and magnetic resonance imaging

    International Nuclear Information System (INIS)

    The aim of this study is to evaluate the role of computed tomography and magnetic resonance imaging in the characterization of deep tissue extension of malignant tumors of the nasal cavity. Twelve patients diagnosed with malignant tumors of the nasal cavity were retrospectively evaluated at the Departments of Diagnostic Imaging and Head and Neck Surgery of the 'Complexo Hospitalar Heliopolis', Sao Paulo, Brazil, between 1990 and 2000. All cases were confirmed by histopathologic examination. The results were: extension to the maxillary and ethmoid sinuses was identified in six patients, extension to contralateral nasal cavity, orbit and lamina cribosa in five patients, extension to nasal pharynx and masticator space in two patients, extension to cavernous sinus, anterior/middle cranial fossa, pterygomaxillary fossa, inferior/superior orbital fissure, frontal sinus, contralateral ethmoid sinus, contralateral lamina cribosa, hard palate and pterygopalatine fossa in one patient. Conclusion: It is important to precisely assess the local extension and spread of tumor by computed tomography and magnetic resonance imaging in order to plan the approach to treatment, which will influence the prognosis. (author)

  15. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    International Nuclear Information System (INIS)

    Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs

  16. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    Directory of Open Access Journals (Sweden)

    Kiupel Matti

    2006-04-01

    Full Text Available Abstract Background Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. Methods In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. Results No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. Conclusion In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs.

  17. Four cases of cell cannibalism in highly malignant feline and canine tumors.

    Science.gov (United States)

    Ferreira, Fernando Costa; Soares, Maria João; Carvalho, Sandra; Borralho, Liliana; Vicente, Gonçalo; Branco, Sandra; Correia, Jorge; Peleteiro, Maria Conceição

    2015-01-01

    Four cases of tumors in which cell internalization was frequently visualized are reported: one feline mammary carcinoma, one feline cutaneous squamous cell carcinoma, one canine pulmonary squamous cell carcinoma and one canine pleural mesothelioma. Cell internalization was observed by cytology in two of these cases (the feline mammary tumour and the pleural effusion in the canine mesothelioma) and by histopathology in all but the canine mesothelioma. Immunohistochemical staining for pancytokeratin was positive for both internalized and host cells, while E-cadherin expression was frequently absent, although internalized cells occasionally stained positive. This cell-to-cell interaction seems to be associated with tumors displaying a strong epithelial-mesenchymal transitional phenotype, in which cancer cells become engulfed by other cancer cells. Such event could be regarded as an important hallmark of very high malignancy. PMID:26525147

  18. Increased expression of C5a receptor (CD88) mRNA in canine mammary tumors.

    Science.gov (United States)

    Hezmee, Mohd Noor Mohd; Kyaw-Tanner, Myat; Lee, Jia Yu Peppermint; Shiels, Ian A; Rolfe, Barbara; Woodruff, Trent; Mills, Paul C

    2011-01-01

    Mammary tumors are among the most common neoplastic conditions in dogs, and there is evidence that inflammation plays a role in the development of some tumor types in dogs. The complement system is a major participant in the inflammatory process and the complement activation component, C5a, is a potent inflammatory peptide. This study investigated the mRNA expression of the major receptor for C5a (C5aR; CD88) in histopathological samples of canine mammary tumors by quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) using canine-specific primers for CD88. A total of seven canine mammary tumors (four malignant carcinomas, two benign mixed mammary tumors, and one myoepithelioma) and eight normal mammary glands were analysed. All the tumor samples expressed low levels of CD88 mRNA, while none of the normal mammary tissues showed any detectable expression. These preliminary results suggest that C5a-CD88 interaction may play a contributory role in the inflammatory response associated with mammary tumor development in dogs. Further studies investigating the mechanisms behind complement activation and C5a receptor expression in canine mammary tumors are warranted. PMID:20846729

  19. Expression of PD-L1 on canine tumor cells and enhancement of IFN-γ production from tumor-infiltrating cells by PD-L1 blockade.

    Directory of Open Access Journals (Sweden)

    Naoya Maekawa

    Full Text Available Programmed death 1 (PD-1, an immunoinhibitory receptor, and programmed death ligand 1 (PD-L1, its ligand, together induce the "exhausted" status in antigen-specific lymphocytes and are thus involved in the immune evasion of tumor cells. In this study, canine PD-1 and PD-L1 were molecularly characterized, and their potential as therapeutic targets for canine tumors was discussed. The canine PD-1 and PD-L1 genes were conserved among canine breeds. Based on the sequence information obtained, the recombinant canine PD-1 and PD-L1 proteins were constructed; they were confirmed to bind each other. Antibovine PD-L1 monoclonal antibody effectively blocked the binding of recombinant PD-1 with PD-L1-expressing cells in a dose-dependent manner. Canine melanoma, mastocytoma, renal cell carcinoma, and other types of tumors examined expressed PD-L1, whereas some did not. Interestingly, anti-PD-L1 antibody treatment enhanced IFN-γ production from tumor-infiltrating cells. These results showed that the canine PD-1/PD-L1 pathway is also associated with T-cell exhaustion in canine tumors and that its blockade with antibody could be a new therapeutic strategy for canine tumors. Further investigations are needed to confirm the ability of anti-PD-L1 antibody to reactivate canine antitumor immunity in vivo, and its therapeutic potential has to be further discussed.

  20. Molecular imaging using Cu-ATSM and FDG in solid canine tumors

    DEFF Research Database (Denmark)

    Hansen, Anders Elias

    Tumor hypoxia is one of the key factors in the development of aggressive and treatment resistant tumors. The negative effects of tumor hypoxia are mediated both by the direct lack of molecular oxygen for therapeutic efficacy and by pro- teomic and genomic changes induced in hypoxic tumor cells...... the potential of implementing canine cancer patients in translational research on tumor hypoxia. 2) Non- invasively evaluate the hypoxia positron emission tomography (PET) tracer 64 Copper(II)diacetyl-bis(N 4 -methylthiosemicarbazone) ( 64 Cu-ATSM), including the comparison to non-invasive measures of...... tumor glycolysis and blood perfu- sion. 3) To compare tumor uptake of 64 Cu-ATSM and [ 18 F]fluoro-D-glucose ( 18 FDG) (glycolytic activity) to pimonidazole (immunological hypoxia marker) immunohistochemistry. 4) To investigate 18 FDG PET as a diagnostic modality in canine cancer patients. The thesis...

  1. Expression of p53 and CD44 in Canine Breast Tumor

    Institute of Scientific and Technical Information of China (English)

    LIU Yun; CUI Wen; CHENG Xi; FENG Xinchang

    2008-01-01

    The p53 and CD44 expression of 10 cases in canine breast tumor were examined utilizing immunohistochemical assay with rabbit anti-mouse polyclonal antibodies against p53 or CD44,respectively.The p53 expression was significantly higher in malignant than in benign breast tumor.The expression of CD44 was not significantly different in malignant breast cancer and benign breast tumor.This suggests that p53 can be used as an indicator for animal prognosis.

  2. Hyperspectral imaging system to discern malignant and benign canine mammary tumors

    Science.gov (United States)

    Sahu, Amrita; McGoverin, Cushla; Pleshko, Nancy; Sorenmo, Karin; Won, Chang-Hee

    2013-05-01

    Hyperspectral imaging is an emerging technology in the field of biomedical engineering which may be used as a noninvasive modality to characterize tumors. In this paper, a hyperspectral imaging system was used to characterize canine mammary tumors of unknown histopathology (pre-surgery) and correlate these results with the post-surgical histopathology results. The system consisted of a charge coupled device (CCD) camera, a liquid crystal tunable filter in the near infrared range (650-1100 nm) and a controller. Spectral signatures of malignant and benign canine mammary tumors were extracted and analyzed. The reflectance intensities of malignant tumor spectra were generally lower than benign tumor spectra over the entire wavelength range. Previous studies have shown that cancerous tissues have a higher hemoglobin and water content, and lower lipid concentration with respect to benign tissues. The decreased reflectance intensity observed for malignant tumors is likely due to the increased microvasculature and therefore higher blood content of malignant tissue relative to benign tissue. Peaks at 700, 840, 900 and 970 nm were observed in the second derivative absorption spectra, these peaks were attributed to deoxy-hemoglobin, oxy-hemoglobin, lipid and water respectively. A `Tissue Optical Index' was developed that enhances contrast between malignant and benign canine tumors. This index is based on the ratio of the reflectance intensity values corresponding to the wavelengths associated with the four chromophores. Preliminary results from 22 canine mammary tumors showed that the sensitivity and specificity of the proposed method is 85.7% and 94.6% respectively. These results show promise in the non-invasive optical diagnosis of canine mammary cancer.

  3. Detection of canine skin and subcutaneous tumors by visible and near-infrared diffuse reflectance spectroscopy

    Science.gov (United States)

    Cugmas, Blaž; Plavec, Tanja; Bregar, Maksimilijan; Naglič, Peter; Pernuš, Franjo; Likar, Boštjan; Bürmen, Miran

    2015-03-01

    Cancer is the main cause of canine morbidity and mortality. The existing evaluation of tumors requires an experienced veterinarian and usually includes invasive procedures (e.g., fine-needle aspiration) that can be unpleasant for the dog and the owner. We investigate visible and near-infrared diffuse reflectance spectroscopy (DRS) as a noninvasive optical technique for evaluation and detection of canine skin and subcutaneous tumors ex vivo and in vivo. The optical properties of tumors and skin were calculated in a spectrally constrained manner, using a lookup table-based inverse model. The obtained optical properties were analyzed and compared among different tumor groups. The calculated parameters of the absorption and reduced scattering coefficients were subsequently used for detection of malignant skin and subcutaneous tumors. The detection sensitivity and specificity of malignant tumors ex vivo were 90.0% and 73.5%, respectively, while corresponding detection sensitivity and specificity of malignant tumors in vivo were 88.4% and 54.6%, respectively. The obtained results show that the DRS is a promising noninvasive optical technique for detection and classification of malignant and benign canine skin and subcutaneous tumors. The method should be further investigated on tumors with common origin.

  4. Computed tomography of malignant tumors of the nasal cavity and paranasal sinuses

    International Nuclear Information System (INIS)

    Staging of malignant tumors of the nasal cavity and paranasal sinuses by computed tomography (CT) was studied in a total of 49 patients, 33 with squamous cell carcinoma and 16 with tumors of other histologic types. Involved sites by the tumor were studied, and clinical staging was made using CT findings alone according to AJC classification for maxillary sinus tumors. Surgical findings for comparison were available for most cases. Of 33 squamous cell carcinomas and of 16 tumors with other histologic types, the maxillary sinus was the site of origin in 29 and eight, respectively. Of these 37 maxillary sinus tumors, 11 were staged T3, 26 T4, and none was staged T1 or T2. None of these tumors were down staged, and one T3 was upstaged after surgical procedures, although all sinuses were not explored in some cases. Sinusitis due to obstruction was indistinguishable from the tumor without bone destruction. And the determination of the site of origin was difficult in some cases. Despite these, CT should be used for pretreatment evaluation of the tumors of these sites

  5. Expression of PD-L1 on Canine Tumor Cells and Enhancement of IFN-γ Production from Tumor-Infiltrating Cells by PD-L1 Blockade

    OpenAIRE

    Maekawa, Naoya; Konnai, Satoru; Ikebuchi, Ryoyo; Okagawa, Tomohiro; Adachi, Mami; Takagi, Satoshi; KAGAWA, Yumiko; Nakajima, Chie; Suzuki, Yasuhiko; Murata, Shiro; Ohashi, Kazuhiko

    2014-01-01

    Programmed death 1 (PD-1), an immunoinhibitory receptor, and programmed death ligand 1 (PD-L1), its ligand, together induce the “exhausted” status in antigen-specific lymphocytes and are thus involved in the immune evasion of tumor cells. In this study, canine PD-1 and PD-L1 were molecularly characterized, and their potential as therapeutic targets for canine tumors was discussed. The canine PD-1 and PD-L1 genes were conserved among canine breeds. Based on the sequence information obtained, t...

  6. Direct preparation protocol to obtain mitotic chromosomes from canine mammary tumors.

    Science.gov (United States)

    Morais, C S D; Affonso, P R A M; Bitencourt, J A; Wenceslau, A A

    2015-01-01

    Currently, mammary neoplasms in female canines are a serious problem in veterinary clinics. In addition, the canine species is an excellent disease model for human oncology because of the biological and genetic similarities between the species. Cytogenetics has allowed further study of the characterization of neoplasms in canines. We hypothesized that the use of a direct preparation protocol for mitotic chromosome analysis would provide a simple and low cost protocol for use in all laboratories. The objective of this method is to display in a few hours of dividing cells just like the time of collection since cell division in tissue can be obtained. Ten female canines with the spontaneous occurrence of mammary neoplasia were used to test a pioneering direct preparation protocol to obtain mitotic chromosomes. The excised breast tumor tissue fragments were subjected to the protocol consisting of treatment with colchicine, treatment with hypotonic solution, and fixation. Mitotic chromosomes were absent in cell suspensions of only two samples among the 10 materials analyzed, based on the analysis of five blades for each preparation obtained. So, the cell suspension obtained allowed for the observation of eight tissue samples viable for cytogenetic analysis, five of which had excellent numbers of mitotic chromosomes. However, the technique was unsuccessful in producing high-quality cell suspensions because of inadequate condensation and scattering of chromosomes. While adjustments to methodological procedures are needed, this protocol represents a low cost and simplified method to study the cytogenetics of canine tumors. PMID:26782592

  7. Canine classical seminoma: a specific malignant type with human classifications is highly correlated with tumor angiogenesis

    International Nuclear Information System (INIS)

    Human seminoma is classified as classical seminoma (SE) and spermatocytic seminoma (SS). Human SE is known to be more malignant and metastasizing more frequently than SS. Tumor angiogenesis is highly related with tumor progression and metastasis, with microvessel density (MVD) being an important parameter of metastatic potential. Canine seminoma is not yet well-established as SE or SS type including correlation with angiogenesis. We classified canine SE and SS, and then compared them to tumor associated vessels. Twenty-three cases of canine seminomas (2 intratubular, 9 diffuse, and 12 intratubular/diffuse seminomas showing both intratubular and diffuse patterns) were classified as SE or SS by immunohistochemistry (IHC) using monoclonal antibody against PLAP and by PAS stain. The histopathological data were then compared to see if there was a correlation with SE or SS. Angiogenesis of seminomas were evaluated by immunohistochemical assay using polyclonal antibody against Von Willebrand factor (vWF) and by calculating the means of MVD, vessels area and perimeters using computerized image analysis. Statistical Package for Social Sciences (SPSS) program was used for various statistical analyses. The numbers of PLAP+/PAS+ canine SEs were 8/23 (34.8%) and PLAP-/PAS- SSs were 15/23 (61.2%). All SE cases (8/8, 100%) were intratubular/diffuse types. SS types included 2 intratubular (2/15, 13.3%), 9 diffuse (9/15, 60%), and 4 intratubular/diffuse (4/15, 26.7%) types. MVD and vascular parameters in SEs were significantly higher than in SSs, showing the highest value in the intratubular/diffuse type. Seminomas observed with neoplastic cells invasion of vessels presented higher perimeter and area values than seminomas without conformed neoplastic cells invasion. In this study, we demonstrated a positive relationship between canine SE and tumor angiogenesis. Furthermore, we also showed that a tumor cells invasion of vessels were a correlated vascular parameter. Although

  8. Interleukin-12 Inhibits Tumor Growth in a Novel Angiogenesis Canine Hemangiosarcoma Xenograft Model1

    OpenAIRE

    Akhtar, Nasim; Padilla, Marcia L.; Dickerson, Erin B; Steinberg, Howard; Breen, Matthew; Auerbach, Robert; Helfand, Stuart C

    2004-01-01

    We established a canine hemangiosarcoma cell line derived from malignant endothelial cells comprising a spontaneous tumor in a dog to provide a renewable source of endothelial cells for studies of angiogenesis in malignancy. Pieces of the hemangiosarcoma biopsy were engrafted subcutaneously in a bg/nu/XID mouse allowing the tumor cells to expand in vivo. A cell line, SB-HSA, was derived from the xenograft. SB-HSA cells expressed vascular endothelial growth factor (VEGF) receptors 1 and 2, CD3...

  9. Interleukin-12 Inhibits Tumor Growth in a Novel Angiogenesis Canine Hemangiosarcoma Xenograft Model

    OpenAIRE

    Nasim Akhtar; Padilla, Marcia L.; Dickerson, Erin B; Howard Steinberg; Matthew Breent; Robert Auerbach; Helfand, Stuart C

    2004-01-01

    We established a canine hemangiosarcoma cell line derived from malignant endothelial cells comprising a spontaneous tumor in a dog to provide a renewable source of endothelial cells for studies of angiogenesis in malignancy. Pieces of the hemangiosarcoma biopsy were engrafted subcutaneously in a bg/nu/XID mouse allowing the tumor cells to expand in vivo. A cell line, SB-HSA, was derived from the xenograft. SB-HSA cells expressed vascular endothelial growth factor (VEGF) receptors 1 and 2, CD3...

  10. Comparison of cellular and tissue transcriptional profiles in canine mammary tumor

    OpenAIRE

    Pawlowski, K.M.; Krol, M.; Majewska, A.; Badowska-Kozakiewicz, A.; Mol, J. A.; Malicka, E.; Motyl, T.

    2009-01-01

    J Physiol Pharmacol. 2009 May;60 Suppl 1:85-94. Comparison of cellular and tissue transcriptional profiles in canine mammary tumor. Pawlowski KM, Krol M, Majewska A, Badowska-Kozakiewicz A, Mol JA, Malicka E, Motyl T. Department of Physiological Sciences, Faculty of Veterinary Medicine, Warsaw University of Life Sciences - SGGW, Poland. Tumor-derived cell lines are widely used as in vitro cancer models. Cell lines historically served as the primary experimental model systems for exploration o...

  11. Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jong-Hyuk, E-mail: jhkim@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Robinson, Sally [Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Sharkey, Leslie C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); O' Brien, Timothy D. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Dickerson, Erin B. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Modiano, Jaime F., E-mail: modiano@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States)

    2014-04-15

    Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

  12. Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

    International Nuclear Information System (INIS)

    Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

  13. Retrospective analysis of canine mesenchymal tumors of skin and soft tissues

    Directory of Open Access Journals (Sweden)

    Aleksić-Kovačević Sanja

    2005-01-01

    Full Text Available Out of the total number of 632 tumor specimens obtained from dogs of different breeds over the period of last 66 months, cutaneous tumors were diagnosed in 211 cases, i.e., in 123 (58.3% male dogs and 88 (41.7% bitches, aged on average 7 years. Among the total number of 211 skin tumors 32 types of cutaneous neoplasms were diagnosed, with epithelial and melanocytic tumors being the most predominant (58.3%, followed by hematopoietic tumors (22.3% and mesenchymal tumors of the skin and soft tissues (19.4%. Cutaneous hematopoietic tumors comprising the total of 47 cases and mesenchymal tumors of the skin and soft tissues (41 cases were subjected to detailed histological analysis, as well as immunohistochemical analysis if necessary, and the tumors were classified based on the most recent WHO classification of cutaneous neoplasms. The large number of cutaneous hematopoietic tumors is the result of a large number of mastocytomas and histiocytomas. These tumors were benign in 14 (29.79% cases, while the remaining 33 (70.21% were malignant. Out of the total number of canine tumors examined based on the biopsy and section materials over the last five years at the Department of Pathology, skin tumors and mammary gland tumors were proved to be the two largest groups diagnosed in 33.4% and 36% of cases, respectively.

  14. Canine and human gastrointestinal stromal tumors display similar mutations in c-KIT exon 11

    International Nuclear Information System (INIS)

    Gastrointestinal stromal tumors (GISTs) are common mesenchymal neoplasms in the gastrointestinal tract of humans and dogs. Little is known about the pathogenesis of these tumors. This study evaluated the role of c-KIT in canine GISTs; specifically, we investigated activating mutations in exons 8, 9, 11, 13, and 17 of c-KIT and exons 12, 14, and 18 of platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), all of which have been implicated in human GISTs. Seventeen canine GISTs all confirmed to be positive for KIT immunostaining were studied. Exons 8, 9, 11, 13 and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA, were amplified from DNA isolated from formalin-fixed paraffin-embedded samples. Of these seventeen cases, six amplicons of exon 11 of c-KIT showed aberrant bands on gel electrophoresis. Sequencing of these amplicons revealed heterozygous in-frame deletions in six cases. The mutations include two different but overlapping six base pair deletions. Exons 8, 9, 13, and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA had no abnormalities detected by electrophoresis and sequencing did not reveal any mutations, other than synonymous single nucleotide polymorphisms (SNPs) found in exon 11 of c-KIT and exons 12 and 14 of PDGFRA. The deletion mutations detected in canine GISTs are similar to those previously found in the juxtamembrane domain of c-KIT in canine cutaneous mast cell tumors in our laboratory as well as to those reported in human GISTs. Interestingly, none of the other c-KIT or PDGFRA exons showed any abnormalities in our cases. This finding underlines the critical importance of c-KIT in the pathophysiology of canine GISTs. The expression of KIT and the identification of these activating mutations in c-KIT implicate KIT in the pathogenesis of these tumors. Our results indicate that mutations in c-KIT may be of prognostic significance and that targeting KIT may be a rational approach to treatment of these malignant tumors. This study further

  15. Immunohistochemical detection of estrogen receptors in canine mammary tumors

    OpenAIRE

    Elena Atanaskova Petrov; Ivica Gjurovski; Trpe Ristoski; Goran Nikolovski; Pandorce Trenkoska; Plamen Trojacanec; Ksenija Ilievska; Toni Dovenski; Gordana Petrushevska

    2016-01-01

    Mammary tumors are among the most common neoplasms in intact female dogs.They have a complex morphology, usually affecting middle age and older bitches. Almost 50% of the mammary tumors in dogs are malignant neoplasms. Prognosis is based on several factors: stage, age, tumor size, metastasis, histopathology, ovariectomy status and hormone-receptor activity. Immunohistochemical (IHC) measurement has become increasingly an important diagnostic and prognostic parameter, with the development of m...

  16. Immunohistochemical study of genital and extragenital forms of canine transmissible venereal tumor in Brazil

    OpenAIRE

    Mariana B. Mascarenhas; Paulo V. Peixoto; Regina R. Ramadinha; Elise M. Yamasaki; Samay Z.R. Costa; David Driemeier; Luciana Sonne; Ticiana N. França

    2014-01-01

    Aiming to provide insight and discussing the problems related to the diagnosis and differential diagnosis of canine transmissible venereal tumor (CTVT), especially in its extragenital form, immunohistochemical evaluation was performed and a comparison was established by analysis of the microscopic appearance of 10 genital CTVTs and 13 exclusively extragenital CTVTs previously diagnosed by cytology and histopathology. CTVTs samples were incubated with biotinylated antibodies raised against spe...

  17. Prevalence of the Prefoldin Subunit 5 Gene Deletion in Canine Mammary Tumors.

    Directory of Open Access Journals (Sweden)

    Silvia Hennecke

    Full Text Available A somatic deletion at the proximal end of canine chromosome 27 (CFA27 was recently reported in 50% of malignant mammary tumors. This region harbours the tumor suppressor gene prefoldin subunit 5 (PFDN5 and the deletion correlated with a higher Ki-67 score. PFDN5 has been described to repress c-MYC and is, therefore, a candidate tumor-suppressor and cancer-driver gene in canine mammary cancer. Aim of this study was to confirm the recurrent deletion in a larger number of tumors.Droplet digital PCR for PFDN5 was performed in DNA from 102 malignant, 40 benign mammary tumors/dysplasias, 11 non-neoplastic mammary tissues and each corresponding genomic DNA from leukocytes. The copy number of PFDN5 was normalized to a reference amplicon on canine chromosome 32 (CFA32. Z-scores were calculated, based on Gaussian distributed normalized PFDN5 copy numbers of the leukocyte DNA. Z-scores ≤ -3.0 in tissue were considered as being indicative of the PFDN5 deletion and called as such. The Ki-67 proliferation index was assessed in a subset of 79 tissue samples by immunohistochemistry.The deletion was confirmed in 24% of all malignant tumors, detected in only 7.5% of the benign tumors and was not present in any normal mammary tissue sample. The subgroup of solid carcinomas (n = 9 showed the highest frequency of the deletion (67% and those malignomas without microscopical high fraction of benign tissue (n = 71 had a 32% frequency (p<0.01 vs. benign samples. The Ki-67 score was found to be significantly higher (p<0.05 in the PFDN5-deleted group compared to malignant tumors without the deletion.A somatic deletion of the PFDN5 gene is recurrently present in canine mammary cancer, supporting a potential role in carcinogenesis. The association of this deletion with higher Ki-67 indicates an increased proliferation rate and thus a link to tumor aggressiveness can be hypothesized. The confirmation of earlier results warrants further studies on PFDN5 as cancer

  18. Effects of nasal CPAP on exhaled SIRT1 and tumor necrosis factor-α in patients with obstructive sleep apnea.

    Science.gov (United States)

    Lin, Ching-Chi; Liaw, Shwu-Fang; Chiu, Chung-Hsin; Chen, Wei-Ji; Lin, Mei-Wei; Chang, Feng-Ting

    2016-07-01

    Exhaled breath condensate (EBC) has been used to examine airway inflammation and oxidative stress. This study aimed to evaluate if there were abnormal Sirtuin 1 (SIRT1) protein and tumor necrosis factor (TNF)-α levels in EBC and to determine if these levels could be improved after nasal continuous positive airway pressure (CPAP) treatment. Thirty-five patients with moderately severe to severe obstructive sleep apnea syndrome (OSAS) who wanted nasal CPAP treatment and 20 healthy controls were prospectively enrolled. The EBC SIRT1 protein levels and EBC TNF-α protein levels were assessed by ELISA. All patients underwent sleep studies that were repeated 3 months after nasal CPAP treatment in patients with OSAS. Results showed that in OSAS before nasal CPAP treatment, the EBC SIRT1 protein levels were lower than that in normal subjects, whereas the EBC TNF-α protein levels were higher. After nasal CPAP treatment, the EBC SIRT1 levels increased and EBC TNF-α levels decreased. In conclusion, successful treatment of OSAS by nasal CPAP can normalize the levels of EBC SIRT1 and EBC TNF-α. PMID:26976689

  19. Steroid Tumor Environment in Male and Female Mice Model of Canine and Human Inflammatory Breast Cancer

    Directory of Open Access Journals (Sweden)

    Sara Caceres

    2016-01-01

    Full Text Available Canine inflammatory mammary cancer (IMC shares clinical and histopathological characteristics with human inflammatory breast cancer (IBC and has been proposed as a good model for studying the human disease. The aim of this study was to evaluate the capacity of female and male mice to reproduce IMC and IBC tumors and identify the hormonal tumor environment. To perform the study sixty 6–8-week-old male and female mice were inoculated subcutaneously with a suspension of 106 IPC-366 and SUM149 cells. Tumors and serum were collected and used for hormonal analysis. Results revealed that IPC-366 reproduced tumors in 90% of males inoculated after 2 weeks compared with 100% of females that reproduced tumor at the same time. SUM149 reproduced tumors in 40% of males instead of 80% of females that reproduced tumors after 4 weeks. Both cell lines produce distant metastasis in lungs being higher than the metastatic rates in females. EIA analysis revealed that male tumors had higher T and SO4E1 concentrations compared to female tumors. Serum steroid levels were lower than those found in tumors. In conclusion, IBC and IMC male mouse model is useful as a tool for IBC research and those circulating estrogens and intratumoral hormonal levels are crucial in the development and progression of tumors.

  20. Steroid Tumor Environment in Male and Female Mice Model of Canine and Human Inflammatory Breast Cancer.

    Science.gov (United States)

    Caceres, Sara; Peña, Laura; Silvan, Gema; Illera, Maria J; Woodward, Wendy A; Reuben, James M; Illera, Juan C

    2016-01-01

    Canine inflammatory mammary cancer (IMC) shares clinical and histopathological characteristics with human inflammatory breast cancer (IBC) and has been proposed as a good model for studying the human disease. The aim of this study was to evaluate the capacity of female and male mice to reproduce IMC and IBC tumors and identify the hormonal tumor environment. To perform the study sixty 6-8-week-old male and female mice were inoculated subcutaneously with a suspension of 10(6)IPC-366 and SUM149 cells. Tumors and serum were collected and used for hormonal analysis. Results revealed that IPC-366 reproduced tumors in 90% of males inoculated after 2 weeks compared with 100% of females that reproduced tumor at the same time. SUM149 reproduced tumors in 40% of males instead of 80% of females that reproduced tumors after 4 weeks. Both cell lines produce distant metastasis in lungs being higher than the metastatic rates in females. EIA analysis revealed that male tumors had higher T and SO4E1 concentrations compared to female tumors. Serum steroid levels were lower than those found in tumors. In conclusion, IBC and IMC male mouse model is useful as a tool for IBC research and those circulating estrogens and intratumoral hormonal levels are crucial in the development and progression of tumors. PMID:27195300

  1. New agents for targeting of IL-13RA2 expressed in primary human and canine brain tumors.

    Directory of Open Access Journals (Sweden)

    Waldemar Debinski

    Full Text Available Interleukin 13 receptor alpha 2 (IL-13RA2 is over-expressed in a vast majority of human patients with high-grade astrocytomas like glioblastoma. Spontaneous astrocytomas in dogs resemble human disease and have been proposed as translational model system for investigation of novel therapeutic strategies for brain tumors. We have generated reagents for both detection and therapeutic targeting of IL-13RA2 in human and canine brain tumors. Peptides from three different regions of IL-13RA2 with 100% sequence identity between human and canine receptors were used as immunogens for generation of monoclonal antibodies. Recombinant canine mutant IL-13 (canIL-13.E13K and canIL-13.E13K based cytotoxin were also produced. The antibodies were examined for their immunoreactivities in western blots, immunohistochemistry, immunofluorescence and cell binding assays using human and canine tumor specimen sections, tissue lysates and established cell lines; the cytotoxin was tested for specific cell killing. Several isolated MAbs were immunoreactive to IL-13RA2 in western blots of cell and tissue lysates from glioblastomas from both human and canine patients. Human and canine astrocytomas and oligodendrogliomas were also positive for IL-13RA2 to various degrees. Interestingly, both human and canine meningiomas also exhibited strong reactivity. Normal human and canine brain samples were virtually negative for IL-13RA2 using the newly generated MAbs. MAb 1E10B9 uniquely worked on tissue specimens and western blots, bound live cells and was internalized in GBM cells over-expressing IL-13RA2. The canIL-13.E13K cytotoxin was very potent and specific in killing canine GBM cell lines. Thus, we have obtained several monoclonal antibodies against IL-13RA2 cross-reacting with human and canine receptors. In addition to GBM, other brain tumors, such as high grade oligodendrogliomas, meningiomas and canine choroid plexus papillomas, appear to express the receptor at high levels

  2. Immunohistochemical and molecular expression of laminin-332 gamma-2 chain in canine mammary tumors

    Directory of Open Access Journals (Sweden)

    D.A.P.C Zuccari

    2011-02-01

    Full Text Available Forty-eight cases of canine mammary cancer were investigated to evaluate the immunohistochemical distribution of the γ2 chain of laminin-332. Tumor cells were compared to a pool of normal mammary tissues using quantitative RT-PCR. The western blot was performed in eight tumor samples as complementary test to evaluate protein integrity. Immunohistochemistry experiments showed negative, focal, and weak expression of laminin-332 γ2 in tumors with the worst prognosis. Quantitative PCR revealed downregulation of the gene in 27 (56.2% of the animals. Out of the 16 dogs with γ2 chain overexpression, seven were still alive. The western blot results showed bands generation of 36, 50, and 98kDa, suggesting degradation of laminin-332 γ2 in malignant tumors. The results suggest that, in the future, low expression and/or degradation of laminin-332 γ2 chain in canine mammary tumors may be used as an indicator of malignant potential. However, further studies are necessary to corroborate these results

  3. Canine parvovirus-like particles, a novel nanomaterial for tumor targeting

    Directory of Open Access Journals (Sweden)

    Destito Giuseppe

    2006-02-01

    Full Text Available Abstract Specific targeting of tumor cells is an important goal for the design of nanotherapeutics for the treatment of cancer. Recently, viruses have been explored as nano-containers for specific targeting applications, however these systems typically require modification of the virus surface using chemical or genetic means to achieve tumor-specific delivery. Interestingly, there exists a subset of viruses with natural affinity for receptors on tumor cells that could be exploited for nanotechnology applications. For example, the canine parvovirus (CPV utilizes transferrin receptors (TfRs for binding and cell entry into canine as well as human cells. TfRs are over-expressed by a variety of tumor cells and are widely being investigated for tumor-targeted drug delivery. We explored whether the natural tropism of CPV to TfRs could be harnessed for targeting tumor cells. Towards this goal, CPV virus-like particles (VLPs produced by expression of the CPV-VP2 capsid protein in a baculovirus expression system were examined for attachment of small molecules and delivery to tumor cells. Structural modeling suggested that six lysines per VP2 subunit are presumably addressable for bioconjugation on the CPV capsid exterior. Between 45 and 100 of the possible 360 lysines/particle could be routinely derivatized with dye molecules depending on the conjugation conditions. Dye conjugation also demonstrated that the CPV-VLPs could withstand conditions for chemical modification on lysines. Attachment of fluorescent dyes neither impaired binding to the TfRs nor affected internalization of the 26 nm-sized VLPs into several human tumor cell lines. CPV-VLPs therefore exhibit highly favorable characteristics for development as a novel nanomaterial for tumor targeting.

  4. Retrospective canine skin peripheral nerve sheath tumors data with emphasis on histologic, immunohistochemical and prognostic factors

    Directory of Open Access Journals (Sweden)

    Gisele S. Boos

    2015-12-01

    Full Text Available Abstract: In this retrospective study was determined the frequency of canine skin peripheral nerve sheath tumors (PNST in cases diagnosed by the Setor de Patologia Veterinária of the Universidade Federal do Rio Grande do Sul (SPV-UFRGS, Brazil, between the years 2000 and 2012. The canine profiles, as well as histological, immunohistochemical and prognostic aspects of the tumors were based on 70 samples, comprising 40 females, 29 males and one unspecified sample. Between 2000 and 2012, 2,984 skin tumors of dogs were diagnosed in the SPV-UFRGS, totaling 2.34% of skin neoplasms in dogs. Animals that comprised the largest amount of samples (43% were those with no breed (SRD, followed by German Shepherds (10%. Females were more affected than males (40/70 - 57% and 29/70 - 41% respectively. Skin PNST of this research showed predominant localization on the limbs (40% in the forelimbs and 29% in the hindlimbs; affecting adult dogs, mostly aged between 8 and 11 years (54%. The samples were routinely processed for hematoxylin and eosin, and were also evaluated by toluidine blue and Masson's trichrome staining, and immunohistochemistry (IHC anti-vimentin, -S-100, -GFAP, -actin, von Willebrand factor and neurofilament. Anisocytosis and anisokaryosis, mitotic index, intratumoral necrosis, invasion of adjacent tissues, tumor location, local recurrence and metastasis were related to the diagnosis of benign (49/70 or malignant tumor (21/70. The Antoni A histological pattern was observed more frequently in benign tumors. The immunohistochemistry helped to diagnose PNST, and anti-vimentin and anti-protein S-100 showed the highest rates of immunostaining. Throughout statistical analysis of animals with tumor recurrence, it was found that the chance of an animal with a malignant peripheral nerve sheath tumor to develop recurrence is 4.61 times higher than in an animal that had a benign tumor.

  5. Anatomia cirúrgica do acesso nasal transesfenoidal para tumores da hipófise Surgical anatomy of the nasal transphenoidal approach for pituitary tumors

    Directory of Open Access Journals (Sweden)

    Murilo S. Meneses

    1997-09-01

    Full Text Available Foram analisadas diferentes medidas relacionadas ao acesso nasal transesfenoidal em 18 hemicabeças de cadáveres com o objetivo de estudar os limites e vantagens dessa via. Foram obtidos os seguintes valores médios (mm para as principais medidas: diâmetro maior da narina 15,18; altura da cavidade nasal 44,11; distância narina - sela turca 71,71. Esses valores demonstram ser o acesso nasal uma via ampla e direta à sela turca. O presente estudo demonstrou também ser possível nesse acesso preservar o septo cartilágino e outras estruturas que são usualmente lesadas no acesso sublabial.Different distances related to the nasal transphenoidal approach were measured on the hemiheads of eighteen cadavers in order to study its limits and advantages. The main mean measures obtained (mm were: major diameter of the nostril 15.18; height of the nasal cavity 44.11; nostril-sella turcica distance 71.71. These results show that the nasal approach is wide and direct to the sella turcica. The present study demonstrate the possibility of preservation of the cartilaginous septum and other structures which are usually damaged when the sublabial approach is employed.

  6. Spontaneous skin canine tumors: toluidine blue stain detection of mast cells in tissue section

    Directory of Open Access Journals (Sweden)

    ALKETA QOKU

    2014-06-01

    Full Text Available Dog mast cell tumor (MCT is common in dog. The etiology of canine MCTs is unknown, but it is probably multi-factorial. Its incidence is higher than it has found in human. There are demonstrated several common biological and clinical characteristics in both species. Cutaneous mast cells are located in the dermis and hypodermis. The objective of this study is to detect of MC on Toluidine Blue stained slides. There were examined 74 dogs of difference breeds and aged, from Tirana city. Six of them demonstrated the skin canine tumors. Skin samples were obtained from these animals. Macroscopic examination of the tumor revealed nodular ulcerated lesion with areas of necrosis and hemorrhage, accompanied with normal superjacent epidermis and annexes. Serial sections obtained from biopsy specimens were processed with toluidine blue staining pH 4.5, specific for MC identification. This study suggests that Toluidine blue, pH 4.5 stain may give a good information about skin tumors in dog, histologically with benign behavior.

  7. Aflatoxins ingestion and canine mammary tumors: There is an association?

    Science.gov (United States)

    Frehse, M S; Martins, M I M; Ono, E Y S; Bracarense, A P F R L; Bissoqui, L Y; Teixeira, E M K; Santos, N J R; Freire, R L

    2015-10-01

    The aim of this study was to determine the presence of mycotoxins on dogs feed and to explore the potential association between mycotoxins exposure and the chance of mamary tumors in a case-control study. The study included 256 female dogs from a hospital population, 85 with mammary tumors (case group) and 171 without mammary tumors (control group). An epidemiological questionnaire was applied to both groups, and the data were analyzed by the EpiInfo statistical package. For the study, 168 samples of the feed offered to dogs were analyzed for the presence of aflatoxins, fumonisins and zearalenone by high-performance liquid chromatography. Mycotoxins were found in 79 samples (100%) in the case group and 87/89 (97.8%) in the control group. Mycotoxins were detected in all types of feed, regardless feed quality. Level of aflatoxin B1 (p = 0.0356, OR = 2.74, 95%, CI 1.13 to 6.60), aflatoxin G1 (AFG1) (p = 0.00007, OR = 4.60, 95%, CI = 2.16 to 9.79), and aflatoxin G2 (AFG2) (p = 0.0133, OR = 9.91, 95%, CI 1.21 to 81.15) were statistically higher in case of mammary cancer. In contrast, neutering was a protective factor for mammary cancer (p = 0.0004, OR = 0.32, 95%, CI = 0.17 to 0.60). PMID:26271706

  8. Canine mast cell tumors: diagnosis, treatment, and prognosis

    Directory of Open Access Journals (Sweden)

    Garrett LD

    2014-08-01

    Full Text Available Laura D Garrett Department of Veterinary Clinical Medicine, University of Illinois College of Veterinary Medicine, Urbana, IL, USA Abstract: Mast cell tumors (MCTs are the most common malignant skin cancer in dogs, and significant variability exists in their biological behavior. Most MCTs are cured with appropriate local therapy, but a subset shows malignant behavior with the potential to spread to lymph nodes, liver, spleen, and other areas and to thus become a systemic cancer. Because of this variable behavior, it is difficult to predict how any individual tumor is going to behave. The variability thus creates uncertainty in deciding what a particular dog's prognosis is, whether staging tests to assess for metastasis are needed, and even what treatments will be necessary for best outcome. In addition to controversies over the potential for development of systemic disease, or diffuse metastasis, controversies also exist over what treatment is needed to best attain local control of these tumors. This article will briefly discuss the diagnosis of MCTs in dogs and will summarize the literature in regards to the controversial topics surrounding the more aggressive form of this disease, with recommendations made based on published studies. Keywords: mitotic index, mastocytosis, tyrosine kinase inhibitor, histologic grade

  9. Potential of Translationally Controlled Tumor Protein-Derived Protein Transduction Domains as Antigen Carriers for Nasal Vaccine Delivery.

    Science.gov (United States)

    Bae, Hae-Duck; Lee, Joohyun; Jin, Xing-Hai; Lee, Kyunglim

    2016-09-01

    Nasal vaccination offers a promising alternative to intramuscular (i.m.) vaccination because it can induce both mucosal and systemic immunity. However, its major drawback is poor absorption of large antigens in the nasal epithelium. Protein transduction domains (PTDs), also called cell-penetrating peptides, have been proposed as vehicles for nasal delivery of therapeutic peptides and proteins. Here, we evaluated the potential of a mutant PTD derived from translationally controlled tumor protein (designated TCTP-PTD 13) as an antigen carrier for nasal vaccines. We first compared the l- and d-forms of TCTP-PTD 13 isomers (l- or d-TCTP-PTD 13) as antigen carriers. Studies in mice demonstrated that nasally administered mixtures of the model antigen ovalbumin (OVA) and d-TCTP-PTD 13 induced higher plasma IgG titers and secretory IgA levels in nasal washes than nasally administered OVA alone, OVA/l-TCTP-PTD 13, or i.m.-injected OVA. Plasma IgG subclass responses (IgG1 and IgG2a) of mice nasally administered OVA/d-TCTP-PTD 13 showed that the predominant IgG subclass was IgG1, indicating a Th2-biased immune response. We also used synthetic CpG oligonucleotides (CpG) as a Th1 immune response-inducing adjuvant. Nasally administered CpG plus OVA/d-TCTP-PTD 13 was superior in eliciting systemic and mucosal immune responses compared to those induced by nasally administered OVA/d-TCTP-PTD 13. Furthermore, the OVA/CpG/d-TCTP-PTD 13 combination skewed IgG1 and IgG2a profiles of humoral immune responses toward a Th1 profile. These findings suggest that TCTP-derived PTD is a suitable vehicle to efficiently carry antigens and to induce more powerful antigen-specific immune responses and a more balanced Th1/Th2 response when combined with a DNA adjuvant. PMID:27454469

  10. Prolonged shedding of the canine influenza H3N2 virus in nasal swabs of experimentally immunocompromised dogs

    OpenAIRE

    Hong, Minki; Kang, Bokyu; Na, Woonsung; An, Dongjun; Moon, Hyoungjoon; Kim, Doo-Jin; Oh, Jinsik; Park, Seong-Jun; Poo, Haryoung; Kim, Jeong-Ki; Kim, Jongman; Song, Daesub

    2013-01-01

    Purpose The avian origin canine influenza virus H3N2 has been recently isolated and found to be currently in dog population in South Korea and China. The purpose of this study was to clarify the relationship between immunosuppressive glucocorticoids used in veterinary clinical practice and viral shedding pattern of influenza in dogs. Materials and Methods Eight conventional beagle dogs were divided into control infection group and immunocompromised group. Dogs of both groups were infected wit...

  11. Ligand-Independent Canonical Wnt Activity in Canine Mammary Tumor Cell Lines Associated with Aberrant LEF1 Expression

    Science.gov (United States)

    van Wolferen, Monique E.; Rao, Nagesha A. S.; Grizelj, Juraj; Vince, Silvijo; Hellmen, Eva; Mol, Jan A.

    2014-01-01

    Pet dogs very frequently develop spontaneous mammary tumors and have been suggested as a good model organism for breast cancer research. In order to obtain an insight into underlying signaling mechanisms during canine mammary tumorigenesis, in this study we assessed the incidence and the mechanism of canonical Wnt activation in a panel of 12 canine mammary tumor cell lines. We show that a subset of canine mammary cell lines exhibit a moderate canonical Wnt activity that is dependent on Wnt ligands, similar to what has been described in human breast cancer cell lines. In addition, three of the tested canine mammary cell lines have a high canonical Wnt activity that is not responsive to inhibitors of Wnt ligand secretion. Tumor cell lines with highly active canonical Wnt signaling often carry mutations in key members of the Wnt signaling cascade. These cell lines, however, carry no mutations in the coding regions of intracellular Wnt pathway components (APC, β-catenin, GSK3β, CK1α and Axin1) and have a functional β-catenin destruction complex. Interestingly, however, the cell lines with high canonical Wnt activity specifically overexpress LEF1 mRNA and the knock-down of LEF1 significantly inhibits TCF-reporter activity. In addition, LEF1 is overexpressed in a subset of canine mammary carcinomas, implicating LEF1 in ligand-independent activation of canonical Wnt signaling in canine mammary tumors. We conclude that canonical Wnt activation may be a frequent event in canine mammary tumors both through Wnt ligand-dependent and novel ligand–independent mechanisms. PMID:24887235

  12. Ligand-independent canonical Wnt activity in canine mammary tumor cell lines associated with aberrant LEF1 expression.

    Directory of Open Access Journals (Sweden)

    Ana Gracanin

    Full Text Available Pet dogs very frequently develop spontaneous mammary tumors and have been suggested as a good model organism for breast cancer research. In order to obtain an insight into underlying signaling mechanisms during canine mammary tumorigenesis, in this study we assessed the incidence and the mechanism of canonical Wnt activation in a panel of 12 canine mammary tumor cell lines. We show that a subset of canine mammary cell lines exhibit a moderate canonical Wnt activity that is dependent on Wnt ligands, similar to what has been described in human breast cancer cell lines. In addition, three of the tested canine mammary cell lines have a high canonical Wnt activity that is not responsive to inhibitors of Wnt ligand secretion. Tumor cell lines with highly active canonical Wnt signaling often carry mutations in key members of the Wnt signaling cascade. These cell lines, however, carry no mutations in the coding regions of intracellular Wnt pathway components (APC, β-catenin, GSK3β, CK1α and Axin1 and have a functional β-catenin destruction complex. Interestingly, however, the cell lines with high canonical Wnt activity specifically overexpress LEF1 mRNA and the knock-down of LEF1 significantly inhibits TCF-reporter activity. In addition, LEF1 is overexpressed in a subset of canine mammary carcinomas, implicating LEF1 in ligand-independent activation of canonical Wnt signaling in canine mammary tumors. We conclude that canonical Wnt activation may be a frequent event in canine mammary tumors both through Wnt ligand-dependent and novel ligand-independent mechanisms.

  13. Biphasic pulses enhance bleomycin efficacy in a spontaneous canine genital tumor model of chemoresistance: Sticker sarcoma

    Directory of Open Access Journals (Sweden)

    Citro Gennaro

    2008-11-01

    Full Text Available Abstract Sticker's sarcoma (also known as transmissible venereal tumor is a horizontally transmitted neoplasm of the dog, that is passed with coitus. It is a locally aggressive tumor with a low tendency to metastatic spread. The most common locations are the genitals, the nose, the perianal area. Standard treatment consists with chemotherapy with vincristine, however other therapies such as, cryotherapy, immunotherapy or, in selected cases, radiation therapy, have been reported. In this article we describe the outcome of a small cohort of canine patients, with chemotherapy resistant transmissible venereal tumor (TVT, treated with bleomycin selectively driven by trains of biphasic pulses (electrochemotherapy. Three canine patients, with refractory TVT, entered the study and received two sessions of ECT under sedation. The pets had local injection of bleomycin at the concentration of 1.5 mg/ml and five minutes after the chemotherapy, trains of 8 biphasic electric pulses lasting 50 + 50 μs each, with 1 ms interpulse intervals, were delivered by means of modified caliper or, for difficult districts, through paired needle electrode. All the patients responded to the treatment and are still in remission at different times. Electrochemotherapy appears as a safe and efficacious modality for the treatment of TVT and warrants further investigations.

  14. Mulberry Tumors in Retina and Nasal Hamartoma in a Patient With Tuberous Sclerosis

    Directory of Open Access Journals (Sweden)

    S. Reshadat

    2008-10-01

    Full Text Available Introduction: Tuberous Sclerosis (TS is an autosomal dominant disease that affects the brain, skin, eye, heart, kidney even bones. The commonest presentation is seizures in infancy or early childhood (in 80% of cases, mental retardation (in 44%of cases. Characteristic skin lesion includes facial angiofibromas, adenoma sebaceum, hypopigmented macules, shagreen patches ungual ungual fibromas, ash leaf spots, cafe'-au-lait spots.Case Report: A nine years old male was admitted in a pediatric hospital because of the status myoclonic seizures. Seizures had been started since infancy. In physical exam he had some hypopigmented macules, cafe'-au-lait spots and ash leaf lesions, frontal fibrosis and also shagreen patches. Patient was a case of mild mentally retardation with no any focal neurological deficit. Computed tomography scan of brain and MRI imaging revealed sub ependymal tubers with multiple calcification in both sides of parietal region. Electroencephal-ogram recording suggested abnormal spike, sharp wave discharges and lennox-Gastaut pattern. The diagnosis based on the history and physical exam and MRI were tuberous sclerosis. His foundoscopic exam revealed two prominent calcified mass around right optic disc in supratemporal arch, left eye was normal. Retinal angiography revealed the mulberry tumors and right phakoma of retina. Conclusion: Computed tomography also revaled the nasal hamartoma. Histopathologic examination confirmed the diagnosis of angiomyolipoma because the lesion was composed of smooth muscle bundles, mature adipose tissue and blood vessels of different sizes. He remained seizures free after treatment.

  15. Influence of catechol-O-methyltransferase (COMT) genotypes on the prognosis of canine mammary tumors.

    Science.gov (United States)

    Dias Pereira, P; Lopes, C C; Matos, A J F; Pinto, D; Gärtner, F; Lopes, C; Medeiros, R

    2009-11-01

    Catechol-O-methyltransferase (COMT) is an important enzyme involved in inactivation of catechol estrogens, which are metabolites with carcinogenic properties. Some investigations in human breast cancer associate a genetic polymorphism in the COMT gene (COMT val158met) with an increased risk and poor clinical progression of the disease. In dogs, there are 2 recognized single nucleotide polymorphisms in the COMT gene (COMTG216A and COMTG482A); however, their influence on the outcome of mammary neoplasms has never been investigated. The purpose of this study is to investigate the influence of COMT in the clinical progression of canine mammary tumors, namely in recurrence, metastasis and survival by testing 2 SNPs (G216A and G482A), and 2 genotypes of the COMT gene. A case series was conducted analyzing genomic DNA samples by polymerase chain reaction-restriction fragment length polymorphism from 80 bitches with mammary tumors. Animals were submitted to an active follow-up study for a period of 24 months after surgery. We observed that bitches carrying both genetic variations simultaneously are more likely to develop recurrence of mammary lesions. Our results demonstrate a possible role for COMT genotypes in the outcome of mammary neoplasms in the dog. Identifying a genetic factor predictive of recurrence may be useful in selecting the most effective surgical approach for canine mammary neoplasms. PMID:19605895

  16. Roles of DNA mutation in the coding region and DNA methylation in the 5' flanking region of BRCA1 in canine mammary tumors.

    Science.gov (United States)

    Qiu, Hengbin; Lin, Deigui

    2016-07-01

    The Breast cancer 1, early onset gene (BRCA1) is known to be significantly associated with human familial breast cancer and is identified to play an important role in canine mammary tumors. Here, genetic variations in the coding region and DNA methylation in the 5' flanking region of BRCA1 in canine mammary tumor samples, 15 each of benign and malignant against 10 normal canine mammary tissue samples, were analyzed using the direct sequencing method. The results indicated two point mutations each in the coding region of canine BRCA1 in one benign mammary tumor sample (4702G >T and 4765G >T) and in one malignant canine mammary tumor sample (3619A >G and 4006G >A). No mutations were detected in the normal canine mammary tissue samples. The 4702G >T mutation was found to terminate further translation. The physical effect of the 4765G >T mutation was found to be the repalacement of the glutamate residue with glutamine. The physical effect of the 3619A >G mutation was found to be the replacement of the threonine residue with alanine, and that of mutation 4006G >A was the replacement of the valine residue with isoleucine in the BRCA1 protein. Bisulfite sequencing detected methylated CpG sites in one canine malignant mammary tumor sample. In conclusion, the present study elucidated the mutational status of the BRCA1 coding region and methylation status of the 5' flanking region of BRCA1 in canine mammary tumors. PMID:26888582

  17. Alternativas Terapéuticas en las neoplasias vesicales caninas Therapeutic options in canine bladder tumors

    Directory of Open Access Journals (Sweden)

    R.L. Rovere

    2002-01-01

    Full Text Available Las neoplasias vesicales en caninos representan menos del 1% de los tumores presentes en esta especie. El tratamiento quirúrgico se indica en tumores benignos y como complemento de la quimioterapia y radioterapia. Para la quimioterapia se emplean más frecuentemente la doxorrubicina, el 5-fluorouracilo, la ciclofosfamida, la vincristina y cisplatino. La asociación de la doxorrubicina-ciclofosfamida por vía sistémica en asociación con el cisplatino intravesical, sería un tratamiento recomendable, en particular en los casos de carcinoma de células de transiciónThe canine urinary bladder tumors represent less than 1% of all tumors present in this species. Surgical treatment is indicated in benign tumors and combined with chemotherapy or radiotherapy. Doxorubicin, 5 fluorouracil, cyclophosphamide, vincristine and cisplatin are the drugs mostly used for chemotherapy. Systemic Doxorubicin-ciclophosphamide therapy in association with intravesical cisplatin therapy are recommended, particularly in transitional cell carcinoma

  18. Interleukin-12 Inhibits Tumor Growth in a Novel Angiogenesis Canine Hemangiosarcoma Xenograft Model

    Directory of Open Access Journals (Sweden)

    Nasim Akhtar

    2004-03-01

    Full Text Available We established a canine hemangiosarcoma cell line derived from malignant endothelial cells comprising a spontaneous tumor in a dog to provide a renewable source of endothelial cells for studies of angiogenesis in malignancy. Pieces of the hemangiosarcoma biopsy were engrafted subcutaneously in a bg/nu/XID mouse allowing the tumor cells to expand in vivo. A cell line, SB-HSA, was derived from the xenograft. SB-HSA cells expressed vascular endothelial growth factor (VEGF receptors 1 and 2, CD31, CD146, and αvβ3 integrin, and produced several growth factors and cytokines, including VEGF, basic fibroblast growth factor, and interleukin (IL-8 that are stimulatory to endothelial cell growth. These results indicated that the cells recapitulated features of mitotically activated endothelia. In vivo, SB-HSA cells stimulated robust angiogenic responses in mice and formed tumor masses composed of aberrant vascular channels in immunocompromised mice providing novel opportunities for investigating the effectiveness of antiangiogenic agents. Using this model, we determined that IL-12, a cytokine with both immunostimulatory and antiangiogenic effects, suppressed angiogenesis induced by, and tumor growth of, SB-HSA cells. The endothelial cell model we have described offers unique opportunities to pursue further investigations with IL-12, as well as other antiangiogenic approaches in cancer therapy.

  19. Identification of tumor-initiating cells in a canine hepatocellular carcinoma cell line.

    Science.gov (United States)

    Michishita, Masaki; Ezaki, Shiori; Ogihara, Kikumi; Naya, Yuko; Azakami, Daigo; Nakagawa, Takayuki; Sasaki, Nobuo; Arai, Toshiro; Shida, Takuo; Takahashi, Kimimasa

    2014-04-01

    Tumor-initiating cells (TICs) or cancer stem cells (CSCs), a small subset of tumor cells, are involved in tumor initiation, progression, recurrence and metastasis. In human hepatocellular carcinoma (HCC), TICs are enriched with cell surface markers and have the ability to self-renew and differentiate tumors at a high frequency. We established a canine HCC cell line, HCC930599, and analyzed it for stem and progenitor cell marker expression using flow cytometry. HCC930599 showed high CD44 and CD29, moderate CD90, and low CD133, CD34, CD24, CD117, and CD13 expression. CD90(+)CD44(+) and CD90(-)CD44(+) cells were characterized using the in vitro sphere assay and an in vivo transplant model. CD90(+)CD44(+) cells acquired enhanced self-renewal capacity, proliferative activity and tumourigenicity compared with CD90(-)CD44(+) cells, suggesting that TICs exist in the HCC930599 cell line and that CD90 is a marker for enriched TICs. Understanding TIC characteristics may help elucidate hepatic carcinogenesis and HCC therapy development. PMID:24534130

  20. A benchmark analysis of radiation flux distribution for Boron Neutron Capture Therapy of canine brain tumors

    International Nuclear Information System (INIS)

    Calculations of radiation flux and dose distributions for Boron Neutron Capture Therapy (BNCT) of brain tumors are typically performed using sophisticated three-dimensional analytical models based on either a homogeneous approximation or a simplified few-region approximation to the actual highly-heterogeneous geometry of the irradiation volume. Such models should be validated by comparison with calculations using detailed models in which all significant macroscopic tissue heterogeneities and geometric structures are explicitly represented as faithfully as possible. This work describes a validation exercise for BNCT of canine brain tumors. Geometric measurements of the canine anatomical structures of interest for this work were performed by dissecting and examining two essentially identical Labrador Retriever heads. Chemical analyses of various tissue samples taken during the dissections were conducted to obtain measurements of elemental compositions for tissues of interest. The resulting geometry and tissue composition data were then used to construct a detailed heterogeneous calculational model of the Labrador Retriever head. Calculations of three-dimensional radiation flux distributions pertinent to BNCT were performed for the model using the TORT discrete-ordinates radiation transport code. The calculations were repeated for a corresponding volume-weighted homogeneous tissue model. Comparison of the results showed that the peak neutron and photon flux magnitudes were quite similar for the two models (within 5%), but that the spatial flux profiles were shifted in the heterogeneous model such that the fluxes in some locations away from the peak differed from the corresponding fluxes in the homogeneous model by as much as 10-20%. Differences of this magnitude can be therapeutically significant, emphasizing the need for proper validation of simplified treatment planning models

  1. A benchmark analysis of radiation flux distribution for Boron Neutron Capture Therapy of canine brain tumors

    Energy Technology Data Exchange (ETDEWEB)

    Moran, J.M.

    1992-02-01

    Calculations of radiation flux and dose distributions for Boron Neutron Capture Therapy (BNCT) of brain tumors are typically performed using sophisticated three-dimensional analytical models based on either a homogeneous approximation or a simplified few-region approximation to the actual highly-heterogeneous geometry of the irradiation volume. Such models should be validated by comparison with calculations using detailed models in which all significant macroscopic tissue heterogeneities and geometric structures are explicitly represented as faithfully as possible. This work describes a validation exercise for BNCT of canine brain tumors. Geometric measurements of the canine anatomical structures of interest for this work were performed by dissecting and examining two essentially identical Labrador Retriever heads. Chemical analyses of various tissue samples taken during the dissections were conducted to obtain measurements of elemental compositions for tissues of interest. The resulting geometry and tissue composition data were then used to construct a detailed heterogeneous calculational model of the Labrador Retriever head. Calculations of three-dimensional radiation flux distributions pertinent to BNCT were performed for the model using the TORT discrete-ordinates radiation transport code. The calculations were repeated for a corresponding volume-weighted homogeneous tissue model. Comparison of the results showed that the peak neutron and photon flux magnitudes were quite similar for the two models (within 5%), but that the spatial flux profiles were shifted in the heterogeneous model such that the fluxes in some locations away from the peak differed from the corresponding fluxes in the homogeneous model by as much as 10-20%. Differences of this magnitude can be therapeutically significant, emphasizing the need for proper validation of simplified treatment planning models.

  2. Interstitial radiation therapy for early-stage nasal vestibule cancer: A continuing quest for optimal tumor control and cosmesis

    International Nuclear Information System (INIS)

    Introduction: This article reports on the effectiveness, cosmetic outcome, and costs of interstitial high-dose-rate (HDR) brachytherapy for early-stage cancer of the nasal vestibule (NV) proper and/or columella high-dose-rate (HDR). Methods and Materials: Tumor control, survival, cosmetic outcome, functional results, and costs were established in 64 T1/T2N0 nasal vestibule cancers treated from 1991-2005 by fractionated interstitial radiation therapy (IRT) only. Total dose is 44 Gy: 2 fractions of 3 Gy per day, 6-hour interval, first and last fraction 4 Gy. Cosmesis is noted in the chart by the medical doctor during follow-up, by the patient (visual analog scale), and by a panel. Finally, full hospital costs are computed. Results: A local relapse-free survival rate of 92% at 5 years was obtained. Four local failures were observed; all four patients were salvaged. The neck was not treated electively; no neck recurrence in follow-up was seen. Excellent cosmetic and functional results were observed. With 10 days admission for full treatment, hospital costs amounted to Euro 5772 ($7044). Conclusion: Excellent tumor control, cosmesis, and function of nasal airway passage can be achieved when HDR-IRT for T1/T2N0 NV cancers is used. For the more advanced cancers (Wang classification: T3 tumor stage), we elect to treat by local excision followed by a reconstructive procedure. The costs, admission to hospital inclusive, for treatment by HDR-IRT amounts to Euro 5772 ($7044 US). This contrasts substantially with the full hospital costs when NV cancers are treated by plastic reconstructive surgery, being on average threefold as expensive

  3. Immunohistochemical study of genital and extragenital forms of canine transmissible venereal tumor in Brazil

    Directory of Open Access Journals (Sweden)

    Mariana B. Mascarenhas

    2014-03-01

    Full Text Available Aiming to provide insight and discussing the problems related to the diagnosis and differential diagnosis of canine transmissible venereal tumor (CTVT, especially in its extragenital form, immunohistochemical evaluation was performed and a comparison was established by analysis of the microscopic appearance of 10 genital CTVTs and 13 exclusively extragenital CTVTs previously diagnosed by cytology and histopathology. CTVTs samples were incubated with biotinylated antibodies raised against specific membrane (anti-macrophage and cytoplasmic antigens (anti-lysozyme, anti-S-100 protein, anti-vimentin and anti-CD18 and subsequently developed using streptavidin-biotin peroxidase and streptavidin-biotin-alkaline phosphatase methods. A strong reactivity with the anti-vimentin antibody was found in 100% of the tumors tested (22/22. No reactivity was found for the anti-lysozyme, anti-macrophage, anti-S-100 protein and anti-CD18. No histopathological or immunoreactivity differences between genital and extragenital CTVTs were found. These findings do not corroborate the hypothesis of histiocytic origin of CTVT (no reactivity to anti-lysozyme, anti-macrophage and anti-CD 18 antibodies. In addition, the antibody panel used is useful to narrow the differential diagnosis for lymphomas, histiocytic tumors, amelanotic melanomas, and poorly differentiated epithelial neoplasias, among others.

  4. Conformal radiotherapy for paranasal sinus and nasal cavity tumors: three-dimensional treatment planning and preliminary results in 40 patients

    International Nuclear Information System (INIS)

    Purpose: To assess the possibility to deliver a high and homogeneous irradiation with respect to maximal tolerated dose to the visual pathways for paranasal sinus and nasal cavity tumors. Methods and Materials: Forty patients with advanced stage malignant tumors were treated with postoperative (30) or primary (10 patients) conformal radiotherapy (CRT). Five patients were previously irradiated. Six to 15 individually shaped isocentric noncoplanar field arrangements, using a multileaf collimator were designed. Dose-volume histograms (DVH) for the planning target volumes (PTV) and the optic pathways were analyzed in 31 cases. Results: Median and maximal delivered doses to the PTV were 60 (±3) and 66 (±4) Gy. Dose distributions for critical organs are detailed. Median follow-up was 19 months (3 to 48). Local, nodal, and metastatic recurrences occurred in 8, 2, and 7 cases, respectively. Major prognostic factor for local recurrences was central nervous system (CNS) involvement. One patient died of meningitis. Two patients developed cataract, and 1 patient ipsilateral blindness due to vascular glaucoma. Conclusion: CRT for locally advanced paranasal sinus and nasal cavity tumors enables the delivery of high homogeneous doses to the PTV with respect to critical organs, with a low toxicity and a high local control

  5. Treatment of nasal hemangiomas.

    Science.gov (United States)

    Simic, R; Vlahovic, A; Subarevic, V

    2009-10-01

    Hemangiomas are the most common soft tissue tumors of infancy. Almost 60% of these tumors develop in the head and neck region. Nasal hemangiomas, distort human physiognomy and leave long lasting psychological sequelae. Conservative approach (intralesional corticosteroids, laser) may accelerate involution. Proponents of an early surgery suggest that aesthetic improvement during a critical period in child development can be achieved. Fourteen patients with nasal hemangioma were treated during 5-year period (2003-2007) with intralesional corticosteroids, lenticular excision, open rhinoplasty excision, and circular excision with "purse string suture". The first line of treatment for large nasal hemangiomas is intralesional corticosteroids. Excision is indicated for small hemangiomas, while subtotal excision is preferable for large nasal hemangiomas. Circular excision and "purse string suture" is appropriate for prominent hemangiomas with predominant deep component. In our opinion surgery with maximal care for nasal architecture is the treatment option for nasal hemangioma. PMID:19656579

  6. The establishment of transmissible venereal tumor lung cancer model in canine and the observation of its biological characteristics

    International Nuclear Information System (INIS)

    Objective: To establish an allogeneic transplanted lung cancer model in canine by percutaneously injecting canine transmissible venereal tumor (CTVT) cell suspension and to observe its biological characteristics. Methods: Under CT guidance fresh CTVT cell suspension was inoculated into the middle or posterior lobe of lungs through percutaneous puncturing needle in 12 beagle dogs. Cyclosporin was administrated orally to obtain immunosuppression. Tumor growth and metastasis were judged by chest CT scanning at regular intervals (every 1-2 weeks). The daily mental and physical condition of the dogs was observed. Autopsy and pathological examination were performed when the animals died naturally or at the tenth week after the procedure when the animals were sacrificed. Results: A total of 15 sites were inoculated in 12 dogs. The formation of tumor was observed in 2 dogs at the fifth week and in 9 dogs at the sixth week. Ten weeks after the inoculation the formation of tumor was detected in 10 inoculated points in 9 dogs, the inoculation success rate was 66.67%. The mean largest diameter of the tumor at 6, 8 and 10 weeks after the inoculation was (1.059 ± 0.113)cm, (1.827 ± 0.084)cm and (2.189 ± 0.153)cm, respectively. The largest diameter of the tumor nodule was 3.5 cm. Moderate to severe pleural effusion and mediastinal lymph nodes metastasis were found in all the dogs that showed the formation of the tumor. Conclusion: Percutaneous CTVT cell suspension injection can establish an allogeneic canine lung cancer model, which is helpful for the experimental studies related to lung cancer. (authors)

  7. Effect of selenodiglutathione on the metabolism of canine mammary tumor cells

    International Nuclear Information System (INIS)

    Selenodiglutathione (SDG) has been shown to be an effective inhibitor of tumor growth. The present studies were designed to evaluate altered metabolism in canine mammary tumor cells (CMT-13) exposed to various concentrations of SDG. Addition of SDG at 0.025 μg Se/ml did not inhibit growth of CMT-13 cells after 24 h of incubation. At this concentration of SDG, approximately 25% of 75Se-35S-SDG was retained in these tumor cells after 24 h of incubation. The nuclear fraction contained 96% of the 75Se and 35S radioactivity. The ratio of 75Se to 35S was 1 to 4.5 in the whole cell and in the nuclear fraction. SDG increased glutathione peroxidase activity by 40% compared to CMT-13 cells not exposed to SDG. Glutathione reductase activity was decreased by 63% by the addition of SDG. In addition, supplemental SDG resulted in a 55% decrease in GSH content but did not alter GSSG concentrations. After 4d of incubation, SDG at 0.1 and 0.5 μg Se/ml caused a 43 and 58% inhibition of growth of CMT-13 cells. Addition of GSH (100μM) partially prevented, 68% and 54%, the growth inhibition caused by SDG at concentrations of 0.1 and 0.5 μg Se per ml respectively during the 4d incubation period. Preincubation of CMT-13 cells with GSH for 48 h before addition of SDG (0.5 μg Se/ml) completely prevented the growth inhibition caused by this seleno-compound

  8. Intratumoral FoxP3 expression is associated with angiogenesis and prognosis in malignant canine mammary tumors.

    Science.gov (United States)

    Carvalho, Maria Isabel; Pires, Isabel; Prada, Justina; Gregório, Hugo; Lobo, Luis; Queiroga, Felisbina L

    2016-10-01

    The activity of regulatory T cells (Tregs) is closely associated with the expression of FoxP3 transcription factor. FoxP3 regulatory T cells (FoxP3Treg) have immunosuppressive properties and can work for prevention of harmful autoimmune responses, however can also interfere with beneficial anti-tumor immunity. In human breast cancer these cells play a crucial role in tumor progression. In canine mammary tumors (CMT) this topic is not well-documented. This study included 80 malignant CMT and studied, by immunohistochemistry, the intratumoral FoxP3 expression together with microvessel density (MVD), vascular endothelial growth factor (VEGF) and several clinicopathological characteristics. Abundant FoxP3Treg cells were associated with tumor necrosis (p=0.001), high mitotic grade (paggression in these tumors. The association of intratumoral FoxP3 expression with shorter OS in multivariate analysis suggests the usefulness of Treg cells as an independent prognostic marker. PMID:27496736

  9. Endoscopic trans-nasal approach for biopsy of orbital tumors using image-guided neuro-navigation system

    International Nuclear Information System (INIS)

    Histopathological diagnosis of intraorbital tumors is of crucial value for planning further therapy. The aim of the study was to explore clinical utility of image-guided endoscopy for biopsy of orbital tumors. Trans-nasal endoscopic biopsy of intraorbital mass lesions was performed in 6 patients using a neuro-navigation system (Medtronic Stealth Station Treon plus). The CT and MRI 1 mm slice images were fused by the system in order to visualise both bony and soft tissue structures. The anatomic fiducial registration protocol was used during the procedure. All lesions were precisely localised and the biopsies could be taken from the representative part of the pathological mass. None of the patients developed aggravation of ocular symptoms after the procedure. The operative corridor as well as the size of orbital wall fenestration could be limited to a minimum. The accuracy of neuro-navigation remained high and stable during the entire procedure. The image-guided neuro-navigation system facilitated endoscopic localisation and biopsy of intraorbital tumors and contributed to the reduction of surgical trauma during the procedure. The technique was particularly useful in small, medially located, retrobulbar tumors and in unclear situations when the structure of the lesion resembled surrounding intraorbital tissue. (author)

  10. Correlation of pretreatment polarographically measured oxygen pressures with quantified contrast-enhanced power doppler ultrasonography in spontaneous canine tumors and their impact on outcome after radiation therapy

    International Nuclear Information System (INIS)

    Purpose: to evaluate the use of noninvasive quantified contrast-enhanced power Doppler ultrasonography as a surrogate in the estimation of tumor hypoxia measured by invasive pO2 histography in canine tumors. Material and methods: data of pretreatment tumor oxygenation status, tumor vascularity and blood volume, and tumor response after radiation therapy was collected in 48 spontaneous malignant oral tumors (Table 1). Tumor oxygenation status was correlated to vascularity and blood volume, and influences on outcome after treatment were analyzed. Results: although vascularity and blood volume correlated moderately with median pO2 (r = 0.51 and 0.61; p = 0.001 and 2 readings ≤ 2.5, 5, and 10 mmHg (r = -0.37 to -0.42; p 2 histography. Both technologies were nonprognostic indicators in spontaneous malignant canine oral tumors. (orig.)

  11. alpha-Galactosylceramide can act as a nasal vaccine adjuvant inducing protective immune responses against viral infection and tumor.

    Science.gov (United States)

    Ko, Sung-Youl; Ko, Hyun-Jeong; Chang, Woo-Sung; Park, Se-Ho; Kweon, Mi-Na; Kang, Chang-Yuil

    2005-09-01

    alpha-Galactosylceramide (alpha-GalCer) is a ligand of invariant Valpha14+ NKT cells and is presented by CD1d molecule on APC. NKT cells produce a large amount of Th1 and Th2 cytokines in response to alpha-GalCer-presented APC. In this study, we assessed whether alpha-GalCer could act as an effective nasal vaccine adjuvant for mucosal vaccine that would be capable of inducing systemic as well as mucosal immune responses. When alpha-GalCer was administered with OVA via the intranasal route to C57BL/6 and BALB/c mice, significant OVA-specific mucosal secretory IgA, systemic IgG, and CTL responses were induced with mixed Th1 and Th2 cytokine profiles seen in both strains of mice. Interestingly, as BALB/c mice were intranasally immunized with PR8 hemagglutinin Ag isolated from influenza virus A/PR/8/34 together with alpha-GalCer, significant protection was afforded against influenza viral infection. When alpha-GalCer was coimmunized with a replication-deficient live adenovirus to BALB/c mice, it significantly induced both humoral and cellular immune responses. In addition, intranasal administration of OVA with alpha-GalCer showed complete protection against EG7 tumor challenge in C57BL/6. The adjuvant effects induced by intranasal coadministration with alpha-GalCer were blocked in CD1d-/- mice, indicating that the immune responses were exclusively mediated by CD1d molecule on APC. Most interestingly, intranasally coadministered alpha-GalCer activated naive T cells and triggered them to differentiate into functional effector T cells when CFSE-labeled OT-1 cells were adoptively transferred into syngeneic mice. Overall, our results are the first to show that alpha-GalCer can act as a nasal vaccine adjuvant inducing protective immune responses against viral infections and tumors. PMID:16116223

  12. Evaluation of tumor markers carcinoembryonic antigen, cytokeratin 19 fragment and cancer-associated antigen 72-4 in neoplastic and non-neoplastic canine effusions differentiation

    OpenAIRE

    L.V Teixeira; T.A. Guerra; F.O. Conrado; S.R. Terra; D.G. Gerardi; González, F.H.D.

    2014-01-01

    The concentration of tumor markers in body fluids can be used for diagnosis and prognosis of patients. This study aimed to investigate the performance of tumor markers cytokeratin 19 fragment (CYFRA 21-1), cancer-associated antigen 72-4 (CA 72-4) and carcinoembryonic antigen (CEA) in the neoplastic and non-neoplastic canine effusions. In thirty-two neoplastic (n=16) and non-neoplastic (n=16) samples of canine thoracic or abdominal effusions, tumor markers were measured. Significant statistica...

  13. Radiation therapy for tumors of the nasal cavity and paranasal sinuses

    International Nuclear Information System (INIS)

    Cancers of the nasal fossa and paranasal sinuses are not common (less than 1 per cent of all cancers), are usually diagnosed late, and more often than not are uncontrolled by current methods of treatment. The symptoms of this group of cancers are nonspecific and are readily mistaken by both the patient and the primary care physician for upper respiratory infections or inflammations of the sinuses. By the time cancer is suspected and the diagnosis is established, several bony walls will have been breached and the anatomic site of origin may no longer be clear. To be successful, treatment often must include eradication of cancer near to or infiltrating critical normal organs or tissues. Radiation therapy has acquired its position in the management of these patients because of its potential for at least partial sparing of these critical tissues. There are five basic techniques available for irradiating cancers of the nasal fossa and paranasal sinuses. The optimal technique varies with the size, shape, and location of the volume requiring irradiation and the anticipated tolerances of associated normal structures

  14. Correlation of tumor-infiltrating lymphocytes to histopathological features and molecular phenotypes in canine mammary carcinoma: A morphologic and immunohistochemical morphometric study

    OpenAIRE

    Kim, Jong-Hyuk; Chon, Seung-Ki; Im, Keum-Soon; Kim, Na-Hyun; Sur, Jung-Hyang

    2013-01-01

    Abundant lymphocyte infiltration is frequently found in canine malignant mammary tumors, but the pathological features and immunophenotypes associated with the infiltration remain to be elucidated. The aim of the present study was to evaluate the relationship between lymphocyte infiltration, histopathological features, and molecular phenotype in canine mammary carcinoma (MC). The study was done with archived formalin-fixed, paraffin-embedded samples (n = 47) by histologic and immunohistochemi...

  15. Failure-to-thrive syndrome associated with tumor formation by Madin-Darby canine kidney cells in newborn nude mice.

    Science.gov (United States)

    Brinster, Lauren R; Omeir, Romelda L; Foseh, Gideon S; Macauley, Juliete N; Snoy, Philip J; Beren, Joel J; Teferedegne, Belete; Peden, Keith; Lewis, Andrew M

    2013-08-01

    Tumors that formed in newborn nude mice that were inoculated with 10(7) Madin-Darby canine kidney (MDCK) cells were associated with a failure-to-thrive (FTT) syndrome consisting of growth retardation, lethargy, weakness, and dehydration. Scoliosis developed in 41% of affected pups. Pups were symptomatic by week 2; severely affected pups became moribund and required euthanasia within 3 to 4 wk. Mice with FTT were classified into categories of mild, moderate, and severe disease by comparing their weight with that of age-matched normal nude mice. The MDCK-induced tumors were adenocarcinomas that invaded adjacent muscle, connective tissue, and bone; 6 of the 26 pups examined had lung metastases. The induction of FTT did not correlate with cell-line aggressiveness as estimated by histopathology or the efficiency of tumor formation (tumor-forming dose 50% endpoint range = 10(2.8) to 10(7.5)); however, tumor invasion of the paravertebral muscles likely contributed to the scoliosis noted. In contrast to the effect of MDCK cells, tumor formation observed in newborn mice inoculated with highly tumorigenic, human-tumor-derived cell lines was not associated with FTT development. We suggest that tumor formation and FTT are characteristics of these MDCK cell inocula and that FTT represents a new syndrome that may be similar to the cachexia that develops in humans with cancer or other diseases. PMID:24209967

  16. Selenium Induces an Anti-tumor Effect Via Inhibiting Intratumoral Angiogenesis in a Mouse Model of Transplanted Canine Mammary Tumor Cells.

    Science.gov (United States)

    Li, Wenyu; Guo, Mengyao; Liu, Yuzhu; Mu, Weiwei; Deng, Ganzhen; Li, Chengye; Qiu, Changwei

    2016-06-01

    Selenium (Se) has been widely reported to possess anti-tumor effects. Angiogenesis is the formation of new blood vessels and is required to supply oxygen, nutrients, and growth factors for tumor growth, progression, and metastasis. To explore whether the anti-tumor effect of Se was associated with angiogenesis in vivo, we studied the effects of sodium selenite (Sel) and methylseleninic acid (MSA) on tumors induced by canine mammary tumor cells (CMT1211) in mice; cyclophosphamide (CTX) served as a positive control. The results showed that the Se content was significantly increased in the Sel and MSA groups. Se significantly inhibited the tumor weights and volumes. Large necrotic areas and scattered and abnormal small necrotic areas were observed in the Se treatment group. Immunofluorescence double staining showed a reduction in the microvessel density (MVD) and increment in the vessel maturation index (VMI) compared with the untreated control group. As expected, the protein and mRNA levels of the angiogenesis factors angiopoietin-2 (Ang-2), platelet-derived growth factor (PDGF), and vascular endothelial growth factor (VEGF) were decreased in the Se-treated tumors by IHC, as shown by western blotting and RT-QPCR. We also found that organic Se MSA provided stronger inhibition of tumor growth compared with inorganic sodium selenite (Sel). Altogether, our results indicated that Se exerted anti-tumor effects in vivo at least partially by inhibiting angiogenic factors. PMID:26507439

  17. Intensity-Modulated Radiotherapy for Tumors of the Nasal Cavity and Paranasal Sinuses: Clinical Outcomes and Patterns of Failure

    Energy Technology Data Exchange (ETDEWEB)

    Wiegner, Ellen A.; Daly, Megan E.; Murphy, James D.; Abelson, Jonathan; Chapman, Chris H.; Chung, Melody; Yu, Yao; Colevas, A. Dimitrios; Kaplan, Michael J.; Fischbein, Nancy; Le, Quynh-Thu [Department of Radiation Oncology, Stanford University, Stanford, CA (United States); Chang, Daniel T., E-mail: dtchang@stanford.edu [Department of Radiation Oncology, Stanford University, Stanford, CA (United States)

    2012-05-01

    Purpose: To report outcomes in patients treated with intensity-modulated radiotherapy (IMRT) for tumors of the paranasal sinuses and nasal cavity (PNS/NC). Methods/Materials: Between June 2000 and December 2009, 52 patients with tumors of the PNS/NC underwent postoperative or definitive radiation with IMRT. Twenty-eight (54%) patients had squamous cell carcinoma (SCC). Twenty-nine patients (56%) received chemotherapy. The median follow-up was 26.6 months (range, 2.9-118.4) for all patients and 30.9 months for living patients. Results: Eighteen patients (35%) developed local-regional failure (LRF) at median time of 7.2 months. Thirteen local failures (25%) were observed, 12 in-field and 1 marginal. Six regional failures were observed, two in-field and four out-of-field. No patients treated with elective nodal radiation had nodal regional failure. Two-year local-regional control (LRC), in-field LRC, freedom from distant metastasis (FFDM), and overall survival (OS) were 64%, 74%, 71%, and 66% among all patients, respectively, and 43%, 61%, 61%, and 53% among patients with SCC, respectively. On multivariate analysis, SCC and >1 subsite involved had worse LRC (p = 0.0004 and p = 0.046, respectively) and OS (p = 0.003 and p = 0.046, respectively). Cribriform plate invasion (p = 0.005) and residual disease (p = 0.047) also had worse LRC. Acute toxicities included Grade {>=}3 mucositis in 19 patients (37%), and Grade 3 dermatitis in 8 patients (15%). Six patients had Grade {>=}3 late toxicity including one optic toxicity. Conclusions: IMRT for patients with PNS/NC tumors has good outcomes compared with historical series and is well tolerated. Patients with SCC have worse LRC and OS. LRF is the predominant pattern of failure.

  18. Intensity-Modulated Radiotherapy for Tumors of the Nasal Cavity and Paranasal Sinuses: Clinical Outcomes and Patterns of Failure

    International Nuclear Information System (INIS)

    Purpose: To report outcomes in patients treated with intensity-modulated radiotherapy (IMRT) for tumors of the paranasal sinuses and nasal cavity (PNS/NC). Methods/Materials: Between June 2000 and December 2009, 52 patients with tumors of the PNS/NC underwent postoperative or definitive radiation with IMRT. Twenty-eight (54%) patients had squamous cell carcinoma (SCC). Twenty-nine patients (56%) received chemotherapy. The median follow-up was 26.6 months (range, 2.9–118.4) for all patients and 30.9 months for living patients. Results: Eighteen patients (35%) developed local-regional failure (LRF) at median time of 7.2 months. Thirteen local failures (25%) were observed, 12 in-field and 1 marginal. Six regional failures were observed, two in-field and four out-of-field. No patients treated with elective nodal radiation had nodal regional failure. Two-year local-regional control (LRC), in-field LRC, freedom from distant metastasis (FFDM), and overall survival (OS) were 64%, 74%, 71%, and 66% among all patients, respectively, and 43%, 61%, 61%, and 53% among patients with SCC, respectively. On multivariate analysis, SCC and >1 subsite involved had worse LRC (p = 0.0004 and p = 0.046, respectively) and OS (p = 0.003 and p = 0.046, respectively). Cribriform plate invasion (p = 0.005) and residual disease (p = 0.047) also had worse LRC. Acute toxicities included Grade ≥3 mucositis in 19 patients (37%), and Grade 3 dermatitis in 8 patients (15%). Six patients had Grade ≥3 late toxicity including one optic toxicity. Conclusions: IMRT for patients with PNS/NC tumors has good outcomes compared with historical series and is well tolerated. Patients with SCC have worse LRC and OS. LRF is the predominant pattern of failure.

  19. Malignant melanoma of the nasal septum, a rare tumor, occurring in a 54-year-old patient after hereditary retinoblastoma treatment.

    Science.gov (United States)

    Djiguimdé, Windinmanégdé Pierre; Diomandé, Ibrahim Abib; Bonnin, Nicolas; Saroul, Nicolas; Touré, Abdoulaye; Sanou, Jérôme; Sankara, Paté; Russier, Marc; Gilain, Laurent; Ahnoux-Zabsonré, Ahgbatouhabéba; Meda, Nonfounikoun; Bacin, Franck

    2016-01-01

    The authors report a case of a malignant melanoma of the nasal cavity that is a rare tumor and very aggressive, constituting 1% of all melanomas. It appeared in a patient 54 years after he was treated for a hereditary retinoblastoma. Its symptoms are nonspecific, and often marked by epistaxis. Its diagnosis is histological, supported by immunohistochemistry. Its prognosis is often unfavorable, and characterized by the occurrence of metastases and recurrences. Because of the risk of secondary cancer that exists in any survivor of hereditary retinoblastoma, we must think of possible mucosal melanoma of the nasal sinus in these patients in cases of chronic epistaxis. The prognosis of this tumor depends on its early diagnosis and surgical treatment. PMID:26929670

  20. Nasal Physiology

    Science.gov (United States)

    ... Q&A Complications of Sinusitis Epistaxis (Nosebleeds) Allergic Rhinitis (Hay Fever) Headaches and Sinus Disease Disorders of ... of the autonomic, i.e. automatic, nervous system) controls blood flow to the nasal cavity and nasal ...

  1. Nasal Cancer

    Science.gov (United States)

    ... the way to your throat as you breathe. Cancer of the nasal cavity and paranasal sinuses is ... be like those of infections. Doctors diagnose nasal cancer with imaging tests, lighted tube-like instruments that ...

  2. Nasal polyps

    Science.gov (United States)

    ... may not have any symptoms. If polyps block nasal passages, a sinus infection can develop. Symptoms include: Runny ... steroid sprays shrink polyps. They help clear blocked nasal passages and runny nose. Symptoms return if treatment is ...

  3. A study to evaluate single port, central axis dosimetry and verification techniques for veterinary radiotherapy, using the canine nasal cavity as a model target

    International Nuclear Information System (INIS)

    Ten normal dogs received single doses of Co-60 radiation to their nasal cavity. The minimum nasal cavity dose was estimated using three different techniques: manual calculation from percent depth dose tables, computerized planning for a homogenous field, and computerized planning utilizing field heterogeneity factors. The doses delivered were measured by LiF thermoluminescent dosimetry (TLD) and by verification film densitometry. The radiation dose resulting from manual calculated prescriptions correlated well to those from computerized planning for a homogenous soft tissue field (corr. coeff. .87; p = .001). However, for both of these methods the estimated dose differed from the measured dose by about 12%. Computerized planning utilizing field heterogeneity factors showed no improvement over the previous two methods, (corr. coeff. .88; p = .0009) but the results were biased by the dose measurements being central axis doses in a normal nasal cavity. Both manual and computerized verification film densitometry correlated well to TLD measurements (corr. coeff. .97 and .94 respectively, p = .00001 and p = .001 respectively), differing from TLD measurements by about 5-7%. Both manual and computerized verification film densitometry correlated well to manual calculated prescriptions (corr. coeff. .86 and .85 respectively, p = .0015 and .0016 respectively). Also manual and computerized verification film densitometry correlated well to computer calculations using homogenous tissue fields (corr. coeff. .86 and .85 respectively, p = .0015 and .0016 respectively) and to computer calculations using heterogeneity factors (corr. coeff. .89 and .89 respectively, p = .005 and .0005 respectively). Film densitometry was found to be a good method to spot check dose delivery to the nasal cavity, a body part for which accurate dosimetry is difficult to achieve

  4. Estrogens metabolism associated with polymorphisms: influence of COMT G482a genotype on age at onset of canine mammary tumors.

    Science.gov (United States)

    Dias Pereira, P; Lopes, C C; Matos, A J F; Pinto, D; Gärtner, F; Lopes, C; Medeiros, R

    2008-03-01

    Catechol-O-methyltransferase (COMT) is an important enzyme participating in inactivation of carcinogenic oestrogen metabolites. In humans there is a single nucleotide polymorphism in COMT gene (COMT val158met) that has been associated with an increased risk for developing breast cancer. In dogs, there is a single nucleotide polymorphism in COMT gene (G482A), but its relation with mammary carcinogenesis has never been investigated. The aim of this study was to focus on the evaluation of such polymorphism as a risk factor for the development of mammary tumors in bitches and on the analysis of its relationship with some clinicopathologic features (dog's age and weight, number and histologic type of the lesions, lymph node metastasis) of canine mammary neoplasms. A case-control study was conducted analyzing 90 bitches with mammary tumors and 84 bitches without evidence of neoplastic disease. The COMT G482A polymorphism was analyzed by PCR-RFLP. We found a protective effect of the polymorphism in age of onset of mammary tumors, although we could not establish a significant association between COMT genotype and other clinicopathologic parameters nor with mammary tumor risk overall. Animals carrying the variant allele have a threefold likelihood of developing mammary tumors after 9 years of age in comparison with noncarriers. The Kaplan-Meier method revealed significant differences in the waiting time for onset of malignant disease for A allele carrier (12.46 years) and noncarrier (11.13 years) animals. This investigation constitutes the first case-control study designed to assess the relationship between polymorphic genes and mammary tumor risk in dogs. Our results point to the combined effect of COMT genotype with other genetic and/or environmental risk factors as important key factors for mammary tumor etiopathogenesis. PMID:18424824

  5. Congenital nasal lipoma

    International Nuclear Information System (INIS)

    The authors describe a rare case of congenital lipoma of a nose and nasopharynx in a 7 months old girl. The tumor, about 7 x 2 cm was situated in the right nasal cavity and the nasopharynx. The tumor caused complete obstruction of the right side of the nose. After CT diagnosis the tumor was excised from intranasal approach. Histological examination disclosed lipoma. The duration of follow up was 10 months without any sight of recurrence. (author)

  6. Predicting location of recurrence using FDG, FLT, and Cu-ATSM PET in canine sinonasal tumors treated with radiotherapy

    International Nuclear Information System (INIS)

    Dose painting relies on the ability of functional imaging to identify resistant tumor subvolumes to be targeted for additional boosting. This work assessed the ability of FDG, FLT, and Cu-ATSM PET imaging to predict the locations of residual FDG PET in canine tumors following radiotherapy. Nineteen canines with spontaneous sinonasal tumors underwent PET/CT imaging with radiotracers FDG, FLT, and Cu-ATSM prior to hypofractionated radiotherapy. Therapy consisted of 10 fractions of 4.2 Gy to the sinonasal cavity with or without an integrated boost of 0.8 Gy to the GTV. Patients had an additional FLT PET/CT scan after fraction 2, a Cu-ATSM PET/CT scan after fraction 3, and follow-up FDG PET/CT scans after radiotherapy. Following image registration, simple and multiple linear and logistic voxel regressions were performed to assess how well pre- and mid-treatment PET imaging predicted post-treatment FDG uptake. R2 and pseudo R2 were used to assess the goodness of fits. For simple linear regression models, regression coefficients for all pre- and mid-treatment PET images were significantly positive across the population (P < 0.05). However, there was large variability among patients in goodness of fits: R2 ranged from 0.00 to 0.85, with a median of 0.12. Results for logistic regression models were similar. Multiple linear regression models resulted in better fits (median R2 = 0.31), but there was still large variability between patients in R2. The R2 from regression models for different predictor variables were highly correlated across patients (R ≈ 0.8), indicating tumors that were poorly predicted with one tracer were also poorly predicted by other tracers. In conclusion, the high inter-patient variability in goodness of fits indicates that PET was able to predict locations of residual tumor in some patients, but not others. This suggests not all patients would be good candidates for dose painting based on a single biological target. (paper)

  7. Predicting location of recurrence using FDG, FLT, and Cu-ATSM PET in canine sinonasal tumors treated with radiotherapy

    Science.gov (United States)

    Bradshaw, Tyler; Fu, Rau; Bowen, Stephen; Zhu, Jun; Forrest, Lisa; Jeraj, Robert

    2015-07-01

    Dose painting relies on the ability of functional imaging to identify resistant tumor subvolumes to be targeted for additional boosting. This work assessed the ability of FDG, FLT, and Cu-ATSM PET imaging to predict the locations of residual FDG PET in canine tumors following radiotherapy. Nineteen canines with spontaneous sinonasal tumors underwent PET/CT imaging with radiotracers FDG, FLT, and Cu-ATSM prior to hypofractionated radiotherapy. Therapy consisted of 10 fractions of 4.2 Gy to the sinonasal cavity with or without an integrated boost of 0.8 Gy to the GTV. Patients had an additional FLT PET/CT scan after fraction 2, a Cu-ATSM PET/CT scan after fraction 3, and follow-up FDG PET/CT scans after radiotherapy. Following image registration, simple and multiple linear and logistic voxel regressions were performed to assess how well pre- and mid-treatment PET imaging predicted post-treatment FDG uptake. R2 and pseudo R2 were used to assess the goodness of fits. For simple linear regression models, regression coefficients for all pre- and mid-treatment PET images were significantly positive across the population (P < 0.05). However, there was large variability among patients in goodness of fits: R2 ranged from 0.00 to 0.85, with a median of 0.12. Results for logistic regression models were similar. Multiple linear regression models resulted in better fits (median R2 = 0.31), but there was still large variability between patients in R2. The R2 from regression models for different predictor variables were highly correlated across patients (R ≈ 0.8), indicating tumors that were poorly predicted with one tracer were also poorly predicted by other tracers. In conclusion, the high inter-patient variability in goodness of fits indicates that PET was able to predict locations of residual tumor in some patients, but not others. This suggests not all patients would be good candidates for dose painting based on a single biological target.

  8. Correlation of tumor-infiltrating lymphocytes to histopathological features and molecular phenotypes in canine mammary carcinoma: A morphologic and immunohistochemical morphometric study.

    Science.gov (United States)

    Kim, Jong-Hyuk; Chon, Seung-Ki; Im, Keum-Soon; Kim, Na-Hyun; Sur, Jung-Hyang

    2013-04-01

    Abundant lymphocyte infiltration is frequently found in canine malignant mammary tumors, but the pathological features and immunophenotypes associated with the infiltration remain to be elucidated. The aim of the present study was to evaluate the relationship between lymphocyte infiltration, histopathological features, and molecular phenotype in canine mammary carcinoma (MC). The study was done with archived formalin-fixed, paraffin-embedded samples (n = 47) by histologic and immunohistochemical methods. The degree of lymphocyte infiltration was evaluated by morphologic analysis, and the T- and B-cell populations as well as the T/B-cell ratio were evaluated by morphometric analysis; results were compared with the histologic features and molecular phenotypes. The degree of lymphocyte infiltration was significantly higher in MCs with lymphatic invasion than in those without lymphatic invasion (P aggressive histologic features, lymphocytes may be important for tumor aggressiveness and greater malignant behavior in the tumor microenvironment. PMID:24082407

  9. Retrospective analysis of canine mesenchymal tumors of skin and soft tissues

    OpenAIRE

    Aleksić-Kovačević Sanja; Kukolj V.; Jelesijević Tomislav; Jovanović M.

    2005-01-01

    Out of the total number of 632 tumor specimens obtained from dogs of different breeds over the period of last 66 months, cutaneous tumors were diagnosed in 211 cases, i.e., in 123 (58.3%) male dogs and 88 (41.7%) bitches, aged on average 7 years. Among the total number of 211 skin tumors 32 types of cutaneous neoplasms were diagnosed, with epithelial and melanocytic tumors being the most predominant (58.3%), followed by hematopoietic tumors (22.3%) and mesenchymal tumors of the skin and soft ...

  10. Progesterone receptor isoform analysis by quantitative real-time polymerase chain reaction in formalin-fixed, paraffin-embedded canine mammary dysplasias and tumors.

    Science.gov (United States)

    Guil-Luna, S; Stenvang, J; Brünner, N; Sánchez-Céspedes, R; Millán, Y; Gómez-Laguna, J; de las Mulas, J Martín

    2014-09-01

    Cloning and sequencing of the progesterone receptor gene in dogs have revealed 2 isoforms, A and B, transcribed from a single gene. Distribution of isoforms A and B in canine mammary lesions has hitherto been investigated only by Western blot analysis. This study analyzed progesterone receptor and its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign tumors, and 59% of carcinomas. Carcinomas, and particularly simple epithelial-type carcinomas, displayed the lowest levels of expression. A high rate of agreement was recorded between RT-qPCR and immunohistochemical labeling. Isoforms A and B were successfully amplified, with correlation coefficients of 0.99 and amplification efficiencies close to 2, and were expressed in all lesion types analyzed. Predominance of A over B expression was observed in carcinomas and complex adenomas. Low-grade tumors exhibited higher progesterone receptor messenger RNA (mRNA) levels, but no difference was observed in the expression of isoform A versus B. Analysis of progesterone receptor mRNA isoforms by RT-qPCR was successful in routinely formalin-fixed, paraffin-embedded tissue samples and enabled the distribution of isoforms A and B to be identified for the first time in dysplasias, benign tumors, and malignant tumors of the canine mammary gland. These findings will facilitate future research into the role of progesterone receptor isoforms in the progression of canine mammary tumors. PMID:24249219

  11. Oxymetazoline Nasal Spray

    Science.gov (United States)

    Afrin® Nasal Spray ... Anefrin® Nasal Spray ... Dristan® Nasal Spray ... Mucinex® Nasal Spray ... Nostrilla® Nasal Spray ... Vicks Sinex® Nasal Spray ... Zicam® Nasal Spray ... Oxymetazoline nasal spray is used to relieve nasal discomfort caused by colds, allergies, and hay fever. It is also used to ...

  12. Canine distemper virus induces apoptosis in cervical tumor derived cell lines

    Directory of Open Access Journals (Sweden)

    Rajão Daniela S

    2011-06-01

    Full Text Available Abstract Apoptosis can be induced or inhibited by viral proteins, it can form part of the host defense against virus infection, or it can be a mechanism for viral spread to neighboring cells. Canine distemper virus (CDV induces apoptotic cells in lymphoid tissues and in the cerebellum of dogs naturally infected. CDV also produces a cytopathologic effect, leading to apoptosis in Vero cells in tissue culture. We tested canine distemper virus, a member of the Paramyxoviridae family, for the ability to trigger apoptosis in HeLa cells, derived from cervical cancer cells resistant to apoptosis. To study the effect of CDV infection in HeLa cells, we examined apoptotic markers 24 h post infection (pi, by flow cytometry assay for DNA fragmentation, real-time PCR assay for caspase-3 and caspase-8 mRNA expression, and by caspase-3 and -8 immunocytochemistry. Flow cytometry showed that DNA fragmentation was induced in HeLa cells infected by CDV, and immunocytochemistry revealed a significant increase in the levels of the cleaved active form of caspase-3 protein, but did not show any difference in expression of caspase-8, indicating an intrinsic apoptotic pathway. Confirming this observation, expression of caspase-3 mRNA was higher in CDV infected HeLa cells than control cells; however, there was no statistically significant change in caspase-8 mRNA expression profile. Our data suggest that canine distemper virus induced apoptosis in HeLa cells, triggering apoptosis by the intrinsic pathway, with no participation of the initiator caspase -8 from the extrinsic pathway. In conclusion, the cellular stress caused by CDV infection of HeLa cells, leading to apoptosis, can be used as a tool in future research for cervical cancer treatment and control.

  13. Operative management of skull base malignant tumors arising from the nasal cavity and paranasal sinus. Recent strategies used in 25 cases

    International Nuclear Information System (INIS)

    Cancers of the paranasal sinuses and nasal cavity are the most common malignant tumors of the anterior and anterolateral skull base. The treatment of these tumors affecting the skull base is complex due to the significant anatomical features. We examined 25 patients, 17 males and 8 females with mean age 61±2 years. En bloc resections using anterior skull base resection, orbital resection, middle fossa resection, and combined procedures of these three resections were performed. Using a combination of adjuvant radiation and chemotherapy, we have achieved a 2-year disease-free survival rate of 90% in these cases. However, potential complications include cerebrospinal fluid leakage, meningitis, abscess formation, pneumocephalus, frontal brain contusion, trismus, and dysphagia as a functional complication. We believe that the optimal management of such malignant tumors involves a multimodal and multidisciplinary team approach. Here we present our recent institutional experience and treatment policy employed during the past 3 years. (author)

  14. Pathophysiology of nasal congestion

    Directory of Open Access Journals (Sweden)

    Robert M Naclerio

    2010-02-01

    Full Text Available Robert M Naclerio1, Claus Bachert2, James N Baraniuk31University of Chicago, Department of Surgery, Section of Otolaryngology – Head and Neck Surgery, Chicago, Illinois, USA; 2University of Ghent, Ghent, Belgium; 3Georgetown University, Washington, DC, USAAbstract: Nasal congestion is a common symptom in rhinitis (both allergic and nonallergic, rhinosinusitis and nasal polyposis. Congestion can also be caused by physical obstruction of nasal passages and/or modulation of sensory perception. Mucosal inflammation underlies many of the specific and interrelated factors that contribute to nasal congestion, as well as other symptoms of both allergic rhinitis and rhinosinusitis. A wide range of biologically active agents (eg, histamine, tumor necrosis factor-α, interleukins, cell adhesion molecules and cell types contribute to inflammation, which can manifest as venous engorgement, increased nasal secretions and tissue swelling/edema, ultimately leading to impaired airflow and the sensation of nasal congestion. Inflammation-induced changes in the properties of sensory afferents (eg, expression of peptides and receptors that innervate the nose can also contribute to altered sensory perception, which may result in a subjective feeling of congestion. Increased understanding of the mechanisms underlying inflammation can facilitate improved treatment selection and the development of new therapies for congestion.Keywords: allergic rhinitis, congestion, obstruction, pathophysiology, rhinosinusitis

  15. A comparison of oral and intravenous pimonidazole in canine tumors using intravenous CCI-103F as a control hypoxia marker

    International Nuclear Information System (INIS)

    Purpose: Pimonidazole HCl is widely used in immunohistochemical analyses of hypoxia in normal and malignant tissues. The present study investigates oral administration as a means of minimizing invasiveness. Methods and Materials: Twelve dogs with confirmed malignancy received 0.5 g/m2 of pimonidazole HCl: 6 by mouth and 6 by i.v. infusion. All dogs received i.v. CCI-103F as a control. Plasma levels of pimonidazole, pimonidazole N-oxide, and CCI-103F were measured. Tumor biopsies were formalin fixed, paraffin embedded, sectioned, immunostained, and analyzed for pimonidazole and CCI-103F binding. pH dependence for pimonidazole and CCI-103F binding was studied in vitro. Results: Pimonidazole and CCI-103F binding in carcinomas and sarcomas was strongly correlated for both oral and i.v. pimonidazole HCl (r 2 = 0.97). On average, the extent of pimonidazole binding exceeded that for CCI-103F by a factor of approximately 1.2, with the factor ranging from 1.0 to 1.65. Binding of both markers was pH dependent, but pimonidazole binding was greater at all values of pH. Conclusions: Oral pimonidazole HCl is effective as a hypoxia marker in spontaneously arising canine tumors. Selective cellular uptake and concomitant higher levels of binding in regions of hypoxia at the high end of pH gradients might account for the greater extent of pimonidazole binding

  16. Perfusion and Volume Response of Canine Brain Tumors to Stereotactic Radiosurgery and Radiotherapy.

    OpenAIRE

    Zwingenberger, AL; Pollard, RE; Taylor, SL; Chen, RX; Nunley, J; Kent, MS

    2016-01-01

    Stereotactic radiosurgery (SRS) and stereotactic radiotherapy (SRT) are highly conformal, high-dose radiation treatment techniques used to treat people and dogs with brain tumors.To evaluate the response to SRS- and SRT-treated tumors using volume and perfusion variables and to measure the survival times of affected dogs.Prospective study of 34 dogs with evidence of brain tumors undergoing stereotactic radiosurgery (SRS) or stereotactic radiotherapy (SRT).Computed tomography and MRI imaging w...

  17. Nasal septum extramedullary plasmacytoma

    Directory of Open Access Journals (Sweden)

    Belić Branislav

    2013-01-01

    Full Text Available Introduction. Plasmacytomas are malignant tumors characterized by abnormal monoclonal proliferation of plasma cells. They originate in either bone - solitary osseous plasmacytoma, or in soft tissue - extramedullary plasmacytoma (EMP. EMP represents less than 1% of all head and neck malignancies. Case report. We presented a case of EMP of the nasal septum in a 44-year-old male who had progressive difficulty in breathing through the nose and frequent heavy epistaxis on the right side. Nasal endoscopy showed dark red, soft, polypoid tumor in the last third of the right nasal cavity arising from the nasal septum. The biopsy showed that it was plasmacytoma. Bence Jones protein in the urine, serum electrophoresis, bone marrow biopsy, skeletal survey and other screening tests failed to detect multiple myeloma. This confirmed the diagnosis of EMP. The mass was completely removed via an endoscopic approach, and then, 4 week later, radiotherapy was conducted with a radiation dose of 50 Gray. No recurrence was noted in a 3-year follow- up period. Conclusion. EMP of the nasal cavity, being rare and having long natural history, represents a diagnostic and therapeutic challenge for any ear, nose and throat surgeon. Depending on the resectability of the lesion, a combined therapy is the accepted treatment.

  18. Dose escalation to high-risk sub-volumes based on non-invasive imaging of hypoxia and glycolytic activity in canine solid tumors

    DEFF Research Database (Denmark)

    Clausen, Malene M.; Hansen, Anders Elias; af Rosenschold, Per Munck; Kjær, Andreas; Kristensen, Annemarie T.; McEvoy, Fintan J.; Engelholm, Svend A.

    2013-01-01

    planning may therefore lead to improved tumor control. In this study we analyzed the overlap between sub-volumes of FDG and hypoxia assessed by the uptake of 64Cu-ATSM in canine solid tumors, and evaluated the possibilities for dose redistribution within the gross tumor volume (GTV). Materials and methods...... defined by a threshold based method. FDG sub-volumes were delineated at 40% (FDG40) and 50% (FDG50) of SUVmax. The size of sub-volumes, intersection and biological target volume (BTV) were measured in a treatment planning software. By varying the average dose prescription to the tumor from 66 to 85 Gy...... in a limited DB. This suggests a more refined dose redistribution based on a weighted combination of the PET tracers in order to obtain an improved tumor control....

  19. The maspin expression in canine mammary tumors: an immunohistochemical and molecular study A expressão do maspin nos tumores mamários caninos: um estudo imuno-histoquímico e molecular

    Directory of Open Access Journals (Sweden)

    Debora A.P.C. Zuccari

    2009-02-01

    Full Text Available The serpin maspin, a tumor suppressor in breast cancer was described as an inhibitor of cell migration and inducer of cell adhesion between the basement membrane and extracellular matrix resulting in inhibition of tumor metastasis. In contrast, overexpression of maspin is correlated with poor prognosis in other types of cancer. Little is known about expression, regulation and function of maspin in canine mammary tumors. It was demonstrated in this study, a loss of maspin expression in malignant canine mammary cells compared with a pool of normal canine mammary tissue, analyzed by quantitative real-time PCR; weak maspin expression in malignant canine mammary tumors were observed by immunohistochemistry. It was also demonstrated that a correlation with nuclear maspin expression and a good prognosis. It is suggested that maspin could be used as a prognostic marker in canine mammary neoplasia.O serpin maspin, um supressor tumoral no câncer de mama foi descrito como inibidor de migração celular e indutor de adesão celular entre a membrana basal e a matriz extracelular resultando na inibição da metástase tumoral. Por outro lado, a alta expressão do maspin está relacionada com um mau prognóstico em outros tipos de câncer. Pouco se sabe sobre a expressão, regulação e função do maspin nos tumores mamários caninos. Neste estudo, foi demonstrada uma perda da expressão de maspin nas células mamárias malignas de cães quando comparadas com um pool de tecido mamário normal de cães, analisado por PCR quantitativa em tempo real. Houve uma expressão fraca maspin em preparações de tumores mamários malignos observadas por imuno-histoquímica. Também foi verificado que a expressão nuclear do maspin em tumores mamários caninos está relacionada a um bom prognóstico. Assim, o maspin pode ser utilizado como um marcador prognóstico nas neoplasias mamárias em cães.

  20. Tumor induction following intraoperative radiotherapy: Late results of the National Cancer Institute canine trials

    Energy Technology Data Exchange (ETDEWEB)

    Barnes, M.; Duray, P.; DeLuca, A.; Anderson, W.; Sindelar, W.; Kinsella, T. (Fox Chase Cancer Center, Philadelphia, PA (USA))

    1990-09-01

    Intraoperative radiotherapy has been employed in human cancer research for over a decade. Since 1979, trials to assess the acute and late toxicity of IORT have been carried out at the National Cancer Institute in an adult dog model in an attempt to establish dose tolerance guidelines for a variety of organs. Of the 170 animals entered on 12 studies with a minimum follow-up of 2 years, 148 dogs received IORT; 22 control animals received only surgery. Animals were sacrificed at designated intervals following IORT, usually at 1, 6, 12, 24, and 60 month intervals. 102 of 148 irradiated dogs were sacrificed less than 24 months; 46 dogs were followed greater than or equal to 24 months after IORT. To date, 34 of the 46 animals have been sacrificed; the 12 remaining animals are to be followed to 5 years. These 12 animals have minimum follow-up of 30 months. In the irradiated group followed for greater than or equal to 24 months, 10 tumors have arisen in 9 animals. One animal developed an incidental spontaneous breast carcinoma outside the IORT port, discovered only at scheduled post-mortem exam. The remaining nine tumors arose within IORT ports. Two tumors were benign neural tumors--a neuroma and a neurofibroma. One animal had a collision tumor comprised of grade I chondrosarcoma adjacent to grade III osteosarcoma arising in lumbar vertebrae. Two other grade III osteosarcomas, one grade III fibrosarcoma, and one grade III malignant fibrous histiocytoma arose in retroperitoneal/paravertebral sites. An embryonal rhabdomyosarcoma (sarcoma botryoides) arose within the irradiated urinary bladder of one animal. No sham irradiated controls nor IORT animals sacrificed less than 24 months have developed any spontaneous or radiation-induced tumors. The time range of diagnoses of tumors was 24-58 months. The IORT dose range associated with tumor development was 20-35 Gy.

  1. Cytological diagnosis of a metastatic canine mammary tumor in pleural effusion

    OpenAIRE

    Cassali G.D.; Gärtner F.; Vieira da Silva M.J.; Schmitt F.C.

    1999-01-01

    Descrevem-se os achados citomorfológicos de um tumor maligno de mama em uma cadela Poodle de sete anos de idade, o qual foi observado inicialmente pelo exame citológico do derrame pleural. Comparam-se os aspectos citológicos do derrame pleural e punção aspirativa com agulha fina do tumor com aqueles descritos para o câncer de mama na espécie humana.

  2. Correlation between histologic diagnosis mean nucleolar organizer region count and prognosis in canine mammary tumors.

    Science.gov (United States)

    Bostock, D E; Moriarty, J; Crocker, J

    1992-09-01

    In this study, surgically excised mammary tumors from 98 bitches were graded histologically, and the grade was compared with the mean nucleolar organizer region (NOR) count in silver-stained paraffin-embedded sections. Histologically benign tumors, papillary adenocarcinomas, and intraductal carcinomas showed relatively little variation; the mean count for each category was between three and four NOR per nucleus. There was, however, a significant increase in the NOR counts in tubular and solid carcinomas. This increase was most pronounced for tumors that showed evidence of infiltration into the surrounding connective tissues. The mean NOR count for noninfiltrative carcinomas was 5.1, and that for invasive carcinomas was 7.3 (P less than 0.03). The mean NOR count for individual carcinomas ranged from 2.0 to 12.3, and a significant correlation was found between an increased NOR count and tumor-related death during the first post-surgical year. The 39 bitches in which the tumor had an NOR count less than 8.0 had a generally favorable prognosis; only six (15%) died as a result of the original neoplasm. In contrast, 18/21 dogs (85%) with a carcinoma having an NOR count greater than 8.0 died from the tumor during the first post-surgical year. A similar, although less pronounced result was obtained specifically for invasive carcinomas, in which 3/12 (25%) tumors with an NOR count less than 6.0 resulted in the death of the host, compared with 17/20 (85%) that had an NOR count greater than 6. By using this technique, it is possible to identify a subgroup of bitches with invasive mammary carcinomas that have a very poor prognosis following apparently adequate surgical ablation of the primary tumor. PMID:1413404

  3. Progesterone receptor isoform analysis by quantitative real-time polymerase chain reaction in formalin-fixed, paraffin-embedded canine mammary dysplasias and tumors

    DEFF Research Database (Denmark)

    Guil-Luna, S.; Stenvang, Jan; Brünner, Nils;

    2014-01-01

    its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign...... the expression of isoform A versus B. Analysis of progesterone receptor mRNA isoforms by RT-qPCR was successful in routinely formalin-fixed, paraffin-embedded tissue samples and enabled the distribution of isoforms A and B to be identified for the first time in dysplasias, benign tumors, and malignant...

  4. Altered microRNA Expression Profiles and Regulation of INK4A/CDKN2A Tumor Suppressor Genes in Canine Breast Cancer Models.

    Science.gov (United States)

    Lutful Kabir, Farruk Mohammad; DeInnocentes, Patricia; Bird, Richard Curtis

    2015-12-01

    microRNA (miRNA) expression profiling of cancer versus normal cells may reveal the characteristic regulatory features that can be correlated to altered gene expression in both human and animal models of cancers. In this study, the comprehensive expression profiles of the 277 highly characterized miRNAs from the canine genome were evaluated in spontaneous canine mammary tumor (CMT) models harboring defects in a group of cell cycle regulatory and potent tumor suppressor genes of INK4/CDKN2 family including p16/INK4A, p14ARF, and p15/INK4B. A large number of differentially expressed miRNAs were identified in three CMT cell lines to potentially target oncogenes, tumor suppressor genes and cancer biomarkers. A group of the altered miRNAs were identified by miRNA target prediction tools for regulation of the INK4/CDKN2 family tumor suppressor genes. miRNA-141 was experimentally validated for INK4A 3'-UTR target binding in the CMT cell lines providing an essential mechanism for the post-transcriptional regulation of the INK4A tumor suppressor gene in CMT models. A well-recognized group of miRNAs including miR-21, miR-155, miR-9, miR-34a, miR-143/145, and miR-31 were found to be altered in both CMTs and human breast cancer. These altered miRNAs might serve as potential targets for advancing the development of future therapeutic reagents. These findings further strengthen the validity and use of canine breast cancers as appropriate models for the study of human breast cancers. PMID:26095675

  5. Alternativas Terapéuticas en las neoplasias vesicales caninas Therapeutic options in canine bladder tumors

    OpenAIRE

    R.L. Rovere; A. ALCOBA

    2002-01-01

    Las neoplasias vesicales en caninos representan menos del 1% de los tumores presentes en esta especie. El tratamiento quirúrgico se indica en tumores benignos y como complemento de la quimioterapia y radioterapia. Para la quimioterapia se emplean más frecuentemente la doxorrubicina, el 5-fluorouracilo, la ciclofosfamida, la vincristina y cisplatino. La asociación de la doxorrubicina-ciclofosfamida por vía sistémica en asociación con el cisplatino intravesical, sería un tratamiento recomendabl...

  6. Canine mammary tumors: a review and consensus of standard guidelines on epithelial and myoepithelial phenotype markers, HER2, and hormone receptor assessment using immunohistochemistry.

    Science.gov (United States)

    Peña, L; Gama, A; Goldschmidt, M H; Abadie, J; Benazzi, C; Castagnaro, M; Díez, L; Gärtner, F; Hellmén, E; Kiupel, M; Millán, Y; Miller, M A; Nguyen, F; Poli, A; Sarli, G; Zappulli, V; de las Mulas, J Martín

    2014-01-01

    Although there have been several studies on the use of immunohistochemical biomarkers of canine mammary tumors (CMTs), the results are difficult to compare. This article provides guidelines on the most useful immunohistochemical markers to standardize their use and understand how outcomes are measured, thus ensuring reproducibility of results. We have reviewed the biomarkers of canine mammary epithelial and myoepithelial cells and identified those biomarkers that are most useful and those biomarkers for invasion and lymph node micrometastatic disease. A 10% threshold for positive reaction for most of these markers is recommended. Guidelines on immunolabeling for HER2, estrogen receptors (ERs), and progesterone receptors (PRs) are provided along with the specific recommendations for interpretation of the results for each of these biomarkers in CMTs. Only 3+ HER2-positive tumors should be considered positive, as found in human breast cancer. The lack of any known response to adjuvant endocrine therapy of ER- and PR-positive CMTs prevents the use of the biological positive/negative threshold used in human breast cancer. Immunohistochemistry results of ER and PR in CMTs should be reported as the sum of the percentage of positive cells and the intensity of immunolabeling (Allred score). Incorporation of these recommendations in future studies, either prospective or retrospective, will provide a mechanism for the direct comparison of studies and will help to determine whether these biomarkers have prognostic significance. Finally, these biomarkers may ascertain the most appropriate treatment(s) for canine malignant mammary neoplasms. PMID:24227007

  7. Desmopressin Nasal

    Science.gov (United States)

    ... nasal spray, follow these steps: Remove the protective cap from the bottle. Press down on the pump 4 times to ... bottle in your other nostril. Replace the protective cap on the bottle. To use the rhinal tube, follow these steps: ...

  8. Quantification of morphology of canine circumanal gland tumors: a fractal based study.

    Science.gov (United States)

    Šoštarić-Zuckermann, I C; Severin, K; Huzak, M; Hohšteter, M; Gudan Kurilj, A; Artuković, B; Džaja, A; Grabarević, Ž

    2016-01-01

    Circumanal gland tumors are very common neoplasms of dogs. Their classification relies on microscopic examination and is further supported by a few immunohistochemical markers that help indicate their prognosis. However, new additional tests would be highly useful. The purpose of this study was to develop such a test using fractal analysis which is increasingly being applied in science, especially in the field of biomedicine. A total of 53 circumanal gland tumors were chosen from our department archives. After a precise histological classification according to the World Health Organization classification, the number of de novo classified samples was as follows: 15 adenomas, 11 epitheliomas, 21 well differentiated carcinomas, 6 poorly differentiated carcinomas. Ten samples of normal circumanal gland were also included as control. All samples were immunohistochemicaly stained with vimentin. All immunohistochemical reactions were photographed at two different magnifications -100X and 400X and converted to 1 bit in black and white (bitmap) images thus enhancing the positive vimentin reactions. These images were used for the assessment of fractal dimension applying the box counting method and computer software Fractalyse. To determine the significance of results, conventional statistics were performed using Statistica software. The overall vimentin stain score was significantly higher in epitheliomas and carcinomas than in normal circumanal glands (CG) or adenomas. Mean values of fractal dimension estimated at magnification 100X and 400X were as follows: normal CG 1.318 and 1.372, CG adenomas 1.384 and 1.408, CG epitheliomas 1.547 and 1.597, CG well differentiated carcinomas 1.569 and 1.607, CG poorly differentiated carcinomas 1.679 and 1.723. Significant differences (at level of 5%) of these values were observed between individual groups of CG adenomas or normal CG, and epitheliomas or carcinomas. The above results indicate vimentin immunohistochemistry staining and

  9. Evaluation of tumor motion effect in canine model for diagnostic and radiotherapy

    International Nuclear Information System (INIS)

    The internal organs move up to 35mm maximum and it provides information and uncertainty that has been distorted in the diagnosis and treatment. Previous most studies for the effect of respiration have been performed with external monitoring systems but it cannot represent internal organ motion such as liver, pancreas, and lung. Positron emission tomography (PET) is more influenced by motion than computed tomography (CT) and magnetic resonance imaging (MRI) since measurement time for image acquisition is longer than CT and MRI. Thus, count of tumor is to be underestimated and region of tumor is to be overestimated. The first aim of this study was developing the artificial pulmonary nodule which can be performed non-invasive transplant into thorax of dogs and second is to assess the effect of respiratory motion on PET image with evaluating the applicability of the artificial model using dogs for diagnosis and treatment. The developed artificial pulmonary nodule showed reproducibility and motion effect as respiratory cycle and it was verified in PET images. Radiation dose estimated was not changed and was reduced slightly of 10 rpm and 15 rpm, respectively, in both of glass dosimeter and ion chamber. The developed artificial pulmonary nodule will be useful tool for evaluating respiratory motion and better research performance for diagnosis and treatment will be expected with performing simulated experiment using the nodule conducted in this study

  10. Evaluation of tumor motion effect in canine model for diagnostic and radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Woo, Sangkeun; Nam, Taewon; Kim, Kyeongmin [Molecular Imaging Research Center, Seoul (Korea, Republic of); Park, Seungwoo; Han, Suchul; Ji, Younghoon [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of); Park, Nohwon; Eom, Kidong [Konkuk Univ., Seoul (Korea, Republic of)

    2013-05-15

    The internal organs move up to 35mm maximum and it provides information and uncertainty that has been distorted in the diagnosis and treatment. Previous most studies for the effect of respiration have been performed with external monitoring systems but it cannot represent internal organ motion such as liver, pancreas, and lung. Positron emission tomography (PET) is more influenced by motion than computed tomography (CT) and magnetic resonance imaging (MRI) since measurement time for image acquisition is longer than CT and MRI. Thus, count of tumor is to be underestimated and region of tumor is to be overestimated. The first aim of this study was developing the artificial pulmonary nodule which can be performed non-invasive transplant into thorax of dogs and second is to assess the effect of respiratory motion on PET image with evaluating the applicability of the artificial model using dogs for diagnosis and treatment. The developed artificial pulmonary nodule showed reproducibility and motion effect as respiratory cycle and it was verified in PET images. Radiation dose estimated was not changed and was reduced slightly of 10 rpm and 15 rpm, respectively, in both of glass dosimeter and ion chamber. The developed artificial pulmonary nodule will be useful tool for evaluating respiratory motion and better research performance for diagnosis and treatment will be expected with performing simulated experiment using the nodule conducted in this study.

  11. Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior

    International Nuclear Information System (INIS)

    Histiocytic malignancies in both humans and dogs are rare and poorly understood. While canine histiocytic sarcoma (HS) is uncommon in the general domestic dog population, there is a strikingly high incidence in a subset of breeds, suggesting heritable predisposition. Molecular cytogenetic profiling of canine HS in these breeds would serve to reveal recurrent DNA copy number aberrations (CNAs) that are breed and/or tumor associated, as well as defining those shared with human HS. This process would identify evolutionarily conserved cytogenetic changes to highlight regions of particular importance to HS biology. Using genome wide array comparative genomic hybridization we assessed CNAs in 104 spontaneously occurring HS from two breeds of dog exhibiting a particularly elevated incidence of this tumor, the Bernese Mountain Dog and Flat-Coated Retriever. Recurrent CNAs were evaluated further by multicolor fluorescence in situ hybridization and loss of heterozygosity analyses. Statistical analyses were performed to identify CNAs associated with tumor location and breed. Almost all recurrent CNAs identified in this study were shared between the two breeds, suggesting that they are associated more with the cancer phenotype than with breed. A subset of recurrent genomic imbalances suggested involvement of known cancer associated genes in HS pathogenesis, including deletions of the tumor suppressor genes CDKN2A/B, RB1 and PTEN. A small number of aberrations were unique to each breed, implying that they may contribute to the major differences in tumor location evident in these two breeds. The most highly recurrent canine CNAs revealed in this study are evolutionarily conserved with those reported in human histiocytic proliferations, suggesting that human and dog HS share a conserved pathogenesis. The breed associated clinical features and DNA copy number aberrations exhibited by canine HS offer a valuable model for the human counterpart, providing additional evidence towards

  12. Evaluation of tumor markers carcinoembryonic antigen, cytokeratin 19 fragment and cancer-associated antigen 72-4 in neoplastic and non-neoplastic canine effusions differentiation

    Directory of Open Access Journals (Sweden)

    L.V. Teixeira

    2014-10-01

    Full Text Available The concentration of tumor markers in body fluids can be used for diagnosis and prognosis of patients. This study aimed to investigate the performance of tumor markers cytokeratin 19 fragment (CYFRA 21-1, cancer-associated antigen 72-4 (CA 72-4 and carcinoembryonic antigen (CEA in the neoplastic and non-neoplastic canine effusions. In thirty-two neoplastic (n=16 and non-neoplastic (n=16 samples of canine thoracic or abdominal effusions, tumor markers were measured. Significant statistical difference was found only for the CYFRA 21-1 marker. The levels were significantly higher for the neoplastic group. The lack of significance between groups for markers CA 72-4 and CEA can be explained by the presence of other diseases in the non-neoplastic group, causing elevated levels of these markers. This study concludes that CYFRA 21-1 performed well, showing good sensitivity, specificity and accuracy in the diagnosis of neoplastic effusions in dogs. However, further investigations are necessary in patients with malignancy as those with benign effusions.

  13. 64Cu-ATSM and 18FDG PET uptake and 64Cu-ATSM autoradiography in spontaneous canine tumors: comparison with pimonidazole hypoxia immunohistochemistry

    International Nuclear Information System (INIS)

    The aim of this study was to compare 64Cu-diacetyl-bis(N4-methylsemicarbazone) (64Cu-ATSM) and 18FDG PET uptake characteristics and 64Cu-ATSM autoradiography to pimonidazole immunohistochemistry in spontaneous canine sarcomas and carcinomas. Biopsies were collected from individual tumors between approximately 3 and 25 hours after the intravenous injection of 64Cu-ATSM and pimonidazole. 64Cu-ATSM autoradiography and pimonidazole immunostaining was performed on sectioned biopsies. Acquired 64Cu-ATSM autoradiography and pimonidazole images were rescaled, aligned and their distribution patterns compared. 64Cu-ATSM and 18FDG PET/CT scans were performed in a concurrent study and uptake characteristics were obtained for tumors where available. Maximum pimonidazole pixel value and mean pimonidazole labeled fraction was found to be strongly correlated to 18FDG PET uptake levels, whereas more varying results were obtained for the comparison to 64Cu-ATSM. In the case of the latter, uptake at scans performed 3 h post injection (pi) generally showed strong positive correlated to pimonidazole uptake. Comparison of distribution patterns of pimonidazole immunohistochemistry and 64Cu-ATSM autoradiography yielded varying results. Significant positive correlations were mainly found in sections displaying a heterogeneous distribution of tracers. Tumors with high levels of pimonidazole staining generally displayed high uptake of 18FDG and 64Cu-ATSM (3 h pi.). Similar regional distribution of 64Cu-ATSM and pimonidazole was observed in most heterogeneous tumor regions. However, tumor and hypoxia level dependent differences may exist with regard to the hypoxia specificity of 64Cu-ATSM in canine tumors

  14. Clinical and clinicopathologic response of canine bone tumor patients to treatment with samarium-153-EDTMP

    International Nuclear Information System (INIS)

    Forty dogs with spontaneous skeletal neoplasia were treated with 153Sm-EDTMP (ethylenediaminetetramethylene phosphonic acid). Both primary and metastatic lesions were treated. Two treatment regimes, a single (37 MBq (1.0 mCi)/kg dose or two 37 MBq (1.0 mCi)/kg doses separated by 1 wk) were tested. Response to treatment was varied. Large lesions with minimal tumor bone formation responded poorly, while primary lesions with substantial ossification usually exhibited a transient response. Small lesions with minimal lysis, metastatic lesions, and axial skeleton lesions generally responded well. The major adverse side effects of treatment were platelet and white blood cell count depression below baseline values for up to 4 wk (p less than 0.05). Minor depression of packed cell volume and transient elevation of serum alkaline phosphatase were also noted (p less than 0.05). No significant differences (p greater than 0.05) between the two treatment groups, either in treatment effect or undesirable side effects, were detected

  15. Nasal encephaloceles

    NARCIS (Netherlands)

    Hoving, Eelco W.

    2000-01-01

    Nasal encephaloceles can be divided into frontoethmoidal and basal encephaloceles. Both conditions are very rare, but frontoethmoidal encephaloceles show a relatively high incidence (1:5,000) in Southeast Asia. The pathogenesis of encephaloceles may be explained by a disturbance in separation of sur

  16. Canine Distemper

    Science.gov (United States)

    Although this brochure provides basic information about canine distemper, your veterinarian is always your best source of ... Consult your veterinarian for more information about canine distemper and its prevention. And Now A Note On ...

  17. A Comparison of Fresh Frozen vs. Formalin-Fixed, Paraffin-Embedded Specimens of Canine Mammary Tumors via Branched-DNA Assay

    Science.gov (United States)

    Lüder Ripoli, Florenza; Mohr, Annika; Conradine Hammer, Susanne; Willenbrock, Saskia; Hewicker-Trautwein, Marion; Hennecke, Silvia; Murua Escobar, Hugo; Nolte, Ingo

    2016-01-01

    Mammary neoplasms are the tumors most affecting female dogs and women. Formalin-fixed, paraffin-embedded (FFPE) tissues are an invaluable source of archived biological material. Fresh frozen (FF) tissue is considered ideal for gene expression analysis. However, strategies based on FFPE material offer several advantages. Branched-DNA assays permit a reliable and fast workflow when analyzing gene expression. The aim of this study was to assess the comparability of the branched-DNA assay when analyzing certain gene expression patterns between FF and FFPE samples in canine mammary tumors. RNA was isolated from 109 FFPE samples and from 93 FF samples of different canine mammary tissues. Sixteen (16) target genes (Tp53; Myc; HMGA1; Pik3ca; Mcl1; MAPK3; FOXO3; PTEN; GATA4; PFDN5; HMGB1; MAPK1; BRCA2; BRCA1; HMGA2; and Her2) were analyzed via branched-DNA assay (b-DNA). ACTB, GAPDH, and HPRT1 were used as data normalizers. Overall, the relative gene expression of the two different origins of samples showed an agreement of 63%. Still, care should be taken, as FFPE specimens showed lower expression of the analyzed targets when compared to FF samples. The fact that the gene expression in FFPE proved to be lower than in FF specimens is likely to have been caused by the effect of storage time. ACTB had the best performance as a data normalizer. PMID:27187374

  18. A Comparison of Fresh Frozen vs. Formalin-Fixed, Paraffin-Embedded Specimens of Canine Mammary Tumors via Branched-DNA Assay

    Directory of Open Access Journals (Sweden)

    Florenza Lüder Ripoli

    2016-05-01

    Full Text Available Mammary neoplasms are the tumors most affecting female dogs and women. Formalin-fixed, paraffin-embedded (FFPE tissues are an invaluable source of archived biological material. Fresh frozen (FF tissue is considered ideal for gene expression analysis. However, strategies based on FFPE material offer several advantages. Branched-DNA assays permit a reliable and fast workflow when analyzing gene expression. The aim of this study was to assess the comparability of the branched-DNA assay when analyzing certain gene expression patterns between FF and FFPE samples in canine mammary tumors. RNA was isolated from 109 FFPE samples and from 93 FF samples of different canine mammary tissues. Sixteen (16 target genes (Tp53; Myc; HMGA1; Pik3ca; Mcl1; MAPK3; FOXO3; PTEN; GATA4; PFDN5; HMGB1; MAPK1; BRCA2; BRCA1; HMGA2; and Her2 were analyzed via branched-DNA assay (b-DNA. ACTB, GAPDH, and HPRT1 were used as data normalizers. Overall, the relative gene expression of the two different origins of samples showed an agreement of 63%. Still, care should be taken, as FFPE specimens showed lower expression of the analyzed targets when compared to FF samples. The fact that the gene expression in FFPE proved to be lower than in FF specimens is likely to have been caused by the effect of storage time. ACTB had the best performance as a data normalizer.

  19. A Comparison of Fresh Frozen vs. Formalin-Fixed, Paraffin-Embedded Specimens of Canine Mammary Tumors via Branched-DNA Assay.

    Science.gov (United States)

    Lüder Ripoli, Florenza; Mohr, Annika; Conradine Hammer, Susanne; Willenbrock, Saskia; Hewicker-Trautwein, Marion; Hennecke, Silvia; Murua Escobar, Hugo; Nolte, Ingo

    2016-01-01

    Mammary neoplasms are the tumors most affecting female dogs and women. Formalin-fixed, paraffin-embedded (FFPE) tissues are an invaluable source of archived biological material. Fresh frozen (FF) tissue is considered ideal for gene expression analysis. However, strategies based on FFPE material offer several advantages. Branched-DNA assays permit a reliable and fast workflow when analyzing gene expression. The aim of this study was to assess the comparability of the branched-DNA assay when analyzing certain gene expression patterns between FF and FFPE samples in canine mammary tumors. RNA was isolated from 109 FFPE samples and from 93 FF samples of different canine mammary tissues. Sixteen (16) target genes (Tp53; Myc; HMGA1; Pik3ca; Mcl1; MAPK3; FOXO3; PTEN; GATA4; PFDN5; HMGB1; MAPK1; BRCA2; BRCA1; HMGA2; and Her2) were analyzed via branched-DNA assay (b-DNA). ACTB, GAPDH, and HPRT1 were used as data normalizers. Overall, the relative gene expression of the two different origins of samples showed an agreement of 63%. Still, care should be taken, as FFPE specimens showed lower expression of the analyzed targets when compared to FF samples. The fact that the gene expression in FFPE proved to be lower than in FF specimens is likely to have been caused by the effect of storage time. ACTB had the best performance as a data normalizer. PMID:27187374

  20. Dose escalation to high-risk sub-volumes based on non-invasive imaging of hypoxia and glycolytic activity in canine solid tumors: a feasibility study

    International Nuclear Information System (INIS)

    Glycolytic activity and hypoxia are associated with poor prognosis and radiation resistance. Including both the tumor uptake of 2-deoxy-2-[18 F]-fluorodeoxyglucose (FDG) and the proposed hypoxia tracer copper(II)diacetyl-bis(N4)-methylsemithio-carbazone (Cu-ATSM) in targeted therapy planning may therefore lead to improved tumor control. In this study we analyzed the overlap between sub-volumes of FDG and hypoxia assessed by the uptake of 64Cu-ATSM in canine solid tumors, and evaluated the possibilities for dose redistribution within the gross tumor volume (GTV). Positron emission tomography/computed tomography (PET/CT) scans of five spontaneous canine solid tumors were included. FDG-PET/CT was obtained at day 1, 64Cu-ATSM at day 2 and 3 (3 and 24 h pi.). GTV was delineated and CT images were co-registered. Sub-volumes for 3 h and 24 h 64Cu-ATSM (Cu3 and Cu24) were defined by a threshold based method. FDG sub-volumes were delineated at 40% (FDG40) and 50% (FDG50) of SUVmax. The size of sub-volumes, intersection and biological target volume (BTV) were measured in a treatment planning software. By varying the average dose prescription to the tumor from 66 to 85 Gy, the possible dose boost (DB) was calculated for the three scenarios that the optimal target for the boost was one, the union or the intersection of the FDG and 64Cu-ATSM sub-volumes. The potential boost volumes represented a fairly large fraction of the total GTV: Cu3 49.8% (26.8-72.5%), Cu24 28.1% (2.4-54.3%), FDG40 45.2% (10.1-75.2%), and FDG50 32.5% (2.6-68.1%). A BTV including the union (∪) of Cu3 and FDG would involve boosting to a larger fraction of the GTV, in the case of Cu3∪FDG40 63.5% (51.8-83.8) and Cu3∪FDG50 48.1% (43.7-80.8). The union allowed only a very limited DB whereas the intersection allowed a substantial dose escalation. FDG and 64Cu-ATSM sub-volumes were only partly overlapping, suggesting that the tracers offer complementing information on tumor physiology. Targeting the

  1. Nasal Schwannoma: a case report

    Directory of Open Access Journals (Sweden)

    Siu-Navarro YJ, Pérez-Carbajal AJ

    2013-10-01

    Full Text Available Introduction: Schwannomas are benign tumors that arise from Schwann cells peripheral nerves sheath. About 25-45% occur in the head and neck and only 4% of these tumors involve the sinunasal tract.Objective: To provide, through a clinic case and lecture review, the clinical and radiopatology findings of a bening and unusual tumors, as are the Nasal schwannomas. Case Report: We report a case of a young woman with nasal schwannoma, who complain of left nasal obstruction and rhinorrhea, which after subsequent imaging studies, surgical and pathology analisis, diagnosis was found. Sustained a favorable clinical evolution.Results and Discussion: The clinic and radiologic findings are nonspecific, depend upon the location or size of the tumor and subsequent involvement of surrounding structures, but generally present as a mass with less agressive behavior. The elective treatment is surgery, confirming this disease by microscopic and immunohistochemistry studies.Conclusion: Given these aspects must be considered nasal schwannomas within the differential diagnosis of a tumor with less aggressive behavior, clinical-radiological, because implies good results for the patient and unusual recurrence after surgery.

  2. HER-2 and EGFR mRNA Expression and Its Relationship with Versican in Malignant Matrix-Producing Tumors of the Canine Mammary Gland.

    Science.gov (United States)

    Damasceno, Karine Araújo; Ferreira, Enio; Estrela-Lima, Alessandra; Gamba, Conrado de Oliveira; Miranda, Fernanda Freitas; Alves, Mariana Rezende; Rocha, Rafael Malagoli; de Barros, André Luís Branco; Cassali, Geovanni Dantas

    2016-01-01

    Versican expression promotes tumor growth by destabilizing focal cell contacts, thus impeding cell adhesion and facilitating cell migration. It not only presents or recruits molecules to the cell surface, but also modulates gene expression levels and coordinates complex signal pathways. Previously, we suggested that the interaction between versican and human epidermal growth factor receptors may be directly associated with tumor aggressiveness. Thus, the expression of EGFR and HER-2 in these neoplasms may contribute to a better understanding of the progression mechanisms in malignant mammary tumors. The purpose of this study was to correlate the gene and protein expressions of EGFR and HER2 by RNA In Situ Hybridization (ISH) and immunohistochemistry (IHC), respectively, and their relationship with the versican expression in carcinomas in mixed tumors and carcinosarcomas of the canine mammary gland. The results revealed that EGFR mRNA expression showed a significant difference between in situ and invasive carcinomatous areas in low and high versican expression groups. Identical results were observed in HER-2 mRNA expression. In immunohistochemistry analysis, neoplasms with low versican expression showed greater EGFR immunostaining in the in situ areas than in invasive areas, even as the group presenting high versican expression displayed greater EGFR and HER-2 staining in in situ areas. Significant EGFR and HER-2 mRNA and protein expressions in in situ carcinomatous sites relative to invasive areas suggest that these molecules play a role during the early stages of tumor progression. PMID:27490467

  3. (64)Cu-ATSM and (18)FDG PET uptake and (64)Cu-ATSM autoradiography in spontaneous canine tumors

    DEFF Research Database (Denmark)

    Hansen, Anders E; Kristensen, Annemarie T; Jørgensen, Jesper T;

    2012-01-01

    The aim of this study was to compare (64)Cu-diacetyl-bis(N(4)-methylsemicarbazone) ((64)Cu-ATSM) and (18)FDG PET uptake characteristics and (64)Cu-ATSM autoradiography to pimonidazole immunohistochemistry in spontaneous canine sarcomas and carcinomas....

  4. Multimodality functional imaging of spontaneous canine tumors using 64CU-ATSM and 18FDG PET/CT and dynamic contrast enhanced perfusion CT

    DEFF Research Database (Denmark)

    Hansen, Anders E; Kristensen, Annemarie T; Law, Ian;

    2012-01-01

    To compare the distribution and uptake of the hypoxia tracer (64)Cu-diacetyl-bis(N(4)-methylthiosemicarbazone) ((64)Cu-ATSM) PET/CT, FDG PET/CT and dynamic contrast enhanced perfusion CT (DCE-pCT) in spontaneous canine tumors. In addition (64)Cu-ATSM distribution over time was evaluated....

  5. Nasal Chondromesenchymal Hamartoma in a Child

    International Nuclear Information System (INIS)

    Nasal chondromesenchymal hamartoma (NCMH) is a benign tumor that was described in 1998. The occurrence of this lesion in the nasal cavity of infants and children is especially rare, with only 21 cases reported in the international literature. We report a 12-month-old boy with respiratory distress due to nasal obstruction. Computed tomographic scan and magnetic resonance imaging examination demonstrated a soft-tissue mass obstructing the left nasal cavity. Digital subtraction angiography and preoperative superselective embolization with microparticles were also performed. The tumor was completely resected surgically. Histopathology and immunohistochemical analyses of the tumor disclosed a NCMH. The imaging characteristics of the tumor are described and the radiology literature is reviewed.

  6. Development of an approach for qualitative and quantitative analysis of trace elements present in canine breast tumors by energy dispersive X-ray fluorescence

    Energy Technology Data Exchange (ETDEWEB)

    Cozer, Thamara C.; Conceicao, Andre L.C.; Paschuk, Sergei A.; Rocha, Anna S.S. da; Fagundes, Alana C.F.; Maciel, Karla F.R.; Pimentel, Gustavo R.O.; Badelli, Juliana C., E-mail: thamara.cozer@gmail.com, E-mail: alconceicao@utfpr.edu.br, E-mail: sergei@utfpr.edu.br, E-mail: anna@utfpr.edu.br, E-mail: alanacarolinef@gmail.com, E-mail: karla_rimanski@hotmail.com, E-mail: g_rop@hotmail.com, E-mail: jubadellin@gmail.com [Universidade Tecnologica Federal do Parana (UTFPR), Curitiba, PR (Brazil). Lab. de Espectroscopia de Raio-X

    2015-07-01

    Studies performed with canines indicate that one of the main neoplasia which affect these animals are the breast tumors, representing from 25% to 50% of all kinds of tumors. Moreover, half of them are classified as malignant. In this sense, recent researches on humans have been associated the presence of certain trace elements with the development of breast neoplasia in those individuals. Then, as the breast tissue composition in canines is very similar to the humans, it is expected the same behavior. In this direction, a very effective technique to identify and to determinate trace elements concentration is the EDXRF. However, studies on this area are scarce in the literature. Therefore, in this work it was developed an approach to quantify the main trace elements present into these tumors with high sensitivity. For this purpose, it was determined calibration curves of standards samples diluted in water, with concentrations of Ca, Fe, Cu and Zn, ranging from 400mg/kg to 35mg/kg, from 20mg/kg to 2mg/kg, from 10mg/kg to 1mg/kg and from 100mg/kg to 10mg/kg, respectively. All calibration curves were linearly fitted and on basis in this behavior it was determined the sensitivity of our approach to quantify the concentration of the trace elements mentioned above. In addition, it is important to mention that studies in this area are of great potential, because EDXRF represents a quickly practical and non-destructive alternative to quantify trace elements. (author)

  7. Development of an approach for qualitative and quantitative analysis of trace elements present in canine breast tumors by energy dispersive X-ray fluorescence

    International Nuclear Information System (INIS)

    Studies performed with canines indicate that one of the main neoplasia which affect these animals are the breast tumors, representing from 25% to 50% of all kinds of tumors. Moreover, half of them are classified as malignant. In this sense, recent researches on humans have been associated the presence of certain trace elements with the development of breast neoplasia in those individuals. Then, as the breast tissue composition in canines is very similar to the humans, it is expected the same behavior. In this direction, a very effective technique to identify and to determinate trace elements concentration is the EDXRF. However, studies on this area are scarce in the literature. Therefore, in this work it was developed an approach to quantify the main trace elements present into these tumors with high sensitivity. For this purpose, it was determined calibration curves of standards samples diluted in water, with concentrations of Ca, Fe, Cu and Zn, ranging from 400mg/kg to 35mg/kg, from 20mg/kg to 2mg/kg, from 10mg/kg to 1mg/kg and from 100mg/kg to 10mg/kg, respectively. All calibration curves were linearly fitted and on basis in this behavior it was determined the sensitivity of our approach to quantify the concentration of the trace elements mentioned above. In addition, it is important to mention that studies in this area are of great potential, because EDXRF represents a quickly practical and non-destructive alternative to quantify trace elements. (author)

  8. Intraosseous hemangioma of the nasal septum: A case report

    Energy Technology Data Exchange (ETDEWEB)

    Park, Min Ho; Kim, Eui Jong; Jang, Ji Hye; Lee, Kyung Mi; Choi, Woo Suk; Kim, Sung Wan; Kim, Yoon Hwa [Kyung Hee University Hospital, Seoul (Korea, Republic of)

    2015-08-15

    Hemangioma can arise in the soft tissues and bone of the nasal cavity. However, to the best of our knowledge, there are no prior case reports presenting intraosseous hemangioma of the nasal septum. Intraosseous hemangioma, in addition to a chondroid tumor, should be included in the differential diagnosis of a calcified mass of the nasal cavity. In the present report, we present a case of an intraosseous cavernous hemangioma in the nasal bony septum of a 53-year-old woman.

  9. Incidence of mammary tumors in the canine population living in the Veneto region (Northeastern Italy): Risk factors and similarities to human breast cancer.

    Science.gov (United States)

    Vascellari, Marta; Capello, Katia; Carminato, Antonio; Zanardello, Claudia; Baioni, Elisa; Mutinelli, Franco

    2016-04-01

    Although mammary gland tumors (MT) are the most-common type of tumor in intact female dogs, there is little information about their incidence in dog population. Data on MT in female dogs was retrieved from the Animal Tumor registry of dogs and cats of Venice and Vicenza provinces during 2005-2013 and was analyzed to visualize crude incidence rates by breed and across age categories. Overall, 2744 mammary tumors were reported accounting for 54% of all tumors in female dogs. The annual incidence rate (IR) was 250 cases per 100,000 dogs. The most frequent malignant tumors were complex carcinomas, consisting of both epithelial and myoepithelial tissues (IR=71.89), and simple carcinomas (IR=62.59). The MT incidence rate increased through the study period; particularly in the last 4 years, and malignant neoplasms occurred more frequently (70%) than the benign counterparts (30%). Seventy-four percent of tumors were diagnosed in intact females, and the mean age at diagnosis was significantly higher for spayed dogs than for intact ones. MT were less frequent in dogs younger than 6 years and increased up to approximately 60% for ages between 8 and 13 years. The purebred dogs had a higher probability to have a malignant neoplasm than mixed-breed dogs, particularly in dogs younger than 7 years, and the Samoyed, Dobermann, Schnauzer and Yorkshire Terrier breeds were more inclined to develop malignant MT. The incidence of MT in dogs is increasing, and IRs are comparable to that in women. The epidemiological similarities between dogs and women support the validity of canine MT as a model for human breast cancer. PMID:26948297

  10. Nicotine Nasal Spray

    Science.gov (United States)

    Nicotine nasal spray is used to help people stop smoking. Nicotine nasal spray should be used together with a smoking cessation ... counseling, or specific behavior change techniques. Nicotine nasal spray is in a class of medications called smoking ...

  11. Nasal Wash Treatment

    Science.gov (United States)

    ... Disease Medications > Alternative Therapies > Nasal Wash Treatment Nasal Wash Treatment The Centers for Disease Control (CDC) guidelines ... increases airflow Watch How to Perform a Nasal Wash CDC Water Preparation Guidelines Wash your hands. Make ...

  12. Azelastine Nasal Spray

    Science.gov (United States)

    Astelin® Nasal Spray ... Astepro® Nasal Spray ... Azelastine comes as a nasal spray. Azelastine usually is sprayed in each nostril two times a day. Follow the directions on your prescription label carefully, and ask ...

  13. Beclomethasone Nasal Spray

    Science.gov (United States)

    Beclomethasone nasal spray is used to relieve symptoms of sneezing, runny, stuffy, or itchy nose (rhinitis) caused by hay fever, other ... nose) after nasal polyp removal surgery. Beclomethasone nasal spray should not be used to treat symptoms (e. ...

  14. Immunophenotype Heterogeneity in Nasal Glomangiopericytoma

    Directory of Open Access Journals (Sweden)

    Adriana Handra-Luca

    2015-01-01

    Full Text Available Nasal glomangiopericytoma is rare. The immunophenotype is heterogeneous, more frequently smooth-muscle-actin and CD34-positive. We report expression patterns for several vascular-related proteins such as CD99, CD146, Bcl2, and WT1 as well as for treatment-related proteins such as mTOR and EGFR in a nasal glomangiopericytoma. The patient (woman, 86 years presented with a left nasal tumefaction. The resected specimen (1.5-cm showed a glomangiopericytoma. Tumor cells expressed smooth-muscle-actin, CD31, CD34, and progesterone receptor. They also expressed the vascular-cell-related proteins Bcl2, CD99, CD146, and WT1, as well as mTOR and EGFR. Nasal glomangiopericytomas show immunohistochemical heterogeneity for vascular-related markers, suggesting a possible extensive pericytic differentiation. The expression of potential targets for drug treatments such as mTOR and EGFR may impact on the clinical follow-up of these tumors occurring at advanced ages, which may require complex surgery.

  15. Nose and Nasal Planum Neoplasia, Reconstruction.

    Science.gov (United States)

    Worley, Deanna R

    2016-07-01

    Most intranasal lesions are best treated with radiation therapy. Computed tomographic imaging with intravenous contrast is critical for treatment planning. Computed tomographic images of the nose will best assess the integrity of the cribriform plate for central nervous system invasion by a nasal tumor. Because of an owner's emotional response to an altered appearance of their dog's face, discussions need to include the entire family before proceeding with nasal planectomy or radical planectomy. With careful case selection, nasal planectomy and radical planectomy surgeries can be locally curative. PMID:26968300

  16. Nasal septal teratoma in a child

    OpenAIRE

    Akinyemi Oluwole A; Ngwu Bethrand A; Kokong Daniel D; Ibekwe Titus S; Nwaorgu Onyekwere G; Akang Effiong E

    2007-01-01

    Abstract Background Teratoma is a rare developmental neoplasm that arises from totipotential tumor stem cells. Head and neck teratomas constitute about 10% of all cases. Only two cases of mature teratoma of the nasal septum have previously been documented in the world literature. Case presentation We present a case of histologically confirmed mature teratoma arising from the nasal septum in an eighteen month old Nigerian female who presented with a history of noisy breathing associated with r...

  17. Nasal chondromesenchymal hamartoma with no nasal symptoms.

    LENUS (Irish Health Repository)

    Uzomefuna, Vincent

    2012-01-01

    The authors present a case of nasal chondromesenchymal hamartoma (NCMH) in an 8-year-old boy with a 4-month history of frontal headache and no symptoms of nasal obstruction, rhinorrhoea or postnasal drip. An ENT examination as well as ophthalmology assessment presented normal results. CT scan showed a lesion involving the sphenoid and ethmoid sinuses. The patient had an endoscopic resection of the lesion that was confirmed histologically to be a NCMH. Though NCMH is known to present usually in infants with obstructing nasal mass, an unusual presentation of a patient with throbbing headache without any nasal symptoms is reported here.

  18. Adenoma pleomórfico de septo nasal: relato de caso Pleomorphic adenoma of the nasal septum: a case report

    Directory of Open Access Journals (Sweden)

    Mauren P. Rocha

    2004-06-01

    Full Text Available As neoplasias nasais são bastante raras. Os tumores mais observados na cavidade nasal são papilomas epiteliais, angiomas, carcinoma de células transicionais, carcinoma pavimentoso e adenocarcinoma. O adenoma pleomórfico pertence ao grupo de tumores que aparecem com menor freqüência na fossa nasal, e é o tumor benigno glandular mais comum originado na cabeça e pescoço. A apresentação clínica típica dos pacientes com adenoma pleomórfico do septo nasal é de obstrução nasal unilateral, epistaxe e massa indolor na cavidade nasal. Em vista da raridade da apresentação clínica do adenoma pleomórfico nesta localização, os autores descrevem um caso de adenoma pleomórfico nasal em um paciente do sexo masculino, com 69 anos de idade, onde relatam os achados clínicos, critérios diagnósticos, tratamento, prognóstico e revisão da literatura.Nasal tumours are very rare. The neoplasms most frequently seen in the nasal cavity are epithelial papillomas, angiomas, transitional cells carcinoma, pavement carcinoma and adenocarcinoma. The pleomorphic adenoma belongs to the group of tumours less commonly observed in the nasal cavity, and is the most common head and neck benign glandular tumour. The typical clinical presentation of the nasal pleomorphic adenoma is of unilateral nasal obstruction, epistaxis and a painless mass in the nasal cavity. The authors reported an adenoma pleomorphic case that highlights itself by its unusual nasal presentation in the nasal septum of a 45-year-old male patient who was submitted to surgical treatment, and discuss the clinical findings, diagnostic criteria, treatment, prognosis and literature review.

  19. Eosinophilic Angiocentric Fibrosis of the Nasal Septum

    Directory of Open Access Journals (Sweden)

    Yunchuan Li

    2013-01-01

    Full Text Available Background. Eosinophilic angiocentric fibrosis (EAF is a rare benign condition of unknown aetiology that causes stenosis of the upper respiratory tract. It is most commonly found at the nasal septum and sinus mucosa causing mucosal thickening and nasal obstructive symptoms. The diagnosis is mainly based on characteristic histologic findings. Case Report. A 27-year-old young woman presented with a slow growing mass at her anterior nasal septum for over eight years. She complained of persistent nasal obstruction, epistaxis, sometimes diffused facial pain, and chronic headache. 3 years ago, the tumor was partially resected for ventilation and a nasal septum perforation was left. Imaging findings indicated soft-tissue thickening of the anterior part of septum and adjacent lateral nasal walls. Pathological examination showed numerous inflammatory cells infiltrates containing eosinophils, fibroinflammatory lesion with a whorled appearance fibrosis which typically surrounded vessels. A diagnosis of eosinophilic angiocentric fibrosis was made. All laboratory tests were unremarkable. Skin prick test was positive. The tumor-like lesion was totally resected. Conclusions. EAF is a rare benign and progressive disorder causing destruction. Combined with radiological imaging of EAF historical findings contribute to the diagnosis. It is important to prevent tumor from recurrence by total resection of the lesion.

  20. Mometasone Nasal Spray

    Science.gov (United States)

    Mometasone nasal spray is used to prevent and relieve symptoms of sneezing, runny, stuffy, or itchy nose caused by hay fever ... of the lining of the nose). Mometasone nasal spray should not be used to treat symptoms (e. ...

  1. Flunisolide Nasal Spray

    Science.gov (United States)

    Flunisolide nasal spray is used to relieve symptoms of sneezing, runny, stuffy, or itchy nose caused by hay fever or other allergies. Flunisolide nasal spray should not be used to treat symptoms (e. ...

  2. Naloxone Nasal Spray

    Science.gov (United States)

    Naloxone nasal spray is used along with emergency medical treatment to reverse the life-threatening effects of a known or suspected opiate (narcotic) overdose. Naloxone nasal spray is in a class of medications called opiate ...

  3. Nasal mucosal biopsy

    Science.gov (United States)

    Biopsy - nasal mucosa; Nose biopsy ... to fast for a few hours before the biopsy. ... Nasal mucosal biopsy is usually done when abnormal tissue is seen during examination of the nose. It may also be done ...

  4. Bacterial Nasal Infections

    Science.gov (United States)

    ... the Nose Sinusitis Bacteria may cause pimples and boils (furuncles) to form just inside the opening of ... weeks. Nasal furuncles More serious infections result in boils (furuncles) in the nasal vestibule. Boils may develop ...

  5. Nasal Harmony in Aguaruna.

    Science.gov (United States)

    Moon, Gui-Sun

    A discussion of the nasal harmony of Aguaruna, a language of the Jivaroan family in South America, approaches the subject from the viewpoint of generative phonology. This theory of phonology proposes an underlying nasal consonant, later deleted, that accounts for vowel nasalization. Complex rules that suppose a complex system of vowel and…

  6. TU-C-12A-11: Comparisons Between Cu-ATSM PET and DCE-CT Kinetic Parameters in Canine Sinonasal Tumors

    International Nuclear Information System (INIS)

    Purpose: Regions of poor perfusion within tumors may be associated with higher hypoxic levels. This study aimed to test this hypothesis by comparing measurements of hypoxia from Cu-ATSM PET to vasculature kinetic parameters from DCE-CT kinetic analysis. Methods: Ten canine patients with sinonasal tumors received one Cu-ATSM PET/CT scan and three DCE-CT scans prior to treatment. Cu-ATSM PET/CT and DCE-CT scans were registered and resampled to matching voxel dimensions. Kinetic analysis was performed on DCE-CT scans and for each patient, the resulting kinetic parameter values from the three DCE-CT scans were averaged together. Cu-ATSM SUVs were spatially correlated (rspatial) on a voxel-to-voxel basis against the following DCE-CT kinetic parameters: transit time (t1), blood flow (F), vasculature fraction (v1), and permeability (PS). In addition, whole-tumor comparisons were performed by correlating (rROI) the mean Cu-ATSM SUV (SUVmean) with median kinetic parameter values. Results: The spatial correlations (rspatial) were poor and ranged from -0.04 to 0.21 for all kinetic parameters. These low spatial correlations may be due to high variability in the DCE-CT kinetic parameter voxel values between scans. In our hypothesis, t1 was expected to have a positive correlation, while F was expected to have a negative correlation to hypoxia. However, in wholetumor analysis the opposite was found for both t1 (rROI = -0.25) and F (rROI = 0.56). PS and v1 may depict angiogenic responses to hypoxia and found positive correlations to Cu-ATSM SUV for PS (rROI = 0.41), and v1 (rROI = 0.57). Conclusion: Low spatial correlations were found between Cu-ATSM uptake and DCE-CT vasculature parameters, implying that poor perfusion is not associated with higher hypoxic regions. Across patients, the most hypoxic tumors tended to have higher blood flow values, which is contrary to our initial hypothesis. Funding: R01 CA136927

  7. TU-C-12A-11: Comparisons Between Cu-ATSM PET and DCE-CT Kinetic Parameters in Canine Sinonasal Tumors

    Energy Technology Data Exchange (ETDEWEB)

    La Fontaine, M; Bradshaw, T [University of Wisconsin, Madison, Wisconsin (United States); Kubicek, L [University of Florida, Gainesville, Florida (United States); Forrest, L [University of Wisconsin-Madison, Madison, Wisconsin (United States); Jeraj, R [University of Wisconsin, Madison, WI (United States)

    2014-06-15

    Purpose: Regions of poor perfusion within tumors may be associated with higher hypoxic levels. This study aimed to test this hypothesis by comparing measurements of hypoxia from Cu-ATSM PET to vasculature kinetic parameters from DCE-CT kinetic analysis. Methods: Ten canine patients with sinonasal tumors received one Cu-ATSM PET/CT scan and three DCE-CT scans prior to treatment. Cu-ATSM PET/CT and DCE-CT scans were registered and resampled to matching voxel dimensions. Kinetic analysis was performed on DCE-CT scans and for each patient, the resulting kinetic parameter values from the three DCE-CT scans were averaged together. Cu-ATSM SUVs were spatially correlated (r{sub spatial}) on a voxel-to-voxel basis against the following DCE-CT kinetic parameters: transit time (t{sub 1}), blood flow (F), vasculature fraction (v{sub 1}), and permeability (PS). In addition, whole-tumor comparisons were performed by correlating (r{sub ROI}) the mean Cu-ATSM SUV (SUV{sub mean}) with median kinetic parameter values. Results: The spatial correlations (r{sub spatial}) were poor and ranged from -0.04 to 0.21 for all kinetic parameters. These low spatial correlations may be due to high variability in the DCE-CT kinetic parameter voxel values between scans. In our hypothesis, t{sub 1} was expected to have a positive correlation, while F was expected to have a negative correlation to hypoxia. However, in wholetumor analysis the opposite was found for both t{sub 1} (r{sub ROI} = -0.25) and F (r{sub ROI} = 0.56). PS and v{sub 1} may depict angiogenic responses to hypoxia and found positive correlations to Cu-ATSM SUV for PS (r{sub ROI} = 0.41), and v{sub 1} (r{sub ROI} = 0.57). Conclusion: Low spatial correlations were found between Cu-ATSM uptake and DCE-CT vasculature parameters, implying that poor perfusion is not associated with higher hypoxic regions. Across patients, the most hypoxic tumors tended to have higher blood flow values, which is contrary to our initial hypothesis. Funding

  8. Nasal Tip Deficiency.

    Science.gov (United States)

    Cerkes, Nazim

    2016-01-01

    Nasal tip deficiency can be congenital or secondary to previous nasal surgeries. Underdeveloped medial crura usually present with underprojected tip and lack of tip definition. Weakness or malposition of lateral crura causes alar rim retraction and lateral nasal wall weakness. Structural grafting of alar cartilages strengthens the tip framework, reinforces the disrupted support mechanisms, and controls the position of the nasal tip. In secondary cases, anatomic reconstruction of the weakened or interrupted alar cartilages and reconstitution of a stable nasal tip tripod must be the goal for a predictable outcome. PMID:26616702

  9. Nasal septal teratoma in a child

    Directory of Open Access Journals (Sweden)

    Akinyemi Oluwole A

    2007-05-01

    Full Text Available Abstract Background Teratoma is a rare developmental neoplasm that arises from totipotential tumor stem cells. Head and neck teratomas constitute about 10% of all cases. Only two cases of mature teratoma of the nasal septum have previously been documented in the world literature. Case presentation We present a case of histologically confirmed mature teratoma arising from the nasal septum in an eighteen month old Nigerian female who presented with a history of noisy breathing associated with recurrent rhinorrhea since birth. Physical examination revealed obstruction of the right nasal cavity by a pale fleshy mass. She underwent a total surgical excision and to date, after thirty one months follow-up, she is free from recurrence. Conclusion The prognosis for benign teratoma of the nasal septum is good following total surgical excision.

  10. Evaluation of [1-11C]-α-aminoisobutyric acid for tumor detection and amino acid transport measurement: Spontaneous canine tumor studies

    International Nuclear Information System (INIS)

    Alpha-aminoisobutyric acid (AIB) or α-methyl alanine, is a nonmetabolized amino acid treansported into cells particularly malignant cells, predominantly by the ''A'' amino acid transport system. Since it is not metabolized, [1-11C]-AIB can be used to quantify A-type amino acid transport into cells using a relatively simple compartmental model and quantitative imaging procedures (e.g. positron tomography). The tissue distribution of [1-11C]-AIB was determined in six dogs bearing spontaneous tumors, including lymphosarcoma, osteogenic sarcoma, mammary carcinoma, and adenocarcinoma. Quantitative imaging with tissue radioassay confirmation at necropsy showed poor to excellent tumor localization. However, in all cases the concentrations achieved appear adequate for amino acid transport measurement at known tumor locations. The observed low normal brain (due to blood-brain barrier exclusion) and high (relative to brain) tumor concentrations of [1-11C]-AIB suggest that this agent may prove effective for the early detection of human brain tumors. (orig.)

  11. Neuropatia paraneoplásica associada ao mastocitoma canino Paraneoplastic neuropathy associated with canine mast cell tumor

    Directory of Open Access Journals (Sweden)

    Sabrina Marin Rodigheri

    2008-06-01

    Full Text Available As síndromes paraneoplásicas compreendem um grupo diverso de alterações clínicas associadas a neoplasias e ocorrem em sítios distantes do tumor primário ou de suas metástases. As neuropatias paraneoplásicas são distúrbios raros em cães, mas representam morbidade significativa e servem como importantes indicadores diagnósticos e prognósticos. O presente trabalho relata a ocorrência de dois casos de neuropatia paraneoplásica em cães com mastocitoma, considerando a apresentação clínica, o diagnóstico e as formas de tratamento utilizadas.Paraneoplastic syndromes comprise a diverse group of clinical anomalies associated with neoplasias and occur in a location distant from the primary tumor or of your metastasis. Paraneoplastic neuropathy are rare disturbs in dogs, but represent significant morbidity and are useful as diagnostic and prognostic indicators. This work report the occurrence of two cases of paraneoplastic neuropathy in dogs with mast cell tumor, considering the clinical signs, diagnosis and treatment used.

  12. Urogenital tumors

    Energy Technology Data Exchange (ETDEWEB)

    Weller, R.E.

    1994-03-01

    An overview is provided for veterinary care of urogenital tumors in companion animals, especially the dog. Neoplasms discussed include tumors of the kidney, urinary bladder, prostate, testis, ovary, vagina, vulva and the canine transmissible venereal tumor. Topics addressed include description, diagnosis and treatment.

  13. The use of {sup 99m}Tc-thymine to identify metastatic disease in dogs presenting the cutaneous form of canine transmissible venereal tumor; Uso da {sup 99m}Tc-timina na identificacao de metastases de tumor venereo transmissivel canino com apresentacao cutanea

    Energy Technology Data Exchange (ETDEWEB)

    Castelo-Branco, Paulo S.M. [Universidade Estacio de Sa, Rio de Janeiro, RJ (Brazil)]. E-mail: p.castelobranco@ig.com.br; Castro, Veronica; Sena, Priscila [Sociedade Uniao Internacional Protetora dos Animais (SUIPA), Rio de Janeiro, RJ (Brazil); Souza, Sergio A. Lopes de; Lopes, Flavia P.P. Lobo; Pereira, Joao Batista; Fonseca, Lea M. Barbosa da; Gutfilen, Bianca [Hospital Universitario Clementino Fraga Filho, Rio de Janeiro, RJ (Brazil). Dept. de Radiologia

    2008-08-15

    The venereal canine transmissible tumor (VCTT) is described in literature as a rare metastatic tumor. However accurate methods for verification of this affirmative are not available in the veterinary medicine routine. In this study, we evaluated the dissemination from VCTT with cutaneous presentation using the {sup 99m}Tc-Thymine scintigraphy. The labelled thymine was up taken by the three cases of VCTT. {sup 99m}Tc-Thymine is a promising imaging technique for non-invasive veterinarian evaluation of tumoral dissemination degree decurrent from the VCTT cases. (author)

  14. Investigation of HER2 expression in canine mammary tumors by antibody-based, transcriptomic and mass spectrometry analysis: is the dog a suitable animal model for human breast cancer?

    Science.gov (United States)

    Burrai, G P; Tanca, A; De Miglio, M R; Abbondio, M; Pisanu, S; Polinas, M; Pirino, S; Mohammed, S I; Uzzau, S; Addis, M F; Antuofermo, E

    2015-11-01

    Canine mammary tumors (CMTs) share many features with human breast cancer (HBC), specifically concerning cancer-related pathways. Although the human epidermal growth factor receptor 2 (HER2) plays a significant role as a therapeutic and prognostic biomarker in HBC, its relevance in the pathogenesis and prognosis of CMT is still controversial. The aim of this study was to investigate HER2 expression in canine mammary hyperplasic and neoplastic tissues as well as to evaluate the specificity of the most commonly used polyclonal anti HER2 antibody by multiple molecular approaches. HER2 protein and RNA expression were determined by immunohistochemistry (IHC) and by quantitative real-time (qRT) PCR. A strong cell membrane associated with non-specific cytoplasmic staining was observed in 22% of carcinomas by IHC. Adenomas and carcinomas exhibited a significantly higher HER2 mRNA expression when compared to normal mammary glands, although no significant difference between benign and malignant tumors was noticed by qRT-PCR. The IHC results suggest a lack of specificity of the FDA-approved antibody in CMT samples as further demonstrated by Western immunoblotting (WB) and reverse phase protein arrays (RPPA). Furthemore, HER2 was not detected by mass spectrometry (MS) in a protein-expressing carcinoma at the IHC investigation. This study highlights that caution needs to be used when trying to translate from human to veterinary medicine information concerning cancer-related biomarkers and pathways. Further investigations are necessary to carefully assess the diagnostic and biological role specifically exerted by HER2 in CMTs and the use of canine mammary tumors as a model of HER2 over-expressing breast cancer. PMID:26088453

  15. How Are Nasal Cavity and Paranasal Sinus Cancers Staged?

    Science.gov (United States)

    ... by stage How are nasal cavity and paranasal sinus cancers staged? Staging is a process that tells ... cavity or ethmoid sinuses. T categories for maxillary sinus cancer TX: Primary (main) tumor cannot be assessed. ...

  16. Spindle cell carcinoma of the nasal cavity

    Directory of Open Access Journals (Sweden)

    Mark D DeLacure

    2013-02-01

    Full Text Available Spindle cell carcinoma (SpCC is a unique variant of squamous cell carcinoma (SCC. SpCC confined to the nasal cavity is extremely rare, with only one case having been previously reported. We present a case report of nasal cavity SpCC and review the literature on this rare entity. A 29-year-old male presented with intermittent epistaxis from the left nasal cavity. On physical examination, the patient had an ulcerated mass in the left nasal vestibule and a biopsy showed a proliferation of spindle and epitheliod cells. The patient underwent wide local excision of the mass via a lateral alotomy approach and reconstruction with a composite conchal bowl skin and cartilage graft. Histologically, the mass had dyplastic squamous epithelium and spindle-shaped cells admixed with epitheliod cells. Immunohistochemistry was only positive for pancytokeratin AE1/AE3 and vimentin. Six months after surgery, the patient continues to have no evidence of disease. On literature review, only one previous case of SpCC confined to the nasal cavity was identified. We present a rare case of nasal cavity SpCC. No definite treatment protocol exists for this unique entity, but we believe that this tumor should primarily be treated with aggressive, wide local excision. Adjuvant radiation and/or chemotherapy have also been used anecdotally.

  17. Canine mastocytosis

    OpenAIRE

    Paiva, D.; Mendonça, A; Vala, Helena

    2013-01-01

    Mastocytosis is a mast cell disorder in which its exaggerated proliferation can occur in two forms: systemic and cutaneous (Davis et al., 1992). Because canine mastocytosis is a rare situation of controversial and difficult diagnosis, the goal of this study consists in a current revision of this subject, in order to sensitize the veterinary staff to its severity, with particular focus on the information the veterinary nurse must hold to better apply a specialized nursing care with the hig...

  18. A rare case of mucoepidermoid carcinoma of the nasal septum

    Directory of Open Access Journals (Sweden)

    Barcellos, Alano Nunes

    2008-12-01

    Full Text Available Introduction: Mucoepidermoid carcinoma is the most common malignant neoplasm of the salivary glands, and the parotid is the main site of attack. It also occurs in the minor salivary glands from the nasal cavity to the lungs. Nasal location of the mucoepidermoid carcinoma is extremely rare. There is little literature on similar cases. Objective: To report a case of mucoepidermoid carcinoma of the right nasal septum, and cover general aspects of the pathogenesis, diagnosis, therapy, and post-operative follow-up. Case Report: We present a case of a 32-year-old patient with a history of nasal obstruction, epistaxis and tumoration in the right nasal cavity. The biopsy revealed it was a mucoepidermoid carcinoma. The tumor was surgically removed using endoscopes with associated complementary radiotherapy. The anatomopathological analysis classified it with a high degree of malignancy. We obtained remission of the symptoms and without subsequent recurrence. Conclusion: Tumor nasal masses should be studied with imaging and histopathology examinations. We may discover rare malignant nasal tumors.

  19. The role of computed tomography in the diagnosis and treatment of malignant tumors of the nasal cavity, paranasal sinuses and nasopharynx

    International Nuclear Information System (INIS)

    We studied the value of computed tomography (CT) in diagnosis and treatment of primary malignant tumors of the sinonasal cavities and nasopharynx, and reached the following conclusions. 1) In maxillary carcinomas, bone destruction is always seen on CT. When bone destruction is not apparent despite invasion to the adjacent site, malignant lymphoma or plasmacytoma is suggested. 2) In defining the tumor extent of maxillary SCC, CT is more reliable than maxillotomy, and is equal to maxillectomy. However, clouding of the sinus without bone destruction remains a problem, since this finding can be caused by either tumor invasion or obstructive sinusitis. 3) In maxillary and nasopharyngeal SCC, CT frequently reveals tumors to be more extensive than previously suspected following physical and conventional x-ray examinations. Therefore, the T-stages of these tumors are often upstaged to more advanced ones. 4) CT is of great help in identifying candidates for surgery in maxillary SCC, and in planning radiation therapy for nasopharyngeal and sinonasal tumors. Dose distribution curves displayed directly on the CT slices are becoming essential tools for radiation oncologists. After the introduction of CT, treatment results in cases of nasopharyngeal SCC have improved, probably due to better definition of the tumor volumes. 5) CT is also used for observing tumor response after therapy and for follow-up. In summary, CT is now indispensable in the management of malignant tumors of these sites. (author)

  20. Degloving médio-facial como via de acesso a tumores nasossinusais Midfacial degloving - acess to nasal cavity and paranasal sinuses lesions

    Directory of Open Access Journals (Sweden)

    Lidiane Maria de Brito Macedo Ferreira

    2006-04-01

    Full Text Available Abordagens cirúrgicas comuns para maxilectomia medial incluem a rinotomia lateral e a via de acesso degloving médio-facial. A rinotomia lateral fornece um excelente campo cirúrgico, mas deixa proeminentes cicatrizes na face. Já o degloving médio-facial tem sido superior à rinotomia lateral, pois não deixa nenhuma cicatriz externa, embora saibamos que este procedimento tem suas limitações¹. Este estudo tem o objetivo de descrever os resultados estéticos e de melhor acesso transoperatório de cirurgias nasossinusais via degloving, com avaliação da morbidade pós-operatória através das seguintes variáveis: hemoglobina pré e pós-operatória, necessidade de transfusão sangüínea, presença de complicações, uso de tampão nasal, uso de antibiótico, fio cirúrgico utilizado, tempo de internamento pós-operatório e presença de recidiva. Foi realizado um estudo retrospectivo a partir de 16 pacientes internados no Hospital Geral de Fortaleza SESA/SUS durante o período de dezembro de 1999 a novembro de 2003. Pelos dados obtidos, conclui-se que a via de acesso degloving é eficaz no tratamento de lesões nasossinusais extensas, com bons resultados estéticos e com reduzida morbidade pós-operatória.Common surgical approaches for medial maxillectomy include lateral rhinotomy and midfacial degloving. Lateral rhinotomy provides excellent surgical exposure but leaves a bulging scar on the face. Despite its own limitations, midfacial degloving has been preferred to lateral rhinotomy because it does not leave any external scar on the face¹. The aim of this study is to evaluate the cosmetic results and surgical exposure access of midfacial degloving. Treatment morbidity was evaluated through: post operative hospital stay length, blood transfusion needs, complications, pre and post operative hemoglobin levels, disease recurrence, nasal packing, type of suture and antibiotics. Retrospective study was carried out with sixteen patients

  1. Olopatadine Nasal Spray

    Science.gov (United States)

    Olopatadine nasal spray is used to relieve sneezing and a stuffy, runny or itchy nose caused by allergic rhinitis (hay fever). ... Olopatadine comes as a liquid to spray in the nose. Olopatadine nasal spray ... twice daily. Follow the directions on your prescription label carefully, ...

  2. Butorphanol Nasal Spray

    Science.gov (United States)

    Butorphanol nasal spray is used to relieve moderate to severe pain. Butorphanol is in a class of medications called opioid agonist- ... Butorphanol nasal spray comes as a solution (liquid) to spray in the nose. It is usually used as needed for pain, ...

  3. Ketorolac Nasal Spray

    Science.gov (United States)

    Ketorolac nasal spray is used for the short-term relief of moderate to moderately severe pain. Ketorolac is in a class ... Nasal ketorolac comes as a liquid to spray in the nose. It is usually used once every 6 to 8 hours as needed to control pain for up to 5 days. ...

  4. Calcitonin Salmon Nasal Spray

    Science.gov (United States)

    ... pump is now primed. To use the nasal spray, follow these steps: Keep your head up and place the nozzle in one nostril. Press down on the pump ... reach of children. Store unopened calcitonin salmon nasal spray in the ... the nozzle clean. Opened calcitonin salmon stored at room temperature ...

  5. Neoplasias mamárias em cadelas: influência hormonal e efeitos da ovario-histerectomia como terapia adjuvante Canine mammary tumors: hormonal influence and effects of ovariohiysterectomy as an adjuvant therapy

    Directory of Open Access Journals (Sweden)

    Cláudia Sampaio Fonseca

    2000-08-01

    Full Text Available As neoplasias mamarias constituem aproximadamente 50% dos tumores diagnosticados em cadelas. Apesar dosharmónios sexuais femininos desempenharem papel fundamental no desenvolvimento desses tumores em mamíferos, o valor da supressão hormonal pela ovário-histerectomia como auxiliar no tratamento do tumor de mama em caninos permanece controverso. Discute-se ainda se a realização da ovário-histerectomia após o diagnóstico influencia ou não o crescimento e progressão do tumor na glândula afetada ou em outras glândulas mamarias. O objetivo desta revisão é discutir alguns aspectos relacionados à influência hormonal na etiologia de tumores mamarias em cadelas, assim como o valor terapêutico da castração, quando realizada no momento da mastectomia.The mammary neoplasms comprises aproximatel 50% ofthe diagnosed tumor s m the bitch. Although female sexual honnones play a fundamental role in the development of these tumors in mammals, the value of the suppression hormonal (ovariohysterectomy as an adjuvam treatment remains controversial. There are still arguments on whether the ovariohysterectomy after diagnosis of the tumor possesses influences lhe growth and progression of the tumor on the affected gland or on other mammary glands. The objective ofthis review is to discuss some aspects related to the hormonal influence in the pathogenesis of the canine tumor, as well as the therapeutic value ofspaying. when accomplished in the moment ofthe mastectomy.

  6. Morphological study of maxillary canine region based on CT

    International Nuclear Information System (INIS)

    The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)

  7. In Vivo Phenotyping of Tumor Metabolism in a Canine Cancer Patient with Simultaneous 18F-FDG-PET and Hyperpolarized 13C-Pyruvate Magnetic Resonance Spectroscopic Imaging (hyperPET: Mismatch Demonstrates that FDG may not Always Reflect the Warburg Effect

    Directory of Open Access Journals (Sweden)

    Henrik Gutte

    2015-06-01

    Full Text Available In this communication the mismatch between simultaneous 18F-FDG-PET and a 13C-lactate imaging (hyperPET in a biopsy verified squamous cell carcinoma in the right tonsil of a canine cancer patient is shown. The results demonstrate that 18F-FDG-PET may not always reflect the Warburg effect in all tumors.

  8. Snoring and Nasal Congestion

    Science.gov (United States)

    ... the noisy breathing caused by vibrations of the upper airway during sleep. In contrast to snoring (noisy but ... can even require a tracheostomy to bypass the upper airway obstruction. If you suffer from nasal congestion, snoring, ...

  9. Fentanyl Nasal Spray

    Science.gov (United States)

    Fentanyl nasal spray is used to treat breakthrough pain (sudden episodes of pain that occur despite round ... effects of the medication) to narcotic pain medications. Fentanyl is in a class of medications called narcotic ( ...

  10. Beclomethasone Nasal Spray

    Science.gov (United States)

    ... symptoms may begin to improve a few days after you first use beclomethasone, but it may take 1 ... your symptoms get worse or do not improve after you use beclomethasone nasal spray for 3 weeks. If ...

  11. Mutational Hotspot of TET2, IDH1, IDH2, SRSF2, SF3B1, KRAS, and NRAS from Human Systemic Mastocytosis Are Not Conserved in Canine Mast Cell Tumors.

    Directory of Open Access Journals (Sweden)

    Eleonora Zorzan

    Full Text Available Both canine cutaneous mast cell tumor (MCT and human systemic mastocytosis (SM are characterized by abnormal proliferation and accumulation of mast cells in tissues and, frequently, by the presence of activating mutations in the receptor tyrosine kinase V-Kit Hardy-Zuckerman 4 Feline Sarcoma Viral Oncogene Homolog (c-KIT, albeit at different incidence (>80% in SM and 10-30% in MCT. In the last few years, it has been discovered that additional mutations in other genes belonging to the methylation system, the splicing machinery and cell signaling, contribute, with c-KIT, to SM pathogenesis and/or phenotype. In the present study, the mutational profile of the Tet methylcytosine dioxygenase 2 (TET2, the isocitrate dehydrogenases 1 and 2 (IDH1 and IDH2, the serine/arginine-rich splicing factor 2 (SRSF2, the splicing factor 3b subunit 1 (SF3B1, the Kirsten rat sarcoma viral oncogene homolog (KRAS and the neuroblastoma RAS viral oncogene homolog (NRAS, commonly mutated in human myeloid malignancies and mastocytosis, was investigated in canine MCTs.Using the Sanger sequencing method, a cohort of 75 DNA samples extracted from MCT biopsies already investigated for c-KIT mutations were screened for the "human-like" hot spot mutations of listed genes.No mutations were ever identified except for TET2 even if with low frequency (2.7%. In contrast to what is observed in human TET2 no frame-shift mutations were found in MCT samples.Results obtained in this preliminary study are suggestive of a substantial difference between human SM and canine MCT if we consider some target genes known to be involved in the pathogenesis of human SM.

  12. Fracture Nasal Bone

    OpenAIRE

    Balasubramanian, Thiagarajan; Venkatesan, Ulaganathan

    2013-01-01

    Nose is the most prominent part of the face, hence it is likely to be the most common structure to be injured in the face. Although fractures involving the nasal bones are very common, it is often ignored by the patient. Patients with fractures of nasal bone will have deformity, tenderness, haemorrhage, edema, ecchymosis, instability, and crepitation. These features may be present in varying combinations. This article discusses the pathophysiology of these fractures, role of radiography and u...

  13. FRACTURE NASAL BONES

    OpenAIRE

    Balasubramanian Thaigarajan; Venkatesan Ulaganathan

    2013-01-01

    Nose is the most prominent part of the face, hence it is likely to be the most common structure to be injured in the face. Although fractures involving the nasal bones are very common, it is often ignored by the patient. Patients with fractures of nasal bone will have deformity, tenderness, haemorrhage, edema, ecchymosis, instability, and crepitation. These features may be present in varying combinations. This article discusses the pathophysiology of these fractures, role of radiography a...

  14. Nasal cytochrome P4502A: Identification in rats and humans

    Energy Technology Data Exchange (ETDEWEB)

    Thornton-Manning, J.R.; Hotchkiss, J.A. [Michigan State Univ., East Lansing, MI (United States); Ding, Xinxin [Wadsworth Center for Laboratories and Research, Albany, NY (United States)] [and others

    1995-12-01

    The nasal mucosa, the first tissue of contact for inhaled xenobiotics, possesses substantial enobiotic-metabolizing capacti. Enzymes of the nasal cavity may metabolize xenobiotics to innocuous, more water-soluble compounds that are eliminated from the body, or they may bioactivate them to toxic metabolites. These toxic metabolites may find to cellular macromolecules in the nasal cavity or be transported to other parts of the body where they may react. Nasal carcinogenesis in rodents often results from bioactivation of xenobiotics. The increased incidences of nasal tumors associated with certain occupations suggest that xenobiotic bioactivation may be important in human nasal cancer etiology, as well. The increasing popularity of the nose as a route of drug administration makes information concerning nasal drug metabolism and disposition vital to accomplish therapeutic goals. For these reasons, the study of xenobiotic-met abolizing capacity of the nasal cavity is an important area of health-related research. In the present study, we have confirmed the presence of CYP2A6 mRNA in human respiratory mucosa.

  15. Non-Hodgkin's lymphoma of nasal cavity: CT diagnosis

    International Nuclear Information System (INIS)

    Objective: To study the CT imaging of nasal lymphomas and find out the relatively specific manifestations of CT imaging of nasal lymphomas. Methods: The CT imaging material of 10 nasal lymphomas confirmed pathologically and evaluate the diagnostic significance of the manifestations of the images combined with review of literatures. Results: The pathology of all 10 cases of nasal lymphomas were T cell Non-Hodgkin's lymphoma (NHL), Ann Arbor stage I-II in 9 and 1 in stage IV. The locations of 10 lymphomas were in the anterior portion of one of the nasal cavities, and the lymphomas extended posteriorly along the inferior and/or media nasalis concha in different extent. No bone structure destruction was found in all stage I cases and the bone of the media nasalis concha as well as the uncinate process was partially absorbed in the stage IV NHL. The skin of the external noses adjacent to the lymphoma of the whole 10 cases were swollen in various severity with disappearance of the subcutaneous fat. Conclusion: If that the tumor located in the anterior portion of nasal cavity, without destruction or deformation of the bone structure, the skin of the external nose adjacent to the tumor was swollen and/or the subcutaneous fat was disappeared shown by CT, the possibility of nasal lymphoma should be considered

  16. Expression of P-glycoprotein, multidrug resistance-associated protein, glutathione-S-transferase pi and p53 in canine transmissible venereal tumor

    Directory of Open Access Journals (Sweden)

    Daniel G. Gerardi

    2014-01-01

    Full Text Available The overexpression of proteins P-glycoprotein (P-gp, multidrug resistance-associated protein (MRP1, mutant p53, and the enzyme glutathione-S-transferase (GSTpi are related to resistance to chemotherapy in neoplasms. This study evaluated the expression of these markers by immunohistochemistry in two groups of canine TVT, without history of prior chemotherapy (TVT1, n=9 and in TVTs presented unsatisfactory clinical response to vincristine sulfate (TVT2, n=5. The percentage of specimens positively stained for P-gp, MRP1, GSTpi and p53 were, respectively 88.8%, 0%, 44.5% and 22.2% in TVT1 and 80%, 0%, 80% and 0% in TVT2. In TVT1, one specimen presented positive expression for three markers and four specimens for two markers. In TVT2, three specimens expressed P-gp and GSTpi. In conclusion, the canine TVTs studied expressed the four markers evaluated, but just P-gp and GSTpi were significantly expressed, mainly at cytoplasm and cytoplasm and nuclei, respectively, either before chemotherapy as after vincristine sulfate exposure. Future studies are needed to demonstrate the function of these two markers in conferring multidrug resistance (MDR or predict the response to chemotherapy in canine TVT.

  17. A Solitary Malignant Schwannoma in the Choana and Nasal Septum

    OpenAIRE

    Eun Jung Lee; Kee Jae Song; Yeon Suk Seo; Kyung-Su Kim

    2014-01-01

    Malignant schwannoma is an extremely rare tumor and the risk of malignant schwannoma increases in patients with von Recklinghausen's disease. Recently, we encountered a case of solitary malignant schwannoma in the choana and posterior nasal septum. Malignant schwannoma has not been previously reported in these locations. A 53-year-old man, who was immunologically healthy and showed no abnormal dermatological lesions, presented with a polypoid mass in the right nasal cavity and underwent endos...

  18. Mode-of-Action Uncertainty for Dual-Mode Carcinogens: A Bounding Approach for Naphthalene-Induced Nasal Tumors in Rats Based on PBPK and 2-Stage Stochastic Cancer Risk Models

    Energy Technology Data Exchange (ETDEWEB)

    Bogen, K T

    2007-05-11

    A relatively simple, quantitative approach is proposed to address a specific, important gap in the appr approach recommended by the USEPA Guidelines for Cancer Risk Assessment to oach address uncertainty in carcinogenic mode of action of certain chemicals when risk is extrapolated from bioassay data. These Guidelines recognize that some chemical carcinogens may have a site-specific mode of action (MOA) that is dual, involving mutation in addition to cell-killing induced hyperplasia. Although genotoxicity may contribute to increased risk at all doses, the Guidelines imply that for dual MOA (DMOA) carcinogens, judgment be used to compare and assess results obtained using separate 'linear' (genotoxic) vs. 'nonlinear' (nongenotoxic) approaches to low low-level risk extrapolation. However, the Guidelines allow the latter approach to be used only when evidence is sufficient t to parameterize a biologically based model that reliably o extrapolates risk to low levels of concern. The Guidelines thus effectively prevent MOA uncertainty from being characterized and addressed when data are insufficient to parameterize such a model, but otherwise clearly support a DMOA. A bounding factor approach - similar to that used in reference dose procedures for classic toxicity endpoints - can address MOA uncertainty in a way that avoids explicit modeling of low low-dose risk as a function of administere administered or internal dose. Even when a 'nonlinear' toxicokinetic model cannot be fully validated, implications of DMOA uncertainty on low low-dose risk may be bounded with reasonable confidence when target tumor types happen to be extremely rare. This concept was i illustrated llustrated for a likely DMOA rodent carcinogen naphthalene, specifically to the issue of risk extrapolation from bioassay data on naphthalene naphthalene-induced nasal tumors in rats. Bioassay data, supplemental toxicokinetic data, and related physiologically based p

  19. Canine Leishmaniasis, Italy

    OpenAIRE

    Ferroglio, Ezio; Maroli, Michele; Gastaldo, Silvia; Mignone, Walter; Rossi, Luca

    2005-01-01

    We report the results of a survey to determine the prevalence of canine leishmaniasis and the presence of sand flies in northwestern Italy, where autochthonous foci of canine leishmaniasis have not been reported. Active foci of canine leishmaniasis were identified, which suggests that the disease is now also endemic in continental climate areas.

  20. Nasal Cavity Masses Resembling Chondro-osseous Respiratory Epithelial Adenomatoid Hamartomas in 3 Dogs.

    Science.gov (United States)

    LaDouceur, E E B; Michel, A O; Lindl Bylicki, B J; Cifuentes, F F; Affolter, V K; Murphy, B G

    2016-05-01

    Chondro-osseous respiratory epithelial adenomatoid hamartomas (COREAHs) are rare tumors in the nasal cavity of people, which have not been described in other species. COREAHs in people are minimally invasive and rarely recur following excision. Histologically, these tumors are composed of disorganized, mature, nasal turbinate tissue that is organized into polypoid growths. These growths are lined by respiratory epithelium, contain glandular elements, and are organized around central cores of chondro-osseous matrix. This report describes 3 cases of dogs with nasal tumors that have histomorphology similar to that of COREAH in people. The tumors were all identified within the nasal cavity and were associated with regional bony lysis of the turbinates and surrounding skull bones, a feature that has not been reported in COREAH in people. There was no evidence of metastasis or extension beyond the nasal cavity in any of the 3 cases. PMID:26253881

  1. Failure patterns following cobalt irradiation in dogs with nasal carcinoma

    International Nuclear Information System (INIS)

    The pattern of tumor recurrence was assessed in 24 dogs receiving cobalt radiation therapy for nasal carcinoma. Dogs were evaluated using nasal cavity computed tomography prior to treatment, and at 1, 3, 6 and 12 months after treatment, and at 6-month intervals thereafter if still alive. Dogs were treated with various combinations of total dose, and fraction size. Total doses were normalized to equivalent doses given in 3.0 Gy fractions. The extent of tumor regression or duration of tumor control were not dependent on absolute total dose, normalized total dose, or tumor type. The median duration of local control in all dogs was 312 days. Marked tumor regression was observed in 11 of the 24 dogs. Median duration of local control was significantly longer in dogs with marked tumor regression in comparison to dogs without tumor regression; 389 vs. 161 days respectively. When tumor recurrence was documented in dogs having tumor regression, the location of the recurrence was in the nasal cavity. No tumor recurred in a sinus or periorbital region, and only one geographic miss was detected. Tumor recurrence in the irradiated volume, including dogs with and without marked regression, was documented in 13 of the 24 dogs. The high local failure rate, coupled with the recurrence pattern in these dogs, suggests there may be an opportunity for improvement in local control through use of shrinking field techniques

  2. Nasal palatal: segment complex

    Directory of Open Access Journals (Sweden)

    Lourdes Romera

    2015-10-01

    Full Text Available This paper focuses on the nature of a segment which is always problematical —the palatal nasal. Phonetic results found in the acoustic, perceptive and articulate spheres, showing the different features of this nasal with regards to others, are the point of departure for a brief reflection on the phonological nature of this segment, taking into account the feature geometry and the articulatory phonology. It concludes by considering the palatal nasal /?/ as a complex segment formed by /n+j/ and the imputation, to temporary effects, of a degree of major o minor assimilation and gestural overlapping during effective perception of /?/, of /n+j/ or of /n+i/.

  3. Dihydroergotamine Injection and Nasal Spray

    Science.gov (United States)

    Migranal® Nasal Spray ... inject subcutaneously (under the skin) and as a spray to be used in the nose. It is ... that you know how to use the nasal spray or administer the injection correctly. After that, you ...

  4. OUTCOMES FOLLOWING NASAL SURGERY WITH AND WITHOUT POSTOPERATIVE NASAL DRESSINGS

    Directory of Open Access Journals (Sweden)

    Surya Prakasa Rao

    2015-02-01

    Full Text Available PURPOSE OF STUDY: Nasal dressing following nasal surgery in an attempt to prevent postoperative bleeding and to modulate the wound healing process. Experience with postoperative nasal dressings in otolaryngologic literature spans more than half a century; despite of this, there is still little agreement between the surgeons on the appropriate choice of nasal dressings following nasal surgery , or whether nasal dressings are required at all. This paper briefly reviews the comparative study between the postoperative case s wi th and without nasal dressings. STUDY DESIGN: It is a prospective study carried out in a te rtiary care, teaching hospital. MATERIALS AND METHODS: A prospective evaluation of patients who underwent nasal surgery at tertiary teaching hospital setting bet ween February 2013 to June 2014 was performed. Nasal dressing was done in some cases who underwent nasal surgery and no dressing was done in some cases. The comparative results between the cases with and without nasal packing in terms of Postoperative blee ding, Adhesion formation, Middle turbinate lateralization were studied. RESULTS: Out of 160 patients included in this study, nasal dressing postoperatively was done in 92 cases and 68 cases were not packed postoperatively. In terms of postoperative bleedin g there is no significant difference between the cases with packs (5.43% and without pack (5.88%. Postoperative Adhesion formation was less in cases without nasal packing ( 2.94% than in cases with nasal dressing ( 8.7%. Middle turbinate lateralization i s also less in cases without nasal packing ( 8.82% than in cases with nasal packing (17.5%. CONCLUSION: The decision as to whether to pack the nose after nasal surgery remains controversial. There has been an increasing tendency to move away from removabl e nasal dressings due to discomfort and bleeding upon removal and also postoperative adhesions. This study showcases that there is no considerable difference in

  5. FRACTURE NASAL BONES

    Directory of Open Access Journals (Sweden)

    Balasubramanian Thaigarajan

    2013-03-01

    Full Text Available Nose is the most prominent part of the face, hence it is likely to be the most common structure to be injured in the face. Although fractures involving the nasal bones are very common, it is often ignored by the patient. Patients with fractures of nasal bone will have deformity, tenderness, haemorrhage, edema, ecchymosis, instability, and crepitation. These features may be present in varying combinations. This article discusses the pathophysiology of these fractures, role of radiography and ultrasound in their diagnosis and their management.

  6. Nasalance Norms in Greek Adults

    Science.gov (United States)

    Okalidou, Areti; Karathanasi, Asimina; Grigoraki, Eleni

    2011-01-01

    The purposes of this study were to derive nasalance norms for monolingual Greek speakers, to examine nasalance scores as a function of gender and to draw cross-linguistic comparisons based on normative data. Participants read aloud a corpus of linguistic material, consisting of (1) a nasal text, an oral text and a balanced text; (2) a set of nasal…

  7. Cosmetic and Functional Nasal Deformities

    Science.gov (United States)

    ... nasal complaints. Nasal deformity can be categorized as “cosmetic” or “functional.” Cosmetic deformity of the nose results in a less ... taste , nose bleeds and/or recurrent sinusitis . A cosmetic or functional nasal deformity may occur secondary to ...

  8. Metaplastic changes of nasal respiratory epithelium in rats exposed to hexamethylphosphoramide (HMPA) by inhalation.

    OpenAIRE

    K. P. Lee(University of Tokyo); Trochimowicz, H. J.

    1982-01-01

    Rats exposed by inhalation to hexamethylphosphoramide (HMPA) at concentrations of 50, 100, 400, and 4000 parts per billion (ppb) for 6-24 months revealed nasal tumors and squamous metaplasia with inflammation in the nasal epithelium, but no changes were observed at 10 ppb. The ciliated cells were most susceptible to HMPA, showing degenerative changes, with abnormal cilia and extensive deciliation. The desquamated nasal epithelium was repaired initially by undifferentiated mucus or microvillou...

  9. Ciclesonide Nasal Spray

    Science.gov (United States)

    Ciclesonide nasal spray is used to treat the symptoms of seasonal (occurs only at certain times of the year), and perennial ( ... Ciclesonide comes as a solution (liquid) to spray in the nose. It is usually sprayed in each nostril once daily. Use ciclesonide at around the same time every day. Follow the ...

  10. Naloxone Nasal Spray

    Science.gov (United States)

    ... symptoms, he or she should give you your first naloxone dose and then call 911 immediately. After receiving the naloxone nasal spray, ... the person on their side (recovery position) and call for emergency medical ... after giving the first naloxone dose. If the person does not respond ...

  11. Oncolytic Virotherapy of Canine and Feline Cancer

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    2014-05-01

    Full Text Available Cancer is the leading cause of disease-related death in companion animals such as dogs and cats. Despite recent progress in the diagnosis and treatment of advanced canine and feline cancer, overall patient treatment outcome has not been substantially improved. Virotherapy using oncolytic viruses is one promising new strategy for cancer therapy. Oncolytic viruses (OVs preferentially infect and lyse cancer cells, without causing excessive damage to surrounding healthy tissue, and initiate tumor-specific immunity. The current review describes the use of different oncolytic viruses for cancer therapy and their application to canine and feline cancer.

  12. [Pituitary neoplasms extending into the nasal cavity and their needle biopsy cytodiagnosis].

    Science.gov (United States)

    Blagoveshchenskaia, N S; Burgman, G P

    1978-01-01

    In 5.5% of 126 patients treated for hypophyseal tumors at the Burdenko Institute of Neurosurgery, AMS USSR for 12 months, spread of the new growth to the nasal cavity was revealed. The tumor was usually located in the posterosuperior parts of the nose and was discovered on anterior rhinoscopy only after the nasal mucosa had been carefully anemized, particularly with the use of a nasal dilator with a lamp on its end specially designed by us. Spread of a hypophyseal tumor to the nasal cavity was encountered when the tumor was very large and grew regularly in all directions or when it was marked by selective infrasellarg growth in the direction of the sphenoidal sinus. Cytologic examination of the punctate made it possible to determine the presence of the hypophyseal tumor and its character (benign, malignant) and differentiate it from other new growths and from c.s.p. cysts. PMID:654183

  13. Assessment of nasal obstruction with flexible nasal endoscopy

    International Nuclear Information System (INIS)

    Objective was to report the value of nasal endoscopy as an outpatient procedure in the diagnosis of posterior nasal obstruction. Over one year period, from March 2002 to March 2003, we evaluated 130 adult patients that attended the Ear, Nose and Throat Department of Sohag University Hospital in Egypt with persistent nasal obstruction via anterior rhinoscopy and flexible nasopharyngoscopy. We reported the cause and site of obstruction in relation to the choanae. We confirmed the diagnosis by CT scanning, rigid endoscopic examination under general anesthesia, and histopathological analysis of biopsies taken. Forty-six percent of our cases had posterior nasal obstruction, 43.5% due to post-choanal lesions (mainly adenoid), 33% due to pre-choanal lesions (mainly choanal polyps), and 23.5% due to choanal lesions (mainly choanal adenoid). We conclude that flexible nasal endoscopy is superior to visual examination in the evaluation of nasal obstruction; hence, we recommend its routine use. (author)

  14. Nasal Bridge Intramuscular Hemangioma

    OpenAIRE

    Zulkifli Hamir Basah; Irfan Mohamad; Ramiza Ramza Ramli; Maha Khadum Gayadh; Samarendra Singh Mutum

    2015-01-01

    Intramuscular haemangioma (IMH) is a benign mesenchymal tumour. It appears as a deep, nontender mass within the soft tissue, particularly in the extremities. This tumour may not be obvious on clinical examination. Head and neck IMHs represent only 13.5% of the total IMHs. The most common site for a head and neck IMH is the masseter muscle, followed by trapezius, sternocleidomastoid, and very rarely temporalis muscle. We present a patient with left nasal bridge swelling which was excised and h...

  15. Mammary tumors

    International Nuclear Information System (INIS)

    Mammary neoplasia is one of the more common malignancies affecting domestic species. Despite their importance, they are often over- diagnosed, undertreated and subject to several misconceptions propagated by veterinarians and pet owners alike. Mammary neoplasia is the most frequent tumor type encountered in the female accounting for almost half of all malignancies reported. The canine has the highest incidence of mammary tumors of all domestic species. In the dog, about 65 percent of mammary tumors are benign mixed tumors, and 25 percent are carcinomas. The rest are adenomas, myoepitheliomas, and malignant mixed tumors. The age distribution of mammary tumors closely follows the age distribution of most tumors in the dog. Mammary tumors are rare in dogs 2 years old, but incidence begins to increase sharply at approximately 6 years of age. Median age at diagnosis is about 10 years. No breed predilection has been consistently reported

  16. Health risks associated with inhaled nasal toxicants

    NARCIS (Netherlands)

    Feron, V.J.; Arts, J.H.E.; Kuper, C.F.; Slootweg, P.J.; Woutersen, R.A.

    2001-01-01

    Health risks of inhaled nasal toxicants were reviewed with emphasis on chemically induced nasal lesions in humans, sensory irritation, olfactory and trigeminal nerve toxicity, nasal immunopathology and carcinogenesis, nasal responses to chemical mixtures, in vitro models, and nasal dosimetry- and me

  17. Single-stage osseointegrated implants for nasal prosthodontic rehabilitation: A clinical report.

    Science.gov (United States)

    de Carvalho, Bruna M D F; Freitas-Pontes, Karina M; de Negreiros, Wagner A; Verde, Marcus A R L

    2015-08-01

    Malignant tumors in the nasal region may be treated by means of invasive surgical procedures, with large facial losses. Nasal prostheses, retained by osseointegrated facial implants, instead of plastic surgery, will, in most patients, offer good biomechanical and cosmetic results. This clinical report describes the prosthetic rehabilitation of a patient with nasal cancer who had the entire nasal vestibule removed in a single-stage surgical procedure in order to shorten the rehabilitation time. The nasal prosthesis was built on a 3-magnet bar and was made of platinum silicone with intrinsic pigmentation, thereby restoring the patient's appearance and self-esteem. The authors concluded that single-stage implants may reduce the rehabilitation time to as little as 1 month, and the correct use of materials and techniques may significantly improve the nasal prosthesis. PMID:25976710

  18. [Weiss' nasal lymphoma (histiocytic, malignant)].

    Science.gov (United States)

    Pons, S; Ortiz Medina, A

    1984-01-01

    We presented a patient with a deforming and necrotizing syndrome of the nasal pyramid. The histopathology demonstrated a lymphoma. The original works of Weiss are related. The diseases is characterized by: ecotaxis of the nasal pyramid, localized persistency during a long time, malaise in advanced studies and sensibility to radiations. We proposed the name linfoma histiocitico maligno nasal de Weiss and consider it as a autonomous entity. PMID:6384693

  19. Epidermal growth factor receptor expression in canine transitional cell carcinoma

    OpenAIRE

    HANAZONO, Kiwamu; Fukumoto, Shinya; KAWAMURA, Yoshio; ENDO, Yoshifumi; Kadosawa, Tsuyoshi; IWANO, Hidetomo; UCHIDE, Tsuyoshi

    2014-01-01

    Transitional cell carcinoma (TCC), a urinary bladder tumor with high mortality, is encountered commonly in dogs. Whereas overexpression of epidermal growth factor receptor (EGFR) is associated with development of human urinary bladder cancer, information on EGFR expression in canine TCC is lacking. In this study, EGFR protein and mRNA expression in canine normal bladder (n=5), polypoid cystitis (n=5) and TCC (n=25) were examined by immunohistochemistry and real-time polymerase chain reaction....

  20. Fibrosarcoma of the nasal cavity: A case report

    Directory of Open Access Journals (Sweden)

    Omar Maliki

    2014-11-01

    Full Text Available Nasal fibrosarcoma is an infrequent malignant neoplasm. It usually presents as other sarcomas in this region, with nasal obstruction and epistaxis. The final diagnosis is based on the histopathology and immunohistochemistry. We report the case of a 37-year-old man with a 3-month history of recurrent epistaxis and nasal obstruction. Nasal endoscopy confirmed a right nasal neoplasia. Computed tomography and magnetic resonance image showed the tumor. TEP scan showed no metastasis. Complete removal was achieved through a combined surgery, by endoscopic endonasal approach and by incision in the right upper oral vestibule. Fibrosarcoma was found on histopathologic and immunohistochemistric examinations. After 12 months, the postoperative course was uneventful and follow-up information showed no recurrence of metastasis. However, in the 13th month, the patient suddenly died at home. Autopsy found no obvious cause for his death. To the best of our knowledge, no case of a fibrosarcoma of the nasal cavity with sudden death has been previously reported in the English-language.

  1. Nasendoscopy for unusual nasal symptoms

    OpenAIRE

    Vedasalam, S; Sipaul, F.; Hill, A.; Porter, G.

    2010-01-01

    A 20-year-old woman who was fit and well presented with a history of left nasal blockage for 2 years. She was noted on anterior rhinoscopy to have nasal septal deviation towards the left. She was listed for septoplasty with the aim of relieving nasal obstruction. At operation she was found to have a mildly deviated septum to the left. There was also a rhinolith in the left nostril posterior to the deviated septum (figure 1). Following removal of the rhinolith, her nasal airway appeared adequa...

  2. Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma

    OpenAIRE

    Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid

    2016-01-01

    Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...

  3. On the relation of nasal cycling with nasal airway dimensions

    International Nuclear Information System (INIS)

    The size and configuration of the nasal airways of humans change with time as a result of the normal process of congestion/decongestion of the erectile tissue of the nasal mucosa. To determine the extent to which airway areas change in vivo, we used magnetic resonance imaging (MRI) to quantitate both the cross-sectional area and perimeter of coronal sections of the entire nasal airway of a human subject. Changes in airway size or patency were indexed to measured changes in unilateral nasal airway resistance determined by posterior rhino manometry. The results of this study in which two MRI scans were performed for presumed left-side patency and two for right-side patency, showed that changes in nasal airway resistance were difficult to ascribe to systematic changes In the sizes of the airways. (author)

  4. Canine chronic inflammatory rhinitis.

    Science.gov (United States)

    Windsor, Rebecca C; Johnson, Lynelle R

    2006-05-01

    Chronic inflammatory rhinitis is commonly found in dogs with chronic nasal disease and is characterized by lymphoplasmacytic infiltrates in the nasal mucosa in the absence of an obvious etiologic process. The pathogenesis of lymphoplasmacytic rhinitis remains unknown. Animals respond poorly to antibiotics, oral glucocorticoids, and antihistamines, making primary infectious, immune-mediated, or allergic etiologies unlikely. Aberrant immune response to inhaled organisms or allergens may induce inflammation in some animals. Common clinical signs include nasal discharge, sneezing, coughing, epistaxis, and stertor. Diagnosis is made by performing a thorough history, physical examination, radiography or advanced imaging (via computed tomography or magnetic resonance imaging), rhinoscopy, and nasal mucosal biopsy to rule out primary etiologies of nasal discharge. Treatment strategies have included various antibiotics, antihistamines, oral and inhalant steroids, nonsteroidal antiinflammatories, and antifungal medications. Some dogs may respond partially to doxycycline or azithromycin, although it is unclear whether response is related to antimicrobial or antiinflammatory properties of these drugs. Hydration of the nasal cavity through nasal drops or aerosols may limit nasal discharge, and some animals may improve with inhalant (but rarely oral) glucocorticoids. PMID:16711613

  5. Patterns of tumor response in canine and feline cancer patients treated with electrochemotherapy: preclinical data for the standardization of this treatment in pets and humans

    Directory of Open Access Journals (Sweden)

    Bonetto Francesco

    2007-10-01

    Full Text Available Abstract Electrochemotherapy (ECT is a novel anticancer therapy that is currently being evaluated in human and pet cancer patients. ECT associates the administration of an anti-tumor agent to the delivery of trains of appropriate waveforms. The increased uptake of chemotherapy leads to apoptotic death of the neoplasm thus resulting in prolonged local control and extended survival. In this paper we describe the histological features of a broad array of spontaneous tumors of companion animals receiving pulse-mediated chemotherapy. Multivariate statistical analysis of the percentage of necrosis and apoptosis in the tumors before and after ECT treatment, shows that only a high percentage of necrosis and apoptosis after the ECT treatment were significantly correlated with longer survivals of the patients (p

  6. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  7. Intratumoral CD3+ T-Lymphocytes Immunoexpression and Its Association with c-Kit, Angiogenesis, and Overall Survival in Malignant Canine Mammary Tumors

    Directory of Open Access Journals (Sweden)

    Maria Isabel Carvalho

    2015-01-01

    Full Text Available In this study 80 malignant CMT were submitted to immunohistochemical detection of CD3, c-kit, VEGF, and CD31, together with clinicopathological parameters of tumor aggressiveness. CD3+ T-cells and c-kit overexpression revealed a positive correlation with VEGF (r = 0.503, P < 0.0001; r = 0.284, P = 0.023 for CD3 and c-kit, resp. and CD31 (r = 0.654, P < 0.0001; r = 0.365, P = 0.003 for CD3 and c-kit, resp.. A significant association (P = 0.039 and a positive correlation (r = 0.263, P = 0.039 between CD3 and c-kit were also observed. High CD3/VEGF, c-kit/VEGF, and CD3/c-kit tumors were associated with elevated grade of malignancy (P < 0.0001 for all groups, presence of intravascular emboli (P < 0.0001 for CD3/VEGF and CD3/c-kit; P = 0.002 for c-kit/VEGF, and presence of lymph node metastasis (P < 0.0001 for all groups. Tumors with high CD3/VEGF (P = 0.006, c-kit/VEGF (P < 0.0001, and CD3/c-kit (P = 0.002 were associated with poor prognosis. Interestingly high c-kit/VEGF tumors retained their significance by multivariate analysis arising as independent prognostic factor.

  8. Intratumoral CD3+ T-lymphocytes immunoexpression and its association with c-Kit, angiogenesis, and overall survival in malignant canine mammary tumors.

    Science.gov (United States)

    Carvalho, Maria Isabel; Pires, Isabel; Dias, Marlene; Prada, Justina; Gregório, Hugo; Lobo, Luis; Queiroga, Felisbina

    2015-01-01

    In this study 80 malignant CMT were submitted to immunohistochemical detection of CD3, c-kit, VEGF, and CD31, together with clinicopathological parameters of tumor aggressiveness. CD3+ T-cells and c-kit overexpression revealed a positive correlation with VEGF (r = 0.503, P < 0.0001; r = 0.284, P = 0.023 for CD3 and c-kit, resp.) and CD31 (r = 0.654, P < 0.0001; r = 0.365, P = 0.003 for CD3 and c-kit, resp.). A significant association (P = 0.039) and a positive correlation (r = 0.263, P = 0.039) between CD3 and c-kit were also observed. High CD3/VEGF, c-kit/VEGF, and CD3/c-kit tumors were associated with elevated grade of malignancy (P < 0.0001 for all groups), presence of intravascular emboli (P < 0.0001 for CD3/VEGF and CD3/c-kit; P = 0.002 for c-kit/VEGF), and presence of lymph node metastasis (P < 0.0001 for all groups). Tumors with high CD3/VEGF (P = 0.006), c-kit/VEGF (P < 0.0001), and CD3/c-kit (P = 0.002) were associated with poor prognosis. Interestingly high c-kit/VEGF tumors retained their significance by multivariate analysis arising as independent prognostic factor. PMID:26346272

  9. Nasal hump: Five year analysis

    Directory of Open Access Journals (Sweden)

    Kljajić Vladimir

    2010-01-01

    Full Text Available Introduction The nose has a prominent central position in the face and therefore it considerably contributes to the esthetic appearance and facial harmony. On the anterior view, the face is dominated by the nasal length and width, as well as medial location. On the lateral view, the nasal dorsum is most important; although it is the dimension we cannot see ourselves, it is the most common cause of surgery. Material and methods This five-year retrospective study included 216 patients of both sexes; their average age was 22 years, and they underwent surgery at the Ear, Throat and Nose Clinic in Novi Sad in the period from 2001 to 2006. There were 89 male, and 127 female patients. Results Most patients were aged 18 - 22 years (57%. A nasal pyramid deformity with septal deviation was present in 81.1% of patients, whereas 18.9% (41 patients presented only with a nasal pyramid deformity. Out of the total number of patients, 24 patients had both nasal kyphosis and scoliosis. All patients underwent closed rhinoplasty with obligatory correction of the tip of the nose. The nasal hump removal with lateral osteotomy was also performed in all patients. Two patients underwent reoperation, due to small dorsal humps within the cartilage, while one patient had a postoperative septal perforation. One patient presented with a postoperative abscess of the nasal dorsum, which was conservatively managed. Conclusion Nasal hump is the most common nasal pyramid deformity, often without a nasal septum deviation. It is quite easily treated by surgery. Two patients have already undergone reoperation with good results, and two patients had postoperative complications. Postoperative complications were recorded in 1,85% of patients.

  10. Cytotoxic effect of jasmonate and methyl jasmonate on a canine macrophage tumor cell line Efeito citotóxico de jasmonato e metiljasmonato em linhagem tumoral celular de macrófagos caninos

    Directory of Open Access Journals (Sweden)

    C. Hernandes

    2012-01-01

    Full Text Available Cancer is one of the leading causes of death in dogs, a fact that has boosted the investigation for new more specific antitumor drugs. This study evaluated the antitumor activity of jasmonates in the canine macrophage cell line DH82 (ATCC # CRL-10389 isolated from a case of malignant histiocytoma. The activities of methyl jasmonate and jasmonic acid were compared to that of doxorubicin by the MTT assay. Methyl jasmonate resulted in the highest inhibition of cell growth (82.2%, followed by doxorubicin (80.7% and jasmonic acid (36.5%. More detailed studies regarding the action of jasmonates on animal health are necessary, but the present results indicate methyl jasmonate as an alternative to the development of drugs for the treatment of canine oncologies.O câncer é uma das principais causas de morte em cães o que tem impulsionado a pesquisa por novos antitumorais com ação mais específica. Neste trabalho, a atividade antitumoral de jasmonatos foi avaliada na linhagem de macrófagos caninos DH82 (ATCC # CRL-10389, a qual é originada de um caso de histiocitoma maligno. A atividade do metil jasmonato (MJ e do ácido jasmônico (AJ foram comparadas à doxorrubicina, através do método de coloração MTT. O MJ apresentou maior inibição (82,2%, seguido da Doxorrubicina (80,7% e AJ (36,5%. Estudos mais completos da ação dos jasmonatos na saúde animal ainda são necessários, porém, os dados deste trabalho apontam o MJ como alternativa para o desenvolvimento de drogas para o tratamento das oncologias caninas.

  11. Scanning electron microscopy of primary bone tumors

    International Nuclear Information System (INIS)

    Critical-point-drying of tumor tissue fixed in a glutaraldehyde-paraformaldehyde solution and viewed by scanning electron microscopy (SEM) provides a 3-dimensional view of tumor cells and their matrices. This report describes the SEM appearance of three primary bone tumors: a canine osteosarcoma of the distal radius, a feline chondrosarcoma of the proximal tibia and a canine fibrosarcoma of the proximal humerus. The ultrastructural morphology is compared with the histologic appearance of each tumor

  12. Canine pulmonary angiostrongylosis

    DEFF Research Database (Denmark)

    Koch, Jørgen; Willesen, Jakob Lundgren

    2009-01-01

    Canine pulmonary angiostrongylosis is an emerging snail-borne disease causing verminous pnemonia and coagulopathy in dogs. The parasite is fund in Europe, North and South America and Africa, covering tropical, subtropical and temperate regions. Its distribution has been characterised by isolated...... larvae may not reflect what happens under field conditions. There is insufficient understanding of the spread of infection and the dynamic consequences of this parasite in the canine population. This review discusses the biology, epidemiology, clinical aspects and management of canine pulmonary...

  13. Definitive magnetic nasal prosthesis for partial nasal defect

    Directory of Open Access Journals (Sweden)

    E Nagaraj

    2011-01-01

    Full Text Available Maxillofacial trauma refers to any injury to the face or jaw caused by physical force, trauma, the presence of foreign objects, animal or human bites, and burns. Facial defects can be devastating in their impact on physical structure and function of the affected individual, leading to potential compromises in quality of life. Restoration of facial defects, especially nasal defects, is a difficult challenge for both the surgeon and the prosthodontist. Here is a case report of partial nasal defect caused by trauma, rehabilitated with a magnetic nasal prosthesis made with silicone elastomers using mechanical and anatomical retentive aids.

  14. A Comparison of Fresh Frozen vs. Formalin-Fixed, Paraffin-Embedded Specimens of Canine Mammary Tumors via Branched-DNA Assay

    OpenAIRE

    Florenza Lüder Ripoli; Annika Mohr; Susanne Conradine Hammer; Saskia Willenbrock; Marion Hewicker-Trautwein; Silvia Hennecke; Hugo Murua Escobar; Ingo Nolte

    2016-01-01

    Mammary neoplasms are the tumors most affecting female dogs and women. Formalin-fixed, paraffin-embedded (FFPE) tissues are an invaluable source of archived biological material. Fresh frozen (FF) tissue is considered ideal for gene expression analysis. However, strategies based on FFPE material offer several advantages. Branched-DNA assays permit a reliable and fast workflow when analyzing gene expression. The aim of this study was to assess the comparability of the branched-DNA assay when an...

  15. Pathogenesis of nasal polyposis.

    Science.gov (United States)

    Hulse, K E; Stevens, W W; Tan, B K; Schleimer, R P

    2015-02-01

    Chronic rhinosinusitis with nasal polyps (CRSwNP) is a complex inflammatory condition that affects a large proportion of the population world-wide and is associated with high cost of management and significant morbidity. Yet, there is a lack of population-based epidemiologic studies using current definitions of CRSwNP, and the mechanisms that drive pathogenesis in this disease remain unclear. In this review, we summarize the current evidence for the plethora of factors that likely contribute to CRSwNP pathogenesis. Defects in the innate function of the airway epithelial barrier, including diminished expression of antimicrobial products and loss of barrier integrity, combined with colonization by fungi and bacteria likely play a critical role in the development of chronic inflammation in CRSwNP. This chronic inflammation is characterized by elevated expression of many key inflammatory cytokines and chemokines, including IL-5, thymic stromal lymphopoietin and CCL11, that help to initiate and perpetuate this chronic inflammatory response. Together, these factors likely combine to drive the influx of a variety of immune cells, including eosinophils, mast cells, group 2 innate lymphoid cells and lymphocytes, which participate in the chronic inflammatory response within the nasal polyps. Importantly, however, future studies are needed to demonstrate the necessity and sufficiency of these potential drivers of disease in CRSwNP. In addition to the development of new tools and models to aid mechanistic studies, the field of CRSwNP research also needs the type of robust epidemiologic data that has served the asthma community so well. Given the high prevalence, costs and morbidity, there is a great need for continued research into CRS that could facilitate the development of novel therapeutic strategies to improve treatment for patients who suffer from this disease. PMID:25482020

  16. FDG PET/CT imaging in canine cancer patients

    DEFF Research Database (Denmark)

    Hansen, Anders Elias; McEvoy, Fintan; Engelholm, Svend Aage;

    2011-01-01

    and organs in canine cancer patients. FDG PET/CT was performed in 14 dogs including, nine mesenchymal tumors, four carcinomas, and one incompletely excised mast cell tumor. A generally higher FDG uptake was observed in carcinomas relative to sarcomas. Maximum SUV of carcinomas ranged from 7.6 to 27.......0, and for sarcomas from 2.0 to 10.6. The FDG SUV of several organs and tissues, including regional brain uptake is reported, to serve as a reference for future FDG PET studies in canine cancer patients. Several potential pitfalls have been recognized in interpretation of FDG PET images of human patients, a number...

  17. The Canine Oral Microbiome

    OpenAIRE

    Dewhirst, Floyd E.; Klein, Erin A.; Thompson, Emily C.; Blanton, Jessica M.; Chen, Tsute; Milella, Lisa; Buckley, Catherine M. F.; Davis, Ian J.; Bennett, Marie-Lousie; Marshall-Jones, Zoe V.

    2012-01-01

    Determining the bacterial composition of the canine oral microbiome is of interest for two primary reasons. First, while the human oral microbiome has been well studied using molecular techniques, the oral microbiomes of other mammals have not been studied in equal depth using culture independent methods. This study allows a comparison of the number of bacterial taxa, based on 16S rRNA-gene sequence comparison, shared between humans and dogs, two divergent mammalian species. Second, canine or...

  18. Keratoacanthoma: an unusual nasal mass.

    Science.gov (United States)

    Sazafi, M S; Salina, H; Asma, A; Masir, N; Primuharsa Putra, S H A

    2013-12-01

    We report a case of keratoacanthoma in a non-sun-exposed nasal vestibule of an 84-year-old man. He presented with a progressively growing left nasal mass that had been present for 8 months. Examination showed a non-tender protruding mass arising from medial vestibular wall of the left nostril. Histopathology indicated it was a keratoacanthoma. In an elderly patient with a history of a progressively growing mass in the nose, a differential diagnosis of malignancy should be ruled out, and histological conformation is essential. To our knowledge, only a very small number of cases of nasal vestibular keratoacanthoma have been reported. PMID:24376301

  19. Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma.

    Science.gov (United States)

    Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid

    2016-01-01

    Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma. PMID:26733734

  20. Complete Genome Sequence of an Avian-Origin H3N2 Canine Influenza Virus Isolated from Dogs in South Korea

    OpenAIRE

    Park, Seong-Jun; Moon, Hyoung-Joon; Kang, Bo-Kyu; Hong, Minki; Na, Woonseong; Kim, Jeong-Ki; Poo, Haryoung; Park, Bong-Kyun; Song, Dae-Sub

    2012-01-01

    An avian-origin Korean H3N2 canine influenza virus (CIV) strain, designated A/canine/Korea/01/2007 (H3N2), was isolated from nasal swabs of pet dogs exhibiting severe respiratory syndrome in 2007. In the present study, we report the first complete genome sequence containing 3′ and 5′ noncoding regions (NCRs) of H3N2 CIV, which will provide important insights into the molecular basis of pathogenesis, transmission, and evolution of CIV.

  1. Cytological diagnosis of a metastatic canine mammary tumor in pleural effusion Diagnóstico citológico de tumor mamário metastático canino em derrame pleural

    OpenAIRE

    Cassali, G.D.; Gärtner, F.; M.J. Vieira da Silva; Schmitt, F C

    1999-01-01

    Descrevem-se os achados citomorfológicos de um tumor maligno de mama em uma cadela Poodle de sete anos de idade, o qual foi observado inicialmente pelo exame citológico do derrame pleural. Comparam-se os aspectos citológicos do derrame pleural e punção aspirativa com agulha fina do tumor com aqueles descritos para o câncer de mama na espécie humana.

  2. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    OpenAIRE

    I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini

    2008-01-01

    A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTAC...

  3. Construction of a multicolor GeneScan analytical system to detect clonal rearrangements of immunoglobulin and T cell receptor genes in canine lymphoid tumors.

    Science.gov (United States)

    Goto-Koshino, Yuko; Mochizuki, Hiroyuki; Sato, Masahiko; Nakashima, Ko; Hiyoshi, Saaya; Fujiwara-Igarashi, Aki; Maeda, Shingo; Nakamura, Kenji; Uchida, Kazuyuki; Fujino, Yasuhito; Ohno, Koichi; Tsujimoto, Hajime

    2015-05-15

    Polymerase chain reaction (PCR) amplification to detect immunoglobulin heavy chain (IgH) and T cell receptor γ-chain (TCRγ) gene rearrangements has recently become widely used as part of the diagnostic strategy for lymphoid tumors in dogs. In this study, we constructed a multicolor GeneScan analytical system to improve the sensitivity and resolution of the clonality analysis of antigen receptor gene rearrangements in dogs. We used 7 reactions per sample, with 2 PCR conditions, to amplify IgH/TCRγ and control genes. By using multicolor-labeled primers, these 7 PCR products could be combined into 3 tubes before capillary electrophoresis. Clonal rearrangement of the IgH/TCRγ genes was detected in 93.3% of dogs with multicentric lymphoma and 84.6% of dogs with gastrointestinal lymphoma. Detection sensitivity of the clonally expanded cells in the background of normal peripheral blood mononuclear cells was 1-10%. The multicolor GeneScan analytical system developed here may prove to be helpful for the diagnosis of lymphoid tumors in dogs. PMID:25840823

  4. Propofol attenuates LPS-induced tumor necrosis factor-α, interleukin-6 and nitric oxide expression in canine peripheral blood mononuclear cells possibly through down-regulation of nuclear factor (NF)-κB activation

    OpenAIRE

    Pei, Zengyang; WANG, Jinqiu

    2014-01-01

    Sepsis is a major cause of mortality in intensive care medicine. Propofol, an intravenous general anesthetic, has been suggested to have anti-inflammatory properties and able to prevent sepsis induced by Gram-positive and Gram-negative bacteria by down-regulating the gene expression of pro-inflammatory cytokines. However, propofol’s anti-inflammatory effects upon canine peripheral blood mononuclear cells (PBMCs) have not yet been clarified. Here, we isolate canine PBMCs and investigate the ef...

  5. Measurement of nasal mucociliary clearance.

    OpenAIRE

    Corbo, G M; Foresi, A; Bonfitto, P; Mugnano, A; Agabiti, N.; Cole, P J

    1989-01-01

    The saccharin test was carried out in a randomly selected sample of schoolchildren (142 boys and 153 girls, age range 11-14 years) to determine the variability and reproducibility of the test and to assess whether it could be used as a screening test for nasal mucociliary clearance. Nasal mucociliary clearance times were analysed according to clinical history (asthma, rhinitis, asthma with rhinitis, and acute upper respiratory tract infections), laboratory findings (positive skin test respons...

  6. Bilateral cleft lip nasal deformity

    OpenAIRE

    Singh Arun; Nandini R.

    2009-01-01

    Bilateral cleft lip nose deformity is a multi-factorial and complex deformity which tends to aggravate with growth of the child, if not attended surgically. The goals of primary bilateral cleft lip nose surgery are, closure of the nasal floor and sill, lengthening of the columella, repositioning of the alar base, achieving nasal tip projection, repositioning of the lower lateral cartilages, and reorienting the nares from horizontal to oblique position. The multiplicity of procedures in the li...

  7. Intratumoral CD3+ T-Lymphocytes Immunoexpression and Its Association with c-Kit, Angiogenesis, and Overall Survival in Malignant Canine Mammary Tumors

    OpenAIRE

    Maria Isabel Carvalho; Isabel Pires; Marlene Dias; Justina Prada; Hugo Gregório; Luis Lobo; Felisbina Queiroga

    2015-01-01

    In this study 80 malignant CMT were submitted to immunohistochemical detection of CD3, c-kit, VEGF, and CD31, together with clinicopathological parameters of tumor aggressiveness. CD3+ T-cells and c-kit overexpression revealed a positive correlation with VEGF (r = 0.503, P < 0.0001; r = 0.284, P = 0.023 for CD3 and c-kit, resp.) and CD31 (r = 0.654, P < 0.0001; r = 0.365, P = 0.003 for CD3 and c-kit, resp.). A significant association (P = 0.039) and a positive correlation (r = 0.263, P = 0.03...

  8. Nasal reconstruction based on aesthetic subunits in Orientals.

    Science.gov (United States)

    Yotsuyanagi, T; Yamashita, K; Urushidate, S; Yokoi, K; Sawada, Y

    2000-07-01

    Reconstruction based on the aesthetic subunit principle has yielded good aesthetic outcomes in patients with moderate to severe nasal defects caused by trauma or tumor resection. However, the topographic subunits previously proposed are often unsuitable for Orientals. Compared with the nose in white patients, the nose in Orientals is low, lacks nasal muscle, and has a flat glabella; the structural features of the underlying cartilage and bone are not distinctly reflected in outward appearance. The authors devised aesthetic subunits suitable for Orientals, and they used these units to reconstruct various parts of the nose. The major difference between these units and those presented previously is the lack of soft triangles and the addition of the glabella as an independent unit. The authors divided the nose into the following five topographic units: the glabella, the nasal dorsum, the nasal tip, and the two alae. The border of the nasal dorsum unit was extended to above the maxillonasal suture. The basic reconstruction techniques use a V-Y advancement flap from the forehead to reconstruct the glabella, an island flap from the forehead to reconstruct the nasal dorsum and nasal tip, a nasolabial flap to reconstruct an ala, and a malar flap to reconstruct the cheek. A combination of flaps was used when the defect involved more than one unit. This concept was used for nasal reconstruction in 24 patients. In one patient undergoing reconstruction of the nasal dorsum and in one undergoing reconstruction of the nasal tip, the texture of the forearm flap did not match well, which resulted in a slightly unsatisfactory aesthetic outcome. In one patient in whom the glabella, nasal dorsum, and part of the cheek were reconstructed simultaneously, a web was formed at the medial ocular angle, and a secondary operation was subsequently performed using Z-plasty. In one patient undergoing reconstruction with a forehead flap, defatting was required to reduce the bulk of the

  9. 显微镜辅助经鼻蝶窦入路垂体瘤切除术的疗效及安全性评价%Evaluation of the efficacy and safety of microscope assisted nasal transsphenoidal pituitary ;tumor resection

    Institute of Scientific and Technical Information of China (English)

    张诚; 李建明

    2015-01-01

    Objective: To study the efficacy and safety of microscope assisted nasal transsphenoidal pituitary tumor resection. Methods: pituitary tumor patients in our hospital from March 2011 to May 2013 were enrolled and divided into observation group given microscope assisted nasal transsphenoidal pituitary tumor resection and control group given oral-nasal septum-sphenoid sinus pituitary tumor resection according to different operation mode. Then stress level, curative effect related index and complications were observed and compared with existing research. Results: (1) Adrenaline, noradrenaline, rennin, angiotensin Ⅱlevel and operation time, intraoperative bleeding volume, postoperative hospitalization time of observation group were lower than control group, cases of hormone levels return to normal and improve were more than control group, complication cases were less than control group. (2)compared with the existing research on nerve endoscopic surgery, operation time, intraoperative bleeding volume, postoperative hospitalization time and cases of hormone levels return to normal, improve and complications of observation group had no statistical difference. Conclusion:microscope assisted nasal transsphenoidal pituitary tumor resection is helpful to reduce surgery trauma, relieve stress condition and can achieve equal operation effect and complications.%目的:研究显微镜辅助下经鼻蝶窦入路垂体瘤切除术的疗效和安全性。方法:回顾性分析垂体瘤患者病历资料,并根据手术方式不同分为接受显微镜辅助下经鼻蝶窦入路垂体瘤切除术的观察组和给予经口唇下-鼻中隔-蝶窦垂体瘤切除术的对照组,观察两组患者的术中应激程度、疗效相关指标以及并发症情况,并与已有研究进行比较。结果:①观察组患者的肾上腺素、去甲肾上腺素、肾素以及血管紧张素Ⅱ水平均以及手术时间、术中出血量、术后住院时间低于对照组,激素

  10. A transseptal approach in transsphenoidal surgery for pituitary (hypophyseal) tumors

    International Nuclear Information System (INIS)

    The authors described the direct transseptal approach in transsphenoidal surgery for hypophyseal tumors. This route gives a good insight into the area of the sella. The above mentioned method is also less destructive to nasal structures in the nasal cavity, because preserves the anterior nasal septum. It is uniformity of actually views of rhinological school. 20 patients were operated using this method and none of them noticed the changes of nasal airway and the sense of smell. (author)

  11. Apoptose no tumor venéreo transmissível canino: características morfológicas e evidenciação bioquímica Apoptosis in the canine transmissible venereal tumor: morphological features and biochemical evidence

    Directory of Open Access Journals (Sweden)

    F.G.A. Santos

    2001-10-01

    Full Text Available Fragmentos de tumor venéreo transmissível canino (TVTC de ocorrência natural, com localização genital, foram obtidos de cinco animais, machos, adultos, sem raça definida. "Imprints" da superfície de corte em lâmina de microscopia foram fixadas em metanol, coradas pelo Giemsa e submetidas à avaliação citológica. Os fragmentos foram fixados e processados rotineiramente para inclusão em parafina e coloração com HE e Shorr, para confirmação histológica do tumor e identificação da apoptose. Outros fragmentos foram envolvidos com papel alumínio e acondicionados dentro de frascos de vidro em gelo seco, para serem processados no mesmo dia, visando à extração de DNA e eletroforese em gel de agarose. Análises cito e histológica do TVTC mostraram a distribuição e o padrão celular e tecidual característicos dessa neoplasia, sobressaindo-se a presença de vacúolos claros, bem definidos no citoplasma à análise citológica. Pela coloração com Shorr pôde-se identificar células retraídas, com aumento da acidofilia citoplasmática e condensação da cromatina nuclear, às vezes com fragmentação do núcleo e das células, caracterizando apoptose. A coloração pelo Shorr mostrou ser mais eficiente na distinção de células apoptóticas do que a coloração por HE. A eletroforese de DNA em gel de agarose demonstrou a fragmentação internucleossômica do genoma, que pôde ser reconhecida pelo clássico "padrão em escada".Fragments of canine transmissible venereal tumors, from natural cases and genital localization, were obtained from five adult male mongrel dogs. Imprints of the tumors were fixed, stained by Giemsa and submitted to cytological analysis to confirm the diagnosis. Representative samples of the tumoral tissue were fixed, embedded in paraffin and processed routinely for microscopic examination. Sections were stained with hematoxylin - eosin and Shorr. Another set of fragments was packed and maintained in dry ice

  12. A entomoftorose nasal

    Directory of Open Access Journals (Sweden)

    Zilton A. Andrade

    1972-10-01

    Full Text Available São apresentados os dados clínico-patológicos de dois casos de entomoftorose nasal, nova doença humana causada por um ficomiceto - Entomophthora coronata. Os pacientes, uma menina e um homem, com 8 e 44 anos de idade respectivamente, apresentaram doença localizada, com nódulos no nariz e região paranasal, edema e deformação da face. O parasito foi isolado do primeiro caso, mas todas as tentativas para isolá-lo no segundo caso resultaram negativas. Histologicamente, havia reação granulomatosa, fibrose e edema, em torno de hifas não septadas, as quais exibiam envólucro eosinófilo amorfo em torno. Foram demonstrados anticorpos circulantes contra, as hifas do E. coronata no soro de um dos pacientes. O material eosinófilo em torno das hifas continha fibrina e material auto-fluorescente sob luz ultra-violeta, provavelmente lipofuscina, mas não foram demonstrados anticorpos ou antígenos nesta área. A apresentação destes casos, os primeiros a serem descritos no Brasil, é acompanhado, de uma revisão geral do assunto, pois tal poderá vir a ser de interesse para aqueles que estudam os problemas da patologia tropical em nosso meio.

  13. TEFLON NASAL SPLINTS IN NASAL SURGERIES: ADVANTAGES OVER CONVENTIONAL NASAL PACKING

    OpenAIRE

    Sudhir M Naik; Ravishankar, B.; T Shashikumar; T Deekshith; C Sherry; N Pooja; P.Sathya

    2014-01-01

    Background &Objectives: Nasal splints have long been used to prevent post operative nasal adhesions in septal surgery. But its efficacy in reducing adhesions and residual deviations are still controversial. Teflon is an inert material used as septal splints with sieves are used in our study as splints. Materials and methods: This is a comparative case series study done in 214 cases of septoplasties. 116 postoperative cases were packed with framycetin packs only and the other 98 cases ...

  14. Image diagnosis of nasal bone fracture

    International Nuclear Information System (INIS)

    Twenty cases of nasal bone fractures were evaluated as to the types of fractures based upon HRCT findings. Conventional X-Ray films for nasal bones were analyzed and compared with HRCT findings. Nasal bone fractures were classified into lateral and frontal fractures. HRCT images were evaluated in three planes including upper, middle and lower portions of the nasal bone. Fractures favored males of teens. Lateral fracture gave rise to the fractures of the nasal bone opposite to the external force, loosening of the ipsilateral nasomaxillary sutures and fractures of the frontal process of the maxilla. Conventional X-Ray films were reevaluated after HRCT evaluation and indications of nasal bone fractures were determined. In addition to the discontinuity of the nasal dorsum, fracture lines parallel to and beneath the nasal dorsum and indistinct fracture lines along the nasomaxillary sutures are the indication of nasal bone fractures by conventional X-Ray films. (author)

  15. Epithelial myoepithelial carcinoma in nasal cavity with bony destruction: A case report

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Ho Jin; Lee, Byung Hoon; Hwang, Yoon Joon; Kim, Su Young [Dept. of Radiology, Ilsan Paik Hospital, Inje University School of Medicine, Goyang , (Korea, Republic of)

    2013-10-15

    Epithelial-myoepithelial carcinoma (EMC) is a rare tumor that commonly involves the salivary glands. EMC arising from the nasal cavity is one of the most unusual cases. We describe a case of a 48-year-old patient who is presented with bilateral nasal obstruction for several months. Multidetector computed tomography reveals expansile, well-defined, heterogeneous enhancing soft tissue masses filling the nasal cavity with bony destruction of hard palate and maxillary alveolar ridge. The carcinoma was histologically characterized by a mixture of trabecular structure with myoepithelial cells and ductal cells, which are confirmed by electron microscopy and immunohistochemistry.

  16. Association between nasal shedding and fever that influenza A (H3N2 induces in dogs

    Directory of Open Access Journals (Sweden)

    Oh Jinsik

    2011-01-01

    Full Text Available Abstract Background Avian origin canine influenza virus was reported in Korea. The dog to dog contact transmission of the avian origin canine influenza virus (CIV H3N2 and CIV H3N8 was shown by experimental contact transmission. This study was focused on viral excretion and fever in order to elucidate the epidemiological associations which might be helpful to control the disease transmissions in CIV outbreak in dogs. Methods An influenza seronegative 10-week-old Beagle dog was experimentally inoculated with the canine influenza virus A/canine/01/2007, subtype H3N2. Eight hours after inoculation, the infected dog was cohoused with seven uninfected Beagle dogs. Clinical signs including fever were recorded for 14 days post inoculation. Results The infected dog and four of seven contact dogs in the study showed clinical signs (sneezing, nasal discharge and coughing during the study. Viral shedding occurred in all of the animals tested and began on 1 to 6 DPI in dogs with clinical signs. Elevated body temperatures above 39.5°C (geometric mean temperature of 39.86°C±0.49 were observed in all symptomatic dogs. The mean viral titer during fever was 2.99 log EID50/ml, which was significantly higher than the viral titer detected in the non fever. Conclusions The data show that contact dogs with a canine influenza infected dog shed different levels of virus in their nasal excretions and demonstrate that clinical signs, including fever, significantly correlate with the viral shedding.

  17. A pRb-responsive, RGD-modified, and Hyaluronidase-armed Canine Oncolytic Adenovirus for Application in Veterinary Oncology

    OpenAIRE

    Laborda, Eduardo; Puig-Saus, Cristina; Rodriguez-García, Alba; Moreno, Rafael; Cascalló, Manel; Pastor, Josep; Alemany, Ramon

    2014-01-01

    Human and canine cancer share similarities such as genetic and molecular aspects, biological complexity, tumor epidemiology, and targeted therapeutic treatment. Lack of good animal models for human adenovirotherapy has spurred the use of canine adenovirus 2-based oncolytic viruses. We have constructed a canine oncolytic virus that mimics the characteristics of our previously published human adenovirus ICOVIR17: expression of E1a controlled by E2F sites, deletion of the pRb-binding site of E1a...

  18. Bilateral cleft lip nasal deformity

    Directory of Open Access Journals (Sweden)

    Singh Arun

    2009-01-01

    Full Text Available Bilateral cleft lip nose deformity is a multi-factorial and complex deformity which tends to aggravate with growth of the child, if not attended surgically. The goals of primary bilateral cleft lip nose surgery are, closure of the nasal floor and sill, lengthening of the columella, repositioning of the alar base, achieving nasal tip projection, repositioning of the lower lateral cartilages, and reorienting the nares from horizontal to oblique position. The multiplicity of procedures in the literature for correction of this deformity alludes to the fact that no single procedure is entirely effective. The timing for surgical intervention and its extent varies considerably. Early surgery on cartilage may adversely affect growth and development; at the same time, allowing the cartilage to grow in an abnormal position and contributing to aggravation of deformity. Some surgeons advocate correction of deformity at an early age. However, others like the cartilages to grow and mature before going in for surgery. With peer pressure also becoming an important consideration during the teens, the current trend is towards early intervention. There is no unanimity in the extent of nasal dissection to be done at the time of primary lip repair. While many perform limited nasal dissection for the fear of growth retardation, others opt for full cartilage correction at the time of primary surgery itself. The value of naso-alveolar moulding (NAM too is not universally accepted and has now more opponents than proponents. Also most centres in the developing world have neither the personnel nor the facilities for the same. The secondary cleft nasal deformity is variable and is affected by the extent of the original abnormality, any prior surgeries performed and alteration due to nasal growth. This article reviews the currently popular methods for correction of nasal deformity associated with bilateral cleft lip, it′s management both at the time of cleft lip repair

  19. Mucosal melanoma of nasal cavity and paranasal sinus

    Directory of Open Access Journals (Sweden)

    Dwivedi Raghav

    2008-01-01

    Full Text Available Mucosal melanoma of the nasal cavity and paranasal sinuses is seldom encountered in routine ENT practice. These tumors have poor prognosis owing to higher rates of locoregional recurrence and distant metastasis. Various treatment modalities have been employed over time but the ideal treatment approach still remains an open issue. This article presents some commonly accepted guidelines in treating these rare mucosal neoplasms.

  20. Primary Burkitt's Lymphoma in the Nasal Cavity and Paranasal Sinuses

    OpenAIRE

    Lee, Dong Hwan; Yu, Myeong Sang; Lee, Bong-Jae

    2013-01-01

    Burkitt's lymphoma is a highly aggressive small B-cell lymphoma. The treatment of choice is complex chemotherapy. As a rare tumor in the head and neck area, Burkitt's lymphoma usually involves cervical lymph nodes, and only fewer than 25% of cases involves extranodal regions. Involvement of the paranasal sinuses has been reported in only 14 cases in the past century. We describe here two patients with rare, sporadic, American type Burkitt's lymphoma involving the nasal cavity and paranasal si...

  1. CAPILLARY HEMANGIOMA OF THE NASAL SEPTUM IN CHILDREN

    OpenAIRE

    Salman, Nergis; Baysal, Nakiye; Adabag, Aysegul; Yildiz, Ugur; Akin, Istemihan

    2012-01-01

    Lobular capillary hemangioma (LCH) is a benign vascular tumor, also known as, pyogenic granuloma. LCH appears on the skin, the oral mucosa, and, rarely, on the nasal mucosa. Trauma, hormones, viral oncogenes, microscopic arteriovenous malformations, and angiogenic growth factors have been implicated in the etiology of LCH lesions. LCH most commonly presents in the third decade of life but may present in persons of any age. It is considerably rare in children; only a few cases have been report...

  2. Expressão dos filamentos intermediários no diagnóstico dos tumores mamários de cadelas Expression of intermediate filaments in canine mammary tumors diagnosis

    OpenAIRE

    D.A.P.C. Zuccari; Santana, A. E.; N.S. Rocha

    2002-01-01

    Foram utilizados anticorpos monoclonais para marcação imunoistoquímica dos tecidos tumorais e obtenção de informações sobre a histogênese dos tumores mamários utilizando-se anti-citoqueratinas para marcação de células epiteliais, e anti-actina e anti-vimentina para células mioepiteliais. O procedimento imunoistoquímico mostrou-se esclarecedor com relação à histogênese dos tumores mamários, confirmando a marcação de células epiteliais com as citoqueratinas que perdem sua expressão na transform...

  3. Clinical utility of a life quality score in dogs with canine transmissible venereal tumor treated by vincristine chemotherapy Utilidade clínica de escala de qualidade de vida durante o tratamento quimioterápico de cães com tumor venéreo transmissível canino (TVTC com vincristina

    Directory of Open Access Journals (Sweden)

    M.L. Valladão

    2010-10-01

    Full Text Available The clinical utility of a life quality score during vincristine chemotherapy of dogs with canine transmissible venereal tumor (CTVT was investigated using 93 tumor-bearing dogs in this prospective study. At diagnosis, clinical data and the performance status were evaluated according to a modified Karnofsky score (CKS adapted for dogs. The animals were treated with vincristine sulphate (0.025mg/kg at weekly intervals until the tumor had macroscopically disappeared. The time until the first adverse event and death were recorded. In a pilot study, CKS revealed a high inter-observer concordance (kappa=0.735; weighted kappa=0.835. CKS permitted a detailed monitoring of adverse effects during therapy. Cox regressions showed that low performance score and reduced body weight were independent predictive factors for death during chemotherapy. The modified Karnofsky performance score is a simple and reproducible clinical instrument, able to estimate patient outcome after treatment of CTVT.Investigou-se a utilidade clínica de uma escala de qualidade de vida durante o tratamento quimioterápico de cães com tumor venéreo transmissível canino (TVTC em 93 animais com TVTC que compuseram este estudo prospectivo. Ao diagnóstico, foram avaliados os dados clínicos e o escore de qualidade de vida adaptado para cães (CKS. Os animais foram tratados com sulfato de vincristina (0.025mg/kg semanalmente até o desaparecimento macroscópico do tumor. Foram anotados o tempo até o aparecimento do primeiro evento adverso e a morte. Em estudo piloto do CKS, alta concordância entre os observadores foi demonstrada (kappa = 0.735; weighted kappa = 0.835. O CKS permitiu um detalhado monitoramento dos eventos adversos durante a terapia. A regressão Cox multivariada demonstrou que o baixo escore de qualidade de vida e o reduzido peso corporal foram fatores preditivos independentes para o óbito durante a quimioterapia. A escala modificada de Karnofsky é um instrumento cl

  4. Vaccines for Canine Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Faeze Foroughi-Parvar

    2014-01-01

    Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

  5. 9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Hepatitis and Canine Adenovirus...; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus. Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed...

  6. Intra And Extra Nasal Laser Surgery

    Science.gov (United States)

    Selking, Stuart G.

    1988-06-01

    The author describes his experience with 400 intranasal laser surgical procedures done with the carbon dioxide laser and the surgical microscope. Procedures include excision and vaporization of polyps, turbinates, tumors, telangiectasia, synechia, nasal stenosis, intranasal cysts, papillomata, and septal spurs. The author describes a suction speculum and drape of his own design which provide smoke free access to the internal nose, and protection of the alar rim and the face from laser energy. Relief of obstruction is comparable to that obtained from the more traditional means of intranasal surgery. Intraoperative and early and delayed post operative bleeding is less with laser surgery than with any other means. Avoidance of technical problems is emphasized in this manuscript, since intranasal laser surgery is in some respects difficult to perform. Included are practical suggestions about patient positioning, use of protective devices, and patient selection.

  7. Olfactory ensheathing cell tumor

    Directory of Open Access Journals (Sweden)

    Ippili Kaushal

    2009-01-01

    Full Text Available Olfactory ensheathing cells (OECs are found in the olfactory bulb and olfactory nasal mucosa. They resemble Schwann cells on light and electron microscopy, however, immunohistochemical staining can distinguish between the two. There are less than 30 cases of olfactory groove schwannomas reported in the literature while there is only one reported case of OEC tumor. We report an OEC tumor in a 42-year-old male and discuss the pathology and origin of this rare tumor.

  8. Nasal trauma: Primary reconstruction with open rhinoplasty.

    Science.gov (United States)

    Konstantinidis, I; Malliari, H; Metaxas, S

    2011-01-01

    Due to the prominent location of the nose, the most common facial traumas are nasal injuries. Although nasal traumas usually require staged intervention at a later period of time, in selected cases, primary reconstruction can be effective. A 20-year-old man who was referred from the emergency department with nasal trauma is presented. He reported a fall after feeling unsteady, which caused a direct nasal injury. Clinical examination revealed septal fracture with obstruction of the left nasal cavity and deformity of the nasal pyramid (inverted V deformity). The patient also had a complete dissection of the columella skin. Epistaxis was self-limited, and an open rhinoplasty procedure was decided because the trauma occurred 1 h before admission and there was no significant edema. Surgical intervention included septal reconstruction combined with restoration of the nasal pyramid and columella. One month later, the patient had patent nasal airways, and he was satisfied with the aesthetic result. PMID:22942663

  9. Studies on the position of canines, premolars and molars by 450 .deg. oblique lateral cephalography

    International Nuclear Information System (INIS)

    This study was done using the 45 .deg. oblique lateral cephalograms of 20 year old, 18 male and 27 female, with normal occlusion, on canines, premolars, premolars and molars on upper and lower jaws. Axial inclination to nasal floor, occlusal plane and mandibular plane, and inter-axial inclination were examined. In addition the position of each tooth was examined in height and depth in upper and lower jaws. The results were obtained as follows; 1. The inclination of long axis of upper lst premolar was most nearly perpendicular, upper canine was tilted mesially, and 2nd premolar and molars were tilted distally. 2. The inclination of long axis of lower molars were tilted mesially. 3. There were no severe variation on the inter-axial inclination of canine to 2nd molar.

  10. Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

    Energy Technology Data Exchange (ETDEWEB)

    Pang, Lisa Y., E-mail: lisa.pang@ed.ac.uk; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J. [Royal (Dick) School of Veterinary Studies and Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG (United Kingdom)

    2011-03-30

    Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology.

  11. Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

    International Nuclear Information System (INIS)

    Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology

  12. High Flow Nasal Cannulae in preterm infants

    OpenAIRE

    F. Ciuffini; Colnaghi, M; A. Lavizzari; D. Mercadante; Musumeci, S; Mosca, F

    2013-01-01

    Despite of improved survival of premature infants, the incidence of long term pulmonary complications, mostly associated with ventilation-induced lung injury, remains high. Non invasive ventilation (NIV) is able to reduce the adverse effects of mechanical ventilation. Although nasal continuous positive airway pressure (NCPAP) is an effective mode of NIV, traumatic nasal complications and intolerance of the nasal interface are common. Recently high flow nasal cannula (HFNC) is emerging as an e...

  13. Nasal pulse oximetry overestimates oxygen saturation

    DEFF Research Database (Denmark)

    Rosenberg, J; Pedersen, M H

    1990-01-01

    Ten surgical patients were monitored with nasal and finger pulse oximetry (Nellcor N-200) for five study periods with alternating mouth and nasal breathing and switching of cables and sensors. Nasal pulse oximetry was found to overestimate arterial oxygen saturation by 4.7 (SD 1.4%) (bias and...

  14. Does Post Septoplasty Nasal Packing Reduce Complications?

    Directory of Open Access Journals (Sweden)

    Bijan Naghibzadeh

    2011-01-01

    Full Text Available The main issues in nasal surgery are to stabilize the nose in the good position after surgery and preserve the cartilages and bones in the favorable situation and reduce the risk of deviation recurrence. Also it is necessary to avoid the synechia formation, nasal valve narrowing, hematoma and bleeding. Due to the above mentioned problems and in order to solve and minimize them nasal packing, nasal splint and nasal mold have been advised. Patients for whom the nasal packing used may faced to some problems like naso-pulmonary reflex, intractable pain, sleep disorder, post operation infection and very dangerous complication like toxic shock syndrome. We have two groups of patients and three surgeons (one of the surgeons used post operative nasal packing in his patients and the two others surgeons did not.Complications and morbidities were compared in these two groups. Comparing the two groups showed that the rate of complication and morbidities between these two groups were same and the differences were not valuable, except the pain and discomfort post operatively and at the time of its removal. Nasal packing has several risks for the patients while its effects are not studied. Septoplasty can be safely performed without postoperative nasal packing. Nasal packing had no main findings that compensated its usage. Septal suture is one of the procedures that can be used as alternative method to nasal packing. Therefore the nasal packing after septoplasty should be reserved for the patients with increased risk of bleeding.

  15. Linfoma nasal de células T/NK Nasal T/NK cell lymphoma

    Directory of Open Access Journals (Sweden)

    A. Torre Iturraspe

    2005-04-01

    Full Text Available El linfoma nasal de células T/ natural killer (NK (LNT/NK, tras haber recibido múltiples denominaciones, ha sido definido y caracterizado en el año 2001 por la Organización Mundial de la Salud (OMS, basándose en una clasificación previa de la Revised European-American Lymphoma Classification (REAL, de la manera en que se le conoce actualmente. Su incidencia en el mundo occidental es baja, mientras que en Asia supone el segundo grupo de linfomas más frecuente, tras los gastrointestinales. Se localiza preferentemente en las fosas nasales y senos maxilares, mostrando un curso clínico agresivo, definido por una destrucción de los tejidos circundantes. Su diagnóstico definitivo se realiza por medio de técnicas de hibridación in situ, llegando a la determinación de su inmunofenotipo. Se ha observado una frecuente asociación con el virus de Epstein-Barr (VEB. El pronóstico de esta enfermedad viene definido por el índice pronóstico internacional (IPI y por el volumen alcanzado por el tumor. A pesar de ser radiosensible, su pronóstico es infausto, aconteciendo la muerte del paciente poco tiempo después del diagnóstico, generalmente como consecuencia de las complicaciones del tratamiento.Nasal T-cell and Natural Killer cell lymphoma (NT/NKL, having been given many names, was defined and described in the year 2001 by the World Health Organization (WHO, on the basis of a previous classification by the Revised European-American Lymphoma Classification (REAL as it is known today. Its incidence in the western world is low, while in Asia it represents the second most frequent group of lymphomas, followed by the gastrointestinal [lymphoma]. It is typically located in the nasal cavity and maxillary sinuses. It is associated with an aggressive clinical course, characterized by the destruction of surrounding tissue. The definitive diagnosis is made by means of in situ hybridization techniques, in order to determine the immunophenotype. Its

  16. Oncolytic virotherapy in veterinary medicine: current status and future prospects for canine patients

    Directory of Open Access Journals (Sweden)

    Patil Sandeep S

    2012-01-01

    Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.

  17. Chronic Rhinosinusitis with Nasal Polyps.

    Science.gov (United States)

    Stevens, Whitney W; Schleimer, Robert P; Kern, Robert C

    2016-01-01

    Chronic rhinosinusitis with nasal polyps (CRSwNP) is an important clinical entity diagnosed by the presence of both subjective and objective evidence of chronic sinonasal inflammation. Symptoms include anterior or posterior rhinorrhea, nasal congestion, hyposmia, and/or facial pressure or pain that last for a duration of more than 12 weeks. Nasal polyps are inflammatory lesions that project into the nasal airway, are typically bilateral, and originate from the ethmoid sinus. Males are more likely to be affected than females, but no specific genetic or environmental factors have been strongly linked to the development of this disorder to date. CRSwNP is frequently associated with asthma and allergic rhinitis, but the cellular and molecular mechanisms that contribute to the clinical symptoms are not fully understood. Defects in the sinonasal epithelial cell barrier, increased exposure to pathogenic and colonized bacteria, and dysregulation of the host immune system are all thought to play prominent roles in disease pathogenesis. Additional studies are needed to further explore the clinical and pathophysiological features of CRSwNP so that biomarkers can be identified and novel advances can be made to improve the treatment and management of this disease. PMID:27393770

  18. Diagnostic strategies in nasal congestion

    Directory of Open Access Journals (Sweden)

    John Krouse

    2010-02-01

    Full Text Available John Krouse1, Valerie Lund2, Wytske Fokkens3, Eli O Meltzer41Temple University School of Medicine, Philadelphia, PA, USA; 2Ear Institute, University College London, UK; 3Department of Otorhinolaryngology, Amsterdam Medical Centre, Netherlands; 4Allergy and Asthma Medical Group and Research Center, San Diego, CA and Department of Pediatrics, University of California, San Diego, USAAbstract: Nasal congestion is a major symptom of upper respiratory tract disorders, and its characterization an important part of the diagnosis of these illnesses. Patient history and assessment of nasal symptoms are essential components of diagnosis, providing an initial evaluation that may be adequate to rule out serious conditions. However, current congestion medications are not always fully effective. Thus, if symptoms do not respond adequately to therapy, or symptoms suggestive of more serious conditions are present, specialized assessments may be needed. Various techniques are available for diagnosing patients, including those used chiefly by primary care clinicians and those requiring the expertise of otolaryngologists, allergists, and other specialists. Endoscopy remains a mainstay for evaluating nasal blockage and its causes, while modalities such as peak nasal inspiratory flow and acoustic rhinometry are evolving to provide easy-to-use, noninvasive procedures that are sensitive enough to measure small but clinically important abnormalities and therapeutic changes. Several imaging modalities are available to the specialist for severe or unusual cases, as are specialized diagnostic procedures that measure adjunctive features of congestion, such as impaired mucociliary function.Keywords: allergic rhinitis, congestion, diagnosis, obstruction, rhinosinusitis

  19. Nasal cavity and frontal sinuses

    International Nuclear Information System (INIS)

    The anatomy, diagnostic principles, and surgical techniques relating to the nasal cavity and frontal sinuses are reviewed. Disorders are considered under headings of infectious, neoplastic, and miscellaneous conditions. For each disease condition, an attempt is made to emphasize particular problems and discuss new developments on treatment. Specific recommendations have been made where possible, along with the expected outcome

  20. Carcinomas of the nasal cavity

    International Nuclear Information System (INIS)

    Between 1969-1985, 45 patients with carcinomas of the nasal cavity proper received curative treatment. Of these, 30 had squamous cell carcinoma, 1 un-differentiated carcinoma, 9 adenocarcinoma and 5 adenoid cystic carcinoma. 18 Patients were treated with definitive radiotherapy (interstitial brachy-therapy in 5 patients and external beam therapy in 13 patients), 27 received surgery and radiotherapy. Median length of follow-up was 11 years (range 2.8-16.8 years). 36 Patients had no evidence of disease at the last follow-up visit. All 14 patients with carcinoma of nasal septum had the disease controlled. 9/31 Patients with lesions of lateral wall and floor died of the disease, 5 of uncontrolled local disease, 2 of distant metastases, 2 of both. Disease specific survival rates at 5 and 10 years were 83 and 80%, the corresponding overall survival rates were 75 and 60%. Blindness occurred in 4 patients, 2 due to orbital exenteration and 2 to radiation injury to the cornea and optic pathway. Other infrequent side effects were bone necrosis, dental decay, nasal stenosis and septal perforation. This study indicated that prognosis of patients with nasal cavity carcinoma was better than that of patients with maxillary sinus cancer treated during the same era. In addition, the study showed that carcinoma of the nasal septum were smaller than those of lateral wall and floor at diagnosis, so that excellent control could be achieved by definitive radiotherapy; when accessible, interstitial brachytherapy might be the treatment of choice in such patients. (author). 18 refs.; 4 figs.; 2 tabs

  1. Appraisal of transverse nasal groove: A study

    Directory of Open Access Journals (Sweden)

    Belagola D Sathyanarayana

    2012-01-01

    Full Text Available Background: Transverse nasal groove is a condition of cosmetic concern which awaits due recognition and has been widely described as a shallow groove that extends transversely over the dorsum of nose. However, we observed variations in the clinical presentations of this entity, hitherto undescribed in literature. Aims: We conducted a clinicoepidemiological study of transverse nasal lesions in patients attending our outpatient department. Methods: We conducted a prospective observational study. We screened all patients attending our out-patient department for presence of transverse nasal lesions, signs of any dermatosis and associated other skin conditions. Results: One hundred patients were recruited in the study. Females (80% predominated over males. Most patients were of 15-45 years age group (70%. Majority of the transverse nasal lesions were classical transverse nasal groove (39% and others included transverse nasal line (28%, strip (28%, ridge (4% and loop (1%. Seborrhoeic diathesis was the most common condition associated with transverse nasal lesion. Conclusions: Occurrence of transverse nasal line, strip, ridge and loop, in addition to classical transverse nasal groove implies that latter is actually a subset of transverse nasal lesions. Common association of this entity with seborrheic dermatitis, seborrhea and dandruff raises a possibility of whether transverse nasal lesion is a manifestation of seborrheic diathesis.

  2. Management of Otic and Nasopharyngeal, and Nasal Polyps in Cats and Dogs.

    Science.gov (United States)

    Greci, Valentina; Mortellaro, Carlo Maria

    2016-07-01

    Feline inflammatory polyps are the most common nonneoplastic lesion of ear and nasopharynx in cats. Minimally invasive techniques for polyp removal, such as traction avulsion combined with curettage of the tympanic cavity and per-endoscopic transtympanic traction, have been successful for long-term resolution. Feline nasal hamartomas are benign lesions of the nasopharynx, and most have a good prognosis after surgical removal. Canine aural and nasopharyngeal inflammatory polyps are rare and have a similar clinical presentation as cats with these lesions. In dogs, it is important to achieve an accurate histologic diagnosis of these masses before appropriate surgical treatment can be planned. PMID:26947114

  3. Effect of nasal decongestion on voice spectrum of a nasal consonant-vowel.

    Science.gov (United States)

    Lee, Guo-She; Yang, Cheryl C H; Wang, Ching-Ping; Kuo, Terry B J

    2005-03-01

    The nasal cavity and its related structures make significant contributions to human phonation, especially the resonance of voice spectra. The voice spectra of the nasal consonant-vowel (CV), [md:], in the subjects with nasal obstruction were obtained and were compared with the spectra of the same CV vocalized by the same subjects after topical nasal decongestion treatment with 1:1000 epinephrine solution. Results revealed that the intensity damping was more marked in the high-frequency area (>1600 Hz) after the nasal decongestion. Moreover, the intensities of the spectral valleys damped more than the spectral peaks, especially the spectral valley of 1000-2700 Hz. Therefore, a more complex spectral pattern was formed by the resultant uneven damping effect after nasal decongestion. The nasal cavity plays an important role in the formation of spectral peaks and valleys, and such engraved voice spectra may also characterize nasal voices like the nasal CV [md:] demonstrated in our study. PMID:15766851

  4. Primary Nasal Reconstruction in Self-Inflicted Nasal Injury.

    Science.gov (United States)

    Kapadia, Abizer; John, Jerry R; Gaba, Sunil; Sharma, Ramesh Kumar

    2015-10-01

    Self-inflicted injury of the nose is extremely rare. It may be associated with severe psychopathology and suicidal ideation. The authors report a case of a 24-year-old man, who presented with soft-tissue loss over both the alae of his nose. He had cut off the alar rims with an ordinary razor blade. He was overtly concerned about his nose being excessively broad and fat. A diagnosis of body dysmorphic disorder with nonsuicidal self-injury was made. Patient was observed during 72 hours in hospital with psychiatric support and local dressings. The authors undertook primary nasal reconstruction with nasolabial flaps on both sides for coverage. In conclusion, self-inflicted nasal injury mandates a judicious balancing of psychiatric support and surgical reconstruction. This can prevent untoward sequelae including further self-harm and suicide. PMID:26468831

  5. The canine vomeronasal organ.

    OpenAIRE

    Adams, D. R.; Wiekamp, M D

    1984-01-01

    The vomeronasal organ was studied in mature dogs with the optical, transmission electron, and scanning electron microscopes. The canine vomeronasal complex is structurally well developed. Large blood vessels are present deep to both the lateral, 'non-receptor' and medial, 'receptor' epithelia. In addition to the unmyelinated vomeronasal nerves in the lamina propria deep to the 'receptor' epithelium, numerous nerves containing both myelinated and unmyelinated fibres are present deep to the 'no...

  6. Contrastive and contextual vowel nasalization in Ottawa

    Science.gov (United States)

    Klopfenstein, Marie

    2005-09-01

    Ottawa is a Central Algonquian language that possesses the recent innovation of contrastive vowel nasalization. Most phonetic studies done to date on contrastive vowel nasalization have investigated Indo-European languages; therefore, a study of Ottawa could prove to be a valuable addition to the literature. To this end, a percentage of nasalization (nasal airflow/oral + nasal airflow) was measured during target vowels produced by native Ottawa speakers using a Nasometer 6200-3. Nasalized vowels in the target word set were either contrastively or contextually nasalized: candidates for contextual nasalization were either regressive or perserverative in word-initial and word-final syllables. Subjects were asked to read words containing target vowels in a carrier sentence. Mean, minimum, and maximum nasalance were obtained for each target vowel across its full duration. Target vowels were compared across context (regressive or perseverative and word-initial or word-final). In addition, contexts were compared to determine whether a significant difference existed between contrastive and contextual nasalization. Results for Ottawa will be compared with results for vowels in similar contexts in other languages including Hindi, Breton, Bengali, and French.

  7. Computed tomographic features of canine nonparenchymal hemangiosarcoma.

    Science.gov (United States)

    Fukuda, Shoko; Kobayashi, Tetsuya; Robertson, Ian D; Oshima, Fukiko; Fukazawa, Eri; Nakano, Yuko; Ono, Shin; Thrall, Donald E

    2014-01-01

    The purpose of this retrospective study was to describe pre- and postcontrast computed tomographic (CT) characteristics of confirmed nonparenchymal hemangiosarcoma in a group of dogs. Medical records were searched during the period of July 2003 and October 2011 and dogs with histologically confirmed nonparenchymal hemangiosarcoma and pre- and postcontrast CT images were recruited. Two observers recorded a consensus opinion for the following CT characteristics for each dog: largest transverse tumor diameter, number of masses, general tumor shape, character of the tumor margin, precontrast appearance, presence of dystrophic calcification, presence of postcontrast enhancement, pattern of postcontrast enhancement, presence of regional lymphadenopathy, and presence of associated cavitary fluid. A total of 17 dogs met inclusion criteria. Tumors were located in the nasal cavity, muscle, mandible, mesentery, subcutaneous tissue, and retroperitoneal space. Computed tomographic features of nonparenchymal hemangiosarcoma were similar to those of other soft tissue sarcomas, with most tumors being heterogeneous in precontrast images, invasive into adjacent tissue, and heterogeneously contrast enhancing. One unexpected finding was the presence of intense foci of contrast enhancement in 13 of the 17 tumors (76%). This appearance, which is not typical of other soft tissue sarcomas, was consistent with contrast medium residing in vascular channels. Findings indicated that there were no unique distinguishing CT characteristics for nonparenchymal hemangiosarcoma in dogs; however, the presence of highly attenuating foci of contrast enhancement may warrant further investigation in prospective diagnostic sensitivity and treatment outcome studies. PMID:24382330

  8. Nasal airway responses to nasal continuous positive airway pressure breathing: An in-vivo pilot study.

    Science.gov (United States)

    White, David E; Bartley, Jim; Shakeel, Muhammad; Nates, Roy J; Hankin, Robin K S

    2016-06-14

    The nasal cycle, through variation in nasal airflow partitioning, allows the upper airway to accommodate the contrasting demands of air conditioning and removal of entrapped air contaminants. The purpose of this study was to investigate the influence of nasal continuous positive airway pressure (nCPAP) breathing has on both nasal airflow partitioning and nasal geometry. Using a custom-made nasal mask, twenty healthy participants had the airflow in each naris measured during normal nasal breathing followed by nCPAP breathing. Eight participants also underwent magnetic resonance imaging (MRI) of the nasal region during spontaneous nasal breathing, and then nCPAP breathing over a range of air pressures. During nCPAP breathing, a simultaneous reduction in airflow through the patent airway together with a corresponding increase in airway flow within the congested nasal airway were observed in sixteen of the twenty participants. Nasal airflow resistance is inversely proportional to airway cross-sectional area. MRI data analysis during nCPAP breathing confirmed airway cross-sectional area reduced along the patent airway while the congested airway experienced an increase in this parameter. During awake breathing, nCPAP disturbs the normal inter-nasal airflow partitioning. This could partially explain the adverse nasal drying symptoms frequently reported by many users of this therapy. PMID:27173595

  9. Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman

    2011-01-01

    Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.

  10. Clinical data and therapy of malignant non-Hodgkin's lymphoma of nasal cavity and paranasal sinuses

    International Nuclear Information System (INIS)

    From 1950 to 1979 276 malignant tumors of nasal cavity and paranasal sinuses were treated in the Clinic of Oto-Rhino-Laryngology of the University. 40 cases were diagnosed as malignant non-Hodgkin's lymphoma. Therefore, after the initial staging procedure, after the primary therapeutic irradiation and the following operation a polychemotherapy must be performed. The prognosis of immunocytic lymphomas is somewhat better, they generalize more seldom than highly malignant lymph node tumors. From the findings presented here the conclusion can be drawn that in the region of nasal cavity and paranasal sinuses the region of nasal cavity and paranasal sinuses the regional lymphatic spread of lymphomas is of little importance only. (orig./MG)

  11. Comparison of computed tomography with radiography as a noninvasive diagnostic technique for chronic nasal disease in dogs

    International Nuclear Information System (INIS)

    Computed tomography was evaluated as a noninvasive technique for the diagnosis of chronic nasal disease in dogs. Computed tomographic images, radiographs, and histopathologic findings were compared in 11 dogs with chronic nasal disease. Definitive diagnosis was made following traumatic nasal flush, exploratory surgery, or necropsy. The study included 8 dogs with intranasal tumors, 2 dogs with bacterial rhinitis (Pasteurella sp), and 1 dog with mycotic rhinitis (Aspergillus sp). Computed tomography was superior to radiography in defining the extent of the disease process and in differentiating infectious rhinitis from nasal neoplasms. It defined lesions in the palate, nasopharyngeal meatus, maxillary sinus, caudal ethmoturbinates, and periorbital tissues that were difficult to demonstrate by use of conventional radiography. Tumors appeared as space-occupying lesions that obliterated the turbinates, caused deviation of the nasal septum, and eroded bone. Rhinitis appeared as a cavitating lesion that spared the paranasal sinuses, thickened and distorted the turbinates, and widened the meatus. Although morphologically distinct on computed tomographic images, infectious rhinitis and nasal neoplasms could not be differentiated by attenuation measurements or degree of contrast enhancement. Computed tomography appeared to be a reliable, noninvasive technique for the diagnosis of chronic nasal disease in dogs, and a promising alternative to diagnostic techniques currently in use

  12. The Comparison Study of Retaining Laryngoscope Combined Nasal Endoscope Laryngoscope and Retaining Laryngoscope on Treating Laryngeal Benign Tumor%支撑喉镜联合喉内窥镜与支撑喉镜治疗喉部良性肿物的疗效对比研究

    Institute of Scientific and Technical Information of China (English)

    2013-01-01

      目的:探讨支撑喉镜联合喉内窥镜及支撑喉镜两者治疗喉部良性肿物的疗效。方法:选取本院2010年10月-2012年12月收治的喉部良性肿物患者160例,根据治疗方法不同,分为两组(对照组与试验组)。对照组70例采用支撑喉镜治疗;试验组90例采用支撑喉镜联合喉内窥镜治疗。结果:对照组治愈率57.1%(40/70),好转率25.7%(18/70),无效率17.1%(12/70),总有效率为82.9%;试验组治愈率76.7%(69/90),好转率17.8%(16/90),无效率5.6%(5/90),总有效率为94.4%。对照组与试验组的术后并发症发生率分别为22.9%与4.4%。结论:支撑喉镜联合喉内镜对喉部良性肿物治疗有效,具有微创、并发症少等优点,有较高临床价值。%Objective:To observe the efficacy of both retaining laryngoscope combined nasal endoscope laryngoscope and retaining laryngoscope treatment of benign tumor of the larynx.Method:Selected 160 cases of benign throat tumor patients in our hospital from October 2010 to December 2012, according to the different treatment methods,They were divided into two groups(control group and the experimental group),the control group were applied with retaining laryngoscope treatment(70 cases),the experimental group were applied with retaining laryngoscope combined nasal endoscope laryngoscope treatment(90 cases).Result:In the control group,the cure rate was 57.1%(40/70),the improvement rate was 25.7%(18/70), invalid for 17.1%(12/70),the total effective rate was 82.9%.In the experimental group,the cure rate was 76.7%(69/90),the improvement rate was 17.8%(16/90),invalid 5.6%(5/90),with a total effective rate was 94.4%.Postoperative complication of the control group and the experimental group was 22.9% and 4.4% respectively.Conclusion:The operation of retaining laryngoscope combined nasal endoscope laryngoscope has effective treatment for benign throat mass,with a minimally invasive

  13. Nasal leech infestation causing persistent epistaxis

    OpenAIRE

    Sarathi, Kalra

    2011-01-01

    Foreign bodies in the nasal cavity are commonly encountered as a cause of epistaxis; however, nasal leech infestation as a cause of unilateral persistent epistaxis is very rare. Examination of nasal cavity revealed fleshy material in the left nostril, which was identified as leech. The leech was removed with the help of an artery forceps following irrigation of the left nostril with normal saline and adopting wait-and-watch policy. In developing countries, leech infestation as a cause of epis...

  14. Comparative nasal effects of bradykinin and histamine: influence on nasal airways resistance and plasma protein exudation.

    OpenAIRE

    Rajakulasingam, K.; Polosa, R; Lau, L.C.; Church, M. K.; Holgate, S T; Howarth, P. H.

    1993-01-01

    BACKGROUND--Bradykinin may contribute to the pathogenesis of allergic rhinitis. Like histamine, nasal challenge with bradykinin induces rhinorrhoea, nasal blockage, and plasma protein leakage. Their comparative nasal potencies have not, however, been fully elucidated. METHODS--Three double blind, randomised, placebo controlled and cross-over studies were undertaken to compare objectively the nasal effects of bradykinin, histamine, and vehicle. RESULTS--Both bradykinin and histamine produced d...

  15. [Review: pathophysiology and methodology of nasal packing].

    Science.gov (United States)

    Beule, A G; Weber, R K; Kaftan, H; Hosemann, W

    2004-08-01

    Nasal packing is a frequent procedure to control spontaneous nasal bleeding or postoperative oozing following different types of nasal surgery. It strives for internal stabilization of the nasal framework and for optimizing wound healing by prevention of stenosis or synechia. A lot of different materials is used and there is no accepted standard concerning the type and application. A review on pathophysiology of the packed nose is given together with a survey on customary packing materials focussing on the specific merits, demerits and side-effects including economical aspects. PMID:15316896

  16. Nasal and Oral Consonant Similarity in Speech Errors: Exploring Parallels with Nasal Consonant Harmony

    Science.gov (United States)

    Walker, Rachel

    2007-01-01

    Previous research has found that "similar" sounds interact in phonological nasal consonant harmony, wherein certain consonants become nasals when the word contains a nasal (e.g., Kikongo: /-kun-idi/ [right arrow] [-kun-ini] "planted"). Across languages, stops and approximants are chiefly affected, especially voiced consonants and ones that match…

  17. Brazilian canine hepatozoonosis.

    Science.gov (United States)

    O'Dwyer, Lucia Helena

    2011-01-01

    The genus Hepatozoon includes hundreds of species that infect birds, reptiles, amphibians and mammals, in all continents with tropical and subtropical climates. Two species have been described in domestic dogs: H. canis, reported in Europe, Asia, Africa, South America and the United States; and H. americanum, which so far has only been diagnosed in the United States. In Brazil, the only species found infecting dogs is H. canis. The objective of this review was to detail some aspects of canine hepatozoonosis, caused by H. canis, and the main points of its biology, transmission, pathogenicity, symptoms, epidemiology and diagnostic methods, with emphasis on research developed in Brazil. PMID:21961746

  18. Preclinical evaluation of oncolytic vaccinia virus for therapy of canine soft tissue sarcoma.

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    Full Text Available Virotherapy using oncolytic vaccinia virus (VACV strains is one promising new strategy for canine cancer therapy. In this study we describe the establishment of an in vivo model of canine soft tissue sarcoma (CSTS using the new isolated cell line STSA-1 and the analysis of the virus-mediated oncolytic and immunological effects of two different Lister VACV LIVP1.1.1 and GLV-1h68 strains against CSTS. Cell culture data demonstrated that both tested VACV strains efficiently infected and destroyed cells of the canine soft tissue sarcoma line STSA-1. In addition, in our new canine sarcoma tumor xenograft mouse model, systemic administration of LIVP1.1.1 or GLV-1h68 viruses led to significant inhibition of tumor growth compared to control mice. Furthermore, LIVP1.1.1 mediated therapy resulted in almost complete tumor regression and resulted in long-term survival of sarcoma-bearing mice. The replication of the tested VACV strains in tumor tissues led to strong oncolytic effects accompanied by an intense intratumoral infiltration of host immune cells, mainly neutrophils. These findings suggest that the direct viral oncolysis of tumor cells and the virus-dependent activation of tumor-associated host immune cells could be crucial parts of anti-tumor mechanism in STSA-1 xenografts. In summary, the data showed that both tested vaccinia virus strains and especially LIVP1.1.1 have great potential for effective treatment of CSTS.

  19. Nasal-skin-fold transposition flap for upper lip reconstruction in a French bulldog.

    Science.gov (United States)

    Benlloch-Gonzalez, Manuel; Lafarge, Stéphanie; Bouvy, Bernard; Poncet, Cyrill

    2013-10-01

    Upper-lip reconstruction after mast-cell tumor-resection in a French bulldog was achieved by using a transposition flap from the nasal-skin-fold and an oral mucosal flap. The new technique is an alternative for reconstruction of extensive upper-lip defects in brachycephalic dogs and achieves satisfactory functional and cosmetic results. PMID:24155421

  20. Nasal-skin-fold transposition flap for upper lip reconstruction in a French bulldog

    OpenAIRE

    Benlloch-Gonzalez, Manuel; Lafarge, Stéphanie; Bouvy, Bernard; Poncet, Cyrill

    2013-01-01

    Upper-lip reconstruction after mast-cell tumor-resection in a French bulldog was achieved by using a transposition flap from the nasal-skin-fold and an oral mucosal flap. The new technique is an alternative for reconstruction of extensive upper-lip defects in brachycephalic dogs and achieves satisfactory functional and cosmetic results.

  1. Apoptosis and Ki-67 as predictive factors for response to radiation therapy in feline nasal lymphomas.

    Science.gov (United States)

    Fu, Dah-Renn; Kato, Daiki; Endo, Yoshifumi; Kadosawa, Tsuyoshi

    2016-08-01

    Nasal lymphoma is the most common nasal tumor in cats and is generally a solitary and radiosensitive tumor. We retrospectively evaluated the response to radiation and survival time in relation to apoptosis and Ki-67 indices in feline nasal lymphomas treated with radiation therapy. The apoptotic and Ki-67 indices were evaluated with TUNEL and immunohistochemical staining in 30 biopsy tissues that were taken before any treatment. These two indices were compared, and differences between different treatment response groups were analyzed. The correlation between the median survival times (MST) and the indices was estimated using the Kaplan Meier method, and statistical differences between survival curves were analyzed using a log-rank method. With regard to apoptotic index, a statistical difference was observed between the samples taken from cats with complete response and stable disease (1.22% vs. 0.45%; P=0.045). The Ki-67 index in cats with both complete response and partial response was significantly higher than in cats with stable disease (44.4% and 39.6% vs. 16.3%; P0.9%) nasal lymphoma were not significantly prolonged MSTs (P=0.202), however, high Ki-67-positive (>40%) cats experienced a statistically significant relationship with longer survival time (P=0.015). Our results indicate that spontaneous apoptotic and Ki-67 indices are strong predictors for response to radiation therapy in feline nasal lymphomas. PMID:27086717

  2. Fungal Agents as a Cause of Nasal Polyposis

    Directory of Open Access Journals (Sweden)

    Mohammad Nejadkazem

    2015-01-01

    Full Text Available Introduction: Sinonasal polyposis is the most common tumor of nasal cavity and sinuses. Its complications are but not limited to sinusitis, breathing difficulties, hyposmia, anosmia and bone erosion.Methods and materials: A total of 98 patients with sinonasal polyposis were examined for suspicious causative fungal agent.Results: Direct microscopy and culture confirmed fungal agent in 8 patients (8.1% from which 3 cases had Alternaria spp, 1 patient Aspergillus spp, 1 patient Bipolaris spp, and 3 patients yeast.Conclusion: Fungi may be considered as a potential cause of sinonasal polyposis. Keywords: Sinonasal Polyposis, Rhinosinusitis, Fungi

  3. Neurilemmoma of lateral nasal wall

    Directory of Open Access Journals (Sweden)

    Jyotsna Naresh Bharti

    2015-06-01

    Full Text Available Neurilemmoma is a benign tumour of nerve sheath origin that can arise from myelinated nerve. The Head and neck is the most frequent site involved and other sites are scalp, face, oral cavity, pharynx, larynx, trachea and ear. Neurilemmoma usually occur as solitary lesions and in association with NF type 2. Malignant transformation is very rare. We report a case of 18 year old male presented with complaint of nasal obstruction and swelling in right side of nose. We discuss the clinical presentation, histologic features, and therapeutic options for such a rare benign lesion.

  4. Clinical analysis of sino-nasal lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Kojya, Shizuo; Itokazu, Tetsuo; Shinhama, Akihiko; Matsumura, Jun; Maeda, Hiroyuki; Inamine, Tomohiro; Toita, Takafumi; Ogawa, Kazuhiko; Noda, Yutaka [Ryukyus Univ., Nishihara, Okinawa (Japan). Faculty of Medicine

    2000-01-01

    Forty cases with sino-nasal malignant lymphoma who were treated at the Department of Otorhinolaryngology, University of the Ryukyus, Faculty of Medicine from 1974 to 1996 are herein reviewed. The staging of these cases was made based on the Ann Arbor classification system and pathologically according to the Working Formulation (WF). In addition, the lesions showed polymorphism regarding the size of the tumor cells which could invade in an angiocentric pattern with various types of inflammatory cells and necrosis of the surrounding tissue was classified as polymorphic reticulosis (PR). Regarding the immunological phenotype, immunostaining was performed with MB-1, L-26 for B cell type and MT-1, UCHL-1 for T cell type. The survival rate was calculated based on the Kaplan Meier method. The results were as follows; The immunophenotypes were T cell type in 63%, including 8 cases of NK cell type and B cell in 29%. Seventy-five percent of all cases were classified as an intermediate stage based on the Working Formulation. The 5-year survival rates for all cases, consisting of T cell type cases, B cell type cases and PR type cases were 49%, 42%, 50% and 54%, respectively. Chemotherapy, including CHOP demonstrated good therapeutic results, but the cases with lymphoma in the high grade group could not be controlled by ordinary therapeutic regimens. A histology-specific treatment regimen for high grade lymphoma is thus needed. (author)

  5. Effect of the nasal cycle on congestive response during bilateral nasal allergen provocation

    Directory of Open Access Journals (Sweden)

    Tomasz Gotlib

    2014-06-01

    Full Text Available Background. Bilateral nasal allergen provocation usually produces more pronounced obstruction of one nasal passage. It was found that this could be related to the stage of the nasal cycle before the provocation. objective. To discover whether the stage of the nasal cycle is decisive for asymmetry in congestive response observed during bilateral allergen nasal provocation. methods. Two bilateral nasal allergen provocations were performed in a group of 26 pollen-sensitive volunteers. Acoustic rhinometry measurements were taken during the nasal cycle, and then after the provocation. A cross-sectional area at the level of the inferior turbinate (CSA-2 was measured. Consecutive challenges were performed in the opposite phase of the nasal cycle: the side which had been wide just before the first challenge, was narrow before the second provocation. results. Asymmetry in CSA-2 reduction between the nasal passages was observed in most cases. Significant difference was observed between mean CSA-2 reduction rate (reactivity of the side that responded with greater congestion, and the opposite side. No significant difference was found in mean CSA-2 reduction rate between the side which was narrow, and the side which was wide before provocation. conclusions. Asymmetry of congestive response during bilateral nasal allergen provocation is not dependent on the stage of the nasal cycle preceding the challenge.

  6. ANTHROPOMETRIC STUDY OF NASAL INDEX OF EGYPTIANS

    Directory of Open Access Journals (Sweden)

    Abdelmonem Awad Hegazy

    2014-12-01

    Full Text Available Background: The nasal index determination is one of the most commonly used anthropometric parameters in classifying human races. There are few reports in medical literature concerning nasal index that specifically address particular Egyptian populations. The objective of this study was to determine the normal parameters of external nose (width, height and nasal index in Egyptians. Methods: The study was conducted randomly on healthy Egyptian subjects of both sexes. Nasal height and width were measured using vernier caliper. Then, nasal index was determined for each subject. The obtained data were subjected to statistical analysis. Results: A total of 290 subjects, 144 males and 146 females, aged 1 month– 65 years, were enrolled in the study. The study showed the existence of sexual dimorphism in nasal morphology, appearing after the age 20 years. The mean nasal index in the investigated adults was 68.01; in males and females was 71.46 and 64.56, respectively. Conclusions: The dominant nasal type in Egyptians was in-between mesorrhine "medium" and leptorrhine "narrow" nose. Forensic and anthropological research, as well as cosmetic and reconstructive surgery may benefit from age- and sex- based data of the study.

  7. GdNCT of spontaneous canine melanoma

    International Nuclear Information System (INIS)

    The effectiveness of GdNCT has been studied in dogs with spontaneous melanoma of the mucousmembrane of the oral cavity patients on the NCT base at the IRT MEPhI reactor. The control group with melanomas was treated with neutrons. Fourteen canine patients were selected in the Clinic of Experimental Therapy affiliated with the RCRC RAMS. The calculation of doses has shown that the total dose of energy release depending on Gd concentration in the target can be several times higher than the dose produced by the reactor neutron beam. The calculations were carried out using the diffusion pharmacokinetic model. The gadolinium drug dipentast was administered intratumorally immediately prior to irradiation. The tumor size was estimated by measuring it in three projections. The tumor was irradiated for 60-90 minutes with a thermal neutron flux of 0.7x109 n/cm2s. The dose on tumor was 80-120 Gy, on surrounding tissues - 12-15 Gy. The treatment plan included immunotherapy with Roncoleikin in a dose of (15-10)x103 IE/kg. The results of GdNCT are still under observation. The results conform to those obtained by us earlier in cell cultures and inoculated experimental tumors. GdNCT is also effective in combination with immunotherapy. (author)

  8. Nasal mucociliary transport in laryngectomees

    International Nuclear Information System (INIS)

    A study has been carried out to assess the mucociliary function of nasal mucosa in 30 patients: 16 had undergone surgery due to larynx malignancy and the remaining 14 were divided in two groups. The first group was composed of seven patients suffering from larynx cancer but not operated, and the second group of seven had pathology not related to the airways (control group). The method used a sup(99m)technetium sulphur colloid drop deposited on the nasal mucosa of one nostril. To calculate the rate of transport, a new method of quantification has been introduced, based on the formation of a parametric image. The mean velocity in laryngectomees was 3.6 mm/min (range 1.1-6.4). It was compared with the group of 14 patients without tracheostomy (mean 5.3, range 3.3-8.2). An impaired student's-t-test gave a significant difference between both groups (P<0.005). The comparison between patients with nonoperated larynx cancer and normals have a nonsignificant difference. The 16 operated patients were arbitrarily divided into two groups as per the time elapsed from laryngectomy; seven were studied within the first 3 years of operation and seven other patients after this term. The comparison between them was not significant. (orig.)

  9. Nasal mucociliary transport in laryngectomees

    Energy Technology Data Exchange (ETDEWEB)

    Pavia, J.; Garcia, A.; Abello, R.; Herranz, R.; Franch, M.; Espana, R. de

    1986-04-01

    A study has been carried out to assess the mucociliary function of nasal mucosa in 30 patients: 16 had undergone surgery due to larynx malignancy and the remaining 14 were divided in two groups. The first group was composed of seven patients suffering from larynx cancer but not operated, and the second group of seven had pathology not related to the airways (control group). The method used a sup(99m)technetium sulphur colloid drop deposited on the nasal mucosa of one nostril. To calculate the rate of transport, a new method of quantification has been introduced, based on the formation of a parametric image. The mean velocity in laryngectomees was 3.6 mm/min (range 1.1-6.4). It was compared with the group of 14 patients without tracheostomy (mean 5.3, range 3.3-8.2). An impaired student's-t-test gave a significant difference between both groups. The comparison between patients with nonoperated larynx cancer and normals have a nonsignificant difference. The 16 operated patients were arbitrarily divided into two groups as per the time elapsed from laryngectomy; seven were studied within the first 3 years of operation and seven other patients after this term. The comparison between them was not significant.

  10. Nasal mucociliary clearance in coal mine workers

    Energy Technology Data Exchange (ETDEWEB)

    Cinar, F.; Beder, L. [Karaelmas University, Kozlu Zonguldak (Turkey)

    2004-06-01

    The purpose of this study was to analyze the effect of coal dust particles on nasal mucociliary function in coal mine workers. Using the saccharin method, nasal mucociliary clearance was determined for 77 subjects, of which 39 who worked in a coal mine were actively exposed to coal dust whereas 38 were unexposed control subjects. The measurements were performed in the coal mine, at the level of 170 m below sea level. The average saccharin nasal transit time in coal mine workers, 12.61 (SD: 4.30) minutes, is longer, than that of the control subjects, 10.97 (SD: 3.22). Although the findings of this study demonstrate that the coal particles affect the nasal mucociliary clearance, the difference in saccharin nasal transit time between the two groups (exposed vs unexposed) is not statistically significant (P = 0.063).

  11. Functional characterization of canine interferon-lambda.

    Science.gov (United States)

    Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun; Yang, Limin; Luo, Tingrong

    2014-11-01

    In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2'5'-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142

  12. Multi-drug resistance in a canine lymphoid cell line due to increased P-glycoprotein expression, a potential model for drug-resistant canine lymphoma

    NARCIS (Netherlands)

    Zandvliet, M; Teske, E; Schrickx, J A

    2014-01-01

    Canine lymphoma is routinely treated with a doxorubicin-based multidrug chemotherapy protocol, and although treatment is initially successful, tumor recurrence is common and associated with therapy resistance. Active efflux of chemotherapeutic agents by transporter proteins of the ATP-Binding Casset

  13. 9 CFR 113.305 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine.

    Science.gov (United States)

    2010-01-01

    ... STANDARD REQUIREMENTS Live Virus Vaccines § 113.305 Canine Hepatitis and Canine Adenovirus Type 2 Vaccine. Canine Hepatitis Vaccine and Canine Adenovirus Type 2 Vaccine shall be prepared from virus-bearing cell... hepatitis, the test is inconclusive and may be repeated. (B) If at least 19 of the 20 vaccinates do...

  14. Cancer of the nasal cavity and ethmoid/sphenoid sinuses

    International Nuclear Information System (INIS)

    During the period from October 1964 to September 1975, 32 patients were treated at the University of Florida for a variety of malignant tumors of the nasal cavity and ethmoid/sphenoid sinuses. All were treated with radical irradiation, 6091 to 7972 rad, in 6 to 9 weeks, cobalt-60. Pretreatment work-up revealed evidence of orbital invasion in 7 patients and involvement of the cranial contents, base of skull, or nasopharynx in an additional 15 patients. Local control was achieved in 95% of nasal cavity cases and 71% of ethmoid/sphenoid sinus cases at 2 years or more. The 5-year actuarial survival rate was 59%, and 5-year survival without evidence of disease as 50% (13/26). Patterns of extension in advanced lesions are clues to potential undetected extension in early cases which must be included in the treatment volume. Eye complications were minimal when it was possible to avoid treatment of the entire eye, but developed in all cases requiring treatment of the entire orbit. Acute and chronic complications involving the eye, ear, central nervous system, sinuses, and nose were reviewed and correlated with initial tumor extent, dose, and radiation treatement technique

  15. Mode-of-Action Uncertainty for Dual-Mode Carcinogens:Lower Bounds for Naphthalene-Induced Nasal Tumors in Rats Implied byPBPK and 2-Stage Stochastic Cancer Risk Models

    Energy Technology Data Exchange (ETDEWEB)

    Bogen, K T

    2007-01-30

    As reflected in the 2005 USEPA Guidelines for Cancer Risk Assessment, some chemical carcinogens may have a site-specific mode of action (MOA) that is dual, involving mutation in addition to cell-killing induced hyperplasia. Although genotoxicity may contribute to increased risk at all doses, the Guidelines imply that for dual MOA (DMOA) carcinogens, judgment be used to compare and assess results obtained using separate ''linear'' (genotoxic) vs. ''nonlinear'' (nongenotoxic) approaches to low-level risk extrapolation. However, the Guidelines allow the latter approach to be used only when evidence is sufficient to parameterize a biologically based model that reliably extrapolates risk to low levels of concern. The Guidelines thus effectively prevent MOA uncertainty from being characterized and addressed when data are insufficient to parameterize such a model, but otherwise clearly support a DMOA. A bounding factor approach--similar to that used in reference dose procedures for classic toxicity endpoints--can address MOA uncertainty in a way that avoids explicit modeling of low-dose risk as a function of administered or internal dose. Even when a ''nonlinear'' toxicokinetic model cannot be fully validated, implications of DMOA uncertainty on low-dose risk may be bounded with reasonable confidence when target tumor types happen to be extremely rare. This concept was illustrated for the rodent carcinogen naphthalene. Bioassay data, supplemental toxicokinetic data, and related physiologically based pharmacokinetic and 2-stage stochastic carcinogenesis modeling results all clearly indicate that naphthalene is a DMOA carcinogen. Plausibility bounds on rat-tumor-type specific DMOA-related uncertainty were obtained using a 2-stage model adapted to reflect the empirical link between genotoxic and cytotoxic effects of the most potent identified genotoxic naphthalene metabolites, 1,2- and 1,4-naphthoquinone. Resulting

  16. Carcinoma of the nasal vestibule treated with radiation therapy

    Energy Technology Data Exchange (ETDEWEB)

    Mendenhall, N.P.; Parsons, J.T.; Cassisi, N.J.; Million, R.R.

    1987-05-01

    Twenty-two patients with squamous carcinoma of the nasal vestibule were treated at the University of Florida Division of Radiation Therapy with curative intent. Fifteen lesions were de novo and seven recurrent after surgery. By AJCC classification, 7 lesions were Tx or T1, 2 were T2, 2 were T3, and 11 were T4. Management of the primary tumor and regional lymphatic drainage was highly individualized. Local control was achieved in 19 out of 22 lesions. The ultimate regional lymph node control rate was 22 out of 22, although two patients required radical neck dissection after development of lymph node disease in untreated regional lymphatics. Two patients have died of cancer and three of intercurrent disease. Cosmetic results are generally excellent but may be compromised by previous surgery in recurrent lesions or tumor destruction of normal tissues in advanced lesions. Complications of treatment are minimal.

  17. Carcinoma of the nasal vestibule treated with radiation therapy

    International Nuclear Information System (INIS)

    Twenty-two patients with squamous carcinoma of the nasal vestibule were treated at the University of Florida Division of Radiation Therapy with curative intent. Fifteen lesions were de novo and seven recurrent after surgery. By AJCC classification, 7 lesions were Tx or T1, 2 were T2, 2 were T3, and 11 were T4. Management of the primary tumor and regional lymphatic drainage was highly individualized. Local control was achieved in 19 out of 22 lesions. The ultimate regional lymph node control rate was 22 out of 22, although two patients required radical neck dissection after development of lymph node disease in untreated regional lymphatics. Two patients have died of cancer and three of intercurrent disease. Cosmetic results are generally excellent but may be compromised by previous surgery in recurrent lesions or tumor destruction of normal tissues in advanced lesions. Complications of treatment are minimal

  18. Nasal Septal Deviation and Facial Skeletal Asymmetries.

    Science.gov (United States)

    Hartman, Christopher; Holton, Nathan; Miller, Steven; Yokley, Todd; Marshall, Steven; Srinivasan, Sreedevi; Southard, Thomas

    2016-03-01

    During ontogeny, the nasal septum exerts a morphogenetic influence on the surrounding facial skeleton. While the influence of the septum is well established in long snouted animal models, its role in human facial growth is less clear. If the septum is a facial growth center in humans, we would predict that deviated septal growth would be associated with facial skeletal asymmetries. Using computed tomographic (CT) scans of n = 55 adult subjects, the purpose of this study was to test whether there is a correlation between septal deviation and facial asymmetries using three-dimensional (3D) geometric morphometric techniques. We calculated deviation as a percentage of septal volume relative to the volume of a modeled non-deviated septum. We then recorded skeletal landmarks representing the nasal, palatal, and lateral facial regions. Landmark data were superimposed using Procrustes analysis. First, we examined the correlation between nasal septal deviation and the overall magnitude of asymmetry. Next, we assessed whether there was a relationship between nasal septal deviation and more localized aspects of asymmetry using multivariate regression analysis. Our results indicate that while there was no correlation between septal deviation and the overall magnitude of asymmetry, septal deviation was associated with asymmetry primarily in the nasal floor and the palatal region. Septal deviation was unassociated with asymmetries in the lateral facial skeleton. Though we did not test the causal relationship between nasal septal deviation and facial asymmetry, our results suggest that the nasal septum may have an influence on patterns of adult facial form. PMID:26677010

  19. Sonographic evaluation of nasal bone fractures

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jung Eun; Lee, Sun Wha; Lee, Jung Kyoung; Chung, Sun Hee [College of Medicine, Ewha Womans University, Seoul (Korea, Republic of)

    2000-07-01

    To describe the sonographic findings of nasal bone fracture and evaluate the diagnostic value of sonography (US). Thirty-six patients with sustained nasal trauma underwent plain radiography, US and CT, and the CT findings were used as the gold standard. The sonographic findings were retrospectively reviewed and compared with those of radiography and CT. Twelve patients underwent follow-up US within 3 months of reduction. Sonographic findings of nasal bone fractures were irregularity (n=3D7), discontinuity (n=3D25) and displacement with discontinuity (n=3D28) of the thin smooth echogenic line formed by the ventral cortex of the nasal bone. Sixty-five nasal bone fractures (36 patients) were identified by CT, 60 of these were revealed on US but only 41 by plain radiographs. CT demonstrated unilateral involvement of nasal bone fractures in seven bones and bilateral involvement in 58, while US revealed unilateral involvement in 12 and bilateral involvement in 48. Plain radiographs, unilateral involvement in 21 bones and bilateral fractures in 20. Plain radiographs were more limited in detecting the location of nasal bone fractures than was US. On follow-up US in 12 patients, normal alignment without residual abnormality was observed in seven patients, residual cortical irregularities in four, and minimal cortical depression in one. The sonographic findings of nasal bone fractures were similar to those of CT in detecting the location and degree of depression or displacement of nasal bone fractures. We believe that US is very useful for the evaluation of such fractures, especially in cases in which plain radiographs reveal equivocal abnormality, or postreduction status is uncertain. (author)

  20. A Huge Adenomatoid Odontogenic Tumor of Maxilla

    OpenAIRE

    2012-01-01

    The adenomatoid odontogenic tumor (AOT) is a benign, nonneoplastic (hamartomatous) lesion with a slow progressing growth. It occurs in both intraosseous and peripheral forms. This paper reports the case of a female aged 16 years who presented with a swelling in anterior maxilla; canine was missing, and a supernumerary tooth was present in the mid line. Radiology revealed a well-defined radiolucent area associated with impacted canine and root resorption of adjacent teeth, which was diagnosed ...

  1. A role of ghrelin in canine mammary carcinoma cells proliferation, apoptosis and migration

    Directory of Open Access Journals (Sweden)

    Majchrzak Kinga

    2012-09-01

    Full Text Available Abstract Background Ghrelin is a natural ligand of the growth hormone secretagogue receptor (GHS-R. They are often co-expressed in multiple human tumors and related cancer cell lines what can indicate that the ghrelin/GHS-R axis may have an important role in tumor growth and progression. However, a role of ghrelin in canine tumors remains unknown. Thus, the aim of our study was two-fold: (1 to assess expression of ghrelin and its receptor in canine mammary cancer and (2 to examine the effect of ghrelin on carcinoma cells proliferation, apoptosis, migration and invasion. The expression of ghrelin and its receptor in canine mammary cancer tissues and cell lines (isolated from primary tumors and their metastases was examined using Real-time qPCR and immunohistochemistry. For apoptosis analysis the Annexin V and propidium iodide dual staining was applied whereas cell proliferation was evaluated by MTT assay and BrdU incorporation test. The influence of ghrelin on cancer cells migration and invasion was assessed using Boyden chamber assays and wound healing assay. Results The highest expression of ghrelin was observed in metastatic cancers whereas the lowest expression of ghrelin receptor was detected in tumors of the 3rd grade of malignancy. Higher expression of ghrelin and its receptor was detected in cancer cell lines isolated from metastases than in cell lines isolated from primary tumors. In vitro experiments demonstrated that exposure to low doses of ghrelin stimulates cellular proliferation, inhibits apoptosis and promotes motility and invasion of canine mammary cancer cells. Growth hormone secretagogue receptor inhibitor ([D-Lys3]-GHRP6 as well as RNA interference enhances early apoptosis. Conclusion The presence of ghrelin and GHS-R in all of the examined canine mammary tumors may indicate their biological role in cancer growth and development. Our experiments conducted in vitro confirmed that ghrelin promotes cancer development and

  2. Nasal Bone Osteotomies with Nonpowered Tools.

    Science.gov (United States)

    Gruber, Ronald P; Garza, Rebecca M; Cho, Gerald J

    2016-01-01

    Controlling the shape of the nasal bones has long been a frustrating problem. Conventional osteotomies are associated with bleeding, loss of reduction, inability to achieve the desired alignment, improperly placed osteotomy sites, and spicule formation. A nonpowered osteotomy method empirically provided the safest and most controlled technique to achieve the desired anatomic result. The nasal bones should be thought of as 2 thin nasal plates that can be released from their medial and lateral attachments to become mobile units that can affect the dorsal width and bony base independently. There is a learning curve to osteotomies. PMID:26616696

  3. Scrotal tumors in dogs: a retrospective study of 676 cases (1986-2010).

    Science.gov (United States)

    Trappler, Michelle C; Popovitch, Cathy A; Goldschmidt, Michael H; Goldschmidt, Kyle H; Risbon, Rebecca E

    2014-01-01

    The objective of this study was to determine common tumor types that occur on the canine scrotum in relation to other cutaneous locations and to identify potential risk factors for specific scrotal tumor development. A retrospective study was conducted and the database of pathology reports from the Surgical Pathology Service of the Department of Pathology and Toxicology, School of Veterinary Medicine, University of Pennsylvania from 1986 to 2010 was searched for canine neoplastic scrotal and non-scrotal cutaneous lesions. Neoplastic lesions were evaluated based on diagnosis, breed, age, and number and location of tumors (scrotal versus non-scrotal cutaneous). Mast cell tumor, melanocytoma, malignant melanoma, vascular hamartoma, hemangiosarcoma, hemangioma, and cutaneous histiocytoma were the most common tumor types identified on the canine scrotum. Breed predispositions and mean age at diagnosis were identified for each tumor type and should be considered when planning surgical excision of a canine scrotal tumor. PMID:24381341

  4. Scrotal tumors in dogs: A retrospective study of 676 cases (1986–2010)

    Science.gov (United States)

    Trappler, Michelle C.; Popovitch, Cathy A.; Goldschmidt, Michael H.; Goldschmidt, Kyle H.; Risbon, Rebecca E.

    2014-01-01

    The objective of this study was to determine common tumor types that occur on the canine scrotum in relation to other cutaneous locations and to identify potential risk factors for specific scrotal tumor development. A retrospective study was conducted and the database of pathology reports from the Surgical Pathology Service of the Department of Pathology and Toxicology, School of Veterinary Medicine, University of Pennsylvania from 1986 to 2010 was searched for canine neoplastic scrotal and non-scrotal cutaneous lesions. Neoplastic lesions were evaluated based on diagnosis, breed, age, and number and location of tumors (scrotal versus non-scrotal cutaneous). Mast cell tumor, melanocytoma, malignant melanoma, vascular hamartoma, hemangiosarcoma, hemangioma, and cutaneous histiocytoma were the most common tumor types identified on the canine scrotum. Breed predispositions and mean age at diagnosis were identified for each tumor type and should be considered when planning surgical excision of a canine scrotal tumor. PMID:24381341

  5. Doxorubicin and deracoxib adjuvant therapy for canine splenic hemangiosarcoma: a pilot study.

    Science.gov (United States)

    Kahn, S Anthony; Mullin, Christine M; de Lorimier, Louis-Philippe; Burgess, Kristine E; Risbon, Rebecca E; Fred, Rogers M; Drobatz, Kenneth; Clifford, Craig A

    2013-03-01

    Canine hemangiosarcoma (HSA) is a highly malignant tumor for which standard chemotherapy has done little to substantially improve survival. Cyclooxygenase-2 (Cox-2) plays a role in the formation, growth, and metastasis of tumors and inhibitors have demonstrated therapeutic benefit with certain canine cancers. In this prospective study, 21 dogs received adjuvant therapy combining the selective Cox-2 inhibitor deracoxib with doxorubicin, following splenectomy for HSA. The combination was well-tolerated with only low-grade gastrointestinal and hematologic toxicities noted. An overall median survival of 150 days (range; 21 to 1506 days) was noted. Although there was no significant difference in survival based upon stage of disease, dogs with stage III HSA (n = 11) had a median survival of 149 days, which appears to be longer than previously reported. Further studies are warranted to evaluate the potential benefit of Cox-2 inhibitors in the treatment of canine HSA. PMID:23997259

  6. Aplicaciones del colgajo frontonasal para la cobertura de defectos nasales

    Directory of Open Access Journals (Sweden)

    M. Pérez

    2015-12-01

    Full Text Available Presentamos una revisión retrospectiva de los pacientes a los cuales se realizó un colgajo frontonasal para la cobertura de defectos nasales intervenidos en la Unidad de Tumores Cutáneos de nuestro Servicio en el periodo comprendido entre enero de 2010 y mayo de 2014. El objetivo es analizar nuestras aplicaciones y resultados además de describir un algoritmo que permita indicar los distintos diseños en función de la localización y el tamaño del defecto a reparar. Empleamos el colgajo frontonasal en 78 pacientes (49 mujeres y 29 varones con un rango de edad de 47 a 92 años (media de 73 años. Creamos un total de 81 defectos, puesto que en 3 casos se resecaron simultáneamente 2 tumoraciones, todos de etiología tumoral (64 carcinomas basocelulares, 16 carcinomas espinocelulares y 1 caso de léntigo maligno melanoma, localizados en el área nasal, con un tamaño mínimo de 12 x 17 mm y máximo de 30 x 35 mm (media de 22 x 25 mm. El periodo de seguimiento fue de entre 2 meses y 4 años (media de 2,5 años. Respecto a las complicaciones observadas, todas ellas menores, hubo 6 casos de necrosis marginal, 8 de dehiscencia parcial de la herida y 1 de cicatrización hipertrófica, tratándose en su mayor parte de varones fumadores. Todos los colgajos sobrevivieron con resultado estético satisfactorio. El colgajo frontonasal permite la cobertura en un sólo tiempo quirúrgico de defectos nasales independientemente de su localización, de hasta 30 x 35 mm en nuestra serie. Se trata de un colgajo seguro y versátil en sus múltiples modificaciones, con unos resultados estéticos satisfactorios. Estas ventajas son de especial importancia en pacientes de edad avanzada como alternativa a técnicas más complejas. Se trata por lo tanto, a nuestro juicio, de una opción a tener en cuenta para la reconstrucción en un único tiempo quirúrgico de defectos nasales.

  7. Model demonstrates functional purpose of the nasal cycle

    OpenAIRE

    White, David E.; Bartley, Jim; Nates, Roy J

    2015-01-01

    Background Despite the occurrence of the nasal cycle being well documented, the functional purpose of this phenomenon is not well understood. This investigation seeks to better understand the physiological objective of the nasal cycle in terms of airway health through the use of a computational nasal air-conditioning model. Method A new state-variable heat and water mass transfer model is developed to predict airway surface liquid (ASL) hydration status within each nasal airway. Nasal geometr...

  8. Plastinated nasal model: a new concept of anatomically realistic cast.

    OpenAIRE

    Durand, Marc; Pourchez, Jérémie; Louis, Bruno; Pouget, Jean-François; Isabey, Daniel; Coste, André; Prades, Jean-Michel; Rusch, Philippe; Cottier, Michèle

    2011-01-01

    BACKGROUND: For many years, researchers have been interested in investigating airflow and aerosol deposition in the nasal cavities. The nasal airways appear to be a complex geometrical system. Thus, in vitro experimental studies are frequently conducted with a more or less biomimetic nasal replica. AIM: This study is devoted to the development of an anatomically realistic nose model with bilateral nasal cavities, i.e. nasal anatomy, airway geometry and aerodynamic properties as close as possi...

  9. A case of obstructive sleep apnea syndrome caused by malignant melanoma in the nasal cavity and paranasal sinus

    Directory of Open Access Journals (Sweden)

    Nobuhiro Asai

    2013-01-01

    Full Text Available A 71 year-old obese woman complained of obstructive sleep apnea syndrome (OSAS related symptoms. The apnea-hypopnea index (AHI was 73.5/hour. She presented with nasal bleeding to an ENT doctor. A mass on the nasal septum was seen and biopsy was performed. Histological confirmation showed malignant melanoma. The tumor stage proved to be cT4aN2M1 (stage IV due to multiple metastatic lesions. After palliative irradiation, the nasal tumor was reduced in size and her symptoms of OSAS were improved. The second AHI revealed 13.5/hour. This case was considered to be OSAS caused by a tumor obstructing the nasal cavity. This might suggest the necessity of routine work-up of the upper airway in cases of patients with sleep disorder. Otherwise, OSAS caused by such obstruction might be missed. We report a very rare case with secondary OSAS caused by malignant melanoma in the nasal cavity and paranasal sinus.

  10. NASAL cytology: practical aspects and clinical relevance.

    Science.gov (United States)

    Gelardi, M; Iannuzzi, L; Quaranta, N; Landi, M; Passalacqua, G

    2016-06-01

    Nasal cytology is a simple and safe diagnostic procedure that allows to assess the normal and pathological aspects of the nasal mucosa, by identifying and counting the cell types and their morphology. It can be easily performed by a nasal scraping followed by May-Grunwald-Giemsa staining and optical microscopy reading. This procedure allows to identify the normal cells (ciliated and mucinous), the inflammatory cells (lymphocytes, neutrophils, eosinophils, mast cells), bacteria, or fungal hyphae/spores. Apart from the normal cell population, some specific cytological patterns can be of help in discriminating among various diseases. Viral infections, allergic rhinitis, vasomotor rhinitis and overlapping forms can be easily identified. According to the predominant cell type, various entities can be defined (named as NARES, NARESMA, NARMA). This implies a more detailed knowledge and assessment of the disease that can integrate the standard diagnostic procedures. Nasal cytology also represents a useful research tool for diagnosis and therapy. PMID:27009397

  11. Malignant melanoma of the nasal cavity: a case report with examination of KIT and platelet derived growth factor receptor-α (PDGFRA

    Directory of Open Access Journals (Sweden)

    Tadashi Terada

    2011-10-01

    Full Text Available Although several clinicopathological studies of malignant melanoma of the nasal cavity have been reported, there are no studies of the expression and gene mutation of KIT and platelet derived growth factor receptor-α (PDGFRA in melanoma of the nasal cavity. A 92-year-old Japanese woman consulted to our hospital because of right nasal obstruction and epistaxis. Physical examination and imaging modalities showed a tumor of the right nasal cavity. A biopsy was taken, and it showed malignant epithelioid cells with melanin deposition. Immunohistochemically, the tumor was positive for S100 protein, HMB45, p53, Ki-67 (labeling=20%, KIT and PDGFRA. The tumor was negative for cytokeratins (AE1/3 and CAM5.2. A genetic analysis using PCR-direct sequencing revealed no mutation of KIT gene (exons 9, 11, 13, and 17 or the PDGFRA gene (exons 12 and 18. The pathological diagnosis was primary malignant melanoma of the nasal cavity. The tumor was reduced in size by local resection and chemotherapy (Darthmose regimen: dacarbazine, carmustine, cisplatine, and tamoxifen, and the patient is now alive and free from metastasis 9 months after the first manifestation. In conclusion, the author reported a case of melanoma of the nasal cavity expressing KIT and PDGFRA without gene mutations of KIT and PDGFRA.

  12. Discriminating between Nasal and Mouth Breathing

    OpenAIRE

    Curran, Kevin; Yuan, Peng; Coyle, Damian

    2010-01-01

    The recommendation to change breathing patterns from the mouth to the nose can have a significantly positive impact upon the general well being of the individual. We classify nasal and mouth breathing by using an acoustic sensor and intelligent signal processing techniques. The overall purpose is to investigate the possibility of identifying the differences in patterns between nasal and mouth breathing in order to integrate this information into a decision support system which will form the b...

  13. The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.

    Science.gov (United States)

    Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki

    2015-04-17

    Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. PMID:25680810

  14. Anti-influenza neuraminidase inhibitor oseltamivir phosphate induces canine mammary cancer cell aggressiveness.

    Science.gov (United States)

    de Oliveira, Joana T; Santos, Ana L; Gomes, Catarina; Barros, Rita; Ribeiro, Cláudia; Mendes, Nuno; de Matos, Augusto J; Vasconcelos, M Helena; Oliveira, Maria José; Reis, Celso A; Gärtner, Fátima

    2015-01-01

    Oseltamivir phosphate is a widely used anti-influenza sialidase inhibitor. Sialylation, governed by sialyltransferases and sialidases, is strongly implicated in the oncogenesis and progression of breast cancer. In this study we evaluated the biological behavior of canine mammary tumor cells upon oseltamivir phosphate treatment (a sialidase inhibitor) in vitro and in vivo. Our in vitro results showed that oseltamivir phosphate impairs sialidase activity leading to increased sialylation in CMA07 and CMT-U27 canine mammary cancer cells. Surprisingly, oseltamivir phosphate stimulated, CMT-U27 cell migration and invasion capacity in vitro, in a dose-dependent manner. CMT-U27 tumors xenograft of oseltamivir phosphate-treated nude mice showed increased sialylation, namely α2,6 terminal structures and SLe(x) expression. Remarkably, a trend towards increased lung metastases was observed in oseltamivir phosphate-treated nude mice. Taken together, our findings revealed that oseltamivir impairs canine mammary cancer cell sialidase activity, altering the sialylation pattern of canine mammary tumors, and leading, surprisingly, to in vitro and in vivo increased mammary tumor aggressiveness. PMID:25850034

  15. Anti-influenza neuraminidase inhibitor oseltamivir phosphate induces canine mammary cancer cell aggressiveness.

    Directory of Open Access Journals (Sweden)

    Joana T de Oliveira

    Full Text Available Oseltamivir phosphate is a widely used anti-influenza sialidase inhibitor. Sialylation, governed by sialyltransferases and sialidases, is strongly implicated in the oncogenesis and progression of breast cancer. In this study we evaluated the biological behavior of canine mammary tumor cells upon oseltamivir phosphate treatment (a sialidase inhibitor in vitro and in vivo. Our in vitro results showed that oseltamivir phosphate impairs sialidase activity leading to increased sialylation in CMA07 and CMT-U27 canine mammary cancer cells. Surprisingly, oseltamivir phosphate stimulated, CMT-U27 cell migration and invasion capacity in vitro, in a dose-dependent manner. CMT-U27 tumors xenograft of oseltamivir phosphate-treated nude mice showed increased sialylation, namely α2,6 terminal structures and SLe(x expression. Remarkably, a trend towards increased lung metastases was observed in oseltamivir phosphate-treated nude mice. Taken together, our findings revealed that oseltamivir impairs canine mammary cancer cell sialidase activity, altering the sialylation pattern of canine mammary tumors, and leading, surprisingly, to in vitro and in vivo increased mammary tumor aggressiveness.

  16. Malignant melanoma of nasal fossae, a propos of a case

    Directory of Open Access Journals (Sweden)

    Gómez-González JL

    2012-07-01

    Full Text Available Introduction: The melanoma of the nasal fossae represents a 4% of all sinonasal malignant tumors. The symptoms are unspecific, thus delaying diagnosis. We present a case of a woman of 80 years of age. She has hypertension and a degenerative heart disease, and presents nasal respiratory insufficiency, left otalgia and epistaxis of 8 months of evolution. Examination revealed a dark, polypoidal, fleshy mass. The CT revealed a mass that occupied that space, without bone erosion. A biopsy of the mass revealed that it was an amelanotic melanoma. Due to the age of the patient and her general pathology, endoscopic sinonasal surgery was applied. The pathological anatomic analysis confirmed that it was a malignant round cell melanoma with the following phenotype: positive for Vimentin, positive for nuclear S-100, focal positive for HMB-45, negative, melan A+ negative for HMB-45 with heterogeneous intensity, and negative for ENE and ALC. The patient did not present symptoms until a year later, when she discovered a small laterocervical adenopathy. A FNAP confirmed that the melanoma had metastatized. The patient underwent a radical neck dissection and remained 15 months without symptoms. She is currently going through monthly revisions. Discussion: The treatment of choice is surgery. Selective neck dissection is not justified. This tumor is radioresistant. Active immunotherapy (a combination of Interferon and Cimetidine and targeted chemotherapy have also been used, mainly in inoperable cases. Five-year survival ranges between 6.5% and 34%.Conclusion: We propose endoscopic surgery for non-infiltrating tumors or for patients who cannot undergo very aggressive surgery due to their general condition.

  17. Nasal continuous positive airway pressure

    DEFF Research Database (Denmark)

    Scholze, Alexandra; Lamwers, Stephanie; Tepel, Martin; Sanner, Bernd M

    2012-01-01

    Obstructive sleep apnoea (OSA) is linked to increased cardiovascular risk. This risk can be reduced by nasal continuous positive airway pressure (nCPAP) treatment. As OSA is associated with an increase of several vasoconstrictive factors, we investigated whether nCPAP influences the digital volume...... automated analysis. In patients with OSA and an apnoea/hypopnoea index (AHI) of >10 events · h(-1), a significant vasoconstriction was observed during the night (p<0.0001 by Friedman's test). A significant positive correlation existed between vasoconstriction and AHI (Spearman correlation, r = 0.27; p<0.......01; n = 94) and the arousal index (Spearman correlation, r = 0.21; p < 0.05; n = 94). After 6 months of nCPAP treatment, the AHI was significantly reduced from 27 ± 3 events · h(-1) to 4 ± 2 events · h(-1) (each n = 29; p<0.001) and vasoconstriction during the night was significantly reduced from 10 ± 3...

  18. Tarantula cubensis extract alters the degree of apoptosis and mitosis in canine mammary adenocarcinomas.

    Science.gov (United States)

    Gultiken, Nilgun; Guvenc, Tolga; Kaya, Duygu; Agaoglu, Ali Reha; Ay, Serhan Serhat; Kucukaslan, Ibrahim; Emre, Birten; Findik, Murat; Schäfer-Somi, Sabine; Aslan, Selim

    2015-01-01

    In the present study, 13 clinical cases of canine mammary adenocarcinoma were evaluated in order to understand the effect of Tarantula cubensis extract (TCE) on tumor tissue. Punch biopsies were taken from the tumors before treatment with TCE. Subcutaneous injections of TCE were administered three times at weekly intervals (3 mL per dog). Between days 7 and 10 after the third injection, the tumor masses were extirpated by complete unilateral mastectomy. Pre- and post-treatment tumor tissues were immunohistochemically assessed. The expression of B-cell lymphoma 2 (Bcl-2) was found to be higher in pre-treatment compared to post-treatment tissues (p 0.05). The apoptotic index was determined to be low before treatment and increased during treatment. These results suggest that TCE may be effective for controlling the local growth of canine mammary adenocarcinoma by regulating apoptosis. PMID:25549212

  19. Nasal meatus plasty: a contribution to plastic reconstruction of the nasal valve during midfacial degloving

    Directory of Open Access Journals (Sweden)

    Lorenz, Kai J.

    2014-05-01

    Full Text Available Midfacial degloving is a proven method for easily accessing the midface, the nasal pyramid, the maxillary and ethmoidal sinuses, the orbits, as well as the anterior skull base. Indications for this method of access mainly include tumour resections in the area of the midface, the septum, the maxillary sinus, the paranasal to the sphenoidal sinus as well as the clivus. In addition, this method of access allows for the exposure of the bony structures of the midface in the event of extensive fractures.In general, this method of access combines an incision in the oral vestibule and circular incisions in the nasal vestibule area in order to release the nasal pyramid.After removing the facial wall of the maxillary sinus, extensive exposure of the surgical site is possible.One disadvantage of this method of access is the difficult reconstruction of the nasal valve area, which often leads to cicatricial stenoses and difficulties with breathing through the nose. Furthermore, wound healing problems and osteoradionecrosis in the area of the lateral margin of the anterior nasal aperture after replantation of the facial wall of the maxillary sinus have been described, because in this area sufficient soft tissue coverage cannot be ensured when a conventional technique is used.We describe a soft tissue flap pedicled in the cranial and caudal directions in the nasal valve area which makes both the reconstruction of the nasal vestibule and sufficient soft tissue coverage of the anterior nasal aperture possible.

  20. Nasal endotracheal intubation in a premature infant with a nasal encephalocele.

    OpenAIRE

    Bannister, C M; Kashab, M; Dagestani, H; Placzek, M

    1993-01-01

    After a difficult nasal intubation a premature infant leaked cerebrospinal fluid (CSF) from one nostril. After developing bacterial meningitis, the baby was referred for neurosurgical management of the CSF fistula. Transaxial computed tomograms demonstrated a nasal encephalocele, but coronal scans were needed to show the defect in the cribriform plate.

  1. Numerical study of the effect of the nasal cycle on unilateral nasal resistance.

    Science.gov (United States)

    Jo, Gyehwan; Chung, Seung-Kyu; Na, Yang

    2015-12-01

    We used computational fluid dynamics to study the effects of the nasal cycle on the modification of unilateral nasal resistance using nasal cavity models from 2 different patients with chronic rhinosinusitis. A steady airflow field with an inspiratory flow rate of 250 mL/s was simulated using ANSYS-FLUENT v14.5. The distribution of local unilateral nasal resistance showed different shapes of variation and magnitudes of resistance depending on the distribution of cross-sectional area in the nasal cavity models. The highest local resistance on the congested side was found near the nasal valve area in the first patient, whereas the highest value was found in the nasal vestibule for the second patient. The relative importance of nasal resistance in the turbinated air passage differed for the 2 patients. The unilateral resistance of the congested state was in the range of 0.0229-0.221 Pas/mL. In the inferior meatus, greater flow rate was allowed during the congested state than during the decongested state if an extensive backflow developed. PMID:26315663

  2. Nasal meatus plasty: a contribution to plastic reconstruction of the nasal valve during midfacial degloving.

    Science.gov (United States)

    Lorenz, Kai J; Maier, Heinz; Wilde, Frank

    2014-01-01

    Midfacial degloving is a proven method for easily accessing the midface, the nasal pyramid, the maxillary and ethmoidal sinuses, the orbits, as well as the anterior skull base. Indications for this method of access mainly include tumour resections in the area of the midface, the septum, the maxillary sinus, the paranasal to the sphenoidal sinus as well as the clivus. In addition, this method of access allows for the exposure of the bony structures of the midface in the event of extensive fractures. In general, this method of access combines an incision in the oral vestibule and circular incisions in the nasal vestibule area in order to release the nasal pyramid. After removing the facial wall of the maxillary sinus, extensive exposure of the surgical site is possible. One disadvantage of this method of access is the difficult reconstruction of the nasal valve area, which often leads to cicatricial stenoses and difficulties with breathing through the nose. Furthermore, wound healing problems and osteoradionecrosis in the area of the lateral margin of the anterior nasal aperture after replantation of the facial wall of the maxillary sinus have been described, because in this area sufficient soft tissue coverage cannot be ensured when a conventional technique is used. We describe a soft tissue flap pedicled in the cranial and caudal directions in the nasal valve area which makes both the reconstruction of the nasal vestibule and sufficient soft tissue coverage of the anterior nasal aperture possible. PMID:26504717

  3. Effects of nasal allergen challenge on dynamic viscoelasticity of nasal mucus.

    Science.gov (United States)

    Hattori, M; Majima, Y; Ukai, K; Sakakura, Y

    1993-04-01

    The effects of nasal provocation on the rheologic properties of nasal mucus were investigated in patients with allergic rhinitis provoked by house dust. The elastic modulus (G') and the dynamic viscosity (eta') of nasal mucus were determined by an oscillating sphere magnetic rheometer. Before and after the allergen challenge, G' increased, whereas eta' decreased with increasing oscillatory frequency; these findings indicate that the nasal mucus under these conditions is a non-newtonian fluid and has the cross-linked gel-like nature typical of mucus. Both G' and eta' values after nasal provocation were significantly lower than before. The values of G' and eta' after allergen challenge were in the optimal viscoelasticity range for mucociliary transport. PMID:8476173

  4. Gene Expression Profiles of Sporadic Canine Hemangiosarcoma Are Uniquely Associated with Breed

    OpenAIRE

    Tamburini, Beth A; Trapp, Susan; Phang, Tzu Lip; Schappa, Jill T.; HUNTER, LAWRENCE E.; Modiano, Jaime F.

    2009-01-01

    The role an individual's genetic background plays on phenotype and biological behavior of sporadic tumors remains incompletely understood. We showed previously that lymphomas from Golden Retrievers harbor defined, recurrent chromosomal aberrations that occur less frequently in lymphomas from other dog breeds, suggesting spontaneous canine tumors provide suitable models to define how heritable traits influence cancer genotypes. Here, we report a complementary approach using gene expression pro...

  5. Ultra-estrutura dos mastócitos de diferentes tipos histológicos de mastocitoma em cães Mast cell ultrastructure in different types of canine mast cell tumor

    Directory of Open Access Journals (Sweden)

    F.A.R. Sueiro

    2002-06-01

    Full Text Available Este trabalho teve por objetivo estudar as diferenças ultraestruturais de mastócitos neoplásicos de diferentes tipos histológicos de mastocitoma em cães, usando microscopia eletrônica de transmissão Os resultados mostraram que o núcleo e os grânulos citoplasmáticos são as estruturas mais indicadas para se avaliar o grau de anaplasia celular e o estádio de indiferenciação do tumor.The objective of this work was study the ultrastructural differences among the different histologic types of mast cell tumors in dogs collected in vivo. The ultrastructural analyses showed that the nuclei and cytoplasmic granules characteristics are the best structures to be appointed on evaluating the undifferentiation stage of this tumor.

  6. Clinical aspects of patients with nasal polyposis

    Directory of Open Access Journals (Sweden)

    Crespo, Cassio Caldini

    2009-09-01

    Full Text Available Introduction: The nasal Polyposis is a non-neoplastic chronic inflammatory process of the nasal mucosa. It causes a large impact to the patients' life quality. Objective: To analyze the characteristics of patients with polyposis in the Brazilian population. Method: 50 records of patients followed up in a tertiary hospital and submitted to surgical treatment of nasal polyposis were reviewed. The following variables were analyzed: age, sex, smoking, presence of asthma, presence of AAS intolerance and also the clinical manifestations: anterior and posterior rhinorrhea, nasal obstruction, hyposmia, sneezing and pruritus. The tomographic evaluation system applied was that of Lund-McKay. For statistical analysis we applied the chi-square test with p<0.05. Results: Out of 50 patients evaluated, 28 were male and 22 were female. The mean age range was of 40.8 years. The main clinical manifestation was nasal obstruction in 100% of the patients. In the tomographic evaluation, according to the Lund-McKay system, the average scoring was of 10.9. Discussion: No statistically significant difference was obtained in the patients' general symptoms compared to the patients with asthma or AAS intolerance. The difference in the Lund-McKay score was statistically significant in the populations studied. The symptoms were similar to the frequency of symptoms of other works. Conclusion: We concluded that the main complaint of the patients with nasal polyposis is nasal obstruction, the most affected age is of about 40 years old, without preference of sex. The severity of tomographic findings is higher in patients with asthma and AAS intolerance.

  7. Rhinoescleroma and nasal syphilis cases treated with radiotherapy (1935)

    International Nuclear Information System (INIS)

    A review is presented of patient with rhinoescleroma, corresponding to the first years of operation of the then National Institute of Radium. It is a 35 year-old patient, the current illness it began before three years with a frequent nasal cold and difficulty of the step of the air until arriving to the total obstruction; additionally, a mass appears inside the nose, with painful ulceration that extends, first to the lip, to the hard palate and the place of installation of the teeth, and then to the part previous of the palatine vault, with fall of the teeth and communication with the skin. The patient also refers loss of the audition of the left side. The tumor to the physical exam measures 6 centimeters of diameter and of height, and there is extension with ulceration of the vestibular area. The rhinoscopy shows obstruction with ulceration and purulent secretion. The x-rays of July 9 1935 show partial destruction of the maxillary superiors that includes the alveolar edges, the palatine apophysis and the nasal spine. In the clinical history, it reports two biopsies; the biopsy of the nose concludes that it is a rhinoescleroma with atypical epithelioma and the biopsy gingival says that it is an incipient epithelioma spine-cellular

  8. Pituitary Tumors

    Science.gov (United States)

    ... Tumors Oligoastrocytoma Oligodendroglioma Pineal Tumor Pituitary Tumor PNET Schwannoma Risk Factors Brain Tumor Facts Brain Tumor Dictionary ... Tumors Oligoastrocytoma Oligodendroglioma Pineal Tumor Pituitary Tumor PNET Schwannoma Risk Factors Brain Tumor Facts Brain Tumor Dictionary ...

  9. Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in canine mammary gland cancer

    Directory of Open Access Journals (Sweden)

    Patrão Diogo FC

    2008-07-01

    Full Text Available Abstract Background In women with breast cancer submitted to neoadjuvant chemotherapy based in doxorubicin, tumor expression of groups of three genes (PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 have classified them as responsive or resistant. We have investigated whether expression of these trios of genes could predict mammary carcinoma response in dogs and whether tumor slices, which maintain epithelial-mesenchymal interactions, could be used to evaluate drug response in vitro. Methods Tumors from 38 dogs were sliced and cultured with or without doxorubicin 1 μM for 24 h. Tumor cells were counted by two observers to establish a percentage variation in cell number, between slices. Based on these results, a reduction in cell number between treated and control samples ≥ 21.7%, arbitrarily classified samples, as drug responsive. Tumor expression of PRSS11, MTSS1, CLPTM1 and SMYD2, was evaluated by real time PCR. Relative expression results were then transformed to their natural logarithm values, which were spatially disposed according to the expression of trios of genes, comprising PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2. Fisher linear discrimination test was used to generate a separation plane between responsive and non-responsive tumors. Results Culture of tumor slices for 24 h was feasible. Nine samples were considered responsive and 29 non-responsive to doxorubicin, considering the pre-established cut-off value of cell number reduction ≥ 21.7%, between doxorubicin treated and control samples. Relative gene expression was evaluated and tumor samples were then spatially distributed according to the expression of the trios of genes: PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2. A separation plane was generated. However, no clear separation between responsive and non-responsive samples could be observed. Conclusion Three-dimensional distribution of samples according to the expression of the trios of genes PRSS11, MTSS1, CLPTM1 and

  10. Canine Oral Eosinophilic Granuloma Treated with Electrochemotherapy

    Directory of Open Access Journals (Sweden)

    Matías Nicolás Tellado

    2014-01-01

    Full Text Available A case of a canine oral eosinophilic granuloma in a 14-year-old female crossbred is described. The dog was presented with a history of ptyalism, halitosis, local pain, decreased appetite, and blood staining noted on food and water bowls. Clinical, hematologic, and biochemical examinations, abdominal ultrasonography, and 3-view chest radiographs were performed, and no metastases were found. Histopathologic examination of two 6 mm punch biopsies from the oral lesion revealed the presence of eosinophilic granulomatous lesions in the submucosa. After treatment with corticosteroids and wide spectrum antibiotics no significant changes in clinical signs and lesion size were observed. Electrochemotherapy (ECT, a novel tumor treatment routinely used for cutaneous and subcutaneous tumors in human patients in the European Union since 2006, was used to treat the eosinophilic granuloma. The procedure was performed under general anesthesia, followed by intravenous administration of bleomycin. Six weeks after treatment a complete response with disappearance of the mass and improvement of clinical signs were observed.

  11. CANINE BUTTERFLY GLIOBLASTOMAS: A NEURORADIOLOGICAL REVIEW

    Directory of Open Access Journals (Sweden)

    John Henry Rossmeisl

    2016-05-01

    Full Text Available In humans, high-grade gliomas may infiltrate across the corpus callosum resulting in bihemispheric lesions that may have symmetrical, winged-like appearances. This particular tumor manifestation has been coined a ‘butterfly’ glioma (BG. While canine and human gliomas share many neuroradiological and pathological features, the BG morphology has not been previously reported in dogs. Here we describe the magnetic resonance imaging (MRI characteristics of BG in three dogs, and review the potential differential diagnoses based on neuroimaging findings. All dogs presented with generalized seizures and interictal neurological deficits referable to multifocal or diffuse forebrain disease. MRI examinations revealed asymmetrical (2/3 or symmetrical (1/3, bihemispheric intra-axial mass lesions that predominantly affected the frontoparietal lobes and associated with extensive perilesional edema, and involvement of the corpus callosum. The masses displayed heterogeneous T1, T2, and FLAIR signal intensities, variable contrast enhancement (2/3, and mass effect. All tumors demonstrated classical histopathological features of glioblastoma (GBM including glial cell pseudopalisading, serpentine necrosis, microvascular proliferation, as well as invasion of the corpus callosum by neoplastic astrocytes. Although rare, GBM should be considered a differential diagnosis in dogs with MRI evidence of asymmetric or symmetric bilateral, intra-axial cerebral mass lesions with signal characteristics compatible with glioma.

  12. Canine Butterfly Glioblastomas: A Neuroradiological Review

    Science.gov (United States)

    Rossmeisl, John H.; Clapp, Kemba; Pancotto, Theresa E.; Emch, Samantha; Robertson, John L.; Debinski, Waldemar

    2016-01-01

    In humans, high-grade gliomas may infiltrate across the corpus callosum resulting in bihemispheric lesions that may have symmetrical, winged-like appearances. This particular tumor manifestation has been coined a “butterfly” glioma (BG). While canine and human gliomas share many neuroradiological and pathological features, the BG morphology has not been previously reported in dogs. Here, we describe the magnetic resonance imaging (MRI) characteristics of BG in three dogs and review the potential differential diagnoses based on neuroimaging findings. All dogs presented for generalized seizures and interictal neurological deficits referable to multifocal or diffuse forebrain disease. MRI examinations revealed asymmetrical (2/3) or symmetrical (1/3), bihemispheric intra-axial mass lesions that predominantly affected the frontoparietal lobes that were associated with extensive perilesional edema, and involvement of the corpus callosum. The masses displayed heterogeneous T1, T2, and fluid-attenuated inversion recovery signal intensities, variable contrast enhancement (2/3), and mass effect. All tumors demonstrated classical histopathological features of glioblastoma multiforme (GBM), including glial cell pseudopalisading, serpentine necrosis, microvascular proliferation as well as invasion of the corpus callosum by neoplastic astrocytes. Although rare, GBM should be considered a differential diagnosis in dogs with an MRI evidence of asymmetric or symmetric bilateral, intra-axial cerebral mass lesions with signal characteristics compatible with glioma.

  13. Extranodal NK/T-Cell Lymphoma, Nasal Type, Presenting as a Breast Mass.

    Science.gov (United States)

    Rahal, Ahmad; Reddy, Pavan S; Alvares, Carmelita

    2015-01-01

    Extranodal natural killer/T-cell lymphoma, nasal type, is a rare type of non-Hodgkin cell lymphoma endemic to East Asia and parts of Central and South America. In most cases, it is driven by Epstein-Barr virus infections, with a broad range of morphologic appearances, frequent necrosis, and angioinvasion. It is designated as NK/T reflecting uncertainty in its cellular origins. These tumors usually arise in the nasal region, typically presenting with symptoms of nasal obstruction, epistaxis, and/or a destructive mass involving the nose, sinuses, or palate. The treatment of patients with extranodal NK/T-cell lymphoma, nasal type, is largely determined by the extent of disease. Localized disease is usually treated with radiation and chemotherapy. The disseminated disease requires combination chemotherapy. This report describes the case of a 30-year-old Caucasian female presenting with a left breast mass of two months duration. Excisional biopsy was done, and the pathological exam confirmed the diagnosis of extranodal NK/T-cell lymphoma, nasal type. Our patient received a systemic combination chemotherapy with steroid (dexamethasone), methotrexate, ifosfamide, L-asparaginase, and etoposide (SMILE) regimen, resulting in a complete clinical and radiological remission. On the basis of our review of the literature, extranodal NK/T non-Hodgkin cell lymphoma, nasal type, presenting as a breast mass is very rare and very uncommon in the United States. Awareness of this occurrence may be valuable as this case may be a forerunner of additional similar cases developing in the future. PMID:26824008

  14. Cell proliferation in rat nasal respiratory epithelium following three months exposure to formaldehyde gas

    International Nuclear Information System (INIS)

    Formaldehyde (HCHO), a ubiquitous chemical and rat nasal carcinogen, enhances cell proliferation in rat, monkey, and xenotransplanted human respiratory epithelium following short-term exposure. The present studies were designed to evaluate cell proliferation in relation to tumor induction in rat nasal respiratory epithelium following subchronic HCHO exposure. Male F-344 rats were whole-body exposed to either 0, 0.7, 2, 6, 10, or 15 ppm HCHO, for wither 4 d (6hr/d), 6 wks (5d/wk) or 3 months. Animals were labeled with tritiated thymidine prior to euthanasia. Nasal sections were processed for autoradiography and cell proliferation data was expressed as unit length labeling indices (ULLI). HCHO-induced lesions and increases in cell proliferation occurred in specific regions of the nose, primarily the wall of the lateral meatus and nasal septum of the anterior nasal cavity. Following 4 d exposure, significant elevations in cell proliferation were observed only in the 6, 10 and 15 ppm groups (16-, 18-, and 20-fold increase over control, respectively). Increases in ULLI were also present in the 6, 10 and 15 ppm groups after 6 wks of exposure (12-, 35-, and 40-fold increase over control). However, after 3 months exposure, elevations in ULLI were present only in the 10 and 15 ppm groups (9- and 14-fold increase over controls). These results demonstrate that (1) low levels of HCHO (0.7 and 2 ppm) do not increase cell proliferation in rat nasal respiratory epithelium; (2) 6 ppm HCHO induces transient increases in cell proliferation; and (3) clearly carcinogenic concentrations of HCHO (10 and 15 ppm) cause sustained elevations in cell proliferation which may play an important role in HCHO-induced carcinogenesis

  15. Nasal administration of amyloid-beta peptide decreases cerebral amyloid burden in a mouse model of Alzheimer's disease

    DEFF Research Database (Denmark)

    Weiner, H L; Lemere, C A; Maron, R;

    2000-01-01

    -Abeta antibodies of the IgG1 and IgG2b classes, and mononuclear cells in the brain expressing the anti-inflammatory cytokines interleukin-4, interleukin-10, and tumor growth factor-beta. Our results demonstrate that chronic nasal administration of Abeta peptide can induce an immune response to Abeta that decreases...

  16. Surgical innovations in canine gonadectomy

    NARCIS (Netherlands)

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated n

  17. Prognostic markers of canine pyometra

    OpenAIRE

    M.C. Sant'Anna; L.G.P. Giordano; K.K.M.C. Flaiban; E.E. Muller; M.I.M. Martins

    2014-01-01

    The pyometra is a disease that affects middle age and elderly female dogs during diestrus. Hormonal, microbiological, biochemical and hematological aspects are well described. However, few studies have evaluated the role of each in the prognosis of canine pyometra. The aim of this study was to identify markers associated with clinical worsening of dogs with pyometra. We prospectively evaluated 80 dogs with pyometra tre...

  18. Central nervous system tumors

    International Nuclear Information System (INIS)

    Central nervous system (CNS) tumors are relatively common in veterinary medicine, with most diagnoses occurring in the canine and feline species. Numerous tumor types from various cells or origins have been identified with the most common tumors being meningiomas and glial cell tumors. Radiation therapy is often used as an aid to control the clinical signs associated with these neoplasms. In general, these tumors have a very low metastatic potential, such that local control offers substantial benefit. Experience in veterinary radiation oncology would indicate that many patients benefit from radiation treatment. Current practice indicates the need for computed tomography or magnetic resonance imaging studies. These highly beneficial studies are used for diagnosis, treatment planning, and to monitor treatment response. Improvements in treatment planning and radiation delivered to the tumor, while sparing the normal tissues, should improve local control and decrease potential radiation related problems to the CNS. When possible, multiple fractions of 3 Gy or less should be used. The tolerance dose to the normal tissue with this fractionation schedule is 50 to 55 Gy. The most common and serious complications of radiation for CNS tumors is delayed radiation myelopathy and necrosis. Medical management of the patient during radiation therapy requires careful attention to anesthetic protocols, and medications to reduce intracranial pressure that is often elevated in these patients. Canine brain tumors have served as an experimental model to test numerous new treatments. Increased availability of advanced imaging modalities has spawned increased detection of these neoplasms. Early detection of these tumors with appropriate aggressive therapy should prove beneficial to many patients

  19. Nasal commensal Staphylococcus epidermidis counteracts influenza virus

    Science.gov (United States)

    Chen, Hui-Wen; Liu, Pei-Feng; Liu, Yu-Tsueng; Kuo, Sherwin; Zhang, Xing-Quan; Schooley, Robert T.; Rohde, Holger; Gallo, Richard L.; Huang, Chun-Ming

    2016-01-01

    Several microbes, including Staphylococcus epidermidis (S. epidermidis), a Gram-positive bacterium, live inside the human nasal cavity as commensals. The role of these nasal commensals in host innate immunity is largely unknown, although bacterial interference in the nasal microbiome may promote ecological competition between commensal bacteria and pathogenic species. We demonstrate here that S. epidermidis culture supernatants significantly suppressed the infectivity of various influenza viruses. Using high-performance liquid chromatography together with mass spectrometry, we identified a giant extracellular matrix-binding protein (Embp) as the major component involved in the anti-influenza effect of S. epidermidis. This anti-influenza activity was abrogated when Embp was mutated, confirming that Embp is essential for S. epidermidis activity against viral infection. We also showed that both S. epidermidis bacterial particles and Embp can directly bind to influenza virus. Furthermore, the injection of a recombinant Embp fragment containing a fibronectin-binding domain into embryonated eggs increased the survival rate of virus-infected chicken embryos. For an in vivo challenge study, prior Embp intranasal inoculation in chickens suppressed the viral titres and induced the expression of antiviral cytokines in the nasal tissues. These results suggest that S. epidermidis in the nasal cavity may serve as a defence mechanism against influenza virus infection. PMID:27306590

  20. In vitro evaluation of nasal mucociliary clearance using excised rat nasal septum.

    Science.gov (United States)

    Inoue, Daisuke; Furubayashi, Tomoyuki; Ogawara, Ken-ichi; Kimura, Toshikiro; Higaki, Kazutaka; Katsumi, Hidemasa; Sakane, Toshiyasu; Yamamoto, Akira; Higashi, Yutaka

    2012-01-01

    Mucus on the nasal mucosa is translocated to the pharynx by ciliary beating, which is an important nonspecific defense mechanism called mucociliary clearance (MC). MC is one of the important factors determining the rate and extent of drug absorption after nasal application. The purpose of this study is to evaluate MC using rat nasal septum under physiological condition in an in vitro system. The nasal septum was excised from rats anesthetized with urethane and the movement of fluorescent microspheres (FMS) applied on the nasal septum was observed with a fluorescence microscope. FMS were transported at a constant velocity in the same direction for a few minutes, but addition of 4% mucin solution on the nasal septum maintained MC for at least 90 min after excision. With our evaluation system established by modifying the method of Saldiva, MC was determined to be around 1 mm/min. Furthermore, the ciliostatic effect of benzalkonium chloride was observed, and it was confirmed that β-adrenergic antagonists and a cholinergic antagonist decreased MC, and that β-adrenergic agonists and a cholinergic agonist tended to increase MC, indicating that our system is valid and useful for evaluating MC function and the effect of drugs and pharmaceutical additives for nasal application on MC. PMID:22687480

  1. Paediatric nasal polyps in cystic fibrosis.

    Science.gov (United States)

    Mohd Slim, Mohd Afiq; Dick, David; Trimble, Keith; McKee, Gary

    2016-01-01

    Patients with cystic fibrosis (CF) are at increased risk of nasal polyps. We present the case of a 17-month-old Caucasian patient with CF who presented with hypertelorism causing cycloplegic astigmatism, right-sided mucoid discharge, snoring and noisy breathing. Imaging suggested bilateral mucoceles in the ethmoid sinuses. Intraoperatively, bilateral soft tissue masses were noted, and both posterior choanae were patent. Polypectomy and bilateral mega-antrostomies were performed. Histological examination revealed inflammatory nasal polyposis typical of CF. The role of early functional endoscopic sinus surgery (FESS) in children with CF nasal polyposis remains questionable as the recurrence rate is higher, and no improvement in pulmonary function has been shown. Our case, however, clearly demonstrates the beneficial upper airway symptom relief and normalisation of facial appearance following FESS in a child with this condition. PMID:27329094

  2. Prenatal diagnosis of a nasal glioma.

    Science.gov (United States)

    Grzegorczyk, Véronica; Brasseur-Daudruy, Marie; Labadie, Gérard; Cellier, Cécile; Verspyck, Eric

    2010-10-01

    Nasal glioma is a rare congenital midline malformation composed of heterotopic masses of neuroglial tissue. We report a case of fetal nasal glioma diagnosed by sonography at 22 weeks' gestation as a vascular hypoechoic mass located on the left nasal bone. Fetal MRI excluded an underlying bone defect. At birth, the lesion appeared as a reddish mass. Post natal imaging confirmed the vascularisation within the lesion with an arterial low-flow velocity and a high-resistance spectrum, consistent with a glioma. The child underwent surgery at 5 months and final diagnosis was made on pathological examination. Therefore, a vascular lesion and a clinical aspect mimicking a haemangioma should not be considered sufficient to reach the final diagnosis. PMID:20401478

  3. Nasal Eosinophilic Angiocentric Fibrosis with Orbital Extension.

    Science.gov (United States)

    Faramarzi, Mohammad; Dadgarnia, Mohammad Hossein; Moghimi, Mansour; Sharouny, Hadi; Behniafard, Nasim

    2015-09-01

    Eosinophilic angiocentric fibrosis (EAF) is an extremely rare, chronic, benign, idiopathic disorder that mostly affects the upper respiratory tract, particularly the nasal cavity, and features progressive submucosal perivascular fibrosis. To the best of our knowledge, only seven cases of EAF with orbital involvement have been reported. We report a case of sinonasal EAF with orbital extension that presented with left nasolacrimal duct obstruction. A 35-year-old man presented with left epiphora, proptosis, anterolateral globe displacement and nasal obstruction. Endoscopic sinus examination showed a firm, gritty, creamy, yellow, fibrous, adherent mass of maxillary sinus. Diagnosis was established with histopathological examination of excisional biopsy of the lesion. Although EAF is very rare, it should be considered in the differential diagnosis of lesions of upper airway tract, particularly the nasal cavity. Biopsy is necessary for diagnosis and treatment planning. Resecting of the involved tissues completely is essential for prevention of recurrence. PMID:25601283

  4. Discriminating between Nasal and Mouth Breathing

    CERN Document Server

    Curran, Kevin; Coyle, Damian

    2010-01-01

    The recommendation to change breathing patterns from the mouth to the nose can have a significantly positive impact upon the general well being of the individual. We classify nasal and mouth breathing by using an acoustic sensor and intelligent signal processing techniques. The overall purpose is to investigate the possibility of identifying the differences in patterns between nasal and mouth breathing in order to integrate this information into a decision support system which will form the basis of a patient monitoring and motivational feedback system to recommend the change from mouth to nasal breathing. Our findings show that the breath pattern can be discriminated in certain places of the body both by visual spectrum analysis and with a Back Propagation neural network classifier. The sound file recoded from the sensor placed on the hollow in the neck shows the most promising accuracy which is as high as 90%.

  5. Nasal birth trauma: a review of appropriate treatment.

    LENUS (Irish Health Repository)

    Cashman, E C

    2012-02-01

    The aetiology of nasal deformity has frequently included birth trauma. There is no consensus in the literature as to whether nasal surgery, in the form of closed reduction, is indicated in neonates. The majority of studies in the literature that advocate intervention have inadequate followup periods and there is a paucity of evidence for the adverse effects of conservative management. This case highlights the therapeutic dilemma posed by such nasal injuries in the neonate and, to the best of the authors\\' knowledge, at the time of writing, represents the earliest reported case in the literature of nasal deformity in the neonate. The term nasal deformity is used to denote deformity of the nasal pyramid, soft tissue, and septum. Three main aspects of neonatal nasal deformity are addressed including, firstly, if nasal deformity at birth needs to be addressed, secondly, if left unaltered, what the long-term effects are and, finally, if intervention alters the normal course of midfacial development.

  6. Nanoparticles for nasal delivery of vaccines : monitoring adaptive immune responses

    NARCIS (Netherlands)

    Keijzer, C.

    2013-01-01

    The continuous emergence of new pathogens and growing drug resistance of microorganisms asks for innovative vaccination strategies. An alternative to conventional multiple injection vaccines is the nasal route of vaccine delivery. The immune response induced following nasal antigen delivery depends

  7. The nasal cavity microbiota of healthy adults

    OpenAIRE

    Bassis, Christine M.; Tang, Alice L.; Young, Vincent B.; Pynnonen, Melissa A

    2014-01-01

    Background The microbiota of the nares has been widely studied. However, relatively few studies have investigated the microbiota of the nasal cavity posterior to the nares. This distinct environment has the potential to contain a distinct microbiota and play an important role in health. Results We obtained 35,142 high-quality bacterial 16S rRNA-encoding gene sequence reads from the nasal cavity and oral cavity (the dorsum of the tongue and the buccal mucosa) of 12 healthy adult humans and dep...

  8. Surgical Treatment of Nasal Obstruction in Rhinoplasty.

    Science.gov (United States)

    Ghosh, Ankona; Friedman, Oren

    2016-01-01

    The key to a successful septorhinoplasty includes an understanding of nasal anatomy and physiology. This allows the surgeon the ability to properly address both form and function during the operation. History and physical examination are paramount in diagnosing and subsequently treating the epicenter of obstruction, which is commonly found among the internal and external nasal valve, the septum, or the turbinates. Treatment of each of these areas is nuanced and multiple approaches are discussed to provide an understanding of the current surgical techniques that allow for excellent functional and cosmetic rhinoplasty results. PMID:26616692

  9. Nasal mucociliary clearance in patients with tracheostomy

    OpenAIRE

    Yadav, S. P. S.; Janab, Khan Shariq; Singh, Jagat; Ranga, Rupender K.

    2003-01-01

    Nasal mucociliary clearance (NMC) time was estimated in 30 tracheostomized patients (24 males & 6 females) in the age group of 13–55 years which was 7.04±0.38 minutes: The patients suffering from nose and paranasal sinus disorders; taking drugs like bromhexine; undergoing radiotherapy and smokers were excluded from the study. The nasal mucociliary clearance in 30 age & sex matched healthy controls was 9.16±0.62 minutes. The NMC was found to he significantly lowered in patients with tracheosto...

  10. Maxillary canine with two root canals

    OpenAIRE

    Nagesh Bolla; Sarath Raj Kavuri

    2011-01-01

    To report a rare case of maxillary canine with two root canals. The case describes the treatment of a maxillary canine with two root canals which was referred from department of prosthodontia for intentional root canal treatment for prosthetic rehabilitation. Clinical examination revealed a maxillary canine with carious lesion and responded within normal limits to electric pulp test. Radiographic examination revealed a distal carious lesion (close proximity to pulp) and also appeared to be an...

  11. Primary Nasal Tuberculosis in a 10-Year-Old Girl

    Science.gov (United States)

    Özer, Murat; Özsurekçi, Yasemin; Cengiz, Ali Bülent; Özçelik, Uğur; Yalçın, Ebru; Gököz, Özay

    2016-01-01

    Nasal tuberculosis is a rare clinical entity which mainly presents in elderly people. Nasal tuberculosis has always been considered to be secondary to tuberculosis of the lungs, and in rare instances it is a primary infection, usually when mycobacteria are inhaled. We describe the case of a 10-year-old girl who was successfully treated for primary nasal tuberculosis. This patient is one of the very few children who have been reported to have primary nasal tuberculosis. PMID:27366187

  12. The use of nasal markers for monitoring mallard populations

    OpenAIRE

    Fabião, António; Rodrigues, David; Figueiredo, Maria

    2001-01-01

    We discuss the advantages and limitations of alphanumeric-coded nasal markers used for monitoring resident mallard populations. We tested two designs of nasal saddles, various colours, PVC tape of 2 thicknesses and ribber tape. The rctangular nasal saddle could disturb birds during feeding, so we changed it to a more anatomical design. The use of alphanumeric coded nasal markers was an efficient method for marking mallards in small wetlands with good visibility and for relatively short periods.

  13. Anthropometric Study of Nasal Index of the Kosovo Albanian Population

    OpenAIRE

    Gloria Staka; Fatmir Dragidella; Metush Disha

    2012-01-01

    Human nose occurs in many shapes and sizes and ethnic influences my results in different appearances of the nose. Nasal index is an ethnic sensitive anthropometric index. It is an important athropometric parameter for classifying the race and sex of the individual whose identity is unknown. This study was undertaken to determine the nasal index of the Kosovo Albanian population. The study sample comprised 204 subjects (101 males and 103 females) aged 18-25 years. Nasal height and nasal width ...

  14. Absorption of acetylsalicylic acid from the rat nasal cavity.

    Science.gov (United States)

    Hussain, A A; Iseki, K; Kagoshima, M; Dittert, L W

    1992-04-01

    The fate of salicylate in the plasma of rats was followed after nasal, intravenous, and oral administration of 2.0-mg doses of aspirin. Aspirin was well absorbed following nasal administration of a neutralized, nonirritating solution containing triethanolamine. The rate of absorption was slower than that of other nasally administered drugs, such as propranolol or progesterone. The bioavailability of aspirin following nasal administration was 100%, whereas the oral bioavailability was only 58.8% at the dose studied. PMID:1501071

  15. Endoscopic removal of nasal septum chondrosarcoma in paediatric patient

    OpenAIRE

    Muhammad Nasri Abu Bakar; Rosdi Ramli; Zulkiflee Salahuddin; Irfan Mohamad

    2014-01-01

    Chondrosarcomas of the head and neck are uncommon malignant tumours of non-epithelial origin. They rarely occur in paediatric age group. The treatment is mainly surgical and adjuvant therapy is only reserved to certain cases. We report a boy with progressive history of nasal obstruction and epistaxis. Nasal endoscopy revealed a mass arising from nasal septum. Endoscopic excision of the tumour was successfully done followed by radiotherapy. Endoscopic excision of chondrosarcoma of the nasal...

  16. Avian-origin H3N2 canine influenza virus circulating in farmed dogs in Guangdong, China.

    Science.gov (United States)

    Su, Shuo; Chen, Ye; Zhao, Fu-Rong; Chen, Ji-Dang; Xie, Jie-Xiong; Chen, Zhong-Ming; Huang, Zhen; Hu, Yi-Ming; Zhang, Min-Ze; Tan, Li-Kai; Zhang, Gui-Hong; Li, Shou-Jun

    2013-10-01

    Since 2006, more and more cases of the infectious H3N2 canine influenza virus (CIV) in pet dogs have been reported in Southern China. However, little is known about the prevalence situation of H3N2 CIV infections in farmed dogs in China. This is the first systematic epidemiological surveillance of CIV in different dog populations in Southern China. Two virus strains A/Canine/Guangdong/1/2011(H3N2) and A/canine/Guangdong/5/2011(H3N2) were isolated from canine nasal swabs collected at one dog farm in Guangzhou and the other farm in Shenzhen. Sequence and phylogenetic analysis of eight gene segments of these viruses revealed that they were most similar to the newly isolated canine H3N2 viruses in dogs and cats from Korea and China, which originated from avian strain. This indicates that H3N2 CIV may be a common pathogen for pet and farmed dog populations in Southern China at present. Serological surveillance has shown that the infection rate of this avian-origin canine influenza in farmed dogs and in pet dogs were 12.22% and 5.3%, respectively; as determined by the ELISA. The data also suggested that transmission occurred, most probably by close contact, between H3N2 CIV infected dogs in different dog populations in recently years. As H3N2 outbreaks among dogs continue in the Guangdong Province (located very close to Hong Kong), the areas where is densely populated and with frequent animal trade, there is a continued risk for pet H3N2 CIV infections and for mutations or genetic reassortment leading to new virus strains with increased transmissibility among dogs. Further in-depth study is required as the H3N2 CIV has been established in different dog populations and posed potential threat to public health. PMID:24298574

  17. Cyclooxygenase Inhibitor Associated with Carboplatin in Treatment of Metastatic Nasal Carcinoma in Dog

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo Fonseca-Alves

    2014-01-01

    Full Text Available A 10-year-old, intact male, pinscher was presented with unilateral bloodstained nasal discharge, sneezing, dyspnea, zygomatic arch deformity, submandibular lymph node increase, blindness in right eye, and exophthalmia. After clinical examination, it was found that the animal presented with upper respiratory tract dyspnea origin, possibly caused by an obstructive process. Complete blood count (CBC, ocular ultrasonography, thoracic radiographs, mandibular lymph node, and nasal sinus fine needle aspiration were performed. The right mandibular lymph node excisional biopsy was conducted and a tumor sample was obtained through the nasal fistula at hard palate. The material was processed, paraffin embedded, sectioned, and stained with hematoxylin and eosin. Immunohistochemical staining for cytokeratin (AE1/AE3, vimentin, and COX-2 was performed. After histopathological evaluation nasal carcinoma diagnosis was obtained. Chemotherapy was established with carboplatin 300 mg/m2 intravenously—four cycles with intervals of 21 days—and firocoxib 5 mg/kg orally every 24 hours for 7 months. After 7 months the treatment started, the animal presented with ataxia, vocalization, hyperesthesia, and anorexia. Due the clinical condition presented, the animal owner opted for performing euthanasia. The chemotherapy protocol was effective causing the disease stagnation, minimizing the clinical signs, and extending patient survival and quality of life.

  18. Canine specific ELISA for coagulation factor VII

    DEFF Research Database (Denmark)

    Knudsen, Tom; Kjelgaard-Hansen, Mads; Tranholm, Mikael; Wiinberg, Bo; Clausen, Jes T.; Hansen, Jens Jacob; Nichols, Timothy C.; Kjalke, Marianne; Jensen, Asger Lundorff; Kristensen, Annemarie Thuri

    2011-01-01

    Canine coagulation factor VII (FVII) deficiency can be hereditary or acquired and may cause life threatening bleeding episodes if untreated. FVII procoagulant activity can be measured by FVII activity (FVII:C), but assays for measurement of canine specific FVII antigen (FVII:Ag) have not been...... available to date. In this study, a canine specific ELISA for measurement of FVII:Ag in plasma was developed and validated. The FVII:Ag ELISA correctly diagnosed homozygous and heterozygous hereditary FVII deficiency. Together with activity based assays, such as FVII:C, the FVII:Ag ELISA should be valuable...... in the diagnosis of hereditary canine FVII deficiency....

  19. The NOFLO trial: low-flow nasal prongs therapy in weaning nasal continuous positive airway pressure in preterm infants.

    LENUS (Irish Health Repository)

    O'Donnell, Sinéad M

    2013-07-01

    To determine if low-flow nasal prongs therapy with room air, compared with no treatment, facilitates weaning from nasal continuous positive airway pressure (NCPAP) in very low birth weight (VLBW, birth weight <1500 g) infants.

  20. 21 CFR 868.5350 - Nasal oxygen catheter.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Nasal oxygen catheter. 868.5350 Section 868.5350...) MEDICAL DEVICES ANESTHESIOLOGY DEVICES Therapeutic Devices § 868.5350 Nasal oxygen catheter. (a) Identification. A nasal oxygen catheter is a device intended to be inserted through a patient's nostril...

  1. Underlying Phoneme Velar Nasal with Lip Rounding in Hueyapan Nahuatl

    Science.gov (United States)

    Campbell, R. Joe

    1976-01-01

    Reasons are given for the idea that Hueyapan (Morelos) Nahuatl has an underlying velar nasal with lip rounding phoneme which never has the surface reflex of a rounded velar nasal allophone, but occurs phonetically as a velar nasal allophone or a labial dental voiced allophone or disappears. (SCC)

  2. 21 CFR 868.5340 - Nasal oxygen cannula.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Nasal oxygen cannula. 868.5340 Section 868.5340...) MEDICAL DEVICES ANESTHESIOLOGY DEVICES Therapeutic Devices § 868.5340 Nasal oxygen cannula. (a) Identification. A nasal oxygen cannula is a two-pronged device used to administer oxygen to a patient...

  3. Impact of facial conformation on canine health: corneal ulceration.

    Directory of Open Access Journals (Sweden)

    Rowena M A Packer

    Full Text Available Concern has arisen in recent years that selection for extreme facial morphology in the domestic dog may be leading to an increased frequency of eye disorders. Corneal ulcers are a common and painful eye problem in domestic dogs that can lead to scarring and/or perforation of the cornea, potentially causing blindness. Exaggerated juvenile-like craniofacial conformations and wide eyes have been suspected as risk factors for corneal ulceration. This study aimed to quantify the relationship between corneal ulceration risk and conformational factors including relative eyelid aperture width, brachycephalic (short-muzzled skull shape, the presence of a nasal fold (wrinkle, and exposed eye-white. A 14 month cross-sectional study of dogs entering a large UK based small animal referral hospital for both corneal ulcers and unrelated disorders was carried out. Dogs were classed as affected if they were diagnosed with a corneal ulcer using fluorescein dye while at the hospital (whether referred for this disorder or not, or if a previous diagnosis of corneal ulcer(s was documented in the dogs' histories. Of 700 dogs recruited, measured and clinically examined, 31 were affected by corneal ulcers. Most cases were male (71%, small breed dogs (mean± SE weight: 11.4±1.1 kg, with the most commonly diagnosed breed being the Pug. Dogs with nasal folds were nearly five times more likely to be affected by corneal ulcers than those without, and brachycephalic dogs (craniofacial ratio <0.5 were twenty times more likely to be affected than non-brachycephalic dogs. A 10% increase in relative eyelid aperture width more than tripled the ulcer risk. Exposed eye-white was associated with a nearly three times increased risk. The results demonstrate that artificially selecting for these facial characteristics greatly heightens the risk of corneal ulcers, and such selection should thus be discouraged to improve canine welfare.

  4. Impact of facial conformation on canine health: corneal ulceration.

    Science.gov (United States)

    Packer, Rowena M A; Hendricks, Anke; Burn, Charlotte C

    2015-01-01

    Concern has arisen in recent years that selection for extreme facial morphology in the domestic dog may be leading to an increased frequency of eye disorders. Corneal ulcers are a common and painful eye problem in domestic dogs that can lead to scarring and/or perforation of the cornea, potentially causing blindness. Exaggerated juvenile-like craniofacial conformations and wide eyes have been suspected as risk factors for corneal ulceration. This study aimed to quantify the relationship between corneal ulceration risk and conformational factors including relative eyelid aperture width, brachycephalic (short-muzzled) skull shape, the presence of a nasal fold (wrinkle), and exposed eye-white. A 14 month cross-sectional study of dogs entering a large UK based small animal referral hospital for both corneal ulcers and unrelated disorders was carried out. Dogs were classed as affected if they were diagnosed with a corneal ulcer using fluorescein dye while at the hospital (whether referred for this disorder or not), or if a previous diagnosis of corneal ulcer(s) was documented in the dogs' histories. Of 700 dogs recruited, measured and clinically examined, 31 were affected by corneal ulcers. Most cases were male (71%), small breed dogs (mean± SE weight: 11.4±1.1 kg), with the most commonly diagnosed breed being the Pug. Dogs with nasal folds were nearly five times more likely to be affected by corneal ulcers than those without, and brachycephalic dogs (craniofacial ratio brachycephalic dogs. A 10% increase in relative eyelid aperture width more than tripled the ulcer risk. Exposed eye-white was associated with a nearly three times increased risk. The results demonstrate that artificially selecting for these facial characteristics greatly heightens the risk of corneal ulcers, and such selection should thus be discouraged to improve canine welfare. PMID:25969983

  5. BNCT of canine osteosarcoma

    International Nuclear Information System (INIS)

    A dog was diagnosed with osteosarcoma (8x6x5cm) in the right wing of ilium by radiography, radionuclide scintigraphy and histological study of biopsy material. The treatment plan was as follows: γ-therapy in combination with chemotherapy; prevention of hematogenous pulmonary metastases by the transfusion of 130 ml of allogenic marrow from a healthy donor; administration of 11.4g 10B-boronphenylalanine into the right iliac artery; resection of the right iliac wing with the osteosarcoma lesion; neutron irradiation (MEPhI Reactor) of the bone fragment (dose on healthy osteocytes - 15±4 Gy (W), on tumor - 50±9 Gy (W); reimplantation and fixation of the fragment; three courses of adjuvant chemotherapy. The doses were determined in full-scale calculations of the reactor radiation fields with a model of the bone under the code RADUGA. The 10B concentration (μg/g) in the bone was: normal tissue - 9±3, tumor - 28±5. In 24 hours post operation the dog was able to walk using the treated limb, and 6 months later it moved freely. The patient has been under observation for 30 months. The results of the research demonstrate complete cure. The use of similar treatment plans improves the therapeutic efficiency of BNCT. (author)

  6. Therapeutic strategies for adenoid cystic carcinoma of the nasal and paranasal sinus from the long-term treatment results

    International Nuclear Information System (INIS)

    This article presents long-term treatment results by analyzing 24 cases with adenoid cystic carcinoma (ACC) of the nasal and paranasal sinus treated from 1975 to 1995 at Akita University Hospital and Chiba University Hospital. The basic strategies for treatment for ACC of the nasal and paranasal sinuses are en bloc tumor resection, followed by primary reconstruction of the maxilla. Preoperative and postoperative radiation were combined. Cumulative 5-year and 10-year survival rates were 70.6% and 47.1% for maxillary sinus tumors, respectively. Cumulative 5-year and 10-year survival rates for nasal tumors were 100% and 75.0%, and those for sphenoid sinus tumors were 50.0% and 0%, respectively. The patient with ethomoid sinus who needed skull base surgery is alive at 8.1 years after therapy. Treatment results closely correlated with tumor extension. Cumulative 5-year survival rates for T2, T3 and, T4 patients with maxillary sinus tumors were 85.7%, 71.4%, and 33.3%, respectively. And cumulative 10-year survival rates for T2, T3, and T4 were 71.4%, 42.9%, and 0%, respectively. The histopathological effects of preoperative radiation were Shimosato II a in 6 out of 10 patients, II b in 2, and III in 2, respectively. Only fast neutron therapy reached Shimosato III. Two of the patients with Shimosato II a died of distant metastasis. The above data suggests that, although radiation therapy alone cannot cure tumors, preoperative full-dose radiation may prevent the development of distant metastasis if it can achieve histopathological effects of a higher classification than Shimosato II b. Because chemotherapy and radiation is not very effective on ACC, the role of skull base surgeries for nasal-paranasal sinus malignancies that invade the skull base is valuable, particularly in cases having a relatively small mass in the ethmoid sinus. (author)

  7. The Effects of the Remanining Time of Anterior Nasal Packing in Nasal Passage on Healing After Septal Surgery

    OpenAIRE

    ÇETİNKAYA, Tufan

    2001-01-01

    One of the most disturbing problems to the patient after septal surgery is the presence of nasal packing. Postoperative nasal packing use has some advantages and disadvantages. This study was performed to determine whether there's a relation between the duration of postoperative nasal packing and patient complaints. A total of 66 patients undergoing septoplasty or septorhinoplasty were included into the study. The patients were divided into two groups according to the duration of nasal packin...

  8. Sewage surveillance reveals the presence of canine GVII norovirus and canine astrovirus in Uruguay.

    Science.gov (United States)

    Lizasoain, A; Tort, L F L; García, M; Gómez, M M; Leite, J P G; Miagostovich, M P; Cristina, J; Berois, M; Colina, R; Victoria, Matías

    2015-11-01

    Canine norovirus (NoV) and astrovirus (AstV) were studied in 20 domestic sewage samples collected in two cities in Uruguay. Four samples were characterized as canine AstV after phylogenetic analysis clustering with strains detected in Italy and Brazil in 2008 and 2012, respectively. One sample was characterized as canine NoV and clustered with a strain detected in Hong Kong and recently classified as GVII. This study shows the occurrence of a canine NoV GVII strain for the first time in the American continent and also warns about possible zoonotic infection, since canine strains were detected in domestic sewage. PMID:26280526

  9. Alkylation and Carbamylation Effects of Lomustine and Its Major Metabolites and MGMT Expression in Canine Cells

    Directory of Open Access Journals (Sweden)

    Thushara Chakkath

    2015-04-01

    Full Text Available DNA Alkylation is thought to be the reason for the efficacy of lomustine while carbamylation has been implicated as the cause for the side effects seen with lomustine treatment such as hepatotoxicity. In the alkylation study we show that lomustine and its metabolites form similar levels of the DNA adducts N7 hydroxyethylguanine and O6 hydroxyethyldeoxyguanosine. In terms of carbamylation, lomustine showed greater extent of carbamylation in the canine hepatocytes and lymphoma cell lines. The DNA repair enzyme O6 methylguanine DNA methyltransferase (MGMT causes resistance of tumor cells to bifunctional nitrosourea, like lomustine. There is no data available regarding MGMT expression/activity in canine cells or tissues. Our study shows that there is low MGMT activity in the canine lymphoid cell line 17–71 while the GL-1 cells did not show any detectable enzyme activity or mRNA expression. The MGMT enzyme activity measured in canine hepatocytes is about 250–350 fmol/mg protein as compared to about 90 fmol/mg protein in 17–71 cells. We also show that MGMT mRNA expression in 17–71 cells and canine hepatocytes positively correlates with its enzyme activity in these cells.

  10. Fatores prognósticos e preditivos dos tumores caninos definidos com auxílio da imuno-histoquímica Prognostic and predictive factors of canine tumours defined with immunohistochemistry's assistance

    Directory of Open Access Journals (Sweden)

    Rodrigo dos Santos Horta

    2012-06-01

    Full Text Available A imuno-histoquímica pode ser aplicada na oncologia veterinária para a definição do imunofenótipo neoplásico, com possibilidades ilimitadas de utilização. A técnica baseia-se na identificação de antígenos "in situ", que podem apresentar valor prognóstico e terapêutico. A expressão de receptores de estrógeno e progesterona está diretamente relacionada ao melhor prognóstico para os neoplasmas mamários, enquanto a super-expressão do receptor KIT (CD117, proteínas Ki-67 (MIB-1, VEGF, CD31 e COX-2 podem ser associados à progressão tumoral para vários tipos histológicos. Essa associação possui valor preditivo em potencial, tendo em vista a possibilidade da utilização de bloqueadores específicos. Esta revisão tem como objetivo apresentar as possibilidades da utilização da imuno-histoquímica nos tumores de cães, visando à definição mais precisa do prognóstico e a indicação de tratamentos específicos para cada paciente.Immunohistochemistry can be applied in veterinary oncology to define the immunophenotype of neoplastic cells with unlimited possibilities of application. The technique is based on the identification of antigens "in situ", which may have prognostic and therapeutic value. Expression of estrogen and progesterone is directly related to better prognosis for breast cancer, while over-expression of receptor KIT (CD117 proteins Ki-67 (MIB-1, COX-2, VEGF and CD31 can be associated with tumor progression for several histological types. This association has a potential predictive value, due to the possibility of using specific blockers. This revision aims at presenting the possibilities of immunohistochemical's application in tumors of dogs, searching for a more precise definition of the prognosis and indication of specific treatments for each patient.

  11. Surgical innovations in canine gonadectomy

    OpenAIRE

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated negative consequences (lengthy placement, impaired wound healing around bulky knots, and the effect of unsightly knots on cosmetics). A study in 9 dogs found that celiotomy closure was easily achiev...

  12. Canine mammary tumours, an overview.

    Science.gov (United States)

    Sleeckx, N; de Rooster, H; Veldhuis Kroeze, E J B; Van Ginneken, C; Van Brantegem, L

    2011-12-01

    Canine mammary tumours (CMTs) are the most common neoplasms in intact female dogs. Although the prevalence of these tumours decreases in regions where preventive ovari(ohyster)ectomy is performed, it remains an important disease entity in veterinary medicine. Moreover, treatment options are limited in comparison with human breast cancer. Nevertheless, recent human treatment protocols might have potential in bitches suffering from CMTs. PMID:21645126

  13. Canine adenovirus based rabies vaccines.

    Science.gov (United States)

    Tordo, N; Foumier, A; Jallet, C; Szelechowski, M; Klonjkowski, B; Eloit, M

    2008-01-01

    Adenovirus based vectors are very attractive candidates for vaccination purposes as they induce in mammalian hosts potent humoral, mucosal and cellular immune responses to antigens encoded by the inserted genes. We have generated E1-deleted and replication-competent recombinant canine type-2 adenoviruses expressing the rabies virus glycoprotein (G). The effectiveness of both vectors to express a native G protein has been characterized in vitro in permissive cell lines. We compared the humoral and cellular immune responses induced in mice by intramuscular injection of the recombinant canine adenovirus vectors with those induced by a human (Ad5) E1-deleted virus expressing the same rabies G protein. Humoral responses specific to the adenoviruses or the rabies glycoprotein antigens were studied. The influence of the mouse strain was observed using replication-competent canine adenovirus. A high level of rabies neutralizing antibody was observed upon i.m. inoculation, and 100% of mice survived lethal challenge. These results are very promising in the perspective of oral vaccine for dog rabies control. PMID:18634509

  14. Objective Measures in Aesthetic and Functional Nasal Surgery – Perspectives on Nasal Form and Function

    OpenAIRE

    Pawar, Sachin S.; Garcia, Guilherme J. M.; Kimbell, Julia S.; Rhee, John S.

    2010-01-01

    The outcomes of aesthetic and functional nasal surgery are difficult to assess objectively due to the intricate balance between nasal form and function. Despite historical emphasis on patient-reported subjective measures, objective measures are gaining importance in both research and the current outcomes-driven healthcare environment. Objective measures presently available have several shortcomings which limit their routine clinical use. In particular, the low correlation between objective an...

  15. How to Use Nasal Pump Sprays

    Science.gov (United States)

    Using Nasal Pump SpraysBlow your nose gently before using the spray. Prime the pump bottle by spraying it into the air a ... Breathe in quickly while squeezing down on the pump bottle one time. Repeat in other nostril. Do ...

  16. Nasal reconstruction with articulated irradiated rib cartilage

    International Nuclear Information System (INIS)

    Nasal structural reconstruction is a formidable task in cases where there is loss of support to both the nasal dorsum and tip. A multitude of surgical approaches and materials have been used for the correction of the saddle-nose deformity with varying degrees of success. Articulated irradiated rib cartilage inserted through an external rhinoplasty approach was used to reconstruct nasal deformities in 18 patients over a 6-year period. Simultaneous use of a midline forehead flap to reconstruct the overlying soft tissue was required in four cases. Follow-up ranged from 1 to 6 years (mean, 2.8 years). Results were rewarding in most cases with marked improvement in nasal support and airway. Revision and/or replacement secondary to trauma or warping of the graft was required in four cases. None of the patients exhibited infection, extrusion, or noticeable resorption. A description of the surgical technique, review of all the cases, and recommendation for continued use of this graft material are discussed

  17. Fracture of nasal bones: an epidemiologic analysis

    Directory of Open Access Journals (Sweden)

    Fornazieri, Marco Aurélio

    2008-12-01

    Full Text Available Introduction: One of the most common diseases in the otorhinolaryngology emergency room is the nasal bones fracture. The peak of incidence is between 15 and 25 years of age. Generally men are more affected. Objective: To analyze the age, gender and the most frequent causes of nasal fractures evaluated in the otorhinolaryngology service of a tertiary hospital. Method: Retrospective study of records of the patients with nasal fracture diagnosis treated between July 1st, 2003 and July 1st, 2007. Results: 167 patients with nasal bones fracture were included in the study, including 134 men and 33 women. Violence was the most frequent cause, with 55 cases (32.9%, followed by fall from their own height, with 33 cases (19.7%, and motorcycle accident, 14 cases (8.4%. The most common age was between 21 and 39 years (46.1%. Conclusion: Male, age between 21 and 39 years and violence are the most common characteristics found in our service. Motorcycle accidents also play an important role in this affection.

  18. High Flow Nasal Cannulae in preterm infants

    Directory of Open Access Journals (Sweden)

    F. Ciuffini

    2013-06-01

    Full Text Available Despite of improved survival of premature infants, the incidence of long term pulmonary complications, mostly associated with ventilation-induced lung injury, remains high. Non invasive ventilation (NIV is able to reduce the adverse effects of mechanical ventilation. Although nasal continuous positive airway pressure (NCPAP is an effective mode of NIV, traumatic nasal complications and intolerance of the nasal interface are common. Recently high flow nasal cannula (HFNC is emerging as an efficient, better tolerated form of NIV, allowing better access to the baby’s face, which may improve nursing, feeding and bonding. The aim of this review is to discuss the available evidence of effectiveness and safety of HFNC in preterm newborns with respiratory distress syndrome (RDS. It is known that distending pressure generated by HFNC increases with increasing flow rate and decreasing infant size and varies according to the amount of leaks by nose and mouth. The effects of HFNC on lung mechanics, its clinical efficacy and safety are still insufficiently investigated. In conclusion, there is a growing evidence of the feasibility of HFNC as an alternative mode of NIV. However, further larger randomized trials are required, before being able to recommend HFNC in the treatment of moderate respiratory distress of preterm infants.

  19. Pleomorphic adenoma of the nasal septum

    OpenAIRE

    Saxena, Sunil Kumar; Gopalakrishnan, S

    2003-01-01

    Despite the common occurrence of pleomorphic adenoma of major salivary glands, intranasal pleomorphic adenoma are rare. We present a ease of pleomorphic adenoma of the nasal septum along with a brief review of literature. The histological nature of this lesion in comparison to other salivary gland tumours and the importance of an accurate diagnosis has been stressed.

  20. Nasal reconstruction with articulated irradiated rib cartilage

    Energy Technology Data Exchange (ETDEWEB)

    Murakami, C.S.; Cook, T.A.; Guida, R.A. (Univ. of Washington School of Medicine, Seattle (USA))

    1991-03-01

    Nasal structural reconstruction is a formidable task in cases where there is loss of support to both the nasal dorsum and tip. A multitude of surgical approaches and materials have been used for the correction of the saddle-nose deformity with varying degrees of success. Articulated irradiated rib cartilage inserted through an external rhinoplasty approach was used to reconstruct nasal deformities in 18 patients over a 6-year period. Simultaneous use of a midline forehead flap to reconstruct the overlying soft tissue was required in four cases. Follow-up ranged from 1 to 6 years (mean, 2.8 years). Results were rewarding in most cases with marked improvement in nasal support and airway. Revision and/or replacement secondary to trauma or warping of the graft was required in four cases. None of the patients exhibited infection, extrusion, or noticeable resorption. A description of the surgical technique, review of all the cases, and recommendation for continued use of this graft material are discussed.

  1. Establishment of canine hemangiosarcoma xenograft models expressing endothelial growth factors, their receptors, and angiogenesis-associated homeobox genes

    International Nuclear Information System (INIS)

    Human hemangiosarcoma (HSA) tends to have a poor prognosis; its tumorigenesis has not been elucidated, as there is a dearth of HSA clinical specimens and no experimental model for HSA. However, the incidence of spontaneous HSA is relatively high in canines; therefore, canine HSA has been useful in the study of human HSA. Recently, the production of angiogenic growth factors and their receptors in human and canine HSA has been reported. Moreover, the growth-factor environment of HSA is very similar to that of pathophysiological angiogenesis, which some homeobox genes regulate in the transcription of angiogenic molecules. In the present study, we established 6 xenograft canine HSA tumors and detected the expression of growth factors, their receptors, and angiogenic homeobox genes. Six primary canine HSAs were xenografted to nude mice subcutaneously and serially transplanted. Subsequently, the expressions of vascular endothelial growth factor (VEGF)-A, basic fibroblast growth factors (bFGF), flt-1 and flk-1 (receptors of VEGF-A), FGFR-1, and angiogenic homeobox genes HoxA9, HoxB3, HoxB7, HoxD3, Pbx1, and Meis1 were investigated in original and xenograft tumors by histopathology, immunostaining, and reverse transcription polymerase chain reaction (RT-PCR), using canine-specific primer sets. Histopathologically, xenograft tumors comprised a proliferation of neoplastic cells that were varied in shape, from spindle-shaped and polygonal to ovoid; some vascular-like structures and vascular clefts of channels were observed, similar to those in the original tumors. The expression of endothelial markers (CD31 and vWF) was detected in xenograft tumors by immunohistochemistry and RT-PCR. Moreover, the expression of VEGF-A, bFGF, flt-1, flk-1, FGFR-1, HoxA9, HoxB3, HoxB7, HoxD3, Pbx1, and Meis1 was detected in xenograft tumors. Interestingly, expressions of bFGF tended to be higher in 3 of the xenograft HSA tumors than in the other tumors. We established 6 xenograft canine HSA

  2. Canine and feline megaesophagus

    International Nuclear Information System (INIS)

    Megaesophagus is rare in cats and occurs as a congenital or secondary acquired disorder. In dogs, megaesophagus can occur as a congenital disorder, as a secondary acquired disorder, or as an adult-onset idiopathic disease. This article reviews the anatomy, pathogenesis, causes, clinical signs, diagnosis, and management of megaesophagus. Pathogenesis includes experimental evidence that evaluates the neural pathway of affected patients. The many disease that can cause megaesophagus are delineated. Discussion focuses on the most common causes-myasthenia gravis, hypoadrenocorticism and possibly hypothyroidism, and the obstructive lesions of the esophagus (vascular ring anomalies, tumors, granulomas, strictures, and foreign bodies). The most common clinical sign associated with megaesophagus is regurgitation. Traditional as well as newer techniques (i.e., manometry and nuclear scintigraphy) for evaluating esophageal motility are presented. Definitive diagnosis requires identification of a dilated esophagus on survey thoracic radiographs or a barium esophagogram. Medical management, including alternative feeding methods and the role of prokinetic drugs, is discussed

  3. Coblation nasal septal swell body reduction for treatment of nasal obstruction: a preliminary report.

    Science.gov (United States)

    Kim, So Jeong; Kim, Hee Tae; Park, Yun Hwi; Kim, Ju Yeon; Bae, Jung Ho

    2016-09-01

    In this paper, we present the results of coblation nasal septal swell body (NSB) reduction for the treatment of nasal obstruction in patients with abnormally thickened NSB. The study design was a retrospective clinical series conducted at a single tertiary medical center. Eight patients underwent coblation NSB reduction. Pre-operative and post-operative nasal functions were evaluated by acoustic rhinometry and subjective symptom scales. We also analyzed pre-operative CT scan images and nasal endoscopic findings. The mean maximal NSB width was 16.4 ± 2.2 mm on pre-operative coronal CT scan images. The mean visual analog scale score for nasal obstruction was decreased from preoperative 7.63 ± 0.99 points to 3.88 ± 0.92 points (postoperative 3 months), 4.16 ± 0.78 points (postoperative 6 months), and 4.63 ± 0.69 points (postoperative 1 year). Six out of the eight patients were satisfied with the clinical outcome at 1 year after the procedure. To the best of our knowledge, coblation NSB reduction has not yet been reported in the medical literature. Our results show that it can be an effective treatment modality for nasal valve narrowing in patients with abnormally thickened NSB. PMID:26912145

  4. Elevation of soluble interleukin-2 receptor levels in nasal allergy

    OpenAIRE

    Hisamatsu, K.; T. Ganbo; Nakazawa, T; S. Horiguchi; Shimomura, S; Murakami, Y.

    1995-01-01

    To investigate soluble IL-2 receptor (sIL-2R) levels in nasal allergy, the sera and nasal secretions from patients with nasal allergy and from healthy subjects were subjected to a double-epitope enzyme-linked immunosorbent assay. Significant elevation of sIL-2R concentrations in the sera and nasal secretions was observed in the allergy patients (n = 26) compared with those of healthy subjects (n = 9). IL-2R-positive (CD25+) cells were observed in the crust formed in an allergic nasal mucosa. ...

  5. Tracheal and laryngeal tumors in the dog and cat: literature review and 13 additional patients

    International Nuclear Information System (INIS)

    Primary tumors of the larynx or trachea are uncommon in the dog and cat. In a review of the English language literature, description of 65 such patients were found. In a search of the Veterinary Teaching Hospitals of the University of Pennsylvania and North Carolina State University, an additional 13 previously unreported patients were identified, bringing the total to at least 78. Of these 78, there have been 16 canine tracheal, 7 feline tracheal, 34 canine laryngeal and 21 feline laryngeal tumors. In the canine and feline trachea, osteochondroma and epithelial malignancies, respectively, appear to be the most common. Epithelial malignancies appear to be the most common tumor of the canine larynx whereas lymphosarcoma appears to be the most common feline laryngeal tumor. In patients described herein, tumors produced clinical signs consistent with airway obstruction. Voice alteration was common in patients with laryngeal tumors. Patients were middle-aged to older, except for dogs with osteochondroma. This compares favorably to historical data. All tumors in this study were readily seen radiographically, with most laryngeal and tracheal tumors appearing as masses within the lumen of the airway. Mineralization was uncommon except for canine osteochondromas. Feline laryngeal tumors in this study appeared as generalized laryngeal thickening rather than as a distinct mass. Response of canine and feline tracheal and laryngeal thickening rather than as a distinct mass. Response of canine and feline tracheal and laryngeal tumors to treatment can not be adequately assessed from available data. Benign tumors of the larynx or trachea may be amenable to complete excision. Neoplastic lesions must be differentiated from polyps or abscesses within the upper airway as these may appear radiographically identical to primary tumors. This can be achieved by endoscopic evaluation and biopsy of airway masses before formulating a prognosis

  6. Nasal surgery in patients with systemic disorders

    Directory of Open Access Journals (Sweden)

    Sachse, Florian

    2010-01-01

    Full Text Available Multisystemic disorders represent a heterogenous group of diseases which can primarily manifest at the nose and paranasal sinuses as limited disease or secondarily as part of systemic involvement. Rhinologists therefore play an important role in the diagnostic but also therapeutic process. Although therapy of multisystemic disorders is primary systemic, additional rhinosurgery may become necessary. The spectrum of procedures consists of sinus surgery, surgery of the orbit and lacrimal duct, septorhinoplasty and closure of nasal septal perforation. Since the prevalence of most systemic diseases is very rare, recommendations are based on the analysis of single case reports and case series with a limited number of patients only. Although data is still limited, experiences published so far have shown that autologous cartilage or bone grafts can be used in nasal reconstruction of deformities caused by tuberculosis, leprosy, Wegener’s granulomatosis, sarcoidosis and relapsing polychondritis. Experiences gained from these diseases support the concept that well-established techniques of septorhinoplasty can be used in systemic diseases as well. However, a state of remission is an essential condition before considering any rhinosurgery in these patients. Even under these circumstances revision surgery has to be expected more frequently compared to the typical collective of patients undergoing septorhinoplasty. In addition, experiences gained from saddle nose reconstruction may in part be of value for the treatment of nasal septal perforations since implantation of cartilage grafts often represents an essential step in multilayer techniques of closure of nasal septal perforations. Aside from the treatment of orbital complications sinus surgery has been proven beneficial in reducing nasal symptoms and increasing quality of life in patients refractory to systemic treatment.

  7. RECENT TECHNIQUES IN NASAL DRUG DELIVERY: A REVIEW

    Directory of Open Access Journals (Sweden)

    Parmar Harshad

    2010-09-01

    Full Text Available Nasal drug administration has been used as an alternative route for the systemic availability of drugs restricted to intravenous administration. This is due to the large surface area, porous endothelial membrane, high total blood flow, the avoidance of first-pass metabolism, and ready accessibility. The nasal administration of drugs, including numerous compound, peptide and protein drugs, for systemic medication has been widely investigated in recent years. Drugs are cleared rapidly from the nasal cavity after intranasal administration, resulting in rapid systemic drug absorption. Approaches are discussed here for increasing the residence time of drug formulations in the nasal cavity, resulting in improved nasal drug absorption. The article highlights the importance and advantages of the nasal drug delivery systems stressed upon bioadhesive properties. Bioadhesive, or more appropriately, mucoadhesive systems have been prepared for both oral and peroral administration in the past. The nasal mucosa presents an ideal site for bioadhesive drug delivery systems. In this review we discuss the effects of microspheres and other bioadhesive drug delivery systems on nasal drug absorption. Drug delivery systems, such as microspheres, liposomes and gels have been demonstrated to have good bioadhesive characteristics which swell easily when in contact with the nasal mucosa. These drug delivery systems have the ability to control the rate of drug clearance from the nasal cavity as well as protect the drug from enzymatic degradation in nasal secretions.

  8. Nodular Epiescleritis Granulomatous Canine. Case Report

    Directory of Open Access Journals (Sweden)

    Camilo Guarín Patarroyo

    2011-12-01

    Full Text Available Granulomatous epiescleritis nodular disease in canines is a very unusual presentation that affects or external fibrous tunic of the eyeball and conjunctiva, which was an increase similar to a unilateral or bilateral tumor. Suspected immune-mediated disease due to lack of identification of an etiologic agent and the response to treatment with immunosuppressive drugs (Couto, 1992. The ideal therapy is the application of steroids via intralesional, topical or systemic, or other immunosuppressants such as cyclosporine and azathioprine; it is still advisable to apply antibiotic is the ideal combination of tetracycline and neomycin (Gilger & Whitley, 1999. The diagnostic method of episcleritis is made by histopathology, which is evident in changes similar to chronic granulomatous inflammation. Are claiming a racial bias in Alsatian, Shepherd Collie Shetland Shepherd, Coker Spaniel, Rottweiler and Labrador Retriever (Gough & Thomas, 2004. The following case is a report of a nodular epiescleritis affecting the cornea, sclera, and the corneoscleral limbus, which describes the diagnosis, signology and treatment.

  9. Free Auricular Composite Graft for Acquired Nasal Stenosis

    Science.gov (United States)

    Riley, Charles A.; Lawlor, Claire M.; Gray, Mingyang Liu; Graham, H. Devon

    2016-01-01

    Background: Acquired nasal stenosis poses a reconstructive challenge for the facial plastic surgeon. Many surgical options are available, ranging from primary closure to skin grafts to free flap reconstruction for complex defects. The free auricular composite graft is a single-stage procedure that can be used to repair nasal vestibular stenosis causing nasal obstruction. Case Report: We present the case of a patient with acquired nasal stenosis as a result of prolonged nasal tampon placement secondary to severe epistaxis and subsequent nasal vestibular infection. Repair via auricular composite graft was successful, and we provide a thorough explanation of graft design and operative technique. Conclusion: Free auricular composite grafts can produce desirable functional and aesthetic outcomes and should be considered in patients presenting with acquired nasal stenosis. PMID:27303225

  10. Expression of CD56 and Epstein-Barr virus in nasal/nasopharyngeal lymphoma

    International Nuclear Information System (INIS)

    We examined malignant lymphomas and polymorphic reticulosis of nasal cavity, nasopharynx, and palate, diagnosed at Korea Cancer Center Hospital from 1987 to 1996. With immunophenotypic study, we reclassified nasal/nasopharyngeal lymphomas into three categories: CD56-positive T/NK lymphoma, CD56-negative lymphoma and B-cell lymphoma. Malignant lymphomas of nasal cavity, nasopharynx and palate were 95 patient, that comprised 11% of the total lymphoma cases, and it was the most common extranodal lymphoma. Twenty-five percent were B-cell lymphomas and 75 % were T/NK lymphomas. According to site, nasal cavity was the most frequent and 91 % of nasal cavity lymphomas were T/NK type. CD56-positive T/NK comprised 82 % of total T/NK lymphomas and CD56-negative cases were 18 %. In 89 % of total T/NK lymphomas, many tumor cells expressed EBER-1 in their nuclei (CD56+ T/NK lymphoma: 97 % of EBV expression, CD56-T-cell lymphoma; 60%). Only one case (5%) of B-cell lymphoma showed EBER-1 positivity in a few cells. CD56+ T/NK lymphomas showed significantly more angiocentricity and severe necrosis than CD56- cases. Although it has no statistical significance, T/NK lymphomas has a tendency to lower survival rates than B-cell lymphomas at 1 year and 2 year. CD56+ T/NK lymphomas has a tendency to lower survival than CD56- T/NK lymphomas (p > 0.05). Our results of this project will serve important basic materials in diagnosing and studying lymphoma. (author). 25 refs., 4 tabs., 4 figs

  11. Surgical Treatment and Recurrence of Cutaneous Nasal Malignancies: A 26-Year Retrospective Review of 1795 Patients.

    Science.gov (United States)

    Christopoulos, George; Sergentanis, Theodoros N; Karantonis, Fotis; Karypidis, Dimitrios; Hampsas, Grigoris; Kostopoulos, Epaminondas; Kostaki, Maria; Papadopoulos, Othon

    2016-08-01

    Frequent localization of facial malignancies in the nasal area and their required complete surgical extirpation pose a significant challenge to the plastic surgeon, who is called to perform a suitable delicate reconstruction of produced nasal skin defects. The present study was aimed to examine the role of tumor characteristics in the prognosis of patients with nasal skin cancer undergoing surgical management.A retrospective review of 1795 patients operated on for nasal cutaneous neoplasms during a 26-year period is presented in our study. Descriptive statistics were appropriately calculated; multivariate Cox regression analysis was performed regarding the possible risk factors for recurrence. Only those with a complete follow-up were included in the study. The mean age of our study population was 66.7 years with a male majority (52.4%). Basal cell carcinoma appeared as the most common histological type (87.7%), followed by squamous cell carcinoma (7.9%); the latter correlated with poor prognosis.The nasal sidewalls were the most frequent lesion location (29.8%), followed by the alae (27.8%), dorsum (21.7%), and tip (19.3%). The columella was very rarely affected (0.5%) but was associated with increased recurrence [hazard ratio, 4.74; 95% confidence interval (CI), 1.12-20.00; P = 0.034]. Most patients were treated with elliptical excision and direct closure (58.7%). Local flaps (31.0%) and skin grafting (9.0%) proved very reliable surgical options, especially for larger, high-risk lesions. Recurrence transpired in 46 patients (2.6%) and 4 skin cancer-related deaths occurred.Surgical modality of choice should be individualized and carefully adjusted to patients' needs. Moreover, more elective techniques, such as Mohs micrographic surgery or cumulative therapeutic approaches, like irradiation, should be examined as a beneficial aid to confront high-risk malignancies. PMID:26207539

  12. Proton Beam Therapy for Unresectable Malignancies of the Nasal Cavity and Paranasal Sinuses

    Energy Technology Data Exchange (ETDEWEB)

    Zenda, Sadamoto, E-mail: szenda@east.ncc.go.jp [Division of Radiation Oncology, National Cancer Center Hospital East, Chiba (Japan); Kohno, Ryosuke; Kawashima, Mitsuhiko; Arahira, Satoko; Nishio, Teiji [Division of Radiation Oncology, National Cancer Center Hospital East, Chiba (Japan); Tahara, Makoto [Division of Gastrointestinal Oncology and Endoscopy, National Cancer Center Hospital East, Chiba (Japan); Hayashi, Ryuichi [Division of Head and Neck Surgery, National Cancer Center Hospital East, Chiba (Japan); Kishimoto, Seiji [Department of Head and Neck Surgery, Tokyo Medical and Dental University, Tokyo (Japan); Ogino, Takashi [Division of Radiation Oncology, National Cancer Center Hospital East, Chiba (Japan)

    2011-12-01

    Purpose: The cure rate for unresectable malignancies of the nasal cavity and paranasal sinuses is low. Because irradiation with proton beams, which are characterized by their rapid fall-off at the distal end of the Bragg peak and sharp lateral penumbra, depending on energy, depth, and delivery, provide better dose distribution than X-ray irradiation, proton beam therapy (PBT) might improve treatment outcomes for conditions located in proximity to risk organs. We retrospectively analyzed the clinical profile of PBT for unresectable malignancies of the nasal cavity and paranasal sinuses. Methods and Materials: We reviewed 39 patients in our database fulfilling the following criteria: unresectable malignant tumors of the nasal cavity, paranasal sinuses or skull base; N0M0 disease; and treatment with PBT (>60 GyE) from January 1999 to December 2006. Results: Median patient age was 57 years (range, 22-84 years); 22 of the patients were men and 17 were women. The most frequent primary site was the nasal cavity (n = 26, 67%). The local control rates at 6 months and 1 year were 84.6% and 77.0%, respectively. With a median active follow-up of 45.4 months, 3-year progression-free and overall survival were 49.1% and 59.3%, respectively. The most common acute toxicities were mild dermatitis (Grade 2, 33.3%), but no severe toxicity was observed (Grade 3 or greater, 0%). Five patients (12.8%) experienced Grade 3 to 5 late toxicities, and one treatment-related death was reported, caused by cerebrospinal fluid leakage Grade 5 (2.6%). Conclusion: These findings suggest that the clinical profile of PBT for unresectable malignancies of the nasal cavity and paranasal sinuses make it is a promising treatment option.

  13. 9 CFR 113.306 - Canine Distemper Vaccine.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of...

  14. Metastatic canine mammary carcinomas can be identified by a gene expression profile that partly overlaps with human breast cancer profiles

    International Nuclear Information System (INIS)

    Similar to human breast cancer mammary tumors of the female dog are commonly associated with a fatal outcome due to the development of distant metastases. However, the molecular defects leading to metastasis are largely unknown and the value of canine mammary carcinoma as a model for human breast cancer is unclear. In this study, we analyzed the gene expression signatures associated with mammary tumor metastasis and asked for parallels with the human equivalent. Messenger RNA expression profiles of twenty-seven lymph node metastasis positive or negative canine mammary carcinomas were established by microarray analysis. Differentially expressed genes were functionally characterized and associated with molecular pathways. The findings were also correlated with published data on human breast cancer. Metastatic canine mammary carcinomas had 1,011 significantly differentially expressed genes when compared to non-metastatic carcinomas. Metastatic carcinomas had a significant up-regulation of genes associated with cell cycle regulation, matrix modulation, protein folding and proteasomal degradation whereas cell differentiation genes, growth factor pathway genes and regulators of actin organization were significantly down-regulated. Interestingly, 265 of the 1,011 differentially expressed canine genes are also related to human breast cancer and, vice versa, parts of a human prognostic gene signature were identified in the expression profiles of the metastatic canine tumors. Metastatic canine mammary carcinomas can be discriminated from non-metastatic carcinomas by their gene expression profiles. More than one third of the differentially expressed genes are also described of relevance for human breast cancer. Many of the differentially expressed genes are linked to functions and pathways which appear to be relevant for the induction and maintenance of metastatic progression and may represent new therapeutic targets. Furthermore, dogs are in some aspects suitable as a

  15. CANINE DISTEMPER VIRUS ANTIBODY TITERS IN DOMESTIC CATS AFTER DELIVERY OF A LIVE ATTENUATED VIRUS VACCINE.

    Science.gov (United States)

    Ramsay, Edward; Sadler, Ryan; Rush, Robert; Seimon, Tracie; Tomaszewicz, Ania; Fleetwood, Ellen A; McAloose, Denise; Wilkes, Rebecca P

    2016-06-01

    Three methods for delivering a live attenuated canine distemper virus (CDV) vaccine to domestic cats ( Felis catus ) were investigated, as models for developing vaccination protocols for tigers (Panthera tigris). Twenty domestic cats were randomly divided into four treatment groups: saline injection (negative controls); and oral, intranasal, and subcutaneous vaccinates. Cats were injected with saline or a CDV vaccine (Nobivac DP, Merck) at wk 0 and 4. Blood and nasal swabs were collected at wk 0 (prior to the initial vaccination) and weekly thereafter for 9 wk. Urine samples were collected on wk 1 to 9 after initial vaccination. Forty-nine weeks following the initial vaccination series, three cats from the subcutaneous group and three cats from the intranasal group were revaccinated. Blood was collected immediately prior, and 7 and 21 days subsequent to revaccination. Nasal swabs and urine samples were collected from each cat prior to wk 49 revaccination and daily for 7 days thereafter. Nasal swabs and urine were analyzed by quantitative PCR for vaccine virus presence. Sera were tested for CDV antibodies by virus neutralization. All cats were sero-negative for CDV antibodies at the beginning of the study, and saline-injected cats remained sero-negative throughout the study. A dramatic anamnestic response was seen following wk 4 subcutaneous vaccinations, with titers peaking at wk 6 (geometric mean = 2,435.5). Following wk 49 revaccination, subcutaneous vaccinates again mounted impressive titers (wk 52 geometric mean = 2,048). Revaccination of the intranasal group cats at wk 49 produced a small increase in titers (wk 52 geometric mean = 203). CDV viral RNA was detected in six nasal swabs but no urine samples, demonstrating low viral shedding postvaccination. The strong antibody response to subcutaneous vaccination and the lack of adverse effects suggest this vaccine is safe and potentially protective against CDV infection in domestic cats. PMID:27468028

  16. The effect of nasalization on /a/ vowel formants before and after nasal consonant in 4-9-year old normal Persian speaking children

    OpenAIRE

    Kowsar Baghban; Farhad Torabinezhad; Negin Moradi; Akbar Biglarian

    2014-01-01

    Background and Aim : Nasalization of a vowel refers to the addition of nasal resonance to the vocal tract transfer function. Also, vowel nasalization occurs because of coarticulation. Coupling of the nasal resonating space to the oropharyngeal cavity alters the vocal tract formants in complex ways. The purpose of this study was to investigate the effect of nasalization on /a/ vowel formants in before and after nasal consonant.Methods: In current cross-sectional study, voice samples of 60 norm...

  17. Result of radiation therapy of sino-nasal cancers using partial attenuation filter

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jin Hee; Kim, Ok Bae; Choi, Tae Jin [Keimyung University College of Medicine, Daegu (Korea, Republic of)

    2007-06-15

    This study was to evaluate the survival and pattern of failure after radiation therapy of sino-nasal cancer using partial attenuation filer and wedged beams and to help radiotherapy planning of sino-nasal cancer. Between February 1992 and March 2003, 17 patients with sino-nasal cancers underwent radiation therapy using partial attenuation filter at Dongsan Medical Center, Keimyung university. There were 9 male and 8 female patients. Patients' age ranged from 40 to 75 years (median 59 years). There were 10 patients of maxillary sinus cancer, 7 patients of nasal cancer. The histologic type was squamous cell carcinoma in 11, adenoid cystic carcinoma in 4 and olfactory neuroblastoma in 2. The distribution of clinical stage by the AJCC system was 3 for stage II, 7 for III and 6 for IV. The five patients were treated with radiation alone and 12 patients were treated with surgery and postoperative radiation therapy. The range of total radiation dose delivered to the primary tumor was from 44 to 76 Gy (median 60 Gy). The follow-up period ranged from 3 to 173 months with median of 78 months. The overall 2 year survival rate and disease free survival rate was 76.4%. The 5 year and 10 year survival rate were 76.4% and 45.6% and the 5 year and 10 year disease free survival rate was 70.6%. The 5 year disease free survival rate by treatment modality was 91.6% for postoperative radiation group and 20% for radiation alone group, statistical significance was found by treatment modality ({rho} = 0.006). There were no differences in survival by pathology and stage. There were local failure in 5 patients (29%) but no distant failure and no severe complication required surgical intervention. Radiation therapy of sino-nasal cancer using partial attenuation filter was safe and effective. Combined modality with conservative surgery and radiation therapy was more advisable to achieve loco-regional control in sino-nasal cancer. Also we considered high precision radiation therapy with

  18. Nasal Carriage of 200 Patients with Nasal Bone Fracture in Korea

    Directory of Open Access Journals (Sweden)

    Jun Wook Lee

    2013-09-01

    Full Text Available Background Pathogens in the nasal cavity during nasal surgery could lead to a systemicinfectious condition, such as bacteremia, nosocomial infection, or toxic shock syndrome.However, there is no research about the prevalence of nasal carriage in patients with nasalbone fracture.Methods This was a prospective, double-blind, randomized study about the rate of nasalcarriage in 200 patients with nasal bone fracture in Korea. Nasal secretions were taken fromboth the middle nasal meatus and colonized. All analyses were carried out using SPSS software.Results Pathogens were identified in 178 of the 200 cases. Coagulase-negative staphylococci(CNS were the most cultured bacteria in 127 (66.84% of the 190 total patients after excluding10 cases of contaminated samples, and methicillin-resistant coagulase-negative staphylococci(MRCNS were found in 48 (25.26%. Staphylococcus aureus was the second mostidentified pathogen, found in 36 (18.95%, followed by 7 cases (3.68% of methicillin-resistantStaphylococcus aureus (MRSA. The prevalence rate of MRSA in the females was higher thanthat in the males (RR=4.70; 95% CI, 1.09-20.18, but other demographic factors had no effecton the prevalence rate of MRSA and MRCNS.Conclusions The prevalence rate of these pathogens in patients with nasal bone fracture inKorea was similar to other reports. However, few studies have addressed the prevalence rateof CNS and MRCNS in accordance with risk factors or the change in prevalence according tospecific prophylaxis against infectious complications. Additional research is needed on thepotential connections between clinical factors and microbiological data.

  19. Comparative Morphology and Histology of the Nasal Fossa in Four Mammals: Gray Squirrel, Bobcat, Coyote, and White-Tailed Deer.

    Science.gov (United States)

    Yee, Karen K; Craven, Brent A; Wysocki, Charles J; Van Valkenburgh, Blaire

    2016-07-01

    Although the anatomy of the nasal fossa is broadly similar among terrestrial mammals, differences are evident in the intricacies of nasal turbinal architecture, which varies from simple scroll-like to complex branching forms, and in the extent of nonsensory and olfactory epithelium covering the turbinals. In this study, detailed morphological and immunohistochemical examinations and quantitative measurements of the turbinals and epithelial lining of the nasal fossa were conducted in an array of species that include the gray squirrel, bobcat, coyote, and white-tailed deer. Results show that much more of the nose is lined with olfactory epithelium in the smallest species (gray squirrel) than in the larger species. In two species with similar body masses, bobcat and coyote, the foreshortened felid snout influences turbinal size and results in a decrease of olfactory epithelium on the ethmoturbinals relative to the longer canine snout. Ethmoturbinal surface area exceeds that of the maxilloturbinals in all four sampled animals, except the white-tailed deer, in which the two are similar in size. Combining our results with published data from a broader array of mammalian noses, it is apparent that olfactory epithelial surface area is influenced by body mass, but is also affected by aspects of life history, such as diet and habitat, as well as skull morphology, itself a product of multiple compromises between various functions, such as feeding, vision, and cognition. The results of this study warrant further examination of other mammalian noses to broaden our evolutionary understanding of nasal fossa anatomy. Anat Rec, 299:840-852, 2016. © 2016 Wiley Periodicals, Inc. PMID:27090617

  20. Prevalência das dermatopatias não-tumorais em cães do município de Santa Maria, Rio Grande do Sul (2005-2008 Prevalence of non-tumorous canine dermatopathies in dogs from the municipality of Santa Maria, Rio Grande do Sul, Brazil (2005-2008

    Directory of Open Access Journals (Sweden)

    Tatiana M. Souza

    2009-02-01

    prevalence of non-tumorous canine dermatopathies affecting dogs from the municipality of Santa Maria, Rio Grande do Sul, Brazil. From March 2005 to June de 2008, the authors followed-up canine dermatological cases from two sources: those referred to the Dermatology Sector of the Veterinary Teaching Hospital at the Universidade Federal de Santa Maria and those from a private practice. During this period 480 dogs with dermatological problems were examined; in 393 (81.9% it was possible to establish a definitive diagnosis and in 87 (18.1% the diagnosis was inconclusive. Four hundred and twenty four primary diagnosis and 78 secondary diagnosis were performed in the 393 dogs with conclusive diagnosis, totaling 502 diagnosis. The distribution of the diagnosis according to the categories of diagnosed dermatopathies was as follows: Allergic (190/502 [37.8%], bacterial (103/502 [20.5%], parasitic (97/502 [19.3%], environmental (28/502 [5,6%], mycotic (20/502 [4.0%], endocrine (13/502 [2.6%], keratinization disturbances (11/502 [2.2%], psychogenic (9/502 [1.8%], acquired alopecias (6/502 [1.2%], autoimmune (6/502 [1.2%], inherited (6/502 [1.2%], pigmentary disturbances (1/502 [0.2%], nutritional (1/502 [0.2%], and sundry conditions (11/502 [2.2%]. In general, the ten most frequently diagnosed non-tumorous dermatopathies in decreasing order of frequency were: Atopy, flea bite allergic dermatitis, bacterial folliculitis, demodectic mange, deep bacterial folliculitis/furunculosis, sarcoptic mange, myiasis, food allergy, traumatic pyoderma, and Malassezia dermatitis. These 10 conditions together made up approximately for three quarters of all canine skin diseases diagnosed in the current study.

  1. Extranodal NK/T-cell lymphoma, nasal type of the uterine cervix: A case report.

    Science.gov (United States)

    Omori, Makiko; Oishi, Naoki; Nakazawa, Tadao; Nakazawa, Kumiko; Mitsumori, Toru; Yuminamochi, Tsutomu; Kirito, Keita; Hirata, Shuji

    2016-05-01

    We report a rare case of extranodal NK/T-cell lymphoma, nasal type of the uterine cervix that showed cytologic features mimicking cervical cancer. A 65-year-old woman presented with vaginal bleeding. Gynecological examination revealed a bulky tumor of the cervix. A conventional Papanicolaou-stained cervical smear showed hypercellularity consisting of numerous variably sized cohesive clusters that mimicked epithelial tumors, with a necrotic and inflammatory background. A small number of individually scattered cells were also identified. These scattered cells showed pleomorphic, often cleaved, or horseshoe-shaped nuclei and pale cytoplasm. Biopsy specimens revealed a diffuse growth of atypical cells with an angiocentric pattern. Extensive necrosis and infiltration of inflammatory cells were present. There were numerous mitotic figures. The tumor cells were positive for CD45RO, CD3ε, CD56, granzyme B, TIA-1, CD7, and Epstein-Barr virus (EBV)-encoded small RNA (EBER) by in situ hybridization, and negative for cytokeratin, chromogranin A, synaptophysin, CD4, CD5, CD8, CD20, and CD30. Based on these findings, this tumor was diagnosed as extranodal NK/T-cell lymphoma, nasal type of the uterine cervix. Diagn. Cytopathol. 2016;44:430-433. © 2016 Wiley Periodicals, Inc. PMID:26872300

  2. External nasal dilators: definition, background, and current uses

    Directory of Open Access Journals (Sweden)

    Dinardi RR

    2014-11-01

    Full Text Available Ricardo Reis Dinardi, Cláudia Ribeiro de Andrade, Cássio da Cunha Ibiapina Department of Pediatrics, Pediatric Pulmonology Unit, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil Abstract: Our goal was to revise the literature about external nasal dilators (ENDs as to their definition, history, and current uses. We reviewed journals in the PubMed and MEDLINE databases. The current uses hereby presented and discussed are physical exercise, nasal congestion and sleep, snoring, pregnancy, cancer, and healthy individuals. Numerous studies have shown that ENDs increase the cross-sectional area of the nasal valve, reducing nasal resistance and transnasal inspiratory pressure and stabilizing the lateral nasal vestibule, avoiding its collapse during final inspiration. These effects also facilitate breathing and are beneficial to patients with nasal obstruction. Furthermore, END use is simple, noninvasive, painless, affordable, and bears minimum risk to the user. Most studies have limited sample size and are mainly focused on physical exercise. In conclusion, ENDs seem useful, so further studies involving potential effects on the performance of physical tests and improvements in sleep quality are necessary, especially in children and teenagers. Keywords: external nasal dilator, nasal valve, nasal congestion, nasal resistance

  3. Differential Diagnosis of Chronic Rhinosinusitis with Nasal Polyps.

    Science.gov (United States)

    London, Nyall R; Reh, Douglas D

    2016-01-01

    Nasal polyps are semi-translucent mucosal outgrowths of the paranasal sinuses which typically arise in the setting of chronic rhinosinusitis (CRS). Nasal polyps are also associated with asthma, aspirin sensitivity, cystic fibrosis and allergic fungal rhinosinusitis (AFS). The majority of nasal polyps are bilateral and characterized by tissue edema and eosinophil infiltration. Patients with nasal polyps often present with complaints including nasal obstruction, congestion, rhinorrhea or altered sense of smell. The differential diagnosis ranges from benign masses such as schneiderian papilloma, antrochoanal polyp, angiofibroma and encephalocele to malignant neoplasms such as squamous cell carcinoma (SCC), esthesioneuroblastoma, nasal lymphoma and rhabdomyosarcoma. These lesions may have a similar appearance as nasal polyps and particular attention to an alternative diagnosis for nasal polyps should be entertained if the mass is unilateral or congenital in nature. Workup for patients with a unilateral mass should include radiographic imaging, possible biopsy and careful follow-up when appropriate. Here, we review the disease etiology of nasal polyps and describe the approach to the patient with nasal polyps with emphasis on differential diagnosis and workup. PMID:27466841

  4. Three-dimensional magnetic resonance reconstruction images before and after surgical therapy of spontaneous canine brain tumors Imagens de reconstrução tri-dimensional por ressonância magnética antes e depois de tratamento cirúrgico de tumores cerebrais espontâneos caninos

    Directory of Open Access Journals (Sweden)

    Julio Carlos Canola

    2007-08-01

    Full Text Available Specific software was used for reconstruction of spontaneous intracranial tumor volume from magnetic resonance images (MRI in three dogs. Histopathologically confirmed meningioma, cystic meningioma, and choroid plexus tumors were evaluated before and after surgery. The software allowed the whole-volume segmentation of the skin, brain, tumor, edema, and cyst. Manipulation of the three-dimensional images (3D allowed visualization of all anatomical structures, aided clinical understanding, surgical planning, and treatment monitoring.Um programa de computador específico foi utilizado para reconstrução do volume tumoral intracraniano espontâneo por imagens de ressonância magnética (IRM em três cães. Tumores histopatologicamente confirmados como meningioma, meningioma cístico e tumor do plexo coróide foram avaliados antes e após cirurgia. O programa de computador permitiu a segmentação por completo da pele, do cérebro, do tumor, do edema e do cisto. A manipulação das imagens tridimensionais permitiu a visibilização de todas as estruturas anatômicas, além da compreensão clínica, do planejamento cirúrgico e da monitorização do tratamento.

  5. Characterization of STAT3 activation and expression in canine and human osteosarcoma

    International Nuclear Information System (INIS)

    Dysregulation of signal transducer and activator of transcription 3 (STAT3) has been implicated as a key participant in tumor cell survival, proliferation, and metastasis and is often correlated with a more malignant tumor phenotype. STAT3 phosphorylation has been demonstrated in a subset of human osteosarcoma (OSA) tissues and cell lines. OSA in the canine population is known to exhibit a similar clinical behavior and molecular biology when compared to its human counterpart, and is often used as a model for preclinical testing of novel therapeutics. The purpose of this study was to investigate the potential role of STAT3 in canine and human OSA, and to evaluate the biologic activity of a novel small molecule STAT3 inhibitor. To examine STAT3 and Src expression in OSA, we performed Western blotting and RT-PCR. OSA cells were treated with either STAT3 siRNA or small molecule Src (SU6656) or STAT3 (LLL3) inhibitors and cell proliferation (CyQUANT), caspase 3/7 activity (ELISA), apoptosis (Western blotting for PARP cleavage) and/or viability (Wst-1) were determined. Additionally, STAT3 DNA binding after treatment was determined using EMSA. Expression of STAT3 targets after treatment was demonstrated with Western blotting, RT-PCR, or gel zymography. Our data demonstrate that constitutive activation of STAT3 is present in a subset of canine OSA tumors and human and canine cell lines, but not normal canine osteoblasts. In both canine and human OSA cell lines, downregulation of STAT3 activity through inhibition of upstream Src family kinases using SU6656, inhibition of STAT3 DNA binding and transcriptional activities using LLL3, or modulation of STAT3 expression using siRNA, all resulted in decreased cell proliferation and viability, ultimately inducing caspase-3/7 mediated apoptosis in treated cells. Furthermore, inhibition of either Src or STAT3 activity downregulated the expression of survivin, VEGF, and MMP2, all known transcriptional targets of STAT3. These data

  6. SEPTOPLASTY WITH AND WITHOUT NASAL PACKING: A COMPARATIVE STUDY

    Directory of Open Access Journals (Sweden)

    Mitta

    2016-05-01

    Full Text Available Septoplasty is one of the most commonly performed surgeries in rhinology to relieve nasal obstruction of patients with distortion in the midline cartilage or septum of the nose to relieve nasal obstruction of patient and findings consistent with nasal endoscopy. The anterior nasal packing routinely done following septoplasty is usually conventional and not evidence based. The purpose of nasal packing is to obtain haemostasis, enhance opposition of septal flaps, avoid septal haematoma formation, close the dead space, avoid synechiae formation, provide support to septal cartilage and prevent its displacement. OBJECTIVE This study intends to evaluate the effects of nasal packing on surgical success and related complications in septoplasty. MATERIALS AND METHODS The present clinical prospective and randomised study was carried out on patients attending Otorhinolaryngology Department of Santhiram Medical College & General Hospital between March 2012 and March 2015. Patients undergoing septoplasty were randomised either to receive anterior nasal packing or to not receive nasal packing postoperatively. RESULTS Levels of pain experienced by patients with nasal packing postoperatively during the initial 24 hours postoperatively and during the removal of the pack were significantly more. Post-operative headache, epiphora, swallowing discomfort and sleep disturbance were more in patients with nasal packing and statistically (p.05. Septal haematoma, adhesions and local infections in both groups were statistically insignificant (p>.05. CONCLUSION Septoplasty enhances the standard of living of patients with septal deviation and nasal obstruction. Our study results suggest that nasal packing after septoplasty is not obligatory. Nasal packing causes considerably more pain and complications, and it should be reserved only for those who have bleeding predisposition.

  7. Fundus imaging with a nasal endoscope

    Directory of Open Access Journals (Sweden)

    P Mahesh Shanmugam

    2015-01-01

    Full Text Available Wide field fundus imaging is needed to diagnose, treat, and follow-up patients with retinal pathology. This is more applicable for pediatric patients as repeated evaluation is a challenge. The presently available imaging machines though provide high definition images, but carry the obvious disadvantages of either being costly or bulky or sometimes both, which limits its usage only to large centers. We hereby report a technique of fundus imaging using a nasal endoscope coupled with viscoelastic. A regular nasal endoscope with viscoelastic coupling was placed on the cornea to image the fundus of infants under general anesthesia. Wide angle fundus images of various fundus pathologies in infants could be obtained easily with readily available instruments and without the much financial investment for the institutes.

  8. Early eruption of permanent canines

    Directory of Open Access Journals (Sweden)

    S Madhu

    2012-01-01

    Full Text Available Systemic and local factors can modify the eruption time of teeth. Generalized eruption time changes could be due to some systemic diseases like hyperthyroidism, hypophosphatasia, precocious puberty, Proteus syndrome, etc. Localized early eruption of permanent teeth could be due to early extraction of deciduous teeth. Presented here is an extremely rare case of early eruption of permanent canines in a 7-year old female child. Though the number of such cases is very limited, the clinician should poses adequate knowledge and keeps an open eye to identify such cases.

  9. Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

    International Nuclear Information System (INIS)

    Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

  10. Assessment of the effect of deviated nasal septum on the structure of nasal cavity.

    Science.gov (United States)

    Wang, Junguo; Dou, Xin; Liu, Dingding; Song, Panpan; Qian, Xiaoyun; Wang, Shoulin; Gao, Xia

    2016-06-01

    The present study was aimed to investigate the effects of DNS on the structure of nasal cavity. The paranasal sinus coronal view CT of 108 patients with DNS and 129 hospitalized patients without DNS was retrospectively analyzed. The transverse diameter of nasal cavity (a), transverse diameter of nasal cavity and paranasal sinus (b), angle between maxillary and palatal bone, interalveolar distance, and maxillary rotation distance were measured. The ratio of a/b in experimental group was 0.367 ± 0.006 which was significantly (P = 0.0023) less than that in control group (0.391 ± 0.005). For the angle between maxillary and palatal bone, there was no significant difference found between DNS and control group for both right and left sides. The interalveolar distance was 40.75 mm in experimental group, and 38.8 mm in control (P = 0.0002). For the maxillary rotation distance, findings were considered as significant (P DNS affects the development of nasal cavity and paranasal sinus, as well as increases the interalveolar distance and maxillary rotation distance. These influences may be caused by the alteration of airflow inside the nasal cavities. PMID:26370235

  11. Reconstructing the extended nasal tip defect.

    Science.gov (United States)

    Mobley, Steven

    2013-10-01

    Reconstruction of large facial defects requires surgical skill, an understanding of engineering principles, an artistic eye, and patience to design the most elegant solution for each patient. Extended nasal tip defects, which may involve additional facial subunits, require even more thoughtful analysis and planning. Reconstructive surgeons need to be aware of the pros and cons of various options for flaps, the use of a delay stage, and sequencing and scheduling of staged operations to achieve an optimal outcome. PMID:24037937

  12. Brain-Targeted Nasal Clonazepam Microspheres

    OpenAIRE

    Shaji J; Poddar A; Iyer S

    2009-01-01

    Gelatin-chitosan mucoadhesive microspheres of clonazepam were prepared using the emulsion cross linking method. Mirospheres were evaluated using the in vitro and ex vivo drug release patterns. In vivo CNS drug distribution studies were carried out in rats by administering the clonazepam microspheres intra-nasally and clonazepam solution intravenously. From the drug levels in plasma and CSF, drug targeting index and drug targeting efficiency were calculated. Results obtained indicated that int...

  13. BLIND NASAL INTUBATION IN CRANIOROFACIAL TRAUMA

    Directory of Open Access Journals (Sweden)

    K.R.DavidThakaran

    2013-09-01

    Full Text Available Restricted mouth opening presents one of the greatest challenges to the anesthetist for endotracheal intubation and ventilation. Awake blind nasal intubation has been one of the finest and favored techniques for intubation in previous decades for restricted mouth opening patients. A coordinated team approach, monitoring and adequate counseling of the patient is mandatory for the airway management to carry out a safe surgical procedure

  14. Genome aberrations in canine mammary carcinomas and their detection in cell-free plasma DNA.

    Directory of Open Access Journals (Sweden)

    Julia Beck

    Full Text Available Mammary tumors are the most frequent cancers in female dogs exhibiting a variety of histopathological differences. There is lack of knowledge about the genomes of these common dog tumors. Five tumors of three different histological subtypes were evaluated. Massive parallel sequencing (MPS was performed in comparison to the respective somatic genome of each animal. Copy number and structural aberrations were validated using droplet digital PCR (ddPCR. Using mate-pair sequencing chromosomal aneuploidies were found in two tumors, frequent smaller deletions were found in one, inter-chromosomal fusions in one other, whereas one tumor was almost normal. These aberrations affect several known cancer associated genes such as cMYC, and KIT. One common deletion of the proximal end of CFA27, harboring the tumor suppressor gene PFDN5 was detected in four tumors. Using ddPCR, this deletion was validated and detected in 50% of tumors (N = 20. Breakpoint specific dPCRs were established for four tumors and tumor specific cell-free DNA (cfDNA was detected in the plasma. In one animal tumor-specific cfDNA was found >1 year after surgery, attributable to a lung metastasis. Paired-end sequencing proved that copy-number imbalances of the tumor are reflected by the cfDNA. This report on chromosomal instability of canine mammary cancers reveals similarities to human breast cancers as well as special canine alterations. This animal model provides a framework for using MPS for screening for individual cancer biomarkers with cost effective confirmation and monitoring using ddPCR. The possibility exists that ddPCR can be expanded to screening for common cancer related variants.

  15. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies

    OpenAIRE

    J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides

    2002-01-01

    Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...

  16. Status of glutathione in nasal epithelium

    International Nuclear Information System (INIS)

    During inhalation exposure to air-born toxicants, the nasal epithelium may be subjected to local toxicity. Since glutathione (GSH) is often involved in xenobiotic metabolism, GSH status in these tissues has been examined. GSH content and apparent first-order rate constants for GSH content and apparent first-order rate constants for GSH turnover and synthesis were determined for respiratory epithelium covering the anterior ventral septum, olfactory epithelium covering the dorsal posterior septum, olfactory epithelium covering the dorsal meatus from male Fischer rats. The three tissues had similar concentrations of GSH (approximately 3-3.4 umol/g tissue) as determined by the Ellman's assay or by HPLC equipped with an electrochemical detector. Animals were administered [35S]Cysteine (Cys) by tail vein injection and rate constants were estimated, after incorporation of Cys into tissue GSH pools, by the decrease in GSH specific activity 1-102 hr after administration. Total [35S]GSH was analyzed by HPLC with a flow-through radioactivity detector. The three nasal epithelial tissues had similar apparent biphasic rates of GSH turnover, with rapid-phase half-lives of less than 10 hr and slow-phase half-lives of approximately 30 hr. The high GSH concentrations and the apparent rapid GSH turnover may facilitate the GSH-mediated detoxification within nasal tissue

  17. Evaluation of Fluticasone (Flixonase Nasal Spray Versus Beclomethasone (Beconase Nasal Spray in the Treatment of Allergic Rhinitis

    Directory of Open Access Journals (Sweden)

    Reza Farid

    2003-12-01

    Full Text Available Although response to intranasal steroid therapy has been reported in pa¬tients with allergic rhinitis, efficacy of some nasal steroids is noteworthy.This study was undertaken to evaluate the efficacy of a two-week course of Fluticasone (Flixonase nasal spray vs. Beclomethasone (beconase nasal spray in patients with symptoms of allergic rhinitis referred to our clinic. This study reviewed sixty randomized studies with symptoms of allergic rhinitis which sup¬ported common aeroallergens with skin prick test. Patients received a total daily dose of nasal spray of Fluticasone (Flixonase 100 meg bid (N=30 compared with patients with allergic rhinitis who received a total daily dose of Beclomethasone (Beconase 50mcg 2 puffs bid (N=30. Patients were visited before and after therapy, and efficacy of Flixonase. and Beconase was evaluated by the change in nasal symptoms including: nasal discharge, nasal obstruction, nasal itching, and sneezing. After two weeks of treatment nasal symptoms of blockage, discharge, sneezing and itching were significantly better in the group treated with Fluticasone nasal spray (65%, 82%, 67%, 79% respectively (/?100 meg bid Flixonase (Fluticasone intranasal spray is more effective than 50 meg 2 puffs bid Beconase (Beclomethasone intranasal spray. Like asthma, allergic rhinitis is an inflammatory disease and should be managed with anti-in¬flammatory medication.

  18. In Vitro Action of Flavonoids in the Canine Malignant Histiocytic Cell Line DH82

    OpenAIRE

    Gabriel Silva; Ana Lúcia Fachin; Beleboni, Renê de O; Suzelei C. França; Mozart Marins

    2013-01-01

    Cancer is commonly diagnosed in dogs over the age of 10 and is a leading cause of death due to the lack of effective drugs. Flavonoids possess antioxidant, anti-inflammatory and anticarcinogenic properties and have been studied as chemopreventive agents in human cancer therapy. However, the literature on dogs is sparse. In this study, we analyzed the effect of nine flavonoids on cell viability, DNA damage and topoisomerase IIa/IIb gene expression in a canine tumor cell line (DH82). Apigenin, ...

  19. Anticancer Effects of Geopropolis Produced by Stingless Bees on Canine Osteosarcoma Cells In Vitro

    OpenAIRE

    Naiara Costa Cinegaglia; Paulo Ricardo Oliveira Bersano; Maria José Abigail Mendes Araújo; Michelle Cristiane Búfalo; José Maurício Sforcin

    2013-01-01

    Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA) cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geop...

  20. Anti-Influenza Neuraminidase Inhibitor Oseltamivir Phosphate Induces Canine Mammary Cancer Cell Aggressiveness

    OpenAIRE

    Joana T de Oliveira; Santos, Ana L.; Catarina Gomes; Rita Barros; Cláudia Ribeiro; Nuno Mendes; de Matos, Augusto J.; M. Helena Vasconcelos; Maria José Oliveira; Celso A Reis; Fátima Gärtner

    2015-01-01

    Oseltamivir phosphate is a widely used anti-influenza sialidase inhibitor. Sialylation, governed by sialyltransferases and sialidases, is strongly implicated in the oncogenesis and progression of breast cancer. In this study we evaluated the biological behavior of canine mammary tumor cells upon oseltamivir phosphate treatment (a sialidase inhibitor) in vitro and in vivo. Our in vitro results showed that oseltamivir phosphate impairs sialidase activity leading to increased sialylation in CMA0...

  1. Modulation of carbohydrate residues in regenerative nodules and neoplasms of canine and feline pancreas.

    OpenAIRE

    Skutelsky, E.; Alroy, J.; Ucci, A. A.; Carpenter, J.L.; Moore, F. M.

    1987-01-01

    The glycoconjugates of regenerative acinar cells, acinic cell carcinomas, islet cell tumors, and normal canine and feline pancreas were studied. The authors used biotinylated lectins as probes and avidin-biotin-peroxidase complex as visualant to identify and to compare the distribution of carbohydrate residues on paraffin sections from 74 cases. The findings demonstrate a difference in the staining pattern between normal acinar, islet, and ductal cells in each species and small differences in...

  2. Anatomical study of nasal cartilage in buffalo (Bubalus bubulus

    Directory of Open Access Journals (Sweden)

    Mahdi Yeganehzad

    2011-07-01

    Full Text Available This study used ten heads of adult buffalo taken from slaughterhouse. After transferring the samples to the anatomy hall, a split was carefully created on skin of muzzle and the skin was slowly separated from muscles and hypodermal connective tissue. Place of connection of cartilages to bone, cartilages to each other and shape of the cartilages were specified. In buffalo, nose apex has two nostrils fixed by bone and cartilage. After identifying and separating the cartilages, it was found that nasal cartilages in buffalo consisted of: 1 septum nasal located between two nostrils and reinforces it from inside. 2 dorso-lateral nasal cartilage constituting dorsal and lateral parts of the nostril. 3 ventro-lateral nasal cartilage constituting ventral and lateral parts of the nostril. 4 lateral accessory cartilage constituting lateral and ventral parts of the nostril. 5 medial accessory nasal cartilage located at Alar fold and connected to ventro-lateral nasal cartilage.

  3. Dialectal and gender differences in nasalance for a Mandarin population.

    Science.gov (United States)

    Kim, Ha-Kyung; Yu, Xiao-Meng; Cao, Yan-Jing; Liu, Xiao-Ming; Huang, Zhao-Ming

    2016-01-01

    The purpose of this study was to determine whether there are dialectal and gender related differences in nasalance of main Mandarin vowels and three sentences in 400 Chinese normal adults. The mean nasalance score difference for dialect and gender was significant (p Beijing > Shanghai > Guangzhou for the nasal sentence, oro-nasal sentence, /a/, /i/ and /u/. In addition, the average nasalance scores of females were higher than those of males for all speech materials in all dialects. The clinical significance of this study can be helpful in making nasalance clinical decisions for Chinese people with cleft palate, hearing disorders and dysarthria with resonance disorders. It also shows the theoretical and socio-cultural features for linguists considering dialects and gender. PMID:26853731

  4. Prognostic markers of canine pyometra

    Directory of Open Access Journals (Sweden)

    M.C. Sant'Anna

    2014-12-01

    Full Text Available The pyometra is a disease that affects middle age and elderly female dogs during diestrus. Hormonal, microbiological, biochemical and hematological aspects are well described. However, few studies have evaluated the role of each in the prognosis of canine pyometra. The aim of this study was to identify markers associated with clinical worsening of dogs with pyometra. We prospectively evaluated 80 dogs with pyometra treated surgically. Group 1 consisted of dogs that were discharged within 48 hours after surgery and Group 2 consisted of those who required prolonged hospitalization or died. The findings of hematological, biochemical and blood lactate levels were compared between groups and variables such as bacterial multidrug resistance, systemic inflammatory response syndrome (SIRS, hyperlactatemia and increased creatinine were analyzed through the dispersion of frequencies between groups. Among the variables studied, the presence of SIRS and elevated serum creatinine >2.5mg/mL were effective in predicting the worsening of the disease and can be used as prognostic markers of canine pyometra.

  5. Mesenchymal stem cells with rhBMP-2 inhibits the growth of canine osteosarcoma cells

    Directory of Open Access Journals (Sweden)

    Grassi Rici Rose

    2012-02-01

    Full Text Available Abstract Background The bone morphogenetic proteins (BMPs belong to a unique group of proteins that includes the growth factor TGF-β. BMPs play important roles in cell differentiation, cell proliferation, and inhibition of cell growth. They also participate in the maturation of several cell types, depending on the microenvironment and interactions with other regulatory factors. Depending on their concentration gradient, the BMPs can attract various types of cells and act as chemotactic, mitogenic, or differentiation agents. BMPs can interfere with cell proliferation and the formation of cartilage and bone. In addition, BMPs can induce the differentiation of mesenchymal progenitor cells into various cell types, including chondroblasts and osteoblasts. The aim of this study was to analyze the effects of treatment with rhBMP-2 on the proliferation of canine mesenchymal stem cells (cMSCs and the tumor suppression properties of rhBMP-2 in canine osteocarcoma (OST cells. Osteosarcoma cell lines were isolated from biopsies and excisions of animals with osteosarcoma and were characterized by the Laboratory of Biochemistry and Biophysics, Butantan Institute. The mesenchymal stem cells were derived from the bone marrow of canine fetuses (cMSCs and belong to the University of São Paulo, College of Veterinary Medicine (FMVZ-USP stem cell bank. After expansion, the cells were cultured in a 12-well Transwell system; cells were treated with bone marrow mesenchymal stem cells associated with rhBMP2. Expression of the intracytoplasmic and nuclear markers such as Caspase-3, Bax, Bad, Bcl-2, Ki-67, p53, Oct3/4, Nanog, Stro-1 were performed by flow citometry. Results We evaluated the regenerative potential of in vitro treatment with rhBMP-2 and found that both osteogenic induction and tumor regression occur in stem cells from canine bone marrow. rhBMP-2 inhibits the proliferation capacity of OST cells by mechanisms of apoptosis and tumor suppression mediated by p

  6. Estimating canine tooth crown height in early Australopithecus.

    Science.gov (United States)

    Plavcan, J Michael; Ward, Carol V; Paulus, Faydre L

    2009-07-01

    Canine tooth size reduction and the associated reduction in canine dimorphism is a basal hominin character that also provides important evidence for models of behavioral evolution. Two specimens of Australopithecus anamensis (KNM-KP 29287 and KNM-KP 29283) that do not preserve the canine crown, but do preserve the root or alveolus, appear to suggest that canine size variation and canine dimorphism in this species may have been greater than in other hominins. We evaluate canine root and crown dimensions in a series of extant hominoids, and estimate canine crown height in Australopithecus afarensis and A. anamensis. Our results demonstrate that it is possible to generate estimates of canine crown height from basal canine crown and root dimensions with a moderate degree of accuracy. Estimates of maxillary canine crown size for A. anamensis are slightly larger than those of A. afarensis, and are approximately the same size as canines of modern female chimpanzees. Estimated mandibular canine crown height is very similar in the two species. Variation within the A. anamensis sample of estimated canine crown heights is similar to that of modern humans, suggesting a low degree of sexual dimorphism. Inclusion of estimates for KNM-KP 29287 and KNM-KP 29283 does not substantially increase either the estimate of overall canine size or variation for A. anamensis. PMID:19482334

  7. Nasal Septal Perforation Caused by Invasive Fungal Sinusitis

    Directory of Open Access Journals (Sweden)

    Wai-Tin Kuo

    2002-11-01

    Full Text Available Nasal septal perforation presents a distinct challenge to otorhinolaryngologists, and is aproblem for patients. Although it has a variety of causes, previous septal surgery is the mostcommon reason. We present a 57-year-old woman who had recurrent chronic sinusitis. Aleft nasal mass was noted and excised via endoscopic sinus surgery. Invasive aspergillosissinusitis was proven both grossly and histopathologically, and a nasal septal perforation wasalso noted during the operation. Although there has been only a single other case presentedby Siberry in 1997, we postulate that perforation of the nasal septum as with the casedescribed herein is a rare complication of invasive fungal sinusitis.

  8. Patient experience with mupirocin or povidone-iodine nasal decolonization.

    Science.gov (United States)

    Maslow, Jed; Hutzler, Lorraine; Cuff, Germaine; Rosenberg, Andrew; Phillips, Michael; Bosco, Joseph

    2014-06-01

    Led by the federal government, the payers of health care are enacting policies designed to base provider reimbursement on the quality of care they render. This study evaluated and compared patient experiences and satisfaction with nasal decolonization with either nasal povidone-iodine (PI) or nasal mupirocin ointment (MO). A total of 1903 patients were randomized to undergo preoperative nasal decolonization with either nasal MO or PI solution. All randomized patients were also given 2% chlorhexidine gluconate topical wipes. Patients were interviewed prior to discharge to assess adverse events and patient experience with their assigned preoperative antiseptic protocol. Of the 1903 randomized patients, 1679 (88.1%) were interviewed prior to discharge. Of patients receiving PI, 3.4% reported an unpleasant or very unpleasant experience, compared with 38.8% of those using nasal MO (P.05). Being recruited as an active participant in surgical site infection prevention was a positive experience for 87.2% of MO patients and 86.3% of PI patients (P=.652). Those assigned to receive PI solution preoperatively reported significantly fewer adverse events than the nasal MO group (P<.01). Preoperative nasal decolonization with either nasal PI or MO was considered somewhat or very helpful by more than two-thirds of patients. PMID:24972440

  9. Delayed Phase Nasal Metastasis of Renal Cell Carcinoma as a Rare Epistaxis Cause

    Directory of Open Access Journals (Sweden)

    Kerem Ozturk

    2014-03-01

    Full Text Available    Malign tumors of sinonasal area composes %1 of malignant tumors in adults and %3 of head and neck malignities. Metastasis to this area is rare but malignities that metastatic to head and neck and below down clavicula, renal cell carcinoma (RCC is the third after lung and breast cancer . As the most frequent malignancy of kidney, RCC is generally seen in male over 40 year old and forms %3 of malign tumors in adults and in RCC cases %8 of disease arises by the metastasis to head and neck which is accepted as a bad prognostic factor. In this case report, a 81 year old male patient is presented with literature datas who is underwent nephrectomy 8 years ago for RCC and referred with recurrent epistaxis and delayed phase nasal RCC metastasis.

  10. Upper respiratory tract tumors in Cpb:WU (Wistar random) rats.

    Science.gov (United States)

    Feron, V J; Woutersen, R A; van Garderen-Hoetmer, A; Dreef-van der Meulen, H C

    1990-01-01

    A survey is given of upper respiratory tract tumors in Cpb:WU (Wistar random) rats. Data were collected from ten 24- to 30-month toxicity/carcinogenicity studies and from one 12-month study. Nasal tumors may lead to dyspnea, mouth breathing, and nasal discharge. These clinical signs mainly occurred in rats bearing squamous cell carcinomas. The large nasal tumors were often osteolytic, they invaded the subcutis over the premaxilla, resulting in swellings on the back of the nose, and extended into the brain. The incidence of nasal tumors in untreated male controls was 1.1% (7/661), the tumors invariably being squamous cell carcinomas. There were no nasal tumors found in untreated female controls. The type of compound-induced nasal tumor most frequently observed was adenocarcinoma (of the olfactory epithelium) followed, in order of decreasing incidence, by squamous cell carcinoma, carcinoma in situ, polypoid adenoma, Schwannoma, and carcinosarcoma. It was proposed that adenocarcinomas of the olfactory epithelium should be classified as neuroepitheliomas. It was also suggested that squamous cell carcinomas, seen in association with necrotizing inflammation of an incisor tooth, should be considered as part of the malocclusion syndrome. No spontaneous tracheal tumors were observed, and only one out of 422 untreated female controls (0.2%) was seen to have a laryngeal tumor, an adenoma. Induced laryngeal tumors included carcinoma in situ, squamous cell carcinoma, and adenocarcinoma. Squamous cell carcinoma was the only type of treatment-related tracheal tumor found. The incidences of induced laryngeal and tracheal tumors were very low, and in no case were these tumors statistically significantly different from the respective incidences in controls. Images PLATE 1. PLATE 2. PLATE 3. PLATE 4. PLATE 5. PLATE 6. PLATE 7. PLATE 8. PLATE 9. PLATE 10. PLATE 11. PLATE 12. PLATE 13. PLATE 14. PLATE 15. PMID:2384064

  11. A comparison of beclomethasone dipropionate aqueous nasal spray and beclomethasone dipropionate pressurized nasal spray in the management of seasonal rhinitis.

    OpenAIRE

    Dunn, A. M.; Wilson, R.S.; Baggott, P. J.

    1984-01-01

    Forty patients with seasonal rhinitis and a proven sensitivity to pollens were studied for 2 weeks during the pollen season of 1982. The study was carried out according to a double-blind, double-dummy design. All patients received 100 micrograms beclomethasone dipropionate (BDP) into each nostril twice daily (400 micrograms/day) on a randomized basis, from either the aqueous nasal spray or the pressurized nasal spray (Beconase Nasal Spray). Analysis of patients' symptom scores, additional sym...

  12. THE CORRELATION BETWEEN DERIVED NASALANCE MEASURES AND PERCEIVED NASALITY IN CHILDREN WITH REPAIRED CLEFT LIP AND PALATE

    Directory of Open Access Journals (Sweden)

    Attuluri Navya

    2014-04-01

    Full Text Available Context: Velopharyngeal dysfunction (VPD is one of the associated condition reported in individuals with repaired cleft lip and palate (RCLP leading to hypernasality. Nasality can be assessed by nasometer through nasalance values. But, mean nasalance values (N found to be overlapping between individuals with RCLP and normals. To overcome these limitations Nasalance Distance (ND and Nasalance Ratio (NR are derived based on nasalance range. Aims: The study is aimed to evaluate, correlate and compare acoustical (N, ND & NR and perceptual measures of nasality between the children with RCLP and control group. Settings and Design: Institutional setup and standard group comparison design Methods and Material: The study included fifteen children with RCLP ranging from 6 to 11 years and the control group consists of age and gender matched 15 typically developing children. Four point standard rating scale was used to rate the hypernasality by three speech language pathologists (SLP’s and Nasometer was used to measure the mean and derived nasalance scores for vowels and sentences in Kannada. Statistical analysis: SPSS, Cronbach’s Alpha test, multivariate analysis and Pearson’s product movement correlation were used to analyze the data. Results: Significant increase in the mean nasalance value and NR was seen in children with RCLP than the control group, whereas ND was contrary. ND was highly correlated with perceived nasality than N. The NR of sentences shows high negative correlation. Conclusions: The measures based on range of nasalance can be adapted to the routine clinical examinations for better correlation with perceived nasality.

  13. The effectiveness of nasal surgery on psychological symptoms in patients with obstructive sleep apnea and nasal obstruction.

    Science.gov (United States)

    Xiao, Yang; Han, Demin; Zang, Hongrui; Wang, Danni

    2016-06-01

    Conclusion Nasal obstruction can aggravate the psychological status of OSA patients, and nasal surgery should reduce this aggravation. Nasal surgery significantly improved sleep latency and ameliorated several polysomnographic characteristics. Background The aim of this study was to investigate the psychological status of patients with obstructive sleep apnea (OSA) and nasal obstruction and to evaluate the effects of nasal surgery on the psychological symptoms and polysomnographic (PSG) parameters of these patients. Methods The study was designed as a prospective comparative study. This study compared 30 patients (all male) with nasal obstruction and 30 matched patients without nasal obstruction using the Pittsburgh Sleep Quality Index (PSQI) and the Symptom Check List 90 (SCL-90). All of the patients had been previously diagnosed with OSA (apnea hypopnea index [AHI] ≥ 5 events/h) via a whole-night polysomnographic examination. Nasal obstruction was assessed using a visual analogue scale (VAS). The patients with nasal obstruction underwent nasal surgery, and their weight, VAS, nocturnal PSG characteristics, and psychological symptoms at baseline and 3 months after surgery were compared. Results The OSA patients with nasal obstruction suffered from significantly longer sleep latency on the PSQI and higher somatization and anxiety scores on the SCL-90 than the subjects without nasal obstruction (p symptoms significantly improved after surgery (VAS decreased from 6.18 ± 1.85 to 1.87 ± 1.76, p symptoms on the SCL-90 (p symptoms on the SCL-90, including inter-personal sensitivity, depression, hostility, paranoid ideation, psychoticism, global symptom index, and the number of positive symptoms (r > 0.3, p < 0.05). PMID:26903174

  14. Extrusion processing : effects on dry canine diets

    NARCIS (Netherlands)

    Tran, Q.D.

    2008-01-01

    Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying. Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the nutritional and

  15. Triple bone labeling of canine mandibles

    DEFF Research Database (Denmark)

    Pinholt, E M; Kwon, P H

    1990-01-01

    Fluorescence microscopy was used for evaluation of new bone formation in 16 canine mandibles augmented with hydroxylapatite (HA) granules. Three fluorochromes were injected at different time intervals during therapeutic radiation treatment. Oxytetracycline, DCAF, and alizarin-complexone were give...

  16. A clinical study of malignancies of the nasal cavity and paranasal sinuses

    International Nuclear Information System (INIS)

    The data of a total of 82 patients with malignancies of the nasal cavity and paranasal sinuses who were initially treated at the University of Tsukuba Hospital between 2002 and 2011 were reviewed. The mean age (±standard deviation) was 63.1 (±14.6) years, and the male-female ratio was 2.73 : 1. The tumor originated from the maxiallry sinus in 40 cases (48.8%), from the nasal cavity in 28 cases (34.1%), from the ethmoid sinus in 9 cases (11.0%), and from other sinuses in 5 cases (6.1%). At our department, treatment for maxillary cancer is initiated with chemoradiotherapy concurrently with intraarterial infusion of fluorouracil, followed by planned surgery for appropriate candidates. The disease-specific 5-year survival rate was 57.0% in our series of patients with maxillary cancer. Malignancies of the nasal cavity and paranasal sinuses may present with diverse clinical features and further investigation is needed to establish appropriate treatment strategies for individual cases. (author)

  17. What Are the Key Statistics about Nasal Cavity and Paranasal Sinus Cancers?

    Science.gov (United States)

    ... the key statistics about nasal cavity and paranasal sinus cancers? Cancers of the nasal cavity and paranasal sinuses ... section “ Survival rates for nasal cavity and paranasal sinus cancers, by stage. ” Last Medical Review: 04/22/2014 ...

  18. Randomized trial of prongs or mask for nasal continuous positive airway pressure in preterm infants.

    LENUS (Irish Health Repository)

    Kieran, Emily A

    2012-11-01

    To determine whether nasal continuous positive airway pressure (NCPAP) given with nasal prongs compared with nasal mask reduces the rate of intubation and mechanical ventilation in preterm infants within 72 hours of starting therapy.

  19. What's New in Nasal Cavity and Paranasal Sinus Cancer Research and Treatment?

    Science.gov (United States)

    ... What’s new in nasal cavity and paranasal sinus cancer research and treatment? There is always research going on ... ways to prevent nasal cavity and paranasal sinus cancers. Research on better treatment for nasal cavity and paranasal ...

  20. The influence of inhaled propylene oxide on glutathione status and cell proliferation in the respiratory nasal epithelium of rats

    OpenAIRE

    Khan, Mohammad Delwar Hossain

    2010-01-01

    Inhaled propylene oxide (PO) induced tumors and cell proliferation at high concentrations (≥300 ppm) in rat respiratory nasal epithelium (RNE). The metabolic elimination of PO in the RNE occurs by the conjugation with Glutathione (GSH) which results the depletion of GSH. In order to substantiate the hypothesis that the increased cell proliferation is caused by GSH depletion, GSH status and cell proliferation were examined in the RNE of rats after inhalation exposure of PO, after co-treatment ...

  1. Canine adenovirus type 1 in a fennec fox (Vulpes zerda).

    Science.gov (United States)

    Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku

    2014-12-01

    A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing. PMID:25632689

  2. Role of neutrophilic inflammation in ozone-induced epithelial alterations in the nasal airways of rats

    Science.gov (United States)

    Cho, Hye Youn

    Ozone is a principal oxidant air pollutant in photochemical smog. Epithelial cells lining the centriacinar region of lung and the proximal aspects of nasal passage are primary target sites for ozone-induced injury in laboratory animals. Acute exposure of rats to high ambient concentrations of ozone (e.g., 0.5 ppm) results in neutrophilic inflammation, epithelial hyperplasia and mucous cell metaplasia (MCM) in the nasal transitional epithelium (NTE) lining the proximal nasal airways. The principal purpose of the present study was to investigate the role of pre-metaplastic cellular responses, especially neutrophilic inflammation, in the pathogenesis of ozone-induced MCM in rat NTE. For this purpose, three specific hypotheses-based whole-animal inhalation studies were conducted. Male F344/N rats were exposed in whole-body inhalation chambers to 0 (filtered air) or 0.5 ppm ozone for 1-3 days (8 h/day). Histochemical, immunochemical, molecular and morphometric techniques were used to investigate the ozone-induced cellular and molecular events in the NTE. Two in vitro studies were also conducted to examine the effects of ozone-inducible cytokines (i.e., tumor necrosis factor-alpha; TNF- a, and interleukin-6; IL-6) on mucin gene (rMuc-5AC) expression. Ozone induced a rapid increase of rMuc-5AC mRNA in nasal tissues within hours after the start of exposure. It preceded the appearance of MCM, and persisted with MCM. Ozone-induced neutrophilic inflammation accompanied the mucin gene upregulation, but was resolved when MCM first appeared in the NTE. Antibody-mediated depletion of circulating neutrophils attenuated ozone-induced MCM, although it did not affect the ozone-induced epithelial hyperplasia and mucin mRNA upregulation. In another study, it was found that preexisting neutrophilic rhinitis induced by endotoxin augmented the ozone-induced MCM. However, pre-existing rhinitis did not alter the severity of ozone-induced epithelial hyperplasia and mucin gene upregulation

  3. [Nonsurgical endodontic treatment of an invaginated canine].

    Science.gov (United States)

    Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P

    1989-01-01

    We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment. PMID:2638021

  4. Canine babesiosis: from molecular taxonomy to control

    Directory of Open Access Journals (Sweden)

    Irwin Peter J

    2009-03-01

    Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

  5. Overexpression of vimentin in canine prostatic carcinoma

    DEFF Research Database (Denmark)

    Rodrigues, M M P; Rema, A; Gärtner, F;

    2011-01-01

    associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests that...... the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....

  6. Breed predisposition to canine gastric carcinoma

    DEFF Research Database (Denmark)

    Seim-Wikse, Tonje; Jörundsson, Einar; Nødtvedt, Ane;

    2013-01-01

    Previous research has indicated a breed predisposition to gastric carcinoma in dogs. However, results to date are inconsistent since several studies have failed to prove such a predisposition. Better knowledge of breeds at risk could facilitate early detection of gastric carcinoma in dogs. The aim...... of the study was to retrospectively investigate the proportion and possible breed predisposition to canine gastric carcinoma using the Norwegian Canine Cancer Register for calculations of proportional morbidity ratios (PMRs) for the period 1998-2009....

  7. Systemic inflammarory response in canine pyometra

    OpenAIRE

    Fransson, Boel

    2003-01-01

    Research efforts have focused mainly on the hormonal aspects of canine pyometra for more than 6 decades. However, this disease is often manifested as systemic illness in response to the bacterial uterine infection. Studies I-II were undertaken to clarify bacteriological aspects of canine pyometra; i.e. the origin of the infecting bacteria, the infecting bacteria’s impact on severity of the systemic illness and the presence of bacterial endotoxin in the systemic circulation. Study I, a bacteri...

  8. Extranodal Natural Killer/T-Cell Lymphoma: A Rare Nasal-Type Case

    OpenAIRE

    Esra Sarıbacak Can; Harika Okutan; Ünsal Han

    2016-01-01

    Nasal type extranodal natural killer (NK) NK-cell/T-cell lymphoma (NKTCL) is a rare extranodal lymphoma of NK-cell or T-cell origin that most commonly affects immunocompetent middle-aged men of Asian or Native American descent [1]. The pathogenesis is not understood completely, but it is related in part to infection of the tumor cells with Epstein-Barr virus (EBV) [2]. Around 6-7% of all non-Hodgkin’s lymphoma (NHL) in Southeast Asia accounts for NKTCL. However, the incid...

  9. Clinical and Statistical Study on Canine Impaction

    Directory of Open Access Journals (Sweden)

    Adina-Simona Coșarcă

    2013-08-01

    Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic

  10. Epidemiology and burden of nasal congestion

    Directory of Open Access Journals (Sweden)

    Michael Stewart

    2010-02-01

    Full Text Available Michael Stewart1, BJ Ferguson2, Len Fromer31Department of Otorhinolaryngology, Weill Cornell Medical College, New York-Presbyterian Hospital/Weill Cornell Medical Center, USA; 2Department of Otolaryngology, University of Pittsburgh School of Medicine, USA; 3University of California, Los Angeles; David Geffen School of Medicine Los Angeles, California, USAAbstract: Nasal congestion, which may be described as fullness, obstruction, reduced airflow, or being “stuffed up,” is a commonly encountered symptom in clinical practice. Systematic study of congestion has largely considered it as a component of a disease state. Conditions associated with congestion include nasal polyposis, obstructive sleep apnea, and anatomic variation; however, most information on the burden of congestion comes from studies of allergic rhinitis and rhinosinusitis, diseases of which congestion is the major symptom. Congestion can be caused by other rhinologic conditions, such as non-allergic rhinitis, viral or bacterial rhinitis, and vasomotor rhinitis. Allergic rhinitis affects as much as one quarter of the population worldwide and imposes a significant economic burden. Additionally, allergic rhinitis significantly impairs quality of life; congestion causes allergic rhinitis sufferers decreased daytime productivity at work or school and reduces night-time sleep time and quality. Annually, rhinosinusitis affects tens of millions of Americans and leads to approximately $6 billion in overall health care expenditures; it has been found to be one of the most costly physical conditions for US employers. Given the high prevalence and significant social and economic burden of nasal congestion, this symptom should be a key consideration in treating patients with rhinologic disease, and there continues to be a significant unmet medical need for effective treatment options for this condition.Keywords: allergic rhinitis, congestion, epidemiology, obstruction, rhinosinusitis

  11. Environmental contamination by canine geohelminths

    Science.gov (United States)

    2014-01-01

    Intestinal nematodes affecting dogs, i.e. roundworms, hookworms and whipworms, have a relevant health-risk impact for animals and, for most of them, for human beings. Both dogs and humans are typically infected by ingesting infective stages, (i.e. larvated eggs or larvae) present in the environment. The existence of a high rate of soil and grass contamination with infective parasitic elements has been demonstrated worldwide in leisure, recreational, public and urban areas, i.e. parks, green areas, bicycle paths, city squares, playgrounds, sandpits, beaches. This review discusses the epidemiological and sanitary importance of faecal pollution with canine intestinal parasites in urban environments and the integrated approaches useful to minimize the risk of infection in different settings. PMID:24524656

  12. CANINE: a robotic mine dog

    Science.gov (United States)

    Stancil, Brian A.; Hyams, Jeffrey; Shelley, Jordan; Babu, Kartik; Badino, Hernán.; Bansal, Aayush; Huber, Daniel; Batavia, Parag

    2013-01-01

    Neya Systems, LLC competed in the CANINE program sponsored by the U.S. Army Tank Automotive Research Development and Engineering Center (TARDEC) which culminated in a competition held at Fort Benning as part of the 2012 Robotics Rodeo. As part of this program, we developed a robot with the capability to learn and recognize the appearance of target objects, conduct an area search amid distractor objects and obstacles, and relocate the target object in the same way that Mine dogs and Sentry dogs are used within military contexts for exploration and threat detection. Neya teamed with the Robotics Institute at Carnegie Mellon University to develop vision-based solutions for probabilistic target learning and recognition. In addition, we used a Mission Planning and Management System (MPMS) to orchestrate complex search and retrieval tasks using a general set of modular autonomous services relating to robot mobility, perception and grasping.

  13. Environmental contamination by canine geohelminths.

    Science.gov (United States)

    Traversa, Donato; Frangipane di Regalbono, Antonio; Di Cesare, Angela; La Torre, Francesco; Drake, Jason; Pietrobelli, Mario

    2014-01-01

    Intestinal nematodes affecting dogs, i.e. roundworms, hookworms and whipworms, have a relevant health-risk impact for animals and, for most of them, for human beings. Both dogs and humans are typically infected by ingesting infective stages, (i.e. larvated eggs or larvae) present in the environment. The existence of a high rate of soil and grass contamination with infective parasitic elements has been demonstrated worldwide in leisure, recreational, public and urban areas, i.e. parks, green areas, bicycle paths, city squares, playgrounds, sandpits, beaches. This review discusses the epidemiological and sanitary importance of faecal pollution with canine intestinal parasites in urban environments and the integrated approaches useful to minimize the risk of infection in different settings. PMID:24524656

  14. Changes in nasal resistance and nasal geometry using pressure and acoustic rhinometry in a feline model of nasal congestion

    DEFF Research Database (Denmark)

    McLeod, R.L.; Mingo, G.G.; Herczku, C.; Corboz, M.R.; DeGennaro-Culver, F.; Pedersen, Ole Finn; Hey, J.A.

    1999-01-01

    , increased nasal airway resistance (NAR) 1.2 +/- 0.6, 5.8 +/- 0.5, 8.6 +/- 1.1 and 7.9 +/- 1.5 cmH2O.L/minute, respectively. Increases in NAR produced by compound 48/80 were associated with a 395% increase in histamine concentration found in the nasal lavage fluid. Pretreatment with the alpha......-adrenoreceptor agonist, phenylpropanolamine (PPA; 0.1-3.0 mg/kg, i.v.), and the NO synthetase inhibitor, NG-nitro-L-arginine (L-NAME; 10 mg/kg, i.v.) attenuated the increases in NAR produced by compound 48/80. The histamine H1 antagonist chlorpheniramine (1.0 mg/kg, i.v.) and the H2 antagonist, ranitidine (1.0 mg/kg, i.......v.) had no decongestant activity. Also without decongestant activity were the muscarinic antagonist atropine, the cyclooxygenase inhibitor indomethacin, and the 5-HT blocker methysergide. Aerosolized histamine (0.1-1.0%) also produced a dose dependent increase in NAR. In studies using acoustic rhinometry...

  15. Septum nasal perforation: treatments and literature' review

    Directory of Open Access Journals (Sweden)

    Martinez Neto, Eulógio Emílio

    2010-03-01

    Full Text Available Introduction: The present study consists in a bibliographical' review concerning the articles related to the different manifestations and forms of the septum nasal perforation, with a main emphasis in the description of its techniques of surgical correction. As the etiology, that is fundamentally iatrogenic, accordingly surgical trauma. Other causes include exhibition to chemical industrial reagents, cocaine use, intranasal steroidal therapeutic, neoplasia and, infectious conditions. There is a few data concerning the prevalence of septum perforation in the general population. The decision making about surgical correction or medical treatment depend on the anatomic characteristics and of the pathogenesis of the septal perforation.

  16. Fronto-nasal Encephalocele. A Case Report

    Directory of Open Access Journals (Sweden)

    Rafael Ferrer Montoya

    2013-06-01

    Full Text Available Encephalocele is a herniation of the brain tissue through a congenital or acquired defect of the skull. The congenital condition is caused by a neural-tube defect attributable to an interaction among several genes and environmental factors. Anterior encephalocele is a rare entity and its incidence varies depending on the geographic area. We report the case of a newborn with a tumour protruding through the fronto-nasal region with a central pedunculated polypoid formation, in addition to the presence of bilateral cleft lip and palate. Surgical treatment was decided after consulting the Neurosurgery Department. This case report is interesting due to the rarity of this entity.

  17. Nasal soft tissue trauma and management.

    Science.gov (United States)

    Immerman, Sara; Constantinides, Minas; Pribitkin, Edmund A; White, W Matthew

    2010-12-01

    The nose is the most prominent of all facial structures and is susceptible to many types of trauma. All soft tissue injuries of the nose have the potential to distort its appearance and adversely affect the patient's self-image and self-esteem. Once life-threatening injuries are stabilized, a careful history and physical exam should be completed and treatment individualized. The ultimate objective of treatment is to achieve both functional and cosmetic restoration with timely diagnosis and repair. Immediate nasal reconstruction is ideal when medically possible because this decreases long-term sequelae. PMID:21086240

  18. [Nasal Highflow - Treatment option in severe hypoxaemia?].

    Science.gov (United States)

    Bräunlich, Jens; Wirtz, Hubert

    2015-12-01

    Nasal High Flow (NHF) provides a warmed and humidified air stream. In pediatrics, this method is already in widespread use and is increasingly replacing the CPAP. New studies show success in treating adults. Currently the acute hypoxemic insufficiency cause of pneumoniae is a secured area of use. NHF is not inferior in comparison to other oxygen delivery systems. At this juncture effectiveness of this easy to use method is not clear. Preliminary reports describe an improvement in ventilation by the NHF. Here, a wash-out of the airways and improved alveolar ventilation seem to be the main operating principles. PMID:26625231

  19. Effect of aspirin on nasal resistance to airflow.

    OpenAIRE

    Jones, A S; Lancer, J M; Moir, A A; Stevens, J. C.

    1985-01-01

    The effect of aspirin on nasal resistance to airflow was investigated by rhinomanometry in 25 healthy subjects before and after ingestion of aspirin or vitamin C in a double blind crossover trial. Aspirin caused a significant increase in nasal resistance compared with vitamin C. The effect of aspirin may be due to its inhibition of the synthesis of prostaglandins.

  20. Sensory neuropeptides and nitric oxide in nasal vascular regulation

    OpenAIRE

    Rinder, Johan

    1996-01-01

    Sensory neuropeptides and nitric oxide in nasal vascular regulation By Johan Rinder, M.D. Division of Pharmacology, Department of Physiology and Pharmacology, Karolinska Institute, S- 171 77 Stockholm, Sweden and Department of Oto-Rhino-Laryngology, Karolinska Hospital, S-17176 Stockholm, SwedenThe role of sensory neuropeptides and nitric oxide in vascular regulation was investigated in the pig nasal mucosa...

  1. Resident aerobic microbiota of the adult human nasal cavity

    DEFF Research Database (Denmark)

    Rasmussen, TT; Kirkeby Nielsen, LP; Poulsen, Knud;

    2000-01-01

    Recent evidence strongly suggests that the microbiota of the nasal cavity plays a crucial role in determining the reaction patterns of the mucosal and systemic immune system. However, little is known about the normal microbiota of the nasal cavity. The purpose of this study was to determine the m...

  2. Pathologic and Molecular Virologic Characterization of a Canine Distemper Outbreak in Farmed Civets.

    Science.gov (United States)

    Techangamsuwan, S; Banlunara, W; Radtanakatikanon, A; Sommanustweechai, A; Siriaroonrat, B; Lombardini, E D; Rungsipipat, A

    2015-07-01

    In October 2011, a fatal disease outbreak occurred in 3 civet species farmed for their use in the coffee industry in Thailand. The disease quickly killed 20 animals in a mixed population of Asian palm civets (Paradoxurus hermaphroditus; n = 18), a masked palm civet (Paguma larvata; n = 1), and small Indian civet (Viverricula indica; n = 1). Clinical signs consisted of severe lethargy, weakness, vomiting, and diarrhea with associated dehydration, dyspnea, nasal and footpad hyperkeratosis, and seizures. All civets were positive for canine morbillivirus using the commercial canine distemper virus (CDV) antigen test kit. Consistently observed necropsy findings consisted of severe pneumonia and hemorrhagic enteritis. Microscopic examination revealed severe gastroenteritis, bronchointerstitial pneumonia, lymphadenitis, necrotizing dermatitis, nonsuppurative polioencephalitis, and characteristic intranuclear/intracytoplasmic eosinophilic viral inclusions in multiple tissues. Immunohistochemical analysis revealed immunoreactivity of varying intensity, while virus isolation demonstrated typical cytopathic effects. To confirm CDV infection, reverse transcription-polymerase chain reaction against fusion (F), phosphoprotein (P), and hemagglutinin (H) genes showed bands of expected size using conjunctival swabs (9 civets, 1 dog [Canis lupus familiaris] living on the farm). Phylogenetic analyses and restriction fragment length polymorphism results indicated that the civets were infected by the Asia-1 strain of CDV commonly found in dogs in Thailand. The deduced amino acid sequences of the signaling lymphocyte activation molecule binding region of the CDV-H proteins revealed a Y549H mutation in both CDV-infected Asian palm civets (n = 4) and a co-located dog. We report a canine distemper outbreak in a civet colony with lineage classification and a Y549H mutation in noncanid species in Thailand. PMID:25253065

  3. Emprego do cell block de agarose como método complementar no diagnóstico citológico de tumores mamários caninos Employment of cell block of agarose as additional method in the cytological diagnosis of canine mammary tumors

    Directory of Open Access Journals (Sweden)

    Diogo Sousa Zanoni

    2013-03-01

    Full Text Available Os tumores mamários são neoplasias comuns em diversas espécies, sendo os processos oncológicos de maior incidência em cães. A elevada frequência e agressividade desses processos justificam a busca de métodos diagnósticos e prognósticos rápidos, de custo reduzido e menor invasividade, visando a uma abordagem cirúrgica e terapêutica adequada. O presente estudo avaliou a adequação da utilização da técnica de cell block de agarose como método diagnóstico complementar aos esfregaços tradicionais no diagnóstico desses processos. Para tanto, foram obtidas 51 amostras citológicas de tumores mamários de 30 cadelas que passaram por excisão tumoral no HOVET-UMESP, comparando-se os resultados obtidos a partir dos esfregaços, de cell blocks, e de sua associação (esfregaços cell blocks-1 com o diagnóstico histopatológico. Os melhores resultados foram obtidos mediante a associação dos métodos, reduzindo os resultados falso-negativos e elevando a correlação cito-histológica, reforçando a importância da citologia na rotina oncológica veterinária.The breast tumors are common neoplasms in several species, with high incidence in dogs. The high frequency and aggressiveness of these cases justifies the search for rapid, low cost and less invasive diagnostic methods, seeking for surgical approach and appropriate therapy. This study evaluated the appropriateness of the use of the agarose cell block technique as a diagnostic tool to complement traditional smears in the diagnosis of these processes. Therefore, it was obtained 51 samples from 30 dogs with breast tumors that underwent tumoral excision at the HOVET-UMESP, comparing the results obtained from smears, cell blocks, alone and in association (smears cell blocks-1, with the histopathologic diagnosis. The best results were obtained with the association of smears and cell block analysis, reducing the false negative results and increasing the cyto-histological correlation

  4. Sinonasal Phosphaturic Mesenchymal Tumor: A Rare and Misinterpreted Entity

    OpenAIRE

    Arnaoutakis, Demetri; Naseri, Iman

    2015-01-01

    Objectives Oncogenic osteomalacia is a paraneoplastic syndrome in which the tumor secretes a peptide-like hormone, fibroblast growth factor, resulting in urinary loss of phosphates. Methods We present the case of a 50-year-old woman with a benign phosphaturic mesenchymal tumor (PMT) involving the ethmoid sinus with obstruction of the ostiomeatal complex causing unilateral nasal airway obstruction. Results The tumor was initially thought to be an esthesioneuroblastoma based on primary patholog...

  5. HABRONEMOSE NASAL EM UMA ÉGUA

    Directory of Open Access Journals (Sweden)

    Fernanda Coutinho de Freitas

    2011-05-01

    Full Text Available A Habronemose é uma doença parasitária, e sua patogenia não está totalmente clara. Supõe-se que as larvas mortas ou que estão morrendo, desencadeiem uma reação de hipersensibilidade. Pode-se realizar tanto o tratamento clínico, como a exérese cirúrgica do granuloma caso seja necessária. O presente caso ilustra umaenfermidade das vias aéreas inferiores secundária a uma afecção parasitária atípica obstruindo o tecido nasal e adjacências. A terapia clínica instituída através da aplicação de neguvon intranasal, mostrou-se eficiente, não ocorrendo recidivas.The habronemiasis is a parasitic disease and its pathogenesis is not entirely clear. It is assumed that maggots dead or dying, eliciting a hypersensitivity reaction. You can perform both clinical treatment such as surgical excision of the granuloma if needed. This case illustrates a lower airway disease secondary to an atypical parasitic disease by blocking the nasal tissue and surroundings. Therapy clinic established by the application of intranasal neguvon, was efficient, with no recidivism.

  6. Treatment of nasal polyposis in Byzantine times.

    Science.gov (United States)

    Lascaratos, J G; Segas, J V; Assimakopoulos, D A

    2000-09-01

    The goal of this study was to describe the therapeutic methods and surgical techniques used during Byzantine times (AD 324-1453) for a disease that has occupied physicians since antiquity: nasal polyps. The original Greek-language texts of the Byzantine medical writers, most of which were published after the 17th century, were studied in order to identify the early knowledge of the definition, symptoms, conservative treatments, and surgical intervention in cases of this disease. A considerable number of conservative treatments, etiologic and local (with inunctions or blowing of caustic substances), with evident influence from Roman medicine, were identified even in the early Byzantine medical texts (4th century). Further, some surgical techniques were described that seem to constitute evolution of the Hippocratic tradition. From the study of the original texts of Byzantine medical writers, their interest in the rhinological diseases is evident; in the case of nasal polyps, new techniques were mentioned. The first meticulous intranasal surgical removal of polyps was described. These techniques, obviously developed during the Hellenistic period, initially influenced European medicine and later the rest of the world. PMID:11007093

  7. Anthropometric Study of Nasal Index of the Kosovo Albanian Population

    Directory of Open Access Journals (Sweden)

    Gloria Staka

    2012-12-01

    Full Text Available Human nose occurs in many shapes and sizes and ethnic influences my results in different appearances of the nose. Nasal index is an ethnic sensitive anthropometric index. It is an important athropometric parameter for classifying the race and sex of the individual whose identity is unknown. This study was undertaken to determine the nasal index of the Kosovo Albanian population. The study sample comprised 204 subjects (101 males and 103 females aged 18-25 years. Nasal height and nasal width were measured using an electronic digital caliper, with accuracy of 0.01 mm (Boss, Hamburg – Germany. Descriptive statistics showed that Kosovo Albanian males and females had mean nasal index of 67.07 ± 6.67 and 63.87 ± 5.56, respectively. The distribution of the nose types showed leptorrhine to be 76.96 % and dominant type among Kosovo – Albanian population.

  8. Correlation of nasal geometry with aerosol deposition in human volunteers

    International Nuclear Information System (INIS)

    The nasal airways act as the first filter in the respiratory tract to remove very large or small particles, that would otherwise penetrate to the lower airways. Aerosol deposition data obtained with human volunteers vary considerably under comparable experimental conditions. Reasons for the intersubject variations have been frequently attributed to the geometry of the nasal passages. Because there is no direct proof of this hypothesis, nasal deposition of ultrafine particles in human volunteers has been studied in our laboratory. Preliminary results obtained with four adult volunteers also vary considerably between subjects. The purpose of this part of the study was to establish a theoretical equation relating diffusional deposition in nasal airways to the geometrical dimensions of the individual nasal airways. This relationship was then applied to the experimental deposition data and measurement of airway morphometry for correlation

  9. Nasal polyps. A clinical radiological histopathological and mycological study

    International Nuclear Information System (INIS)

    Forty patients with nasal polyposis were studied. This study included clinical, haematological and mycological aspects. There were 24 females (60% of patients) and 16 males (40%). We found that all patients presented with nasal obstruction and nasal tone and the majority of them had allergic nasal symptoms such as sneezing and watery discharge. Thirty five percent of the patients were recurrent cases, being operated before for nasal polyps. Radiological investigations showed high of sinusitis and that 10% of the patients had complicated disease with orbital or intracranial extensions. Mycological studies revealed the presence of fungal infection in 4 patient (10%) and it was caused by Aspergillus flavus. Histological studies identified the allergic nature of the polyps in all patients. Surgical treatment was carried out in all patients and operations varied from simple intranasal polypectomy, intranasal ethmiodectomy, external ethmoidectomy to Caldwell-Luc operation for patients with antrochanal polyps.(Author)

  10. A diagnostic study of muco-pyocele of the posterior nasal accessory sinuses accompanied by visual disturbances

    International Nuclear Information System (INIS)

    Two cases of muco-pyocele of the posterior nasal accessory sinuses were reported. The diagnostic procedure of the disease was considered with special reference to a clinical evaluation of ''computed tomography''. The following conclusions were drawn: 1) Muco-pyocele of the posterior nasal accessory sinuses is one of the most clinically significant disease causing visual disturbances. An early establishment of both diagnosis and surgical treatment is of prime importance for a satisfactory results. 2) Conventional ophthalmological examinations, plain sinus and skull films, tomograms of the region of the posterior nasal accessory sinuses and angiograms of the internal carotid artery and the orbital vessels may be useful for making differential diagnosis of that pathologic condition, though these may require considerable experiences. 3) The computed tomographic scanning (CT) is very valuable in the investigation of the posterior paranasal and the surrounding lesions, since the CT scan is capable of demonstrating whether these lesions are arising from, or extending into the posterior nasal accessory sinuses. The CT scan may be helpful to identify muco-pyocele and to differentiate it from many other diseases such as hypophyseal tumor or orbital lesions on the basis of detailed findings. (author)

  11. Constitutive phosphorylation of the mTORC2/Akt/4E-BP1 pathway in newly derived canine hemangiosarcoma cell lines

    Directory of Open Access Journals (Sweden)

    Murai Atsuko

    2012-07-01

    Full Text Available Abstract Background Canine hemangiosarcoma (HSA is a malignant tumor with poor long-term prognosis due to development of metastasis despite aggressive treatment. The phosphatidyl-inositol-3 kinase/Akt/mammalian target of rapamycin (PI3K/Akt/mTOR pathway is involved in its endothelial pathologies; however, it remains unknown how this pathway plays a role in canine HSA. Here, we characterized new canine HSA cell lines derived from nude mice-xenografted canine HSAs and investigated the deregulation of the signaling pathways in these cell lines. Results Seven canine HSA cell lines were established from 3 xenograft canine HSAs and showed characteristics of endothelial cells (ECs, that is, uptake of acetylated low-density lipoprotein and expression of canine-specific CD31 mRNA. They showed varied morphologies and mRNA expression levels for VEGF-A, bFGF, HGF, IGF-I, EGF, PDGF-B, and their receptors. Cell proliferation was stimulated by these growth factors and fetal bovine serum (FBS in 1 cell line and by FBS alone in 3 cell lines. However, cell proliferation was not stimulated by growth factors and FBS in the remaining 3 cell lines. Phosphorylated p44/42 Erk1/2 was increased by FBS stimulation in 4 cell lines. In contrast, phosphorylation of Akt at Ser473, mTOR complex 1 (mTORC1 at Ser2448, and eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1 at Ser65 was high in serum-starved condition and not altered by FBS stimulation in 6 cell lines, despite increased phosphorylation of these residues in normal canine ECs. This suggested that the mTORC2/Akt/4E-BP1 pathway was constitutively activated in these 6 canine HSA cell lines. After cell inoculation into nude mice, canine HSA tumors were formed from 4 cell lines and showed Akt and 4E-BP1 phosphorylation identical to the parental cell lines. Conclusions Our findings suggest that the present cell lines may be useful tools for investigating the role of the mTORC2/Akt/4E-BP1 pathway in

  12. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    OpenAIRE

    Del Puerto, Helen L; Vasconcelos, Anilton C.; Luciana Moro; Fabiana Alves; Braz, Gissandra F; Almir S. Martins

    2010-01-01

    A quantitative real time polymerase chain reaction (PCR) revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus...

  13. Seasonal changes in nasal cytology in mite-allergic patients

    Directory of Open Access Journals (Sweden)

    Gelardi M

    2014-03-01

    Full Text Available Matteo Gelardi,1 Diego G Peroni,2 Cristoforo Incorvaia,3 Nicola Quaranta,1 Concetta De Luca,1 Salvatore Barberi,4 Ilaria Dell'Albani,5 Massimo Landi,6 Franco Frati,5 Olivier de Beaumont7 1Otolaryngology Unit, Department of Neuroscience and Sensory Organs, University of Bari, Bari, Italy; 2Department of Pediatrics, University of Verona, Verona, Italy; 3Allergy/Pulmonary Rehabilitation, ICP Hospital, Milan, Italy; 4Department of Pediatrics, San Paolo Hospital, Milan, Italy; 5Medical and Scientific Department, Stallergenes, Milan, Italy; 6Department of Pediatrics, National Healthcare System, ASL TO1, Turin, Italy; 7Medical Affairs Department, Stallergenes, Antony, France Background: House dust mites (HDMs are a major cause of allergic rhinitis (AR and asthma worldwide. Recent studies suggested that the allergen load presents seasonal modifications, giving rise to seasonal variation in nasal inflammation and symptoms. The aim of this study was to evaluate by nasal cytology whether nasal inflammation in mite-allergic patients changes with the seasons of the year. Methods: The study included 16 patients (seven males and nine females, mean age 38.1 years with persistent AR caused by monosensitization to HDMs. Nasal cytology was performed in all patients once monthly for 1 year. Results: Nasal cytology showed that the cells most commonly detected in the nasal mucosa were neutrophils. During the period from October to April, a peak in the number of neutrophils and also the presence of significant numbers of eosinophils, mast cells, and lymphocytes/plasma cells were found, which shows the occurrence of more intense inflammation during these months. Conclusion: Nasal cytology provides useful data in detecting nasal inflammation and its association with the clinical stage of AR. The seasonal variations in nasal cytology are likely to be induced by the fluctuations in the HDM allergen that have been uncovered in recent investigations. Keywords: allergens

  14. Diagnostic value of ultrasound for identification of nasal fracture

    Directory of Open Access Journals (Sweden)

    Nazanin Farshchian

    2011-07-01

    Full Text Available Background: Nasal fracture is a common fracture due to trauma. Gold standard method in diagnosis of nasal fracture is clinical examination and radiography is used in legal situation. Recently, ultrasound is recommended as a noninvasive and simple method in diagnosis of nasal fracture. This study investigates the role of ultrasound in diagnosis of nasal fracture.Methods: 126 cases with suspected nasal fracture were evaluated using both ultrasound and nasal radiography in compare with clinical examination as a gold standard and the results were evaluated statistically. Sensitivity, specificity, negative predictive value and positive predictive value, negative likelihood ratio and positive likelihood ratio were calculated with confidence interval 95%. Accuracy of both methods was also evaluated.Results: In clinical examination 111 cases (88.1% out of 126 cases, were diagnosed fractured and 15cases (11.9% were unfractured. From these 111 fracture cases, 108 cases in ultrasound and 92 in radiography evaluation were also diagnosed fractured. Ultrasound sensitivity, specificity and accuracy in diagnosis of nasal fracture were; 96.4% (91.1-98.6, 93.3% (70.2-98.8 and 96% respectively. Radiography report showed sensitivity 81.1% (72.8-87.3%, specificity 86.7% (62.1-96.3% and accuracy of 82%. Most sensitivity of both methods was in diagnosis of nasal dorsum fracture (100% in ultrasound and 92.6% in radiography. Most specificity of ultrasound was in diagnosis of lateral wall (100% and in radiography was in diagnosis of nasal dorsum fractures (50%.Conclusion: According to this findings ultrasound can used as a noninvasive method with high sensitivity and specificity to diagnosis of nasal fracture.

  15. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

    Directory of Open Access Journals (Sweden)

    Anna McRee

    2014-02-01

    Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  16. Lavagem nasal como método de avaliação das cavidades nasais Nasal lavage as a tool to evaluate nasal cavities

    Directory of Open Access Journals (Sweden)

    Guilherme P. Caminha

    2001-01-01

    Full Text Available A avaliação das cavidades nasais é extremamente importante nos indivíduos portadores de patologias nasais e nos que estão expostos a substâncias potencialmente nocivas presentes no meio ambiente. Como a histologia da mucosa nasal é similar à das vias respiratórias inferiores, uma resposta inflamatória vista no nariz pode ser um sinal de alerta de inflamação na via aérea inferior. A presença de biomarcadores nas cavidades nasais pode ser facilmente detectada através de inúmeras técnicas. Entretanto, é necessário dispormos de um método para avaliação das alterações encontradas nesta região que seja simples e seguro. A lavagem nasal preenche estes critérios e deve ser considerada sempre que se deseje estudar esta região.The evaluation of the nasal cavities of subjects with nasal pathologies and those exposed to environmental contaminants is very important. Nasal mucosal histology is similar to that in the lower airways. Therefore, an inflammatory response seen in the nasal passages may be a warning signal of inflammation in the lower airways. Biomarkers in the nasal cavities can be easily detected in many ways. However, it is necessary to have a method of quantifying this effects that is safe and simple to perform. Nasal lavage fulfills these criteria and should be considered when studying this area.

  17. Development of the canine tooth in the beagle

    International Nuclear Information System (INIS)

    The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla

  18. 9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus..., DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper...

  19. In vitro permeation of desmopressin across rabbit nasal mucosa from liquid nasal sprays: the enhancing effect of potassium sorbate.

    Science.gov (United States)

    Bortolotti, Fabrizio; Fabrizio, Bortolotti; Balducci, Anna Giulia; Giulia, Balducci Anna; Sonvico, Fabio; Fabio, Sonvico; Russo, Paola; Paola, Russo; Colombo, Gaia; Gaia, Colombo

    2009-04-11

    Nasal spray products containing desmopressin acetate (DDAVP) were tested in vitro to evaluate the effect of the contained preservatives on drug permeation across rabbit nasal mucosa. Experiments were performed using Franz-type diffusion cells with rabbit nasal mucosa as model barrier. Transport profiles obtained in comparison with a preservative-free solution evidenced that in the presence of preservatives DDAVP permeation in vitro always increased (phypothesis that the two compounds formed an ion pair in solution with improved permeability was made. Additional experiments with aqueous test solutions reconstructed ad hoc containing desmopressin and varying sorbate concentrations confirmed the enhancing effect of sorbate, which however resulted to be independent of sorbate concentration. In conclusion, preservatives significantly enhanced desmopressin permeation in vitro across rabbit nasal mucosa with different mechanisms. If a correlation existed between these data and in vivo DDAVP bioavailability after nasal administration, this could strengthen the safety concerns related to the use of this medication in adults and children. PMID:19162181

  20. Esporotricose canina: relato de caso Canine sporotrichosis: case report

    Directory of Open Access Journals (Sweden)

    N.T. Souza

    2009-06-01

    Full Text Available Relata-se um caso de esporotricose em um cão da raça Boxer, macho, com seis anos, encaminhado para uma consulta por causa de massa na região nasal e de dispneia. Após o exame físico, o animal foi internado para a realização de citologia, histologia e radiografia. Nos exames citológico e radiográfico, não foram constatadas alterações que justificassem a massa e a dispneia. Na histologia, observou-se a presença de um granuloma contendo dois esporos de Sporothrix schenckii. Foi realizado tratamento com itraconazol 5mg/kg BID por 60 dias. Após esse período, a massa desapareceu e a respiração do animal melhorou, tendo sido recomendada a manutenção da terapia por mais 30 dias, para evitar recidiva.A case of canine sporotrichosis was reported in a six-year-old male Boxer, referred to a veterinary hospital because of a mass in the region of the nose and dyspnea. After physical examination, the animal was submitted to cytological, histological, and radiographic exams. The cytological and radiographic exams showed no alterations that could justify the mass and the dyspnea. The histological exam showed the presence of a granuloma with two Sporothrix schenckii spores. The dog was treated with itraconazol 5mg/kg BID during 60 days. After this period, the mass disappeared and breathing improved. The therapy was maintained for 30 other days to avoid relapse.