WorldWideScience

Sample records for canine nasal tumors

  1. Use of an image-guided robotic radiosurgery system for the treatment of canine nonlymphomatous nasal tumors.

    Science.gov (United States)

    Glasser, Seth A; Charney, Sarah; Dervisis, Nikolaos G; Witten, Matthew R; Ettinger, Susan; Berg, Jason; Joseph, Richard

    2014-01-01

    An image-guided robotic stereotactic radiosurgery (SRS) system can be used to deliver curative-intent radiation in either single fraction or hypofractionated doses. Medical records for 19 dogs with nonlymphomatous nasal tumors treated with hypofractionated image-guided robotic stereotactic body radiotherapy (SBRT), either with or without adjunctive treatment, were retrospectively analyzed for survival and prognostic factors. Median survival time (MST) was evaluated using Kaplan-Meier survival curves. Age, breed, tumor type, stage, tumor size, prescribed radiation dose, and heterogeneity index were analyzed for prognostic significance. Dogs were treated with three consecutive-day, 8-12 gray (Gy) fractions of image-guided robotic SBRT. Overall MST was 399 days. No significant prognostic factors were identified. Acute side effects were rare and mild. Late side effects included one dog with an oronasal fistula and six dogs with seizures. In three of six dogs, seizures were a presenting complaint prior to SBRT. The cause of seizures in the remaining three dogs could not be definitively determined due to lack of follow-up computed tomography (CT) imaging. The seizures could have been related to either progression of disease or late radiation effect. Results indicate that image-guided robotic SBRT, either with or without adjunctive therapy, for canine nonlymphomatous nasal tumors provides comparable survival times (STs) to daily fractionated megavoltage radiation with fewer required fractions and fewer acute side effects. PMID:24446402

  2. Molecular Imaging Biomarkers of Resistance to Radiation Therapy for Spontaneous Nasal Tumors in Canines

    Energy Technology Data Exchange (ETDEWEB)

    Bradshaw, Tyler J. [Department of Medical Physics, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States); Bowen, Stephen R. [Departments of Radiation Oncology and Radiology, University of Washington, Seattle, Washington (United States); Deveau, Michael A. [Department of Small Animal Clinical Sciences, Texas A& M University, College Station, Texas (United States); Kubicek, Lyndsay [Angell Animal Medical Center, Boston, Massachusetts (United States); White, Pamela [Department of Surgical Sciences, School of Veterinary Medicine, University of Wisconsin-Madison, Madison, Wisconsin (United States); Bentzen, Søren M. [Division of Biostatistics and Bioinformatics, University of Maryland Greenebaum Cancer Center, and Department of Epidemiology and Public Health, University of Maryland School of Medicine, Baltimore, Maryland (United States); Chappell, Richard J. [Department of Biostatistics and Medical Informatics, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States); Forrest, Lisa J. [Department of Surgical Sciences, School of Veterinary Medicine, University of Wisconsin-Madison, Madison, Wisconsin (United States); Jeraj, Robert, E-mail: rjeraj@wisc.edu [Department of Medical Physics, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States); Department of Human Oncology, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States)

    2015-03-15

    Purpose: Imaging biomarkers of resistance to radiation therapy can inform and guide treatment management. Most studies have so far focused on assessing a single imaging biomarker. The goal of this study was to explore a number of different molecular imaging biomarkers as surrogates of resistance to radiation therapy. Methods and Materials: Twenty-two canine patients with spontaneous sinonasal tumors were treated with accelerated hypofractionated radiation therapy, receiving either 10 fractions of 4.2 Gy each or 10 fractions of 5.0 Gy each to the gross tumor volume. Patients underwent fluorodeoxyglucose (FDG)-, fluorothymidine (FLT)-, and Cu(II)-diacetyl-bis(N4-methylthiosemicarbazone) (Cu-ATSM)-labeled positron emission tomography/computed tomography (PET/CT) imaging before therapy and FLT and Cu-ATSM PET/CT imaging during therapy. In addition to conventional maximum and mean standardized uptake values (SUV{sub max}; SUV{sub mean}) measurements, imaging metrics providing response and spatiotemporal information were extracted for each patient. Progression-free survival was assessed according to response evaluation criteria in solid tumor. The prognostic value of each imaging biomarker was evaluated using univariable Cox proportional hazards regression. Multivariable analysis was also performed but was restricted to 2 predictor variables due to the limited number of patients. The best bivariable model was selected according to pseudo-R{sup 2}. Results: The following variables were significantly associated with poor clinical outcome following radiation therapy according to univariable analysis: tumor volume (P=.011), midtreatment FLT SUV{sub mean} (P=.018), and midtreatment FLT SUV{sub max} (P=.006). Large decreases in FLT SUV{sub mean} from pretreatment to midtreatment were associated with worse clinical outcome (P=.013). In the bivariable model, the best 2-variable combination for predicting poor outcome was high midtreatment FLT SUV{sub max} (P=.022) in

  3. Molecular Imaging Biomarkers of Resistance to Radiation Therapy for Spontaneous Nasal Tumors in Canines

    International Nuclear Information System (INIS)

    Purpose: Imaging biomarkers of resistance to radiation therapy can inform and guide treatment management. Most studies have so far focused on assessing a single imaging biomarker. The goal of this study was to explore a number of different molecular imaging biomarkers as surrogates of resistance to radiation therapy. Methods and Materials: Twenty-two canine patients with spontaneous sinonasal tumors were treated with accelerated hypofractionated radiation therapy, receiving either 10 fractions of 4.2 Gy each or 10 fractions of 5.0 Gy each to the gross tumor volume. Patients underwent fluorodeoxyglucose (FDG)-, fluorothymidine (FLT)-, and Cu(II)-diacetyl-bis(N4-methylthiosemicarbazone) (Cu-ATSM)-labeled positron emission tomography/computed tomography (PET/CT) imaging before therapy and FLT and Cu-ATSM PET/CT imaging during therapy. In addition to conventional maximum and mean standardized uptake values (SUVmax; SUVmean) measurements, imaging metrics providing response and spatiotemporal information were extracted for each patient. Progression-free survival was assessed according to response evaluation criteria in solid tumor. The prognostic value of each imaging biomarker was evaluated using univariable Cox proportional hazards regression. Multivariable analysis was also performed but was restricted to 2 predictor variables due to the limited number of patients. The best bivariable model was selected according to pseudo-R2. Results: The following variables were significantly associated with poor clinical outcome following radiation therapy according to univariable analysis: tumor volume (P=.011), midtreatment FLT SUVmean (P=.018), and midtreatment FLT SUVmax (P=.006). Large decreases in FLT SUVmean from pretreatment to midtreatment were associated with worse clinical outcome (P=.013). In the bivariable model, the best 2-variable combination for predicting poor outcome was high midtreatment FLT SUVmax (P=.022) in combination with large FLT response from

  4. Canine and feline nasal neoplasia.

    Science.gov (United States)

    Malinowski, Christine

    2006-05-01

    Dogs and cats of our society have outgrown their status as merely pets and are now considered our close companions and even family members. This shift in their roles has led to pet owners seeking improved preventative medicine for their four-legged friends. Subsequently, dogs and cats are living longer lives than ever before and developing more old-age-related diseases. One of the most devastating diseases of older animals is cancer. Once a veterinarian has detected cancer in a pet, pet owners seek advice on their next course of action. This article is intended to provide concise information regarding the diagnosis and treatment of intranasal tumors of the dog and cat. This article outlines the forms of nasal tumors that are the most common, the recommended imaging and biopsy techniques to diagnose the tumor, and the most appropriate treatments of them. PMID:16711615

  5. Tumor relapse present in oncologic nasal repair

    International Nuclear Information System (INIS)

    Introduction: Tumor relapse is one of the more fearsome complications of the oncologic course and also to obscure the life prognosis, causing the loss of many reconstructions and of exhausting the repairing surgical possibilities. The aim of this study was to determine the relapse frequency, the repercussion on the repair and the subsequent medical course of patients operated on malign nasal tumors. Methods: We made a retrospective and descriptive study in 20 patients operated on malign nasal tumors with immediate repair using frontal flap. Patients came from National Institute of Oncology and Radiobiology (NIOR), where they were seen from 2002 and 2007. Results: There were two relapses in 5 patients (25% of total), and the 80% of these were an epidermoid carcinoma. All patients with relapse lost the repaired tissues and received radiotherapy. Only it was possible to repair the defect in one of the patients; two of remained deceased, and were alive, without tumor relapse but without possibilities of repair. Conclusions: Considering the relapse frequency of nasal epidermoid carcinomas and of its repercussions when the Mhos histography technique is not available, it is advisable to delay the nasal repair until will be possible to confirm completely the histology of tumor exeresis. (author)

  6. Combination of radiation therapy and firocoxib for the treatment of canine nasal carcinoma.

    Science.gov (United States)

    Cancedda, Simona; Sabattini, Silvia; Bettini, Giuliano; Leone, Vito F; Laganga, Paola; Rossi, Federica; Terragni, Rossella; Gnudi, Giacomo; Vignoli, Massimo

    2015-01-01

    Carcinomas represent two-thirds of canine nasosinal neoplasms. Although radiation therapy (RT) is the standard of care, the incidence of local recurrence following treatment is high. Cyclooxygenase-isoform-2 (COX-2) is expressed in 71-95% of canine nasal carcinomas and has been implicated in tumor growth and angiogenesis. Accordingly, COX-2 inhibition seems rational to improve outcome. Dogs with histologically confirmed, previously untreated nasal carcinomas were randomized to receive the combination of a selective COX-2 inhibitor (firocoxib) and palliative RT (Group 1) or RT and placebo (Group 2). Patients were regularly monitored with blood tests, urinalysis, and computed tomography. Pet owners were asked to complete monthly a quality-of-life questionnaire. Twenty-four dogs were prospectively enrolled. According to Adams modified system, there were five stage 1, five stage 2, three stage 3, and 11 stage 4 tumors. Two dogs had metastases to regional lymph nodes. Median progression-free interval and overall survival were 228 and 335 days in Group 1 (n = 12) and 234 and 244 days in Group 2 (n = 12). These differences were not statistically significant. The involvement of regional lymph nodes was significantly associated with progression-free interval and overall survival (P = 0.004). Quality of life was significantly improved in Group 1 (P = 0.008). In particular, a significant difference was observed for activity and appetite. Although not providing a significant enhancement of progression-free interval and overall survival, firocoxib in combination with RT is safe and improved life quality in dogs with nasal carcinomas. PMID:25703137

  7. TVT NASALTumor Venéreo Transmissível- um caso clínico

    Directory of Open Access Journals (Sweden)

    CANAL, Ivo Hellmeister; DAGLI, Maria Lucia Zaidan; TORRES, Luciana Neves; PIVETA , Lidiana Cândida; CANAL, Raoní Bertelli.

    2005-02-01

    Full Text Available The authors do a revision of CTVT - Canine Transmissible Venereal Tumor – clinic, diagnostic and treatment from a clinical case in nasal cavity and describes a complete protocol for the treatment using biotechniques and anti-tumor medication. Vincristine and ciclofosfamide like chemotherapeutic management and anti-tumor medication, and Interferon in low and oral doses with Levamisol, immune modulator, like a biotherapy. A bibliography revision. This description is the most recent and complete treatment used by the clinic.

  8. Squamous cell carcinoma of the canine nasal cavity and frontal sinus: eight cases

    International Nuclear Information System (INIS)

    Squamous cell carcinoma of the canine nasal cavity and frontal sinus was diagnosed in eight cases between May 1988 and April 1994. The most common presenting complaints were nasal discharge, including epistaxis; sneezing; and facial deformity or exophthalmos. Metastasis was not identified in any case, but bone lysis and invasion into tissues outside the nasal cavity were noted in five cases. Computed tomograms were performed in five cases and were more useful than radiographs in determining the extent of neoplastic involvement. Euthanasia was performed within one week of diagnosis in three cases at the owner's request; one case died at home within one month; and the remaining four cases were euthanized within eight months due to progressive clinical signs. The mean survival time in these eight cases was three months, with a range of zero weeks to eight months

  9. Classification and grading of canine malignant mammary tumors

    OpenAIRE

    Abbas Tavasoly; Hannaneh Golshahi; Annahita Rezaie; Mohammad Farhadi

    2013-01-01

    Histological grading is a good parameter to stratify tumors according to their biological aggressiveness. The Elston and Ellis grading method in humans, invasive ductal breast carcinomas and other invasive tumors are routinely used. The aims of this study were classification of mammary gland tumors and also application of a human grading method in canine mammary carcinoma. The samples included 37 tumors of mammary glands. Mammary tumors were carcinomas (n = 32) and sarcomas (n = 5). The carci...

  10. Frequent alteration of the tumor suppressor gene APC in sporadic canine colorectal tumors.

    Directory of Open Access Journals (Sweden)

    Lydia Youmans

    Full Text Available Sporadic canine colorectal cancers (CRCs should make excellent models for studying the corresponding human cancers. To molecularly characterize canine CRC, we investigated exonic sequence mutations of adenomatous polyposis coli (APC, the best known tumor suppressor gene of human CRC, in 23 sporadic canine colorectal tumors, including 8 adenomas and 15 adenocarcinomas, via exon-resequencing analysis. As a comparison, we also performed the same sequencing analysis on 10 other genes, either located at human 5q22 (the same locus as APC or 18q21 (also frequently altered in human CRC, or known to play a role in human carcinogenesis. We noted that APC was the most significantly mutated gene in both canine adenomas and adenocarcinomas among the 11 genes examined. Significantly, we detected large deletions of ≥ 10 bases, many clustered near the mutation cluster region, as well as single or two base deletions in ~70% canine tumors of both subtypes. These observations indicate that like in the human, APC is also frequently altered in sporadic colorectal tumors in the dog and its alteration is an early event in canine colorectal tumorigenesis. Our study provides further evidence demonstrating the molecular similarity in pathogenesis between sporadic human and canine CRCs. This work, along with our previous copy number abnormality study, supports that sporadic canine CRCs are valid models of human CRCs at the molecular level.

  11. Cytological diagnostic of canine transmissible venereal tumor - Case report

    Directory of Open Access Journals (Sweden)

    Ulčar Igor

    2012-01-01

    Full Text Available Canine Transmissible Venereal Tumor (CTVT is a benign reticuloendothelial (histiocytic tumor of the dog that mainly affects the external genitalia. This tumor was found in male 2 years old mongrel dog. According the anamnestic data, there was no visible change of its general clinical status, except spontaneous bleeding with blood drops on the praeputium and the presence of blood in the urine. With clinical examination a multilobular mass on radix penis mucosa was found, which actually caused pseudohemorrhagia. The material for cytological diagnostic was taken with the imprint method and 4 cytological films were prepared and strained. The conclusion of the cytological diagnosis was CTVT. The tumor cause only local disturbances, and the differential diagnosis of the other "round cells tumors", histiocytomas, plasmacytomas, lymphoma, some melanomas and especially lymphosarcomas, which could be located on the external genitalia, had a big significance. Although some authors are mentioning spontaneous regression, however, because this is invasive tumor, a complete chirurgical excision was made.

  12. Survivin and related proteins in canine mammary tumors: immunohistochemical expression.

    Science.gov (United States)

    Bongiovanni, L; Romanucci, M; Malatesta, D; D'Andrea, A; Ciccarelli, A; Della Salda, L

    2015-03-01

    Survivin is reexpressed in most human breast cancers, where its expression has been associated with tumor aggressiveness, poor prognosis, and poor response to therapy. Survivin expression was evaluated in 41 malignant canine mammary tumors (CMTs) by immunohistochemistry, in relation to histological grade and stage, and correlated with that of some related molecules (β-catenin, caspase 3, heat shock proteins) to understand their possible role in canine mammary tumorigenesis. An increase in nuclear survivin expression, compared with healthy mammary glands, was observed in CMTs, where nuclear immunolabeling was related to the presence of necrosis. No statistically significant relation was found between the expression of the investigated molecules and the histological grade or stage. The present study may suggest an important involvement of survivin in CMT tumorigenesis. Its overexpression in most of the cases evaluated might suggest that targeting survivin in CMTs may be a valid anticancer therapy. PMID:24686389

  13. Immunohistochemical detection of estrogen receptors in canine mammary tumors

    Directory of Open Access Journals (Sweden)

    Elena Atanaskova Petrov

    2016-03-01

    Full Text Available Mammary tumors are among the most common neoplasms in intact female dogs.They have a complex morphology, usually affecting middle age and older bitches. Almost 50% of the mammary tumors in dogs are malignant neoplasms. Prognosis is based on several factors: stage, age, tumor size, metastasis, histopathology, ovariectomy status and hormone-receptor activity. Immunohistochemical (IHC measurement has become increasingly an important diagnostic and prognostic parameter, with the development of monoclonal antibodies against nuclear estrogen and progestin receptors. The aim of this study was to detect the presence of ER receptors in malignant canine mammary tumors and to identify their association with the clinical course of the tumor. Mammary tumor samples have been obtained by mastectomy from dogs presented at our clinic. Detailed clinical examination, CBC and basic serum biochemical profile were performed in all patients. Surgery was the only treatment. Histopathological examination and immunohistochemical detection of estrogen α receptors (ERα was performed on 8 formalin-fixed, paraffin-embedded tissue samples, using the PT LINK immunoperoxidase technique. Histopathological examination of the mammary tumor samples (n=11 revealed tubular adenocarcinoma (n=6,54.5% and ductal adenocarcinoma (n=3, 27.3%, one patient with benign adenoma and one with mastitis. Patients with positive ER tumors are alive, without remission, while 3 of the patients that were ER negative died due to lung metastases. According to our results, it can be concluded that the appearance and development of canine mammary tumors is highly connected with ovarian steroid hormones and that immunostaining of the tumors may be used as a good prognostic parameter in these patients.

  14. Comparative expression pathway analysis of human and canine mammary tumors

    Directory of Open Access Journals (Sweden)

    Marconato Laura

    2009-03-01

    Full Text Available Abstract Background Spontaneous tumors in dog have been demonstrated to share many features with their human counterparts, including relevant molecular targets, histological appearance, genetics, biological behavior and response to conventional treatments. Mammary tumors in dog therefore provide an attractive alternative to more classical mouse models, such as transgenics or xenografts, where the tumour is artificially induced. To assess the extent to which dog tumors represent clinically significant human phenotypes, we performed the first genome-wide comparative analysis of transcriptional changes occurring in mammary tumors of the two species, with particular focus on the molecular pathways involved. Results We analyzed human and dog gene expression data derived from both tumor and normal mammary samples. By analyzing the expression levels of about ten thousand dog/human orthologous genes we observed a significant overlap of genes deregulated in the mammary tumor samples, as compared to their normal counterparts. Pathway analysis of gene expression data revealed a great degree of similarity in the perturbation of many cancer-related pathways, including the 'PI3K/AKT', 'KRAS', 'PTEN', 'WNT-beta catenin' and 'MAPK cascade'. Moreover, we show that the transcriptional relationships between different gene signatures observed in human breast cancer are largely maintained in the canine model, suggesting a close interspecies similarity in the network of cancer signalling circuitries. Conclusion Our data confirm and further strengthen the value of the canine mammary cancer model and open up new perspectives for the evaluation of novel cancer therapeutics and the development of prognostic and diagnostic biomarkers to be used in clinical studies.

  15. Expression and significance of CHIP in canine mammary gland tumors.

    Science.gov (United States)

    Wang, Huanan; Yang, Xu; Jin, Yipeng; Pei, Shimin; Zhang, Di; Ma, Wen; Huang, Jian; Qiu, Hengbin; Zhang, Xinke; Jiang, Qiuyue; Sun, Weidong; Zhang, Hong; Lin, Degui

    2015-11-01

    CHIP (Carboxy terminus of Hsc70 Interacting Protein) is an E3 ubiquitin ligase that can induce ubiquitination and degradation of several oncogenic proteins. The expression of CHIP is frequently lower in human breast cancer than in normal breast tissue. However, the expression and role of CHIP in the canine mammary gland tumor (CMGT) remain unclear. We investigated the potential correlation between CHIP expression and mammary gland tumor prognosis in female dogs. CHIP expression was measured in 54 dogs by immunohistochemistry and real-time RT-PCR. CHIP protein expression was significantly correlated with the histopathological diagnosis, outcome of disease and tumor classification. The transcriptional level of CHIP was significantly higher in normal tissues (P=0.001) and benign tumors (P=0.009) than it in malignant tumors. CHIP protein expression was significantly correlated with the transcriptional level of CHIP (P=0.0102). The log-rank test survival curves indicated that patients with low expression of CHIP had shorter overall periods of survival than those with higher CHIP protein expression (P=0.050). Our data suggest that CHIP may play an important role in the formation and development of CMGTs and serve as a valuable prognostic marker and potential target for genetic therapy.

  16. Nasal, oral and ear swabs for canine visceral leishmaniasis diagnosis: new practical approaches for detection of Leishmania infantum DNA.

    Directory of Open Access Journals (Sweden)

    Sidney de Almeida Ferreira

    Full Text Available BACKGROUND: The aim of this study was to evaluate the potential use of nasal, oral, and ear swabs for molecular diagnosis of canine visceral leishmaniasis (CVL in an endemic urban area in Brazil. METHODOLOGY/PRINCIPAL FINDINGS: Sixty-two naturally infected and ten healthy dogs were enrolled in this study. Bone marrow aspirates, peripheral blood, skin biopsy, and conjunctival, nasal, oral, and ear swabs were collected. All samples, except blood, were submitted to conventional PCR (cPCR and quantitative real time PCR (qPCR to detect and quantify Leishmania infantum DNA, respectively. All dogs were submitted to thorough clinical analysis and were included based on a combination of serological (ELISA immunoassay and immunofluorescent antibody test and parasitological methods. The cPCR positivity obtained from nasal swab samples was 87% (54/62, equivalent to those from other samples (P>0.05. Positive results were obtained for 79% (22/28 in oral swabs and 43% (12/28 in ear swab samples. A significant difference was observed between these data (P=0.013, and the frequency of positive results from oral swab was equivalent to those from other samples (P>0.05. The use of ear swab samples for cPCR assays is promising because its result was equivalent to skin biopsy data (P>0.05. The qPCR data revealed that parasite loads in mucosal tissues were similar (P>0.05, but significantly lower than the parasite burden observed in bone marrow and skin samples (P<0.05. CONCLUSIONS: Nasal and oral swab samples showed a high potential for the qualitative molecular diagnosis of CVL because their results were equivalent to those observed in samples collected invasively. Considering that mucosae swab collections are painless, noninvasive, fast and practical, the combination of these samples would be useful in massive screening of dogs. This work highlights the potential of practical approaches for molecular diagnosis of CVL and human leishmaniasis infections.

  17. Malignant tumors of the nasal cavity: computed tomography and magnetic resonance imaging; Tumores malignos da cavidade nasal: tomografia computadorizada e ressonancia magnetica

    Energy Technology Data Exchange (ETDEWEB)

    Souza, Ricardo Pires de; Paes Junior, Ademar Jose de Oliveira; Gonzalez, Fabio Mota; Cordeiro, Flamarion de Barros; Yamashiro, Ilka [Complexo Hospitalar Heliopolis, Sao Paulo, SP (Brazil). Programa de Residencia Medica em Radiologia e Diagnostico por Imagem]. E-mail: ricapires@ig.com.br; Lenh, Carlos Neutzling [Complexo Hospitalar Heliopolis, Sao Paulo, SP (Brazil). Servico de Cirurgia de Cabeca e Pescoco; Rapoport, Abrao [Complexo Hospitalar Heliopolis, Sao Paulo, SP (Brazil). Curso de Pos-graduacao em Ciencias da Saude

    2004-10-01

    The aim of this study is to evaluate the role of computed tomography and magnetic resonance imaging in the characterization of deep tissue extension of malignant tumors of the nasal cavity. Twelve patients diagnosed with malignant tumors of the nasal cavity were retrospectively evaluated at the Departments of Diagnostic Imaging and Head and Neck Surgery of the 'Complexo Hospitalar Heliopolis', Sao Paulo, Brazil, between 1990 and 2000. All cases were confirmed by histopathologic examination. The results were: extension to the maxillary and ethmoid sinuses was identified in six patients, extension to contralateral nasal cavity, orbit and lamina cribosa in five patients, extension to nasal pharynx and masticator space in two patients, extension to cavernous sinus, anterior/middle cranial fossa, pterygomaxillary fossa, inferior/superior orbital fissure, frontal sinus, contralateral ethmoid sinus, contralateral lamina cribosa, hard palate and pterygopalatine fossa in one patient. Conclusion: It is important to precisely assess the local extension and spread of tumor by computed tomography and magnetic resonance imaging in order to plan the approach to treatment, which will influence the prognosis. (author)

  18. Antigen profiling analysis of vaccinia virus injected canine tumors: oncolytic virus efficiency predicted by boolean models.

    Science.gov (United States)

    Cecil, Alexander; Gentschev, Ivaylo; Adelfinger, Marion; Nolte, Ingo; Dandekar, Thomas; Szalay, Aladar A

    2014-01-01

    Virotherapy on the basis of oncolytic vaccinia virus (VACV) strains is a novel approach for cancer therapy. In this study we describe for the first time the use of dynamic boolean modeling for tumor growth prediction of vaccinia virus GLV-1h68-injected canine tumors including canine mammary adenoma (ZMTH3), canine mammary carcinoma (MTH52c), canine prostate carcinoma (CT1258), and canine soft tissue sarcoma (STSA-1). Additionally, the STSA-1 xenografted mice were injected with either LIVP 1.1.1 or LIVP 5.1.1 vaccinia virus strains.   Antigen profiling data of the four different vaccinia virus-injected canine tumors were obtained, analyzed and used to calculate differences in the tumor growth signaling network by type and tumor type. Our model combines networks for apoptosis, MAPK, p53, WNT, Hedgehog, TK cell, Interferon, and Interleukin signaling networks. The in silico findings conform with in vivo findings of tumor growth. Boolean modeling describes tumor growth and remission semi-quantitatively with a good fit to the data obtained for all cancer type variants. At the same time it monitors all signaling activities as a basis for treatment planning according to antigen levels. Mitigation and elimination of VACV- susceptible tumor types as well as effects on the non-susceptible type CT1258 are predicted correctly. Thus the combination of Antigen profiling and semi-quantitative modeling optimizes the therapy already before its start.

  19. Selective intra arterial infusion chemotherapy for malignant nasal and paranasal sinus tumors

    International Nuclear Information System (INIS)

    Since 1998, we have treated 14 malignant nasal and paranasal sinus tumor patients with selective intra arterial infusion chemotherapy. We report results for 7 of maxillary sinus, 3 of sphenoid sinus 1 of ethmoid sinus, and 3 of the nasal cavity. Only 1 maxillary sinus case involved recurrence. Intra arterial infusions of cisplatin (100 mg/body) was delivered rapidly to the tumor and usually repeated for 4 times. Conventional external-beam irradiation (2 Gy per fraction x 30) was also used. Complete response cases were 9 of 14 and control of the local lesion found in all new cases. These results indicate that intra arterial infusion therapy is effective against advanced malignant nasal and paranasal sinus tumors. (author)

  20. Recent progress in canine tumor vaccination: potential applications for human tumor vaccines.

    Science.gov (United States)

    Denies, Sofie; Sanders, Niek N

    2012-11-01

    Tumor vaccination holds great promise for the treatment of cancer and research concerning tumor vaccination in dogs is of great interest for veterinary as well as human medicine. Indeed, cancer is the leading cause of death in adult dogs and companion animals are acknowledged as excellent preclinical models for human oncology. The license of the veterinary melanoma vaccine (Oncept™) and Provenge® for the treatment of prostate cancer in men established tumor vaccination as a valid treatment modality for cancer. Although the results with this and other vaccines are promising, there are still some hurdles to overcome. In this article, preclinical and clinical trials with tumor vaccines in dogs are discussed, as well as the surplus value of canine cancer patients for human medicine. PMID:23249236

  1. Pindborg Tumor Presenting as a Nasal Polyp: Immunohistology and Ultrastructural Features of a Rare Case, With Review of the Literature.

    Science.gov (United States)

    Mitra, Suvradeep; Kaur, Gurwinder; Nada, Ritambhra; Mohindra, Satyawati

    2016-09-01

    Calcifying epithelial odontogenic tumor, also known as Pindborg tumor, is a rare benign odontogenic tumor. This tumor predominantly involves the mandible, though the maxilla can also be involved in some cases. The involvement of maxillary sinuses, however, has been previously reported in only 8 case reports English literature. These patients chiefly presented with nasal obstruction along with epistaxis or proptosis in rare cases. However, a primary presentation as nasal polyp is unheard of. We present a rare case of calcifying epithelial odontogenic tumor presenting as a nasal polyp, posing a diagnostic difficulty.

  2. Prevalence of the Prefoldin Subunit 5 Gene Deletion in Canine Mammary Tumors

    OpenAIRE

    Silvia Hennecke; Julia Beck; Kirsten Bornemann-Kolatzki; Stephan Neumann; Hugo Murua Escobar; Ingo Nolte; Susanne Conradine Hammer; Marion Hewicker-Trautwein; Johannes Junginger; Franz-Josef Kaup; Bertram Brenig; Ekkehard Schütz

    2015-01-01

    Background A somatic deletion at the proximal end of canine chromosome 27 (CFA27) was recently reported in 50% of malignant mammary tumors. This region harbours the tumor suppressor gene prefoldin subunit 5 (PFDN5) and the deletion correlated with a higher Ki-67 score. PFDN5 has been described to repress c-MYC and is, therefore, a candidate tumor-suppressor and cancer-driver gene in canine mammary cancer. Aim of this study was to confirm the recurrent deletion in a larger number of tumors. Me...

  3. Characterization of alpha-adrenoceptors in the vasculature of the canine nasal mucosa.

    OpenAIRE

    Berridge, T L; Roach, A G

    1986-01-01

    alpha-Adrenoceptors present in the vasculature of the nasal mucosa in beta-adrenoceptor blocked dogs have been characterized pharmacologically using selective alpha 1- and alpha 2-adrenoceptor agonists and antagonists. In pentobarbitone-anaesthetized dogs, intra-arterial (i.a.) administration of the selective alpha 1-agonists cirazoline and phenylephrine, the selective alpha 2-agonist UK-14,304 and the mixed alpha 1/alpha 2-agonists adrenaline, noradrenaline and oxymetazoline produced dose-re...

  4. Breed- and age-related differences in canine mammary tumors.

    Science.gov (United States)

    Kim, Hyun-Woo; Lim, Ha-Young; Shin, Jong-Il; Seung, Byung-Joon; Ju, Jung-Hyung; Sur, Jung-Hyang

    2016-04-01

    Triple-negative breast cancer is a type of breast cancer that does not express the genes for estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor-2 (HER-2). It is an important and clinically relevant condition as it has a poor prognosis and is difficult to treat. Basal-like triple-negative cancer is highly prevalent in both African-Americans and adolescents. We therefore examined whether such a cancer likewise occurs in specific breeds and age groups in dogs, focusing on basal-like triple-negative cancer in particular. In this study, 181 samples from dogs with malignant mammary carcinoma from the 5 most common breeds and 2 age groups in Korea were analyzed. Histological classification and molecular subtyping, including assessment of immunohistochemical findings, were carried out. Twenty-five of 28 (89.3%) triple-negative carcinomas were identified as basal-like triple-negative carcinomas. Analysis of associations of classified factors revealed that the shih tzu breed (9/25, 36.0%) and advanced-age (19/25, 76.0%) groups were characterized by higher prevalence of basal-like triple-negative tumors with diverse histological types and of a higher grade. These results suggest that breed- and age-related differences can be identified in canine mammary carcinoma and, notably, in the shih tzu breed and at older ages. Further investigation of these distinguishing characteristics of the shih tzu breed is warranted. PMID:27127342

  5. A case of nasal malignant peripheral nerve sheath tumor%鼻腔恶性外周神经鞘肿瘤1例

    Institute of Scientific and Technical Information of China (English)

    张晓松; 丁锋

    2013-01-01

    The 52-year-old female patient complained of persistent and progressive obstruction in left nasal cavity for more than 1 years. A grey, hard and smooth tumor with telangiectasia, were seen plugged in left post-nostrils and nasopharynx. CT scanning showed a tumor in the left nasal cavity . Post-operational pathologic diagnosis was peripheral nerve sheath tumors of nasal cavity.

  6. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    Directory of Open Access Journals (Sweden)

    Kiupel Matti

    2006-04-01

    Full Text Available Abstract Background Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. Methods In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. Results No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. Conclusion In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs.

  7. Four cases of cell cannibalism in highly malignant feline and canine tumors.

    Science.gov (United States)

    Ferreira, Fernando Costa; Soares, Maria João; Carvalho, Sandra; Borralho, Liliana; Vicente, Gonçalo; Branco, Sandra; Correia, Jorge; Peleteiro, Maria Conceição

    2015-01-01

    Four cases of tumors in which cell internalization was frequently visualized are reported: one feline mammary carcinoma, one feline cutaneous squamous cell carcinoma, one canine pulmonary squamous cell carcinoma and one canine pleural mesothelioma. Cell internalization was observed by cytology in two of these cases (the feline mammary tumour and the pleural effusion in the canine mesothelioma) and by histopathology in all but the canine mesothelioma. Immunohistochemical staining for pancytokeratin was positive for both internalized and host cells, while E-cadherin expression was frequently absent, although internalized cells occasionally stained positive. This cell-to-cell interaction seems to be associated with tumors displaying a strong epithelial-mesenchymal transitional phenotype, in which cancer cells become engulfed by other cancer cells. Such event could be regarded as an important hallmark of very high malignancy. PMID:26525147

  8. Increased expression of C5a receptor (CD88) mRNA in canine mammary tumors.

    Science.gov (United States)

    Hezmee, Mohd Noor Mohd; Kyaw-Tanner, Myat; Lee, Jia Yu Peppermint; Shiels, Ian A; Rolfe, Barbara; Woodruff, Trent; Mills, Paul C

    2011-01-01

    Mammary tumors are among the most common neoplastic conditions in dogs, and there is evidence that inflammation plays a role in the development of some tumor types in dogs. The complement system is a major participant in the inflammatory process and the complement activation component, C5a, is a potent inflammatory peptide. This study investigated the mRNA expression of the major receptor for C5a (C5aR; CD88) in histopathological samples of canine mammary tumors by quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) using canine-specific primers for CD88. A total of seven canine mammary tumors (four malignant carcinomas, two benign mixed mammary tumors, and one myoepithelioma) and eight normal mammary glands were analysed. All the tumor samples expressed low levels of CD88 mRNA, while none of the normal mammary tissues showed any detectable expression. These preliminary results suggest that C5a-CD88 interaction may play a contributory role in the inflammatory response associated with mammary tumor development in dogs. Further studies investigating the mechanisms behind complement activation and C5a receptor expression in canine mammary tumors are warranted. PMID:20846729

  9. Expression of PD-L1 on canine tumor cells and enhancement of IFN-γ production from tumor-infiltrating cells by PD-L1 blockade.

    Directory of Open Access Journals (Sweden)

    Naoya Maekawa

    Full Text Available Programmed death 1 (PD-1, an immunoinhibitory receptor, and programmed death ligand 1 (PD-L1, its ligand, together induce the "exhausted" status in antigen-specific lymphocytes and are thus involved in the immune evasion of tumor cells. In this study, canine PD-1 and PD-L1 were molecularly characterized, and their potential as therapeutic targets for canine tumors was discussed. The canine PD-1 and PD-L1 genes were conserved among canine breeds. Based on the sequence information obtained, the recombinant canine PD-1 and PD-L1 proteins were constructed; they were confirmed to bind each other. Antibovine PD-L1 monoclonal antibody effectively blocked the binding of recombinant PD-1 with PD-L1-expressing cells in a dose-dependent manner. Canine melanoma, mastocytoma, renal cell carcinoma, and other types of tumors examined expressed PD-L1, whereas some did not. Interestingly, anti-PD-L1 antibody treatment enhanced IFN-γ production from tumor-infiltrating cells. These results showed that the canine PD-1/PD-L1 pathway is also associated with T-cell exhaustion in canine tumors and that its blockade with antibody could be a new therapeutic strategy for canine tumors. Further investigations are needed to confirm the ability of anti-PD-L1 antibody to reactivate canine antitumor immunity in vivo, and its therapeutic potential has to be further discussed.

  10. Salient Points in Reconstruction of Nasal Skin after Tumor Ablation with Local Flaps

    Science.gov (United States)

    Ebrahimi, Ali; Motamedi, Mohammad Hosein Kalantar; Nejadsarvari, Nasrin; Ebrahimi, Azin; Rasouli, Hamid Reza

    2016-01-01

    Objective: A variety of nasal skin reconstruction methods are available to meet the esthetic patient's needs. In this article, we review some of modifications of these procedures and share our experience in reconstruction of different parts of the nasal skin following skin tumor ablation. Patients and Methods: From January 2010 to January 2014, 171 patients underwent nasal skin reconstruction after excising cancerous lesions of the involved nasal skin. The patient's history, pre- and post-operation photographs, and the surgery data were collected and assessed. Demographic data related to the type of cancer, defect size and location, type of reconstruction were collected. Results: A variety of local flaps were used based on location and defect features. Nearly all flaps healed primarily without postsurgical significant complications. Conclusion: According to the results and the outcomes of the operations, we concluded that a certain flaps are more effective than others in nasal skin reconstruction. Local flap reconstruction of the nose has good esthetic result with low complication rate.

  11. Expression of p53 and CD44 in Canine Breast Tumor

    Institute of Scientific and Technical Information of China (English)

    LIU Yun; CUI Wen; CHENG Xi; FENG Xinchang

    2008-01-01

    The p53 and CD44 expression of 10 cases in canine breast tumor were examined utilizing immunohistochemical assay with rabbit anti-mouse polyclonal antibodies against p53 or CD44,respectively.The p53 expression was significantly higher in malignant than in benign breast tumor.The expression of CD44 was not significantly different in malignant breast cancer and benign breast tumor.This suggests that p53 can be used as an indicator for animal prognosis.

  12. The Role of c-KIT in Tumorigenesis: Evaluation in Canine Cutaneous Mast Cell Tumors

    Directory of Open Access Journals (Sweden)

    Joshua D. Webster

    2006-02-01

    Full Text Available The c-KIT proto-oncogene has been implicated in the pathogenesis of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and mast cell tumors (MCTs in canines. Cutaneous MCTs are common neoplasms in dogs and have a variable biologic behavior. The goal of this study was to define the prognostic significance of c-KIT mutations identified in canine MCTs and the associations between c-KIT mutations, KIT localization, and KIT expression levels. Microdissection and polymerase chain reaction were performed on 60 MCTs to identify c-KIT mutations. Anti-KIT antibodies were used for immunohistochemical evaluation of KIT localization. Forty-two MCTs were included in a tissue microarray, and KIT expression was quantified using immunofluorescence. Canine MCTs with c-KIT mutations were significantly associated with an increased incidence of recurrent disease and death. c-KIT mutations were also significantly associated with aberrant protein localization; however, the level of KIT expression did not correlate with either c-KIT mutations or changes in protein localization. Considering the high prevalence of canine MCTs and the central role of c-KIT in the tumorigenesis of certain tumors, canine MCTs are an excellent model for characterizing the role of c-KIT in neoplastic diseases and is a potential target for novel therapeutic agents in clinical trials.

  13. Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jong-Hyuk, E-mail: jhkim@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Robinson, Sally [Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Sharkey, Leslie C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); O' Brien, Timothy D. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Dickerson, Erin B. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Modiano, Jaime F., E-mail: modiano@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States)

    2014-04-15

    Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

  14. Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

    International Nuclear Information System (INIS)

    Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

  15. Molecular imaging using Cu-ATSM and FDG in solid canine tumors

    DEFF Research Database (Denmark)

    Hansen, Anders Elias

    Tumor hypoxia is one of the key factors in the development of aggressive and treatment resistant tumors. The negative effects of tumor hypoxia are mediated both by the direct lack of molecular oxygen for therapeutic efficacy and by pro- teomic and genomic changes induced in hypoxic tumor cells....... Identification of hypoxic tumor and intratumoral hypoxic regions therefore hold the potential to serve as a basis for individualized treatment protocols, including image guided radiation therapy. The current PhD project was undertaken to study tumor hypoxia in cancer bearing dogs, with the aims of 1) identifying...... the potential of implementing canine cancer patients in translational research on tumor hypoxia. 2) Non- invasively evaluate the hypoxia positron emission tomography (PET) tracer 64 Copper(II)diacetyl-bis(N 4 -methylthiosemicarbazone) ( 64 Cu-ATSM), including the comparison to non-invasive measures of tumor...

  16. Downregulation of ATM Gene and Protein Expression in Canine Mammary Tumors

    DEFF Research Database (Denmark)

    Raposo-Ferreira, T M M; Bueno, R C; Terra, E M;

    2016-01-01

    The ataxia telangiectasia mutated (ATM) gene encodes a protein associated with DNA damage repair and maintenance of genomic integrity. In women, ATM transcript and protein downregulation have been reported in sporadic breast carcinomas, and the absence of ATM protein expression has been associated...... with poor prognosis. The aim of this study was to evaluate ATM gene and protein expression in canine mammary tumors and their association with clinical outcome. ATM gene and protein expression was evaluated by reverse transcription-quantitative polymerase chain reaction and immunohistochemistry...... downregulation is involved in canine mammary gland tumorigenesis....

  17. Cox-2 levels in canine mammary tumors, including inflammatory mammary carcinoma: clinicopathological features and prognostic significance.

    Science.gov (United States)

    Queiroga, Felisbina Luisa; Perez-Alenza, Maria Dolores; Silvan, Gema; Peña, Laura; Lopes, Carlos; Illera, Juan Carlos

    2005-01-01

    Cyclo-oxygenase (Cox-2) plays an important role in mammary carcinogenesis, nevertheless, its role in canine mammary tumors, and particularly in inflammatory mammary carcinoma (IMC), is unknown. Tumor Cox-2 levels were analyzed by enzyme immunoassay, in post-surgical tumor homogenates of 129 mammary tumors (62 dysplasias and benign tumors, 57 malignant non-IMC and 10 IMC) from 57 female dogs. The highest Cox-2 values were detected in the IMC group. In non-IMC malignant tumors, high values of Cox-2 were related to skin ulceration (p IMC cases could indicate a special role of Cox-2 in the inflammatory phenotype and open the possibility of additional new therapeutic approaches in this special type of mammary cancer in humans and dogs.

  18. Canine and human gastrointestinal stromal tumors display similar mutations in c-KIT exon 11

    International Nuclear Information System (INIS)

    Gastrointestinal stromal tumors (GISTs) are common mesenchymal neoplasms in the gastrointestinal tract of humans and dogs. Little is known about the pathogenesis of these tumors. This study evaluated the role of c-KIT in canine GISTs; specifically, we investigated activating mutations in exons 8, 9, 11, 13, and 17 of c-KIT and exons 12, 14, and 18 of platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), all of which have been implicated in human GISTs. Seventeen canine GISTs all confirmed to be positive for KIT immunostaining were studied. Exons 8, 9, 11, 13 and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA, were amplified from DNA isolated from formalin-fixed paraffin-embedded samples. Of these seventeen cases, six amplicons of exon 11 of c-KIT showed aberrant bands on gel electrophoresis. Sequencing of these amplicons revealed heterozygous in-frame deletions in six cases. The mutations include two different but overlapping six base pair deletions. Exons 8, 9, 13, and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA had no abnormalities detected by electrophoresis and sequencing did not reveal any mutations, other than synonymous single nucleotide polymorphisms (SNPs) found in exon 11 of c-KIT and exons 12 and 14 of PDGFRA. The deletion mutations detected in canine GISTs are similar to those previously found in the juxtamembrane domain of c-KIT in canine cutaneous mast cell tumors in our laboratory as well as to those reported in human GISTs. Interestingly, none of the other c-KIT or PDGFRA exons showed any abnormalities in our cases. This finding underlines the critical importance of c-KIT in the pathophysiology of canine GISTs. The expression of KIT and the identification of these activating mutations in c-KIT implicate KIT in the pathogenesis of these tumors. Our results indicate that mutations in c-KIT may be of prognostic significance and that targeting KIT may be a rational approach to treatment of these malignant tumors. This study further

  19. c-erbB-2 expression and nuclear pleomorphism in canine mammary tumors

    Directory of Open Access Journals (Sweden)

    Dutra A.P.

    2004-01-01

    Full Text Available The objective of the present investigation was to study the expression of c-erbB-2 and MIB-1 and try to associate them with morphological features of the cell such as nuclear pleomorphism, mitotic count and histological grade in a series of 70 canine mammary gland tumors, 22 of them benign and 48 malignant. Tumors were collected at the Veterinary Hospital of UFMG (Brazil and the Veterinary Faculty of Porto University (Portugal. c-erbB-2 expression was determined according to the guidelines provided by the manufacturer of the HercepTest system and nuclear pleomorphism, mitotic count and histological grade according the Elston and Ellis grading system. The HercepTest is the FDA-approved in vitro diagnostic test marketed by Dako. It is a semi-quantitative immunohistochemical assay used to determine overexpression of HER2 protein (human epidermal growth factor receptor in breast cancer tissue. MIB-1 expression was also evaluated in 28 malignant tumors. Seventeen (35.4% of the malignant tumors were positive for c-erbB-2 expression, which was positively associated with nuclear pleomorphism (P < 0.0001, histological grade (P = 0.0017 and mitotic count (P < 0.05. Nuclear pleomorphism also showed a positive association with MIB-1 index (P < 0.0001. These results suggest that some of the biological and morphological characteristics of the tumor are associated in canine mammary gland tumors, as also reported for human breast cancer. It was also possible to show that the immunoexpression of c-erbB-2 can be a factor in mammary carcinogenesis. This fact opens the possibility of using anti-c-erbB-2 antibodies in the treatment of canine mammary tumors.

  20. Immunohistochemical study of genital and extragenital forms of canine transmissible venereal tumor in Brazil

    OpenAIRE

    Mariana B. Mascarenhas; Paulo V. Peixoto; Regina R. Ramadinha; Elise M. Yamasaki; Samay Z.R. Costa; David Driemeier; Luciana Sonne; Ticiana N. França

    2014-01-01

    Aiming to provide insight and discussing the problems related to the diagnosis and differential diagnosis of canine transmissible venereal tumor (CTVT), especially in its extragenital form, immunohistochemical evaluation was performed and a comparison was established by analysis of the microscopic appearance of 10 genital CTVTs and 13 exclusively extragenital CTVTs previously diagnosed by cytology and histopathology. CTVTs samples were incubated with biotinylated antibodies raised against spe...

  1. Primary oral and nasal transmissible venereal tumor in a mix-breed dog

    Institute of Scientific and Technical Information of China (English)

    Mahdieh Rezaei; Shahrzad Azizi; Shima Shahheidaripour; Sara Rostami

    2016-01-01

    Transmissible venereal tumor (TVT) is a coitally transmitted tumor of dogs with wide-spread distribution. The present study describes the occurrence of the primary oral and nasal TVT in a 10-year-old, female, mix-breed dog. The case was presented with a history of anorexia, inability to swallow and dyspnea. Clinical examinations revealed the ema-ciation, muzzle deformity due to the presence of a friable, fleshy, cauliflower-like mass in the oral cavity and submandibular lymphadenopathy. TVT was diagnosed based on histopathological findings. The dog was discharged with therapeutic intervention with vincristine. Unfortunately, the case died before readmission because of the progressive worsening of the general condition. Our findings highlight the need for considering TVT for the differential diagnosis of the extragenital masses in dogs.

  2. Prevalence of the Prefoldin Subunit 5 Gene Deletion in Canine Mammary Tumors.

    Directory of Open Access Journals (Sweden)

    Silvia Hennecke

    Full Text Available A somatic deletion at the proximal end of canine chromosome 27 (CFA27 was recently reported in 50% of malignant mammary tumors. This region harbours the tumor suppressor gene prefoldin subunit 5 (PFDN5 and the deletion correlated with a higher Ki-67 score. PFDN5 has been described to repress c-MYC and is, therefore, a candidate tumor-suppressor and cancer-driver gene in canine mammary cancer. Aim of this study was to confirm the recurrent deletion in a larger number of tumors.Droplet digital PCR for PFDN5 was performed in DNA from 102 malignant, 40 benign mammary tumors/dysplasias, 11 non-neoplastic mammary tissues and each corresponding genomic DNA from leukocytes. The copy number of PFDN5 was normalized to a reference amplicon on canine chromosome 32 (CFA32. Z-scores were calculated, based on Gaussian distributed normalized PFDN5 copy numbers of the leukocyte DNA. Z-scores ≤ -3.0 in tissue were considered as being indicative of the PFDN5 deletion and called as such. The Ki-67 proliferation index was assessed in a subset of 79 tissue samples by immunohistochemistry.The deletion was confirmed in 24% of all malignant tumors, detected in only 7.5% of the benign tumors and was not present in any normal mammary tissue sample. The subgroup of solid carcinomas (n = 9 showed the highest frequency of the deletion (67% and those malignomas without microscopical high fraction of benign tissue (n = 71 had a 32% frequency (p<0.01 vs. benign samples. The Ki-67 score was found to be significantly higher (p<0.05 in the PFDN5-deleted group compared to malignant tumors without the deletion.A somatic deletion of the PFDN5 gene is recurrently present in canine mammary cancer, supporting a potential role in carcinogenesis. The association of this deletion with higher Ki-67 indicates an increased proliferation rate and thus a link to tumor aggressiveness can be hypothesized. The confirmation of earlier results warrants further studies on PFDN5 as cancer

  3. Steroid Tumor Environment in Male and Female Mice Model of Canine and Human Inflammatory Breast Cancer

    Directory of Open Access Journals (Sweden)

    Sara Caceres

    2016-01-01

    Full Text Available Canine inflammatory mammary cancer (IMC shares clinical and histopathological characteristics with human inflammatory breast cancer (IBC and has been proposed as a good model for studying the human disease. The aim of this study was to evaluate the capacity of female and male mice to reproduce IMC and IBC tumors and identify the hormonal tumor environment. To perform the study sixty 6–8-week-old male and female mice were inoculated subcutaneously with a suspension of 106 IPC-366 and SUM149 cells. Tumors and serum were collected and used for hormonal analysis. Results revealed that IPC-366 reproduced tumors in 90% of males inoculated after 2 weeks compared with 100% of females that reproduced tumor at the same time. SUM149 reproduced tumors in 40% of males instead of 80% of females that reproduced tumors after 4 weeks. Both cell lines produce distant metastasis in lungs being higher than the metastatic rates in females. EIA analysis revealed that male tumors had higher T and SO4E1 concentrations compared to female tumors. Serum steroid levels were lower than those found in tumors. In conclusion, IBC and IMC male mouse model is useful as a tool for IBC research and those circulating estrogens and intratumoral hormonal levels are crucial in the development and progression of tumors.

  4. Steroid Tumor Environment in Male and Female Mice Model of Canine and Human Inflammatory Breast Cancer.

    Science.gov (United States)

    Caceres, Sara; Peña, Laura; Silvan, Gema; Illera, Maria J; Woodward, Wendy A; Reuben, James M; Illera, Juan C

    2016-01-01

    Canine inflammatory mammary cancer (IMC) shares clinical and histopathological characteristics with human inflammatory breast cancer (IBC) and has been proposed as a good model for studying the human disease. The aim of this study was to evaluate the capacity of female and male mice to reproduce IMC and IBC tumors and identify the hormonal tumor environment. To perform the study sixty 6-8-week-old male and female mice were inoculated subcutaneously with a suspension of 10(6)IPC-366 and SUM149 cells. Tumors and serum were collected and used for hormonal analysis. Results revealed that IPC-366 reproduced tumors in 90% of males inoculated after 2 weeks compared with 100% of females that reproduced tumor at the same time. SUM149 reproduced tumors in 40% of males instead of 80% of females that reproduced tumors after 4 weeks. Both cell lines produce distant metastasis in lungs being higher than the metastatic rates in females. EIA analysis revealed that male tumors had higher T and SO4E1 concentrations compared to female tumors. Serum steroid levels were lower than those found in tumors. In conclusion, IBC and IMC male mouse model is useful as a tool for IBC research and those circulating estrogens and intratumoral hormonal levels are crucial in the development and progression of tumors. PMID:27195300

  5. TP53 Polymorphisms allow for genetic sub-grouping of the canine transmissible venereal tumor

    Science.gov (United States)

    Sánchez-Servín, Abel; Córdova-Alarcon, Emilio; Fajardo, Raúl

    2009-01-01

    The canine transmissible venereal tumor (CTVT) is found mainly in dogs' sexual organs. Currently, it is widely accepted that all samples of CTVT show similar histopathological characteristics and share common genetic alterations. Despite the common genetic origin of CTVT, mutations in the P53 gene have been reported. In this study, we proposed that tumor samples can be genetically grouped using this gene. The presence of different subgroups of CTVT was determined in Mexican dogs using the TP53 gene sequence in CTVT samples. Four new polymorphisms were found and therefore, the CTVT samples were classified in five subgroups. PMID:19934603

  6. Immunohistochemical and molecular expression of laminin-332 gamma-2 chain in canine mammary tumors

    Directory of Open Access Journals (Sweden)

    D.A.P.C Zuccari

    2011-02-01

    Full Text Available Forty-eight cases of canine mammary cancer were investigated to evaluate the immunohistochemical distribution of the γ2 chain of laminin-332. Tumor cells were compared to a pool of normal mammary tissues using quantitative RT-PCR. The western blot was performed in eight tumor samples as complementary test to evaluate protein integrity. Immunohistochemistry experiments showed negative, focal, and weak expression of laminin-332 γ2 in tumors with the worst prognosis. Quantitative PCR revealed downregulation of the gene in 27 (56.2% of the animals. Out of the 16 dogs with γ2 chain overexpression, seven were still alive. The western blot results showed bands generation of 36, 50, and 98kDa, suggesting degradation of laminin-332 γ2 in malignant tumors. The results suggest that, in the future, low expression and/or degradation of laminin-332 γ2 chain in canine mammary tumors may be used as an indicator of malignant potential. However, further studies are necessary to corroborate these results

  7. New agents for targeting of IL-13RA2 expressed in primary human and canine brain tumors.

    Directory of Open Access Journals (Sweden)

    Waldemar Debinski

    Full Text Available Interleukin 13 receptor alpha 2 (IL-13RA2 is over-expressed in a vast majority of human patients with high-grade astrocytomas like glioblastoma. Spontaneous astrocytomas in dogs resemble human disease and have been proposed as translational model system for investigation of novel therapeutic strategies for brain tumors. We have generated reagents for both detection and therapeutic targeting of IL-13RA2 in human and canine brain tumors. Peptides from three different regions of IL-13RA2 with 100% sequence identity between human and canine receptors were used as immunogens for generation of monoclonal antibodies. Recombinant canine mutant IL-13 (canIL-13.E13K and canIL-13.E13K based cytotoxin were also produced. The antibodies were examined for their immunoreactivities in western blots, immunohistochemistry, immunofluorescence and cell binding assays using human and canine tumor specimen sections, tissue lysates and established cell lines; the cytotoxin was tested for specific cell killing. Several isolated MAbs were immunoreactive to IL-13RA2 in western blots of cell and tissue lysates from glioblastomas from both human and canine patients. Human and canine astrocytomas and oligodendrogliomas were also positive for IL-13RA2 to various degrees. Interestingly, both human and canine meningiomas also exhibited strong reactivity. Normal human and canine brain samples were virtually negative for IL-13RA2 using the newly generated MAbs. MAb 1E10B9 uniquely worked on tissue specimens and western blots, bound live cells and was internalized in GBM cells over-expressing IL-13RA2. The canIL-13.E13K cytotoxin was very potent and specific in killing canine GBM cell lines. Thus, we have obtained several monoclonal antibodies against IL-13RA2 cross-reacting with human and canine receptors. In addition to GBM, other brain tumors, such as high grade oligodendrogliomas, meningiomas and canine choroid plexus papillomas, appear to express the receptor at high levels

  8. Canine parvovirus-like particles, a novel nanomaterial for tumor targeting

    Directory of Open Access Journals (Sweden)

    Destito Giuseppe

    2006-02-01

    Full Text Available Abstract Specific targeting of tumor cells is an important goal for the design of nanotherapeutics for the treatment of cancer. Recently, viruses have been explored as nano-containers for specific targeting applications, however these systems typically require modification of the virus surface using chemical or genetic means to achieve tumor-specific delivery. Interestingly, there exists a subset of viruses with natural affinity for receptors on tumor cells that could be exploited for nanotechnology applications. For example, the canine parvovirus (CPV utilizes transferrin receptors (TfRs for binding and cell entry into canine as well as human cells. TfRs are over-expressed by a variety of tumor cells and are widely being investigated for tumor-targeted drug delivery. We explored whether the natural tropism of CPV to TfRs could be harnessed for targeting tumor cells. Towards this goal, CPV virus-like particles (VLPs produced by expression of the CPV-VP2 capsid protein in a baculovirus expression system were examined for attachment of small molecules and delivery to tumor cells. Structural modeling suggested that six lysines per VP2 subunit are presumably addressable for bioconjugation on the CPV capsid exterior. Between 45 and 100 of the possible 360 lysines/particle could be routinely derivatized with dye molecules depending on the conjugation conditions. Dye conjugation also demonstrated that the CPV-VLPs could withstand conditions for chemical modification on lysines. Attachment of fluorescent dyes neither impaired binding to the TfRs nor affected internalization of the 26 nm-sized VLPs into several human tumor cell lines. CPV-VLPs therefore exhibit highly favorable characteristics for development as a novel nanomaterial for tumor targeting.

  9. Pathogenesis of canine cortisol-secreting adrenocortical tumors

    NARCIS (Netherlands)

    Kool, Miriam

    2015-01-01

    In dogs, hypercortisolism is one of the most frequently observed endocrine disorders, with an estimated incidence of about 1-2 cases per 1000 dogs per year. Approximately 15% of these cases is due to a cortisol-secreting adrenocortical tumor (AT). Cortisol-secreting ATs are characterized by uncontro

  10. Aflatoxins ingestion and canine mammary tumors: There is an association?

    Science.gov (United States)

    Frehse, M S; Martins, M I M; Ono, E Y S; Bracarense, A P F R L; Bissoqui, L Y; Teixeira, E M K; Santos, N J R; Freire, R L

    2015-10-01

    The aim of this study was to determine the presence of mycotoxins on dogs feed and to explore the potential association between mycotoxins exposure and the chance of mamary tumors in a case-control study. The study included 256 female dogs from a hospital population, 85 with mammary tumors (case group) and 171 without mammary tumors (control group). An epidemiological questionnaire was applied to both groups, and the data were analyzed by the EpiInfo statistical package. For the study, 168 samples of the feed offered to dogs were analyzed for the presence of aflatoxins, fumonisins and zearalenone by high-performance liquid chromatography. Mycotoxins were found in 79 samples (100%) in the case group and 87/89 (97.8%) in the control group. Mycotoxins were detected in all types of feed, regardless feed quality. Level of aflatoxin B1 (p = 0.0356, OR = 2.74, 95%, CI 1.13 to 6.60), aflatoxin G1 (AFG1) (p = 0.00007, OR = 4.60, 95%, CI = 2.16 to 9.79), and aflatoxin G2 (AFG2) (p = 0.0133, OR = 9.91, 95%, CI 1.21 to 81.15) were statistically higher in case of mammary cancer. In contrast, neutering was a protective factor for mammary cancer (p = 0.0004, OR = 0.32, 95%, CI = 0.17 to 0.60).

  11. Canine mast cell tumors: diagnosis, treatment, and prognosis

    Directory of Open Access Journals (Sweden)

    Garrett LD

    2014-08-01

    Full Text Available Laura D Garrett Department of Veterinary Clinical Medicine, University of Illinois College of Veterinary Medicine, Urbana, IL, USA Abstract: Mast cell tumors (MCTs are the most common malignant skin cancer in dogs, and significant variability exists in their biological behavior. Most MCTs are cured with appropriate local therapy, but a subset shows malignant behavior with the potential to spread to lymph nodes, liver, spleen, and other areas and to thus become a systemic cancer. Because of this variable behavior, it is difficult to predict how any individual tumor is going to behave. The variability thus creates uncertainty in deciding what a particular dog's prognosis is, whether staging tests to assess for metastasis are needed, and even what treatments will be necessary for best outcome. In addition to controversies over the potential for development of systemic disease, or diffuse metastasis, controversies also exist over what treatment is needed to best attain local control of these tumors. This article will briefly discuss the diagnosis of MCTs in dogs and will summarize the literature in regards to the controversial topics surrounding the more aggressive form of this disease, with recommendations made based on published studies. Keywords: mitotic index, mastocytosis, tyrosine kinase inhibitor, histologic grade

  12. Aflatoxins ingestion and canine mammary tumors: There is an association?

    Science.gov (United States)

    Frehse, M S; Martins, M I M; Ono, E Y S; Bracarense, A P F R L; Bissoqui, L Y; Teixeira, E M K; Santos, N J R; Freire, R L

    2015-10-01

    The aim of this study was to determine the presence of mycotoxins on dogs feed and to explore the potential association between mycotoxins exposure and the chance of mamary tumors in a case-control study. The study included 256 female dogs from a hospital population, 85 with mammary tumors (case group) and 171 without mammary tumors (control group). An epidemiological questionnaire was applied to both groups, and the data were analyzed by the EpiInfo statistical package. For the study, 168 samples of the feed offered to dogs were analyzed for the presence of aflatoxins, fumonisins and zearalenone by high-performance liquid chromatography. Mycotoxins were found in 79 samples (100%) in the case group and 87/89 (97.8%) in the control group. Mycotoxins were detected in all types of feed, regardless feed quality. Level of aflatoxin B1 (p = 0.0356, OR = 2.74, 95%, CI 1.13 to 6.60), aflatoxin G1 (AFG1) (p = 0.00007, OR = 4.60, 95%, CI = 2.16 to 9.79), and aflatoxin G2 (AFG2) (p = 0.0133, OR = 9.91, 95%, CI 1.21 to 81.15) were statistically higher in case of mammary cancer. In contrast, neutering was a protective factor for mammary cancer (p = 0.0004, OR = 0.32, 95%, CI = 0.17 to 0.60). PMID:26271706

  13. Spontaneous skin canine tumors: toluidine blue stain detection of mast cells in tissue section

    Directory of Open Access Journals (Sweden)

    ALKETA QOKU

    2014-06-01

    Full Text Available Dog mast cell tumor (MCT is common in dog. The etiology of canine MCTs is unknown, but it is probably multi-factorial. Its incidence is higher than it has found in human. There are demonstrated several common biological and clinical characteristics in both species. Cutaneous mast cells are located in the dermis and hypodermis. The objective of this study is to detect of MC on Toluidine Blue stained slides. There were examined 74 dogs of difference breeds and aged, from Tirana city. Six of them demonstrated the skin canine tumors. Skin samples were obtained from these animals. Macroscopic examination of the tumor revealed nodular ulcerated lesion with areas of necrosis and hemorrhage, accompanied with normal superjacent epidermis and annexes. Serial sections obtained from biopsy specimens were processed with toluidine blue staining pH 4.5, specific for MC identification. This study suggests that Toluidine blue, pH 4.5 stain may give a good information about skin tumors in dog, histologically with benign behavior.

  14. Immunohistochemical identification of myoepithelial, epithelial, and connective tissue cells in canine mammary tumors.

    Science.gov (United States)

    Destexhe, E; Lespagnard, L; Degeyter, M; Heymann, R; Coignoul, F

    1993-03-01

    Fifty-eight formalin-fixed paraffin-embedded canine mammary tumors, 19 malignant and 39 benign, were used in this study. Tumors were obtained from dogs submitted for surgical resection of lesions at private veterinary practices in Brussels or from the surgery unit of the Faculty of Veterinary Medicine, University of Liège. Immunohistochemical evaluation was performed, using monoclonal antibodies directed against keratins 8-18 and 19, vimentin, desmin, and alpha-actin and polyclonal antibodies directed against high-molecular-weight keratins and S-100 protein. The main cell types, epithelial, myoepithelial, and connective, were identified, and myoepithelial cells represented the major component of most tumors, both benign and malignant. Myoepithelial cells had five patterns: resting and proliferative suprabasal cells, spindle and star-shaped interstitial cells, and cartilage. Reactivity to keratin 19, vimentin, alpha-actin, and S-100 protein suggested a progressive transformation from resting cells to cartilage. Epithelial cell reactivities were limited to keratins; only keratinized cells were positive for polyclonal keratins. Myofibroblasts were positive for both vimentin and alpha-actin, and connective tissue cells were positive for vimentin. Myoepithelial cells appeared to be the major component of carcinomas, justifying reevaluation and simplification of histomorphologic classifications, with a "pleomorphic carcinoma" group including all carcinomas except squamous, mucinous, and comedo carcinomas. Immunohistochemical evaluation, in addition to routine hematoxylin and eosin histopathologic evaluation is recommended for precise classification of canine mammary tumors. PMID:7682367

  15. Ligand-Independent Canonical Wnt Activity in Canine Mammary Tumor Cell Lines Associated with Aberrant LEF1 Expression

    Science.gov (United States)

    van Wolferen, Monique E.; Rao, Nagesha A. S.; Grizelj, Juraj; Vince, Silvijo; Hellmen, Eva; Mol, Jan A.

    2014-01-01

    Pet dogs very frequently develop spontaneous mammary tumors and have been suggested as a good model organism for breast cancer research. In order to obtain an insight into underlying signaling mechanisms during canine mammary tumorigenesis, in this study we assessed the incidence and the mechanism of canonical Wnt activation in a panel of 12 canine mammary tumor cell lines. We show that a subset of canine mammary cell lines exhibit a moderate canonical Wnt activity that is dependent on Wnt ligands, similar to what has been described in human breast cancer cell lines. In addition, three of the tested canine mammary cell lines have a high canonical Wnt activity that is not responsive to inhibitors of Wnt ligand secretion. Tumor cell lines with highly active canonical Wnt signaling often carry mutations in key members of the Wnt signaling cascade. These cell lines, however, carry no mutations in the coding regions of intracellular Wnt pathway components (APC, β-catenin, GSK3β, CK1α and Axin1) and have a functional β-catenin destruction complex. Interestingly, however, the cell lines with high canonical Wnt activity specifically overexpress LEF1 mRNA and the knock-down of LEF1 significantly inhibits TCF-reporter activity. In addition, LEF1 is overexpressed in a subset of canine mammary carcinomas, implicating LEF1 in ligand-independent activation of canonical Wnt signaling in canine mammary tumors. We conclude that canonical Wnt activation may be a frequent event in canine mammary tumors both through Wnt ligand-dependent and novel ligand–independent mechanisms. PMID:24887235

  16. Ligand-independent canonical Wnt activity in canine mammary tumor cell lines associated with aberrant LEF1 expression.

    Directory of Open Access Journals (Sweden)

    Ana Gracanin

    Full Text Available Pet dogs very frequently develop spontaneous mammary tumors and have been suggested as a good model organism for breast cancer research. In order to obtain an insight into underlying signaling mechanisms during canine mammary tumorigenesis, in this study we assessed the incidence and the mechanism of canonical Wnt activation in a panel of 12 canine mammary tumor cell lines. We show that a subset of canine mammary cell lines exhibit a moderate canonical Wnt activity that is dependent on Wnt ligands, similar to what has been described in human breast cancer cell lines. In addition, three of the tested canine mammary cell lines have a high canonical Wnt activity that is not responsive to inhibitors of Wnt ligand secretion. Tumor cell lines with highly active canonical Wnt signaling often carry mutations in key members of the Wnt signaling cascade. These cell lines, however, carry no mutations in the coding regions of intracellular Wnt pathway components (APC, β-catenin, GSK3β, CK1α and Axin1 and have a functional β-catenin destruction complex. Interestingly, however, the cell lines with high canonical Wnt activity specifically overexpress LEF1 mRNA and the knock-down of LEF1 significantly inhibits TCF-reporter activity. In addition, LEF1 is overexpressed in a subset of canine mammary carcinomas, implicating LEF1 in ligand-independent activation of canonical Wnt signaling in canine mammary tumors. We conclude that canonical Wnt activation may be a frequent event in canine mammary tumors both through Wnt ligand-dependent and novel ligand-independent mechanisms.

  17. Anatomia cirúrgica do acesso nasal transesfenoidal para tumores da hipófise Surgical anatomy of the nasal transphenoidal approach for pituitary tumors

    Directory of Open Access Journals (Sweden)

    Murilo S. Meneses

    1997-09-01

    Full Text Available Foram analisadas diferentes medidas relacionadas ao acesso nasal transesfenoidal em 18 hemicabeças de cadáveres com o objetivo de estudar os limites e vantagens dessa via. Foram obtidos os seguintes valores médios (mm para as principais medidas: diâmetro maior da narina 15,18; altura da cavidade nasal 44,11; distância narina - sela turca 71,71. Esses valores demonstram ser o acesso nasal uma via ampla e direta à sela turca. O presente estudo demonstrou também ser possível nesse acesso preservar o septo cartilágino e outras estruturas que são usualmente lesadas no acesso sublabial.Different distances related to the nasal transphenoidal approach were measured on the hemiheads of eighteen cadavers in order to study its limits and advantages. The main mean measures obtained (mm were: major diameter of the nostril 15.18; height of the nasal cavity 44.11; nostril-sella turcica distance 71.71. These results show that the nasal approach is wide and direct to the sella turcica. The present study demonstrate the possibility of preservation of the cartilaginous septum and other structures which are usually damaged when the sublabial approach is employed.

  18. Biphasic pulses enhance bleomycin efficacy in a spontaneous canine genital tumor model of chemoresistance: Sticker sarcoma

    Directory of Open Access Journals (Sweden)

    Citro Gennaro

    2008-11-01

    Full Text Available Abstract Sticker's sarcoma (also known as transmissible venereal tumor is a horizontally transmitted neoplasm of the dog, that is passed with coitus. It is a locally aggressive tumor with a low tendency to metastatic spread. The most common locations are the genitals, the nose, the perianal area. Standard treatment consists with chemotherapy with vincristine, however other therapies such as, cryotherapy, immunotherapy or, in selected cases, radiation therapy, have been reported. In this article we describe the outcome of a small cohort of canine patients, with chemotherapy resistant transmissible venereal tumor (TVT, treated with bleomycin selectively driven by trains of biphasic pulses (electrochemotherapy. Three canine patients, with refractory TVT, entered the study and received two sessions of ECT under sedation. The pets had local injection of bleomycin at the concentration of 1.5 mg/ml and five minutes after the chemotherapy, trains of 8 biphasic electric pulses lasting 50 + 50 μs each, with 1 ms interpulse intervals, were delivered by means of modified caliper or, for difficult districts, through paired needle electrode. All the patients responded to the treatment and are still in remission at different times. Electrochemotherapy appears as a safe and efficacious modality for the treatment of TVT and warrants further investigations.

  19. Potential of Translationally Controlled Tumor Protein-Derived Protein Transduction Domains as Antigen Carriers for Nasal Vaccine Delivery.

    Science.gov (United States)

    Bae, Hae-Duck; Lee, Joohyun; Jin, Xing-Hai; Lee, Kyunglim

    2016-09-01

    Nasal vaccination offers a promising alternative to intramuscular (i.m.) vaccination because it can induce both mucosal and systemic immunity. However, its major drawback is poor absorption of large antigens in the nasal epithelium. Protein transduction domains (PTDs), also called cell-penetrating peptides, have been proposed as vehicles for nasal delivery of therapeutic peptides and proteins. Here, we evaluated the potential of a mutant PTD derived from translationally controlled tumor protein (designated TCTP-PTD 13) as an antigen carrier for nasal vaccines. We first compared the l- and d-forms of TCTP-PTD 13 isomers (l- or d-TCTP-PTD 13) as antigen carriers. Studies in mice demonstrated that nasally administered mixtures of the model antigen ovalbumin (OVA) and d-TCTP-PTD 13 induced higher plasma IgG titers and secretory IgA levels in nasal washes than nasally administered OVA alone, OVA/l-TCTP-PTD 13, or i.m.-injected OVA. Plasma IgG subclass responses (IgG1 and IgG2a) of mice nasally administered OVA/d-TCTP-PTD 13 showed that the predominant IgG subclass was IgG1, indicating a Th2-biased immune response. We also used synthetic CpG oligonucleotides (CpG) as a Th1 immune response-inducing adjuvant. Nasally administered CpG plus OVA/d-TCTP-PTD 13 was superior in eliciting systemic and mucosal immune responses compared to those induced by nasally administered OVA/d-TCTP-PTD 13. Furthermore, the OVA/CpG/d-TCTP-PTD 13 combination skewed IgG1 and IgG2a profiles of humoral immune responses toward a Th1 profile. These findings suggest that TCTP-derived PTD is a suitable vehicle to efficiently carry antigens and to induce more powerful antigen-specific immune responses and a more balanced Th1/Th2 response when combined with a DNA adjuvant. PMID:27454469

  20. Roles of DNA mutation in the coding region and DNA methylation in the 5' flanking region of BRCA1 in canine mammary tumors.

    Science.gov (United States)

    Qiu, Hengbin; Lin, Deigui

    2016-07-01

    The Breast cancer 1, early onset gene (BRCA1) is known to be significantly associated with human familial breast cancer and is identified to play an important role in canine mammary tumors. Here, genetic variations in the coding region and DNA methylation in the 5' flanking region of BRCA1 in canine mammary tumor samples, 15 each of benign and malignant against 10 normal canine mammary tissue samples, were analyzed using the direct sequencing method. The results indicated two point mutations each in the coding region of canine BRCA1 in one benign mammary tumor sample (4702G >T and 4765G >T) and in one malignant canine mammary tumor sample (3619A >G and 4006G >A). No mutations were detected in the normal canine mammary tissue samples. The 4702G >T mutation was found to terminate further translation. The physical effect of the 4765G >T mutation was found to be the repalacement of the glutamate residue with glutamine. The physical effect of the 3619A >G mutation was found to be the replacement of the threonine residue with alanine, and that of mutation 4006G >A was the replacement of the valine residue with isoleucine in the BRCA1 protein. Bisulfite sequencing detected methylated CpG sites in one canine malignant mammary tumor sample. In conclusion, the present study elucidated the mutational status of the BRCA1 coding region and methylation status of the 5' flanking region of BRCA1 in canine mammary tumors. PMID:26888582

  1. Alternativas Terapéuticas en las neoplasias vesicales caninas Therapeutic options in canine bladder tumors

    Directory of Open Access Journals (Sweden)

    R.L. Rovere

    2002-01-01

    Full Text Available Las neoplasias vesicales en caninos representan menos del 1% de los tumores presentes en esta especie. El tratamiento quirúrgico se indica en tumores benignos y como complemento de la quimioterapia y radioterapia. Para la quimioterapia se emplean más frecuentemente la doxorrubicina, el 5-fluorouracilo, la ciclofosfamida, la vincristina y cisplatino. La asociación de la doxorrubicina-ciclofosfamida por vía sistémica en asociación con el cisplatino intravesical, sería un tratamiento recomendable, en particular en los casos de carcinoma de células de transiciónThe canine urinary bladder tumors represent less than 1% of all tumors present in this species. Surgical treatment is indicated in benign tumors and combined with chemotherapy or radiotherapy. Doxorubicin, 5 fluorouracil, cyclophosphamide, vincristine and cisplatin are the drugs mostly used for chemotherapy. Systemic Doxorubicin-ciclophosphamide therapy in association with intravesical cisplatin therapy are recommended, particularly in transitional cell carcinoma

  2. Mulberry Tumors in Retina and Nasal Hamartoma in a Patient With Tuberous Sclerosis

    Directory of Open Access Journals (Sweden)

    S. Reshadat

    2008-10-01

    Full Text Available Introduction: Tuberous Sclerosis (TS is an autosomal dominant disease that affects the brain, skin, eye, heart, kidney even bones. The commonest presentation is seizures in infancy or early childhood (in 80% of cases, mental retardation (in 44%of cases. Characteristic skin lesion includes facial angiofibromas, adenoma sebaceum, hypopigmented macules, shagreen patches ungual ungual fibromas, ash leaf spots, cafe'-au-lait spots.Case Report: A nine years old male was admitted in a pediatric hospital because of the status myoclonic seizures. Seizures had been started since infancy. In physical exam he had some hypopigmented macules, cafe'-au-lait spots and ash leaf lesions, frontal fibrosis and also shagreen patches. Patient was a case of mild mentally retardation with no any focal neurological deficit. Computed tomography scan of brain and MRI imaging revealed sub ependymal tubers with multiple calcification in both sides of parietal region. Electroencephal-ogram recording suggested abnormal spike, sharp wave discharges and lennox-Gastaut pattern. The diagnosis based on the history and physical exam and MRI were tuberous sclerosis. His foundoscopic exam revealed two prominent calcified mass around right optic disc in supratemporal arch, left eye was normal. Retinal angiography revealed the mulberry tumors and right phakoma of retina. Conclusion: Computed tomography also revaled the nasal hamartoma. Histopathologic examination confirmed the diagnosis of angiomyolipoma because the lesion was composed of smooth muscle bundles, mature adipose tissue and blood vessels of different sizes. He remained seizures free after treatment.

  3. Differential diagnosis of pediatric tumors of the nasal cavity and paranasal sinuses: a 45-year multi-institutional review.

    Science.gov (United States)

    Holsinger, F Christopher; Hafemeister, Adam C; Hicks, M John; Sulek, Marcelle; Huh, Winston W; Friedman, Ellen M

    2010-11-01

    We conducted a retrospective case-series review to identify the various diagnoses of neoplasms of the nasal cavity and paranasal sinuses in a pediatric population. Our study group was made up of 54 children-23 boys and 31 girls, aged 8 months to 16 years (mean: 9 yr). All patients had been diagnosed with a tumor of the nasal cavity or paranasal sinuses between Jan. 1, 1955, and Dec. 31, 1999, at one of four university-based, tertiary care referral centers. We compiled data on tumoral characteristics (location, size, and histopathology), morbidity and mortality, and rates of recurrence. Lesions included adnexal neoplasm, ameloblastic fibro-odontoma, basal cell carcinoma, benign fibrous histiocytoma, blue nevus, chondrosarcoma, compound nevus, epithelioma adenoides cysticum, esthesioneuroblastoma, Ewing sarcoma, fibrosarcoma, giant cell granuloma, granulocytic sarcoma, hemangioma, hemangiopericytoma, Langerhans cell histiocytosis, lymphangioma, lymphoma, melanoma, neuroblastoma, neurofibroma, ossifying osteofibroma, osteochondroma, osteosarcoma, port wine stain, rhabdomyosarcoma, Spitz nevus, and xanthogranuloma. To the best of our knowledge, this is the largest such study of its kind to date. We believe that the large size of this study and the data on disease incidence will allow clinicians to be better informed of the differential diagnosis of neoplasms of the nasal cavity and paranasal sinuses in the pediatric population.

  4. A benchmark analysis of radiation flux distribution for Boron Neutron Capture Therapy of canine brain tumors

    Energy Technology Data Exchange (ETDEWEB)

    Moran, J.M.

    1992-02-01

    Calculations of radiation flux and dose distributions for Boron Neutron Capture Therapy (BNCT) of brain tumors are typically performed using sophisticated three-dimensional analytical models based on either a homogeneous approximation or a simplified few-region approximation to the actual highly-heterogeneous geometry of the irradiation volume. Such models should be validated by comparison with calculations using detailed models in which all significant macroscopic tissue heterogeneities and geometric structures are explicitly represented as faithfully as possible. This work describes a validation exercise for BNCT of canine brain tumors. Geometric measurements of the canine anatomical structures of interest for this work were performed by dissecting and examining two essentially identical Labrador Retriever heads. Chemical analyses of various tissue samples taken during the dissections were conducted to obtain measurements of elemental compositions for tissues of interest. The resulting geometry and tissue composition data were then used to construct a detailed heterogeneous calculational model of the Labrador Retriever head. Calculations of three-dimensional radiation flux distributions pertinent to BNCT were performed for the model using the TORT discrete-ordinates radiation transport code. The calculations were repeated for a corresponding volume-weighted homogeneous tissue model. Comparison of the results showed that the peak neutron and photon flux magnitudes were quite similar for the two models (within 5%), but that the spatial flux profiles were shifted in the heterogeneous model such that the fluxes in some locations away from the peak differed from the corresponding fluxes in the homogeneous model by as much as 10-20%. Differences of this magnitude can be therapeutically significant, emphasizing the need for proper validation of simplified treatment planning models.

  5. A benchmark analysis of radiation flux distribution for Boron Neutron Capture Therapy of canine brain tumors

    International Nuclear Information System (INIS)

    Calculations of radiation flux and dose distributions for Boron Neutron Capture Therapy (BNCT) of brain tumors are typically performed using sophisticated three-dimensional analytical models based on either a homogeneous approximation or a simplified few-region approximation to the actual highly-heterogeneous geometry of the irradiation volume. Such models should be validated by comparison with calculations using detailed models in which all significant macroscopic tissue heterogeneities and geometric structures are explicitly represented as faithfully as possible. This work describes a validation exercise for BNCT of canine brain tumors. Geometric measurements of the canine anatomical structures of interest for this work were performed by dissecting and examining two essentially identical Labrador Retriever heads. Chemical analyses of various tissue samples taken during the dissections were conducted to obtain measurements of elemental compositions for tissues of interest. The resulting geometry and tissue composition data were then used to construct a detailed heterogeneous calculational model of the Labrador Retriever head. Calculations of three-dimensional radiation flux distributions pertinent to BNCT were performed for the model using the TORT discrete-ordinates radiation transport code. The calculations were repeated for a corresponding volume-weighted homogeneous tissue model. Comparison of the results showed that the peak neutron and photon flux magnitudes were quite similar for the two models (within 5%), but that the spatial flux profiles were shifted in the heterogeneous model such that the fluxes in some locations away from the peak differed from the corresponding fluxes in the homogeneous model by as much as 10-20%. Differences of this magnitude can be therapeutically significant, emphasizing the need for proper validation of simplified treatment planning models

  6. Immunohistochemical study of genital and extragenital forms of canine transmissible venereal tumor in Brazil

    Directory of Open Access Journals (Sweden)

    Mariana B. Mascarenhas

    2014-03-01

    Full Text Available Aiming to provide insight and discussing the problems related to the diagnosis and differential diagnosis of canine transmissible venereal tumor (CTVT, especially in its extragenital form, immunohistochemical evaluation was performed and a comparison was established by analysis of the microscopic appearance of 10 genital CTVTs and 13 exclusively extragenital CTVTs previously diagnosed by cytology and histopathology. CTVTs samples were incubated with biotinylated antibodies raised against specific membrane (anti-macrophage and cytoplasmic antigens (anti-lysozyme, anti-S-100 protein, anti-vimentin and anti-CD18 and subsequently developed using streptavidin-biotin peroxidase and streptavidin-biotin-alkaline phosphatase methods. A strong reactivity with the anti-vimentin antibody was found in 100% of the tumors tested (22/22. No reactivity was found for the anti-lysozyme, anti-macrophage, anti-S-100 protein and anti-CD18. No histopathological or immunoreactivity differences between genital and extragenital CTVTs were found. These findings do not corroborate the hypothesis of histiocytic origin of CTVT (no reactivity to anti-lysozyme, anti-macrophage and anti-CD 18 antibodies. In addition, the antibody panel used is useful to narrow the differential diagnosis for lymphomas, histiocytic tumors, amelanotic melanomas, and poorly differentiated epithelial neoplasias, among others.

  7. Transrectal ultrasound-integrated spectral optical tomography of hypoxic progression of a regressing tumor in a canine prostate.

    Science.gov (United States)

    Jiang, Z; Piao, D; Bartels, K E; Holyoak, G R; Ritchey, J W; Ownby, C L; Rock, K; Slobodov, G

    2011-12-01

    The objective of this study was to evaluate if transrectal optical tomography implemented at three wavelength bands for spectral detection could monitor changes of the hemoglobin oxygen saturation (StO2) in addition to those of the total hemoglobin concentration ([HbT]) in lesions of a canine prostate, including an induced tumor modeling canine prostate cancer. Near-infrared (NIR) optical tomography was integrated with ultrasound (US) for transrectal imaging. Multi-spectral detection at 705_nm, 785_nm and 808_nm rendered measurements of [HbT] and StO2. Canine transmissible venereal tumor (TVT) cells were injected into the right lobe of a dog's prostate gland, which had a pre-existing cyst in the left lobe. Longitudinal assessments of the prostate were performed weekly over a 63-day duration by NIR imaging concurrent with grey-scale and Doppler US. Ultrasonography revealed a bi-lobular tumor-mass regressing from day-49 to day-63. At day-49 this tumor-mass developed a hypoxic core that became larger and more intense by day-56 and expanded further by day-63. The tumor-mass presented a strong hyper-[HbT] feature on day-56 that was inconsistent with US-visualized blood flow. Histology confirmed two necrotic TVT foci within this tumor-mass. The cyst appeared to have a large anoxic-like interior that was greater in size than its ultrasonographically delineated lesion, and a weak lesional elevation of [HbT]. On day-56, the cyst presented a strong hyper-[HbT] feature consistent with US-resolved blood flow. Histology revealed acute and chronic hemorrhage in the periphery of the cyst. The NIR imaging features of two other TVT nodules and a metastatic lymph node were evaluated retrospectively. Transrectal US-integrated spectral optical tomography seems to enable longitudinal monitoring of intra-lesional oxygenation dynamics in addition to the hemoglobin content of lesions in the canine prostate.

  8. Downregulation of the KLF4 transcription factor inhibits the proliferation and migration of canine mammary tumor cells.

    Science.gov (United States)

    Tien, Yung-Tien; Chang, Mei-Hsien; Chu, Pei-Yi; Lin, Chen-Si; Liu, Chen-Hsuan; Liao, Albert T

    2015-08-01

    Canine mammary tumor (CMT) is the most common neoplasm in female dogs, and over 50% of CMTs are diagnosed as malignant. Krüppel-like factor 4 (KLF4) is a member of the KLF family of transcription factors and is associated with cell proliferation, differentiation, migration, and apoptosis. Although the role of KLF4 is still controversial in various human cancers, KLF4 has been identified as an oncogene in human breast cancer. Moreover, high KLF4 expression is correlated with an aggressive phenotype in CMT. Therefore, investigating the function of KLF4 may help better understand the pathogenesis of CMT. In this study, partial sequences of canine KLF4 and KLF4 expression were identified in various normal canine tissues, as well as CMT cells and Madin-Darby canine kidney (MDCK) cells. Kenpaullone, a small molecule inhibitor of KLF4, downregulated KLF4 expression in CMT cells and reduced CMT cell proliferation, migration, and colony formation in soft agar. Kenpaullone treatment induced S and G2/M phase arrest in CMT and MDCK cells, and induced death in CMT cells, but not in MDCK cells. It was concluded that KLF4 is expressed in various normal canine tissues, and downregulation of KLF4 inhibited CMT cell proliferation and migration, and induced cell death. The results of this study suggest that KLF4 may represent a suitable therapeutic target for CMT therapy. PMID:25616642

  9. Interstitial radiation therapy for early-stage nasal vestibule cancer: A continuing quest for optimal tumor control and cosmesis

    International Nuclear Information System (INIS)

    Introduction: This article reports on the effectiveness, cosmetic outcome, and costs of interstitial high-dose-rate (HDR) brachytherapy for early-stage cancer of the nasal vestibule (NV) proper and/or columella high-dose-rate (HDR). Methods and Materials: Tumor control, survival, cosmetic outcome, functional results, and costs were established in 64 T1/T2N0 nasal vestibule cancers treated from 1991-2005 by fractionated interstitial radiation therapy (IRT) only. Total dose is 44 Gy: 2 fractions of 3 Gy per day, 6-hour interval, first and last fraction 4 Gy. Cosmesis is noted in the chart by the medical doctor during follow-up, by the patient (visual analog scale), and by a panel. Finally, full hospital costs are computed. Results: A local relapse-free survival rate of 92% at 5 years was obtained. Four local failures were observed; all four patients were salvaged. The neck was not treated electively; no neck recurrence in follow-up was seen. Excellent cosmetic and functional results were observed. With 10 days admission for full treatment, hospital costs amounted to Euro 5772 ($7044). Conclusion: Excellent tumor control, cosmesis, and function of nasal airway passage can be achieved when HDR-IRT for T1/T2N0 NV cancers is used. For the more advanced cancers (Wang classification: T3 tumor stage), we elect to treat by local excision followed by a reconstructive procedure. The costs, admission to hospital inclusive, for treatment by HDR-IRT amounts to Euro 5772 ($7044 US). This contrasts substantially with the full hospital costs when NV cancers are treated by plastic reconstructive surgery, being on average threefold as expensive

  10. Detection of mutations within exons 4 to 8 of the p53 tumor suppressor gene in canine mammary glands

    Directory of Open Access Journals (Sweden)

    D.M.B. Souza

    2012-04-01

    Full Text Available Fifteen female canines with mammary tumors and 6 normal females were used to study mutations in exons 4 to 8 of the p53 gene. DNA samples from the tumors, respective adjacent normal mammary tissue and mammary glands from healthy animals were sequenced and analyzed for the presence of mutations. Mutations were found in 71.8% of the samples and the most frequent were missense mutations. The most attacked exons in the mammary tumor were 5, 7 and 8, with 23.4, 31.6 and 23.4% mutations, respectively. Canine mammary tumors are related to mutations in gene p53 and mutations mostly occur in the region of the protein that is linked to the DNA in the cell nucleus, which can change the functionality of the cell and propitiate tumor growth. Despite being macroscopically normal, the mammary tissue adjacent to the tumors has mutations that can lead to recurrence if not removed together with the tumor.

  11. Expression of growth hormone in canine mammary tissue and mammary tumors. Evidence for a potential autocrine/paracrine stimulatory loop.

    OpenAIRE

    Van Garderen, E.; Wit, M. de; Voorhout, W F; Rutteman, G. R.; Mol, J.A.; Nederbragt, H; Misdorp, W.

    1997-01-01

    The role of progestins in the pathogenesis of breast cancer in women remains controversial. To advance this discussion, we report the demonstration and localization of progestin-induced biosynthesis of growth hormone (GH) in canine mammary gland tissue. Nontumorous mammary tissues and tumors, both benign and malignant, were obtained from private household dogs. Immunoreactive GH was localized in mammary epithelial cells and correlated with the presence of GH mRNA. Local synthesis of GH was al...

  12. Intratumoral FoxP3 expression is associated with angiogenesis and prognosis in malignant canine mammary tumors.

    Science.gov (United States)

    Carvalho, Maria Isabel; Pires, Isabel; Prada, Justina; Gregório, Hugo; Lobo, Luis; Queiroga, Felisbina L

    2016-10-01

    The activity of regulatory T cells (Tregs) is closely associated with the expression of FoxP3 transcription factor. FoxP3 regulatory T cells (FoxP3Treg) have immunosuppressive properties and can work for prevention of harmful autoimmune responses, however can also interfere with beneficial anti-tumor immunity. In human breast cancer these cells play a crucial role in tumor progression. In canine mammary tumors (CMT) this topic is not well-documented. This study included 80 malignant CMT and studied, by immunohistochemistry, the intratumoral FoxP3 expression together with microvessel density (MVD), vascular endothelial growth factor (VEGF) and several clinicopathological characteristics. Abundant FoxP3Treg cells were associated with tumor necrosis (p=0.001), high mitotic grade (paggression in these tumors. The association of intratumoral FoxP3 expression with shorter OS in multivariate analysis suggests the usefulness of Treg cells as an independent prognostic marker. PMID:27496736

  13. Evaluation of tumor markers carcinoembryonic antigen, cytokeratin 19 fragment and cancer-associated antigen 72-4 in neoplastic and non-neoplastic canine effusions differentiation

    OpenAIRE

    L.V Teixeira; T.A. Guerra; F.O. Conrado; S.R. Terra; D.G. Gerardi; González, F.H.D.

    2014-01-01

    The concentration of tumor markers in body fluids can be used for diagnosis and prognosis of patients. This study aimed to investigate the performance of tumor markers cytokeratin 19 fragment (CYFRA 21-1), cancer-associated antigen 72-4 (CA 72-4) and carcinoembryonic antigen (CEA) in the neoplastic and non-neoplastic canine effusions. In thirty-two neoplastic (n=16) and non-neoplastic (n=16) samples of canine thoracic or abdominal effusions, tumor markers were measured. Significant statistica...

  14. Correlation of tumor-infiltrating lymphocytes to histopathological features and molecular phenotypes in canine mammary carcinoma: A morphologic and immunohistochemical morphometric study

    OpenAIRE

    Kim, Jong-Hyuk; Chon, Seung-Ki; Im, Keum-Soon; Kim, Na-Hyun; Sur, Jung-Hyang

    2013-01-01

    Abundant lymphocyte infiltration is frequently found in canine malignant mammary tumors, but the pathological features and immunophenotypes associated with the infiltration remain to be elucidated. The aim of the present study was to evaluate the relationship between lymphocyte infiltration, histopathological features, and molecular phenotype in canine mammary carcinoma (MC). The study was done with archived formalin-fixed, paraffin-embedded samples (n = 47) by histologic and immunohistochemi...

  15. Failure-to-thrive syndrome associated with tumor formation by Madin-Darby canine kidney cells in newborn nude mice.

    Science.gov (United States)

    Brinster, Lauren R; Omeir, Romelda L; Foseh, Gideon S; Macauley, Juliete N; Snoy, Philip J; Beren, Joel J; Teferedegne, Belete; Peden, Keith; Lewis, Andrew M

    2013-08-01

    Tumors that formed in newborn nude mice that were inoculated with 10(7) Madin-Darby canine kidney (MDCK) cells were associated with a failure-to-thrive (FTT) syndrome consisting of growth retardation, lethargy, weakness, and dehydration. Scoliosis developed in 41% of affected pups. Pups were symptomatic by week 2; severely affected pups became moribund and required euthanasia within 3 to 4 wk. Mice with FTT were classified into categories of mild, moderate, and severe disease by comparing their weight with that of age-matched normal nude mice. The MDCK-induced tumors were adenocarcinomas that invaded adjacent muscle, connective tissue, and bone; 6 of the 26 pups examined had lung metastases. The induction of FTT did not correlate with cell-line aggressiveness as estimated by histopathology or the efficiency of tumor formation (tumor-forming dose 50% endpoint range = 10(2.8) to 10(7.5)); however, tumor invasion of the paravertebral muscles likely contributed to the scoliosis noted. In contrast to the effect of MDCK cells, tumor formation observed in newborn mice inoculated with highly tumorigenic, human-tumor-derived cell lines was not associated with FTT development. We suggest that tumor formation and FTT are characteristics of these MDCK cell inocula and that FTT represents a new syndrome that may be similar to the cachexia that develops in humans with cancer or other diseases. PMID:24209967

  16. Selenium Induces an Anti-tumor Effect Via Inhibiting Intratumoral Angiogenesis in a Mouse Model of Transplanted Canine Mammary Tumor Cells.

    Science.gov (United States)

    Li, Wenyu; Guo, Mengyao; Liu, Yuzhu; Mu, Weiwei; Deng, Ganzhen; Li, Chengye; Qiu, Changwei

    2016-06-01

    Selenium (Se) has been widely reported to possess anti-tumor effects. Angiogenesis is the formation of new blood vessels and is required to supply oxygen, nutrients, and growth factors for tumor growth, progression, and metastasis. To explore whether the anti-tumor effect of Se was associated with angiogenesis in vivo, we studied the effects of sodium selenite (Sel) and methylseleninic acid (MSA) on tumors induced by canine mammary tumor cells (CMT1211) in mice; cyclophosphamide (CTX) served as a positive control. The results showed that the Se content was significantly increased in the Sel and MSA groups. Se significantly inhibited the tumor weights and volumes. Large necrotic areas and scattered and abnormal small necrotic areas were observed in the Se treatment group. Immunofluorescence double staining showed a reduction in the microvessel density (MVD) and increment in the vessel maturation index (VMI) compared with the untreated control group. As expected, the protein and mRNA levels of the angiogenesis factors angiopoietin-2 (Ang-2), platelet-derived growth factor (PDGF), and vascular endothelial growth factor (VEGF) were decreased in the Se-treated tumors by IHC, as shown by western blotting and RT-QPCR. We also found that organic Se MSA provided stronger inhibition of tumor growth compared with inorganic sodium selenite (Sel). Altogether, our results indicated that Se exerted anti-tumor effects in vivo at least partially by inhibiting angiogenic factors. PMID:26507439

  17. Intensity-Modulated Radiotherapy for Tumors of the Nasal Cavity and Paranasal Sinuses: Clinical Outcomes and Patterns of Failure

    Energy Technology Data Exchange (ETDEWEB)

    Wiegner, Ellen A.; Daly, Megan E.; Murphy, James D.; Abelson, Jonathan; Chapman, Chris H.; Chung, Melody; Yu, Yao; Colevas, A. Dimitrios; Kaplan, Michael J.; Fischbein, Nancy; Le, Quynh-Thu [Department of Radiation Oncology, Stanford University, Stanford, CA (United States); Chang, Daniel T., E-mail: dtchang@stanford.edu [Department of Radiation Oncology, Stanford University, Stanford, CA (United States)

    2012-05-01

    Purpose: To report outcomes in patients treated with intensity-modulated radiotherapy (IMRT) for tumors of the paranasal sinuses and nasal cavity (PNS/NC). Methods/Materials: Between June 2000 and December 2009, 52 patients with tumors of the PNS/NC underwent postoperative or definitive radiation with IMRT. Twenty-eight (54%) patients had squamous cell carcinoma (SCC). Twenty-nine patients (56%) received chemotherapy. The median follow-up was 26.6 months (range, 2.9-118.4) for all patients and 30.9 months for living patients. Results: Eighteen patients (35%) developed local-regional failure (LRF) at median time of 7.2 months. Thirteen local failures (25%) were observed, 12 in-field and 1 marginal. Six regional failures were observed, two in-field and four out-of-field. No patients treated with elective nodal radiation had nodal regional failure. Two-year local-regional control (LRC), in-field LRC, freedom from distant metastasis (FFDM), and overall survival (OS) were 64%, 74%, 71%, and 66% among all patients, respectively, and 43%, 61%, 61%, and 53% among patients with SCC, respectively. On multivariate analysis, SCC and >1 subsite involved had worse LRC (p = 0.0004 and p = 0.046, respectively) and OS (p = 0.003 and p = 0.046, respectively). Cribriform plate invasion (p = 0.005) and residual disease (p = 0.047) also had worse LRC. Acute toxicities included Grade {>=}3 mucositis in 19 patients (37%), and Grade 3 dermatitis in 8 patients (15%). Six patients had Grade {>=}3 late toxicity including one optic toxicity. Conclusions: IMRT for patients with PNS/NC tumors has good outcomes compared with historical series and is well tolerated. Patients with SCC have worse LRC and OS. LRF is the predominant pattern of failure.

  18. Progesterone receptor isoform analysis by quantitative real-time polymerase chain reaction in formalin-fixed, paraffin-embedded canine mammary dysplasias and tumors

    DEFF Research Database (Denmark)

    Guil-Luna, S.; Stenvang, Jan; Brünner, Nils;

    2014-01-01

    and its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign...

  19. Multimodality functional imaging of spontaneous canine tumors using 64CU-ATSM and 18FDG PET/CT and dynamic contrast enhanced perfusion CT

    DEFF Research Database (Denmark)

    Hansen, Anders E; Kristensen, Annemarie T; Law, Ian;

    2012-01-01

    To compare the distribution and uptake of the hypoxia tracer (64)Cu-diacetyl-bis(N(4)-methylthiosemicarbazone) ((64)Cu-ATSM) PET/CT, FDG PET/CT and dynamic contrast enhanced perfusion CT (DCE-pCT) in spontaneous canine tumors. In addition (64)Cu-ATSM distribution over time was evaluated....

  20. Treatment of natural mammary gland tumors in canines and felines using gold nanorods-assisted plasmonic photothermal therapy to induce tumor apoptosis

    Directory of Open Access Journals (Sweden)

    Ali MRK

    2016-09-01

    Full Text Available Moustafa R K Ali,1 Ibrahim M Ibrahim,2,† Hala R Ali,2,3 Salah A Selim,2 Mostafa A El-Sayed1,4 1School of Chemistry and Biochemistry, Georgia Institute of Technology, and Laser Dynamics Laboratory, Atlanta, GA, USA; 2Department of Veterinary Medicine, Cairo University, Giza, Cairo, Egypt; 3Department of Bacteriology and Immunology, Animal Health Research Institute (AHRI, Dokki, Giza, Egypt; 4School of Chemistry, King Abdul Aziz University, Jeddah, Saudi Arabia †Ibrahim M Ibrahim passed away on August 23, 2015 Abstract: Plasmonic photothermal therapy (PPTT is a cancer therapy in which gold nanorods are injected at the site of a tumor before near-infrared light is transiently applied to the tumor causing localized cell death. Previously, PPTT studies have been carried out on xenograft mice models. Herein, we report a study showing the feasibility of PPTT as applied to natural tumors in the mammary glands of dogs and cats, which more realistically represent their human equivalents at the molecular level. We optimized a regime of three low PPTT doses at 2-week intervals that ablated tumors mainly via apoptosis in 13 natural mammary gland tumors from seven animals. Histopathology, X-ray, blood profiles, and comprehensive examinations were used for both the diagnosis and the evaluation of tumor statuses before and after treatment. Histopathology results showed an obvious reduction in the cancer grade shortly after the first treatment and a complete regression after the third treatment. Blood tests showed no obvious change in liver and kidney functions. Similarly, X-ray diffraction showed no metastasis after 1 year of treatment. In conclusion, our study suggests the feasibility of applying the gold nanorods-PPTT on natural tumors in dogs and cats without any relapse or toxicity effects after 1 year of treatment. Keywords: gold nanorods, natural mammary tumors, plasmonic photothermal therapy, canine, feline

  1. Establishment of a canine mammary gland tumor cell line and characterization of its miRNA expression

    Science.gov (United States)

    Sunden, Yuji; Sugiyama, Akihiko; Azuma, Kazuo; Murahata, Yusuke; Tsuka, Takeshi; Ito, Norihiko; Imagawa, Tomohiro; Okamoto, Yoshiharu

    2016-01-01

    Canine mammary gland tumors (CMGTs), which are the most common neoplasms in sexually intact female dogs, have been suggested as a model for studying human breast cancer because of several similarities, including relative age of onset, risk factors, incidence, histological and molecular features, biological behavior, metastatic pattern, and responses to therapy. In the present study, we established a new cell line, the SNP cell line, from a CMGT. A tumor formed in each NOD.CB17-Prkdcscid/J mouse at the site of subcutaneous SNP cell injection. SNP cells are characterized by proliferation in a tubulopapillary pattern and are vimentin positive. Moreover, we examined miRNA expression in the cultured cells and found that the expression values of miRNA-143 and miRNA-138a showed the greatest increase and decrease, respectively, of all miRNAs observed, indicating that these miRNAs might play a significant role in the malignancy of SNP cells. Overall, the results of this study indicate that SNP cells might serve as a model for future genetic analysis and clinical treatments of human breast tumors. PMID:26726024

  2. Correlation of tumor-infiltrating lymphocytes to histopathological features and molecular phenotypes in canine mammary carcinoma: A morphologic and immunohistochemical morphometric study.

    Science.gov (United States)

    Kim, Jong-Hyuk; Chon, Seung-Ki; Im, Keum-Soon; Kim, Na-Hyun; Sur, Jung-Hyang

    2013-04-01

    Abundant lymphocyte infiltration is frequently found in canine malignant mammary tumors, but the pathological features and immunophenotypes associated with the infiltration remain to be elucidated. The aim of the present study was to evaluate the relationship between lymphocyte infiltration, histopathological features, and molecular phenotype in canine mammary carcinoma (MC). The study was done with archived formalin-fixed, paraffin-embedded samples (n = 47) by histologic and immunohistochemical methods. The degree of lymphocyte infiltration was evaluated by morphologic analysis, and the T- and B-cell populations as well as the T/B-cell ratio were evaluated by morphometric analysis; results were compared with the histologic features and molecular phenotypes. The degree of lymphocyte infiltration was significantly higher in MCs with lymphatic invasion than in those without lymphatic invasion (P aggressive histologic features, lymphocytes may be important for tumor aggressiveness and greater malignant behavior in the tumor microenvironment. PMID:24082407

  3. Progesterone receptor isoform analysis by quantitative real-time polymerase chain reaction in formalin-fixed, paraffin-embedded canine mammary dysplasias and tumors.

    Science.gov (United States)

    Guil-Luna, S; Stenvang, J; Brünner, N; Sánchez-Céspedes, R; Millán, Y; Gómez-Laguna, J; de las Mulas, J Martín

    2014-09-01

    Cloning and sequencing of the progesterone receptor gene in dogs have revealed 2 isoforms, A and B, transcribed from a single gene. Distribution of isoforms A and B in canine mammary lesions has hitherto been investigated only by Western blot analysis. This study analyzed progesterone receptor and its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign tumors, and 59% of carcinomas. Carcinomas, and particularly simple epithelial-type carcinomas, displayed the lowest levels of expression. A high rate of agreement was recorded between RT-qPCR and immunohistochemical labeling. Isoforms A and B were successfully amplified, with correlation coefficients of 0.99 and amplification efficiencies close to 2, and were expressed in all lesion types analyzed. Predominance of A over B expression was observed in carcinomas and complex adenomas. Low-grade tumors exhibited higher progesterone receptor messenger RNA (mRNA) levels, but no difference was observed in the expression of isoform A versus B. Analysis of progesterone receptor mRNA isoforms by RT-qPCR was successful in routinely formalin-fixed, paraffin-embedded tissue samples and enabled the distribution of isoforms A and B to be identified for the first time in dysplasias, benign tumors, and malignant tumors of the canine mammary gland. These findings will facilitate future research into the role of progesterone receptor isoforms in the progression of canine mammary tumors. PMID:24249219

  4. Canine distemper virus induces apoptosis in cervical tumor derived cell lines

    Directory of Open Access Journals (Sweden)

    Rajão Daniela S

    2011-06-01

    Full Text Available Abstract Apoptosis can be induced or inhibited by viral proteins, it can form part of the host defense against virus infection, or it can be a mechanism for viral spread to neighboring cells. Canine distemper virus (CDV induces apoptotic cells in lymphoid tissues and in the cerebellum of dogs naturally infected. CDV also produces a cytopathologic effect, leading to apoptosis in Vero cells in tissue culture. We tested canine distemper virus, a member of the Paramyxoviridae family, for the ability to trigger apoptosis in HeLa cells, derived from cervical cancer cells resistant to apoptosis. To study the effect of CDV infection in HeLa cells, we examined apoptotic markers 24 h post infection (pi, by flow cytometry assay for DNA fragmentation, real-time PCR assay for caspase-3 and caspase-8 mRNA expression, and by caspase-3 and -8 immunocytochemistry. Flow cytometry showed that DNA fragmentation was induced in HeLa cells infected by CDV, and immunocytochemistry revealed a significant increase in the levels of the cleaved active form of caspase-3 protein, but did not show any difference in expression of caspase-8, indicating an intrinsic apoptotic pathway. Confirming this observation, expression of caspase-3 mRNA was higher in CDV infected HeLa cells than control cells; however, there was no statistically significant change in caspase-8 mRNA expression profile. Our data suggest that canine distemper virus induced apoptosis in HeLa cells, triggering apoptosis by the intrinsic pathway, with no participation of the initiator caspase -8 from the extrinsic pathway. In conclusion, the cellular stress caused by CDV infection of HeLa cells, leading to apoptosis, can be used as a tool in future research for cervical cancer treatment and control.

  5. Nasal Physiology

    Science.gov (United States)

    ... Q&A Complications of Sinusitis Epistaxis (Nosebleeds) Allergic Rhinitis (Hay Fever) Headaches and Sinus Disease Disorders of ... of the autonomic, i.e. automatic, nervous system) controls blood flow to the nasal cavity and nasal ...

  6. Nasal Cancer

    Science.gov (United States)

    ... the way to your throat as you breathe. Cancer of the nasal cavity and paranasal sinuses is ... be like those of infections. Doctors diagnose nasal cancer with imaging tests, lighted tube-like instruments that ...

  7. Bipolar electric coagulation under nasal endoscopic treatment of tumor curative effect observation of nasal bleeding%鼻内窥镜下双极电凝治疗非肿瘤性鼻出血的疗效观察

    Institute of Scientific and Technical Information of China (English)

    杨伟

    2016-01-01

    ObjectiveTo observe the bipolar electric coagulation under nasal endoscopic treatment of tumor clinical therapeutic effects of nasal bleeding.MethodsSelect our hospital of tumor patients, 82 cases of nasal bleeding,randomly divided into experimental group and control group,experimental group of 41 cases using bipolar under nasal endoscope,an electrocautery unit of blood control group 41 cases using traditional tamponade hemostasis method.Observe and compare the experimental group and control group of hemostatic efifciency,adverse reactions as well as the treatment time after treatment.ResultsIn all patients after discharge for more than three months of follow-up,the experimental group in the early bleeding rate is 92%, the control group is 56%; After long-term tracking total hemostatic rate is 96%, the control group is 90%; Experimental group adverse reaction rate is 8%,the control group is 80%;The average treatment time group 3.8 days, the control group of 7.1 days. Comparing all of the above content, statistically signiifcant difference (P<0.05).ConclusionThe beginning of the bipolar electric coagulation under nasal endoscopic hemostatic rate is significantly higher than the traditional nasal tamponade hemostasis rate,and also can reduce adverse reaction,shorten the treatment time at the same time,the overall curative effect is distinct,worthy of clinical use.%目的:观察鼻内窥镜下双极电凝治疗非肿瘤性鼻出血的临床治疗疗效。方法选取2013年5月~2015年5月我院收治的非肿瘤性鼻出血患者82例作为研究对象,随机分成实验组和参照组,各41例。实验组患者使用鼻内窥镜下双极电凝止血,参照组患者使用传统填塞止血方法。观察并对比实验组和参照组的止血效率、治疗后的不良反应以及治疗时间。结果出院后对所有患者进行三个月以上的随访,实验组初期止血率是92%,对照组是56%;实验组远期跟踪后总止血率是96%

  8. Congenital nasal lipoma

    International Nuclear Information System (INIS)

    The authors describe a rare case of congenital lipoma of a nose and nasopharynx in a 7 months old girl. The tumor, about 7 x 2 cm was situated in the right nasal cavity and the nasopharynx. The tumor caused complete obstruction of the right side of the nose. After CT diagnosis the tumor was excised from intranasal approach. Histological examination disclosed lipoma. The duration of follow up was 10 months without any sight of recurrence. (author)

  9. A comparison of oral and intravenous pimonidazole in canine tumors using intravenous CCI-103F as a control hypoxia marker

    International Nuclear Information System (INIS)

    Purpose: Pimonidazole HCl is widely used in immunohistochemical analyses of hypoxia in normal and malignant tissues. The present study investigates oral administration as a means of minimizing invasiveness. Methods and Materials: Twelve dogs with confirmed malignancy received 0.5 g/m2 of pimonidazole HCl: 6 by mouth and 6 by i.v. infusion. All dogs received i.v. CCI-103F as a control. Plasma levels of pimonidazole, pimonidazole N-oxide, and CCI-103F were measured. Tumor biopsies were formalin fixed, paraffin embedded, sectioned, immunostained, and analyzed for pimonidazole and CCI-103F binding. pH dependence for pimonidazole and CCI-103F binding was studied in vitro. Results: Pimonidazole and CCI-103F binding in carcinomas and sarcomas was strongly correlated for both oral and i.v. pimonidazole HCl (r 2 = 0.97). On average, the extent of pimonidazole binding exceeded that for CCI-103F by a factor of approximately 1.2, with the factor ranging from 1.0 to 1.65. Binding of both markers was pH dependent, but pimonidazole binding was greater at all values of pH. Conclusions: Oral pimonidazole HCl is effective as a hypoxia marker in spontaneously arising canine tumors. Selective cellular uptake and concomitant higher levels of binding in regions of hypoxia at the high end of pH gradients might account for the greater extent of pimonidazole binding

  10. Novel frameshift mutation in the p16/INK4A tumor suppressor gene in canine breast cancer alters expression from the p16/INK4A/p14ARF locus.

    Science.gov (United States)

    Lutful Kabir, Farruk M; Agarwal, Payal; Deinnocentes, Patricia; Zaman, Jishan; Bird, Allison Church; Bird, R Curtis

    2013-01-01

    The INK4 family of cyclin-dependent kinase inhibitors (CKI) encode important cell cycle regulators that tightly control cell cycle during G1 to S phase. These related genes are considered tumor suppressors as loss of function contributes to the malignant phenotype. Expression of CKIs p16, p14ARF, or p15 were defective in six different canine mammary tumor (CMT) cell lines compared to normal thoracic canine fibroblasts. This suggests CKI defects are frequently responsible for neoplastic transformation in canine mammary carcinomas. p16 and p14ARF are two alternatively spliced products derived from the canine p16/INK4A/p14ARF gene locus. Despite omissions in the published p16 transcript and canine genome and the presence of GC-rich repeats, we determined the complete coding sequence of canine p16 revealing a deletion and frameshift mutation in p16 exon 1α in CMT28 cells. In addition, we determined canine p14ARF mRNA and protein sequences. Mapping of these mutations uncovered important aspects of p16 and p14ARF expression and defects in CMT28 cells shifting the p16 reading frame into p14ARF making a fusion protein that was predicted to be truncated, unstable and devoid of structural and functional integrity. This data describes an important neoplastic mechanism in the p16/INK4A/p14ARF locus in a spontaneous canine model of breast cancer.

  11. Oxymetazoline Nasal Spray

    Science.gov (United States)

    Afrin® Nasal Spray ... Anefrin® Nasal Spray ... Dristan® Nasal Spray ... Mucinex® Nasal Spray ... Nostrilla® Nasal Spray ... Vicks Sinex® Nasal Spray ... Zicam® Nasal Spray ... Oxymetazoline nasal spray is used to relieve nasal discomfort caused by colds, allergies, and hay fever. It is also used to ...

  12. Spontaneous canine transmissible venereal tumor: cell morphology and influence on P-glycoprotein expression

    OpenAIRE

    GASPAR, Luis Fernando Jantzen; FERREIRA, Isabelle; COLODEL, Marcia MOLETA

    2010-01-01

    The present study aimed to determine P-glycoprotein expression according to TVT cell morphology in 42 dogs with confirmed TVT, classified into lymphocytoid, plasmocytoid, and mixed. The chemotherapy efficiency was investigated along with its relation to P-glycoprotein expression in tumoral cells, evaluated by immunocytochemistry, considering positive tumors more than 10% stained. Among the samples collected, 50.00% possessed plasmocytoid morphology, 18.63% lymphocytoid, and 31.37% mixed. The ...

  13. Cytological diagnosis of a metastatic canine mammary tumor in pleural effusion

    OpenAIRE

    Cassali G.D.; Gärtner F.; Vieira da Silva M.J.; Schmitt F.C.

    1999-01-01

    Descrevem-se os achados citomorfológicos de um tumor maligno de mama em uma cadela Poodle de sete anos de idade, o qual foi observado inicialmente pelo exame citológico do derrame pleural. Comparam-se os aspectos citológicos do derrame pleural e punção aspirativa com agulha fina do tumor com aqueles descritos para o câncer de mama na espécie humana.

  14. Tumor induction following intraoperative radiotherapy: Late results of the National Cancer Institute canine trials

    Energy Technology Data Exchange (ETDEWEB)

    Barnes, M.; Duray, P.; DeLuca, A.; Anderson, W.; Sindelar, W.; Kinsella, T. (Fox Chase Cancer Center, Philadelphia, PA (USA))

    1990-09-01

    Intraoperative radiotherapy has been employed in human cancer research for over a decade. Since 1979, trials to assess the acute and late toxicity of IORT have been carried out at the National Cancer Institute in an adult dog model in an attempt to establish dose tolerance guidelines for a variety of organs. Of the 170 animals entered on 12 studies with a minimum follow-up of 2 years, 148 dogs received IORT; 22 control animals received only surgery. Animals were sacrificed at designated intervals following IORT, usually at 1, 6, 12, 24, and 60 month intervals. 102 of 148 irradiated dogs were sacrificed less than 24 months; 46 dogs were followed greater than or equal to 24 months after IORT. To date, 34 of the 46 animals have been sacrificed; the 12 remaining animals are to be followed to 5 years. These 12 animals have minimum follow-up of 30 months. In the irradiated group followed for greater than or equal to 24 months, 10 tumors have arisen in 9 animals. One animal developed an incidental spontaneous breast carcinoma outside the IORT port, discovered only at scheduled post-mortem exam. The remaining nine tumors arose within IORT ports. Two tumors were benign neural tumors--a neuroma and a neurofibroma. One animal had a collision tumor comprised of grade I chondrosarcoma adjacent to grade III osteosarcoma arising in lumbar vertebrae. Two other grade III osteosarcomas, one grade III fibrosarcoma, and one grade III malignant fibrous histiocytoma arose in retroperitoneal/paravertebral sites. An embryonal rhabdomyosarcoma (sarcoma botryoides) arose within the irradiated urinary bladder of one animal. No sham irradiated controls nor IORT animals sacrificed less than 24 months have developed any spontaneous or radiation-induced tumors. The time range of diagnoses of tumors was 24-58 months. The IORT dose range associated with tumor development was 20-35 Gy.

  15. The maspin expression in canine mammary tumors: an immunohistochemical and molecular study A expressão do maspin nos tumores mamários caninos: um estudo imuno-histoquímico e molecular

    Directory of Open Access Journals (Sweden)

    Debora A.P.C. Zuccari

    2009-02-01

    Full Text Available The serpin maspin, a tumor suppressor in breast cancer was described as an inhibitor of cell migration and inducer of cell adhesion between the basement membrane and extracellular matrix resulting in inhibition of tumor metastasis. In contrast, overexpression of maspin is correlated with poor prognosis in other types of cancer. Little is known about expression, regulation and function of maspin in canine mammary tumors. It was demonstrated in this study, a loss of maspin expression in malignant canine mammary cells compared with a pool of normal canine mammary tissue, analyzed by quantitative real-time PCR; weak maspin expression in malignant canine mammary tumors were observed by immunohistochemistry. It was also demonstrated that a correlation with nuclear maspin expression and a good prognosis. It is suggested that maspin could be used as a prognostic marker in canine mammary neoplasia.O serpin maspin, um supressor tumoral no câncer de mama foi descrito como inibidor de migração celular e indutor de adesão celular entre a membrana basal e a matriz extracelular resultando na inibição da metástase tumoral. Por outro lado, a alta expressão do maspin está relacionada com um mau prognóstico em outros tipos de câncer. Pouco se sabe sobre a expressão, regulação e função do maspin nos tumores mamários caninos. Neste estudo, foi demonstrada uma perda da expressão de maspin nas células mamárias malignas de cães quando comparadas com um pool de tecido mamário normal de cães, analisado por PCR quantitativa em tempo real. Houve uma expressão fraca maspin em preparações de tumores mamários malignos observadas por imuno-histoquímica. Também foi verificado que a expressão nuclear do maspin em tumores mamários caninos está relacionada a um bom prognóstico. Assim, o maspin pode ser utilizado como um marcador prognóstico nas neoplasias mamárias em cães.

  16. Alternativas Terapéuticas en las neoplasias vesicales caninas Therapeutic options in canine bladder tumors

    OpenAIRE

    R.L. Rovere; A. ALCOBA

    2002-01-01

    Las neoplasias vesicales en caninos representan menos del 1% de los tumores presentes en esta especie. El tratamiento quirúrgico se indica en tumores benignos y como complemento de la quimioterapia y radioterapia. Para la quimioterapia se emplean más frecuentemente la doxorrubicina, el 5-fluorouracilo, la ciclofosfamida, la vincristina y cisplatino. La asociación de la doxorrubicina-ciclofosfamida por vía sistémica en asociación con el cisplatino intravesical, sería un tratamiento recomendabl...

  17. Proposal of a 2-tier histologic grading system for canine cutaneous mast cell tumors to more accurately predict biological behavior.

    Science.gov (United States)

    Kiupel, M; Webster, J D; Bailey, K L; Best, S; DeLay, J; Detrisac, C J; Fitzgerald, S D; Gamble, D; Ginn, P E; Goldschmidt, M H; Hendrick, M J; Howerth, E W; Janovitz, E B; Langohr, I; Lenz, S D; Lipscomb, T P; Miller, M A; Misdorp, W; Moroff, S; Mullaney, T P; Neyens, I; O'Toole, D; Ramos-Vara, J; Scase, T J; Schulman, F Y; Sledge, D; Smedley, R C; Smith, K; W Snyder, P; Southorn, E; Stedman, N L; Steficek, B A; Stromberg, P C; Valli, V E; Weisbrode, S E; Yager, J; Heller, J; Miller, R

    2011-01-01

    Currently, prognostic and therapeutic determinations for canine cutaneous mast cell tumors (MCTs) are primarily based on histologic grade. However, the use of different grading systems by veterinary pathologists and institutional modifications make the prognostic value of histologic grading highly questionable. To evaluate the consistency of microscopic grading among veterinary pathologists and the prognostic significance of the Patnaik grading system, 95 cutaneous MCTs from 95 dogs were graded in a blinded study by 28 veterinary pathologists from 16 institutions. Concordance among veterinary pathologists was 75% for the diagnosis of grade 3 MCTs and less than 64% for the diagnosis of grade 1 and 2 MCTs. To improve concordance among pathologists and to provide better prognostic significance, a 2-tier histologic grading system was devised. The diagnosis of high-grade MCTs is based on the presence of any one of the following criteria: at least 7 mitotic figures in 10 high-power fields (hpf); at least 3 multinucleated (3 or more nuclei) cells in 10 hpf; at least 3 bizarre nuclei in 10 hpf; karyomegaly (ie, nuclear diameters of at least 10% of neoplastic cells vary by at least two-fold). Fields with the highest mitotic activity or with the highest degree of anisokaryosis were selected to assess the different parameters. According to the novel grading system, high-grade MCTs were significantly associated with shorter time to metastasis or new tumor development, and with shorter survival time. The median survival time was less than 4 months for high-grade MCTs but more than 2 years for low-grade MCTs.

  18. Nasal septum extramedullary plasmacytoma

    Directory of Open Access Journals (Sweden)

    Belić Branislav

    2013-01-01

    Full Text Available Introduction. Plasmacytomas are malignant tumors characterized by abnormal monoclonal proliferation of plasma cells. They originate in either bone - solitary osseous plasmacytoma, or in soft tissue - extramedullary plasmacytoma (EMP. EMP represents less than 1% of all head and neck malignancies. Case report. We presented a case of EMP of the nasal septum in a 44-year-old male who had progressive difficulty in breathing through the nose and frequent heavy epistaxis on the right side. Nasal endoscopy showed dark red, soft, polypoid tumor in the last third of the right nasal cavity arising from the nasal septum. The biopsy showed that it was plasmacytoma. Bence Jones protein in the urine, serum electrophoresis, bone marrow biopsy, skeletal survey and other screening tests failed to detect multiple myeloma. This confirmed the diagnosis of EMP. The mass was completely removed via an endoscopic approach, and then, 4 week later, radiotherapy was conducted with a radiation dose of 50 Gray. No recurrence was noted in a 3-year follow- up period. Conclusion. EMP of the nasal cavity, being rare and having long natural history, represents a diagnostic and therapeutic challenge for any ear, nose and throat surgeon. Depending on the resectability of the lesion, a combined therapy is the accepted treatment.

  19. Altered microRNA Expression Profiles and Regulation of INK4A/CDKN2A Tumor Suppressor Genes in Canine Breast Cancer Models.

    Science.gov (United States)

    Lutful Kabir, Farruk Mohammad; DeInnocentes, Patricia; Bird, Richard Curtis

    2015-12-01

    microRNA (miRNA) expression profiling of cancer versus normal cells may reveal the characteristic regulatory features that can be correlated to altered gene expression in both human and animal models of cancers. In this study, the comprehensive expression profiles of the 277 highly characterized miRNAs from the canine genome were evaluated in spontaneous canine mammary tumor (CMT) models harboring defects in a group of cell cycle regulatory and potent tumor suppressor genes of INK4/CDKN2 family including p16/INK4A, p14ARF, and p15/INK4B. A large number of differentially expressed miRNAs were identified in three CMT cell lines to potentially target oncogenes, tumor suppressor genes and cancer biomarkers. A group of the altered miRNAs were identified by miRNA target prediction tools for regulation of the INK4/CDKN2 family tumor suppressor genes. miRNA-141 was experimentally validated for INK4A 3'-UTR target binding in the CMT cell lines providing an essential mechanism for the post-transcriptional regulation of the INK4A tumor suppressor gene in CMT models. A well-recognized group of miRNAs including miR-21, miR-155, miR-9, miR-34a, miR-143/145, and miR-31 were found to be altered in both CMTs and human breast cancer. These altered miRNAs might serve as potential targets for advancing the development of future therapeutic reagents. These findings further strengthen the validity and use of canine breast cancers as appropriate models for the study of human breast cancers. PMID:26095675

  20. Canine mammary tumors: a review and consensus of standard guidelines on epithelial and myoepithelial phenotype markers, HER2, and hormone receptor assessment using immunohistochemistry.

    Science.gov (United States)

    Peña, L; Gama, A; Goldschmidt, M H; Abadie, J; Benazzi, C; Castagnaro, M; Díez, L; Gärtner, F; Hellmén, E; Kiupel, M; Millán, Y; Miller, M A; Nguyen, F; Poli, A; Sarli, G; Zappulli, V; de las Mulas, J Martín

    2014-01-01

    Although there have been several studies on the use of immunohistochemical biomarkers of canine mammary tumors (CMTs), the results are difficult to compare. This article provides guidelines on the most useful immunohistochemical markers to standardize their use and understand how outcomes are measured, thus ensuring reproducibility of results. We have reviewed the biomarkers of canine mammary epithelial and myoepithelial cells and identified those biomarkers that are most useful and those biomarkers for invasion and lymph node micrometastatic disease. A 10% threshold for positive reaction for most of these markers is recommended. Guidelines on immunolabeling for HER2, estrogen receptors (ERs), and progesterone receptors (PRs) are provided along with the specific recommendations for interpretation of the results for each of these biomarkers in CMTs. Only 3+ HER2-positive tumors should be considered positive, as found in human breast cancer. The lack of any known response to adjuvant endocrine therapy of ER- and PR-positive CMTs prevents the use of the biological positive/negative threshold used in human breast cancer. Immunohistochemistry results of ER and PR in CMTs should be reported as the sum of the percentage of positive cells and the intensity of immunolabeling (Allred score). Incorporation of these recommendations in future studies, either prospective or retrospective, will provide a mechanism for the direct comparison of studies and will help to determine whether these biomarkers have prognostic significance. Finally, these biomarkers may ascertain the most appropriate treatment(s) for canine malignant mammary neoplasms. PMID:24227007

  1. Quantification of morphology of canine circumanal gland tumors: a fractal based study.

    Science.gov (United States)

    Šoštarić-Zuckermann, I C; Severin, K; Huzak, M; Hohšteter, M; Gudan Kurilj, A; Artuković, B; Džaja, A; Grabarević, Ž

    2016-01-01

    Circumanal gland tumors are very common neoplasms of dogs. Their classification relies on microscopic examination and is further supported by a few immunohistochemical markers that help indicate their prognosis. However, new additional tests would be highly useful. The purpose of this study was to develop such a test using fractal analysis which is increasingly being applied in science, especially in the field of biomedicine. A total of 53 circumanal gland tumors were chosen from our department archives. After a precise histological classification according to the World Health Organization classification, the number of de novo classified samples was as follows: 15 adenomas, 11 epitheliomas, 21 well differentiated carcinomas, 6 poorly differentiated carcinomas. Ten samples of normal circumanal gland were also included as control. All samples were immunohistochemicaly stained with vimentin. All immunohistochemical reactions were photographed at two different magnifications -100X and 400X and converted to 1 bit in black and white (bitmap) images thus enhancing the positive vimentin reactions. These images were used for the assessment of fractal dimension applying the box counting method and computer software Fractalyse. To determine the significance of results, conventional statistics were performed using Statistica software. The overall vimentin stain score was significantly higher in epitheliomas and carcinomas than in normal circumanal glands (CG) or adenomas. Mean values of fractal dimension estimated at magnification 100X and 400X were as follows: normal CG 1.318 and 1.372, CG adenomas 1.384 and 1.408, CG epitheliomas 1.547 and 1.597, CG well differentiated carcinomas 1.569 and 1.607, CG poorly differentiated carcinomas 1.679 and 1.723. Significant differences (at level of 5%) of these values were observed between individual groups of CG adenomas or normal CG, and epitheliomas or carcinomas. The above results indicate vimentin immunohistochemistry staining and

  2. Evaluation of tumor motion effect in canine model for diagnostic and radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Woo, Sangkeun; Nam, Taewon; Kim, Kyeongmin [Molecular Imaging Research Center, Seoul (Korea, Republic of); Park, Seungwoo; Han, Suchul; Ji, Younghoon [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of); Park, Nohwon; Eom, Kidong [Konkuk Univ., Seoul (Korea, Republic of)

    2013-05-15

    The internal organs move up to 35mm maximum and it provides information and uncertainty that has been distorted in the diagnosis and treatment. Previous most studies for the effect of respiration have been performed with external monitoring systems but it cannot represent internal organ motion such as liver, pancreas, and lung. Positron emission tomography (PET) is more influenced by motion than computed tomography (CT) and magnetic resonance imaging (MRI) since measurement time for image acquisition is longer than CT and MRI. Thus, count of tumor is to be underestimated and region of tumor is to be overestimated. The first aim of this study was developing the artificial pulmonary nodule which can be performed non-invasive transplant into thorax of dogs and second is to assess the effect of respiratory motion on PET image with evaluating the applicability of the artificial model using dogs for diagnosis and treatment. The developed artificial pulmonary nodule showed reproducibility and motion effect as respiratory cycle and it was verified in PET images. Radiation dose estimated was not changed and was reduced slightly of 10 rpm and 15 rpm, respectively, in both of glass dosimeter and ion chamber. The developed artificial pulmonary nodule will be useful tool for evaluating respiratory motion and better research performance for diagnosis and treatment will be expected with performing simulated experiment using the nodule conducted in this study.

  3. Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior

    Directory of Open Access Journals (Sweden)

    Abadie Jerome

    2011-05-01

    Full Text Available Abstract Background Histiocytic malignancies in both humans and dogs are rare and poorly understood. While canine histiocytic sarcoma (HS is uncommon in the general domestic dog population, there is a strikingly high incidence in a subset of breeds, suggesting heritable predisposition. Molecular cytogenetic profiling of canine HS in these breeds would serve to reveal recurrent DNA copy number aberrations (CNAs that are breed and/or tumor associated, as well as defining those shared with human HS. This process would identify evolutionarily conserved cytogenetic changes to highlight regions of particular importance to HS biology. Methods Using genome wide array comparative genomic hybridization we assessed CNAs in 104 spontaneously occurring HS from two breeds of dog exhibiting a particularly elevated incidence of this tumor, the Bernese Mountain Dog and Flat-Coated Retriever. Recurrent CNAs were evaluated further by multicolor fluorescence in situ hybridization and loss of heterozygosity analyses. Statistical analyses were performed to identify CNAs associated with tumor location and breed. Results Almost all recurrent CNAs identified in this study were shared between the two breeds, suggesting that they are associated more with the cancer phenotype than with breed. A subset of recurrent genomic imbalances suggested involvement of known cancer associated genes in HS pathogenesis, including deletions of the tumor suppressor genes CDKN2A/B, RB1 and PTEN. A small number of aberrations were unique to each breed, implying that they may contribute to the major differences in tumor location evident in these two breeds. The most highly recurrent canine CNAs revealed in this study are evolutionarily conserved with those reported in human histiocytic proliferations, suggesting that human and dog HS share a conserved pathogenesis. Conclusions The breed associated clinical features and DNA copy number aberrations exhibited by canine HS offer a valuable model

  4. Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior

    International Nuclear Information System (INIS)

    Histiocytic malignancies in both humans and dogs are rare and poorly understood. While canine histiocytic sarcoma (HS) is uncommon in the general domestic dog population, there is a strikingly high incidence in a subset of breeds, suggesting heritable predisposition. Molecular cytogenetic profiling of canine HS in these breeds would serve to reveal recurrent DNA copy number aberrations (CNAs) that are breed and/or tumor associated, as well as defining those shared with human HS. This process would identify evolutionarily conserved cytogenetic changes to highlight regions of particular importance to HS biology. Using genome wide array comparative genomic hybridization we assessed CNAs in 104 spontaneously occurring HS from two breeds of dog exhibiting a particularly elevated incidence of this tumor, the Bernese Mountain Dog and Flat-Coated Retriever. Recurrent CNAs were evaluated further by multicolor fluorescence in situ hybridization and loss of heterozygosity analyses. Statistical analyses were performed to identify CNAs associated with tumor location and breed. Almost all recurrent CNAs identified in this study were shared between the two breeds, suggesting that they are associated more with the cancer phenotype than with breed. A subset of recurrent genomic imbalances suggested involvement of known cancer associated genes in HS pathogenesis, including deletions of the tumor suppressor genes CDKN2A/B, RB1 and PTEN. A small number of aberrations were unique to each breed, implying that they may contribute to the major differences in tumor location evident in these two breeds. The most highly recurrent canine CNAs revealed in this study are evolutionarily conserved with those reported in human histiocytic proliferations, suggesting that human and dog HS share a conserved pathogenesis. The breed associated clinical features and DNA copy number aberrations exhibited by canine HS offer a valuable model for the human counterpart, providing additional evidence towards

  5. Evaluation of tumor markers carcinoembryonic antigen, cytokeratin 19 fragment and cancer-associated antigen 72-4 in neoplastic and non-neoplastic canine effusions differentiation

    Directory of Open Access Journals (Sweden)

    L.V. Teixeira

    2014-10-01

    Full Text Available The concentration of tumor markers in body fluids can be used for diagnosis and prognosis of patients. This study aimed to investigate the performance of tumor markers cytokeratin 19 fragment (CYFRA 21-1, cancer-associated antigen 72-4 (CA 72-4 and carcinoembryonic antigen (CEA in the neoplastic and non-neoplastic canine effusions. In thirty-two neoplastic (n=16 and non-neoplastic (n=16 samples of canine thoracic or abdominal effusions, tumor markers were measured. Significant statistical difference was found only for the CYFRA 21-1 marker. The levels were significantly higher for the neoplastic group. The lack of significance between groups for markers CA 72-4 and CEA can be explained by the presence of other diseases in the non-neoplastic group, causing elevated levels of these markers. This study concludes that CYFRA 21-1 performed well, showing good sensitivity, specificity and accuracy in the diagnosis of neoplastic effusions in dogs. However, further investigations are necessary in patients with malignancy as those with benign effusions.

  6. Canine Distemper

    Science.gov (United States)

    Although this brochure provides basic information about canine distemper, your veterinarian is always your best source of ... Consult your veterinarian for more information about canine distemper and its prevention. And Now A Note On ...

  7. A Comparison of Fresh Frozen vs. Formalin-Fixed, Paraffin-Embedded Specimens of Canine Mammary Tumors via Branched-DNA Assay

    Directory of Open Access Journals (Sweden)

    Florenza Lüder Ripoli

    2016-05-01

    Full Text Available Mammary neoplasms are the tumors most affecting female dogs and women. Formalin-fixed, paraffin-embedded (FFPE tissues are an invaluable source of archived biological material. Fresh frozen (FF tissue is considered ideal for gene expression analysis. However, strategies based on FFPE material offer several advantages. Branched-DNA assays permit a reliable and fast workflow when analyzing gene expression. The aim of this study was to assess the comparability of the branched-DNA assay when analyzing certain gene expression patterns between FF and FFPE samples in canine mammary tumors. RNA was isolated from 109 FFPE samples and from 93 FF samples of different canine mammary tissues. Sixteen (16 target genes (Tp53; Myc; HMGA1; Pik3ca; Mcl1; MAPK3; FOXO3; PTEN; GATA4; PFDN5; HMGB1; MAPK1; BRCA2; BRCA1; HMGA2; and Her2 were analyzed via branched-DNA assay (b-DNA. ACTB, GAPDH, and HPRT1 were used as data normalizers. Overall, the relative gene expression of the two different origins of samples showed an agreement of 63%. Still, care should be taken, as FFPE specimens showed lower expression of the analyzed targets when compared to FF samples. The fact that the gene expression in FFPE proved to be lower than in FF specimens is likely to have been caused by the effect of storage time. ACTB had the best performance as a data normalizer.

  8. A Comparison of Fresh Frozen vs. Formalin-Fixed, Paraffin-Embedded Specimens of Canine Mammary Tumors via Branched-DNA Assay.

    Science.gov (United States)

    Lüder Ripoli, Florenza; Mohr, Annika; Conradine Hammer, Susanne; Willenbrock, Saskia; Hewicker-Trautwein, Marion; Hennecke, Silvia; Murua Escobar, Hugo; Nolte, Ingo

    2016-01-01

    Mammary neoplasms are the tumors most affecting female dogs and women. Formalin-fixed, paraffin-embedded (FFPE) tissues are an invaluable source of archived biological material. Fresh frozen (FF) tissue is considered ideal for gene expression analysis. However, strategies based on FFPE material offer several advantages. Branched-DNA assays permit a reliable and fast workflow when analyzing gene expression. The aim of this study was to assess the comparability of the branched-DNA assay when analyzing certain gene expression patterns between FF and FFPE samples in canine mammary tumors. RNA was isolated from 109 FFPE samples and from 93 FF samples of different canine mammary tissues. Sixteen (16) target genes (Tp53; Myc; HMGA1; Pik3ca; Mcl1; MAPK3; FOXO3; PTEN; GATA4; PFDN5; HMGB1; MAPK1; BRCA2; BRCA1; HMGA2; and Her2) were analyzed via branched-DNA assay (b-DNA). ACTB, GAPDH, and HPRT1 were used as data normalizers. Overall, the relative gene expression of the two different origins of samples showed an agreement of 63%. Still, care should be taken, as FFPE specimens showed lower expression of the analyzed targets when compared to FF samples. The fact that the gene expression in FFPE proved to be lower than in FF specimens is likely to have been caused by the effect of storage time. ACTB had the best performance as a data normalizer. PMID:27187374

  9. Dose escalation to high-risk sub-volumes based on non-invasive imaging of hypoxia and glycolytic activity in canine solid tumors: a feasibility study

    International Nuclear Information System (INIS)

    Glycolytic activity and hypoxia are associated with poor prognosis and radiation resistance. Including both the tumor uptake of 2-deoxy-2-[18 F]-fluorodeoxyglucose (FDG) and the proposed hypoxia tracer copper(II)diacetyl-bis(N4)-methylsemithio-carbazone (Cu-ATSM) in targeted therapy planning may therefore lead to improved tumor control. In this study we analyzed the overlap between sub-volumes of FDG and hypoxia assessed by the uptake of 64Cu-ATSM in canine solid tumors, and evaluated the possibilities for dose redistribution within the gross tumor volume (GTV). Positron emission tomography/computed tomography (PET/CT) scans of five spontaneous canine solid tumors were included. FDG-PET/CT was obtained at day 1, 64Cu-ATSM at day 2 and 3 (3 and 24 h pi.). GTV was delineated and CT images were co-registered. Sub-volumes for 3 h and 24 h 64Cu-ATSM (Cu3 and Cu24) were defined by a threshold based method. FDG sub-volumes were delineated at 40% (FDG40) and 50% (FDG50) of SUVmax. The size of sub-volumes, intersection and biological target volume (BTV) were measured in a treatment planning software. By varying the average dose prescription to the tumor from 66 to 85 Gy, the possible dose boost (DB) was calculated for the three scenarios that the optimal target for the boost was one, the union or the intersection of the FDG and 64Cu-ATSM sub-volumes. The potential boost volumes represented a fairly large fraction of the total GTV: Cu3 49.8% (26.8-72.5%), Cu24 28.1% (2.4-54.3%), FDG40 45.2% (10.1-75.2%), and FDG50 32.5% (2.6-68.1%). A BTV including the union (∪) of Cu3 and FDG would involve boosting to a larger fraction of the GTV, in the case of Cu3∪FDG40 63.5% (51.8-83.8) and Cu3∪FDG50 48.1% (43.7-80.8). The union allowed only a very limited DB whereas the intersection allowed a substantial dose escalation. FDG and 64Cu-ATSM sub-volumes were only partly overlapping, suggesting that the tracers offer complementing information on tumor physiology. Targeting the

  10. HER-2 and EGFR mRNA Expression and Its Relationship with Versican in Malignant Matrix-Producing Tumors of the Canine Mammary Gland.

    Science.gov (United States)

    Damasceno, Karine Araújo; Ferreira, Enio; Estrela-Lima, Alessandra; Gamba, Conrado de Oliveira; Miranda, Fernanda Freitas; Alves, Mariana Rezende; Rocha, Rafael Malagoli; de Barros, André Luís Branco; Cassali, Geovanni Dantas

    2016-01-01

    Versican expression promotes tumor growth by destabilizing focal cell contacts, thus impeding cell adhesion and facilitating cell migration. It not only presents or recruits molecules to the cell surface, but also modulates gene expression levels and coordinates complex signal pathways. Previously, we suggested that the interaction between versican and human epidermal growth factor receptors may be directly associated with tumor aggressiveness. Thus, the expression of EGFR and HER-2 in these neoplasms may contribute to a better understanding of the progression mechanisms in malignant mammary tumors. The purpose of this study was to correlate the gene and protein expressions of EGFR and HER2 by RNA In Situ Hybridization (ISH) and immunohistochemistry (IHC), respectively, and their relationship with the versican expression in carcinomas in mixed tumors and carcinosarcomas of the canine mammary gland. The results revealed that EGFR mRNA expression showed a significant difference between in situ and invasive carcinomatous areas in low and high versican expression groups. Identical results were observed in HER-2 mRNA expression. In immunohistochemistry analysis, neoplasms with low versican expression showed greater EGFR immunostaining in the in situ areas than in invasive areas, even as the group presenting high versican expression displayed greater EGFR and HER-2 staining in in situ areas. Significant EGFR and HER-2 mRNA and protein expressions in in situ carcinomatous sites relative to invasive areas suggest that these molecules play a role during the early stages of tumor progression. PMID:27490467

  11. (64)Cu-ATSM and (18)FDG PET uptake and (64)Cu-ATSM autoradiography in spontaneous canine tumors

    DEFF Research Database (Denmark)

    Hansen, Anders E; Kristensen, Annemarie T; Jørgensen, Jesper T;

    2012-01-01

    The aim of this study was to compare (64)Cu-diacetyl-bis(N(4)-methylsemicarbazone) ((64)Cu-ATSM) and (18)FDG PET uptake characteristics and (64)Cu-ATSM autoradiography to pimonidazole immunohistochemistry in spontaneous canine sarcomas and carcinomas....

  12. Nasal encephaloceles

    NARCIS (Netherlands)

    Hoving, Eelco W.

    2000-01-01

    Nasal encephaloceles can be divided into frontoethmoidal and basal encephaloceles. Both conditions are very rare, but frontoethmoidal encephaloceles show a relatively high incidence (1:5,000) in Southeast Asia. The pathogenesis of encephaloceles may be explained by a disturbance in separation of sur

  13. Development of an approach for qualitative and quantitative analysis of trace elements present in canine breast tumors by energy dispersive X-ray fluorescence

    Energy Technology Data Exchange (ETDEWEB)

    Cozer, Thamara C.; Conceicao, Andre L.C.; Paschuk, Sergei A.; Rocha, Anna S.S. da; Fagundes, Alana C.F.; Maciel, Karla F.R.; Pimentel, Gustavo R.O.; Badelli, Juliana C., E-mail: thamara.cozer@gmail.com, E-mail: alconceicao@utfpr.edu.br, E-mail: sergei@utfpr.edu.br, E-mail: anna@utfpr.edu.br, E-mail: alanacarolinef@gmail.com, E-mail: karla_rimanski@hotmail.com, E-mail: g_rop@hotmail.com, E-mail: jubadellin@gmail.com [Universidade Tecnologica Federal do Parana (UTFPR), Curitiba, PR (Brazil). Lab. de Espectroscopia de Raio-X

    2015-07-01

    Studies performed with canines indicate that one of the main neoplasia which affect these animals are the breast tumors, representing from 25% to 50% of all kinds of tumors. Moreover, half of them are classified as malignant. In this sense, recent researches on humans have been associated the presence of certain trace elements with the development of breast neoplasia in those individuals. Then, as the breast tissue composition in canines is very similar to the humans, it is expected the same behavior. In this direction, a very effective technique to identify and to determinate trace elements concentration is the EDXRF. However, studies on this area are scarce in the literature. Therefore, in this work it was developed an approach to quantify the main trace elements present into these tumors with high sensitivity. For this purpose, it was determined calibration curves of standards samples diluted in water, with concentrations of Ca, Fe, Cu and Zn, ranging from 400mg/kg to 35mg/kg, from 20mg/kg to 2mg/kg, from 10mg/kg to 1mg/kg and from 100mg/kg to 10mg/kg, respectively. All calibration curves were linearly fitted and on basis in this behavior it was determined the sensitivity of our approach to quantify the concentration of the trace elements mentioned above. In addition, it is important to mention that studies in this area are of great potential, because EDXRF represents a quickly practical and non-destructive alternative to quantify trace elements. (author)

  14. Incidence of mammary tumors in the canine population living in the Veneto region (Northeastern Italy): Risk factors and similarities to human breast cancer.

    Science.gov (United States)

    Vascellari, Marta; Capello, Katia; Carminato, Antonio; Zanardello, Claudia; Baioni, Elisa; Mutinelli, Franco

    2016-04-01

    Although mammary gland tumors (MT) are the most-common type of tumor in intact female dogs, there is little information about their incidence in dog population. Data on MT in female dogs was retrieved from the Animal Tumor registry of dogs and cats of Venice and Vicenza provinces during 2005-2013 and was analyzed to visualize crude incidence rates by breed and across age categories. Overall, 2744 mammary tumors were reported accounting for 54% of all tumors in female dogs. The annual incidence rate (IR) was 250 cases per 100,000 dogs. The most frequent malignant tumors were complex carcinomas, consisting of both epithelial and myoepithelial tissues (IR=71.89), and simple carcinomas (IR=62.59). The MT incidence rate increased through the study period; particularly in the last 4 years, and malignant neoplasms occurred more frequently (70%) than the benign counterparts (30%). Seventy-four percent of tumors were diagnosed in intact females, and the mean age at diagnosis was significantly higher for spayed dogs than for intact ones. MT were less frequent in dogs younger than 6 years and increased up to approximately 60% for ages between 8 and 13 years. The purebred dogs had a higher probability to have a malignant neoplasm than mixed-breed dogs, particularly in dogs younger than 7 years, and the Samoyed, Dobermann, Schnauzer and Yorkshire Terrier breeds were more inclined to develop malignant MT. The incidence of MT in dogs is increasing, and IRs are comparable to that in women. The epidemiological similarities between dogs and women support the validity of canine MT as a model for human breast cancer. PMID:26948297

  15. Dose escalation to high-risk sub-volumes based on non-invasive imaging of hypoxia and glycolytic activity in canine solid tumors

    DEFF Research Database (Denmark)

    Clausen, Malene M.; Hansen, Anders Elias; af Rosenschold, Per Munck;

    2013-01-01

    , the possible dose boost (DB) was calculated for the three scenarios that the optimal target for the boost was one, the union or the intersection of the FDG and 64Cu-ATSM sub-volumes. Results: The potential boost volumes represented a fairly large fraction of the total GTV: Cu3 49.8% (26.8-72.5%), Cu24 28.1% (2...... planning may therefore lead to improved tumor control. In this study we analyzed the overlap between sub-volumes of FDG and hypoxia assessed by the uptake of 64Cu-ATSM in canine solid tumors, and evaluated the possibilities for dose redistribution within the gross tumor volume (GTV). Materials and methods...... defined by a threshold based method. FDG sub-volumes were delineated at 40% (FDG40) and 50% (FDG50) of SUVmax. The size of sub-volumes, intersection and biological target volume (BTV) were measured in a treatment planning software. By varying the average dose prescription to the tumor from 66 to 85 Gy...

  16. Nasal Schwannoma: a case report

    Directory of Open Access Journals (Sweden)

    Siu-Navarro YJ, Pérez-Carbajal AJ

    2013-10-01

    Full Text Available Introduction: Schwannomas are benign tumors that arise from Schwann cells peripheral nerves sheath. About 25-45% occur in the head and neck and only 4% of these tumors involve the sinunasal tract.Objective: To provide, through a clinic case and lecture review, the clinical and radiopatology findings of a bening and unusual tumors, as are the Nasal schwannomas. Case Report: We report a case of a young woman with nasal schwannoma, who complain of left nasal obstruction and rhinorrhea, which after subsequent imaging studies, surgical and pathology analisis, diagnosis was found. Sustained a favorable clinical evolution.Results and Discussion: The clinic and radiologic findings are nonspecific, depend upon the location or size of the tumor and subsequent involvement of surrounding structures, but generally present as a mass with less agressive behavior. The elective treatment is surgery, confirming this disease by microscopic and immunohistochemistry studies.Conclusion: Given these aspects must be considered nasal schwannomas within the differential diagnosis of a tumor with less aggressive behavior, clinical-radiological, because implies good results for the patient and unusual recurrence after surgery.

  17. Nasal Chondromesenchymal Hamartoma in a Child

    International Nuclear Information System (INIS)

    Nasal chondromesenchymal hamartoma (NCMH) is a benign tumor that was described in 1998. The occurrence of this lesion in the nasal cavity of infants and children is especially rare, with only 21 cases reported in the international literature. We report a 12-month-old boy with respiratory distress due to nasal obstruction. Computed tomographic scan and magnetic resonance imaging examination demonstrated a soft-tissue mass obstructing the left nasal cavity. Digital subtraction angiography and preoperative superselective embolization with microparticles were also performed. The tumor was completely resected surgically. Histopathology and immunohistochemical analyses of the tumor disclosed a NCMH. The imaging characteristics of the tumor are described and the radiology literature is reviewed.

  18. Intraosseous hemangioma of the nasal septum: A case report

    Energy Technology Data Exchange (ETDEWEB)

    Park, Min Ho; Kim, Eui Jong; Jang, Ji Hye; Lee, Kyung Mi; Choi, Woo Suk; Kim, Sung Wan; Kim, Yoon Hwa [Kyung Hee University Hospital, Seoul (Korea, Republic of)

    2015-08-15

    Hemangioma can arise in the soft tissues and bone of the nasal cavity. However, to the best of our knowledge, there are no prior case reports presenting intraosseous hemangioma of the nasal septum. Intraosseous hemangioma, in addition to a chondroid tumor, should be included in the differential diagnosis of a calcified mass of the nasal cavity. In the present report, we present a case of an intraosseous cavernous hemangioma in the nasal bony septum of a 53-year-old woman.

  19. Nasal Wash Treatment

    Science.gov (United States)

    ... Disease Medications > Alternative Therapies > Nasal Wash Treatment Nasal Wash Treatment The Centers for Disease Control (CDC) guidelines ... increases airflow Watch How to Perform a Nasal Wash CDC Water Preparation Guidelines Wash your hands. Make ...

  20. Nicotine Nasal Spray

    Science.gov (United States)

    Nicotine nasal spray is used to help people stop smoking. Nicotine nasal spray should be used together with a smoking cessation ... counseling, or specific behavior change techniques. Nicotine nasal spray is in a class of medications called smoking ...

  1. A Comparative Study of Airflow and Odorant Deposition in the Mammalian Nasal Cavity

    Science.gov (United States)

    Richter, Joseph; Rumple, Christopher; Ranslow, Allison; Quigley, Andrew; Pang, Benison; Neuberger, Thomas; Krane, Michael; van Valkenburgh, Blaire; Craven, Brent

    2013-11-01

    The complex structure of the mammalian nasal cavity provides a tortuous airflow path and a large surface area for respiratory air conditioning, filtering of inspired contaminants, and olfaction. Due to the small and contorted structure of the nasal turbinals, nasal anatomy and function remains poorly understood in most mammals. Here, we utilize high-resolution MRI scans to reconstruct anatomically-accurate models of the mammalian nasal cavity. These data are used to compare the form and function of the mammalian nose. High-fidelity computational fluid dynamics (CFD) simulations of nasal airflow and odorant deposition are presented and used to compare olfactory function across species (primate, rodent, canine, feline, ungulate).

  2. Immunophenotype Heterogeneity in Nasal Glomangiopericytoma

    Directory of Open Access Journals (Sweden)

    Adriana Handra-Luca

    2015-01-01

    Full Text Available Nasal glomangiopericytoma is rare. The immunophenotype is heterogeneous, more frequently smooth-muscle-actin and CD34-positive. We report expression patterns for several vascular-related proteins such as CD99, CD146, Bcl2, and WT1 as well as for treatment-related proteins such as mTOR and EGFR in a nasal glomangiopericytoma. The patient (woman, 86 years presented with a left nasal tumefaction. The resected specimen (1.5-cm showed a glomangiopericytoma. Tumor cells expressed smooth-muscle-actin, CD31, CD34, and progesterone receptor. They also expressed the vascular-cell-related proteins Bcl2, CD99, CD146, and WT1, as well as mTOR and EGFR. Nasal glomangiopericytomas show immunohistochemical heterogeneity for vascular-related markers, suggesting a possible extensive pericytic differentiation. The expression of potential targets for drug treatments such as mTOR and EGFR may impact on the clinical follow-up of these tumors occurring at advanced ages, which may require complex surgery.

  3. Vincristine modulates the expression of Ki67 and apoptosis in naturally occurring canine transmissible venereal tumor (TVT).

    Science.gov (United States)

    Özalp, G R; Zik, B; Bastan, A; Peker, S; Özdemir-Salci, E S; Bastan, I; Darbaz, I; Salar, S; Karakas, K

    2012-07-01

    We investigated eight adult dogs that were brought to veterinary clinics with a history of transmissible venereal tumors (TVT). Our goal was to demonstrate the occurrence of apoptosis and the cessation of cell proliferation at every phase of scheduled chemotherapy for naturally occurring TVT. Tissue samples were collected immediately after weekly treatments with vincristine sulfate and processed for histological purposes. Sections 5 μm thick were stained by the TUNEL reaction for apoptosis and immunostained for Ki67 as a proliferation marker. We observed that after vincristine applications, tumor cell proliferation ceased and apoptosis increased. Ki67 HSCORE values were significantly lowered after the first and second treatments with the chemotherapeutic agent compared to controls, whereas TUNEL HSCORE values were significantly higher after two applications of vincristine compared to controls. Our results suggest that scheduled vincristine sulfate applications stabilize the induction of tumor regression by inducing apoptosis and preventing cell proliferation.

  4. TU-C-12A-11: Comparisons Between Cu-ATSM PET and DCE-CT Kinetic Parameters in Canine Sinonasal Tumors

    Energy Technology Data Exchange (ETDEWEB)

    La Fontaine, M; Bradshaw, T [University of Wisconsin, Madison, Wisconsin (United States); Kubicek, L [University of Florida, Gainesville, Florida (United States); Forrest, L [University of Wisconsin-Madison, Madison, Wisconsin (United States); Jeraj, R [University of Wisconsin, Madison, WI (United States)

    2014-06-15

    Purpose: Regions of poor perfusion within tumors may be associated with higher hypoxic levels. This study aimed to test this hypothesis by comparing measurements of hypoxia from Cu-ATSM PET to vasculature kinetic parameters from DCE-CT kinetic analysis. Methods: Ten canine patients with sinonasal tumors received one Cu-ATSM PET/CT scan and three DCE-CT scans prior to treatment. Cu-ATSM PET/CT and DCE-CT scans were registered and resampled to matching voxel dimensions. Kinetic analysis was performed on DCE-CT scans and for each patient, the resulting kinetic parameter values from the three DCE-CT scans were averaged together. Cu-ATSM SUVs were spatially correlated (r{sub spatial}) on a voxel-to-voxel basis against the following DCE-CT kinetic parameters: transit time (t{sub 1}), blood flow (F), vasculature fraction (v{sub 1}), and permeability (PS). In addition, whole-tumor comparisons were performed by correlating (r{sub ROI}) the mean Cu-ATSM SUV (SUV{sub mean}) with median kinetic parameter values. Results: The spatial correlations (r{sub spatial}) were poor and ranged from -0.04 to 0.21 for all kinetic parameters. These low spatial correlations may be due to high variability in the DCE-CT kinetic parameter voxel values between scans. In our hypothesis, t{sub 1} was expected to have a positive correlation, while F was expected to have a negative correlation to hypoxia. However, in wholetumor analysis the opposite was found for both t{sub 1} (r{sub ROI} = -0.25) and F (r{sub ROI} = 0.56). PS and v{sub 1} may depict angiogenic responses to hypoxia and found positive correlations to Cu-ATSM SUV for PS (r{sub ROI} = 0.41), and v{sub 1} (r{sub ROI} = 0.57). Conclusion: Low spatial correlations were found between Cu-ATSM uptake and DCE-CT vasculature parameters, implying that poor perfusion is not associated with higher hypoxic regions. Across patients, the most hypoxic tumors tended to have higher blood flow values, which is contrary to our initial hypothesis. Funding

  5. Nasal chondromesenchymal hamartoma with no nasal symptoms.

    LENUS (Irish Health Repository)

    Uzomefuna, Vincent

    2012-01-01

    The authors present a case of nasal chondromesenchymal hamartoma (NCMH) in an 8-year-old boy with a 4-month history of frontal headache and no symptoms of nasal obstruction, rhinorrhoea or postnasal drip. An ENT examination as well as ophthalmology assessment presented normal results. CT scan showed a lesion involving the sphenoid and ethmoid sinuses. The patient had an endoscopic resection of the lesion that was confirmed histologically to be a NCMH. Though NCMH is known to present usually in infants with obstructing nasal mass, an unusual presentation of a patient with throbbing headache without any nasal symptoms is reported here.

  6. Eosinophilic Angiocentric Fibrosis of the Nasal Septum

    Directory of Open Access Journals (Sweden)

    Yunchuan Li

    2013-01-01

    Full Text Available Background. Eosinophilic angiocentric fibrosis (EAF is a rare benign condition of unknown aetiology that causes stenosis of the upper respiratory tract. It is most commonly found at the nasal septum and sinus mucosa causing mucosal thickening and nasal obstructive symptoms. The diagnosis is mainly based on characteristic histologic findings. Case Report. A 27-year-old young woman presented with a slow growing mass at her anterior nasal septum for over eight years. She complained of persistent nasal obstruction, epistaxis, sometimes diffused facial pain, and chronic headache. 3 years ago, the tumor was partially resected for ventilation and a nasal septum perforation was left. Imaging findings indicated soft-tissue thickening of the anterior part of septum and adjacent lateral nasal walls. Pathological examination showed numerous inflammatory cells infiltrates containing eosinophils, fibroinflammatory lesion with a whorled appearance fibrosis which typically surrounded vessels. A diagnosis of eosinophilic angiocentric fibrosis was made. All laboratory tests were unremarkable. Skin prick test was positive. The tumor-like lesion was totally resected. Conclusions. EAF is a rare benign and progressive disorder causing destruction. Combined with radiological imaging of EAF historical findings contribute to the diagnosis. It is important to prevent tumor from recurrence by total resection of the lesion.

  7. Adenoma pleomórfico de septo nasal: relato de caso Pleomorphic adenoma of the nasal septum: a case report

    Directory of Open Access Journals (Sweden)

    Mauren P. Rocha

    2004-06-01

    Full Text Available As neoplasias nasais são bastante raras. Os tumores mais observados na cavidade nasal são papilomas epiteliais, angiomas, carcinoma de células transicionais, carcinoma pavimentoso e adenocarcinoma. O adenoma pleomórfico pertence ao grupo de tumores que aparecem com menor freqüência na fossa nasal, e é o tumor benigno glandular mais comum originado na cabeça e pescoço. A apresentação clínica típica dos pacientes com adenoma pleomórfico do septo nasal é de obstrução nasal unilateral, epistaxe e massa indolor na cavidade nasal. Em vista da raridade da apresentação clínica do adenoma pleomórfico nesta localização, os autores descrevem um caso de adenoma pleomórfico nasal em um paciente do sexo masculino, com 69 anos de idade, onde relatam os achados clínicos, critérios diagnósticos, tratamento, prognóstico e revisão da literatura.Nasal tumours are very rare. The neoplasms most frequently seen in the nasal cavity are epithelial papillomas, angiomas, transitional cells carcinoma, pavement carcinoma and adenocarcinoma. The pleomorphic adenoma belongs to the group of tumours less commonly observed in the nasal cavity, and is the most common head and neck benign glandular tumour. The typical clinical presentation of the nasal pleomorphic adenoma is of unilateral nasal obstruction, epistaxis and a painless mass in the nasal cavity. The authors reported an adenoma pleomorphic case that highlights itself by its unusual nasal presentation in the nasal septum of a 45-year-old male patient who was submitted to surgical treatment, and discuss the clinical findings, diagnostic criteria, treatment, prognosis and literature review.

  8. Bacterial Nasal Infections

    Science.gov (United States)

    ... the Nose Sinusitis Bacteria may cause pimples and boils (furuncles) to form just inside the opening of ... weeks. Nasal furuncles More serious infections result in boils (furuncles) in the nasal vestibule. Boils may develop ...

  9. Nasal mucosal biopsy

    Science.gov (United States)

    Biopsy - nasal mucosa; Nose biopsy ... to fast for a few hours before the biopsy. ... Nasal mucosal biopsy is usually done when abnormal tissue is seen during examination of the nose. It may also be done ...

  10. Mometasone Nasal Spray

    Science.gov (United States)

    Mometasone nasal spray is used to prevent and relieve symptoms of sneezing, runny, stuffy, or itchy nose caused by hay fever ... of the lining of the nose). Mometasone nasal spray should not be used to treat symptoms (e. ...

  11. Flunisolide Nasal Spray

    Science.gov (United States)

    Flunisolide nasal spray is used to relieve symptoms of sneezing, runny, stuffy, or itchy nose caused by hay fever or other allergies. Flunisolide nasal spray should not be used to treat symptoms (e. ...

  12. Naloxone Nasal Spray

    Science.gov (United States)

    Naloxone nasal spray is used along with emergency medical treatment to reverse the life-threatening effects of a known or suspected opiate (narcotic) overdose. Naloxone nasal spray is in a class of medications called opiate ...

  13. Urogenital tumors

    Energy Technology Data Exchange (ETDEWEB)

    Weller, R.E.

    1994-03-01

    An overview is provided for veterinary care of urogenital tumors in companion animals, especially the dog. Neoplasms discussed include tumors of the kidney, urinary bladder, prostate, testis, ovary, vagina, vulva and the canine transmissible venereal tumor. Topics addressed include description, diagnosis and treatment.

  14. The use of {sup 99m}Tc-thymine to identify metastatic disease in dogs presenting the cutaneous form of canine transmissible venereal tumor; Uso da {sup 99m}Tc-timina na identificacao de metastases de tumor venereo transmissivel canino com apresentacao cutanea

    Energy Technology Data Exchange (ETDEWEB)

    Castelo-Branco, Paulo S.M. [Universidade Estacio de Sa, Rio de Janeiro, RJ (Brazil)]. E-mail: p.castelobranco@ig.com.br; Castro, Veronica; Sena, Priscila [Sociedade Uniao Internacional Protetora dos Animais (SUIPA), Rio de Janeiro, RJ (Brazil); Souza, Sergio A. Lopes de; Lopes, Flavia P.P. Lobo; Pereira, Joao Batista; Fonseca, Lea M. Barbosa da; Gutfilen, Bianca [Hospital Universitario Clementino Fraga Filho, Rio de Janeiro, RJ (Brazil). Dept. de Radiologia

    2008-08-15

    The venereal canine transmissible tumor (VCTT) is described in literature as a rare metastatic tumor. However accurate methods for verification of this affirmative are not available in the veterinary medicine routine. In this study, we evaluated the dissemination from VCTT with cutaneous presentation using the {sup 99m}Tc-Thymine scintigraphy. The labelled thymine was up taken by the three cases of VCTT. {sup 99m}Tc-Thymine is a promising imaging technique for non-invasive veterinarian evaluation of tumoral dissemination degree decurrent from the VCTT cases. (author)

  15. Apoptosis in the transplanted canine transmissible venereal tumor during growth and regression phases Apoptose no tumor venéreo transmissível canino durante as fases de crescimento e regressão

    Directory of Open Access Journals (Sweden)

    F.G.A. Santos

    2008-06-01

    Full Text Available Twelve male, mongrel, adult dogs were subcutaneously transplanted with cells originated from two canine transmissible venereal tumors (TVT. The aim was to demonstrate and to quantify the occurrence of apoptosis in the TVT regression. After six months of transplantation, a tumor sample was obtained from each dog, being six dogs with TVT in the growing phase and six in the regression phase as verified by daily measurements. Samples were processed for histological and ultrastructural purposes as well as for DNA extraction. Sections of 4µm were stained by HE, Shorr, methyl green pyronine, Van Gieson, TUNEL reaction and immunostained for P53. The Shorr stained sections went through morphometry that demonstrated an increase of the apoptotic cells per field in the regressive tumors. It was also confirmed by transmission electron microscopy, which showed cells with typical morphology of apoptosis and by the TUNEL reaction that detected in situ the 3'OH nick end labeling mainly in the regressive tumors. The regressive TVTs also showed an intensified immunostaining for P53 besides a more intense genomic DNA fragmentation detected by the agarose gel electrophoresis. In conclusion, apoptosis has an important role in the regression of the experimental TVT in a way that is P53-dependent.Doze cães, adultos, machos e sem raça definida foram transplantados subcutaneamente, na região hipogástrica, com células originadas de dois tumores venéreos transmissíveis caninos (TVT. O objetivo do estudo foi demonstrar e quantificar a ocorrência de apoptose na regressão do TVT. Após seis meses, foi obtido um tumor de cada animal, totalizando seis em crescimento e seis em regressão. Fragmentos dos tumores foram processados para avaliação histológica, ultra-estrutural e também para extração de DNA. Cortes de 4µm foram corados em HE, Shorr, verde de metila pironina e Van Gieson e alguns foram submetidos à reação do TUNEL e à imunoistoquímica para P53

  16. Development of an ante-mortem diagnostic test for enzootic nasal tumor virus and detection of neutralizing antibodies in host serum.

    Science.gov (United States)

    Walsh, Scott R; Stinson, Kevin J; Menzies, Paula I; Wootton, Sarah K

    2014-08-01

    Enzootic nasal adenocarcinoma (ENA) is a contagious neoplasm of the nasal mucosa of sheep and goats and is associated with enzootic nasal tumour virus (ENTV). As ENA is a common disease in North America and there are no vaccines against ENTV-1, diagnostic tests that can identify infected animals and assist with eradication and disease surveillance efforts are greatly needed. In this study, we endeavoured to develop a novel, non-invasive diagnostic tool that could be used not only to validate clinical signs of ENA but also to detect ENTV-1 infection prior to the onset of disease signs (i.e. pre-clinical diagnosis). Cytology, serology and reverse transcription (RT)-PCR-based diagnostic methods were investigated. Although the cytology-based assay was able to detect ENTV-1 infection in some animals, it had poor sensitivity and specificity and thus was not developed further as an ante-mortem diagnostic method. Three different assays, including ELISA, Western blotting and virus neutralization, were developed to detect the presence of ENTV-1-specific antibodies in sheep serum. Whilst a surprisingly large number of sheep mounted an antibody-mediated immune response against ENTV-1, and in some cases neutralizing, correlation with disease status was poor. In contrast, RT-PCR on RNA extracted from nasal swabs reliably detected exogenous ENTV-1 sequences, did not amplify endogenous ovine betaretroviral sequences, demonstrated high concordance with immunohistochemical staining for ENTV-1 envelope protein, and had perfect sensitivity and specificity. This report describes a practical and highly specific RT-PCR technique for the detection of clinical and pre-clinical ENA that may prove beneficial in future control or eradication programmes.

  17. Tumorer

    DEFF Research Database (Denmark)

    Prause, J.U.; Heegaard, S.

    2005-01-01

    oftalmologi, øjenlågstumorer, conjunctivale tumorer, malignt melanom, retinoblastom, orbitale tumorer......oftalmologi, øjenlågstumorer, conjunctivale tumorer, malignt melanom, retinoblastom, orbitale tumorer...

  18. Investigation of HER2 expression in canine mammary tumors by antibody-based, transcriptomic and mass spectrometry analysis: is the dog a suitable animal model for human breast cancer?

    Science.gov (United States)

    Burrai, G P; Tanca, A; De Miglio, M R; Abbondio, M; Pisanu, S; Polinas, M; Pirino, S; Mohammed, S I; Uzzau, S; Addis, M F; Antuofermo, E

    2015-11-01

    Canine mammary tumors (CMTs) share many features with human breast cancer (HBC), specifically concerning cancer-related pathways. Although the human epidermal growth factor receptor 2 (HER2) plays a significant role as a therapeutic and prognostic biomarker in HBC, its relevance in the pathogenesis and prognosis of CMT is still controversial. The aim of this study was to investigate HER2 expression in canine mammary hyperplasic and neoplastic tissues as well as to evaluate the specificity of the most commonly used polyclonal anti HER2 antibody by multiple molecular approaches. HER2 protein and RNA expression were determined by immunohistochemistry (IHC) and by quantitative real-time (qRT) PCR. A strong cell membrane associated with non-specific cytoplasmic staining was observed in 22% of carcinomas by IHC. Adenomas and carcinomas exhibited a significantly higher HER2 mRNA expression when compared to normal mammary glands, although no significant difference between benign and malignant tumors was noticed by qRT-PCR. The IHC results suggest a lack of specificity of the FDA-approved antibody in CMT samples as further demonstrated by Western immunoblotting (WB) and reverse phase protein arrays (RPPA). Furthemore, HER2 was not detected by mass spectrometry (MS) in a protein-expressing carcinoma at the IHC investigation. This study highlights that caution needs to be used when trying to translate from human to veterinary medicine information concerning cancer-related biomarkers and pathways. Further investigations are necessary to carefully assess the diagnostic and biological role specifically exerted by HER2 in CMTs and the use of canine mammary tumors as a model of HER2 over-expressing breast cancer. PMID:26088453

  19. Nasal septal teratoma in a child

    Directory of Open Access Journals (Sweden)

    Akinyemi Oluwole A

    2007-05-01

    Full Text Available Abstract Background Teratoma is a rare developmental neoplasm that arises from totipotential tumor stem cells. Head and neck teratomas constitute about 10% of all cases. Only two cases of mature teratoma of the nasal septum have previously been documented in the world literature. Case presentation We present a case of histologically confirmed mature teratoma arising from the nasal septum in an eighteen month old Nigerian female who presented with a history of noisy breathing associated with recurrent rhinorrhea since birth. Physical examination revealed obstruction of the right nasal cavity by a pale fleshy mass. She underwent a total surgical excision and to date, after thirty one months follow-up, she is free from recurrence. Conclusion The prognosis for benign teratoma of the nasal septum is good following total surgical excision.

  20. Protocol for the anatomopathological examination of canine mammary tumors Protocolo para exame anatomopatológico de tumores mamários em cães

    Directory of Open Access Journals (Sweden)

    E. Ferreira

    2003-02-01

    Full Text Available Foi elaborado um protocolo para exame anatomopatológico de tumores de mama em cães, constituído de três partes: requisição, exame clínico e laudo histopatológico. O exame clínico contém dados sobre a descrição macroscópica da lesão. O laudo histopatológico constituiu-se de campos para descrição microscópica pormenorizada das lesões e classificação da principal lesão observada. A elaboração do protocolo tem como objetivo estabelecer critérios para estudos e pesquisas sobre neoplasias mamárias em animais e auxiliar no diagnóstico e prognóstico de lesões mamárias.

  1. CT findings of nasal non-Hodgkin`s lymphomas associated with prognosis

    Energy Technology Data Exchange (ETDEWEB)

    Aoki, Yuki; Matsubayashi, Takashi; Kan, Shinichi; Ikeda, Toshiaki; Nishiguchi, Iku [Kitasato Univ., Sagamihara, Kanagawa (Japan). School of Medicine

    1999-02-01

    X-ray CT images of the head obtained from thirteen patients (9 men and 4 women) among 33 patients (19 men and 14 women) with nasal non-Hodgkin`s lymphoma (NHL) who had been seen at Kitasato University Hospital during the period from April 1975 to March 1995 were retrospectively reviewed to search for useful prognostic image factors for nasal NHL. Extracavitary subcutaneous tumor extension into the nasal wing or cheek, and tumor penetration through the nasal septum revealed on X-ray CT images seemed to be likely indicators of a poor prognosis for patients with nasal NHL. (author)

  2. Spindle cell carcinoma of the nasal cavity

    Directory of Open Access Journals (Sweden)

    Mark D DeLacure

    2013-02-01

    Full Text Available Spindle cell carcinoma (SpCC is a unique variant of squamous cell carcinoma (SCC. SpCC confined to the nasal cavity is extremely rare, with only one case having been previously reported. We present a case report of nasal cavity SpCC and review the literature on this rare entity. A 29-year-old male presented with intermittent epistaxis from the left nasal cavity. On physical examination, the patient had an ulcerated mass in the left nasal vestibule and a biopsy showed a proliferation of spindle and epitheliod cells. The patient underwent wide local excision of the mass via a lateral alotomy approach and reconstruction with a composite conchal bowl skin and cartilage graft. Histologically, the mass had dyplastic squamous epithelium and spindle-shaped cells admixed with epitheliod cells. Immunohistochemistry was only positive for pancytokeratin AE1/AE3 and vimentin. Six months after surgery, the patient continues to have no evidence of disease. On literature review, only one previous case of SpCC confined to the nasal cavity was identified. We present a rare case of nasal cavity SpCC. No definite treatment protocol exists for this unique entity, but we believe that this tumor should primarily be treated with aggressive, wide local excision. Adjuvant radiation and/or chemotherapy have also been used anecdotally.

  3. A Case of Nasal Glial Heterotopia in an Adult

    Directory of Open Access Journals (Sweden)

    Akira Hagiwara

    2014-01-01

    Full Text Available We report a rare case of nasal glial heterotopia in an adult. After the surgery, frontal lobe cerebral hemorrhage developed. A 58-year-old man had unilateral nasal obstruction that progressed for one year. He had been treated for hypertension, chronic heart failure, and cerebral infarction with aspirin and warfarin. A computed tomography scan showed that the tumor occupied the right nasal cavity and the sinuses with small defect in the cribriform plate. The tumor was removed totally with endoscopy. After the operation, the patient developed convulsions and frontal lobe cerebral hemorrhage. The hemorrhage site was located near a defect in the cribriform plate. Nasal glial heterotopia is a rare developmental abnormality, particularly rare in adult. Only few cases were reported. We could not find any report of adult nasal glial heterotopias that developed cerebral hemorrhage as a complication of the surgery.

  4. Degloving médio-facial como via de acesso a tumores nasossinusais Midfacial degloving - acess to nasal cavity and paranasal sinuses lesions

    Directory of Open Access Journals (Sweden)

    Lidiane Maria de Brito Macedo Ferreira

    2006-04-01

    Full Text Available Abordagens cirúrgicas comuns para maxilectomia medial incluem a rinotomia lateral e a via de acesso degloving médio-facial. A rinotomia lateral fornece um excelente campo cirúrgico, mas deixa proeminentes cicatrizes na face. Já o degloving médio-facial tem sido superior à rinotomia lateral, pois não deixa nenhuma cicatriz externa, embora saibamos que este procedimento tem suas limitações¹. Este estudo tem o objetivo de descrever os resultados estéticos e de melhor acesso transoperatório de cirurgias nasossinusais via degloving, com avaliação da morbidade pós-operatória através das seguintes variáveis: hemoglobina pré e pós-operatória, necessidade de transfusão sangüínea, presença de complicações, uso de tampão nasal, uso de antibiótico, fio cirúrgico utilizado, tempo de internamento pós-operatório e presença de recidiva. Foi realizado um estudo retrospectivo a partir de 16 pacientes internados no Hospital Geral de Fortaleza SESA/SUS durante o período de dezembro de 1999 a novembro de 2003. Pelos dados obtidos, conclui-se que a via de acesso degloving é eficaz no tratamento de lesões nasossinusais extensas, com bons resultados estéticos e com reduzida morbidade pós-operatória.Common surgical approaches for medial maxillectomy include lateral rhinotomy and midfacial degloving. Lateral rhinotomy provides excellent surgical exposure but leaves a bulging scar on the face. Despite its own limitations, midfacial degloving has been preferred to lateral rhinotomy because it does not leave any external scar on the face¹. The aim of this study is to evaluate the cosmetic results and surgical exposure access of midfacial degloving. Treatment morbidity was evaluated through: post operative hospital stay length, blood transfusion needs, complications, pre and post operative hemoglobin levels, disease recurrence, nasal packing, type of suture and antibiotics. Retrospective study was carried out with sixteen patients

  5. Calcitonin Salmon Nasal Spray

    Science.gov (United States)

    ... pump is now primed. To use the nasal spray, follow these steps: Keep your head up and place the nozzle in one nostril. Press down on the pump ... reach of children. Store unopened calcitonin salmon nasal spray in the ... the nozzle clean. Opened calcitonin salmon stored at room temperature ...

  6. Olopatadine Nasal Spray

    Science.gov (United States)

    Olopatadine nasal spray is used to relieve sneezing and a stuffy, runny or itchy nose caused by allergic rhinitis (hay fever). ... Olopatadine comes as a liquid to spray in the nose. Olopatadine nasal spray ... twice daily. Follow the directions on your prescription label carefully, ...

  7. Ketorolac Nasal Spray

    Science.gov (United States)

    Ketorolac nasal spray is used for the short-term relief of moderate to moderately severe pain. Ketorolac is in a class ... Nasal ketorolac comes as a liquid to spray in the nose. It is usually used once every 6 to 8 hours as needed to control pain for up to 5 days. ...

  8. Morphological study of maxillary canine region based on CT

    International Nuclear Information System (INIS)

    The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)

  9. Expression of P-glycoprotein, multidrug resistance-associated protein, glutathione-S-transferase pi and p53 in canine transmissible venereal tumor

    Directory of Open Access Journals (Sweden)

    Daniel G. Gerardi

    2014-01-01

    Full Text Available The overexpression of proteins P-glycoprotein (P-gp, multidrug resistance-associated protein (MRP1, mutant p53, and the enzyme glutathione-S-transferase (GSTpi are related to resistance to chemotherapy in neoplasms. This study evaluated the expression of these markers by immunohistochemistry in two groups of canine TVT, without history of prior chemotherapy (TVT1, n=9 and in TVTs presented unsatisfactory clinical response to vincristine sulfate (TVT2, n=5. The percentage of specimens positively stained for P-gp, MRP1, GSTpi and p53 were, respectively 88.8%, 0%, 44.5% and 22.2% in TVT1 and 80%, 0%, 80% and 0% in TVT2. In TVT1, one specimen presented positive expression for three markers and four specimens for two markers. In TVT2, three specimens expressed P-gp and GSTpi. In conclusion, the canine TVTs studied expressed the four markers evaluated, but just P-gp and GSTpi were significantly expressed, mainly at cytoplasm and cytoplasm and nuclei, respectively, either before chemotherapy as after vincristine sulfate exposure. Future studies are needed to demonstrate the function of these two markers in conferring multidrug resistance (MDR or predict the response to chemotherapy in canine TVT.

  10. Budesonide Nasal Spray

    Science.gov (United States)

    ... ingredients in budesonide nasal spray. Check the package label for a list of the ingredients.tell your doctor and pharmacist what prescription and nonprescription medications, vitamins, nutritional supplements, and herbal products you are taking or ...

  11. Fluticasone Nasal Spray

    Science.gov (United States)

    ... ingredients in fluticasone nasal spray. Check the package label for a list of the ingredients.tell your doctor and pharmacist what prescription and nonprescription medications, vitamins, nutritional supplements, and herbal products you are taking, or ...

  12. Zolmitriptan Nasal Spray

    Science.gov (United States)

    ... a copy of the manufacturer's information for the patient.To use the nasal spray, follow these steps: ... used to treat certain types of migraine headaches (hemiplegic or basilar) or other types of headaches (such ...

  13. Fentanyl Nasal Spray

    Science.gov (United States)

    Fentanyl nasal spray is used to treat breakthrough pain (sudden episodes of pain that occur despite round ... effects of the medication) to narcotic pain medications. Fentanyl is in a class of medications called narcotic ( ...

  14. Nasal packing and stenting

    Directory of Open Access Journals (Sweden)

    Weber, Rainer K.

    2009-01-01

    Full Text Available Nasal packs are indispensable in ENT practice. This study reviews current indications, effectiveness and risks of nasal packs and stents. In endoscopic surgery, nasal packs should always have smooth surfaces to minimize mucosal damage, improve wound healing and increase patient comfort. Functional endoscopic endonasal sinus surgery allows the use of modern nasal packs, since pressure is no longer required. So called hemostatic/resorbable materials are a first step in this direction. However, they may lead to adhesions and foreign body reactions in mucosal membranes. Simple occlusion is an effective method for creating a moist milieu for improved wound healing and avoiding dryness. Stenting of the frontal sinus is recommended if surgery fails to produce a wide, physiologically shaped drainage path that is sufficiently covered by intact tissue.

  15. Beclomethasone Nasal Spray

    Science.gov (United States)

    ... symptoms may begin to improve a few days after you first use beclomethasone, but it may take 1 ... your symptoms get worse or do not improve after you use beclomethasone nasal spray for 3 weeks. If ...

  16. FRACTURE NASAL BONES

    OpenAIRE

    Balasubramanian Thaigarajan; Venkatesan Ulaganathan

    2013-01-01

    Nose is the most prominent part of the face, hence it is likely to be the most common structure to be injured in the face. Although fractures involving the nasal bones are very common, it is often ignored by the patient. Patients with fractures of nasal bone will have deformity, tenderness, haemorrhage, edema, ecchymosis, instability, and crepitation. These features may be present in varying combinations. This article discusses the pathophysiology of these fractures, role of radiography a...

  17. Fracture Nasal Bone

    OpenAIRE

    Balasubramanian, Thiagarajan; Venkatesan, Ulaganathan

    2013-01-01

    Nose is the most prominent part of the face, hence it is likely to be the most common structure to be injured in the face. Although fractures involving the nasal bones are very common, it is often ignored by the patient. Patients with fractures of nasal bone will have deformity, tenderness, haemorrhage, edema, ecchymosis, instability, and crepitation. These features may be present in varying combinations. This article discusses the pathophysiology of these fractures, role of radiography and u...

  18. Risk factors for nasal malignancies in German men: the South-German Nasal cancer study

    Directory of Open Access Journals (Sweden)

    Greiser Eberhard M

    2012-11-01

    Full Text Available Abstract Background There are few studies of the effects of nasal snuff and environmental factors on the risk of nasal cancer. This study aimed to investigate the impact of using nasal snuff and of other risk factors on the risk of nasal cancer in German men. Methods A population-based case–control study was conducted in the German Federal States of Bavaria and Baden-Württemberg. Tumor registries and ear, nose and throat departments provided access to patients born in 1926 or later. Results Telephone interviews were conducted with 427 cases (mean age 62.1 years and 2.401 population-based controls (mean age 60.8 years. Ever-use of nasal snuff was associated with an odds ratio (OR for nasal cancer of 1.45 (95% confidence interval [CI] 0.88–2.38 in the total study population, whereas OR in smokers was 2.01 (95% CI 1.00-4.02 and in never smokers was 1.10 (95% CI 0.43–2.80. The OR in ever-smokers vs. never-smokers was 1.60 (95% CI 1.24–2.07, with an OR of 1.06 (95% CI 1.05–1.07 per pack-year smoked, and the risk was significantly decreased after quitting smoking. Exposure to hardwood dust for at least 1 year resulted in an OR of 2.33 (95% CI 1.40–3.91 in the total population, which was further increased in never-smokers (OR 4.89, 95% CI 1.92–12.49 in analyses stratified by smoking status. The OR for nasal cancer after exposure to organic solvents for at least 1 year was 1.53 (1.17–2.01. Ever-use of nasal sprays/nasal lavage for at least 1 month rendered an OR of 1.59 (1.04–2.44. The OR after use of insecticides in homes was 1.48 (95% CI 1.04–2.11. Conclusions Smoking and exposure to hardwood dust were confirmed as risk factors for nasal carcinoma. There is evidence that exposure to organic solvents, and in-house use of insecticides could represent novel risk factors. Exposure to asbestos and use of nasal snuff were risk factors in smokers only.

  19. Non-Hodgkin's lymphoma of nasal cavity: CT diagnosis

    International Nuclear Information System (INIS)

    Objective: To study the CT imaging of nasal lymphomas and find out the relatively specific manifestations of CT imaging of nasal lymphomas. Methods: The CT imaging material of 10 nasal lymphomas confirmed pathologically and evaluate the diagnostic significance of the manifestations of the images combined with review of literatures. Results: The pathology of all 10 cases of nasal lymphomas were T cell Non-Hodgkin's lymphoma (NHL), Ann Arbor stage I-II in 9 and 1 in stage IV. The locations of 10 lymphomas were in the anterior portion of one of the nasal cavities, and the lymphomas extended posteriorly along the inferior and/or media nasalis concha in different extent. No bone structure destruction was found in all stage I cases and the bone of the media nasalis concha as well as the uncinate process was partially absorbed in the stage IV NHL. The skin of the external noses adjacent to the lymphoma of the whole 10 cases were swollen in various severity with disappearance of the subcutaneous fat. Conclusion: If that the tumor located in the anterior portion of nasal cavity, without destruction or deformation of the bone structure, the skin of the external nose adjacent to the tumor was swollen and/or the subcutaneous fat was disappeared shown by CT, the possibility of nasal lymphoma should be considered

  20. Nasal cytochrome P4502A: Identification in rats and humans

    Energy Technology Data Exchange (ETDEWEB)

    Thornton-Manning, J.R.; Hotchkiss, J.A. [Michigan State Univ., East Lansing, MI (United States); Ding, Xinxin [Wadsworth Center for Laboratories and Research, Albany, NY (United States)] [and others

    1995-12-01

    The nasal mucosa, the first tissue of contact for inhaled xenobiotics, possesses substantial enobiotic-metabolizing capacti. Enzymes of the nasal cavity may metabolize xenobiotics to innocuous, more water-soluble compounds that are eliminated from the body, or they may bioactivate them to toxic metabolites. These toxic metabolites may find to cellular macromolecules in the nasal cavity or be transported to other parts of the body where they may react. Nasal carcinogenesis in rodents often results from bioactivation of xenobiotics. The increased incidences of nasal tumors associated with certain occupations suggest that xenobiotic bioactivation may be important in human nasal cancer etiology, as well. The increasing popularity of the nose as a route of drug administration makes information concerning nasal drug metabolism and disposition vital to accomplish therapeutic goals. For these reasons, the study of xenobiotic-met abolizing capacity of the nasal cavity is an important area of health-related research. In the present study, we have confirmed the presence of CYP2A6 mRNA in human respiratory mucosa.

  1. A Case of Enzootic Nasal Adenocarcinoma in a Ewe

    Directory of Open Access Journals (Sweden)

    Devorah Marks Stowe

    2012-01-01

    Full Text Available An approximately 2-year-old open Suffolk ewe presented to the North Carolina State University College of Veterinary Medicine Veterinary Health Complex for evaluation of a left nasal mass. An ultrasound-guided aspirate and core biopsies were performed. An epithelial neoplasia with mild mixed inflammation (neutrophils and plasma cells was diagnosed on cytology and confirmed on histopathology. Immunohistochemistry (IHC, reverse transcriptase polymerase chain reaction (RT-PCR, and transmission electron microscopy were also performed. IHC and RT-PCR identified the presence of enzootic nasal tumor virus and confirmed the final diagnosis of enzootic nasal adenocarcinoma.

  2. Mode-of-Action Uncertainty for Dual-Mode Carcinogens: A Bounding Approach for Naphthalene-Induced Nasal Tumors in Rats Based on PBPK and 2-Stage Stochastic Cancer Risk Models

    Energy Technology Data Exchange (ETDEWEB)

    Bogen, K T

    2007-05-11

    A relatively simple, quantitative approach is proposed to address a specific, important gap in the appr approach recommended by the USEPA Guidelines for Cancer Risk Assessment to oach address uncertainty in carcinogenic mode of action of certain chemicals when risk is extrapolated from bioassay data. These Guidelines recognize that some chemical carcinogens may have a site-specific mode of action (MOA) that is dual, involving mutation in addition to cell-killing induced hyperplasia. Although genotoxicity may contribute to increased risk at all doses, the Guidelines imply that for dual MOA (DMOA) carcinogens, judgment be used to compare and assess results obtained using separate 'linear' (genotoxic) vs. 'nonlinear' (nongenotoxic) approaches to low low-level risk extrapolation. However, the Guidelines allow the latter approach to be used only when evidence is sufficient t to parameterize a biologically based model that reliably o extrapolates risk to low levels of concern. The Guidelines thus effectively prevent MOA uncertainty from being characterized and addressed when data are insufficient to parameterize such a model, but otherwise clearly support a DMOA. A bounding factor approach - similar to that used in reference dose procedures for classic toxicity endpoints - can address MOA uncertainty in a way that avoids explicit modeling of low low-dose risk as a function of administere administered or internal dose. Even when a 'nonlinear' toxicokinetic model cannot be fully validated, implications of DMOA uncertainty on low low-dose risk may be bounded with reasonable confidence when target tumor types happen to be extremely rare. This concept was i illustrated llustrated for a likely DMOA rodent carcinogen naphthalene, specifically to the issue of risk extrapolation from bioassay data on naphthalene naphthalene-induced nasal tumors in rats. Bioassay data, supplemental toxicokinetic data, and related physiologically based p

  3. Optimization of methods to assess mitochondrial DNA in archival paraffin-embedded tissues from mammary canine tumors Otimização dos métodos para avaliar o DNA mitocondrial obtido a partir de tumores mamários caninos incluídos em parafina

    Directory of Open Access Journals (Sweden)

    Angélica C. Bertagnolli

    2008-08-01

    Full Text Available In this study we describe the alterations used to extract and amplify mitochondrial desoxyribonucleic acid (DNA from formalin-fixed paraffin-embedded samples of canine mammary tumors. The epithelial and mesenchymal components (chondromyxoid and chondroid of each tumor, as well as the normal mammary gland tissues, were manually microdissected from 19 mixed canine mammary tumors (10 benign mixed tumors and nine carcinomas arising in mixed tumors. DNA was extracted by Invisorb® Spin Tissue Mini Kit, with protocol changes proposed by the manufacturer. A 273-bp fragment was amplified by polymerase chain reaction (PCR and submitted to automatic sequence analysis. The fragment was successfully analyzed in 100% of the samples. However, an additional lysis step, the reduction of volume in buffer solutions and PCR, a higher annealing temperature and an increase in the number of PCR cycles were required. The initial PCR products were diluted and re-amplified in six samples so that they could be successfully analyzed.A presente comunicação descreve as modificações usadas para extrair e amplificar o DNA mitocondrial obtido de amostras de tumores mamários caninos fixados em formol tamponado a 10% e incluídos em parafina. Os componentes epiteliais e mesenquimais (condromixóide e condróide, bem como a mama normal adjacente, foram microdissectados manualmente de 19 tumores mamários (10 tumores mistos benignos e nove carcinomas em tumores mistos. O DNA foi extraído utilizando-se o Invisorb® Spin Tissue Mini Kit com modificações do protocolo proposto pelo fabricante. Um fragmento de 273-pb foi amplificado por reação em cadeia da polimerase (PCR e seqüenciado em seqüenciador automático. O fragmento foi analisado em 100% das amostras, entretanto modificações como lise adicional, redução do volume das soluções de extração e PCR, aumento da temperatura de anelamento e do número de ciclos de amplificação foram necessárias. Em seis

  4. Failure patterns following cobalt irradiation in dogs with nasal carcinoma

    International Nuclear Information System (INIS)

    The pattern of tumor recurrence was assessed in 24 dogs receiving cobalt radiation therapy for nasal carcinoma. Dogs were evaluated using nasal cavity computed tomography prior to treatment, and at 1, 3, 6 and 12 months after treatment, and at 6-month intervals thereafter if still alive. Dogs were treated with various combinations of total dose, and fraction size. Total doses were normalized to equivalent doses given in 3.0 Gy fractions. The extent of tumor regression or duration of tumor control were not dependent on absolute total dose, normalized total dose, or tumor type. The median duration of local control in all dogs was 312 days. Marked tumor regression was observed in 11 of the 24 dogs. Median duration of local control was significantly longer in dogs with marked tumor regression in comparison to dogs without tumor regression; 389 vs. 161 days respectively. When tumor recurrence was documented in dogs having tumor regression, the location of the recurrence was in the nasal cavity. No tumor recurred in a sinus or periorbital region, and only one geographic miss was detected. Tumor recurrence in the irradiated volume, including dogs with and without marked regression, was documented in 13 of the 24 dogs. The high local failure rate, coupled with the recurrence pattern in these dogs, suggests there may be an opportunity for improvement in local control through use of shrinking field techniques

  5. The Relevance of CD117-Immunocytochemistry Staining Patterns to Mutational Exon-11 in c-kit Detected by PCR from Fine-Needle Aspirated Canine Mast Cell Tumor Cells

    Directory of Open Access Journals (Sweden)

    A. Sailasuta

    2014-01-01

    Full Text Available Canine cutaneous mast cell tumors (MCT are the lethal skin tumors. The biological behavior of the MCT cells is quite varied and unpredictable. Almost MCT dogs usually require a rapid diagnosis and therapy. However, MCT diagnosis and prognosis are still dependent on histopathology which is rather inconvenient, time-consuming, painful, and harmful for some cases. Indeed, MCT can be easily accessible using fine-needle aspiration (FNA. In this study, our biopsy specimens were classified as low- and high-grade MCT based on the novel 2-tier histopathologic grading system. We have demonstrated the usage of fine-needle aspirated MCT cells (FNA-MCT cells from these specimens as a primary cell source to study the distribution of CD117-immunocytochemistry (CD117-ICC staining patterns and the frequency of internal tandem duplication- (ITD- mutant exon-11 of c-kit. The result has substantially shown that there were three staining patterns identified in the cells. Only paranuclear pattern was significantly increased in the cells from high-grade MCT. Altogether, the ITD-mutant exon-11 was also detectable only in these cells. Therefore, the result has supported our hypothesis that there was an increased opportunity to observe a higher CD117-ICC staining pattern and exon-11 mutation in high-grade MCT; even these two parameters may not precisely indicate a histopathological grade.

  6. Oncolytic Virotherapy of Canine and Feline Cancer

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    2014-05-01

    Full Text Available Cancer is the leading cause of disease-related death in companion animals such as dogs and cats. Despite recent progress in the diagnosis and treatment of advanced canine and feline cancer, overall patient treatment outcome has not been substantially improved. Virotherapy using oncolytic viruses is one promising new strategy for cancer therapy. Oncolytic viruses (OVs preferentially infect and lyse cancer cells, without causing excessive damage to surrounding healthy tissue, and initiate tumor-specific immunity. The current review describes the use of different oncolytic viruses for cancer therapy and their application to canine and feline cancer.

  7. Nasal palatal: segment complex

    Directory of Open Access Journals (Sweden)

    Lourdes Romera

    2015-10-01

    Full Text Available This paper focuses on the nature of a segment which is always problematical —the palatal nasal. Phonetic results found in the acoustic, perceptive and articulate spheres, showing the different features of this nasal with regards to others, are the point of departure for a brief reflection on the phonological nature of this segment, taking into account the feature geometry and the articulatory phonology. It concludes by considering the palatal nasal /?/ as a complex segment formed by /n+j/ and the imputation, to temporary effects, of a degree of major o minor assimilation and gestural overlapping during effective perception of /?/, of /n+j/ or of /n+i/.

  8. Investigation on Canine Tumors in Hangzhou from 2012 to 2014%2012年-2014年杭州地区宠物犬肿瘤调查

    Institute of Scientific and Technical Information of China (English)

    朱国; 师福山; 杨杨

    2015-01-01

    在浙江大学附属动物医院门诊收集了133例犬肿瘤自然发生病例,通过对其临床症状、发病部位、品种、年龄、性别、饮食等进行调查。发现肿瘤发病早期一般不表现全身症状,恶性肿瘤发生转移时会有恶病质的表现;乳腺和皮肤及软组织是犬肿瘤临床高发的部位,分别占全部患犬的42.11%和24.81%;京巴犬、杂交犬、贵宾犬、西施犬和可卡犬是肿瘤高发品种,分别占患犬的19.55%、14.29%、11.28%、7.52%和6.77%;患病犬年龄1岁~15岁,平均年龄9.39岁,6岁~10岁发病率最高;一些肿瘤类型与性别、是否绝育有关;日常饮食与犬肿瘤的发生有关,肉拌饭类、纯肉加火腿肠类、狗粮加肉类和纯狗粮类,发病比例分别为39.85%、26.32%、21.05%和12.78%,纯狗粮饲养的犬发病率较低。%In order to investigate the epidemiology of canine tumors,we examined 133 cases of canine tumors from animal hospital of Zhejiang University and studied the relationship between tumors and clinical symptoms,species, genders,ages and diets.Our results indicated that animals with neoplastic diseases show no general systemic symptoms in the early stages of diseases,but cachexia was invariably observed at metastatic stage.The most com-mon locations of the tumors are:mammary glands (42.11% of the cases),skin and soft tissues (24.81%).The most affected breeds,in decreasing order of frequency,were pekingese (19.55%),hybrids (14.29%),poodles (11.28%),shih tzu (7.52%)and cocker spaniel (6.77%).The age of tumor ocurrence extends from 1 to 15 years old,with the most frequent occurrence being in the age group of 6 to 10 years old,and an average age of 9.39 years old .The occurrence of the tumors depends also on a daily diet :meat with rice diet shows the highest rate (39.85%),whereas meat plus ham/ sausages (26.32%)and dog food plus meat (21.05%)were associated with

  9. OUTCOMES FOLLOWING NASAL SURGERY WITH AND WITHOUT POSTOPERATIVE NASAL DRESSINGS

    Directory of Open Access Journals (Sweden)

    Surya Prakasa Rao

    2015-02-01

    Full Text Available PURPOSE OF STUDY: Nasal dressing following nasal surgery in an attempt to prevent postoperative bleeding and to modulate the wound healing process. Experience with postoperative nasal dressings in otolaryngologic literature spans more than half a century; despite of this, there is still little agreement between the surgeons on the appropriate choice of nasal dressings following nasal surgery , or whether nasal dressings are required at all. This paper briefly reviews the comparative study between the postoperative case s wi th and without nasal dressings. STUDY DESIGN: It is a prospective study carried out in a te rtiary care, teaching hospital. MATERIALS AND METHODS: A prospective evaluation of patients who underwent nasal surgery at tertiary teaching hospital setting bet ween February 2013 to June 2014 was performed. Nasal dressing was done in some cases who underwent nasal surgery and no dressing was done in some cases. The comparative results between the cases with and without nasal packing in terms of Postoperative blee ding, Adhesion formation, Middle turbinate lateralization were studied. RESULTS: Out of 160 patients included in this study, nasal dressing postoperatively was done in 92 cases and 68 cases were not packed postoperatively. In terms of postoperative bleedin g there is no significant difference between the cases with packs (5.43% and without pack (5.88%. Postoperative Adhesion formation was less in cases without nasal packing ( 2.94% than in cases with nasal dressing ( 8.7%. Middle turbinate lateralization i s also less in cases without nasal packing ( 8.82% than in cases with nasal packing (17.5%. CONCLUSION: The decision as to whether to pack the nose after nasal surgery remains controversial. There has been an increasing tendency to move away from removabl e nasal dressings due to discomfort and bleeding upon removal and also postoperative adhesions. This study showcases that there is no considerable difference in

  10. Dihydroergotamine Injection and Nasal Spray

    Science.gov (United States)

    Migranal® Nasal Spray ... inject subcutaneously (under the skin) and as a spray to be used in the nose. It is ... that you know how to use the nasal spray or administer the injection correctly. After that, you ...

  11. FRACTURE NASAL BONES

    Directory of Open Access Journals (Sweden)

    Balasubramanian Thaigarajan

    2013-03-01

    Full Text Available Nose is the most prominent part of the face, hence it is likely to be the most common structure to be injured in the face. Although fractures involving the nasal bones are very common, it is often ignored by the patient. Patients with fractures of nasal bone will have deformity, tenderness, haemorrhage, edema, ecchymosis, instability, and crepitation. These features may be present in varying combinations. This article discusses the pathophysiology of these fractures, role of radiography and ultrasound in their diagnosis and their management.

  12. Molecular portrait-based correlation between primary canine mammary tumor and its lymph node metastasis: possible prognostic-predictive models and/or stronghold for specific treatments?

    Directory of Open Access Journals (Sweden)

    Beha Germana

    2012-11-01

    Full Text Available Abstract Background This study aimed to evaluate the relationship between the molecular phenotype of the primary mammary tumor and its related lymph node metastasis in the dog to develop prognostic-predictive models and targeted therapeutic options. Results Twenty mammary tumor samples and their lymph node metastases were selected and stained by immunohistochemistry with anti-estrogen receptor (ER, -progesterone receptor (PR, -human epidermal growth factor receptor 2 (c-erbB-2, -cytokeratin 5/6 (CK 5/6, -cytokeratin 14 (CK14, -cytokeratin 19 (CK 19 and -protein 63 (p63 antibodies. Four phenotypes (luminal A, luminal B, c-erbB2 overexpressing and basal-like were diagnosed in primary tumors and five (luminal A, luminal B, c-erbB-2 overexpressing, basal-like and normal-like in the lymph node metastases. Phenotypic concordance was found in 13 of the 20 cases (65%, and seven cases (35% showed discordance with different lymph node phenotypic profile from the primary tumor. Conclusions The phenotype of the primary tumor assumes a predictive-therapeutic role only in concordant cases, meaning that both the primary tumor and its lymph node metastasis should be evaluated at the same time. A treatment plan based only on the primary tumor phenotype could lead to therapeutic failures if the phenotype of the lymph node metastasis differs from that of the primary tumor.

  13. Nasalance Norms in Greek Adults

    Science.gov (United States)

    Okalidou, Areti; Karathanasi, Asimina; Grigoraki, Eleni

    2011-01-01

    The purposes of this study were to derive nasalance norms for monolingual Greek speakers, to examine nasalance scores as a function of gender and to draw cross-linguistic comparisons based on normative data. Participants read aloud a corpus of linguistic material, consisting of (1) a nasal text, an oral text and a balanced text; (2) a set of nasal…

  14. Cosmetic and Functional Nasal Deformities

    Science.gov (United States)

    ... nasal complaints. Nasal deformity can be categorized as “cosmetic” or “functional.” Cosmetic deformity of the nose results in a less ... taste , nose bleeds and/or recurrent sinusitis . A cosmetic or functional nasal deformity may occur secondary to ...

  15. Metaplastic changes of nasal respiratory epithelium in rats exposed to hexamethylphosphoramide (HMPA) by inhalation.

    OpenAIRE

    K. P. Lee(University of Tokyo); Trochimowicz, H. J.

    1982-01-01

    Rats exposed by inhalation to hexamethylphosphoramide (HMPA) at concentrations of 50, 100, 400, and 4000 parts per billion (ppb) for 6-24 months revealed nasal tumors and squamous metaplasia with inflammation in the nasal epithelium, but no changes were observed at 10 ppb. The ciliated cells were most susceptible to HMPA, showing degenerative changes, with abnormal cilia and extensive deciliation. The desquamated nasal epithelium was repaired initially by undifferentiated mucus or microvillou...

  16. Tumor

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    2008479 Preliminary study of MR elastography in brain tumors. XU Lei(徐磊), et al.Neurosci Imaging Center, Beijing Tiantan Hosp, Capital Med Univ, Beijing 100050.Chin J Radiol 2008;42(6):605-608. Objective To investigate the potential values of magnetic resonance elastography (MRE) for evaluating the brain tumor consistency in vivo. Methods Fourteen patients with known solid brain tumor (5 male, 9 female; age range: 16-63 years)

  17. Butorphanol Nasal Spray

    Science.gov (United States)

    ... have any questions. You can also visit the Food and Drug Administration (FDA) website (http://www.fda.gov/cder) to obtain the Medication Guide. ... butorphanol, any other medications, or benzethonium chloride (a preservative ... nasal spray. Alcohol can make the side effects of the medication worse.

  18. Ciclesonide Nasal Spray

    Science.gov (United States)

    Ciclesonide nasal spray is used to treat the symptoms of seasonal (occurs only at certain times of the year), and perennial ( ... Ciclesonide comes as a solution (liquid) to spray in the nose. It is usually sprayed in each nostril once daily. Use ciclesonide at around the same time every day. Follow the ...

  19. Clival chordoma manifesting as nasal bleeding. A case report

    Energy Technology Data Exchange (ETDEWEB)

    Kitai, Ryuhei; Yoshida, Kazuhiko; Kubota, Toshihiko; Sato, Kazufumi; Handa, Yuji; Kasahara, Kazuma [University of Fukui, Department of Neurosurgery, Fukui (Japan); Nakajima, Hirofumi [Tsuruga Municipal Hospital, Department of Neurosurgery, Fukui (Japan)

    2005-05-01

    Chordoma is a rare cartilaginous tumor, for which bleeding presentation is unusual. We report a case of rare hemorrhaged clival chordoma, which was diagnosed correctly by magnetic resonance imaging. A 32-year-old man presented with nasal bleeding. The tumor was totally removed via a trans-sphenoidal approach, from which the surgical specimen confirmed chordoma. Epistaxis seemed to be caused by the spreading of the intratumoral hemorrhage into the sphenoid sinus. This case demonstrates the importance of an exact differential diagnostic evaluation, including chordoma, by use of modern imaging techniques for nasal bleeding. (orig.)

  20. Ameloblastoma de fossa nasal: revisão bibliográfica e relato de dois casos Nasal ameloblastoma: literature review and report of two cases

    Directory of Open Access Journals (Sweden)

    Washington L. C. Almeida

    2001-09-01

    Full Text Available O ameloblastoma é um tumor bastante incomum na cavidade nasal. Surge a partir do epitélio odontogênico, podendo estender-se ao seio maxilar, órbitas e base de crânio. Apresentamos dois casos de ameloblastoma em fossa nasal direita, associados a sintomas nasossinusais e seus principais achados, clínicos e cirúrgicos.Ameloblastoma is a very unusual tumor in the nasal cavity. It arises from the odontogenic epithelium and extends up to the maxillary sinus, orbits and skull base. We have presented two cases of ameloblastoma, both in the right nasal cavity, associated with nasal and sinusal symptoms, and reported the main surgical and clinical findings.

  1. Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma

    OpenAIRE

    Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid

    2016-01-01

    Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...

  2. Assessment of nasal obstruction with flexible nasal endoscopy

    International Nuclear Information System (INIS)

    Objective was to report the value of nasal endoscopy as an outpatient procedure in the diagnosis of posterior nasal obstruction. Over one year period, from March 2002 to March 2003, we evaluated 130 adult patients that attended the Ear, Nose and Throat Department of Sohag University Hospital in Egypt with persistent nasal obstruction via anterior rhinoscopy and flexible nasopharyngoscopy. We reported the cause and site of obstruction in relation to the choanae. We confirmed the diagnosis by CT scanning, rigid endoscopic examination under general anesthesia, and histopathological analysis of biopsies taken. Forty-six percent of our cases had posterior nasal obstruction, 43.5% due to post-choanal lesions (mainly adenoid), 33% due to pre-choanal lesions (mainly choanal polyps), and 23.5% due to choanal lesions (mainly choanal adenoid). We conclude that flexible nasal endoscopy is superior to visual examination in the evaluation of nasal obstruction; hence, we recommend its routine use. (author)

  3. Intratumoral CD3+ T-lymphocytes immunoexpression and its association with c-Kit, angiogenesis, and overall survival in malignant canine mammary tumors.

    Science.gov (United States)

    Carvalho, Maria Isabel; Pires, Isabel; Dias, Marlene; Prada, Justina; Gregório, Hugo; Lobo, Luis; Queiroga, Felisbina

    2015-01-01

    In this study 80 malignant CMT were submitted to immunohistochemical detection of CD3, c-kit, VEGF, and CD31, together with clinicopathological parameters of tumor aggressiveness. CD3+ T-cells and c-kit overexpression revealed a positive correlation with VEGF (r = 0.503, P < 0.0001; r = 0.284, P = 0.023 for CD3 and c-kit, resp.) and CD31 (r = 0.654, P < 0.0001; r = 0.365, P = 0.003 for CD3 and c-kit, resp.). A significant association (P = 0.039) and a positive correlation (r = 0.263, P = 0.039) between CD3 and c-kit were also observed. High CD3/VEGF, c-kit/VEGF, and CD3/c-kit tumors were associated with elevated grade of malignancy (P < 0.0001 for all groups), presence of intravascular emboli (P < 0.0001 for CD3/VEGF and CD3/c-kit; P = 0.002 for c-kit/VEGF), and presence of lymph node metastasis (P < 0.0001 for all groups). Tumors with high CD3/VEGF (P = 0.006), c-kit/VEGF (P < 0.0001), and CD3/c-kit (P = 0.002) were associated with poor prognosis. Interestingly high c-kit/VEGF tumors retained their significance by multivariate analysis arising as independent prognostic factor. PMID:26346272

  4. Intratumoral CD3+ T-Lymphocytes Immunoexpression and Its Association with c-Kit, Angiogenesis, and Overall Survival in Malignant Canine Mammary Tumors

    Directory of Open Access Journals (Sweden)

    Maria Isabel Carvalho

    2015-01-01

    Full Text Available In this study 80 malignant CMT were submitted to immunohistochemical detection of CD3, c-kit, VEGF, and CD31, together with clinicopathological parameters of tumor aggressiveness. CD3+ T-cells and c-kit overexpression revealed a positive correlation with VEGF (r = 0.503, P < 0.0001; r = 0.284, P = 0.023 for CD3 and c-kit, resp. and CD31 (r = 0.654, P < 0.0001; r = 0.365, P = 0.003 for CD3 and c-kit, resp.. A significant association (P = 0.039 and a positive correlation (r = 0.263, P = 0.039 between CD3 and c-kit were also observed. High CD3/VEGF, c-kit/VEGF, and CD3/c-kit tumors were associated with elevated grade of malignancy (P < 0.0001 for all groups, presence of intravascular emboli (P < 0.0001 for CD3/VEGF and CD3/c-kit; P = 0.002 for c-kit/VEGF, and presence of lymph node metastasis (P < 0.0001 for all groups. Tumors with high CD3/VEGF (P = 0.006, c-kit/VEGF (P < 0.0001, and CD3/c-kit (P = 0.002 were associated with poor prognosis. Interestingly high c-kit/VEGF tumors retained their significance by multivariate analysis arising as independent prognostic factor.

  5. Health risks associated with inhaled nasal toxicants

    NARCIS (Netherlands)

    Feron, V.J.; Arts, J.H.E.; Kuper, C.F.; Slootweg, P.J.; Woutersen, R.A.

    2001-01-01

    Health risks of inhaled nasal toxicants were reviewed with emphasis on chemically induced nasal lesions in humans, sensory irritation, olfactory and trigeminal nerve toxicity, nasal immunopathology and carcinogenesis, nasal responses to chemical mixtures, in vitro models, and nasal dosimetry- and me

  6. Polymorphous low-grade adenocarcinoma of the nasal fossa.

    Science.gov (United States)

    González-Lagunas, Javier; Alasà-Caparrós, Cristian; Vendrell-Escofet, Gerard; Huguet-Redecilla, Pere; Raspall-Martin, Guillermo

    2005-01-01

    An unusual case of a T4N2CMx polymorphous low grade adenocarcinoma located in the nasal fossae and extending to the pterygoid area is presented. The primary tumor was excised through a Lefort I maxillotomy and the neck was managed with a supraomohyoid neck dissection. Adjuntive postoperative radiotherapy was also administered to the patient.

  7. Nasendoscopy for unusual nasal symptoms

    OpenAIRE

    Vedasalam, S; Sipaul, F.; Hill, A.; Porter, G.

    2010-01-01

    A 20-year-old woman who was fit and well presented with a history of left nasal blockage for 2 years. She was noted on anterior rhinoscopy to have nasal septal deviation towards the left. She was listed for septoplasty with the aim of relieving nasal obstruction. At operation she was found to have a mildly deviated septum to the left. There was also a rhinolith in the left nostril posterior to the deviated septum (figure 1). Following removal of the rhinolith, her nasal airway appeared adequa...

  8. A Comparison of Fresh Frozen vs. Formalin-Fixed, Paraffin-Embedded Specimens of Canine Mammary Tumors via Branched-DNA Assay

    OpenAIRE

    Florenza Lüder Ripoli; Annika Mohr; Susanne Conradine Hammer; Saskia Willenbrock; Marion Hewicker-Trautwein; Silvia Hennecke; Hugo Murua Escobar; Ingo Nolte

    2016-01-01

    Mammary neoplasms are the tumors most affecting female dogs and women. Formalin-fixed, paraffin-embedded (FFPE) tissues are an invaluable source of archived biological material. Fresh frozen (FF) tissue is considered ideal for gene expression analysis. However, strategies based on FFPE material offer several advantages. Branched-DNA assays permit a reliable and fast workflow when analyzing gene expression. The aim of this study was to assess the comparability of the branched-DNA assay when an...

  9. Immunohistochemical expression of B and T-lymphocytes and TGF-β in experimentally transplanted canine venereal tumor Expressão imunoistoquímica de linfócitos T e B e do TGF-β no tumor venéreo transmissível canino experimentalmente transplantado

    Directory of Open Access Journals (Sweden)

    Ana Carolina Trompieri Silveira

    2009-07-01

    Full Text Available The tumor/host relationship may have a determining role in the progression or remission of a tumor. Greater infiltration of leukocytes into tumors has been associated with a better prognosis, although controversy regarding whether these cells have a central role in antitumor immunity still exists. Canine transmissible venereal tumor (TVT is an experimentally transplantable type of tumor that has been used as an experimental model for the tumor/host relationship. The aim of this study was to evaluate the infiltration of T-lymphocytes (CD3, CD4, CD8 and B lymphocytes (CD79-α and the expression of the cytokine TGF-β in TVT, by means of immunohistochemistry (ABC method. The experimental tumors were composed of puppies that developed TVT after transplantation, in the progression (n=8 (Group 1a, latency (n=8 (Group 1b and regression (n=8 (Group 1c phases of the tumor. CD3+ T-lymphocytes predominated in the progression and regression phases, in relation to the latency phase. CD4+ and ¹CD8+ T-lymphocytes were predominant in the progression phase, and with lower expression in the regression phase. The greatest quantities of B-lymphocytes were in the regression phase, with restricted expression in the progression phase. TGF-β was expressed equally in the phases of the transplanted TVT.A relação tumor/hospedeiro pode ter um papel determinante na progressão ou remissão de um tumor. Uma maior infiltração de leucócitos nos tumores tem sido associada a um melhor prognóstico. Entretanto, o papel central dessas células na imunidade antitumoral ainda é controverso. O tumor venéreo transmissível (TVT canino é um tumor transplantável experimentalmente e tem sido utilizado como modelo experimental da relação tumor versus hospedeiro. O objetivo deste estudo foi avaliar a infiltração de linfócitos T (CD3, CD4, CD8, B (CD79-α e a expressão da citocina TGF-β no TVT por meio da imunoistoquímica (método ABC. Os grupos experimentais foram

  10. FDG PET/CT imaging in canine cancer patients

    DEFF Research Database (Denmark)

    Hansen, Anders Elias; McEvoy, Fintan; Engelholm, Svend Aage;

    2011-01-01

    and organs in canine cancer patients. FDG PET/CT was performed in 14 dogs including, nine mesenchymal tumors, four carcinomas, and one incompletely excised mast cell tumor. A generally higher FDG uptake was observed in carcinomas relative to sarcomas. Maximum SUV of carcinomas ranged from 7.6 to 27.......0, and for sarcomas from 2.0 to 10.6. The FDG SUV of several organs and tissues, including regional brain uptake is reported, to serve as a reference for future FDG PET studies in canine cancer patients. Several potential pitfalls have been recognized in interpretation of FDG PET images of human patients, a number...

  11. Cytological diagnosis of a metastatic canine mammary tumor in pleural effusion Diagnóstico citológico de tumor mamário metastático canino em derrame pleural

    OpenAIRE

    Cassali, G.D.; Gärtner, F.; M.J. Vieira da Silva; Schmitt, F C

    1999-01-01

    Descrevem-se os achados citomorfológicos de um tumor maligno de mama em uma cadela Poodle de sete anos de idade, o qual foi observado inicialmente pelo exame citológico do derrame pleural. Comparam-se os aspectos citológicos do derrame pleural e punção aspirativa com agulha fina do tumor com aqueles descritos para o câncer de mama na espécie humana.

  12. Cytological diagnosis of a metastatic canine mammary tumor in pleural effusion Diagnóstico citológico de tumor mamário metastático canino em derrame pleural

    Directory of Open Access Journals (Sweden)

    G.D. Cassali

    1999-08-01

    Full Text Available Descrevem-se os achados citomorfológicos de um tumor maligno de mama em uma cadela Poodle de sete anos de idade, o qual foi observado inicialmente pelo exame citológico do derrame pleural. Comparam-se os aspectos citológicos do derrame pleural e punção aspirativa com agulha fina do tumor com aqueles descritos para o câncer de mama na espécie humana.

  13. Propofol attenuates LPS-induced tumor necrosis factor-α, interleukin-6 and nitric oxide expression in canine peripheral blood mononuclear cells possibly through down-regulation of nuclear factor (NF)-κB activation

    OpenAIRE

    Pei, Zengyang; WANG, Jinqiu

    2014-01-01

    Sepsis is a major cause of mortality in intensive care medicine. Propofol, an intravenous general anesthetic, has been suggested to have anti-inflammatory properties and able to prevent sepsis induced by Gram-positive and Gram-negative bacteria by down-regulating the gene expression of pro-inflammatory cytokines. However, propofol’s anti-inflammatory effects upon canine peripheral blood mononuclear cells (PBMCs) have not yet been clarified. Here, we isolate canine PBMCs and investigate the ef...

  14. Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma.

    Science.gov (United States)

    Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid

    2016-01-01

    Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma. PMID:26733734

  15. Intratumoral CD3+ T-Lymphocytes Immunoexpression and Its Association with c-Kit, Angiogenesis, and Overall Survival in Malignant Canine Mammary Tumors

    OpenAIRE

    Maria Isabel Carvalho; Isabel Pires; Marlene Dias; Justina Prada; Hugo Gregório; Luis Lobo; Felisbina Queiroga

    2015-01-01

    In this study 80 malignant CMT were submitted to immunohistochemical detection of CD3, c-kit, VEGF, and CD31, together with clinicopathological parameters of tumor aggressiveness. CD3+ T-cells and c-kit overexpression revealed a positive correlation with VEGF (r = 0.503, P < 0.0001; r = 0.284, P = 0.023 for CD3 and c-kit, resp.) and CD31 (r = 0.654, P < 0.0001; r = 0.365, P = 0.003 for CD3 and c-kit, resp.). A significant association (P = 0.039) and a positive correlation (r = 0.263, P = 0.03...

  16. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    OpenAIRE

    I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini

    2008-01-01

    A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTAC...

  17. Definitive magnetic nasal prosthesis for partial nasal defect

    Directory of Open Access Journals (Sweden)

    E Nagaraj

    2011-01-01

    Full Text Available Maxillofacial trauma refers to any injury to the face or jaw caused by physical force, trauma, the presence of foreign objects, animal or human bites, and burns. Facial defects can be devastating in their impact on physical structure and function of the affected individual, leading to potential compromises in quality of life. Restoration of facial defects, especially nasal defects, is a difficult challenge for both the surgeon and the prosthodontist. Here is a case report of partial nasal defect caused by trauma, rehabilitated with a magnetic nasal prosthesis made with silicone elastomers using mechanical and anatomical retentive aids.

  18. Apoptose no tumor venéreo transmissível canino: características morfológicas e evidenciação bioquímica Apoptosis in the canine transmissible venereal tumor: morphological features and biochemical evidence

    Directory of Open Access Journals (Sweden)

    F.G.A. Santos

    2001-10-01

    Full Text Available Fragmentos de tumor venéreo transmissível canino (TVTC de ocorrência natural, com localização genital, foram obtidos de cinco animais, machos, adultos, sem raça definida. "Imprints" da superfície de corte em lâmina de microscopia foram fixadas em metanol, coradas pelo Giemsa e submetidas à avaliação citológica. Os fragmentos foram fixados e processados rotineiramente para inclusão em parafina e coloração com HE e Shorr, para confirmação histológica do tumor e identificação da apoptose. Outros fragmentos foram envolvidos com papel alumínio e acondicionados dentro de frascos de vidro em gelo seco, para serem processados no mesmo dia, visando à extração de DNA e eletroforese em gel de agarose. Análises cito e histológica do TVTC mostraram a distribuição e o padrão celular e tecidual característicos dessa neoplasia, sobressaindo-se a presença de vacúolos claros, bem definidos no citoplasma à análise citológica. Pela coloração com Shorr pôde-se identificar células retraídas, com aumento da acidofilia citoplasmática e condensação da cromatina nuclear, às vezes com fragmentação do núcleo e das células, caracterizando apoptose. A coloração pelo Shorr mostrou ser mais eficiente na distinção de células apoptóticas do que a coloração por HE. A eletroforese de DNA em gel de agarose demonstrou a fragmentação internucleossômica do genoma, que pôde ser reconhecida pelo clássico "padrão em escada".Fragments of canine transmissible venereal tumors, from natural cases and genital localization, were obtained from five adult male mongrel dogs. Imprints of the tumors were fixed, stained by Giemsa and submitted to cytological analysis to confirm the diagnosis. Representative samples of the tumoral tissue were fixed, embedded in paraffin and processed routinely for microscopic examination. Sections were stained with hematoxylin - eosin and Shorr. Another set of fragments was packed and maintained in dry ice

  19. Pathogenesis of nasal polyposis.

    Science.gov (United States)

    Hulse, K E; Stevens, W W; Tan, B K; Schleimer, R P

    2015-02-01

    Chronic rhinosinusitis with nasal polyps (CRSwNP) is a complex inflammatory condition that affects a large proportion of the population world-wide and is associated with high cost of management and significant morbidity. Yet, there is a lack of population-based epidemiologic studies using current definitions of CRSwNP, and the mechanisms that drive pathogenesis in this disease remain unclear. In this review, we summarize the current evidence for the plethora of factors that likely contribute to CRSwNP pathogenesis. Defects in the innate function of the airway epithelial barrier, including diminished expression of antimicrobial products and loss of barrier integrity, combined with colonization by fungi and bacteria likely play a critical role in the development of chronic inflammation in CRSwNP. This chronic inflammation is characterized by elevated expression of many key inflammatory cytokines and chemokines, including IL-5, thymic stromal lymphopoietin and CCL11, that help to initiate and perpetuate this chronic inflammatory response. Together, these factors likely combine to drive the influx of a variety of immune cells, including eosinophils, mast cells, group 2 innate lymphoid cells and lymphocytes, which participate in the chronic inflammatory response within the nasal polyps. Importantly, however, future studies are needed to demonstrate the necessity and sufficiency of these potential drivers of disease in CRSwNP. In addition to the development of new tools and models to aid mechanistic studies, the field of CRSwNP research also needs the type of robust epidemiologic data that has served the asthma community so well. Given the high prevalence, costs and morbidity, there is a great need for continued research into CRS that could facilitate the development of novel therapeutic strategies to improve treatment for patients who suffer from this disease. PMID:25482020

  20. Hereditary nasal parakeratosis in Labrador retrievers: 11 new cases and a retrospective study on the presence of accumulations of serum ('serum lakes') in the epidermis of parakeratotic dermatoses and inflamed nasal plana of dogs.

    Science.gov (United States)

    Peters, Jeanine; Scott, Danny W; Erb, Hollis N; Miller, William H

    2003-08-01

    We report 11 new cases of hereditary nasal parakeratosis in Labrador retrievers. The disease was first observed when the dogs were 6 months to 2 years of age, and affected dogs of either sex and all coat colours. Hyperkeratosis and depigmentation were confined to the nasal planum, and affected dogs were otherwise healthy. The principal histological findings in biopsy specimens were marked diffuse parakeratotic hyperkeratosis, multiple intracorneal serum lakes and superficial interstitial-to-interface lymphoplasmacytic dermatitis. Topical applications of propylene glycol in water or white petrolatum were often effective for treatment of the dermatosis. However, continued applications were required to maintain a beneficial response. A retrospective histological study of parakeratotic inflammatory diseases of canine haired skin and inflammatory diseases of the canine nasal planum was performed. The degree of parakeratotic hyperkeratosis and the number and size of intracorneal serum lakes were evaluated. The degree of parakeratotic hyperkeratosis was greater in hereditary nasal parakeratosis specimens than that seen in discoid lupus erythematosus and Malassezia dermatitis. There were more serum lakes in hereditary nasal parakeratosis specimens than in specimens from dogs with discoid lupus erythematosus, Malassezia dermatitis, primary seborrheic dermatitis or zinc-responsive dermatosis. Significant differences in sizes of serum lakes (if present) were not seen. PMID:12895224

  1. Keratoacanthoma: an unusual nasal mass.

    Science.gov (United States)

    Sazafi, M S; Salina, H; Asma, A; Masir, N; Primuharsa Putra, S H A

    2013-12-01

    We report a case of keratoacanthoma in a non-sun-exposed nasal vestibule of an 84-year-old man. He presented with a progressively growing left nasal mass that had been present for 8 months. Examination showed a non-tender protruding mass arising from medial vestibular wall of the left nostril. Histopathology indicated it was a keratoacanthoma. In an elderly patient with a history of a progressively growing mass in the nose, a differential diagnosis of malignancy should be ruled out, and histological conformation is essential. To our knowledge, only a very small number of cases of nasal vestibular keratoacanthoma have been reported. PMID:24376301

  2. Mitek Suspension of the Lateral Nasal Wall.

    Science.gov (United States)

    White, James R; Hamilton, Grant S

    2016-02-01

    The nasal valve has long been described as the anatomical boundary most likely to inhibit nasal airflow and lead to subsequent nasal obstruction. Although many procedures can address this area to improve the nasal airway, for over 20 years, suture lateralization of the external nasal valve has been described as a minimally invasive technique that can improve nasal breathing. We report our modification of the standard technique in which we lateralize the placement of the bone-anchored suture and incorporate Gore-Tex within the nasal vestibular incision to prevent tissue migration. PMID:26862966

  3. A pRb-responsive, RGD-modified, and Hyaluronidase-armed Canine Oncolytic Adenovirus for Application in Veterinary Oncology

    OpenAIRE

    Laborda, Eduardo; Puig-Saus, Cristina; Rodriguez-García, Alba; Moreno, Rafael; Cascalló, Manel; Pastor, Josep; Alemany, Ramon

    2014-01-01

    Human and canine cancer share similarities such as genetic and molecular aspects, biological complexity, tumor epidemiology, and targeted therapeutic treatment. Lack of good animal models for human adenovirotherapy has spurred the use of canine adenovirus 2-based oncolytic viruses. We have constructed a canine oncolytic virus that mimics the characteristics of our previously published human adenovirus ICOVIR17: expression of E1a controlled by E2F sites, deletion of the pRb-binding site of E1a...

  4. Expressão dos filamentos intermediários no diagnóstico dos tumores mamários de cadelas Expression of intermediate filaments in canine mammary tumors diagnosis

    OpenAIRE

    D.A.P.C. Zuccari; Santana, A. E.; N.S. Rocha

    2002-01-01

    Foram utilizados anticorpos monoclonais para marcação imunoistoquímica dos tecidos tumorais e obtenção de informações sobre a histogênese dos tumores mamários utilizando-se anti-citoqueratinas para marcação de células epiteliais, e anti-actina e anti-vimentina para células mioepiteliais. O procedimento imunoistoquímico mostrou-se esclarecedor com relação à histogênese dos tumores mamários, confirmando a marcação de células epiteliais com as citoqueratinas que perdem sua expressão na transform...

  5. 显微镜辅助经鼻蝶窦入路垂体瘤切除术的疗效及安全性评价%Evaluation of the efficacy and safety of microscope assisted nasal transsphenoidal pituitary ;tumor resection

    Institute of Scientific and Technical Information of China (English)

    张诚; 李建明

    2015-01-01

    Objective: To study the efficacy and safety of microscope assisted nasal transsphenoidal pituitary tumor resection. Methods: pituitary tumor patients in our hospital from March 2011 to May 2013 were enrolled and divided into observation group given microscope assisted nasal transsphenoidal pituitary tumor resection and control group given oral-nasal septum-sphenoid sinus pituitary tumor resection according to different operation mode. Then stress level, curative effect related index and complications were observed and compared with existing research. Results: (1) Adrenaline, noradrenaline, rennin, angiotensin Ⅱlevel and operation time, intraoperative bleeding volume, postoperative hospitalization time of observation group were lower than control group, cases of hormone levels return to normal and improve were more than control group, complication cases were less than control group. (2)compared with the existing research on nerve endoscopic surgery, operation time, intraoperative bleeding volume, postoperative hospitalization time and cases of hormone levels return to normal, improve and complications of observation group had no statistical difference. Conclusion:microscope assisted nasal transsphenoidal pituitary tumor resection is helpful to reduce surgery trauma, relieve stress condition and can achieve equal operation effect and complications.%目的:研究显微镜辅助下经鼻蝶窦入路垂体瘤切除术的疗效和安全性。方法:回顾性分析垂体瘤患者病历资料,并根据手术方式不同分为接受显微镜辅助下经鼻蝶窦入路垂体瘤切除术的观察组和给予经口唇下-鼻中隔-蝶窦垂体瘤切除术的对照组,观察两组患者的术中应激程度、疗效相关指标以及并发症情况,并与已有研究进行比较。结果:①观察组患者的肾上腺素、去甲肾上腺素、肾素以及血管紧张素Ⅱ水平均以及手术时间、术中出血量、术后住院时间低于对照组,激素

  6. Clinical utility of a life quality score in dogs with canine transmissible venereal tumor treated by vincristine chemotherapy Utilidade clínica de escala de qualidade de vida durante o tratamento quimioterápico de cães com tumor venéreo transmissível canino (TVTC com vincristina

    Directory of Open Access Journals (Sweden)

    M.L. Valladão

    2010-10-01

    Full Text Available The clinical utility of a life quality score during vincristine chemotherapy of dogs with canine transmissible venereal tumor (CTVT was investigated using 93 tumor-bearing dogs in this prospective study. At diagnosis, clinical data and the performance status were evaluated according to a modified Karnofsky score (CKS adapted for dogs. The animals were treated with vincristine sulphate (0.025mg/kg at weekly intervals until the tumor had macroscopically disappeared. The time until the first adverse event and death were recorded. In a pilot study, CKS revealed a high inter-observer concordance (kappa=0.735; weighted kappa=0.835. CKS permitted a detailed monitoring of adverse effects during therapy. Cox regressions showed that low performance score and reduced body weight were independent predictive factors for death during chemotherapy. The modified Karnofsky performance score is a simple and reproducible clinical instrument, able to estimate patient outcome after treatment of CTVT.Investigou-se a utilidade clínica de uma escala de qualidade de vida durante o tratamento quimioterápico de cães com tumor venéreo transmissível canino (TVTC em 93 animais com TVTC que compuseram este estudo prospectivo. Ao diagnóstico, foram avaliados os dados clínicos e o escore de qualidade de vida adaptado para cães (CKS. Os animais foram tratados com sulfato de vincristina (0.025mg/kg semanalmente até o desaparecimento macroscópico do tumor. Foram anotados o tempo até o aparecimento do primeiro evento adverso e a morte. Em estudo piloto do CKS, alta concordância entre os observadores foi demonstrada (kappa = 0.735; weighted kappa = 0.835. O CKS permitiu um detalhado monitoramento dos eventos adversos durante a terapia. A regressão Cox multivariada demonstrou que o baixo escore de qualidade de vida e o reduzido peso corporal foram fatores preditivos independentes para o óbito durante a quimioterapia. A escala modificada de Karnofsky é um instrumento cl

  7. Vaccines for Canine Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Faeze Foroughi-Parvar

    2014-01-01

    Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

  8. Bilateral cleft lip nasal deformity

    OpenAIRE

    Singh Arun; Nandini R.

    2009-01-01

    Bilateral cleft lip nose deformity is a multi-factorial and complex deformity which tends to aggravate with growth of the child, if not attended surgically. The goals of primary bilateral cleft lip nose surgery are, closure of the nasal floor and sill, lengthening of the columella, repositioning of the alar base, achieving nasal tip projection, repositioning of the lower lateral cartilages, and reorienting the nares from horizontal to oblique position. The multiplicity of procedures in the li...

  9. 应用分子靶点药物治疗犬肥大细胞瘤的研究进展%Progress on Application of Molecular Target Drugs in Treatments of Canine Mast Cell Tumors

    Institute of Scientific and Technical Information of China (English)

    李格宾; 杨紫嫣; 林珈好; 夏兆飞

    2016-01-01

    犬肥大细胞瘤因其恶性率和转移率都较高,并且常规化疗药物副作用较强,患犬生存期和生存质量显著下降,因此急需新型的药物进行治疗。近几年,治疗肿瘤的分子靶点药物凭借其疗效好、副作用低的特点,受到越来越广泛的关注,特别是在治疗犬肥大细胞瘤的应用中效果显著。论文重点介绍了欧美小动物临床最常用的伊马替尼、托赛拉尼、马赛替尼这3种以异常 KIT 为靶点的药物及其药物作用机理及药效,最后介绍了由 c-kit 基因二次突变所导致的耐药问题及其预防措施,期望能对我国小动物临床医师和科研工作者有所启发。%Mast cell tumors (MCT)have the high metastatic and mortality rate.Moreover,the convention-al chemotherapy drugs have many unpleasant side effects.As such,dogs with anaplastic MCT remain a frustrating undertaking of survival time and quality of life.Therefore,it is necessary to have better under-standing of novel,effective drugs for control of MCT.With the dramatically development of molecule biol-ogy in oncology field,molecular target drugs have been aroused general concern because of their great effect and low side-effect.Especially,molecular target drugs have attained remarkably effect of canine MCT treatment.In the present paper,we emphasized the mechanism and effect of three drugs (Imatinib, Toceranib and Masitinib)which are the most commonly used in America and Europe and targeted to the c-kit gene.At last we showed the drug resistance and preventive measure caused by second mutation of c-kit gene.We hope these could provide references to scientific researchers and small animal clinical practitioners in China.

  10. Condrossarcoma nasal: relato de caso

    Directory of Open Access Journals (Sweden)

    Pinna Fábio de Rezende

    2003-01-01

    Full Text Available O condrossarcoma é uma neoplasia maligna proveniente de tecido cartilaginoso, cuja incidência em região de cabeça e pescoço é rara. É mais freqüente em pacientes do sexo masculino, entre a terceira e quarta décadas, e na face localiza-se no seio e osso maxilar, sendo raro no septo nasal. Esse relato descreve o caso de uma paciente do sexo feminino, de 13 anos de idade, que apresentava queixa de deformidade facial em região malar direita acompanhada de dores esporádicas. Ao exame físico apresentava um abaulamento de aproximadamente 3 cm de diâmetro em região malar esquerda, não sendo notada nenhuma alteração à rinoscopia anterior. Foram realizadas tomografia computadorizada (TC de seios paranasais, ressonância magnética de face e biópsia da lesão para estudo anatomopatológico, que inicialmente sugeria o diagnóstico de condroma. Após a exérese da massa, a paciente evoluiu com recidiva da lesão em apenas 5 meses. Diante deste fato surpreendente, foi requisitada a revisão da lâmina que evidenciou Condrossarcoma tipo I. Nova cirurgia foi realizada, visando a remoção do tumor, com tratamento radioterápico complementar. Atualmente, a paciente se encontra em acompanhamento ambulatorial, sem queixas álgicas e sem sinas de recidiva. Os condrossarcomas são tumores malignos de crescimento lento, mas localmente agressivos, tendo grande propensão a recidivas. A conduta é preferencialmente cirúrgica, uma vez que são pouco radiossensíveis e a quimioterapia é meramente paliativa. O objetivo deste estudo é apresentar um caso de condrossarcoma em seio maxilar, etmóide, esfenóide e septo, discutindo o quadro clínico, diagnóstico, fatores prognósticos e conduta.

  11. A entomoftorose nasal

    Directory of Open Access Journals (Sweden)

    Zilton A. Andrade

    1972-10-01

    Full Text Available São apresentados os dados clínico-patológicos de dois casos de entomoftorose nasal, nova doença humana causada por um ficomiceto - Entomophthora coronata. Os pacientes, uma menina e um homem, com 8 e 44 anos de idade respectivamente, apresentaram doença localizada, com nódulos no nariz e região paranasal, edema e deformação da face. O parasito foi isolado do primeiro caso, mas todas as tentativas para isolá-lo no segundo caso resultaram negativas. Histologicamente, havia reação granulomatosa, fibrose e edema, em torno de hifas não septadas, as quais exibiam envólucro eosinófilo amorfo em torno. Foram demonstrados anticorpos circulantes contra, as hifas do E. coronata no soro de um dos pacientes. O material eosinófilo em torno das hifas continha fibrina e material auto-fluorescente sob luz ultra-violeta, provavelmente lipofuscina, mas não foram demonstrados anticorpos ou antígenos nesta área. A apresentação destes casos, os primeiros a serem descritos no Brasil, é acompanhado, de uma revisão geral do assunto, pois tal poderá vir a ser de interesse para aqueles que estudam os problemas da patologia tropical em nosso meio.

  12. Association between nasal shedding and fever that influenza A (H3N2 induces in dogs

    Directory of Open Access Journals (Sweden)

    Oh Jinsik

    2011-01-01

    Full Text Available Abstract Background Avian origin canine influenza virus was reported in Korea. The dog to dog contact transmission of the avian origin canine influenza virus (CIV H3N2 and CIV H3N8 was shown by experimental contact transmission. This study was focused on viral excretion and fever in order to elucidate the epidemiological associations which might be helpful to control the disease transmissions in CIV outbreak in dogs. Methods An influenza seronegative 10-week-old Beagle dog was experimentally inoculated with the canine influenza virus A/canine/01/2007, subtype H3N2. Eight hours after inoculation, the infected dog was cohoused with seven uninfected Beagle dogs. Clinical signs including fever were recorded for 14 days post inoculation. Results The infected dog and four of seven contact dogs in the study showed clinical signs (sneezing, nasal discharge and coughing during the study. Viral shedding occurred in all of the animals tested and began on 1 to 6 DPI in dogs with clinical signs. Elevated body temperatures above 39.5°C (geometric mean temperature of 39.86°C±0.49 were observed in all symptomatic dogs. The mean viral titer during fever was 2.99 log EID50/ml, which was significantly higher than the viral titer detected in the non fever. Conclusions The data show that contact dogs with a canine influenza infected dog shed different levels of virus in their nasal excretions and demonstrate that clinical signs, including fever, significantly correlate with the viral shedding.

  13. TEFLON NASAL SPLINTS IN NASAL SURGERIES: ADVANTAGES OVER CONVENTIONAL NASAL PACKING

    OpenAIRE

    Sudhir M Naik; Ravishankar, B.; T Shashikumar; T Deekshith; C Sherry; N Pooja; P.Sathya

    2014-01-01

    Background &Objectives: Nasal splints have long been used to prevent post operative nasal adhesions in septal surgery. But its efficacy in reducing adhesions and residual deviations are still controversial. Teflon is an inert material used as septal splints with sieves are used in our study as splints. Materials and methods: This is a comparative case series study done in 214 cases of septoplasties. 116 postoperative cases were packed with framycetin packs only and the other 98 cases ...

  14. Olfactory ensheathing cell tumor

    Directory of Open Access Journals (Sweden)

    Ippili Kaushal

    2009-01-01

    Full Text Available Olfactory ensheathing cells (OECs are found in the olfactory bulb and olfactory nasal mucosa. They resemble Schwann cells on light and electron microscopy, however, immunohistochemical staining can distinguish between the two. There are less than 30 cases of olfactory groove schwannomas reported in the literature while there is only one reported case of OEC tumor. We report an OEC tumor in a 42-year-old male and discuss the pathology and origin of this rare tumor.

  15. Epithelial myoepithelial carcinoma in nasal cavity with bony destruction: A case report

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Ho Jin; Lee, Byung Hoon; Hwang, Yoon Joon; Kim, Su Young [Dept. of Radiology, Ilsan Paik Hospital, Inje University School of Medicine, Goyang , (Korea, Republic of)

    2013-10-15

    Epithelial-myoepithelial carcinoma (EMC) is a rare tumor that commonly involves the salivary glands. EMC arising from the nasal cavity is one of the most unusual cases. We describe a case of a 48-year-old patient who is presented with bilateral nasal obstruction for several months. Multidetector computed tomography reveals expansile, well-defined, heterogeneous enhancing soft tissue masses filling the nasal cavity with bony destruction of hard palate and maxillary alveolar ridge. The carcinoma was histologically characterized by a mixture of trabecular structure with myoepithelial cells and ductal cells, which are confirmed by electron microscopy and immunohistochemistry.

  16. Image diagnosis of nasal bone fracture

    International Nuclear Information System (INIS)

    Twenty cases of nasal bone fractures were evaluated as to the types of fractures based upon HRCT findings. Conventional X-Ray films for nasal bones were analyzed and compared with HRCT findings. Nasal bone fractures were classified into lateral and frontal fractures. HRCT images were evaluated in three planes including upper, middle and lower portions of the nasal bone. Fractures favored males of teens. Lateral fracture gave rise to the fractures of the nasal bone opposite to the external force, loosening of the ipsilateral nasomaxillary sutures and fractures of the frontal process of the maxilla. Conventional X-Ray films were reevaluated after HRCT evaluation and indications of nasal bone fractures were determined. In addition to the discontinuity of the nasal dorsum, fracture lines parallel to and beneath the nasal dorsum and indistinct fracture lines along the nasomaxillary sutures are the indication of nasal bone fractures by conventional X-Ray films. (author)

  17. TEFLON NASAL SPLINTS IN NASAL SURGERIES: ADVANTAGES OVER CONVENTIONAL NASAL PACKING

    Directory of Open Access Journals (Sweden)

    Sudhir M Naik

    2014-10-01

    Full Text Available Background &Objectives: Nasal splints have long been used to prevent post operative nasal adhesions in septal surgery. But its efficacy in reducing adhesions and residual deviations are still controversial. Teflon is an inert material used as septal splints with sieves are used in our study as splints. Materials and methods: This is a comparative case series study done in 214 cases of septoplasties. 116 postoperative cases were packed with framycetin packs only and the other 98 cases by framycetin packs and teflon septal splints. The groups were compared for postoperative nasal adhesions, residual deviation , pain , septal perforations and subjective patient satisfaction. Result: The rates of adhesion and pain on VAS scale showed no significant difference in the splinted and non splinted group. Pain was more with the splints even after pack removal. Residual deviation was reduced with these teflon nasal septal splints. Conclusion: Nasal septal splint does not significantly reduce the adhesions after septoplasty but are effective in reducing the residual deviations. The pain and discomfort are more with the splints. Post operative adhesions are better reduced by nasal irrigation and manual cleaning of the cavities by antibiotic ointments.

  18. Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

    International Nuclear Information System (INIS)

    Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology

  19. Vaccines for canine leishmaniasis

    Directory of Open Access Journals (Sweden)

    Clarisa B. Palatnik-De-Sousa

    2012-04-01

    Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans

  20. Bilateral cleft lip nasal deformity

    Directory of Open Access Journals (Sweden)

    Singh Arun

    2009-01-01

    Full Text Available Bilateral cleft lip nose deformity is a multi-factorial and complex deformity which tends to aggravate with growth of the child, if not attended surgically. The goals of primary bilateral cleft lip nose surgery are, closure of the nasal floor and sill, lengthening of the columella, repositioning of the alar base, achieving nasal tip projection, repositioning of the lower lateral cartilages, and reorienting the nares from horizontal to oblique position. The multiplicity of procedures in the literature for correction of this deformity alludes to the fact that no single procedure is entirely effective. The timing for surgical intervention and its extent varies considerably. Early surgery on cartilage may adversely affect growth and development; at the same time, allowing the cartilage to grow in an abnormal position and contributing to aggravation of deformity. Some surgeons advocate correction of deformity at an early age. However, others like the cartilages to grow and mature before going in for surgery. With peer pressure also becoming an important consideration during the teens, the current trend is towards early intervention. There is no unanimity in the extent of nasal dissection to be done at the time of primary lip repair. While many perform limited nasal dissection for the fear of growth retardation, others opt for full cartilage correction at the time of primary surgery itself. The value of naso-alveolar moulding (NAM too is not universally accepted and has now more opponents than proponents. Also most centres in the developing world have neither the personnel nor the facilities for the same. The secondary cleft nasal deformity is variable and is affected by the extent of the original abnormality, any prior surgeries performed and alteration due to nasal growth. This article reviews the currently popular methods for correction of nasal deformity associated with bilateral cleft lip, it′s management both at the time of cleft lip repair

  1. CAPILLARY HEMANGIOMA OF THE NASAL SEPTUM IN CHILDREN

    OpenAIRE

    Salman, Nergis; Baysal, Nakiye; Adabag, Aysegul; Yildiz, Ugur; Akin, Istemihan

    2012-01-01

    Lobular capillary hemangioma (LCH) is a benign vascular tumor, also known as, pyogenic granuloma. LCH appears on the skin, the oral mucosa, and, rarely, on the nasal mucosa. Trauma, hormones, viral oncogenes, microscopic arteriovenous malformations, and angiogenic growth factors have been implicated in the etiology of LCH lesions. LCH most commonly presents in the third decade of life but may present in persons of any age. It is considerably rare in children; only a few cases have been report...

  2. Primary Burkitt's Lymphoma in the Nasal Cavity and Paranasal Sinuses

    OpenAIRE

    Lee, Dong Hwan; Yu, Myeong Sang; Lee, Bong-Jae

    2013-01-01

    Burkitt's lymphoma is a highly aggressive small B-cell lymphoma. The treatment of choice is complex chemotherapy. As a rare tumor in the head and neck area, Burkitt's lymphoma usually involves cervical lymph nodes, and only fewer than 25% of cases involves extranodal regions. Involvement of the paranasal sinuses has been reported in only 14 cases in the past century. We describe here two patients with rare, sporadic, American type Burkitt's lymphoma involving the nasal cavity and paranasal si...

  3. Oncolytic virotherapy in veterinary medicine: current status and future prospects for canine patients

    Directory of Open Access Journals (Sweden)

    Patil Sandeep S

    2012-01-01

    Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.

  4. Intra And Extra Nasal Laser Surgery

    Science.gov (United States)

    Selking, Stuart G.

    1988-06-01

    The author describes his experience with 400 intranasal laser surgical procedures done with the carbon dioxide laser and the surgical microscope. Procedures include excision and vaporization of polyps, turbinates, tumors, telangiectasia, synechia, nasal stenosis, intranasal cysts, papillomata, and septal spurs. The author describes a suction speculum and drape of his own design which provide smoke free access to the internal nose, and protection of the alar rim and the face from laser energy. Relief of obstruction is comparable to that obtained from the more traditional means of intranasal surgery. Intraoperative and early and delayed post operative bleeding is less with laser surgery than with any other means. Avoidance of technical problems is emphasized in this manuscript, since intranasal laser surgery is in some respects difficult to perform. Included are practical suggestions about patient positioning, use of protective devices, and patient selection.

  5. Evaluation of Cone Beam Computed Tomography in Diagnosis and Treatment Plan of Impacted Maxillary Canines Evaluation of Cone Beam Computed Tomography in Diagnosis and Treatment Plan of Impacted Maxillary Canines

    Directory of Open Access Journals (Sweden)

    Seyed Hossein Hoseini Zarch

    2013-06-01

    Full Text Available Introduction: Maxillary canines have important roles in facial appearance, development of arch, and functional occlusion. Radiographs are important in evaluating the location and nature of these anomalies. The purpose of this study was to evaluate two types of 2D and 3D imaging technique in diagnosis and treatment of maxillary impacted canines. Methods: Thirty eight patients (50 impacted canines were enrolled. An oral radiologist assessed all of patients’ panoramic radiographs and then cone beam computed tomography (CBCT to determine the presence of adjacent teeth root resorption, root dilacerations before dental extraction, dental rotation, and buccolingual localization ofimpacted canine crown and root contact with sinus and nasal cavity.Then using the patient’s radiographs the treatment plan of each impacted canine was determined by an orthodontist. Results: Differences between panoramic radiography and CBCT in diagnosis of root resorption and dental rotation were significant. There was an agreement between panoramic radiographs and CBCT in localization of impacted teeth crown. Only the treatment plans of 20% of impacted canines were different between panoramic radiographs and CBCT and treatment plan of 80% of impacted teeth was similar. Conclusion: These results showed that 2D and 3D images of impacted maxillary canines can produce different diagnoses and treatment plans.  

  6. Nasal trauma: Primary reconstruction with open rhinoplasty.

    Science.gov (United States)

    Konstantinidis, I; Malliari, H; Metaxas, S

    2011-01-01

    Due to the prominent location of the nose, the most common facial traumas are nasal injuries. Although nasal traumas usually require staged intervention at a later period of time, in selected cases, primary reconstruction can be effective. A 20-year-old man who was referred from the emergency department with nasal trauma is presented. He reported a fall after feeling unsteady, which caused a direct nasal injury. Clinical examination revealed septal fracture with obstruction of the left nasal cavity and deformity of the nasal pyramid (inverted V deformity). The patient also had a complete dissection of the columella skin. Epistaxis was self-limited, and an open rhinoplasty procedure was decided because the trauma occurred 1 h before admission and there was no significant edema. Surgical intervention included septal reconstruction combined with restoration of the nasal pyramid and columella. One month later, the patient had patent nasal airways, and he was satisfied with the aesthetic result. PMID:22942663

  7. The canine vomeronasal organ.

    OpenAIRE

    Adams, D. R.; Wiekamp, M D

    1984-01-01

    The vomeronasal organ was studied in mature dogs with the optical, transmission electron, and scanning electron microscopes. The canine vomeronasal complex is structurally well developed. Large blood vessels are present deep to both the lateral, 'non-receptor' and medial, 'receptor' epithelia. In addition to the unmyelinated vomeronasal nerves in the lamina propria deep to the 'receptor' epithelium, numerous nerves containing both myelinated and unmyelinated fibres are present deep to the 'no...

  8. High Flow Nasal Cannulae in preterm infants

    OpenAIRE

    F. Ciuffini; Colnaghi, M; A. Lavizzari; D. Mercadante; Musumeci, S; Mosca, F

    2013-01-01

    Despite of improved survival of premature infants, the incidence of long term pulmonary complications, mostly associated with ventilation-induced lung injury, remains high. Non invasive ventilation (NIV) is able to reduce the adverse effects of mechanical ventilation. Although nasal continuous positive airway pressure (NCPAP) is an effective mode of NIV, traumatic nasal complications and intolerance of the nasal interface are common. Recently high flow nasal cannula (HFNC) is emerging as an e...

  9. Nasal pulse oximetry overestimates oxygen saturation

    DEFF Research Database (Denmark)

    Rosenberg, J; Pedersen, M H

    1990-01-01

    Ten surgical patients were monitored with nasal and finger pulse oximetry (Nellcor N-200) for five study periods with alternating mouth and nasal breathing and switching of cables and sensors. Nasal pulse oximetry was found to overestimate arterial oxygen saturation by 4.7 (SD 1.4%) (bias...

  10. Does Post Septoplasty Nasal Packing Reduce Complications?

    Directory of Open Access Journals (Sweden)

    Bijan Naghibzadeh

    2011-01-01

    Full Text Available The main issues in nasal surgery are to stabilize the nose in the good position after surgery and preserve the cartilages and bones in the favorable situation and reduce the risk of deviation recurrence. Also it is necessary to avoid the synechia formation, nasal valve narrowing, hematoma and bleeding. Due to the above mentioned problems and in order to solve and minimize them nasal packing, nasal splint and nasal mold have been advised. Patients for whom the nasal packing used may faced to some problems like naso-pulmonary reflex, intractable pain, sleep disorder, post operation infection and very dangerous complication like toxic shock syndrome. We have two groups of patients and three surgeons (one of the surgeons used post operative nasal packing in his patients and the two others surgeons did not.Complications and morbidities were compared in these two groups. Comparing the two groups showed that the rate of complication and morbidities between these two groups were same and the differences were not valuable, except the pain and discomfort post operatively and at the time of its removal. Nasal packing has several risks for the patients while its effects are not studied. Septoplasty can be safely performed without postoperative nasal packing. Nasal packing had no main findings that compensated its usage. Septal suture is one of the procedures that can be used as alternative method to nasal packing. Therefore the nasal packing after septoplasty should be reserved for the patients with increased risk of bleeding.

  11. Diagnostic strategies in nasal congestion

    Directory of Open Access Journals (Sweden)

    John Krouse

    2010-02-01

    Full Text Available John Krouse1, Valerie Lund2, Wytske Fokkens3, Eli O Meltzer41Temple University School of Medicine, Philadelphia, PA, USA; 2Ear Institute, University College London, UK; 3Department of Otorhinolaryngology, Amsterdam Medical Centre, Netherlands; 4Allergy and Asthma Medical Group and Research Center, San Diego, CA and Department of Pediatrics, University of California, San Diego, USAAbstract: Nasal congestion is a major symptom of upper respiratory tract disorders, and its characterization an important part of the diagnosis of these illnesses. Patient history and assessment of nasal symptoms are essential components of diagnosis, providing an initial evaluation that may be adequate to rule out serious conditions. However, current congestion medications are not always fully effective. Thus, if symptoms do not respond adequately to therapy, or symptoms suggestive of more serious conditions are present, specialized assessments may be needed. Various techniques are available for diagnosing patients, including those used chiefly by primary care clinicians and those requiring the expertise of otolaryngologists, allergists, and other specialists. Endoscopy remains a mainstay for evaluating nasal blockage and its causes, while modalities such as peak nasal inspiratory flow and acoustic rhinometry are evolving to provide easy-to-use, noninvasive procedures that are sensitive enough to measure small but clinically important abnormalities and therapeutic changes. Several imaging modalities are available to the specialist for severe or unusual cases, as are specialized diagnostic procedures that measure adjunctive features of congestion, such as impaired mucociliary function.Keywords: allergic rhinitis, congestion, diagnosis, obstruction, rhinosinusitis

  12. Chronic Rhinosinusitis with Nasal Polyps.

    Science.gov (United States)

    Stevens, Whitney W; Schleimer, Robert P; Kern, Robert C

    2016-01-01

    Chronic rhinosinusitis with nasal polyps (CRSwNP) is an important clinical entity diagnosed by the presence of both subjective and objective evidence of chronic sinonasal inflammation. Symptoms include anterior or posterior rhinorrhea, nasal congestion, hyposmia, and/or facial pressure or pain that last for a duration of more than 12 weeks. Nasal polyps are inflammatory lesions that project into the nasal airway, are typically bilateral, and originate from the ethmoid sinus. Males are more likely to be affected than females, but no specific genetic or environmental factors have been strongly linked to the development of this disorder to date. CRSwNP is frequently associated with asthma and allergic rhinitis, but the cellular and molecular mechanisms that contribute to the clinical symptoms are not fully understood. Defects in the sinonasal epithelial cell barrier, increased exposure to pathogenic and colonized bacteria, and dysregulation of the host immune system are all thought to play prominent roles in disease pathogenesis. Additional studies are needed to further explore the clinical and pathophysiological features of CRSwNP so that biomarkers can be identified and novel advances can be made to improve the treatment and management of this disease. PMID:27393770

  13. Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman

    2011-01-01

    Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.

  14. Idiopathic calcinosis cutis of nasal dorsum

    Directory of Open Access Journals (Sweden)

    Shrinath D.P Kamath

    2012-01-01

    Full Text Available A 23-year-old lady presented with a slowly progressing firm mass on the nasal dorsum since 8 months. Her biochemical, haematological and collagen vascular disease screening tests were normal. Radiographs of the nasal bones showed a subcutaneous calcifying lesion with no evidence of nasal bone erosion. A diagnosis of idiopathic calcinosis cutis (ICC was made. The mass was excised and soft tissue defect was augmented with silicone prosthesis. The histopathology with the haematoxylin and eosin staining and von Kossa stain confirmed the diagnosis of calcinosis cutis. This is an unusual presentation of ICC involving the nasal dorsum requiring surgery and nasal dorsal augmentation with silicone prosthesis.

  15. Nasal Septum Perforation due to Methamphetamine abuse

    Directory of Open Access Journals (Sweden)

    Mehdi Bakhshaee

    2012-07-01

    Full Text Available Introduction: Spontaneous Perforation of the nasal septum is an uncommon condition. Nasal inhalation of substances such as cocaine has long been linked to this Perforation. Case Report: This report describes the case of a 46-year-old woman who was addicted to methamphetamine and who presented with perforation of the nasal septum.This is the first reported case of nasal septal necrosis linked to nasal inhalation of methamphetamine. Conclusions: Patient history and assurance regardingillegal drug consumption and abuse is a key point for fast and accurate diagnosis. The pathophysiology of drug-induced sinunasal disease and a review of the literature are also presented.

  16. [Nasal respiratory stenosis and maxillary hypoplasia. Changes after orthodontic treatment with rapid palatal expansion].

    Science.gov (United States)

    Piccini, A; Giorgetti, R; Fiorelli, G

    1989-01-01

    The relationship between hypoplasia of the upper maxillary bone and nasal respiratory insufficiency in a group of twenty infants with malocclusion being treated by rapid maxillary expansion (RME) were studied. Prior to treatment all patients presented endognatia with discrepancies of from -4 to -7 mm in the transverse basal skeleton. These were often associated with adenoid hypertrophy (70% of the cases), increased total nasal resistance (70%), oral respiration (80%) and middle ear diseases (30%). RME led to resolution of occlusion alterations in all cases and often also brought about a regression in adenoid hypertrophy (57% of the cases), normalization of the total nasal resistance (70%) and respiration (80%). These effects were achieved alone without association with any other form of medical or surgical E.N.T. treatment. The functional results confirmed by the radiological and clinical findings indicate an increase in the diameters of the nasal fossa and in the distance between the canines, between premolars and between molars as well as reduction in adenoid vegetation and in the diffuse hypertrophic tissues lining the naso-pharyngeal space. Nonetheless, hypoplasia of the upper maxillary bone and nasal respiratory insufficiency remain strictly linked and are bound to a variable, and at times uncertain, cause-effect relationship. Is nasal stenosis the moving force of maxillary-mandibular dysmorphism and gnatological dysfunction or does it result from an overall genetic conditioning of facial skeleton development? During their vast experience in adenoid and metadenoid pathologies in infancy the authors have, at times, observed significant maxillo-facial dysmorphisms. They have likewise found that "facies adenoidea" were not always associated with hypertrophy of the pharyngeal tonsil.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Effect of nasal decongestion on voice spectrum of a nasal consonant-vowel.

    Science.gov (United States)

    Lee, Guo-She; Yang, Cheryl C H; Wang, Ching-Ping; Kuo, Terry B J

    2005-03-01

    The nasal cavity and its related structures make significant contributions to human phonation, especially the resonance of voice spectra. The voice spectra of the nasal consonant-vowel (CV), [md:], in the subjects with nasal obstruction were obtained and were compared with the spectra of the same CV vocalized by the same subjects after topical nasal decongestion treatment with 1:1000 epinephrine solution. Results revealed that the intensity damping was more marked in the high-frequency area (>1600 Hz) after the nasal decongestion. Moreover, the intensities of the spectral valleys damped more than the spectral peaks, especially the spectral valley of 1000-2700 Hz. Therefore, a more complex spectral pattern was formed by the resultant uneven damping effect after nasal decongestion. The nasal cavity plays an important role in the formation of spectral peaks and valleys, and such engraved voice spectra may also characterize nasal voices like the nasal CV [md:] demonstrated in our study. PMID:15766851

  18. Primary Nasal Reconstruction in Self-Inflicted Nasal Injury.

    Science.gov (United States)

    Kapadia, Abizer; John, Jerry R; Gaba, Sunil; Sharma, Ramesh Kumar

    2015-10-01

    Self-inflicted injury of the nose is extremely rare. It may be associated with severe psychopathology and suicidal ideation. The authors report a case of a 24-year-old man, who presented with soft-tissue loss over both the alae of his nose. He had cut off the alar rims with an ordinary razor blade. He was overtly concerned about his nose being excessively broad and fat. A diagnosis of body dysmorphic disorder with nonsuicidal self-injury was made. Patient was observed during 72 hours in hospital with psychiatric support and local dressings. The authors undertook primary nasal reconstruction with nasolabial flaps on both sides for coverage. In conclusion, self-inflicted nasal injury mandates a judicious balancing of psychiatric support and surgical reconstruction. This can prevent untoward sequelae including further self-harm and suicide. PMID:26468831

  19. Preclinical evaluation of oncolytic vaccinia virus for therapy of canine soft tissue sarcoma.

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    Full Text Available Virotherapy using oncolytic vaccinia virus (VACV strains is one promising new strategy for canine cancer therapy. In this study we describe the establishment of an in vivo model of canine soft tissue sarcoma (CSTS using the new isolated cell line STSA-1 and the analysis of the virus-mediated oncolytic and immunological effects of two different Lister VACV LIVP1.1.1 and GLV-1h68 strains against CSTS. Cell culture data demonstrated that both tested VACV strains efficiently infected and destroyed cells of the canine soft tissue sarcoma line STSA-1. In addition, in our new canine sarcoma tumor xenograft mouse model, systemic administration of LIVP1.1.1 or GLV-1h68 viruses led to significant inhibition of tumor growth compared to control mice. Furthermore, LIVP1.1.1 mediated therapy resulted in almost complete tumor regression and resulted in long-term survival of sarcoma-bearing mice. The replication of the tested VACV strains in tumor tissues led to strong oncolytic effects accompanied by an intense intratumoral infiltration of host immune cells, mainly neutrophils. These findings suggest that the direct viral oncolysis of tumor cells and the virus-dependent activation of tumor-associated host immune cells could be crucial parts of anti-tumor mechanism in STSA-1 xenografts. In summary, the data showed that both tested vaccinia virus strains and especially LIVP1.1.1 have great potential for effective treatment of CSTS.

  20. Isolation and characterization of bacteria from canine respiratory diseases in and around Hyderabad city, Andhra Pradesh, India

    OpenAIRE

    S. Ayodhya; D. S. Tirumala Rao; Y. Narsimha Reddy; N. Syam Sundar; V Girish Kumar

    2013-01-01

    Aim: To identify the organisms causing respiratory diseases in dogs that belongs to areas in and around Hyderabad city.Materials and Methods: Nasal samples were collected using sterile swabs from the canine clinical cases that were presented with the history of respiratory diseases at the University administered Veterinary Hospital, Bhoiguda, Secunderabad and Campus Veterinary Hospital, College of Veterinary Science, Rajendranagar, Hyderabad over a period of 26 months i.e., from October 2008 ...

  1. Contrastive and contextual vowel nasalization in Ottawa

    Science.gov (United States)

    Klopfenstein, Marie

    2005-09-01

    Ottawa is a Central Algonquian language that possesses the recent innovation of contrastive vowel nasalization. Most phonetic studies done to date on contrastive vowel nasalization have investigated Indo-European languages; therefore, a study of Ottawa could prove to be a valuable addition to the literature. To this end, a percentage of nasalization (nasal airflow/oral + nasal airflow) was measured during target vowels produced by native Ottawa speakers using a Nasometer 6200-3. Nasalized vowels in the target word set were either contrastively or contextually nasalized: candidates for contextual nasalization were either regressive or perserverative in word-initial and word-final syllables. Subjects were asked to read words containing target vowels in a carrier sentence. Mean, minimum, and maximum nasalance were obtained for each target vowel across its full duration. Target vowels were compared across context (regressive or perseverative and word-initial or word-final). In addition, contexts were compared to determine whether a significant difference existed between contrastive and contextual nasalization. Results for Ottawa will be compared with results for vowels in similar contexts in other languages including Hindi, Breton, Bengali, and French.

  2. Nasal airway responses to nasal continuous positive airway pressure breathing: An in-vivo pilot study.

    Science.gov (United States)

    White, David E; Bartley, Jim; Shakeel, Muhammad; Nates, Roy J; Hankin, Robin K S

    2016-06-14

    The nasal cycle, through variation in nasal airflow partitioning, allows the upper airway to accommodate the contrasting demands of air conditioning and removal of entrapped air contaminants. The purpose of this study was to investigate the influence of nasal continuous positive airway pressure (nCPAP) breathing has on both nasal airflow partitioning and nasal geometry. Using a custom-made nasal mask, twenty healthy participants had the airflow in each naris measured during normal nasal breathing followed by nCPAP breathing. Eight participants also underwent magnetic resonance imaging (MRI) of the nasal region during spontaneous nasal breathing, and then nCPAP breathing over a range of air pressures. During nCPAP breathing, a simultaneous reduction in airflow through the patent airway together with a corresponding increase in airway flow within the congested nasal airway were observed in sixteen of the twenty participants. Nasal airflow resistance is inversely proportional to airway cross-sectional area. MRI data analysis during nCPAP breathing confirmed airway cross-sectional area reduced along the patent airway while the congested airway experienced an increase in this parameter. During awake breathing, nCPAP disturbs the normal inter-nasal airflow partitioning. This could partially explain the adverse nasal drying symptoms frequently reported by many users of this therapy. PMID:27173595

  3. The Comparison Study of Retaining Laryngoscope Combined Nasal Endoscope Laryngoscope and Retaining Laryngoscope on Treating Laryngeal Benign Tumor%支撑喉镜联合喉内窥镜与支撑喉镜治疗喉部良性肿物的疗效对比研究

    Institute of Scientific and Technical Information of China (English)

    2013-01-01

      目的:探讨支撑喉镜联合喉内窥镜及支撑喉镜两者治疗喉部良性肿物的疗效。方法:选取本院2010年10月-2012年12月收治的喉部良性肿物患者160例,根据治疗方法不同,分为两组(对照组与试验组)。对照组70例采用支撑喉镜治疗;试验组90例采用支撑喉镜联合喉内窥镜治疗。结果:对照组治愈率57.1%(40/70),好转率25.7%(18/70),无效率17.1%(12/70),总有效率为82.9%;试验组治愈率76.7%(69/90),好转率17.8%(16/90),无效率5.6%(5/90),总有效率为94.4%。对照组与试验组的术后并发症发生率分别为22.9%与4.4%。结论:支撑喉镜联合喉内镜对喉部良性肿物治疗有效,具有微创、并发症少等优点,有较高临床价值。%Objective:To observe the efficacy of both retaining laryngoscope combined nasal endoscope laryngoscope and retaining laryngoscope treatment of benign tumor of the larynx.Method:Selected 160 cases of benign throat tumor patients in our hospital from October 2010 to December 2012, according to the different treatment methods,They were divided into two groups(control group and the experimental group),the control group were applied with retaining laryngoscope treatment(70 cases),the experimental group were applied with retaining laryngoscope combined nasal endoscope laryngoscope treatment(90 cases).Result:In the control group,the cure rate was 57.1%(40/70),the improvement rate was 25.7%(18/70), invalid for 17.1%(12/70),the total effective rate was 82.9%.In the experimental group,the cure rate was 76.7%(69/90),the improvement rate was 17.8%(16/90),invalid 5.6%(5/90),with a total effective rate was 94.4%.Postoperative complication of the control group and the experimental group was 22.9% and 4.4% respectively.Conclusion:The operation of retaining laryngoscope combined nasal endoscope laryngoscope has effective treatment for benign throat mass,with a minimally invasive

  4. Comparison of computed tomography with radiography as a noninvasive diagnostic technique for chronic nasal disease in dogs

    International Nuclear Information System (INIS)

    Computed tomography was evaluated as a noninvasive technique for the diagnosis of chronic nasal disease in dogs. Computed tomographic images, radiographs, and histopathologic findings were compared in 11 dogs with chronic nasal disease. Definitive diagnosis was made following traumatic nasal flush, exploratory surgery, or necropsy. The study included 8 dogs with intranasal tumors, 2 dogs with bacterial rhinitis (Pasteurella sp), and 1 dog with mycotic rhinitis (Aspergillus sp). Computed tomography was superior to radiography in defining the extent of the disease process and in differentiating infectious rhinitis from nasal neoplasms. It defined lesions in the palate, nasopharyngeal meatus, maxillary sinus, caudal ethmoturbinates, and periorbital tissues that were difficult to demonstrate by use of conventional radiography. Tumors appeared as space-occupying lesions that obliterated the turbinates, caused deviation of the nasal septum, and eroded bone. Rhinitis appeared as a cavitating lesion that spared the paranasal sinuses, thickened and distorted the turbinates, and widened the meatus. Although morphologically distinct on computed tomographic images, infectious rhinitis and nasal neoplasms could not be differentiated by attenuation measurements or degree of contrast enhancement. Computed tomography appeared to be a reliable, noninvasive technique for the diagnosis of chronic nasal disease in dogs, and a promising alternative to diagnostic techniques currently in use

  5. Nasal leech infestation causing persistent epistaxis

    OpenAIRE

    Sarathi, Kalra

    2011-01-01

    Foreign bodies in the nasal cavity are commonly encountered as a cause of epistaxis; however, nasal leech infestation as a cause of unilateral persistent epistaxis is very rare. Examination of nasal cavity revealed fleshy material in the left nostril, which was identified as leech. The leech was removed with the help of an artery forceps following irrigation of the left nostril with normal saline and adopting wait-and-watch policy. In developing countries, leech infestation as a cause of epis...

  6. Nasal-skin-fold transposition flap for upper lip reconstruction in a French bulldog.

    Science.gov (United States)

    Benlloch-Gonzalez, Manuel; Lafarge, Stéphanie; Bouvy, Bernard; Poncet, Cyrill

    2013-10-01

    Upper-lip reconstruction after mast-cell tumor-resection in a French bulldog was achieved by using a transposition flap from the nasal-skin-fold and an oral mucosal flap. The new technique is an alternative for reconstruction of extensive upper-lip defects in brachycephalic dogs and achieves satisfactory functional and cosmetic results.

  7. [Review: pathophysiology and methodology of nasal packing].

    Science.gov (United States)

    Beule, A G; Weber, R K; Kaftan, H; Hosemann, W

    2004-08-01

    Nasal packing is a frequent procedure to control spontaneous nasal bleeding or postoperative oozing following different types of nasal surgery. It strives for internal stabilization of the nasal framework and for optimizing wound healing by prevention of stenosis or synechia. A lot of different materials is used and there is no accepted standard concerning the type and application. A review on pathophysiology of the packed nose is given together with a survey on customary packing materials focussing on the specific merits, demerits and side-effects including economical aspects. PMID:15316896

  8. Nasal Myiasis in Hinduism and Contemporary Otorhinolaryngology.

    Science.gov (United States)

    Bosmia, Anand N; Zimmermann, Terence M; Griessenauer, Christoph J; Shane Tubbs, R; Rosenthal, Eben L

    2014-01-01

    Various case reports on nasal myiasis written during the 1990s and 2000s state that nasal myiasis, which is known as peenash among South Asian natives, is a form of divine punishment in Hindu mythology, but do not provide citations from Hindu scriptures that would suggest this interpretation. This paper aims to discuss the phenomenon of peenash in a historical context by examining medical literature written during the nineteenth and early twentieth centuries, to identify Hindu texts contributing to the belief of some Hindus that nasal myiasis is a form of divine punishment, and to provide an overview of contemporary treatment for and management of nasal myiasis. PMID:24385004

  9. Nasal and Oral Consonant Similarity in Speech Errors: Exploring Parallels with Nasal Consonant Harmony

    Science.gov (United States)

    Walker, Rachel

    2007-01-01

    Previous research has found that "similar" sounds interact in phonological nasal consonant harmony, wherein certain consonants become nasals when the word contains a nasal (e.g., Kikongo: /-kun-idi/ [right arrow] [-kun-ini] "planted"). Across languages, stops and approximants are chiefly affected, especially voiced consonants and ones that match…

  10. Apoptosis and Ki-67 as predictive factors for response to radiation therapy in feline nasal lymphomas.

    Science.gov (United States)

    Fu, Dah-Renn; Kato, Daiki; Endo, Yoshifumi; Kadosawa, Tsuyoshi

    2016-08-01

    Nasal lymphoma is the most common nasal tumor in cats and is generally a solitary and radiosensitive tumor. We retrospectively evaluated the response to radiation and survival time in relation to apoptosis and Ki-67 indices in feline nasal lymphomas treated with radiation therapy. The apoptotic and Ki-67 indices were evaluated with TUNEL and immunohistochemical staining in 30 biopsy tissues that were taken before any treatment. These two indices were compared, and differences between different treatment response groups were analyzed. The correlation between the median survival times (MST) and the indices was estimated using the Kaplan Meier method, and statistical differences between survival curves were analyzed using a log-rank method. With regard to apoptotic index, a statistical difference was observed between the samples taken from cats with complete response and stable disease (1.22% vs. 0.45%; P=0.045). The Ki-67 index in cats with both complete response and partial response was significantly higher than in cats with stable disease (44.4% and 39.6% vs. 16.3%; P0.9%) nasal lymphoma were not significantly prolonged MSTs (P=0.202), however, high Ki-67-positive (>40%) cats experienced a statistically significant relationship with longer survival time (P=0.015). Our results indicate that spontaneous apoptotic and Ki-67 indices are strong predictors for response to radiation therapy in feline nasal lymphomas. PMID:27086717

  11. Multi-drug resistance in a canine lymphoid cell line due to increased P-glycoprotein expression, a potential model for drug-resistant canine lymphoma

    NARCIS (Netherlands)

    Zandvliet, M; Teske, E; Schrickx, J A

    2014-01-01

    Canine lymphoma is routinely treated with a doxorubicin-based multidrug chemotherapy protocol, and although treatment is initially successful, tumor recurrence is common and associated with therapy resistance. Active efflux of chemotherapeutic agents by transporter proteins of the ATP-Binding Casset

  12. 9 CFR 113.305 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine.

    Science.gov (United States)

    2010-01-01

    ... STANDARD REQUIREMENTS Live Virus Vaccines § 113.305 Canine Hepatitis and Canine Adenovirus Type 2 Vaccine. Canine Hepatitis Vaccine and Canine Adenovirus Type 2 Vaccine shall be prepared from virus-bearing cell... hepatitis, the test is inconclusive and may be repeated. (B) If at least 19 of the 20 vaccinates do...

  13. Changes in nasal resistance and nasal geometry using pressure and acoustic rhinometry in a feline model of nasal congestion

    DEFF Research Database (Denmark)

    McLeod, R.L.; Mingo, G.G.; Herczku, C.;

    1999-01-01

    This is the first report describing the use and pharmacological characterization of nasal patency by both pressure rhinometry and acoustic rhinometry (AcR) in an experimental cat model of nasal congestion. In pressure rhinometry studies, aerosolized compound 48/80 (0.1-3.0%), a mast cell liberato...

  14. Clinical analysis of sino-nasal lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Kojya, Shizuo; Itokazu, Tetsuo; Shinhama, Akihiko; Matsumura, Jun; Maeda, Hiroyuki; Inamine, Tomohiro; Toita, Takafumi; Ogawa, Kazuhiko; Noda, Yutaka [Ryukyus Univ., Nishihara, Okinawa (Japan). Faculty of Medicine

    2000-01-01

    Forty cases with sino-nasal malignant lymphoma who were treated at the Department of Otorhinolaryngology, University of the Ryukyus, Faculty of Medicine from 1974 to 1996 are herein reviewed. The staging of these cases was made based on the Ann Arbor classification system and pathologically according to the Working Formulation (WF). In addition, the lesions showed polymorphism regarding the size of the tumor cells which could invade in an angiocentric pattern with various types of inflammatory cells and necrosis of the surrounding tissue was classified as polymorphic reticulosis (PR). Regarding the immunological phenotype, immunostaining was performed with MB-1, L-26 for B cell type and MT-1, UCHL-1 for T cell type. The survival rate was calculated based on the Kaplan Meier method. The results were as follows; The immunophenotypes were T cell type in 63%, including 8 cases of NK cell type and B cell in 29%. Seventy-five percent of all cases were classified as an intermediate stage based on the Working Formulation. The 5-year survival rates for all cases, consisting of T cell type cases, B cell type cases and PR type cases were 49%, 42%, 50% and 54%, respectively. Chemotherapy, including CHOP demonstrated good therapeutic results, but the cases with lymphoma in the high grade group could not be controlled by ordinary therapeutic regimens. A histology-specific treatment regimen for high grade lymphoma is thus needed. (author)

  15. Neurilemmoma of lateral nasal wall

    Directory of Open Access Journals (Sweden)

    Jyotsna Naresh Bharti

    2015-06-01

    Full Text Available Neurilemmoma is a benign tumour of nerve sheath origin that can arise from myelinated nerve. The Head and neck is the most frequent site involved and other sites are scalp, face, oral cavity, pharynx, larynx, trachea and ear. Neurilemmoma usually occur as solitary lesions and in association with NF type 2. Malignant transformation is very rare. We report a case of 18 year old male presented with complaint of nasal obstruction and swelling in right side of nose. We discuss the clinical presentation, histologic features, and therapeutic options for such a rare benign lesion.

  16. Numbered nasal discs for waterfowl

    Science.gov (United States)

    Bartonek, J.C.; Dane, C.W.

    1964-01-01

    Numbered nasal discs were successfully used in studies requiring large numbers of individually marked waterfowl. The procedure for constructing these discs is outlined. Blue-winged teal (Anas discors) with 5/8-inch discs, and canvasback (Aythya valisineria) and redhead (A. americana) with 3/4-inch discs can be individually identified up to 50 and 80 yards, respectively, with a gunstock-mounted, 20-power spotting scope. The particular value of these markers is their durability, the number of combinations possible, and the apparent absence of behavioral or mortality influence among such species as the blue-winged teal.

  17. Characterization and Comparison of Cancer Stem Cells in Human and Canine Glioma Cell Lines

    Directory of Open Access Journals (Sweden)

    Thomas Clements

    2012-01-01

    Full Text Available Gliomas are among the most common and malignantforms of primary brain tumors that occur naturally inhumans. They represent about 33% of brain tumorsand 80% of malignant brain tumors. Gliomas alsospontaneously arise in specific breeds in the canine family.Canine gliomas are histologically similar to human gliomaand have similar presentation and response to treatmentin the clinic. A comparison of canine and human gliomascould prove to be invaluable, because the acceptedrodent model has limitations when testing therapies andidentifying targets. Our goal is to obtain global proteinexpression and metabolic profiles of different classificationand grades of human and canine glioma, in order toidentify and compare the tumor survival strategies in bothsystems. Toward this end, we harvested and cultured cellsfrom a naturally occurring grade-3 oligodendrogliomatumor that was isolated from a canine patient at the PurdueUniversity Veterinary Teaching Hospital. Similar to cellsfrom human glioma, these cells formed neurosphereswhen cultured in serum free media in the presence of FGFand EGF. The cells were also sensitive to plating densityand oxygen concentrations.This work was supported by the National Institutes ofHealth, National Cancer Institute R25CA128770 CancerPrevention Internship Program administered by theOncological Sciences Center and the Discovery LearningResearch Center at Purdue University. This work wasalso supported by Showalter Research Foundation and aCollege of Technology Seed Grant.

  18. NASAL INVERTED PAPILLOMA OF UNUSUAL ORIGIN

    Directory of Open Access Journals (Sweden)

    kasim s. kasim

    2013-12-01

    Full Text Available Two cases of Schneiderian papilloma of the nasal septum are presented. The condition is rare, as indicated by a review of previously published cases. The clinical course of the lesion suggests that it behaves like Schneiderian papillomas elsewhere in the nasal cavity and paranasal sinuses. The need for aggressive surgical management and careful follow-up is emphasized.

  19. Nasal mucociliary transport in laryngectomees

    Energy Technology Data Exchange (ETDEWEB)

    Pavia, J.; Garcia, A.; Abello, R.; Herranz, R.; Franch, M.; Espana, R. de

    1986-04-01

    A study has been carried out to assess the mucociliary function of nasal mucosa in 30 patients: 16 had undergone surgery due to larynx malignancy and the remaining 14 were divided in two groups. The first group was composed of seven patients suffering from larynx cancer but not operated, and the second group of seven had pathology not related to the airways (control group). The method used a sup(99m)technetium sulphur colloid drop deposited on the nasal mucosa of one nostril. To calculate the rate of transport, a new method of quantification has been introduced, based on the formation of a parametric image. The mean velocity in laryngectomees was 3.6 mm/min (range 1.1-6.4). It was compared with the group of 14 patients without tracheostomy (mean 5.3, range 3.3-8.2). An impaired student's-t-test gave a significant difference between both groups. The comparison between patients with nonoperated larynx cancer and normals have a nonsignificant difference. The 16 operated patients were arbitrarily divided into two groups as per the time elapsed from laryngectomy; seven were studied within the first 3 years of operation and seven other patients after this term. The comparison between them was not significant.

  20. Chronic Rhinosinusitis without Nasal Polyps.

    Science.gov (United States)

    Cho, Seong Ho; Kim, Dae Woo; Gevaert, Philippe

    2016-01-01

    Chronic rhinosinusitis without nasal polyps (CRSsNP) is more prevalent than chronic rhinosinusitis with nasal polyps (CRSwNP). Certain diseases predispose to whereas others are associated with CRSsNP. Predisposing diseases include allergic and nonallergic upper and lower airway diseases, epithelial cell disorders, immunodeficiencies, autoimmune diseases, and some infectious diseases. In addition, environmental and host factors, examples of which include smoking, a higher incidence of abnormal biofilms, and innate immune defects, play a role in the pathogenesis of this disease. CRSsNP is characterized by histologic abnormalities, including basement membrane thickening (fibrosis) and goblet cell hyperplasia. Neutrophils and several chemokines, TGF-β and C-X-C motif chemokine ligand (CXCL)-8, play a role in CRSsNP remodeling. However, there are conflicting data about CRSsNP endotypes, for example, whether it is characterized by neutrophilia or eosinophilia or both. In spite of advancements and the understanding of the pathogenesis of this disease, additional study is necessary to better comprehend its underlying mechanisms, endotypes, and evidence-based treatment strategies. PMID:27393771

  1. Pharmacologic inhibition of MEK signaling prevents growth of canine hemangiosarcoma

    Science.gov (United States)

    Andersen, Nicholas J.; Nickoloff, Brian J.; Dykema, Karl J.; Boguslawski, Elissa A.; Krivochenitser, Roman I.; Froman, Roe E.; Dawes, Michelle J.; Baker, Laurence H.; Thomas, Dafydd G.; Kamstock, Debra A.; Kitchell, Barbara E.; Furge, Kyle A.; Duesbery, Nicholas S.

    2013-01-01

    Angiosarcoma (AS) is a rare neoplasm of endothelial origin that has limited treatment options and poor five-year survival. As a model for human AS, we studied primary cells and tumorgrafts derived from canine hemangiosarcoma (HSA), which is also an endothelial malignancy with similar presentation and histology. Primary cells isolated from HSA showed constitutive ERK activation. The MEK inhibitor CI-1040 reduced ERK activation and the viability of primary cells derived from visceral, cutaneous, and cardiac HSA in vitro. HSA-derived primary cells were also sensitive to sorafenib, an inhibitor of B-Raf and multi-receptor tyrosine kinases. In vivo, CI-1040 or PD0325901 decreased the growth of cutaneous cell-derived xenografts and cardiac-derived tumorgrafts. Sorafenib decreased tumor size in both in vivo models, although cardiac tumorgrafts were more sensitive. In human AS, we noted that 50% of tumors stained positively for phosphorylated ERK1/2 and that the expression of several MEK-responsive transcription factors was up-regulated. Our data showed that MEK signaling is essential for the growth of HSA in vitro and in vivo and provided evidence that the same pathways are activated in human AS. This indicates that MEK inhibitors may form part of an effective therapeutic strategy for the treatment of canine HSA or human AS, and it highlights the utility of spontaneous canine cancers as a model of human disease. PMID:23804705

  2. A Woman With Nasal Mass and Epistaxis: An Unusual Presentation of Leprosy

    Directory of Open Access Journals (Sweden)

    Houshang Gerami

    2009-12-01

    Full Text Available Leprosy is an infectious and non-fatal disease that mainly involved skin and peripheral nervous system and caused by Mycobacterium Lepra. This case is a 41-year-old woman with intermittent nasal bleeding and a mass (1.5×2.5 cm in the right side of lateral nasal wall and a (1×1 cm mass on septum in the left side of the nose. Considering the probability of intranasal tumor, endoscopic biopsy for histopathologic examination had been done and the result confirmed the diagnosis of leprosy. After unexpected proving of pathologic leprelepromatose, the patient put under 3-drug- treatment.

  3. Mode-of-Action Uncertainty for Dual-Mode Carcinogens:Lower Bounds for Naphthalene-Induced Nasal Tumors in Rats Implied byPBPK and 2-Stage Stochastic Cancer Risk Models

    Energy Technology Data Exchange (ETDEWEB)

    Bogen, K T

    2007-01-30

    As reflected in the 2005 USEPA Guidelines for Cancer Risk Assessment, some chemical carcinogens may have a site-specific mode of action (MOA) that is dual, involving mutation in addition to cell-killing induced hyperplasia. Although genotoxicity may contribute to increased risk at all doses, the Guidelines imply that for dual MOA (DMOA) carcinogens, judgment be used to compare and assess results obtained using separate ''linear'' (genotoxic) vs. ''nonlinear'' (nongenotoxic) approaches to low-level risk extrapolation. However, the Guidelines allow the latter approach to be used only when evidence is sufficient to parameterize a biologically based model that reliably extrapolates risk to low levels of concern. The Guidelines thus effectively prevent MOA uncertainty from being characterized and addressed when data are insufficient to parameterize such a model, but otherwise clearly support a DMOA. A bounding factor approach--similar to that used in reference dose procedures for classic toxicity endpoints--can address MOA uncertainty in a way that avoids explicit modeling of low-dose risk as a function of administered or internal dose. Even when a ''nonlinear'' toxicokinetic model cannot be fully validated, implications of DMOA uncertainty on low-dose risk may be bounded with reasonable confidence when target tumor types happen to be extremely rare. This concept was illustrated for the rodent carcinogen naphthalene. Bioassay data, supplemental toxicokinetic data, and related physiologically based pharmacokinetic and 2-stage stochastic carcinogenesis modeling results all clearly indicate that naphthalene is a DMOA carcinogen. Plausibility bounds on rat-tumor-type specific DMOA-related uncertainty were obtained using a 2-stage model adapted to reflect the empirical link between genotoxic and cytotoxic effects of the most potent identified genotoxic naphthalene metabolites, 1,2- and 1,4-naphthoquinone. Resulting

  4. Analysis of EGFR and HER-2 expressions in ductal carcinomas in situ in canine mammary glands

    Directory of Open Access Journals (Sweden)

    I.L.D. Silva

    2014-06-01

    Full Text Available Biomolecular evidence has shown that ductal carcinoma in situ (DCIS may develop into invasive carcinoma of the canine mammary gland, and mutations in proto-oncogenes HER2 and EGFR; two members of the family of epidermal growth factor receptors, may be involved in this process. The purpose of this study was the characterization of the immunohistochemical expression of the EGFR and HER2 proteins in the process of neoplastic transformation, supposedly present in ductal carcinomas in situ in canine mammary glands. Fifteen cases of DCIS were evaluated, with a higher expression of HER2 and EGFR being observed in low-grade carcinomas when compared with high-grade neoplasms, and with a high positive statistical correlation in the latter. Results suggest that aggressive tumors tend to lose the expression of EGFR and HER2 simultaneously. The loss of the expression of these markers may be related to the process of neoplastic progression in canine mammary tumors.

  5. The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.

    Science.gov (United States)

    Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki

    2015-04-17

    Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. PMID:25680810

  6. Carcinoma of the nasal vestibule treated with radiation therapy

    Energy Technology Data Exchange (ETDEWEB)

    Mendenhall, N.P.; Parsons, J.T.; Cassisi, N.J.; Million, R.R.

    1987-05-01

    Twenty-two patients with squamous carcinoma of the nasal vestibule were treated at the University of Florida Division of Radiation Therapy with curative intent. Fifteen lesions were de novo and seven recurrent after surgery. By AJCC classification, 7 lesions were Tx or T1, 2 were T2, 2 were T3, and 11 were T4. Management of the primary tumor and regional lymphatic drainage was highly individualized. Local control was achieved in 19 out of 22 lesions. The ultimate regional lymph node control rate was 22 out of 22, although two patients required radical neck dissection after development of lymph node disease in untreated regional lymphatics. Two patients have died of cancer and three of intercurrent disease. Cosmetic results are generally excellent but may be compromised by previous surgery in recurrent lesions or tumor destruction of normal tissues in advanced lesions. Complications of treatment are minimal.

  7. Carcinoma of the nasal vestibule treated with radiation therapy

    International Nuclear Information System (INIS)

    Twenty-two patients with squamous carcinoma of the nasal vestibule were treated at the University of Florida Division of Radiation Therapy with curative intent. Fifteen lesions were de novo and seven recurrent after surgery. By AJCC classification, 7 lesions were Tx or T1, 2 were T2, 2 were T3, and 11 were T4. Management of the primary tumor and regional lymphatic drainage was highly individualized. Local control was achieved in 19 out of 22 lesions. The ultimate regional lymph node control rate was 22 out of 22, although two patients required radical neck dissection after development of lymph node disease in untreated regional lymphatics. Two patients have died of cancer and three of intercurrent disease. Cosmetic results are generally excellent but may be compromised by previous surgery in recurrent lesions or tumor destruction of normal tissues in advanced lesions. Complications of treatment are minimal

  8. Nasal Septal Deviation and Facial Skeletal Asymmetries.

    Science.gov (United States)

    Hartman, Christopher; Holton, Nathan; Miller, Steven; Yokley, Todd; Marshall, Steven; Srinivasan, Sreedevi; Southard, Thomas

    2016-03-01

    During ontogeny, the nasal septum exerts a morphogenetic influence on the surrounding facial skeleton. While the influence of the septum is well established in long snouted animal models, its role in human facial growth is less clear. If the septum is a facial growth center in humans, we would predict that deviated septal growth would be associated with facial skeletal asymmetries. Using computed tomographic (CT) scans of n = 55 adult subjects, the purpose of this study was to test whether there is a correlation between septal deviation and facial asymmetries using three-dimensional (3D) geometric morphometric techniques. We calculated deviation as a percentage of septal volume relative to the volume of a modeled non-deviated septum. We then recorded skeletal landmarks representing the nasal, palatal, and lateral facial regions. Landmark data were superimposed using Procrustes analysis. First, we examined the correlation between nasal septal deviation and the overall magnitude of asymmetry. Next, we assessed whether there was a relationship between nasal septal deviation and more localized aspects of asymmetry using multivariate regression analysis. Our results indicate that while there was no correlation between septal deviation and the overall magnitude of asymmetry, septal deviation was associated with asymmetry primarily in the nasal floor and the palatal region. Septal deviation was unassociated with asymmetries in the lateral facial skeleton. Though we did not test the causal relationship between nasal septal deviation and facial asymmetry, our results suggest that the nasal septum may have an influence on patterns of adult facial form. PMID:26677010

  9. [Histological aspects of naso-ethmoidal tumors].

    Science.gov (United States)

    Carnot, F

    1997-01-01

    Among malignant neoplasms of the sino-nasal tract, tumors of the nasal vault have special features: their higher incidence in woodworkers, their frequent local recurrence and invasiveness in the skull base. Histologically too, they are peculiar by the predominance of the glandular tumors, of colonic or enteric type especially. Microscopic examination allows histological grading of these adenocarcinoma. Squamous carcinoma and adenoid cystic carcinoma are less frequent than in other parts of the sinonasal tract. Rare other tumors, often undifferentiated, can be diagnosed by immuno-staining as esthesioneuroblastomas, malignant melanomas, neuro-endocrine carcinomas, malignant lymphomas or sarcomas. A retrospective study of 147 patients yielded similar data.

  10. Nasal continuous positive airway pressure

    DEFF Research Database (Denmark)

    Scholze, Alexandra; Lamwers, Stephanie; Tepel, Martin;

    2012-01-01

    Obstructive sleep apnoea (OSA) is linked to increased cardiovascular risk. This risk can be reduced by nasal continuous positive airway pressure (nCPAP) treatment. As OSA is associated with an increase of several vasoconstrictive factors, we investigated whether nCPAP influences the digital volume...... pulse wave. We performed digital photoplethysmography during sleep at night in 94 consecutive patients who underwent polysomnography and 29 patients treated with nCPAP. Digital volume pulse waves were obtained independently of an investigator and were quantified using an algorithm for continuous.......01; n = 94) and the arousal index (Spearman correlation, r = 0.21; p CPAP treatment, the AHI was significantly reduced from 27 ± 3 events · h(-1) to 4 ± 2 events · h(-1) (each n = 29; p

  11. Anti-influenza neuraminidase inhibitor oseltamivir phosphate induces canine mammary cancer cell aggressiveness.

    Science.gov (United States)

    de Oliveira, Joana T; Santos, Ana L; Gomes, Catarina; Barros, Rita; Ribeiro, Cláudia; Mendes, Nuno; de Matos, Augusto J; Vasconcelos, M Helena; Oliveira, Maria José; Reis, Celso A; Gärtner, Fátima

    2015-01-01

    Oseltamivir phosphate is a widely used anti-influenza sialidase inhibitor. Sialylation, governed by sialyltransferases and sialidases, is strongly implicated in the oncogenesis and progression of breast cancer. In this study we evaluated the biological behavior of canine mammary tumor cells upon oseltamivir phosphate treatment (a sialidase inhibitor) in vitro and in vivo. Our in vitro results showed that oseltamivir phosphate impairs sialidase activity leading to increased sialylation in CMA07 and CMT-U27 canine mammary cancer cells. Surprisingly, oseltamivir phosphate stimulated, CMT-U27 cell migration and invasion capacity in vitro, in a dose-dependent manner. CMT-U27 tumors xenograft of oseltamivir phosphate-treated nude mice showed increased sialylation, namely α2,6 terminal structures and SLe(x) expression. Remarkably, a trend towards increased lung metastases was observed in oseltamivir phosphate-treated nude mice. Taken together, our findings revealed that oseltamivir impairs canine mammary cancer cell sialidase activity, altering the sialylation pattern of canine mammary tumors, and leading, surprisingly, to in vitro and in vivo increased mammary tumor aggressiveness. PMID:25850034

  12. Anti-influenza neuraminidase inhibitor oseltamivir phosphate induces canine mammary cancer cell aggressiveness.

    Directory of Open Access Journals (Sweden)

    Joana T de Oliveira

    Full Text Available Oseltamivir phosphate is a widely used anti-influenza sialidase inhibitor. Sialylation, governed by sialyltransferases and sialidases, is strongly implicated in the oncogenesis and progression of breast cancer. In this study we evaluated the biological behavior of canine mammary tumor cells upon oseltamivir phosphate treatment (a sialidase inhibitor in vitro and in vivo. Our in vitro results showed that oseltamivir phosphate impairs sialidase activity leading to increased sialylation in CMA07 and CMT-U27 canine mammary cancer cells. Surprisingly, oseltamivir phosphate stimulated, CMT-U27 cell migration and invasion capacity in vitro, in a dose-dependent manner. CMT-U27 tumors xenograft of oseltamivir phosphate-treated nude mice showed increased sialylation, namely α2,6 terminal structures and SLe(x expression. Remarkably, a trend towards increased lung metastases was observed in oseltamivir phosphate-treated nude mice. Taken together, our findings revealed that oseltamivir impairs canine mammary cancer cell sialidase activity, altering the sialylation pattern of canine mammary tumors, and leading, surprisingly, to in vitro and in vivo increased mammary tumor aggressiveness.

  13. Isolation and characterization of bacteria from canine respiratory diseases in and around Hyderabad city, Andhra Pradesh, India

    Directory of Open Access Journals (Sweden)

    S. Ayodhya

    2013-06-01

    Full Text Available Aim: To identify the organisms causing respiratory diseases in dogs that belongs to areas in and around Hyderabad city.Materials and Methods: Nasal samples were collected using sterile swabs from the canine clinical cases that were presented with the history of respiratory diseases at the University administered Veterinary Hospital, Bhoiguda, Secunderabad and Campus Veterinary Hospital, College of Veterinary Science, Rajendranagar, Hyderabad over a period of 26 months i.e., from October 2008 to November 2010. Clinical signs included coughing, nasal discharge, sneezing, difficulty in breathing, fever, loss of appetite and lethargic behavior. Nasal swabs were immediately transferred, aseptically, into a nutrient broth and were subjected to various cultural tests and microscopic examination. Results: Out of 90 nasal samples, different species of bacteria were isolated. Results from our bacterial culture, microscopic and biochemical studies of the nasal discharges collected from dogs suffering with respiratory diseases revealed various bacteria such as E. coli, Klebsiella spp, Streptococci spp.Staphylococci and mixed infections.Conclusion: This study revealed that the bacteria such as E. coli, Klebsiella spp, Streptococci spp. Staphylococci and mixed infections are the common causative agents that lead to respiratory diseases in dogs belonging to areas in and around Hyderabad city.

  14. Tarantula cubensis extract alters the degree of apoptosis and mitosis in canine mammary adenocarcinomas.

    Science.gov (United States)

    Gultiken, Nilgun; Guvenc, Tolga; Kaya, Duygu; Agaoglu, Ali Reha; Ay, Serhan Serhat; Kucukaslan, Ibrahim; Emre, Birten; Findik, Murat; Schäfer-Somi, Sabine; Aslan, Selim

    2015-01-01

    In the present study, 13 clinical cases of canine mammary adenocarcinoma were evaluated in order to understand the effect of Tarantula cubensis extract (TCE) on tumor tissue. Punch biopsies were taken from the tumors before treatment with TCE. Subcutaneous injections of TCE were administered three times at weekly intervals (3 mL per dog). Between days 7 and 10 after the third injection, the tumor masses were extirpated by complete unilateral mastectomy. Pre- and post-treatment tumor tissues were immunohistochemically assessed. The expression of B-cell lymphoma 2 (Bcl-2) was found to be higher in pre-treatment compared to post-treatment tissues (p 0.05). The apoptotic index was determined to be low before treatment and increased during treatment. These results suggest that TCE may be effective for controlling the local growth of canine mammary adenocarcinoma by regulating apoptosis. PMID:25549212

  15. Ultra-estrutura dos mastócitos de diferentes tipos histológicos de mastocitoma em cães Mast cell ultrastructure in different types of canine mast cell tumor

    Directory of Open Access Journals (Sweden)

    F.A.R. Sueiro

    2002-06-01

    Full Text Available Este trabalho teve por objetivo estudar as diferenças ultraestruturais de mastócitos neoplásicos de diferentes tipos histológicos de mastocitoma em cães, usando microscopia eletrônica de transmissão Os resultados mostraram que o núcleo e os grânulos citoplasmáticos são as estruturas mais indicadas para se avaliar o grau de anaplasia celular e o estádio de indiferenciação do tumor.The objective of this work was study the ultrastructural differences among the different histologic types of mast cell tumors in dogs collected in vivo. The ultrastructural analyses showed that the nuclei and cytoplasmic granules characteristics are the best structures to be appointed on evaluating the undifferentiation stage of this tumor.

  16. Nasal mass removal in the koala (Phascolarctos cinereus).

    Science.gov (United States)

    Bercier, Marjorie; Wynne, Janna; Klause, Stephen; Stadler, Cynthia K; Gorow, April; Pye, Geoffrey W

    2012-12-01

    Nasal masses in the koala (Phascolarctos cinereus) are not uncommon and can be challenging to diagnose and treat. Differential diagnoses for nasal masses in the koala are cryptococcal granulomas, nasal polyps, nasal adenocarcinoma, and osteochondromatosis. This report describes successful surgical approaches for two adult koalas with nasal masses and includes photodocumentation and description of the anatomy of the koala nasal passages from the postmortem transverse sectioning of a normal koala head. Surgical removal of the nasal masses in these koalas resulted in a rapid resolution of clinical signs.

  17. Aplicaciones del colgajo frontonasal para la cobertura de defectos nasales

    Directory of Open Access Journals (Sweden)

    M. Pérez

    2015-12-01

    Full Text Available Presentamos una revisión retrospectiva de los pacientes a los cuales se realizó un colgajo frontonasal para la cobertura de defectos nasales intervenidos en la Unidad de Tumores Cutáneos de nuestro Servicio en el periodo comprendido entre enero de 2010 y mayo de 2014. El objetivo es analizar nuestras aplicaciones y resultados además de describir un algoritmo que permita indicar los distintos diseños en función de la localización y el tamaño del defecto a reparar. Empleamos el colgajo frontonasal en 78 pacientes (49 mujeres y 29 varones con un rango de edad de 47 a 92 años (media de 73 años. Creamos un total de 81 defectos, puesto que en 3 casos se resecaron simultáneamente 2 tumoraciones, todos de etiología tumoral (64 carcinomas basocelulares, 16 carcinomas espinocelulares y 1 caso de léntigo maligno melanoma, localizados en el área nasal, con un tamaño mínimo de 12 x 17 mm y máximo de 30 x 35 mm (media de 22 x 25 mm. El periodo de seguimiento fue de entre 2 meses y 4 años (media de 2,5 años. Respecto a las complicaciones observadas, todas ellas menores, hubo 6 casos de necrosis marginal, 8 de dehiscencia parcial de la herida y 1 de cicatrización hipertrófica, tratándose en su mayor parte de varones fumadores. Todos los colgajos sobrevivieron con resultado estético satisfactorio. El colgajo frontonasal permite la cobertura en un sólo tiempo quirúrgico de defectos nasales independientemente de su localización, de hasta 30 x 35 mm en nuestra serie. Se trata de un colgajo seguro y versátil en sus múltiples modificaciones, con unos resultados estéticos satisfactorios. Estas ventajas son de especial importancia en pacientes de edad avanzada como alternativa a técnicas más complejas. Se trata por lo tanto, a nuestro juicio, de una opción a tener en cuenta para la reconstrucción en un único tiempo quirúrgico de defectos nasales.

  18. Canine Oral Eosinophilic Granuloma Treated with Electrochemotherapy

    Directory of Open Access Journals (Sweden)

    Matías Nicolás Tellado

    2014-01-01

    Full Text Available A case of a canine oral eosinophilic granuloma in a 14-year-old female crossbred is described. The dog was presented with a history of ptyalism, halitosis, local pain, decreased appetite, and blood staining noted on food and water bowls. Clinical, hematologic, and biochemical examinations, abdominal ultrasonography, and 3-view chest radiographs were performed, and no metastases were found. Histopathologic examination of two 6 mm punch biopsies from the oral lesion revealed the presence of eosinophilic granulomatous lesions in the submucosa. After treatment with corticosteroids and wide spectrum antibiotics no significant changes in clinical signs and lesion size were observed. Electrochemotherapy (ECT, a novel tumor treatment routinely used for cutaneous and subcutaneous tumors in human patients in the European Union since 2006, was used to treat the eosinophilic granuloma. The procedure was performed under general anesthesia, followed by intravenous administration of bleomycin. Six weeks after treatment a complete response with disappearance of the mass and improvement of clinical signs were observed.

  19. Canine Butterfly Glioblastomas: A Neuroradiological Review

    Science.gov (United States)

    Rossmeisl, John H.; Clapp, Kemba; Pancotto, Theresa E.; Emch, Samantha; Robertson, John L.; Debinski, Waldemar

    2016-01-01

    In humans, high-grade gliomas may infiltrate across the corpus callosum resulting in bihemispheric lesions that may have symmetrical, winged-like appearances. This particular tumor manifestation has been coined a “butterfly” glioma (BG). While canine and human gliomas share many neuroradiological and pathological features, the BG morphology has not been previously reported in dogs. Here, we describe the magnetic resonance imaging (MRI) characteristics of BG in three dogs and review the potential differential diagnoses based on neuroimaging findings. All dogs presented for generalized seizures and interictal neurological deficits referable to multifocal or diffuse forebrain disease. MRI examinations revealed asymmetrical (2/3) or symmetrical (1/3), bihemispheric intra-axial mass lesions that predominantly affected the frontoparietal lobes that were associated with extensive perilesional edema, and involvement of the corpus callosum. The masses displayed heterogeneous T1, T2, and fluid-attenuated inversion recovery signal intensities, variable contrast enhancement (2/3), and mass effect. All tumors demonstrated classical histopathological features of glioblastoma multiforme (GBM), including glial cell pseudopalisading, serpentine necrosis, microvascular proliferation as well as invasion of the corpus callosum by neoplastic astrocytes. Although rare, GBM should be considered a differential diagnosis in dogs with an MRI evidence of asymmetric or symmetric bilateral, intra-axial cerebral mass lesions with signal characteristics compatible with glioma.

  20. CANINE BUTTERFLY GLIOBLASTOMAS: A NEURORADIOLOGICAL REVIEW

    Directory of Open Access Journals (Sweden)

    John Henry Rossmeisl

    2016-05-01

    Full Text Available In humans, high-grade gliomas may infiltrate across the corpus callosum resulting in bihemispheric lesions that may have symmetrical, winged-like appearances. This particular tumor manifestation has been coined a ‘butterfly’ glioma (BG. While canine and human gliomas share many neuroradiological and pathological features, the BG morphology has not been previously reported in dogs. Here we describe the magnetic resonance imaging (MRI characteristics of BG in three dogs, and review the potential differential diagnoses based on neuroimaging findings. All dogs presented with generalized seizures and interictal neurological deficits referable to multifocal or diffuse forebrain disease. MRI examinations revealed asymmetrical (2/3 or symmetrical (1/3, bihemispheric intra-axial mass lesions that predominantly affected the frontoparietal lobes and associated with extensive perilesional edema, and involvement of the corpus callosum. The masses displayed heterogeneous T1, T2, and FLAIR signal intensities, variable contrast enhancement (2/3, and mass effect. All tumors demonstrated classical histopathological features of glioblastoma (GBM including glial cell pseudopalisading, serpentine necrosis, microvascular proliferation, as well as invasion of the corpus callosum by neoplastic astrocytes. Although rare, GBM should be considered a differential diagnosis in dogs with MRI evidence of asymmetric or symmetric bilateral, intra-axial cerebral mass lesions with signal characteristics compatible with glioma.

  1. Plastinated nasal model: a new concept of anatomically realistic cast.

    OpenAIRE

    Durand, Marc; Pourchez, Jérémie; Louis, Bruno; Pouget, Jean-François; Isabey, Daniel; Coste, André; Prades, Jean-Michel; Rusch, Philippe; Cottier, Michèle

    2011-01-01

    BACKGROUND: For many years, researchers have been interested in investigating airflow and aerosol deposition in the nasal cavities. The nasal airways appear to be a complex geometrical system. Thus, in vitro experimental studies are frequently conducted with a more or less biomimetic nasal replica. AIM: This study is devoted to the development of an anatomically realistic nose model with bilateral nasal cavities, i.e. nasal anatomy, airway geometry and aerodynamic properties as close as possi...

  2. Model demonstrates functional purpose of the nasal cycle

    OpenAIRE

    White, David E.; Bartley, Jim; Nates, Roy J

    2015-01-01

    Background Despite the occurrence of the nasal cycle being well documented, the functional purpose of this phenomenon is not well understood. This investigation seeks to better understand the physiological objective of the nasal cycle in terms of airway health through the use of a computational nasal air-conditioning model. Method A new state-variable heat and water mass transfer model is developed to predict airway surface liquid (ASL) hydration status within each nasal airway. Nasal geometr...

  3. Current developments in canine genetics.

    Science.gov (United States)

    Marschall, Yvonne; Distl, Ottmar

    2010-01-01

    In recent years, canine genetics had made huge progress. In 1999 the first complete karyotype and ideogram of the dog was published. Several linkage and RH maps followed. Using these maps, sets of microsatellite markers for whole genome scans were compiled. In 2003 the sequencing of the DNA of a female Boxer began. Now the second version of the dog genome assembly has been put online, and recently, a microchip SNP array became available. Parallel to these developments, some causal mutations for different traits have been identified. Most of the identified mutations were responsible for monogenic canine hereditary diseases. With the tools available now, it is possible to use the advantages of the population structure of the various dog breeds to unravel complex genetic traits. Furthermore, the dog is a suitable model for the research of a large number of human hereditary diseases and particularly for cancer genetics, heart and neurodegenerative diseases. There are some examples where it was possible to benefit from the knowledge of canine genetics for human research. The search for quantitative trait loci (QTL), the testing of candidate genes and genome-wide association studies can now be performed in dogs. QTL for skeletal size variations and for canine hip dysplasia have been already identified and for these complex traits the responsible genes and their possible interactions can now be identified. PMID:20690545

  4. Prognostic markers of canine pyometra

    OpenAIRE

    M.C. Sant'Anna; L.G.P. Giordano; K.K.M.C. Flaiban; Muller, E.E.; M.I.M. Martins

    2014-01-01

    The pyometra is a disease that affects middle age and elderly female dogs during diestrus. Hormonal, microbiological, biochemical and hematological aspects are well described. However, few studies have evaluated the role of each in the prognosis of canine pyometra. The aim of this study was to identify markers associated with clinical worsening of dogs with pyometra. We prospectively evaluated 80 dogs with pyometra tre...

  5. Surgical innovations in canine gonadectomy

    NARCIS (Netherlands)

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated n

  6. Malignant melanoma of the nasal cavity: a case report with examination of KIT and platelet derived growth factor receptor-α (PDGFRA

    Directory of Open Access Journals (Sweden)

    Tadashi Terada

    2011-10-01

    Full Text Available Although several clinicopathological studies of malignant melanoma of the nasal cavity have been reported, there are no studies of the expression and gene mutation of KIT and platelet derived growth factor receptor-α (PDGFRA in melanoma of the nasal cavity. A 92-year-old Japanese woman consulted to our hospital because of right nasal obstruction and epistaxis. Physical examination and imaging modalities showed a tumor of the right nasal cavity. A biopsy was taken, and it showed malignant epithelioid cells with melanin deposition. Immunohistochemically, the tumor was positive for S100 protein, HMB45, p53, Ki-67 (labeling=20%, KIT and PDGFRA. The tumor was negative for cytokeratins (AE1/3 and CAM5.2. A genetic analysis using PCR-direct sequencing revealed no mutation of KIT gene (exons 9, 11, 13, and 17 or the PDGFRA gene (exons 12 and 18. The pathological diagnosis was primary malignant melanoma of the nasal cavity. The tumor was reduced in size by local resection and chemotherapy (Darthmose regimen: dacarbazine, carmustine, cisplatine, and tamoxifen, and the patient is now alive and free from metastasis 9 months after the first manifestation. In conclusion, the author reported a case of melanoma of the nasal cavity expressing KIT and PDGFRA without gene mutations of KIT and PDGFRA.

  7. Central nervous system tumors

    International Nuclear Information System (INIS)

    Central nervous system (CNS) tumors are relatively common in veterinary medicine, with most diagnoses occurring in the canine and feline species. Numerous tumor types from various cells or origins have been identified with the most common tumors being meningiomas and glial cell tumors. Radiation therapy is often used as an aid to control the clinical signs associated with these neoplasms. In general, these tumors have a very low metastatic potential, such that local control offers substantial benefit. Experience in veterinary radiation oncology would indicate that many patients benefit from radiation treatment. Current practice indicates the need for computed tomography or magnetic resonance imaging studies. These highly beneficial studies are used for diagnosis, treatment planning, and to monitor treatment response. Improvements in treatment planning and radiation delivered to the tumor, while sparing the normal tissues, should improve local control and decrease potential radiation related problems to the CNS. When possible, multiple fractions of 3 Gy or less should be used. The tolerance dose to the normal tissue with this fractionation schedule is 50 to 55 Gy. The most common and serious complications of radiation for CNS tumors is delayed radiation myelopathy and necrosis. Medical management of the patient during radiation therapy requires careful attention to anesthetic protocols, and medications to reduce intracranial pressure that is often elevated in these patients. Canine brain tumors have served as an experimental model to test numerous new treatments. Increased availability of advanced imaging modalities has spawned increased detection of these neoplasms. Early detection of these tumors with appropriate aggressive therapy should prove beneficial to many patients

  8. Discriminating between Nasal and Mouth Breathing

    OpenAIRE

    Curran, Kevin; Yuan, Peng; Coyle, Damian

    2010-01-01

    The recommendation to change breathing patterns from the mouth to the nose can have a significantly positive impact upon the general well being of the individual. We classify nasal and mouth breathing by using an acoustic sensor and intelligent signal processing techniques. The overall purpose is to investigate the possibility of identifying the differences in patterns between nasal and mouth breathing in order to integrate this information into a decision support system which will form the b...

  9. Numerical simulation and nasal air-conditioning

    Directory of Open Access Journals (Sweden)

    Keck, Tilman

    2010-01-01

    Full Text Available Heating and humidification of the respiratory air are the main functions of the nasal airways in addition to cleansing and olfaction. Optimal nasal air conditioning is mandatory for an ideal pulmonary gas exchange in order to avoid desiccation and adhesion of the alveolar capillary bed. The complex three-dimensional anatomical structure of the nose makes it impossible to perform detailed in vivo studies on intranasal heating and humidification within the entire nasal airways applying various technical set-ups. The main problem of in vivo temperature and humidity measurements is a poor spatial and time resolution. Therefore, in vivo measurements are feasible only to a restricted extent, solely providing single temperature values as the complete nose is not entirely accessible. Therefore, data on the overall performance of the nose are only based on one single measurement within each nasal segment. In vivo measurements within the entire nose are not feasible. These serious technical issues concerning in vivo measurements led to a large number of numerical simulation projects in the last few years providing novel information about the complex functions of the nasal airways. In general, numerical simulations merely calculate predictions in a computational model, e.g. a realistic nose model, depending on the setting of the boundary conditions. Therefore, numerical simulations achieve only approximations of a possible real situation. The aim of this review is the synopsis of the technical expertise on the field of in vivo nasal air conditioning, the novel information of numerical simulations and the current state of knowledge on the influence of nasal and sinus surgery on nasal air conditioning.

  10. Detection of Helicobacter pylori in Nasal Polyps.

    Science.gov (United States)

    Bansal, Divya; Sharma, Sonal; Agarwal, Sarla; Saha, Rumpa; Gupta, Neelima

    2016-09-01

    To detect the presence of Helicobacter pylori in nasal polyps. A case-control study was conducted enrolling 35 patients with nasal polyps (cases) and patients undergoing septoplasty (controls). Fresh tissue samples were used for urea broth test and imprint cytology, while formalin fixed tissue sections were used for morphology, special stains and immunohistochemistry for H. pylori. Fresh stool samples from both groups were tested to correlate the gastrointestinal status. H. pylori was detected in 40.0 % (14/35) of cases and 8.5 % of controls (3/35) (p = 0.004) by immunohistochemistry. Amongst cases, eight were positive with urea broth test, six with imprint cytology (Giemsa stain), three with H & E, and nine with modified McMullen's stain. Hyperplasia of the lining epithelium and lymphoid aggregates were significantly noticed in nasal polyps positive for H. pylori. Stool antigen test was positive in subjects who were positive for H. pylori in the nasal mucosa. There appears to be an association between H. pylori and nasal polyps. Immunohistochemistry is more sensitive and specific method to detect H. pylori. H. pylori induced inflammatory tissue reaction pattern indicates a possible causal association. Further studies are needed to prove the causal relationship between H. pylori and nasal polyps. PMID:26830396

  11. NASALIZATION IN BRAZILIAN PORTUGUESE: AN AUTOSEGMENTAL (REVIEW

    Directory of Open Access Journals (Sweden)

    Consuelo de Paiva Godinho COSTA

    2015-06-01

    Full Text Available We propose to make a brief review on nasalization phenomena studies in Portuguese, aiming the phonological process of nasal harmonization that occurs in the variety of Brazilian Portuguese spoken in Vitória da Conquista-BA and region, a phenomenon hitherto not described for any Portuguese dialect. To do so, we consider as fundamental, D’Angelis (2002 analysis, which incorporates relevant concepts presented by Trubetzkoy, from the Prague School, and some points of Camara Jr. propose. We also propose to update the discussion with the approaches along the lines of auto segmental phonology, incorporating some insights of Piggott (1992, discussing with other analyzes for nasalization phenomena in other languages, especially Guarani (language of Tupi-Guarani Linguistic Family, as proposed by Costa (2010, which deals with the phonological processes involving nasality and nasal harmony in Brazilian indigenous languages , in order to verify if the researches on nasality phenomena in other languages can shed some light on the processes that occur in Portuguese.

  12. Correlations of nasal responses to leukotriene D4 and histamine nasal provocation with quality of life in allergic rhinitis

    Science.gov (United States)

    Zhu, Zheng; Xie, Yanqing; Guan, Weijie; Gao, Yi; Xia, Shu; Shi, Xu

    2016-01-01

    Background The symptoms of allergic rhinitis (AR) greatly affect the quality of life (QoL) in the patients with AR. The correlations of nasal response to leukotriene D4 (LTD4) and histamine nasal provocation with health related QoL in AR are not clear. Objective To evaluate the correlations of nasal response to LTD4 and histamine nasal challenge with QoL in AR. Methods Patients randomly underwent LTD4 and histamine nasal challenge tests, completed the rhinoconjunctivitis quality of life questionnaire (RQoLQ), and rating the symptom severity score (total symptom score 4, TSS4) in the previous week. The correlations between nasal challenge tests induced nasal responses and QoL in RQoLQ were analyzed. Results A total of 25 eligible AR patients enrolled and finished both LTD4 and histamine nasal challenge and completed the questionnaire of RQoLQ. Histamine nasal challenge induced sneezing, increased nasal resistant were correlated with most of the dimensions (general, practical, nasal, eye problems, and quality of sleep, p < 0.05), while LTD4 nasal challenge induced sneeze, increased nasal resistant only correlated with nasal and ocular problems. On the contrary, the severity of the sneeze assessed by TSS4, was not correlated with QoL, while the severity of rhinorrhea, congestion, and nasal pruritus were correlated with nasal and practical problems, and nasal congestion was also correlated with ocular problems (r = 0.60, p = 0.01). Conclusion LTD4 and histamine nasal challenge induced nasal responses were correlated with different clinical symptoms severity and QoL, which can be used as a good diagnosis and evaluation methods for the management of AR.

  13. Nasal meatus plasty: a contribution to plastic reconstruction of the nasal valve during midfacial degloving

    Directory of Open Access Journals (Sweden)

    Lorenz, Kai J.

    2014-05-01

    Full Text Available Midfacial degloving is a proven method for easily accessing the midface, the nasal pyramid, the maxillary and ethmoidal sinuses, the orbits, as well as the anterior skull base. Indications for this method of access mainly include tumour resections in the area of the midface, the septum, the maxillary sinus, the paranasal to the sphenoidal sinus as well as the clivus. In addition, this method of access allows for the exposure of the bony structures of the midface in the event of extensive fractures.In general, this method of access combines an incision in the oral vestibule and circular incisions in the nasal vestibule area in order to release the nasal pyramid.After removing the facial wall of the maxillary sinus, extensive exposure of the surgical site is possible.One disadvantage of this method of access is the difficult reconstruction of the nasal valve area, which often leads to cicatricial stenoses and difficulties with breathing through the nose. Furthermore, wound healing problems and osteoradionecrosis in the area of the lateral margin of the anterior nasal aperture after replantation of the facial wall of the maxillary sinus have been described, because in this area sufficient soft tissue coverage cannot be ensured when a conventional technique is used.We describe a soft tissue flap pedicled in the cranial and caudal directions in the nasal valve area which makes both the reconstruction of the nasal vestibule and sufficient soft tissue coverage of the anterior nasal aperture possible.

  14. Nasal meatus plasty: a contribution to plastic reconstruction of the nasal valve during midfacial degloving.

    Science.gov (United States)

    Lorenz, Kai J; Maier, Heinz; Wilde, Frank

    2014-01-01

    Midfacial degloving is a proven method for easily accessing the midface, the nasal pyramid, the maxillary and ethmoidal sinuses, the orbits, as well as the anterior skull base. Indications for this method of access mainly include tumour resections in the area of the midface, the septum, the maxillary sinus, the paranasal to the sphenoidal sinus as well as the clivus. In addition, this method of access allows for the exposure of the bony structures of the midface in the event of extensive fractures. In general, this method of access combines an incision in the oral vestibule and circular incisions in the nasal vestibule area in order to release the nasal pyramid. After removing the facial wall of the maxillary sinus, extensive exposure of the surgical site is possible. One disadvantage of this method of access is the difficult reconstruction of the nasal valve area, which often leads to cicatricial stenoses and difficulties with breathing through the nose. Furthermore, wound healing problems and osteoradionecrosis in the area of the lateral margin of the anterior nasal aperture after replantation of the facial wall of the maxillary sinus have been described, because in this area sufficient soft tissue coverage cannot be ensured when a conventional technique is used. We describe a soft tissue flap pedicled in the cranial and caudal directions in the nasal valve area which makes both the reconstruction of the nasal vestibule and sufficient soft tissue coverage of the anterior nasal aperture possible. PMID:26504717

  15. Válvula nasal: anatomia e fisiologia Nasal valve: anatomy and physiology

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo Nazareth Nigro

    2009-04-01

    Full Text Available A porção anterior das cavidades nasais, da narina à válvula nasal (VN, é a região de maior resistência nasal ao fluxo aerífero, de suma importância para a fisiologia nasal. Na literatura existem terminologias diferentes para se referir às mesmas estruturas anatômicas e, ainda, o mesmo termo se referindo a estruturas anatômicas diferentes. OBJETIVO: Realizamos este trabalho com o objetivo de revisarmos o funcionamento da VN e definirmos com mais clareza estruturas anatômicas da porção anterior das cavidades nasais, principalmente a região da VN. CONCLUSÃO: Existe controvérsia na literatura quanto à nomenclatura das estruturas da VN. Neste trabalho definimos VN como uma estrutura tridimensional compreendida anteriormente pelo ostium internum e posteriormente pelo isthmus nasi.The anterior portion of the nasal cavities, from the nostril to the nasal valve (NV, is the place of highest nasal resistance to airflow, paramount to nasal physiology. There are different terminologies for the same anatomic structures in the literature. AIM: The aim of this paper was to study the NV function and define clearly the structures of the anterior portion of the nasal cavities, mainly the region of the NV. CONCLUSION: Internum ostium is the anterior segment and isthmus nasi is the posterior segment of the NV region.

  16. BNCT of canine osteosarcoma

    International Nuclear Information System (INIS)

    A dog was diagnosed with osteosarcoma (8x6x5cm) in the right wing of ilium by radiography, radionuclide scintigraphy and histological study of biopsy material. The treatment plan was as follows: γ-therapy in combination with chemotherapy; prevention of hematogenous pulmonary metastases by the transfusion of 130 ml of allogenic marrow from a healthy donor; administration of 11.4g 10B-boronphenylalanine into the right iliac artery; resection of the right iliac wing with the osteosarcoma lesion; neutron irradiation (MEPhI Reactor) of the bone fragment (dose on healthy osteocytes - 15±4 Gy (W), on tumor - 50±9 Gy (W); reimplantation and fixation of the fragment; three courses of adjuvant chemotherapy. The doses were determined in full-scale calculations of the reactor radiation fields with a model of the bone under the code RADUGA. The 10B concentration (μg/g) in the bone was: normal tissue - 9±3, tumor - 28±5. In 24 hours post operation the dog was able to walk using the treated limb, and 6 months later it moved freely. The patient has been under observation for 30 months. The results of the research demonstrate complete cure. The use of similar treatment plans improves the therapeutic efficiency of BNCT. (author)

  17. Effects of nasal allergen challenge on dynamic viscoelasticity of nasal mucus.

    Science.gov (United States)

    Hattori, M; Majima, Y; Ukai, K; Sakakura, Y

    1993-04-01

    The effects of nasal provocation on the rheologic properties of nasal mucus were investigated in patients with allergic rhinitis provoked by house dust. The elastic modulus (G') and the dynamic viscosity (eta') of nasal mucus were determined by an oscillating sphere magnetic rheometer. Before and after the allergen challenge, G' increased, whereas eta' decreased with increasing oscillatory frequency; these findings indicate that the nasal mucus under these conditions is a non-newtonian fluid and has the cross-linked gel-like nature typical of mucus. Both G' and eta' values after nasal provocation were significantly lower than before. The values of G' and eta' after allergen challenge were in the optimal viscoelasticity range for mucociliary transport. PMID:8476173

  18. Airborne Fine Particulate Matter Induces Oxidative Stress and Inflammation in Human Nasal Epithelial Cells.

    Science.gov (United States)

    Hong, Zhicong; Guo, Zhiqiang; Zhang, Ruxin; Xu, Jian; Dong, Weiyang; Zhuang, Guoshun; Deng, Congrui

    2016-01-01

    Airborne fine particulate matter with an aerodynamic diameter equal to or smaller than 2.5 μm is abbreviated as PM2.5, which is one of the main components in air pollution. Exposure to PM2.5 is associated with increased risk of many human diseases, including chronic and allergic rhinitis, but the underlying molecular mechanism for its toxicity has not been fully elucidated. We have hypothesized that PM2.5 may cause oxidative stress and enhance inflammatory responses in nasal epithelial cells. Accordingly, we used human RPMI 2650 cells, derived from squamous cell carcinoma of the nasal septum, as a model of nasal epithelial cells, and exposed them to PM2.5 that was collected at Fudan University (31.3°N, 121.5°E) in Shanghai, China. PM2.5 exposure decreased the viability of RPMI 2650 cells, suggesting that PM2.5 may impair the barrier function of nasal epithelial cells. Moreover, PM2.5 increased the levels of intracellular reactive oxygen species (ROS) and the nuclear translocation of NF-E2-related factor-2 (Nrf2). Importantly, PM2.5 also decreased the activities of superoxide dismutase, catalase and glutathione peroxidase. Pretreatment with N-Acetyl-L-cysteine (an anti-oxidant) reduced the degree of the PM2.5-induced oxidative stress in RPMI 2650 cells. In addition, PM2.5 increased the production of granulocyte-macrophage colony-stimulating factor, tumor necrosis factor-α, interleukin-13 and eotaxin (C-C motif chemokine ligand 11), each of which initiates and/or augments local inflammation. These results suggest that PM2.5 may induce oxidative stress and inflammatory responses in human nasal epithelial cells, thereby leading to nasal inflammatory diseases. The present study provides insights into cellular injury induced by PM2.5.

  19. Extranodal NK/T-Cell Lymphoma, Nasal Type, Presenting as a Breast Mass.

    Science.gov (United States)

    Rahal, Ahmad; Reddy, Pavan S; Alvares, Carmelita

    2015-01-01

    Extranodal natural killer/T-cell lymphoma, nasal type, is a rare type of non-Hodgkin cell lymphoma endemic to East Asia and parts of Central and South America. In most cases, it is driven by Epstein-Barr virus infections, with a broad range of morphologic appearances, frequent necrosis, and angioinvasion. It is designated as NK/T reflecting uncertainty in its cellular origins. These tumors usually arise in the nasal region, typically presenting with symptoms of nasal obstruction, epistaxis, and/or a destructive mass involving the nose, sinuses, or palate. The treatment of patients with extranodal NK/T-cell lymphoma, nasal type, is largely determined by the extent of disease. Localized disease is usually treated with radiation and chemotherapy. The disseminated disease requires combination chemotherapy. This report describes the case of a 30-year-old Caucasian female presenting with a left breast mass of two months duration. Excisional biopsy was done, and the pathological exam confirmed the diagnosis of extranodal NK/T-cell lymphoma, nasal type. Our patient received a systemic combination chemotherapy with steroid (dexamethasone), methotrexate, ifosfamide, L-asparaginase, and etoposide (SMILE) regimen, resulting in a complete clinical and radiological remission. On the basis of our review of the literature, extranodal NK/T non-Hodgkin cell lymphoma, nasal type, presenting as a breast mass is very rare and very uncommon in the United States. Awareness of this occurrence may be valuable as this case may be a forerunner of additional similar cases developing in the future. PMID:26824008

  20. Cell proliferation in rat nasal respiratory epithelium following three months exposure to formaldehyde gas

    International Nuclear Information System (INIS)

    Formaldehyde (HCHO), a ubiquitous chemical and rat nasal carcinogen, enhances cell proliferation in rat, monkey, and xenotransplanted human respiratory epithelium following short-term exposure. The present studies were designed to evaluate cell proliferation in relation to tumor induction in rat nasal respiratory epithelium following subchronic HCHO exposure. Male F-344 rats were whole-body exposed to either 0, 0.7, 2, 6, 10, or 15 ppm HCHO, for wither 4 d (6hr/d), 6 wks (5d/wk) or 3 months. Animals were labeled with tritiated thymidine prior to euthanasia. Nasal sections were processed for autoradiography and cell proliferation data was expressed as unit length labeling indices (ULLI). HCHO-induced lesions and increases in cell proliferation occurred in specific regions of the nose, primarily the wall of the lateral meatus and nasal septum of the anterior nasal cavity. Following 4 d exposure, significant elevations in cell proliferation were observed only in the 6, 10 and 15 ppm groups (16-, 18-, and 20-fold increase over control, respectively). Increases in ULLI were also present in the 6, 10 and 15 ppm groups after 6 wks of exposure (12-, 35-, and 40-fold increase over control). However, after 3 months exposure, elevations in ULLI were present only in the 10 and 15 ppm groups (9- and 14-fold increase over controls). These results demonstrate that (1) low levels of HCHO (0.7 and 2 ppm) do not increase cell proliferation in rat nasal respiratory epithelium; (2) 6 ppm HCHO induces transient increases in cell proliferation; and (3) clearly carcinogenic concentrations of HCHO (10 and 15 ppm) cause sustained elevations in cell proliferation which may play an important role in HCHO-induced carcinogenesis

  1. Congenital salivary gland anlage tumor of the nasopharynx.

    Science.gov (United States)

    Tinsa, Faten; Boussetta, Khadija; Bousnina, Souad; Menif, Khaled; Nouira, Faouzi; Haouet, Slim; Sahtout, Samia

    2010-01-01

    Nasal and upper respiratory tract obstruction in the neonatal period can result from a variety of conditions, and may be present with variable symptoms. Salivary gland anlage tumor, also referred as congenital pleomorphic adenoma, is a very rare benign congenital tumor of the nasopharynx, which may produce nasal obstruction and other associated, nonspecific symptoms. We report a case of congenital salivary gland anlage tumor causing a severe neonatal respiratory distress with pulmonary hypertension. The tumor was removed and the outcome was favourable without recurrence at five years of the follow up.

  2. Comparative Aspects of Molecular Mechanisms of Drug Resistance through ABC Transporters and Other Related Molecules in Canine Lymphoma

    Directory of Open Access Journals (Sweden)

    Hirotaka Tomiyasu

    2015-08-01

    Full Text Available The most important causes of treatment failure in canine lymphoma include intrinsic or acquired drug resistance. Thus, elucidation of molecular mechanisms of drug resistance is essential for the establishment of better treatment alternatives for lymphoma patients. The overexpression of drug transporters is one of the most intensively studied mechanisms of drug resistance in many tumors. In canine lymphoma, it has also been shown that the overexpression of drug efflux pumps such as P-glycoprotein is associated with drug-resistant phenotypes. Canine lymphoma has many pathological similarities to human non-Hodgkin’s lymphoma, and they also share similar molecular mechanisms of drug resistance. We have previously demonstrated the association of the overexpression of drug transporters with drug resistance and indicated some molecular mechanisms of the regulation of these transporters’ expressions in canine and human lymphoid tumor cells. However, it has also been indicated that other known or novel drug resistance factors should be explored to overcome drug resistance in lymphoma. In this review, we summarize the recent findings on the molecular mechanisms of drug resistance and possible strategies to develop better treatment modalities for canine lymphoma from the comparative aspects with human lymphoid tumors.

  3. Surgical innovations in canine gonadectomy

    OpenAIRE

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated negative consequences (lengthy placement, impaired wound healing around bulky knots, and the effect of unsightly knots on cosmetics). A study in 9 dogs found that celiotomy closure was easily achiev...

  4. Genome Sequence of Canine Herpesvirus.

    Directory of Open Access Journals (Sweden)

    Konstantinos V Papageorgiou

    Full Text Available Canine herpesvirus is a widespread alphaherpesvirus that causes a fatal haemorrhagic disease of neonatal puppies. We have used high-throughput methods to determine the genome sequences of three viral strains (0194, V777 and V1154 isolated in the United Kingdom between 1985 and 2000. The sequences are very closely related to each other. The canine herpesvirus genome is estimated to be 125 kbp in size and consists of a unique long sequence (97.5 kbp and a unique short sequence (7.7 kbp that are each flanked by terminal and internal inverted repeats (38 bp and 10.0 kbp, respectively. The overall nucleotide composition is 31.6% G+C, which is the lowest among the completely sequenced alphaherpesviruses. The genome contains 76 open reading frames predicted to encode functional proteins, all of which have counterparts in other alphaherpesviruses. The availability of the sequences will facilitate future research on the diagnosis and treatment of canine herpesvirus-associated disease.

  5. Nasal commensal Staphylococcus epidermidis counteracts influenza virus

    Science.gov (United States)

    Chen, Hui-Wen; Liu, Pei-Feng; Liu, Yu-Tsueng; Kuo, Sherwin; Zhang, Xing-Quan; Schooley, Robert T.; Rohde, Holger; Gallo, Richard L.; Huang, Chun-Ming

    2016-01-01

    Several microbes, including Staphylococcus epidermidis (S. epidermidis), a Gram-positive bacterium, live inside the human nasal cavity as commensals. The role of these nasal commensals in host innate immunity is largely unknown, although bacterial interference in the nasal microbiome may promote ecological competition between commensal bacteria and pathogenic species. We demonstrate here that S. epidermidis culture supernatants significantly suppressed the infectivity of various influenza viruses. Using high-performance liquid chromatography together with mass spectrometry, we identified a giant extracellular matrix-binding protein (Embp) as the major component involved in the anti-influenza effect of S. epidermidis. This anti-influenza activity was abrogated when Embp was mutated, confirming that Embp is essential for S. epidermidis activity against viral infection. We also showed that both S. epidermidis bacterial particles and Embp can directly bind to influenza virus. Furthermore, the injection of a recombinant Embp fragment containing a fibronectin-binding domain into embryonated eggs increased the survival rate of virus-infected chicken embryos. For an in vivo challenge study, prior Embp intranasal inoculation in chickens suppressed the viral titres and induced the expression of antiviral cytokines in the nasal tissues. These results suggest that S. epidermidis in the nasal cavity may serve as a defence mechanism against influenza virus infection. PMID:27306590

  6. Alkylation and Carbamylation Effects of Lomustine and Its Major Metabolites and MGMT Expression in Canine Cells

    Directory of Open Access Journals (Sweden)

    Thushara Chakkath

    2015-04-01

    Full Text Available DNA Alkylation is thought to be the reason for the efficacy of lomustine while carbamylation has been implicated as the cause for the side effects seen with lomustine treatment such as hepatotoxicity. In the alkylation study we show that lomustine and its metabolites form similar levels of the DNA adducts N7 hydroxyethylguanine and O6 hydroxyethyldeoxyguanosine. In terms of carbamylation, lomustine showed greater extent of carbamylation in the canine hepatocytes and lymphoma cell lines. The DNA repair enzyme O6 methylguanine DNA methyltransferase (MGMT causes resistance of tumor cells to bifunctional nitrosourea, like lomustine. There is no data available regarding MGMT expression/activity in canine cells or tissues. Our study shows that there is low MGMT activity in the canine lymphoid cell line 17–71 while the GL-1 cells did not show any detectable enzyme activity or mRNA expression. The MGMT enzyme activity measured in canine hepatocytes is about 250–350 fmol/mg protein as compared to about 90 fmol/mg protein in 17–71 cells. We also show that MGMT mRNA expression in 17–71 cells and canine hepatocytes positively correlates with its enzyme activity in these cells.

  7. Impact of facial conformation on canine health: corneal ulceration.

    Directory of Open Access Journals (Sweden)

    Rowena M A Packer

    Full Text Available Concern has arisen in recent years that selection for extreme facial morphology in the domestic dog may be leading to an increased frequency of eye disorders. Corneal ulcers are a common and painful eye problem in domestic dogs that can lead to scarring and/or perforation of the cornea, potentially causing blindness. Exaggerated juvenile-like craniofacial conformations and wide eyes have been suspected as risk factors for corneal ulceration. This study aimed to quantify the relationship between corneal ulceration risk and conformational factors including relative eyelid aperture width, brachycephalic (short-muzzled skull shape, the presence of a nasal fold (wrinkle, and exposed eye-white. A 14 month cross-sectional study of dogs entering a large UK based small animal referral hospital for both corneal ulcers and unrelated disorders was carried out. Dogs were classed as affected if they were diagnosed with a corneal ulcer using fluorescein dye while at the hospital (whether referred for this disorder or not, or if a previous diagnosis of corneal ulcer(s was documented in the dogs' histories. Of 700 dogs recruited, measured and clinically examined, 31 were affected by corneal ulcers. Most cases were male (71%, small breed dogs (mean± SE weight: 11.4±1.1 kg, with the most commonly diagnosed breed being the Pug. Dogs with nasal folds were nearly five times more likely to be affected by corneal ulcers than those without, and brachycephalic dogs (craniofacial ratio <0.5 were twenty times more likely to be affected than non-brachycephalic dogs. A 10% increase in relative eyelid aperture width more than tripled the ulcer risk. Exposed eye-white was associated with a nearly three times increased risk. The results demonstrate that artificially selecting for these facial characteristics greatly heightens the risk of corneal ulcers, and such selection should thus be discouraged to improve canine welfare.

  8. Establishment of canine hemangiosarcoma xenograft models expressing endothelial growth factors, their receptors, and angiogenesis-associated homeobox genes

    International Nuclear Information System (INIS)

    Human hemangiosarcoma (HSA) tends to have a poor prognosis; its tumorigenesis has not been elucidated, as there is a dearth of HSA clinical specimens and no experimental model for HSA. However, the incidence of spontaneous HSA is relatively high in canines; therefore, canine HSA has been useful in the study of human HSA. Recently, the production of angiogenic growth factors and their receptors in human and canine HSA has been reported. Moreover, the growth-factor environment of HSA is very similar to that of pathophysiological angiogenesis, which some homeobox genes regulate in the transcription of angiogenic molecules. In the present study, we established 6 xenograft canine HSA tumors and detected the expression of growth factors, their receptors, and angiogenic homeobox genes. Six primary canine HSAs were xenografted to nude mice subcutaneously and serially transplanted. Subsequently, the expressions of vascular endothelial growth factor (VEGF)-A, basic fibroblast growth factors (bFGF), flt-1 and flk-1 (receptors of VEGF-A), FGFR-1, and angiogenic homeobox genes HoxA9, HoxB3, HoxB7, HoxD3, Pbx1, and Meis1 were investigated in original and xenograft tumors by histopathology, immunostaining, and reverse transcription polymerase chain reaction (RT-PCR), using canine-specific primer sets. Histopathologically, xenograft tumors comprised a proliferation of neoplastic cells that were varied in shape, from spindle-shaped and polygonal to ovoid; some vascular-like structures and vascular clefts of channels were observed, similar to those in the original tumors. The expression of endothelial markers (CD31 and vWF) was detected in xenograft tumors by immunohistochemistry and RT-PCR. Moreover, the expression of VEGF-A, bFGF, flt-1, flk-1, FGFR-1, HoxA9, HoxB3, HoxB7, HoxD3, Pbx1, and Meis1 was detected in xenograft tumors. Interestingly, expressions of bFGF tended to be higher in 3 of the xenograft HSA tumors than in the other tumors. We established 6 xenograft canine HSA

  9. Study of Effect of Resection of Cephalic Portion of Nasal Alar Cartilage on Nasal Tip Rotation

    Directory of Open Access Journals (Sweden)

    N Berjis

    2005-11-01

    Full Text Available Background: One of the most common techniques of nasal tip surgery in rhinoplasty is conservative resection of cephalic portion of nasal alar cartilage; although, there is a controversy about its effectiveness on nasal tip rotation in textbooks and articles. Therefore, in this research, we have studied the effect of conservative resection of cephalic portion of alar cartilage on nasal tip rotation. Methods: 35 patients were selected from the patients who were candidates for septoplasty, after getting their agreement. In surgery we performed conservative resection of cephalic portion of alar cartilage. Nasolabial angles were calculated, using the lateral photographs of the patients before and six monthes after surgery. The means of these angles were analyzed with t-paired test. Results: The means and standard deviations of nasolabial angles before and six months after surgery were 91.49±7.35 and 91.57±7.04, respectively. Calculated P-value was 0.52. Conclusion: There was no meaningful difference between means of nasolabial angles before and six months after surgery (P-value was greater than 0.05. Therefore, in this research we concluded that conservative resection of cephalic portion of alar cartilage has no effect on nasal tip rotation. Key words: nasal alar cartilage, nasolabial angle, nasal tip

  10. Prenatal diagnosis of a nasal glioma.

    Science.gov (United States)

    Grzegorczyk, Véronica; Brasseur-Daudruy, Marie; Labadie, Gérard; Cellier, Cécile; Verspyck, Eric

    2010-10-01

    Nasal glioma is a rare congenital midline malformation composed of heterotopic masses of neuroglial tissue. We report a case of fetal nasal glioma diagnosed by sonography at 22 weeks' gestation as a vascular hypoechoic mass located on the left nasal bone. Fetal MRI excluded an underlying bone defect. At birth, the lesion appeared as a reddish mass. Post natal imaging confirmed the vascularisation within the lesion with an arterial low-flow velocity and a high-resistance spectrum, consistent with a glioma. The child underwent surgery at 5 months and final diagnosis was made on pathological examination. Therefore, a vascular lesion and a clinical aspect mimicking a haemangioma should not be considered sufficient to reach the final diagnosis. PMID:20401478

  11. Paediatric nasal polyps in cystic fibrosis.

    Science.gov (United States)

    Mohd Slim, Mohd Afiq; Dick, David; Trimble, Keith; McKee, Gary

    2016-01-01

    Patients with cystic fibrosis (CF) are at increased risk of nasal polyps. We present the case of a 17-month-old Caucasian patient with CF who presented with hypertelorism causing cycloplegic astigmatism, right-sided mucoid discharge, snoring and noisy breathing. Imaging suggested bilateral mucoceles in the ethmoid sinuses. Intraoperatively, bilateral soft tissue masses were noted, and both posterior choanae were patent. Polypectomy and bilateral mega-antrostomies were performed. Histological examination revealed inflammatory nasal polyposis typical of CF. The role of early functional endoscopic sinus surgery (FESS) in children with CF nasal polyposis remains questionable as the recurrence rate is higher, and no improvement in pulmonary function has been shown. Our case, however, clearly demonstrates the beneficial upper airway symptom relief and normalisation of facial appearance following FESS in a child with this condition. PMID:27329094

  12. Nasal Eosinophilic Angiocentric Fibrosis with Orbital Extension.

    Science.gov (United States)

    Faramarzi, Mohammad; Dadgarnia, Mohammad Hossein; Moghimi, Mansour; Sharouny, Hadi; Behniafard, Nasim

    2015-09-01

    Eosinophilic angiocentric fibrosis (EAF) is an extremely rare, chronic, benign, idiopathic disorder that mostly affects the upper respiratory tract, particularly the nasal cavity, and features progressive submucosal perivascular fibrosis. To the best of our knowledge, only seven cases of EAF with orbital involvement have been reported. We report a case of sinonasal EAF with orbital extension that presented with left nasolacrimal duct obstruction. A 35-year-old man presented with left epiphora, proptosis, anterolateral globe displacement and nasal obstruction. Endoscopic sinus examination showed a firm, gritty, creamy, yellow, fibrous, adherent mass of maxillary sinus. Diagnosis was established with histopathological examination of excisional biopsy of the lesion. Although EAF is very rare, it should be considered in the differential diagnosis of lesions of upper airway tract, particularly the nasal cavity. Biopsy is necessary for diagnosis and treatment planning. Resecting of the involved tissues completely is essential for prevention of recurrence. PMID:25601283

  13. Discriminating between Nasal and Mouth Breathing

    CERN Document Server

    Curran, Kevin; Coyle, Damian

    2010-01-01

    The recommendation to change breathing patterns from the mouth to the nose can have a significantly positive impact upon the general well being of the individual. We classify nasal and mouth breathing by using an acoustic sensor and intelligent signal processing techniques. The overall purpose is to investigate the possibility of identifying the differences in patterns between nasal and mouth breathing in order to integrate this information into a decision support system which will form the basis of a patient monitoring and motivational feedback system to recommend the change from mouth to nasal breathing. Our findings show that the breath pattern can be discriminated in certain places of the body both by visual spectrum analysis and with a Back Propagation neural network classifier. The sound file recoded from the sensor placed on the hollow in the neck shows the most promising accuracy which is as high as 90%.

  14. Nodular Epiescleritis Granulomatous Canine. Case Report

    Directory of Open Access Journals (Sweden)

    Camilo Guarín Patarroyo

    2011-12-01

    Full Text Available Granulomatous epiescleritis nodular disease in canines is a very unusual presentation that affects or external fibrous tunic of the eyeball and conjunctiva, which was an increase similar to a unilateral or bilateral tumor. Suspected immune-mediated disease due to lack of identification of an etiologic agent and the response to treatment with immunosuppressive drugs (Couto, 1992. The ideal therapy is the application of steroids via intralesional, topical or systemic, or other immunosuppressants such as cyclosporine and azathioprine; it is still advisable to apply antibiotic is the ideal combination of tetracycline and neomycin (Gilger & Whitley, 1999. The diagnostic method of episcleritis is made by histopathology, which is evident in changes similar to chronic granulomatous inflammation. Are claiming a racial bias in Alsatian, Shepherd Collie Shetland Shepherd, Coker Spaniel, Rottweiler and Labrador Retriever (Gough & Thomas, 2004. The following case is a report of a nodular epiescleritis affecting the cornea, sclera, and the corneoscleral limbus, which describes the diagnosis, signology and treatment.

  15. Nanoparticles for nasal delivery of vaccines : monitoring adaptive immune responses

    NARCIS (Netherlands)

    Keijzer, C.

    2013-01-01

    The continuous emergence of new pathogens and growing drug resistance of microorganisms asks for innovative vaccination strategies. An alternative to conventional multiple injection vaccines is the nasal route of vaccine delivery. The immune response induced following nasal antigen delivery depends

  16. Nasal birth trauma: a review of appropriate treatment.

    LENUS (Irish Health Repository)

    Cashman, E C

    2012-02-01

    The aetiology of nasal deformity has frequently included birth trauma. There is no consensus in the literature as to whether nasal surgery, in the form of closed reduction, is indicated in neonates. The majority of studies in the literature that advocate intervention have inadequate followup periods and there is a paucity of evidence for the adverse effects of conservative management. This case highlights the therapeutic dilemma posed by such nasal injuries in the neonate and, to the best of the authors\\' knowledge, at the time of writing, represents the earliest reported case in the literature of nasal deformity in the neonate. The term nasal deformity is used to denote deformity of the nasal pyramid, soft tissue, and septum. Three main aspects of neonatal nasal deformity are addressed including, firstly, if nasal deformity at birth needs to be addressed, secondly, if left unaltered, what the long-term effects are and, finally, if intervention alters the normal course of midfacial development.

  17. Nasal Birth Trauma: A Review of Appropriate Treatment

    Directory of Open Access Journals (Sweden)

    E. C. Cashman

    2010-01-01

    Full Text Available The aetiology of nasal deformity has frequently included birth trauma. There is no consensus in the literature as to whether nasal surgery, in the form of closed reduction, is indicated in neonates. The majority of studies in the literature that advocate intervention have inadequate followup periods and there is a paucity of evidence for the adverse effects of conservative management. This case highlights the therapeutic dilemma posed by such nasal injuries in the neonate and, to the best of the authors' knowledge, at the time of writing, represents the earliest reported case in the literature of nasal deformity in the neonate. The term nasal deformity is used to denote deformity of the nasal pyramid, soft tissue, and septum. Three main aspects of neonatal nasal deformity are addressed including, firstly, if nasal deformity at birth needs to be addressed, secondly, if left unaltered, what the long-term effects are and, finally, if intervention alters the normal course of midfacial development.

  18. Cytotoxicity of Different Excipients on RPMI 2650 Human Nasal Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Tamás Horváth

    2016-05-01

    Full Text Available The nasal route receives a great deal of attention as a non-invasive method for the systemic administration of drugs. For nasal delivery, specific formulations containing excipients are used. Because of the sensitive respiratory mucosa, not only the active ingredients, but also additives need to be tested in appropriate models for toxicity. The aim of the study was to measure the cytotoxicity of six pharmaceutical excipients, which could help to reach larger residence time, better permeability, and increased solubility dissolution rate. The following excipients were investigated on RPMI 2650 human nasal septum tumor epithelial cells: β-d-mannitol, sodium hyaluronate, α and β-cyclodextrin, polyvinyl alcohol and methylcellulose. 3-(4,5-dimethyltiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT dye conversion assay and real-time impedance analysis were used to investigate cytotoxicity. No excipient showed toxicity at 0.3% (w/v concentration or below while 1% concentration a significantly reduced metabolic activity was measured by MTT assay for methylcellulose and cyclodextrins. Using impedance measurements, only β-cyclodextrin (1% was toxic to cells. Mannitol at 1% concentration had a barrier opening effect on epithelial cells, but caused no cellular damage. Based on the results, all additives at 0.3%, sodium hyaluronate and polyvinyl alcohol at 1% concentrations can be safely used for nasal formulations.

  19. Cyclooxygenase Inhibitor Associated with Carboplatin in Treatment of Metastatic Nasal Carcinoma in Dog

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo Fonseca-Alves

    2014-01-01

    Full Text Available A 10-year-old, intact male, pinscher was presented with unilateral bloodstained nasal discharge, sneezing, dyspnea, zygomatic arch deformity, submandibular lymph node increase, blindness in right eye, and exophthalmia. After clinical examination, it was found that the animal presented with upper respiratory tract dyspnea origin, possibly caused by an obstructive process. Complete blood count (CBC, ocular ultrasonography, thoracic radiographs, mandibular lymph node, and nasal sinus fine needle aspiration were performed. The right mandibular lymph node excisional biopsy was conducted and a tumor sample was obtained through the nasal fistula at hard palate. The material was processed, paraffin embedded, sectioned, and stained with hematoxylin and eosin. Immunohistochemical staining for cytokeratin (AE1/AE3, vimentin, and COX-2 was performed. After histopathological evaluation nasal carcinoma diagnosis was obtained. Chemotherapy was established with carboplatin 300 mg/m2 intravenously—four cycles with intervals of 21 days—and firocoxib 5 mg/kg orally every 24 hours for 7 months. After 7 months the treatment started, the animal presented with ataxia, vocalization, hyperesthesia, and anorexia. Due the clinical condition presented, the animal owner opted for performing euthanasia. The chemotherapy protocol was effective causing the disease stagnation, minimizing the clinical signs, and extending patient survival and quality of life.

  20. Cytotoxicity of Different Excipients on RPMI 2650 Human Nasal Epithelial Cells.

    Science.gov (United States)

    Horváth, Tamás; Bartos, Csilla; Bocsik, Alexandra; Kiss, Lóránd; Veszelka, Szilvia; Deli, Mária A; Újhelyi, Gabriella; Szabó-Révész, Piroska; Ambrus, Rita

    2016-01-01

    The nasal route receives a great deal of attention as a non-invasive method for the systemic administration of drugs. For nasal delivery, specific formulations containing excipients are used. Because of the sensitive respiratory mucosa, not only the active ingredients, but also additives need to be tested in appropriate models for toxicity. The aim of the study was to measure the cytotoxicity of six pharmaceutical excipients, which could help to reach larger residence time, better permeability, and increased solubility dissolution rate. The following excipients were investigated on RPMI 2650 human nasal septum tumor epithelial cells: β-d-mannitol, sodium hyaluronate, α and β-cyclodextrin, polyvinyl alcohol and methylcellulose. 3-(4,5-dimethyltiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) dye conversion assay and real-time impedance analysis were used to investigate cytotoxicity. No excipient showed toxicity at 0.3% (w/v) concentration or below while 1% concentration a significantly reduced metabolic activity was measured by MTT assay for methylcellulose and cyclodextrins. Using impedance measurements, only β-cyclodextrin (1%) was toxic to cells. Mannitol at 1% concentration had a barrier opening effect on epithelial cells, but caused no cellular damage. Based on the results, all additives at 0.3%, sodium hyaluronate and polyvinyl alcohol at 1% concentrations can be safely used for nasal formulations. PMID:27213303

  1. uPAR EXPRESSION IN CANINE NORMAL PROSTATE AND WITH PROLIFERATIVE DISORDERS

    Directory of Open Access Journals (Sweden)

    Mariana Rodrigues Faleiro

    2013-06-01

    Full Text Available Prostatic lesions such as prostatic intraepithelial neoplasia (PIN and proliferative inflammatory atrophy (PIA are studied in human and canine species due to their malignance potential. The plasminogen activator (PA system has been suggested to play a central role in cell adhesion, angiogenesis, inflammation, and tumor invasion. The urokinase-type plasminogen activator receptor (uPAR is a component of the PA, with a range of expression in tumor and stromal cells. In this study, uPAR expression in both canine normal prostates and with proliferative disorders (benign prostatic hyperplasia-BPH, proliferative inflammatory atrophy-PIA, prostatic intraepithelial neoplasia-PIN, and carcinoma-PC was evaluated by immunohistochemistry in a tissue microarray (TMA slide to establish the role of this enzyme in extracellular matrix (ECM remodeling and in the processes of tissue invasion. A total of 298 cores and 355 diagnoses were obtained, with 36 (10.1% normal prostates, 46 (13.0% with BPH, 128 (36.1% with PIA, 74 (20.8% with PIN and 71 (20.0% with PC. There is variation in the expression of uPAR in canine prostate according to the lesion, with lower expression in normal tissue and with BPH, and higher expression in tissue with PIA, PIN and PC. The high expression of uPAR in inflammatory and neoplastic microenvironment indicates increased proteolytic activity in canine prostates with PIA, PIN, and PC.

  2. Intrinsic Radiosensitivity and Cellular Characterization of 27 Canine Cancer Cell Lines.

    Science.gov (United States)

    Maeda, Junko; Froning, Coral E; Brents, Colleen A; Rose, Barbara J; Thamm, Douglas H; Kato, Takamitsu A

    2016-01-01

    Canine cancer cell lines have progressively been developed, but are still underused resources for radiation biology research. Measurement of the cellular intrinsic radiosensitivity is important because understanding the difference may provide a framework for further elucidating profiles for prediction of radiation therapy response. Our studies have focused on characterizing diverse canine cancer cell lines in vitro and understanding parameters that might contribute to intrinsic radiosensitivity. First, intrinsic radiosensitivity of 27 canine cancer cell lines derived from ten tumor types was determined using a clonogenic assay. The 27 cell lines had varying radiosensitivities regardless tumor type (survival fraction at 2 Gy, SF2 = 0.19-0.93). In order to understand parameters that might contribute to intrinsic radiosensitivity, we evaluated the relationships of cellular radiosensitivity with basic cellular characteristics of the cell lines. There was no significant correlation of SF2 with S-phase fraction, doubling time, chromosome number, ploidy, or number of metacentric chromosomes, while there was a statistically significant correlation between SF2 and plating efficiency. Next, we selected the five most radiosensitive cell lines as the radiosensitive group and the five most radioresistant cell lines as the radioresistant group. Then, we evaluated known parameters for cell killing by ionizing radiation, including radiation-induced DNA double strand break (DSB) repair and apoptosis, in the radiosensitive group as compared to the radioresistant group. High levels of residual γ-H2AX foci at the sites of DSBs were present in the four out of the five radiosensitive canine cancer cell lines. Our studies suggested that substantial differences in intrinsic radiosensitivity exist in canine cancer cell lines, and radiation-induced DSB repair was related to radiosensitivity, which is consistent with previous human studies. These data may assist further investigations

  3. Primary Nasal Tuberculosis in a 10-Year-Old Girl

    Science.gov (United States)

    Özer, Murat; Özsurekçi, Yasemin; Cengiz, Ali Bülent; Özçelik, Uğur; Yalçın, Ebru; Gököz, Özay

    2016-01-01

    Nasal tuberculosis is a rare clinical entity which mainly presents in elderly people. Nasal tuberculosis has always been considered to be secondary to tuberculosis of the lungs, and in rare instances it is a primary infection, usually when mycobacteria are inhaled. We describe the case of a 10-year-old girl who was successfully treated for primary nasal tuberculosis. This patient is one of the very few children who have been reported to have primary nasal tuberculosis. PMID:27366187

  4. The use of nasal markers for monitoring mallard populations

    OpenAIRE

    Fabião, António; Rodrigues, David; Figueiredo, Maria

    2001-01-01

    We discuss the advantages and limitations of alphanumeric-coded nasal markers used for monitoring resident mallard populations. We tested two designs of nasal saddles, various colours, PVC tape of 2 thicknesses and ribber tape. The rctangular nasal saddle could disturb birds during feeding, so we changed it to a more anatomical design. The use of alphanumeric coded nasal markers was an efficient method for marking mallards in small wetlands with good visibility and for relatively short periods.

  5. Absorption of acetylsalicylic acid from the rat nasal cavity.

    Science.gov (United States)

    Hussain, A A; Iseki, K; Kagoshima, M; Dittert, L W

    1992-04-01

    The fate of salicylate in the plasma of rats was followed after nasal, intravenous, and oral administration of 2.0-mg doses of aspirin. Aspirin was well absorbed following nasal administration of a neutralized, nonirritating solution containing triethanolamine. The rate of absorption was slower than that of other nasally administered drugs, such as propranolol or progesterone. The bioavailability of aspirin following nasal administration was 100%, whereas the oral bioavailability was only 58.8% at the dose studied. PMID:1501071

  6. Endoscopic removal of nasal septum chondrosarcoma in paediatric patient

    OpenAIRE

    Muhammad Nasri Abu Bakar; Rosdi Ramli; Zulkiflee Salahuddin; Irfan Mohamad

    2014-01-01

    Chondrosarcomas of the head and neck are uncommon malignant tumours of non-epithelial origin. They rarely occur in paediatric age group. The treatment is mainly surgical and adjuvant therapy is only reserved to certain cases. We report a boy with progressive history of nasal obstruction and epistaxis. Nasal endoscopy revealed a mass arising from nasal septum. Endoscopic excision of the tumour was successfully done followed by radiotherapy. Endoscopic excision of chondrosarcoma of the nasal...

  7. 9 CFR 113.306 - Canine Distemper Vaccine.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of...

  8. Canine and feline parasitic zoonoses in China

    Directory of Open Access Journals (Sweden)

    Chen Jia

    2012-07-01

    Full Text Available Abstract Canine and feline parasitic zoonoses have not been given high priority in China, although the role of companion animals as reservoirs for zoonotic parasitic diseases has been recognized worldwide. With an increasing number of dogs and cats under unregulated conditions in China, the canine and feline parasitic zoonoses are showing a trend towards being gradually uncontrolled. Currently, canine and feline parasitic zoonoses threaten human health, and cause death and serious diseases in China. This article comprehensively reviews the current status of major canine and feline parasitic zoonoses in mainland China, discusses the risks dogs and cats pose with regard to zoonotic transmission of canine and feline parasites, and proposes control strategies and measures.

  9. The NOFLO trial: low-flow nasal prongs therapy in weaning nasal continuous positive airway pressure in preterm infants.

    LENUS (Irish Health Repository)

    O'Donnell, Sinéad M

    2013-07-01

    To determine if low-flow nasal prongs therapy with room air, compared with no treatment, facilitates weaning from nasal continuous positive airway pressure (NCPAP) in very low birth weight (VLBW, birth weight <1500 g) infants.

  10. Staphylococcus aureus and the ecology of the nasal microbiome

    DEFF Research Database (Denmark)

    Liu, Cindy M; Price, Lance B; Hungate, Bruce A;

    2015-01-01

    The human microbiome can play a key role in host susceptibility to pathogens, including in the nasal cavity, a site favored by Staphylococcus aureus. However, what determines our resident nasal microbiota-the host or the environment-and can interactions among nasal bacteria determine S. aureus...

  11. Underlying Phoneme Velar Nasal with Lip Rounding in Hueyapan Nahuatl

    Science.gov (United States)

    Campbell, R. Joe

    1976-01-01

    Reasons are given for the idea that Hueyapan (Morelos) Nahuatl has an underlying velar nasal with lip rounding phoneme which never has the surface reflex of a rounded velar nasal allophone, but occurs phonetically as a velar nasal allophone or a labial dental voiced allophone or disappears. (SCC)

  12. 21 CFR 868.5350 - Nasal oxygen catheter.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Nasal oxygen catheter. 868.5350 Section 868.5350...) MEDICAL DEVICES ANESTHESIOLOGY DEVICES Therapeutic Devices § 868.5350 Nasal oxygen catheter. (a) Identification. A nasal oxygen catheter is a device intended to be inserted through a patient's nostril...

  13. 21 CFR 868.5340 - Nasal oxygen cannula.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Nasal oxygen cannula. 868.5340 Section 868.5340...) MEDICAL DEVICES ANESTHESIOLOGY DEVICES Therapeutic Devices § 868.5340 Nasal oxygen cannula. (a) Identification. A nasal oxygen cannula is a two-pronged device used to administer oxygen to a patient...

  14. Prevalência das dermatopatias não-tumorais em cães do município de Santa Maria, Rio Grande do Sul (2005-2008 Prevalence of non-tumorous canine dermatopathies in dogs from the municipality of Santa Maria, Rio Grande do Sul, Brazil (2005-2008

    Directory of Open Access Journals (Sweden)

    Tatiana M. Souza

    2009-02-01

    prevalence of non-tumorous canine dermatopathies affecting dogs from the municipality of Santa Maria, Rio Grande do Sul, Brazil. From March 2005 to June de 2008, the authors followed-up canine dermatological cases from two sources: those referred to the Dermatology Sector of the Veterinary Teaching Hospital at the Universidade Federal de Santa Maria and those from a private practice. During this period 480 dogs with dermatological problems were examined; in 393 (81.9% it was possible to establish a definitive diagnosis and in 87 (18.1% the diagnosis was inconclusive. Four hundred and twenty four primary diagnosis and 78 secondary diagnosis were performed in the 393 dogs with conclusive diagnosis, totaling 502 diagnosis. The distribution of the diagnosis according to the categories of diagnosed dermatopathies was as follows: Allergic (190/502 [37.8%], bacterial (103/502 [20.5%], parasitic (97/502 [19.3%], environmental (28/502 [5,6%], mycotic (20/502 [4.0%], endocrine (13/502 [2.6%], keratinization disturbances (11/502 [2.2%], psychogenic (9/502 [1.8%], acquired alopecias (6/502 [1.2%], autoimmune (6/502 [1.2%], inherited (6/502 [1.2%], pigmentary disturbances (1/502 [0.2%], nutritional (1/502 [0.2%], and sundry conditions (11/502 [2.2%]. In general, the ten most frequently diagnosed non-tumorous dermatopathies in decreasing order of frequency were: Atopy, flea bite allergic dermatitis, bacterial folliculitis, demodectic mange, deep bacterial folliculitis/furunculosis, sarcoptic mange, myiasis, food allergy, traumatic pyoderma, and Malassezia dermatitis. These 10 conditions together made up approximately for three quarters of all canine skin diseases diagnosed in the current study.

  15. Salivary gland anlage tumor in a neonate presenting with respiratory distress: radiographic and pathologic correlation.

    Science.gov (United States)

    Mogensen, M A; Lin, A C; Chang, K W; Berry, G J; Barnes, P D; Fischbein, N J

    2009-05-01

    We present a case of congenital salivary gland anlage tumor (SGAT) of the nasal septum in a 2-week-old infant who had difficulty breathing through her nose since birth. CT and MR imaging demonstrated a circumscribed mass within the nasal cavity that did not communicate with the intracranial compartment. Differential diagnosis and clinical significance of recognizing this rare lesion are reviewed.

  16. Increased levels of interleukins 8 and 10 as findings of canine inflammatory mammary cancer.

    Science.gov (United States)

    de Andrés, Paloma Jimena; Illera, Juan Carlos; Cáceres, Sara; Díez, Lucía; Pérez-Alenza, Maria Dolores; Peña, Laura

    2013-04-15

    Inflammatory mammary cancer (IMC) is a distinct form of mammary cancer that affects dogs and women [in humans, IMC is known as inflammatory breast cancer (IBC)], and is characterized by a sudden onset and an aggressive clinical course. Spontaneous canine IMC shares epidemiologic, histopathological and clinical characteristics with the disease in humans and has been proposed as the best spontaneous animal model for studying IBC, although several aspects remain unstudied. Interleukins (ILs) play an important role in cancer as potential modulators of angiogenesis, leukocyte infiltration and tumor growth. The aims of the present study were to assess serum and tumor levels of several ILs (IL-1α, IL-1β, IL-6, IL-8 and IL-10) by enzyme-immunoassay in dogs bearing benign and malignant mammary tumors, including dogs with IMC, for a better understanding of this disease. Forty-eight dogs were prospectively included. Animals consisted of 7 healthy Beagles used as donors for normal mammary glands (NMG) and serum controls (SCs), 10 dogs with hyperplasias and benign mammary tumors (HBMT), 24 with non-inflammatory malignant mammary tumors (non-IMC MMT) and 7 dogs with clinical and pathological IMC. IL-8 (serum) and IL-10 (serum and tissue homogenate) levels were higher in the dogs with IMC compared with the non-IMC MMT group. ILs were increased with tumor malignancy as follows: in tumor homogenates IL-6 levels were higher in malignant tumors (IMC and non-IMC MMT) versus HBMT and versus NMG and tumor IL-8 was increased in malignant tumors versus NMG; in serum, IL-1α and IL-8 levels were higher in the malignant groups respect to HBMT and SCs; interestingly, IL-10 was elevated only in the serum of IMC animals. To the best of our knowledge, this is the first report that analyzes ILs in IMC and IL-10 in canine mammary tumors. Our results indicate a role for IL-6, IL-8 and IL-10 in canine mammary malignancy and specific differences in ILs content in IMC versus non-IMC MMT that could

  17. Three-dimensional magnetic resonance reconstruction images before and after surgical therapy of spontaneous canine brain tumors Imagens de reconstrução tri-dimensional por ressonância magnética antes e depois de tratamento cirúrgico de tumores cerebrais espontâneos caninos

    Directory of Open Access Journals (Sweden)

    Julio Carlos Canola

    2007-08-01

    Full Text Available Specific software was used for reconstruction of spontaneous intracranial tumor volume from magnetic resonance images (MRI in three dogs. Histopathologically confirmed meningioma, cystic meningioma, and choroid plexus tumors were evaluated before and after surgery. The software allowed the whole-volume segmentation of the skin, brain, tumor, edema, and cyst. Manipulation of the three-dimensional images (3D allowed visualization of all anatomical structures, aided clinical understanding, surgical planning, and treatment monitoring.Um programa de computador específico foi utilizado para reconstrução do volume tumoral intracraniano espontâneo por imagens de ressonância magnética (IRM em três cães. Tumores histopatologicamente confirmados como meningioma, meningioma cístico e tumor do plexo coróide foram avaliados antes e após cirurgia. O programa de computador permitiu a segmentação por completo da pele, do cérebro, do tumor, do edema e do cisto. A manipulação das imagens tridimensionais permitiu a visibilização de todas as estruturas anatômicas, além da compreensão clínica, do planejamento cirúrgico e da monitorização do tratamento.

  18. High Flow Nasal Cannulae in preterm infants

    Directory of Open Access Journals (Sweden)

    F. Ciuffini

    2013-06-01

    Full Text Available Despite of improved survival of premature infants, the incidence of long term pulmonary complications, mostly associated with ventilation-induced lung injury, remains high. Non invasive ventilation (NIV is able to reduce the adverse effects of mechanical ventilation. Although nasal continuous positive airway pressure (NCPAP is an effective mode of NIV, traumatic nasal complications and intolerance of the nasal interface are common. Recently high flow nasal cannula (HFNC is emerging as an efficient, better tolerated form of NIV, allowing better access to the baby’s face, which may improve nursing, feeding and bonding. The aim of this review is to discuss the available evidence of effectiveness and safety of HFNC in preterm newborns with respiratory distress syndrome (RDS. It is known that distending pressure generated by HFNC increases with increasing flow rate and decreasing infant size and varies according to the amount of leaks by nose and mouth. The effects of HFNC on lung mechanics, its clinical efficacy and safety are still insufficiently investigated. In conclusion, there is a growing evidence of the feasibility of HFNC as an alternative mode of NIV. However, further larger randomized trials are required, before being able to recommend HFNC in the treatment of moderate respiratory distress of preterm infants.

  19. Measurement of secretion in nasal lavage

    DEFF Research Database (Denmark)

    Bisgaard, H; Krogsgaard, O W; Mygind, N

    1987-01-01

    for repeated use in humans. 4. The nasal lavage technique adopted allowed the return of 99.2% (median value) of the instilled volume. The area irrigated was visualized on a gamma-camera, and was demonstrated to cover an area larger than the area reached by challenge from a pumpspray, i.e. a large part...

  20. Pleomorphic adenoma of the nasal septum

    OpenAIRE

    Saxena, Sunil Kumar; Gopalakrishnan, S

    2003-01-01

    Despite the common occurrence of pleomorphic adenoma of major salivary glands, intranasal pleomorphic adenoma are rare. We present a ease of pleomorphic adenoma of the nasal septum along with a brief review of literature. The histological nature of this lesion in comparison to other salivary gland tumours and the importance of an accurate diagnosis has been stressed.

  1. Fracture of nasal bones: an epidemiologic analysis

    Directory of Open Access Journals (Sweden)

    Fornazieri, Marco Aurélio

    2008-12-01

    Full Text Available Introduction: One of the most common diseases in the otorhinolaryngology emergency room is the nasal bones fracture. The peak of incidence is between 15 and 25 years of age. Generally men are more affected. Objective: To analyze the age, gender and the most frequent causes of nasal fractures evaluated in the otorhinolaryngology service of a tertiary hospital. Method: Retrospective study of records of the patients with nasal fracture diagnosis treated between July 1st, 2003 and July 1st, 2007. Results: 167 patients with nasal bones fracture were included in the study, including 134 men and 33 women. Violence was the most frequent cause, with 55 cases (32.9%, followed by fall from their own height, with 33 cases (19.7%, and motorcycle accident, 14 cases (8.4%. The most common age was between 21 and 39 years (46.1%. Conclusion: Male, age between 21 and 39 years and violence are the most common characteristics found in our service. Motorcycle accidents also play an important role in this affection.

  2. Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

    International Nuclear Information System (INIS)

    Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

  3. Objective Measures in Aesthetic and Functional Nasal Surgery – Perspectives on Nasal Form and Function

    OpenAIRE

    Pawar, Sachin S.; Garcia, Guilherme J. M.; Kimbell, Julia S.; Rhee, John S.

    2010-01-01

    The outcomes of aesthetic and functional nasal surgery are difficult to assess objectively due to the intricate balance between nasal form and function. Despite historical emphasis on patient-reported subjective measures, objective measures are gaining importance in both research and the current outcomes-driven healthcare environment. Objective measures presently available have several shortcomings which limit their routine clinical use. In particular, the low correlation between objective an...

  4. CANINE DISTEMPER VIRUS ANTIBODY TITERS IN DOMESTIC CATS AFTER DELIVERY OF A LIVE ATTENUATED VIRUS VACCINE.

    Science.gov (United States)

    Ramsay, Edward; Sadler, Ryan; Rush, Robert; Seimon, Tracie; Tomaszewicz, Ania; Fleetwood, Ellen A; McAloose, Denise; Wilkes, Rebecca P

    2016-06-01

    Three methods for delivering a live attenuated canine distemper virus (CDV) vaccine to domestic cats ( Felis catus ) were investigated, as models for developing vaccination protocols for tigers (Panthera tigris). Twenty domestic cats were randomly divided into four treatment groups: saline injection (negative controls); and oral, intranasal, and subcutaneous vaccinates. Cats were injected with saline or a CDV vaccine (Nobivac DP, Merck) at wk 0 and 4. Blood and nasal swabs were collected at wk 0 (prior to the initial vaccination) and weekly thereafter for 9 wk. Urine samples were collected on wk 1 to 9 after initial vaccination. Forty-nine weeks following the initial vaccination series, three cats from the subcutaneous group and three cats from the intranasal group were revaccinated. Blood was collected immediately prior, and 7 and 21 days subsequent to revaccination. Nasal swabs and urine samples were collected from each cat prior to wk 49 revaccination and daily for 7 days thereafter. Nasal swabs and urine were analyzed by quantitative PCR for vaccine virus presence. Sera were tested for CDV antibodies by virus neutralization. All cats were sero-negative for CDV antibodies at the beginning of the study, and saline-injected cats remained sero-negative throughout the study. A dramatic anamnestic response was seen following wk 4 subcutaneous vaccinations, with titers peaking at wk 6 (geometric mean = 2,435.5). Following wk 49 revaccination, subcutaneous vaccinates again mounted impressive titers (wk 52 geometric mean = 2,048). Revaccination of the intranasal group cats at wk 49 produced a small increase in titers (wk 52 geometric mean = 203). CDV viral RNA was detected in six nasal swabs but no urine samples, demonstrating low viral shedding postvaccination. The strong antibody response to subcutaneous vaccination and the lack of adverse effects suggest this vaccine is safe and potentially protective against CDV infection in domestic cats. PMID:27468028

  5. Coblation nasal septal swell body reduction for treatment of nasal obstruction: a preliminary report.

    Science.gov (United States)

    Kim, So Jeong; Kim, Hee Tae; Park, Yun Hwi; Kim, Ju Yeon; Bae, Jung Ho

    2016-09-01

    In this paper, we present the results of coblation nasal septal swell body (NSB) reduction for the treatment of nasal obstruction in patients with abnormally thickened NSB. The study design was a retrospective clinical series conducted at a single tertiary medical center. Eight patients underwent coblation NSB reduction. Pre-operative and post-operative nasal functions were evaluated by acoustic rhinometry and subjective symptom scales. We also analyzed pre-operative CT scan images and nasal endoscopic findings. The mean maximal NSB width was 16.4 ± 2.2 mm on pre-operative coronal CT scan images. The mean visual analog scale score for nasal obstruction was decreased from preoperative 7.63 ± 0.99 points to 3.88 ± 0.92 points (postoperative 3 months), 4.16 ± 0.78 points (postoperative 6 months), and 4.63 ± 0.69 points (postoperative 1 year). Six out of the eight patients were satisfied with the clinical outcome at 1 year after the procedure. To the best of our knowledge, coblation NSB reduction has not yet been reported in the medical literature. Our results show that it can be an effective treatment modality for nasal valve narrowing in patients with abnormally thickened NSB. PMID:26912145

  6. Coblation nasal septal swell body reduction for treatment of nasal obstruction: a preliminary report.

    Science.gov (United States)

    Kim, So Jeong; Kim, Hee Tae; Park, Yun Hwi; Kim, Ju Yeon; Bae, Jung Ho

    2016-09-01

    In this paper, we present the results of coblation nasal septal swell body (NSB) reduction for the treatment of nasal obstruction in patients with abnormally thickened NSB. The study design was a retrospective clinical series conducted at a single tertiary medical center. Eight patients underwent coblation NSB reduction. Pre-operative and post-operative nasal functions were evaluated by acoustic rhinometry and subjective symptom scales. We also analyzed pre-operative CT scan images and nasal endoscopic findings. The mean maximal NSB width was 16.4 ± 2.2 mm on pre-operative coronal CT scan images. The mean visual analog scale score for nasal obstruction was decreased from preoperative 7.63 ± 0.99 points to 3.88 ± 0.92 points (postoperative 3 months), 4.16 ± 0.78 points (postoperative 6 months), and 4.63 ± 0.69 points (postoperative 1 year). Six out of the eight patients were satisfied with the clinical outcome at 1 year after the procedure. To the best of our knowledge, coblation NSB reduction has not yet been reported in the medical literature. Our results show that it can be an effective treatment modality for nasal valve narrowing in patients with abnormally thickened NSB.

  7. Genome aberrations in canine mammary carcinomas and their detection in cell-free plasma DNA.

    Directory of Open Access Journals (Sweden)

    Julia Beck

    Full Text Available Mammary tumors are the most frequent cancers in female dogs exhibiting a variety of histopathological differences. There is lack of knowledge about the genomes of these common dog tumors. Five tumors of three different histological subtypes were evaluated. Massive parallel sequencing (MPS was performed in comparison to the respective somatic genome of each animal. Copy number and structural aberrations were validated using droplet digital PCR (ddPCR. Using mate-pair sequencing chromosomal aneuploidies were found in two tumors, frequent smaller deletions were found in one, inter-chromosomal fusions in one other, whereas one tumor was almost normal. These aberrations affect several known cancer associated genes such as cMYC, and KIT. One common deletion of the proximal end of CFA27, harboring the tumor suppressor gene PFDN5 was detected in four tumors. Using ddPCR, this deletion was validated and detected in 50% of tumors (N = 20. Breakpoint specific dPCRs were established for four tumors and tumor specific cell-free DNA (cfDNA was detected in the plasma. In one animal tumor-specific cfDNA was found >1 year after surgery, attributable to a lung metastasis. Paired-end sequencing proved that copy-number imbalances of the tumor are reflected by the cfDNA. This report on chromosomal instability of canine mammary cancers reveals similarities to human breast cancers as well as special canine alterations. This animal model provides a framework for using MPS for screening for individual cancer biomarkers with cost effective confirmation and monitoring using ddPCR. The possibility exists that ddPCR can be expanded to screening for common cancer related variants.

  8. Elevation of soluble interleukin-2 receptor levels in nasal allergy

    OpenAIRE

    Hisamatsu, K.; T. Ganbo; Nakazawa, T; S. Horiguchi; Shimomura, S; Murakami, Y.

    1995-01-01

    To investigate soluble IL-2 receptor (sIL-2R) levels in nasal allergy, the sera and nasal secretions from patients with nasal allergy and from healthy subjects were subjected to a double-epitope enzyme-linked immunosorbent assay. Significant elevation of sIL-2R concentrations in the sera and nasal secretions was observed in the allergy patients (n = 26) compared with those of healthy subjects (n = 9). IL-2R-positive (CD25+) cells were observed in the crust formed in an allergic nasal mucosa. ...

  9. Nasal surgery in patients with systemic disorders

    Directory of Open Access Journals (Sweden)

    Sachse, Florian

    2010-01-01

    Full Text Available Multisystemic disorders represent a heterogenous group of diseases which can primarily manifest at the nose and paranasal sinuses as limited disease or secondarily as part of systemic involvement. Rhinologists therefore play an important role in the diagnostic but also therapeutic process. Although therapy of multisystemic disorders is primary systemic, additional rhinosurgery may become necessary. The spectrum of procedures consists of sinus surgery, surgery of the orbit and lacrimal duct, septorhinoplasty and closure of nasal septal perforation. Since the prevalence of most systemic diseases is very rare, recommendations are based on the analysis of single case reports and case series with a limited number of patients only. Although data is still limited, experiences published so far have shown that autologous cartilage or bone grafts can be used in nasal reconstruction of deformities caused by tuberculosis, leprosy, Wegener’s granulomatosis, sarcoidosis and relapsing polychondritis. Experiences gained from these diseases support the concept that well-established techniques of septorhinoplasty can be used in systemic diseases as well. However, a state of remission is an essential condition before considering any rhinosurgery in these patients. Even under these circumstances revision surgery has to be expected more frequently compared to the typical collective of patients undergoing septorhinoplasty. In addition, experiences gained from saddle nose reconstruction may in part be of value for the treatment of nasal septal perforations since implantation of cartilage grafts often represents an essential step in multilayer techniques of closure of nasal septal perforations. Aside from the treatment of orbital complications sinus surgery has been proven beneficial in reducing nasal symptoms and increasing quality of life in patients refractory to systemic treatment.

  10. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies

    OpenAIRE

    J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides

    2002-01-01

    Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...

  11. RECENT TECHNIQUES IN NASAL DRUG DELIVERY: A REVIEW

    Directory of Open Access Journals (Sweden)

    Parmar Harshad

    2010-09-01

    Full Text Available Nasal drug administration has been used as an alternative route for the systemic availability of drugs restricted to intravenous administration. This is due to the large surface area, porous endothelial membrane, high total blood flow, the avoidance of first-pass metabolism, and ready accessibility. The nasal administration of drugs, including numerous compound, peptide and protein drugs, for systemic medication has been widely investigated in recent years. Drugs are cleared rapidly from the nasal cavity after intranasal administration, resulting in rapid systemic drug absorption. Approaches are discussed here for increasing the residence time of drug formulations in the nasal cavity, resulting in improved nasal drug absorption. The article highlights the importance and advantages of the nasal drug delivery systems stressed upon bioadhesive properties. Bioadhesive, or more appropriately, mucoadhesive systems have been prepared for both oral and peroral administration in the past. The nasal mucosa presents an ideal site for bioadhesive drug delivery systems. In this review we discuss the effects of microspheres and other bioadhesive drug delivery systems on nasal drug absorption. Drug delivery systems, such as microspheres, liposomes and gels have been demonstrated to have good bioadhesive characteristics which swell easily when in contact with the nasal mucosa. These drug delivery systems have the ability to control the rate of drug clearance from the nasal cavity as well as protect the drug from enzymatic degradation in nasal secretions.

  12. Free Auricular Composite Graft for Acquired Nasal Stenosis

    Science.gov (United States)

    Riley, Charles A.; Lawlor, Claire M.; Gray, Mingyang Liu; Graham, H. Devon

    2016-01-01

    Background: Acquired nasal stenosis poses a reconstructive challenge for the facial plastic surgeon. Many surgical options are available, ranging from primary closure to skin grafts to free flap reconstruction for complex defects. The free auricular composite graft is a single-stage procedure that can be used to repair nasal vestibular stenosis causing nasal obstruction. Case Report: We present the case of a patient with acquired nasal stenosis as a result of prolonged nasal tampon placement secondary to severe epistaxis and subsequent nasal vestibular infection. Repair via auricular composite graft was successful, and we provide a thorough explanation of graft design and operative technique. Conclusion: Free auricular composite grafts can produce desirable functional and aesthetic outcomes and should be considered in patients presenting with acquired nasal stenosis. PMID:27303225

  13. Evaluation of the nasal shape after orthognathic surgery

    Directory of Open Access Journals (Sweden)

    Wagner Ranier Maciel Dantas

    2015-02-01

    Full Text Available Introduction: Patients with dentofacial deformities may benefit from orthognathic surgery in the maxilla. Maxillary osteotomy may include procedures in the bone, cartilaginous, and soft tissues of the nose, leading to shape alterations. Objective: To evaluate the anatomic alterations of the nasal region in patients undergoing a Le Fort I osteotomy for advancement or superior impaction. Methods: This is a clinical prospective study. Twenty-one patients were evaluated during the preand postoperative periods. The positioning of the nasal tip and the modification of the nasal base were evaluated. Results: The results showed that the nasal tip was superiorly positioned in 85% of the cases, advanced in 80%, rotated in 80%, and there was a wide nasal base in 95%, resulting in esthetic improvement. Conclusions: Surgeries of maxillary advancement and superior reposition tend to cause elevation and advancement of the nasal tip, as well as enlargement of the nasal base.

  14. Canine Mammary Carcinomas: A Comparative Analysis of Altered Gene Expression

    Directory of Open Access Journals (Sweden)

    Farruk M. Lutful Kabir

    2015-12-01

    Full Text Available Breast cancer represents the second most frequent neoplasm in humans and sexually intact female dogs after lung and skin cancers, respectively. Many similar features in human and dog cancers including, spontaneous development, clinical presentation, tumor heterogeneity, disease progression and response to conventional therapies have supported development of this comparative model as an alternative to mice. The highly conserved similarities between canine and human genomes are also key to this comparative analysis, especially when compared to the murine genome. Studies with canine mammary tumor (CMT models have shown a strong genetic correlation with their human counterparts, particularly in terms of altered expression profiles of cell cycle regulatory genes, tumor suppressor and oncogenes and also a large group of non-coding RNAs or microRNAs (miRNAs. Because CMTs are considered predictive intermediate models for human breast cancer, similarities in genetic alterations and cancer predisposition between humans and dogs have raised further interest. Many cancer-associated genetic defects critical to mammary tumor development and oncogenic determinants of metastasis have been reported and appear to be similar in both species. Comparative analysis of deregulated gene sets or cancer signaling pathways has shown that a significant proportion of orthologous genes are comparably up- or down-regulated in both human and dog breast tumors. Particularly, a group of cell cycle regulators called cyclin-dependent kinase inhibitors (CKIs acting as potent tumor suppressors are frequently defective in CMTs. Interestingly, comparative analysis of coding sequences has also shown that these genes are highly conserved in mammals in terms of their evolutionary divergence from a common ancestor. Moreover, co-deletion and/or homozygous loss of the INK4A/ARF/INK4B (CDKN2A/B locus, encoding three members of the CKI tumor suppressor gene families (p16/INK4A, p14ARF and p15

  15. Proton Beam Therapy for Unresectable Malignancies of the Nasal Cavity and Paranasal Sinuses

    Energy Technology Data Exchange (ETDEWEB)

    Zenda, Sadamoto, E-mail: szenda@east.ncc.go.jp [Division of Radiation Oncology, National Cancer Center Hospital East, Chiba (Japan); Kohno, Ryosuke; Kawashima, Mitsuhiko; Arahira, Satoko; Nishio, Teiji [Division of Radiation Oncology, National Cancer Center Hospital East, Chiba (Japan); Tahara, Makoto [Division of Gastrointestinal Oncology and Endoscopy, National Cancer Center Hospital East, Chiba (Japan); Hayashi, Ryuichi [Division of Head and Neck Surgery, National Cancer Center Hospital East, Chiba (Japan); Kishimoto, Seiji [Department of Head and Neck Surgery, Tokyo Medical and Dental University, Tokyo (Japan); Ogino, Takashi [Division of Radiation Oncology, National Cancer Center Hospital East, Chiba (Japan)

    2011-12-01

    Purpose: The cure rate for unresectable malignancies of the nasal cavity and paranasal sinuses is low. Because irradiation with proton beams, which are characterized by their rapid fall-off at the distal end of the Bragg peak and sharp lateral penumbra, depending on energy, depth, and delivery, provide better dose distribution than X-ray irradiation, proton beam therapy (PBT) might improve treatment outcomes for conditions located in proximity to risk organs. We retrospectively analyzed the clinical profile of PBT for unresectable malignancies of the nasal cavity and paranasal sinuses. Methods and Materials: We reviewed 39 patients in our database fulfilling the following criteria: unresectable malignant tumors of the nasal cavity, paranasal sinuses or skull base; N0M0 disease; and treatment with PBT (>60 GyE) from January 1999 to December 2006. Results: Median patient age was 57 years (range, 22-84 years); 22 of the patients were men and 17 were women. The most frequent primary site was the nasal cavity (n = 26, 67%). The local control rates at 6 months and 1 year were 84.6% and 77.0%, respectively. With a median active follow-up of 45.4 months, 3-year progression-free and overall survival were 49.1% and 59.3%, respectively. The most common acute toxicities were mild dermatitis (Grade 2, 33.3%), but no severe toxicity was observed (Grade 3 or greater, 0%). Five patients (12.8%) experienced Grade 3 to 5 late toxicities, and one treatment-related death was reported, caused by cerebrospinal fluid leakage Grade 5 (2.6%). Conclusion: These findings suggest that the clinical profile of PBT for unresectable malignancies of the nasal cavity and paranasal sinuses make it is a promising treatment option.

  16. Surgical Treatment and Recurrence of Cutaneous Nasal Malignancies: A 26-Year Retrospective Review of 1795 Patients.

    Science.gov (United States)

    Christopoulos, George; Sergentanis, Theodoros N; Karantonis, Fotis; Karypidis, Dimitrios; Hampsas, Grigoris; Kostopoulos, Epaminondas; Kostaki, Maria; Papadopoulos, Othon

    2016-08-01

    Frequent localization of facial malignancies in the nasal area and their required complete surgical extirpation pose a significant challenge to the plastic surgeon, who is called to perform a suitable delicate reconstruction of produced nasal skin defects. The present study was aimed to examine the role of tumor characteristics in the prognosis of patients with nasal skin cancer undergoing surgical management.A retrospective review of 1795 patients operated on for nasal cutaneous neoplasms during a 26-year period is presented in our study. Descriptive statistics were appropriately calculated; multivariate Cox regression analysis was performed regarding the possible risk factors for recurrence. Only those with a complete follow-up were included in the study. The mean age of our study population was 66.7 years with a male majority (52.4%). Basal cell carcinoma appeared as the most common histological type (87.7%), followed by squamous cell carcinoma (7.9%); the latter correlated with poor prognosis.The nasal sidewalls were the most frequent lesion location (29.8%), followed by the alae (27.8%), dorsum (21.7%), and tip (19.3%). The columella was very rarely affected (0.5%) but was associated with increased recurrence [hazard ratio, 4.74; 95% confidence interval (CI), 1.12-20.00; P = 0.034]. Most patients were treated with elliptical excision and direct closure (58.7%). Local flaps (31.0%) and skin grafting (9.0%) proved very reliable surgical options, especially for larger, high-risk lesions. Recurrence transpired in 46 patients (2.6%) and 4 skin cancer-related deaths occurred.Surgical modality of choice should be individualized and carefully adjusted to patients' needs. Moreover, more elective techniques, such as Mohs micrographic surgery or cumulative therapeutic approaches, like irradiation, should be examined as a beneficial aid to confront high-risk malignancies. PMID:26207539

  17. Prognostic markers of canine pyometra

    Directory of Open Access Journals (Sweden)

    M.C. Sant'Anna

    2014-12-01

    Full Text Available The pyometra is a disease that affects middle age and elderly female dogs during diestrus. Hormonal, microbiological, biochemical and hematological aspects are well described. However, few studies have evaluated the role of each in the prognosis of canine pyometra. The aim of this study was to identify markers associated with clinical worsening of dogs with pyometra. We prospectively evaluated 80 dogs with pyometra treated surgically. Group 1 consisted of dogs that were discharged within 48 hours after surgery and Group 2 consisted of those who required prolonged hospitalization or died. The findings of hematological, biochemical and blood lactate levels were compared between groups and variables such as bacterial multidrug resistance, systemic inflammatory response syndrome (SIRS, hyperlactatemia and increased creatinine were analyzed through the dispersion of frequencies between groups. Among the variables studied, the presence of SIRS and elevated serum creatinine >2.5mg/mL were effective in predicting the worsening of the disease and can be used as prognostic markers of canine pyometra.

  18. In Vitro Action of Flavonoids in the Canine Malignant Histiocytic Cell Line DH82

    OpenAIRE

    Gabriel Silva; Ana Lúcia Fachin; Beleboni, Renê de O; Suzelei C. França; Mozart Marins

    2013-01-01

    Cancer is commonly diagnosed in dogs over the age of 10 and is a leading cause of death due to the lack of effective drugs. Flavonoids possess antioxidant, anti-inflammatory and anticarcinogenic properties and have been studied as chemopreventive agents in human cancer therapy. However, the literature on dogs is sparse. In this study, we analyzed the effect of nine flavonoids on cell viability, DNA damage and topoisomerase IIa/IIb gene expression in a canine tumor cell line (DH82). Apigenin, ...

  19. Modulation of carbohydrate residues in regenerative nodules and neoplasms of canine and feline pancreas.

    OpenAIRE

    Skutelsky, E.; Alroy, J.; Ucci, A. A.; Carpenter, J.L.; Moore, F. M.

    1987-01-01

    The glycoconjugates of regenerative acinar cells, acinic cell carcinomas, islet cell tumors, and normal canine and feline pancreas were studied. The authors used biotinylated lectins as probes and avidin-biotin-peroxidase complex as visualant to identify and to compare the distribution of carbohydrate residues on paraffin sections from 74 cases. The findings demonstrate a difference in the staining pattern between normal acinar, islet, and ductal cells in each species and small differences in...

  20. Anti-Influenza Neuraminidase Inhibitor Oseltamivir Phosphate Induces Canine Mammary Cancer Cell Aggressiveness

    OpenAIRE

    Joana T de Oliveira; Santos, Ana L.; Catarina Gomes; Rita Barros; Cláudia Ribeiro; Nuno Mendes; de Matos, Augusto J.; M. Helena Vasconcelos; Maria José Oliveira; Celso A Reis; Fátima Gärtner

    2015-01-01

    Oseltamivir phosphate is a widely used anti-influenza sialidase inhibitor. Sialylation, governed by sialyltransferases and sialidases, is strongly implicated in the oncogenesis and progression of breast cancer. In this study we evaluated the biological behavior of canine mammary tumor cells upon oseltamivir phosphate treatment (a sialidase inhibitor) in vitro and in vivo. Our in vitro results showed that oseltamivir phosphate impairs sialidase activity leading to increased sialylation in CMA0...

  1. Effects of Carbenoxolone on the Canine Pituitary-Adrenal Axis.

    Directory of Open Access Journals (Sweden)

    Takahiro Teshima

    Full Text Available Cushing's disease caused by pituitary corticotroph adenoma is a common endocrine disease in dogs. A characteristic biochemical feature of corticotroph adenomas is their relative resistance to suppressive negative feedback by glucocorticoids. The abnormal expression of 11beta-hydroxysteroid dehydrogenase (11HSD, which is a cortisol metabolic enzyme, is found in human and murine corticotroph adenomas. Our recent studies demonstrated that canine corticotroph adenomas also have abnormal expression of 11HSD. 11HSD has two isoforms in dogs, 11HSD type1 (HSD11B1, which converts cortisone into active cortisol, and 11HSD type2 (HSD11B2, which converts cortisol into inactive cortisone. It has been suggested that glucocorticoid resistance in corticotroph tumors is related to the overexpression of HSD11B2. Therefore it was our aim to investigate the effects of carbenoxolone (CBX, an 11HSD inhibitor, on the healthy dog's pituitary-adrenal axis. Dogs were administered 50 mg/kg of CBX twice each day for 15 days. During CBX administration, no adverse effects were observed in any dogs. The plasma adrenocorticotropic hormone (ACTH, and serum cortisol and cortisone concentrations were significantly lower at day 7 and 15 following corticotropin releasing hormone stimulation. After completion of CBX administration, the HSD11B1 mRNA expression was higher, and HSD11B2 mRNA expression was significantly lower in the pituitaries. Moreover, proopiomelanocortin mRNA expression was lower, and the ratio of ACTH-positive cells in the anterior pituitary was also significantly lower after CBX treatment. In adrenal glands treated with CBX, HSD11B1 and HSD11B2 mRNA expression were both lower compared to normal canine adrenal glands. The results of this study suggested that CBX inhibits ACTH secretion from pituitary due to altered 11HSD expressions, and is potentially useful for the treatment of canine Cushing's disease.

  2. Comparative Morphology and Histology of the Nasal Fossa in Four Mammals: Gray Squirrel, Bobcat, Coyote, and White-Tailed Deer.

    Science.gov (United States)

    Yee, Karen K; Craven, Brent A; Wysocki, Charles J; Van Valkenburgh, Blaire

    2016-07-01

    Although the anatomy of the nasal fossa is broadly similar among terrestrial mammals, differences are evident in the intricacies of nasal turbinal architecture, which varies from simple scroll-like to complex branching forms, and in the extent of nonsensory and olfactory epithelium covering the turbinals. In this study, detailed morphological and immunohistochemical examinations and quantitative measurements of the turbinals and epithelial lining of the nasal fossa were conducted in an array of species that include the gray squirrel, bobcat, coyote, and white-tailed deer. Results show that much more of the nose is lined with olfactory epithelium in the smallest species (gray squirrel) than in the larger species. In two species with similar body masses, bobcat and coyote, the foreshortened felid snout influences turbinal size and results in a decrease of olfactory epithelium on the ethmoturbinals relative to the longer canine snout. Ethmoturbinal surface area exceeds that of the maxilloturbinals in all four sampled animals, except the white-tailed deer, in which the two are similar in size. Combining our results with published data from a broader array of mammalian noses, it is apparent that olfactory epithelial surface area is influenced by body mass, but is also affected by aspects of life history, such as diet and habitat, as well as skull morphology, itself a product of multiple compromises between various functions, such as feeding, vision, and cognition. The results of this study warrant further examination of other mammalian noses to broaden our evolutionary understanding of nasal fossa anatomy. Anat Rec, 299:840-852, 2016. © 2016 Wiley Periodicals, Inc. PMID:27090617

  3. Mesenchymal stem cells with rhBMP-2 inhibits the growth of canine osteosarcoma cells

    Directory of Open Access Journals (Sweden)

    Grassi Rici Rose

    2012-02-01

    Full Text Available Abstract Background The bone morphogenetic proteins (BMPs belong to a unique group of proteins that includes the growth factor TGF-β. BMPs play important roles in cell differentiation, cell proliferation, and inhibition of cell growth. They also participate in the maturation of several cell types, depending on the microenvironment and interactions with other regulatory factors. Depending on their concentration gradient, the BMPs can attract various types of cells and act as chemotactic, mitogenic, or differentiation agents. BMPs can interfere with cell proliferation and the formation of cartilage and bone. In addition, BMPs can induce the differentiation of mesenchymal progenitor cells into various cell types, including chondroblasts and osteoblasts. The aim of this study was to analyze the effects of treatment with rhBMP-2 on the proliferation of canine mesenchymal stem cells (cMSCs and the tumor suppression properties of rhBMP-2 in canine osteocarcoma (OST cells. Osteosarcoma cell lines were isolated from biopsies and excisions of animals with osteosarcoma and were characterized by the Laboratory of Biochemistry and Biophysics, Butantan Institute. The mesenchymal stem cells were derived from the bone marrow of canine fetuses (cMSCs and belong to the University of São Paulo, College of Veterinary Medicine (FMVZ-USP stem cell bank. After expansion, the cells were cultured in a 12-well Transwell system; cells were treated with bone marrow mesenchymal stem cells associated with rhBMP2. Expression of the intracytoplasmic and nuclear markers such as Caspase-3, Bax, Bad, Bcl-2, Ki-67, p53, Oct3/4, Nanog, Stro-1 were performed by flow citometry. Results We evaluated the regenerative potential of in vitro treatment with rhBMP-2 and found that both osteogenic induction and tumor regression occur in stem cells from canine bone marrow. rhBMP-2 inhibits the proliferation capacity of OST cells by mechanisms of apoptosis and tumor suppression mediated by p

  4. The effect of nasalization on /a/ vowel formants before and after nasal consonant in 4-9-year old normal Persian speaking children

    OpenAIRE

    Kowsar Baghban; Farhad Torabinezhad; Negin Moradi; Akbar Biglarian

    2014-01-01

    Background and Aim : Nasalization of a vowel refers to the addition of nasal resonance to the vocal tract transfer function. Also, vowel nasalization occurs because of coarticulation. Coupling of the nasal resonating space to the oropharyngeal cavity alters the vocal tract formants in complex ways. The purpose of this study was to investigate the effect of nasalization on /a/ vowel formants in before and after nasal consonant.Methods: In current cross-sectional study, voice samples of 60 norm...

  5. Extrusion processing : effects on dry canine diets

    NARCIS (Netherlands)

    Tran, Q.D.

    2008-01-01

    Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying. Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the nutritional and

  6. Triple bone labeling of canine mandibles

    DEFF Research Database (Denmark)

    Pinholt, E M; Kwon, P H

    1990-01-01

    Fluorescence microscopy was used for evaluation of new bone formation in 16 canine mandibles augmented with hydroxylapatite (HA) granules. Three fluorochromes were injected at different time intervals during therapeutic radiation treatment. Oxytetracycline, DCAF, and alizarin-complexone were give...

  7. The relationship between basal and luminal cytokeratins with histopathologic characteristics of canine mammary gland cancer.

    Science.gov (United States)

    Eivani, D; Mortazavi, P

    2016-01-01

    Neoplasia occurs mostly in mammary glands in female dogs and mammary gland cancer is one of the causes of death in these animals cytokeratins are one of the most important of tumor markers for identification of tumor prognosis. In this study, 120 canine malignant tumor samples of mammary glands were studied. From each sample, a section was taken for hematoxylin-eosin staining and two sections for immunohistochemical staining of markers CK5/6 and CK7. Histopathology slides was evaluated by light microscope. The results show that the presence of markers CK7 and CK5/6 had no significant relationship with tumor grade and type (pmammary gland tumors. PMID:27487499

  8. Differential Diagnosis of Chronic Rhinosinusitis with Nasal Polyps.

    Science.gov (United States)

    London, Nyall R; Reh, Douglas D

    2016-01-01

    Nasal polyps are semi-translucent mucosal outgrowths of the paranasal sinuses which typically arise in the setting of chronic rhinosinusitis (CRS). Nasal polyps are also associated with asthma, aspirin sensitivity, cystic fibrosis and allergic fungal rhinosinusitis (AFS). The majority of nasal polyps are bilateral and characterized by tissue edema and eosinophil infiltration. Patients with nasal polyps often present with complaints including nasal obstruction, congestion, rhinorrhea or altered sense of smell. The differential diagnosis ranges from benign masses such as schneiderian papilloma, antrochoanal polyp, angiofibroma and encephalocele to malignant neoplasms such as squamous cell carcinoma (SCC), esthesioneuroblastoma, nasal lymphoma and rhabdomyosarcoma. These lesions may have a similar appearance as nasal polyps and particular attention to an alternative diagnosis for nasal polyps should be entertained if the mass is unilateral or congenital in nature. Workup for patients with a unilateral mass should include radiographic imaging, possible biopsy and careful follow-up when appropriate. Here, we review the disease etiology of nasal polyps and describe the approach to the patient with nasal polyps with emphasis on differential diagnosis and workup. PMID:27466841

  9. External nasal dilators: definition, background, and current uses

    Directory of Open Access Journals (Sweden)

    Dinardi RR

    2014-11-01

    Full Text Available Ricardo Reis Dinardi, Cláudia Ribeiro de Andrade, Cássio da Cunha Ibiapina Department of Pediatrics, Pediatric Pulmonology Unit, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil Abstract: Our goal was to revise the literature about external nasal dilators (ENDs as to their definition, history, and current uses. We reviewed journals in the PubMed and MEDLINE databases. The current uses hereby presented and discussed are physical exercise, nasal congestion and sleep, snoring, pregnancy, cancer, and healthy individuals. Numerous studies have shown that ENDs increase the cross-sectional area of the nasal valve, reducing nasal resistance and transnasal inspiratory pressure and stabilizing the lateral nasal vestibule, avoiding its collapse during final inspiration. These effects also facilitate breathing and are beneficial to patients with nasal obstruction. Furthermore, END use is simple, noninvasive, painless, affordable, and bears minimum risk to the user. Most studies have limited sample size and are mainly focused on physical exercise. In conclusion, ENDs seem useful, so further studies involving potential effects on the performance of physical tests and improvements in sleep quality are necessary, especially in children and teenagers. Keywords: external nasal dilator, nasal valve, nasal congestion, nasal resistance

  10. Fundus imaging with a nasal endoscope

    Directory of Open Access Journals (Sweden)

    P Mahesh Shanmugam

    2015-01-01

    Full Text Available Wide field fundus imaging is needed to diagnose, treat, and follow-up patients with retinal pathology. This is more applicable for pediatric patients as repeated evaluation is a challenge. The presently available imaging machines though provide high definition images, but carry the obvious disadvantages of either being costly or bulky or sometimes both, which limits its usage only to large centers. We hereby report a technique of fundus imaging using a nasal endoscope coupled with viscoelastic. A regular nasal endoscope with viscoelastic coupling was placed on the cornea to image the fundus of infants under general anesthesia. Wide angle fundus images of various fundus pathologies in infants could be obtained easily with readily available instruments and without the much financial investment for the institutes.

  11. SEPTOPLASTY WITH AND WITHOUT NASAL PACKING: A COMPARATIVE STUDY

    Directory of Open Access Journals (Sweden)

    Mitta

    2016-05-01

    Full Text Available Septoplasty is one of the most commonly performed surgeries in rhinology to relieve nasal obstruction of patients with distortion in the midline cartilage or septum of the nose to relieve nasal obstruction of patient and findings consistent with nasal endoscopy. The anterior nasal packing routinely done following septoplasty is usually conventional and not evidence based. The purpose of nasal packing is to obtain haemostasis, enhance opposition of septal flaps, avoid septal haematoma formation, close the dead space, avoid synechiae formation, provide support to septal cartilage and prevent its displacement. OBJECTIVE This study intends to evaluate the effects of nasal packing on surgical success and related complications in septoplasty. MATERIALS AND METHODS The present clinical prospective and randomised study was carried out on patients attending Otorhinolaryngology Department of Santhiram Medical College & General Hospital between March 2012 and March 2015. Patients undergoing septoplasty were randomised either to receive anterior nasal packing or to not receive nasal packing postoperatively. RESULTS Levels of pain experienced by patients with nasal packing postoperatively during the initial 24 hours postoperatively and during the removal of the pack were significantly more. Post-operative headache, epiphora, swallowing discomfort and sleep disturbance were more in patients with nasal packing and statistically (p.05. Septal haematoma, adhesions and local infections in both groups were statistically insignificant (p>.05. CONCLUSION Septoplasty enhances the standard of living of patients with septal deviation and nasal obstruction. Our study results suggest that nasal packing after septoplasty is not obligatory. Nasal packing causes considerably more pain and complications, and it should be reserved only for those who have bleeding predisposition.

  12. Canine babesiosis: from molecular taxonomy to control

    Directory of Open Access Journals (Sweden)

    Irwin Peter J

    2009-03-01

    Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

  13. [Nonsurgical endodontic treatment of an invaginated canine].

    Science.gov (United States)

    Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P

    1989-01-01

    We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment. PMID:2638021

  14. Systemic inflammarory response in canine pyometra

    OpenAIRE

    Fransson, Boel

    2003-01-01

    Research efforts have focused mainly on the hormonal aspects of canine pyometra for more than 6 decades. However, this disease is often manifested as systemic illness in response to the bacterial uterine infection. Studies I-II were undertaken to clarify bacteriological aspects of canine pyometra; i.e. the origin of the infecting bacteria, the infecting bacteria’s impact on severity of the systemic illness and the presence of bacterial endotoxin in the systemic circulation. Study I, a bacteri...

  15. [Nonsurgical endodontic treatment of an invaginated canine].

    Science.gov (United States)

    Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P

    1989-01-01

    We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.

  16. Treatment modalities of palatal impacted canines

    OpenAIRE

    Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona

    2012-01-01

    Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...

  17. Proliferative histiocytic disorders of canine skin.

    Science.gov (United States)

    Middleton, D J

    1997-06-01

    Proliferative histiocytic disorders of canine skin present a clinical spectrum from the innocuous self-limiting solitary dermal lesion of cutaneous histiocytoma, through the recurrent deep dermal nodules of cutaneous histiocytosis to the generally fatal condition of Bernese Mountain Dogs termed systemic histiocytosis, in which visceral involvement is commonly encountered. Immunocytochemical characterization of the constituent histiocytic cells and accompanying lymphoid infiltrate using canine species specific reagents has elucidated considerably the mechanism by which these conditions exhibit their various biologic behaviours.

  18. BLIND NASAL INTUBATION IN CRANIOROFACIAL TRAUMA

    Directory of Open Access Journals (Sweden)

    K.R.DavidThakaran

    2013-09-01

    Full Text Available Restricted mouth opening presents one of the greatest challenges to the anesthetist for endotracheal intubation and ventilation. Awake blind nasal intubation has been one of the finest and favored techniques for intubation in previous decades for restricted mouth opening patients. A coordinated team approach, monitoring and adequate counseling of the patient is mandatory for the airway management to carry out a safe surgical procedure

  19. Reconstructing the extended nasal tip defect.

    Science.gov (United States)

    Mobley, Steven

    2013-10-01

    Reconstruction of large facial defects requires surgical skill, an understanding of engineering principles, an artistic eye, and patience to design the most elegant solution for each patient. Extended nasal tip defects, which may involve additional facial subunits, require even more thoughtful analysis and planning. Reconstructive surgeons need to be aware of the pros and cons of various options for flaps, the use of a delay stage, and sequencing and scheduling of staged operations to achieve an optimal outcome. PMID:24037937

  20. Brain-Targeted Nasal Clonazepam Microspheres

    OpenAIRE

    Shaji J; Poddar A; Iyer S

    2009-01-01

    Gelatin-chitosan mucoadhesive microspheres of clonazepam were prepared using the emulsion cross linking method. Mirospheres were evaluated using the in vitro and ex vivo drug release patterns. In vivo CNS drug distribution studies were carried out in rats by administering the clonazepam microspheres intra-nasally and clonazepam solution intravenously. From the drug levels in plasma and CSF, drug targeting index and drug targeting efficiency were calculated. Results obtained indicated that int...

  1. Despre babesioza canină

    Directory of Open Access Journals (Sweden)

    Andrei Nanu

    2016-06-01

    Full Text Available The objective of this bibliographic essay, addressed both to veterinary clinicians and researchers, is to bring to mind the disease in terms of etiology, clinical manifestations and therapeutic and prophylactic management, as well as to remind the issues arising from recent researches. Depending on the virulence of the parasite species, body's immune response and therapeutic management approached, the plateau of disease evolution can be quite wide - from a favorable prognosis to a lethal outcome of the animal. The complexity of the pathogenic mechanism in babesiosis is due to soluble parasite antigens (SPA which, according to recent studies, have been obtained in vitro and then used as immunological product in disease prevention. Producing a vaccine against canine babesiosis with parasite antigens of local strains could play an important role to prevent the clinical expression of this disease in Romania.

  2. Environmental contamination by canine geohelminths.

    Science.gov (United States)

    Traversa, Donato; Frangipane di Regalbono, Antonio; Di Cesare, Angela; La Torre, Francesco; Drake, Jason; Pietrobelli, Mario

    2014-01-01

    Intestinal nematodes affecting dogs, i.e. roundworms, hookworms and whipworms, have a relevant health-risk impact for animals and, for most of them, for human beings. Both dogs and humans are typically infected by ingesting infective stages, (i.e. larvated eggs or larvae) present in the environment. The existence of a high rate of soil and grass contamination with infective parasitic elements has been demonstrated worldwide in leisure, recreational, public and urban areas, i.e. parks, green areas, bicycle paths, city squares, playgrounds, sandpits, beaches. This review discusses the epidemiological and sanitary importance of faecal pollution with canine intestinal parasites in urban environments and the integrated approaches useful to minimize the risk of infection in different settings. PMID:24524656

  3. Biomarkers in canine parvovirus enteritis.

    Science.gov (United States)

    Schoeman, J P; Goddard, A; Leisewitz, A L

    2013-07-01

    Canine parvovirus (CPV) enteritis has, since its emergence in 1978, remained a common and important cause of morbidity and mortality in young dogs. The continued incidence of parvoviral enteritis is partly due to the virus' capability to evolve into more virulent and resistant variants with significant local gastrointestinal and systemic inflammatory sequelae. This paper reviews current knowledge on historical-, signalment-, and clinical factors as well as several haematological-, biochemical- and endocrine parameters that can be used as diagnostic and prognostic biomarkers in CPV enteritis. These factors include season of presentation, purebred nature, bodyweight, vomiting, leukopaenia, lymphopaenia, thrombocytopaenia, hypercoagulability, hypercortisolaemia, hypothyroxinaemia, hypoalbuminaemia, elevated C-reactive protein and tumour necrosis factor, hypocholesterolaemia and hypocitrullinaemia. Factors contributing to the manifestations of CPV infection are multiple with elements of host, pathogen, secondary infections, underlying stressors and environment affecting severity and outcome. The availability of several prognosticators has made identification of patients at high risk of death and their subsequent targeted management more rewarding.

  4. CANINE: a robotic mine dog

    Science.gov (United States)

    Stancil, Brian A.; Hyams, Jeffrey; Shelley, Jordan; Babu, Kartik; Badino, Hernán.; Bansal, Aayush; Huber, Daniel; Batavia, Parag

    2013-01-01

    Neya Systems, LLC competed in the CANINE program sponsored by the U.S. Army Tank Automotive Research Development and Engineering Center (TARDEC) which culminated in a competition held at Fort Benning as part of the 2012 Robotics Rodeo. As part of this program, we developed a robot with the capability to learn and recognize the appearance of target objects, conduct an area search amid distractor objects and obstacles, and relocate the target object in the same way that Mine dogs and Sentry dogs are used within military contexts for exploration and threat detection. Neya teamed with the Robotics Institute at Carnegie Mellon University to develop vision-based solutions for probabilistic target learning and recognition. In addition, we used a Mission Planning and Management System (MPMS) to orchestrate complex search and retrieval tasks using a general set of modular autonomous services relating to robot mobility, perception and grasping.

  5. A new method for rapid Canine retraction

    Directory of Open Access Journals (Sweden)

    "Khavari A

    2001-06-01

    Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.

  6. Status of glutathione in nasal epithelium

    International Nuclear Information System (INIS)

    During inhalation exposure to air-born toxicants, the nasal epithelium may be subjected to local toxicity. Since glutathione (GSH) is often involved in xenobiotic metabolism, GSH status in these tissues has been examined. GSH content and apparent first-order rate constants for GSH content and apparent first-order rate constants for GSH turnover and synthesis were determined for respiratory epithelium covering the anterior ventral septum, olfactory epithelium covering the dorsal posterior septum, olfactory epithelium covering the dorsal meatus from male Fischer rats. The three tissues had similar concentrations of GSH (approximately 3-3.4 umol/g tissue) as determined by the Ellman's assay or by HPLC equipped with an electrochemical detector. Animals were administered [35S]Cysteine (Cys) by tail vein injection and rate constants were estimated, after incorporation of Cys into tissue GSH pools, by the decrease in GSH specific activity 1-102 hr after administration. Total [35S]GSH was analyzed by HPLC with a flow-through radioactivity detector. The three nasal epithelial tissues had similar apparent biphasic rates of GSH turnover, with rapid-phase half-lives of less than 10 hr and slow-phase half-lives of approximately 30 hr. The high GSH concentrations and the apparent rapid GSH turnover may facilitate the GSH-mediated detoxification within nasal tissue

  7. Surgical Nasal Implants: Indications and Risks.

    Science.gov (United States)

    Genther, Dane J; Papel, Ira D

    2016-10-01

    Rhinoplasty often requires the use of grafting material, and the goal of the specific graft dictates the ideal characteristics of the material to be used. An ideal material would be biologically inert, resistant to infection, noncarcinogenic, nondegradable, widely available, cost-effective, readily modifiable, and easily removable, have compatible biomechanical characteristics, retain physical properties over time, and not migrate. Unfortunately, no material currently in existence meets all of these criteria. In modern rhinoplasty, autologous grafts are the gold standard against which all other nasal implants are measured and offer the safest long-term results for most patients. They are easily manipulated, have inherent stability and biomechanical characteristics similar to the native nasal framework, and confer minimal risk of complications. Modern homologous and alloplastic materials have gained considerable support in recent years because they are readily available in endless quantity, do not require a second surgical site for harvest, and are generally considered safe if most circumstances, but they confer additional risk and have biomechanical characteristics different from that of the native nasal framework. To address some of these issues, we provide a contemporary review of autologous, homologous, and alloplastic materials commonly used in rhinoplasty surgery. PMID:27680520

  8. [Language tests for the examination of nasal resonance].

    Science.gov (United States)

    Gasiorek, J; Pruszewicz, A; Obrebowski, A

    1996-01-01

    A set of 7 word tests with different number of nasal phonemes was prepared. These tests are adjusted to technical possibilities of nasal resonance examination by means of own construction apparatus. The VII-th test consisting only oral speech sounds appeared to be most important for estimating physiological nasal resonance characteristic for the Polish language and gave individual timbre of the voice. For Polish language these resonance rate is 15.2%. It is useful as reference data to evaluate patients with pathological nasal resonance. The VII-th test together with the V-th one which contain 6.3% of nasal consonants, and the VI-th with 33.3% of them were used for detailed evaluation of nasal resonance.

  9. Three-dimensional canine loop for management of buccally erupted canines

    Directory of Open Access Journals (Sweden)

    Praveen Mehrotra

    2015-01-01

    Full Text Available Maxillary canines are known as the cornerstones of mouth. They are considered to be important for esthetics and for functional occlusion. Any disturbance in the eruption process leading to an aberrant position will hamper esthetics as well as function. Orthodontic tooth movement of total buccally blocked-out canine is usually difficult as it is related with the problems of severe crowding, midline deviation, involvement of long root movement and risk of gingival recession. Such conditions can be treated orthodontically in various ways, but this clinical innovation helps to correct the buccally placed canines into the arch with a precise control of the canine in all the Three-dimensions (3D of space as well as providing maximum comfort to the patient by placing the canine loop on the palatal surface of the tooth, reducing soreness on the labial mucosa. It can be easily fabricated and activated at chairside for either simultaneous or sequential control in 3D.

  10. Emprego do cell block de agarose como método complementar no diagnóstico citológico de tumores mamários caninos Employment of cell block of agarose as additional method in the cytological diagnosis of canine mammary tumors

    Directory of Open Access Journals (Sweden)

    Diogo Sousa Zanoni

    2013-03-01

    Full Text Available Os tumores mamários são neoplasias comuns em diversas espécies, sendo os processos oncológicos de maior incidência em cães. A elevada frequência e agressividade desses processos justificam a busca de métodos diagnósticos e prognósticos rápidos, de custo reduzido e menor invasividade, visando a uma abordagem cirúrgica e terapêutica adequada. O presente estudo avaliou a adequação da utilização da técnica de cell block de agarose como método diagnóstico complementar aos esfregaços tradicionais no diagnóstico desses processos. Para tanto, foram obtidas 51 amostras citológicas de tumores mamários de 30 cadelas que passaram por excisão tumoral no HOVET-UMESP, comparando-se os resultados obtidos a partir dos esfregaços, de cell blocks, e de sua associação (esfregaços cell blocks-1 com o diagnóstico histopatológico. Os melhores resultados foram obtidos mediante a associação dos métodos, reduzindo os resultados falso-negativos e elevando a correlação cito-histológica, reforçando a importância da citologia na rotina oncológica veterinária.The breast tumors are common neoplasms in several species, with high incidence in dogs. The high frequency and aggressiveness of these cases justifies the search for rapid, low cost and less invasive diagnostic methods, seeking for surgical approach and appropriate therapy. This study evaluated the appropriateness of the use of the agarose cell block technique as a diagnostic tool to complement traditional smears in the diagnosis of these processes. Therefore, it was obtained 51 samples from 30 dogs with breast tumors that underwent tumoral excision at the HOVET-UMESP, comparing the results obtained from smears, cell blocks, alone and in association (smears cell blocks-1, with the histopathologic diagnosis. The best results were obtained with the association of smears and cell block analysis, reducing the false negative results and increasing the cyto-histological correlation

  11. Web-based analysis of nasal sound spectra.

    Science.gov (United States)

    Seren, Erdal

    2005-10-01

    The spectral analysis of the nasal sound is an indicator of the nasal airflow pattern. We investigated a new technique for nasal sound analysis via Internet. This study includes 27 patients and 22 healthy people. Patients were treated by septoplasty operation for septal deviation. Postoperation 10(th) day, this technique was applied to follow nasal airflow course. The patients recorded the nasal sound by microphone into the computer as a .wav file and sent us via internet, all those records were evaluated by us. The results were sent back to themselves. The 11 patients who had nasal obstruction symptoms (group A) were called to the hospital to check. In the nasal sound analyses e-mails of those patients, the sound intensity was at high frequencies (2-4 kHz, 4-6 kHz) above 30 dB, but low (500-1000 Hz) and medium frequencies (1-2 kHz), are below then 10 dB. In the patients without nasal obstruction symptom (group B), the sound intensity was at high frequencies below 10 dB, but low and medium frequencies are above 20 dB. There was a statistically significant difference in sound intensity between group A and group B. In the endoscopical examination of those obstructions, which decreases the nasal airway, crusting formation in the nasal cavity was found. Web-based nasal sound analysis is an important method to follow the postoperative course and the nasal airflow evaluation. The new method will save time and money, avoiding a return visit to the hospital unnecessarily.

  12. A Comparative Study of Septoplasty With or Without Nasal Packing

    OpenAIRE

    Walikar, Basavaraj N.; Rashinkar, S. M.; Watwe, M. V.; Fathima, Anees; Kakkeri, Ashfak

    2011-01-01

    This study was conducted to compare the outcome of septoplasty with or without Nasal packing. The study subjects were randomly allocated into two groups. There was significant reduction in frequency of post operative pain, headache, discomfort and duration of hospital stay in patients who have undergone septoplasty without nasal packing. However there was no difference in post operative bleeding and septal perforation between two groups. Therefore after Septoplasty without nasal packing is pr...

  13. Generalized canine discoid lupus erythematosus responsive to tetracycline and niacinamide therapy.

    Science.gov (United States)

    Rossi, Michael A; Messenger, Linda M; Linder, Keith E; Olivry, Thierry

    2015-01-01

    Discoid lupus erythematosus (DLE) is a commonly reported canine autoimmune disease that normally presents with a phenotype consisting of erythema, depigmentation, scaling, erosions/ulcers, and scarring over the nasal planum and the proximal dorsal muzzle. Recently, two cases of a generalized variant of this disease have been reported, whose lesions responded to either systemic glucocorticoids or a combination of topical corticosteroids, topical tacrolimus, and the oral antimalarial hydroxychloroquine. The purpose of this report is to describe an 11 yr old shih tzu that presented with skin lesions consisting of multiple annular, erythematous papules and plaques, hyperpigmentation, adherent scaling, and atrophic scars over the caudal dorsum, flanks, craniodorsal thorax, and lateroproximal extremities. A diagnosis of generalized DLE was made based on the clinical presentation, histopathology, laboratory values, and direct immunofluorescence findings. Treatment consisted of oral tetracycline and oral niacinamide, which resulted in complete remission of clinical signs. This is the first documented report of generalized canine DLE responding to the described immunomodulating regimen. Such a combination might therefore be considered as a glucocorticoid and/or antimalarial alternative for the management of generalized DLE.

  14. Patient experience with mupirocin or povidone-iodine nasal decolonization.

    Science.gov (United States)

    Maslow, Jed; Hutzler, Lorraine; Cuff, Germaine; Rosenberg, Andrew; Phillips, Michael; Bosco, Joseph

    2014-06-01

    Led by the federal government, the payers of health care are enacting policies designed to base provider reimbursement on the quality of care they render. This study evaluated and compared patient experiences and satisfaction with nasal decolonization with either nasal povidone-iodine (PI) or nasal mupirocin ointment (MO). A total of 1903 patients were randomized to undergo preoperative nasal decolonization with either nasal MO or PI solution. All randomized patients were also given 2% chlorhexidine gluconate topical wipes. Patients were interviewed prior to discharge to assess adverse events and patient experience with their assigned preoperative antiseptic protocol. Of the 1903 randomized patients, 1679 (88.1%) were interviewed prior to discharge. Of patients receiving PI, 3.4% reported an unpleasant or very unpleasant experience, compared with 38.8% of those using nasal MO (P.05). Being recruited as an active participant in surgical site infection prevention was a positive experience for 87.2% of MO patients and 86.3% of PI patients (P=.652). Those assigned to receive PI solution preoperatively reported significantly fewer adverse events than the nasal MO group (P<.01). Preoperative nasal decolonization with either nasal PI or MO was considered somewhat or very helpful by more than two-thirds of patients. PMID:24972440

  15. Pathologic and Molecular Virologic Characterization of a Canine Distemper Outbreak in Farmed Civets.

    Science.gov (United States)

    Techangamsuwan, S; Banlunara, W; Radtanakatikanon, A; Sommanustweechai, A; Siriaroonrat, B; Lombardini, E D; Rungsipipat, A

    2015-07-01

    In October 2011, a fatal disease outbreak occurred in 3 civet species farmed for their use in the coffee industry in Thailand. The disease quickly killed 20 animals in a mixed population of Asian palm civets (Paradoxurus hermaphroditus; n = 18), a masked palm civet (Paguma larvata; n = 1), and small Indian civet (Viverricula indica; n = 1). Clinical signs consisted of severe lethargy, weakness, vomiting, and diarrhea with associated dehydration, dyspnea, nasal and footpad hyperkeratosis, and seizures. All civets were positive for canine morbillivirus using the commercial canine distemper virus (CDV) antigen test kit. Consistently observed necropsy findings consisted of severe pneumonia and hemorrhagic enteritis. Microscopic examination revealed severe gastroenteritis, bronchointerstitial pneumonia, lymphadenitis, necrotizing dermatitis, nonsuppurative polioencephalitis, and characteristic intranuclear/intracytoplasmic eosinophilic viral inclusions in multiple tissues. Immunohistochemical analysis revealed immunoreactivity of varying intensity, while virus isolation demonstrated typical cytopathic effects. To confirm CDV infection, reverse transcription-polymerase chain reaction against fusion (F), phosphoprotein (P), and hemagglutinin (H) genes showed bands of expected size using conjunctival swabs (9 civets, 1 dog [Canis lupus familiaris] living on the farm). Phylogenetic analyses and restriction fragment length polymorphism results indicated that the civets were infected by the Asia-1 strain of CDV commonly found in dogs in Thailand. The deduced amino acid sequences of the signaling lymphocyte activation molecule binding region of the CDV-H proteins revealed a Y549H mutation in both CDV-infected Asian palm civets (n = 4) and a co-located dog. We report a canine distemper outbreak in a civet colony with lineage classification and a Y549H mutation in noncanid species in Thailand. PMID:25253065

  16. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    OpenAIRE

    Del Puerto, Helen L; Vasconcelos, Anilton C.; Luciana Moro; Fabiana Alves; Braz, Gissandra F; Almir S. Martins

    2010-01-01

    A quantitative real time polymerase chain reaction (PCR) revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus...

  17. A comparison of beclomethasone dipropionate aqueous nasal spray and beclomethasone dipropionate pressurized nasal spray in the management of seasonal rhinitis.

    OpenAIRE

    Dunn, A. M.; Wilson, R.S.; Baggott, P. J.

    1984-01-01

    Forty patients with seasonal rhinitis and a proven sensitivity to pollens were studied for 2 weeks during the pollen season of 1982. The study was carried out according to a double-blind, double-dummy design. All patients received 100 micrograms beclomethasone dipropionate (BDP) into each nostril twice daily (400 micrograms/day) on a randomized basis, from either the aqueous nasal spray or the pressurized nasal spray (Beconase Nasal Spray). Analysis of patients' symptom scores, additional sym...

  18. Role of neutrophilic inflammation in ozone-induced epithelial alterations in the nasal airways of rats

    Science.gov (United States)

    Cho, Hye Youn

    Ozone is a principal oxidant air pollutant in photochemical smog. Epithelial cells lining the centriacinar region of lung and the proximal aspects of nasal passage are primary target sites for ozone-induced injury in laboratory animals. Acute exposure of rats to high ambient concentrations of ozone (e.g., 0.5 ppm) results in neutrophilic inflammation, epithelial hyperplasia and mucous cell metaplasia (MCM) in the nasal transitional epithelium (NTE) lining the proximal nasal airways. The principal purpose of the present study was to investigate the role of pre-metaplastic cellular responses, especially neutrophilic inflammation, in the pathogenesis of ozone-induced MCM in rat NTE. For this purpose, three specific hypotheses-based whole-animal inhalation studies were conducted. Male F344/N rats were exposed in whole-body inhalation chambers to 0 (filtered air) or 0.5 ppm ozone for 1-3 days (8 h/day). Histochemical, immunochemical, molecular and morphometric techniques were used to investigate the ozone-induced cellular and molecular events in the NTE. Two in vitro studies were also conducted to examine the effects of ozone-inducible cytokines (i.e., tumor necrosis factor-alpha; TNF- a, and interleukin-6; IL-6) on mucin gene (rMuc-5AC) expression. Ozone induced a rapid increase of rMuc-5AC mRNA in nasal tissues within hours after the start of exposure. It preceded the appearance of MCM, and persisted with MCM. Ozone-induced neutrophilic inflammation accompanied the mucin gene upregulation, but was resolved when MCM first appeared in the NTE. Antibody-mediated depletion of circulating neutrophils attenuated ozone-induced MCM, although it did not affect the ozone-induced epithelial hyperplasia and mucin mRNA upregulation. In another study, it was found that preexisting neutrophilic rhinitis induced by endotoxin augmented the ozone-induced MCM. However, pre-existing rhinitis did not alter the severity of ozone-induced epithelial hyperplasia and mucin gene upregulation

  19. Extranodal Natural Killer/T-Cell Lymphoma: A Rare Nasal-Type Case

    OpenAIRE

    Esra Sarıbacak Can; Harika Okutan; Ünsal Han

    2016-01-01

    Nasal type extranodal natural killer (NK) NK-cell/T-cell lymphoma (NKTCL) is a rare extranodal lymphoma of NK-cell or T-cell origin that most commonly affects immunocompetent middle-aged men of Asian or Native American descent [1]. The pathogenesis is not understood completely, but it is related in part to infection of the tumor cells with Epstein-Barr virus (EBV) [2]. Around 6-7% of all non-Hodgkin’s lymphoma (NHL) in Southeast Asia accounts for NKTCL. However, the incid...

  20. Constitutive phosphorylation of the mTORC2/Akt/4E-BP1 pathway in newly derived canine hemangiosarcoma cell lines

    Directory of Open Access Journals (Sweden)

    Murai Atsuko

    2012-07-01

    Full Text Available Abstract Background Canine hemangiosarcoma (HSA is a malignant tumor with poor long-term prognosis due to development of metastasis despite aggressive treatment. The phosphatidyl-inositol-3 kinase/Akt/mammalian target of rapamycin (PI3K/Akt/mTOR pathway is involved in its endothelial pathologies; however, it remains unknown how this pathway plays a role in canine HSA. Here, we characterized new canine HSA cell lines derived from nude mice-xenografted canine HSAs and investigated the deregulation of the signaling pathways in these cell lines. Results Seven canine HSA cell lines were established from 3 xenograft canine HSAs and showed characteristics of endothelial cells (ECs, that is, uptake of acetylated low-density lipoprotein and expression of canine-specific CD31 mRNA. They showed varied morphologies and mRNA expression levels for VEGF-A, bFGF, HGF, IGF-I, EGF, PDGF-B, and their receptors. Cell proliferation was stimulated by these growth factors and fetal bovine serum (FBS in 1 cell line and by FBS alone in 3 cell lines. However, cell proliferation was not stimulated by growth factors and FBS in the remaining 3 cell lines. Phosphorylated p44/42 Erk1/2 was increased by FBS stimulation in 4 cell lines. In contrast, phosphorylation of Akt at Ser473, mTOR complex 1 (mTORC1 at Ser2448, and eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1 at Ser65 was high in serum-starved condition and not altered by FBS stimulation in 6 cell lines, despite increased phosphorylation of these residues in normal canine ECs. This suggested that the mTORC2/Akt/4E-BP1 pathway was constitutively activated in these 6 canine HSA cell lines. After cell inoculation into nude mice, canine HSA tumors were formed from 4 cell lines and showed Akt and 4E-BP1 phosphorylation identical to the parental cell lines. Conclusions Our findings suggest that the present cell lines may be useful tools for investigating the role of the mTORC2/Akt/4E-BP1 pathway in

  1. Sinonasal Phosphaturic Mesenchymal Tumor: A Rare and Misinterpreted Entity

    OpenAIRE

    Arnaoutakis, Demetri; Naseri, Iman

    2015-01-01

    Objectives Oncogenic osteomalacia is a paraneoplastic syndrome in which the tumor secretes a peptide-like hormone, fibroblast growth factor, resulting in urinary loss of phosphates. Methods We present the case of a 50-year-old woman with a benign phosphaturic mesenchymal tumor (PMT) involving the ethmoid sinus with obstruction of the ostiomeatal complex causing unilateral nasal airway obstruction. Results The tumor was initially thought to be an esthesioneuroblastoma based on primary patholog...

  2. Elevated Krüppel-like factor 4 transcription factor in canine mammary carcinoma

    Directory of Open Access Journals (Sweden)

    Yeh Kun-Tu

    2011-10-01

    Full Text Available Abstract Background Krüppel-like factors (KLFs are critical regulators of biological and physiological systems and have been extensively studied for their roles in cell proliferation, differentiation and survival in the context of cancer. Among the KLFs, KLF4 is highly expressed in human breast cancers and plays an oncogenic role. The present study examined the expression of KLF4 and assessed its significance in canine mammary carcinoma. Results Immunohistochemistry was employed to investigate the expression of KLF4 in 142 cases of canine mammary tumor. 75 of the 142 (52.8% cases were histologically confirmed as mammary carcinoma. Quantification of immunohistochemistry was carried out using Quick score which multiply the staining intensity by the percentage of positive cells. High KLF4 expression was identified in 44 of the 75 (59% dogs with mammary carcinoma and none in the benign cases. High KLF4 expression occurred only in the tumor cells and not the adjacent normal cells in mammary carcinoma (P Conclusions KLF4 is highly and frequently expressed in canine mammary carcinoma and correlates with a more aggressive phenotype.

  3. Randomized trial of prongs or mask for nasal continuous positive airway pressure in preterm infants.

    LENUS (Irish Health Repository)

    Kieran, Emily A

    2012-11-01

    To determine whether nasal continuous positive airway pressure (NCPAP) given with nasal prongs compared with nasal mask reduces the rate of intubation and mechanical ventilation in preterm infants within 72 hours of starting therapy.

  4. 9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus..., DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper...

  5. Canine hypothyroidism. A diagnostic challenge?

    International Nuclear Information System (INIS)

    Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen registered) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high interobserver

  6. Efficacy of mupirocin nasal ointment in eradicating Staphylococcus aureus nasal carriage in chronic haemodialysis patients

    NARCIS (Netherlands)

    D. L. Holton; L. E. Nicolle; D. Diley; K. Bernstein

    1991-01-01

    textabstractTopical 2% mupirocin ointment eradicated chronic Staphylococcus aureus nasal carriage immediately post-therapy in 17 (77%) of 22 haemodialysis patients. Mean time to recurrence was 3.8 weeks. Similar pre-therapy and post-therapy phage types occurred in 12 (71%) of 17 patients. Staphyloco

  7. Establishment and characterization of a canine xenograft model of inflammatory mammary carcinoma.

    Science.gov (United States)

    Camacho, L; Peña, L; González Gil, A; Cáceres, S; Díez, L; Illera, J C

    2013-12-01

    Canine inflammatory mammary cancer (IMC) and human inflammatory breast cancer (IBC) are the most aggressive form of mammary/breast cancer. Both species naturally develop it, sharing epidemiological, clinical and histological characteristics. Thus, IMC has been suggested as a model to study the human disease. We have developed the first IMC xenograft model in SCID mice. Xenografts reproduced the histological features from the primary tumor, were highly aggressive and showed dermal tumor emboli, distinctive hallmarks of IMC/IBC. This model was hormone receptors positive and HER2 negative. Our findings showed that estrogens and androgens are locally produced in tissues. Factors related to tumor vascularization showed positive expression and xenografts with the highest expression of all analyzed vascular factors had the highest rate of tumor proliferation. The role of steroid hormones and the angio/lymphangiogenic properties found in this model, provide additional knowledge for future interventions in the diagnosis, treatment and prevention of the disease.

  8. Transmigration of mandibular canine – case report

    International Nuclear Information System (INIS)

    Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation

  9. Canine treatment with SnET2 for photodynamic therapy

    Science.gov (United States)

    Frazier, Donita L.; Milligan, Andrew J.; Vo-Dinh, Tuan; Morgan, Alan R.; Overholt, Bergein F.

    1990-07-01

    Photodynamic therapy is a treatment technique that utilizes the photoactived species of a drug to destroy tumor tissue. To be successful, the drug must localize in tumor tissue preferentially over normal tissue and must be activated by light of a specific wavelength. Currently the only drug to be approved for clinical use is Heinatoporphyrin Derivative (HpD) although a series of new drugs are being developed for use in the near future. One of the drugs belongs to a class called purpurins which display absorp-' tions between 630-711 nm. Along with several other investigators, we are currently exploring the characteristics of a specific purpurin (SnET2) in normal and tumorous canine tissue. The use of this compound has demonstrated increased tumor control rates in spontaneous dog tumors. Preliminary pharmacokinetic studies have been performed on 6 normal beagle dogs. SnET2 (2 mg/kg) was injected intravenously over 10 minutes and blood was collected at 5, 15, 30, 45 minutes and at 1, 2, 4, 8, 12 and 24 hours following administration for determination of drug concentration and calculation of pharinacokinetic parameters. Skin biopsies were collected at 1, 4, 8, 12 and 24 hours. Dogs were euthanized at 24 hours and tissues (liver, kidney muscle, esophagus, stomach, duodenum, jejunum, ileura, colon, adrenal gland, thyroid, heart, lung, urinary bladder, prostate, pancreas, eye, brain) were collected for drug raeasurement. Drug was shown to persist in liver and kidney for a prolonged period of time coiapared to other tissues. Knowledge of the pharmacokinetic properties of the drug will greatly add to the ability to treat patients with effective protocols.

  10. Esporotricose canina: relato de caso Canine sporotrichosis: case report

    Directory of Open Access Journals (Sweden)

    N.T. Souza

    2009-06-01

    Full Text Available Relata-se um caso de esporotricose em um cão da raça Boxer, macho, com seis anos, encaminhado para uma consulta por causa de massa na região nasal e de dispneia. Após o exame físico, o animal foi internado para a realização de citologia, histologia e radiografia. Nos exames citológico e radiográfico, não foram constatadas alterações que justificassem a massa e a dispneia. Na histologia, observou-se a presença de um granuloma contendo dois esporos de Sporothrix schenckii. Foi realizado tratamento com itraconazol 5mg/kg BID por 60 dias. Após esse período, a massa desapareceu e a respiração do animal melhorou, tendo sido recomendada a manutenção da terapia por mais 30 dias, para evitar recidiva.A case of canine sporotrichosis was reported in a six-year-old male Boxer, referred to a veterinary hospital because of a mass in the region of the nose and dyspnea. After physical examination, the animal was submitted to cytological, histological, and radiographic exams. The cytological and radiographic exams showed no alterations that could justify the mass and the dyspnea. The histological exam showed the presence of a granuloma with two Sporothrix schenckii spores. The dog was treated with itraconazol 5mg/kg BID during 60 days. After this period, the mass disappeared and breathing improved. The therapy was maintained for 30 other days to avoid relapse.

  11. Chronic urticaria treated with soft nasal filters

    Directory of Open Access Journals (Sweden)

    Pasricha J

    1995-01-01

    Full Text Available A 22-year-old boy having two attacks of urticaria per day for the last 5 years and intermittent attacks of sneezing and rhinorrhoea, and without any clues to the causative agent in spite of a detailed history and follow up, showed almost complete relief on wearing an ordinary cloth mask for 3 days. He was subsequently trained to use the soft nasal filters and obtained almost 80% relief in urticaria and complete relief in rhinitis during the next 1 year. Wearing the mask for 2 days again led to complete relief and further training in the proper use of the filters was helpful.

  12. [Nasal Highflow - Treatment option in severe hypoxaemia?].

    Science.gov (United States)

    Bräunlich, Jens; Wirtz, Hubert

    2015-12-01

    Nasal High Flow (NHF) provides a warmed and humidified air stream. In pediatrics, this method is already in widespread use and is increasingly replacing the CPAP. New studies show success in treating adults. Currently the acute hypoxemic insufficiency cause of pneumoniae is a secured area of use. NHF is not inferior in comparison to other oxygen delivery systems. At this juncture effectiveness of this easy to use method is not clear. Preliminary reports describe an improvement in ventilation by the NHF. Here, a wash-out of the airways and improved alveolar ventilation seem to be the main operating principles. PMID:26625231

  13. 鼻内镜手术治疗鼻内翻性乳头状瘤的临床研究%Clinical Study in the Treatment of Nasal Inverted Papilloma with Nasal Endoscope Operation

    Institute of Scientific and Technical Information of China (English)

    李美璐

    2014-01-01

    目的:探讨鼻内镜下鼻内翻性乳头状瘤切除术的手术方法和临床疗效。方法回顾分析我院2011年1月至2012年6月间鼻内镜下鼻内翻性乳头状瘤切除术34例。结果经鼻内镜治疗鼻腔鼻窦内翻性乳头状瘤34例,术后随访30例。失访4例。随访时间12~36个月。术后复发2例,复发部位为前筛顶、额隐窝,再次手术,随诊12个月无复发。本组手术无眶眼、颅底并发症。结论鼻内镜外科技术治疗鼻内翻性乳头状瘤,手术视野清晰,能够准确彻底切除瘤体,降低了术后复发率;同时避免了鼻侧切开等人为手术入路创伤,术后面部无切口瘢痕。%Objective To investigate the surgical method and clinical efficacy of nasal endoscope in the treatment of nasal inverted papilloma. Methods 34 cases of nasal inverted papilloma resection through nasal endoscope in our hospital from January 2011 to June 2012 were analyzed retrospectively. Results 34 patients of nasal inverted papilloma were treated with nasal endoscope, 30 patients were followed up from 12 months to 36 months after operation, and 4 patients were lost to follow-up. 2 cases of postoperative recurrence were found and the recurrence occurred at anterior ethmoid roof, volume recessus, but no recurrence happened within 12 months follow-up after reoperation. No orbit-eye and skull base complications occurred in the operation. Conclusion Nasal endoscope surgery in the treatment of nasal inverted papilloma resection have a clear vision, remove the tumor accurately and completely, decrease the postoperative recurrence rate; as well as avoid human operative approach trauma such as lateral rhinotomy, and no facial incision scar after operation.

  14. Composite mandibular allografts in canines

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objective: To evaluate the feasibility of transplanting composite mandibular allografts to repair large mandibular defects. Methods: Three composite mandibular transplantation models were established. The first model consisted of hemimandible with the attached teeth, muscle and skin, and oral mucosa. The second model was transplanted in the same way with the first one excluding oral mucosa and some teeth, and third one excluding the oral mucosa and all dental crowns. Fourteen transplanting operations were performed in canines. Cyclosporine A and methylprednisone were given for immunosuppression. Results: The composite mandibular organs had an effective and closed return circuit. Transplantation of vascularized allograft of mandibular compound organs was feasible. Two longest time survivors of 67 d and 76 d were in the third model group. Cyclosporine A was successful in suppressing rejection of transplanted composite allograft and prolonging survival time of transplantation models. Conclusions: The composite mandibular allografts were available with large block of living composite tissue,and helpful in restoration of appearance and function for severe mandibular defects.

  15. Canine malignant peripheral nerve sheath tumor involving nerve roots of the third lumbar spinal cord segmentTumor maligno da bainha de nervo periférico envolvendo raízes nervosas do terceiro segmento medular lombar em um cão

    Directory of Open Access Journals (Sweden)

    Elisângela Olegário da Silva

    2012-12-01

    Full Text Available Malignant peripheral nerve sheath tumors (MPNST involving spinal nerve roots are uncommon in dogs. A nine-year old, intact, mixed-breed dog, demonstrated clinical signs of incoordination in the pelvic limbs and micturition for approximately one week. Clinical examination revealed proprioceptive deficits and bilateral patellar hyperreflexia. During exploratory celiotomy a mass was observed adhered to the lumbar vertebral segments. Medical therapy was initiated, but neurological signs were progressive, and the owner opted for euthanasia. Gross examination showed that the mass in the abdominal cavity was attached to the lumbar segments L3 and L4, causing bone lysis in L3, but showed no tumor invasion into the spinal canal. Microscopic features were characterized by prominent proliferation of ovoid and fusiform cells with poorly defined cytoplasm arranged in interlacing bundles and concentric whorls. The cells were embedded in a delicate to moderate collagenous stroma and moderate anisokariose and high mitotic activity were noted. The immunohistochemical assay showed positive staining for GFAP, S-100 protein and vimentin, and negative staining for factor VIII, ?-actin and citokeratine. The definitive diagnosis of malignant peripheral nerve sheath tumor was made on the basis of the histological and immunohistochemical findings. Tumores malignos da bainha de nervo periférico (TMBNP em raízes nervosas espinhais são incomuns em cães. Relata-se o caso de um cão, sem raça definida, nove anos de idade, não castrado, com histórico de incoordenação em membros pélvicos e retenção urinária há aproximadamente uma semana. Ao exame clínico constatou-se déficit proprioceptivo e hiperreflexia patelar bilaterais. Durante a celiotomia exploratória constatou-se uma massa intensamente vascularizada e aderida aos segmentos vertebrais lombares. Estabeleceu-se plano terapêutico e o animal foi tratado com fluidoterapia, anti-inflamatório e analg

  16. Sensory neuropeptides and nitric oxide in nasal vascular regulation

    OpenAIRE

    Rinder, Johan

    1996-01-01

    Sensory neuropeptides and nitric oxide in nasal vascular regulation By Johan Rinder, M.D. Division of Pharmacology, Department of Physiology and Pharmacology, Karolinska Institute, S- 171 77 Stockholm, Sweden and Department of Oto-Rhino-Laryngology, Karolinska Hospital, S-17176 Stockholm, SwedenThe role of sensory neuropeptides and nitric oxide in vascular regulation was investigated in the pig nasal mucosa...

  17. Resident aerobic microbiota of the adult human nasal cavity

    DEFF Research Database (Denmark)

    Rasmussen, TT; Kirkeby Nielsen, LP; Poulsen, Knud;

    2000-01-01

    Recent evidence strongly suggests that the microbiota of the nasal cavity plays a crucial role in determining the reaction patterns of the mucosal and systemic immune system. However, little is known about the normal microbiota of the nasal cavity. The purpose of this study was to determine the m...

  18. Polyvinyl siloxane: novel material for external nasal splinting.

    Science.gov (United States)

    Jayakumar, N K; Rathnaprabhu, V; Ramesh, S; Parameswaran, A

    2016-01-01

    External nasal splinting is performed routinely after nasal bone fracture reductions, osteotomies, and rhinoplasties. Materials commonly used include plaster of Paris (POP), thermoplastic splints, self-adhesive padded aluminium splints, and Orthoplast, among many others. The disadvantages of these materials are described in this paper, and polyvinyl siloxane is recommended as an effective and more readily available alternative material to counter these pitfalls.

  19. The nasal distribution of metered dose inhalers.

    Science.gov (United States)

    Newman, S P; Morén, P F; Clarke, S W

    1987-02-01

    The intranasal distribution of aerosol from a metered dose inhaler has been assessed using a radiotracer technique. Inhalers were prepared by adding 99Tcm-labelled Teflon particles (simulating the drug particles) to chlorofluorocarbon propellants, and scans of the head (and chest) taken with a gamma camera. Ten healthy subjects (age range 19-29 years) each performed two radioaerosol studies with the inhaler held in two different ways: either in a single position (vial pointing upwards) or in two positions (vial pointing upwards and then tilted by 30 degrees in the sagittal plane). The vast majority of the dose (82.5 +/- 2.8 (mean +/- SEM) per cent and 80.7 +/- 3.1 per cent respectively for one-position and two-position studies) was deposited on a single localized area in the anterior one-third of the nose, the initial distribution pattern being identical for each study. No significant radioaerosol was detected in the lungs. Only 18.0 +/- 4.7 per cent and 15.4 +/- 4.1 per cent of the dose had been removed by mucociliary action after 30 minutes, and it is probable that the remainder had not penetrated initially beyond the vestibule. Since the deposition pattern was highly localized and more than half the dose probably failed to reach the turbinates it is possible that the overall effect of nasal MDIs is suboptimal for the treatment of generalized nasal disorders.

  20. Treatment of nasal polyposis in Byzantine times.

    Science.gov (United States)

    Lascaratos, J G; Segas, J V; Assimakopoulos, D A

    2000-09-01

    The goal of this study was to describe the therapeutic methods and surgical techniques used during Byzantine times (AD 324-1453) for a disease that has occupied physicians since antiquity: nasal polyps. The original Greek-language texts of the Byzantine medical writers, most of which were published after the 17th century, were studied in order to identify the early knowledge of the definition, symptoms, conservative treatments, and surgical intervention in cases of this disease. A considerable number of conservative treatments, etiologic and local (with inunctions or blowing of caustic substances), with evident influence from Roman medicine, were identified even in the early Byzantine medical texts (4th century). Further, some surgical techniques were described that seem to constitute evolution of the Hippocratic tradition. From the study of the original texts of Byzantine medical writers, their interest in the rhinological diseases is evident; in the case of nasal polyps, new techniques were mentioned. The first meticulous intranasal surgical removal of polyps was described. These techniques, obviously developed during the Hellenistic period, initially influenced European medicine and later the rest of the world. PMID:11007093

  1. Nasal polyps. A clinical radiological histopathological and mycological study

    International Nuclear Information System (INIS)

    Forty patients with nasal polyposis were studied. This study included clinical, haematological and mycological aspects. There were 24 females (60% of patients) and 16 males (40%). We found that all patients presented with nasal obstruction and nasal tone and the majority of them had allergic nasal symptoms such as sneezing and watery discharge. Thirty five percent of the patients were recurrent cases, being operated before for nasal polyps. Radiological investigations showed high of sinusitis and that 10% of the patients had complicated disease with orbital or intracranial extensions. Mycological studies revealed the presence of fungal infection in 4 patient (10%) and it was caused by Aspergillus flavus. Histological studies identified the allergic nature of the polyps in all patients. Surgical treatment was carried out in all patients and operations varied from simple intranasal polypectomy, intranasal ethmiodectomy, external ethmoidectomy to Caldwell-Luc operation for patients with antrochanal polyps.(Author)

  2. Binding of VEGF-A to canine cancer cells with preferential expression of VEGFR1

    Directory of Open Access Journals (Sweden)

    Antonella Borgatti,

    2014-01-01

    Full Text Available Aim: Despite encouraging results in syngeneic and xenografts cancer models with various inhibitors of vascular endothelial growth factor (VEGF or its receptors (VEGFRs, beneficial effects have not been consistently translated to the clinic, underscoring the need to develop strategies that go beyond the inhibition of these targets. The purpose of this study was to generate data to support the hypothesis that VEGF may be used as “bait” to selectively deliver therapeutics to VEGFR-expressing cancer cells. Materials and Methods: VEGFR1 and VEGFR2 expression was characterized using real time quantitative reverse transcriptase polymerase chain reaction (RT-qPCR in canine hemangiosarcoma (Grace-HSA, Emma-HSA, melanoma (TLM-1, and thyroid adenocarcinoma (CTAC cell lines. TLM-1 and Grace-HSA were identified as representative cell lines that selectively expressed high levels of VEGFR1. Flow cytometry was performed to examine binding of a single VEGF molecule (biotinylated VEGFA and avidin conjugated to fluorescein isothiocyanate (FITC by these chemoresistant cell lines. Results: RT-qPCR showed that canine tumor cells can preferentially express VEGFR1 over VEGFR2. Both TLM-1 and Grace-HSA cell lines, which represent VEGFR1-expressing tumors, showed specific binding to VEGF-A and this binding was competitively inhibited by anti-VEGF antibody. Conclusions: Cells preferentially expressing VEGFR1 can be targeted with a single VEGF molecule and these ligand-receptor pairs are well suited for targeting cytotoxic molecules in various canine tumor cells. Further studies are needed to develop strategies to selectively deliver therapeutics through VEGF-VEGFRs binding into VEGFR-expressing tumors.

  3. Granuloma nasal (rinite atópica de bovinos Bovine nasal granuloma (atopic Rhinitis

    Directory of Open Access Journals (Sweden)

    Adriana Lücke Stigger

    2001-06-01

    Full Text Available Granuloma nasal ocorreu em 13 bovinos Jersey, fêmeas, com idades entre 9 meses e 3 anos, em uma propriedade de Pinhal Grande, Rio Grande do Sul. Sinais clínicos incluíam corrimento nasal seroso ou mucoso, às vezes com estrias de sangue, espirros, respiração ruidosa, dificuldade em respirar, lacrimejamento, congestão dos vasos da esclera e roçar o focinho em árvores e outros objetos. Os sinais clínicos se exacerbavam após exercício. No exame clínico de 10 bovinos, foram observados nódulos na mucosa da porção proximal da cavidade nasal. Na citologia do corrimento nasal de 9 bovinos, observaram-se eosinófilos em números diretamente proporcionais à intensidade dos sinais clínicos. Não houve alterações no hemograma. Um dos animais afetados foi sacrificado e necropsiado. As principais alterações macroscópicas observadas foram nódulos polipóides firmes, branco-alaranjados, multifocais, com 2 a 4mm de diâmetro, agrupados na porção proximal das fossas nasais. No exame histológico, os nódulos consistiam de epitélio respiratório hiperplásico, com metaplasia escamosa, sobre uma proliferação fibrovascular acentuadamente infiltrada por eosinófilos e, em menor grau, por, macrófagos e plasmócitos.Nasal granuloma affecting 13 female Jersey cattle with ages ranging from 9 months to 3-year-old occurred in a farm in Pinhal Grande, Rio Grande do Sul, Brazil. Clinical signs included serous to serosanguineous or mucous nasal discharge, snoring, sniffling, difficult in breathing, lacrimation, congestion of the vessels of the sclera and rubbing the nose against trees and other hard surfaces. Clinical signs were exacerbated by exercise. The clinical examination of 10 affected cattle revealed small nodules in the mucous membrane of the proximal portion of the nasal cavity. Cytology carried out in the nasal discharge of 9 affected cattle revealed mainly eosinophils in numbers directly proportional to the severity of clinical signs

  4. Tooth fractures in canine clinical practice

    International Nuclear Information System (INIS)

    Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients

  5. A Study of Transmigrated Canine in an Indian Population

    Science.gov (United States)

    Sharma, Gaurav; Nagpal, Archna

    2014-01-01

    Aim. The purpose of this study was to investigate the prevalence of transmigrated canines in a north Indian population and association with gender, side, associated pathologies, and dental anomalies. Subjects and methods. The prospective study consisted of panoramic radiographs of 3000 patients from two dental colleges in north India. The panoramic radiographs were screened for radiographically identified position of the transmigrated tooth, retained canine, and other coexisting dental anomalies. Results. The overall prevalence of transmigrated canines (15 mandibular and 5 maxillary) was 0.66%. The prevalence of mandibular transmigrated canine was 0.5% and maxillary transmigrated canine was 0.16%. All the transmigrated canines were unilateral. The age range was 15–53 years (average age 24.1 years) and there were 12 males (60%) and 8 females (40%). Type 1 mandibular canine transmigration was the commonest type found in our study (10 cases), followed by types 2 and 4 (2 cases each) and 1 case of type 5 transmigration. Conclusion. The prevalence of transmigrated canines in the north Indian population was 0.66% and no gender predilection was evident. The transmigrated canines have a low complication rate (10.0%) and no correlation with other dental anomalies was found. Type 3 canine is the rarest form of mandibular canine transmigration. PMID:27433532

  6. Seasonal changes in nasal cytology in mite-allergic patients

    Directory of Open Access Journals (Sweden)

    Gelardi M

    2014-03-01

    Full Text Available Matteo Gelardi,1 Diego G Peroni,2 Cristoforo Incorvaia,3 Nicola Quaranta,1 Concetta De Luca,1 Salvatore Barberi,4 Ilaria Dell'Albani,5 Massimo Landi,6 Franco Frati,5 Olivier de Beaumont7 1Otolaryngology Unit, Department of Neuroscience and Sensory Organs, University of Bari, Bari, Italy; 2Department of Pediatrics, University of Verona, Verona, Italy; 3Allergy/Pulmonary Rehabilitation, ICP Hospital, Milan, Italy; 4Department of Pediatrics, San Paolo Hospital, Milan, Italy; 5Medical and Scientific Department, Stallergenes, Milan, Italy; 6Department of Pediatrics, National Healthcare System, ASL TO1, Turin, Italy; 7Medical Affairs Department, Stallergenes, Antony, France Background: House dust mites (HDMs are a major cause of allergic rhinitis (AR and asthma worldwide. Recent studies suggested that the allergen load presents seasonal modifications, giving rise to seasonal variation in nasal inflammation and symptoms. The aim of this study was to evaluate by nasal cytology whether nasal inflammation in mite-allergic patients changes with the seasons of the year. Methods: The study included 16 patients (seven males and nine females, mean age 38.1 years with persistent AR caused by monosensitization to HDMs. Nasal cytology was performed in all patients once monthly for 1 year. Results: Nasal cytology showed that the cells most commonly detected in the nasal mucosa were neutrophils. During the period from October to April, a peak in the number of neutrophils and also the presence of significant numbers of eosinophils, mast cells, and lymphocytes/plasma cells were found, which shows the occurrence of more intense inflammation during these months. Conclusion: Nasal cytology provides useful data in detecting nasal inflammation and its association with the clinical stage of AR. The seasonal variations in nasal cytology are likely to be induced by the fluctuations in the HDM allergen that have been uncovered in recent investigations. Keywords: allergens

  7. Gene expression profiling of canine osteosarcoma reveals genes associated with short and long survival times

    Directory of Open Access Journals (Sweden)

    Rao Nagesha AS

    2009-09-01

    Full Text Available Abstract Background Gene expression profiling of spontaneous tumors in the dog offers a unique translational opportunity to identify prognostic biomarkers and signaling pathways that are common to both canine and human. Osteosarcoma (OS accounts for approximately 80% of all malignant bone tumors in the dog. Canine OS are highly comparable with their human counterpart with respect to histology, high metastatic rate and poor long-term survival. This study investigates the prognostic gene profile among thirty-two primary canine OS using canine specific cDNA microarrays representing 20,313 genes to identify genes and cellular signaling pathways associated with survival. This, the first report of its kind in dogs with OS, also demonstrates the advantages of cross-species comparison with human OS. Results The 32 tumors were classified into two prognostic groups based on survival time (ST. They were defined as short survivors (dogs with poor prognosis: surviving fewer than 6 months and long survivors (dogs with better prognosis: surviving 6 months or longer. Fifty-one transcripts were found to be differentially expressed, with common upregulation of these genes in the short survivors. The overexpressed genes in short survivors are associated with possible roles in proliferation, drug resistance or metastasis. Several deregulated pathways identified in the present study, including Wnt signaling, Integrin signaling and Chemokine/cytokine signaling are comparable to the pathway analysis conducted on human OS gene profiles, emphasizing the value of the dog as an excellent model for humans. Conclusion A molecular-based method for discrimination of outcome for short and long survivors is useful for future prognostic stratification at initial diagnosis, where genes and pathways associated with cell cycle/proliferation, drug resistance and metastasis could be potential targets for diagnosis and therapy. The similarities between human and canine OS makes the

  8. Sequential chemoradiotherapy for stage I/II nasal natural killer/T cell lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Noh, Young Joo [Ulsan University Hospital, University of Ulsan College of Medicine, Seoul (Korea, Republic of); Ahn, Yong Chan; Kim, Won Seog; Ko, Young Hyeh [Sungkyunkwan University School of Medicine, Seoul (Korea, Republic of)

    2004-09-15

    Authors would report the results of sequential CHOP chemotherapy (cyclophosphamide, adriamycin, vincristine, and prednisone) and involved field radiotherapy (IFRT) for early stage nasal natural killer/T-cell lymphoma (NKTCL). Fourteen among 17 patients, who were registered at the Samsung Medical Center tumor registry with stage I and II nasal NKTCL from March 1995 to December 1999 received this treatment protocol. Three to four cycles of CHOP chemotherapy were given at 3 weeks' interval, which was followed by local IFRT including the known tumor extent and the adjacent draining lymphatics. Favorable responses after chemotherapy (before IFRT) were achievable only in seven patients (5 CR's + 2 PR's: 50%), while seven patients showed disease progression. There were six patients with local failures, two with distant relapses, and none with regional lymphatic failure. The actuarial overall survival and progression-free survival at 3 years were 50.0% and 42.9%. All the failures and deaths occurred within 13 months of the treatment start. The factors that correlated with the improved survival were the absence of 'B' symptoms, the favorable response to chemotherapy and overall treatment, and the low risk by international prognostic index on univariate analyses. Compared with the historic treatment results by IFRT either alone or followed by chemotherapy, the current trial failed to demonstrate advantages with respect to the failure pattern and survival. Development of new treatment strategy in combining IFRT and chemotherapy is required for improving outcomes.

  9. Phenylephrine as an alternative to cocaine for nasal vasoconstriction before nasal surgery: A randomised trial

    Directory of Open Access Journals (Sweden)

    Sawsan T AlHaddad

    2013-01-01

    Full Text Available Background: Cocaine is often used topically to provide the profound vasoconstriction required for nasal surgery; however, it has been associated with intraoperative cardiac adverse effects. We compared cocaine with phenylephrine as an alternative to ascertain their relative efficacy as vasoconstrictors in nasal septoplasty. Methods: Adult patients, presenting for elective nasal septoplasty, of American Society of Anaesthesiologists physical status I-III, were randomised to either 0.5% phenylephrine or 4% cocaine. The primary outcome was quality of vasoconstriction on a 5-point scale (1=unacceptable, 5=excellent, rated by the surgeon at the end of the procedure. Results: Twenty-nine patients received phenylephrine and 26 received cocaine. The median rating for quality of the vasoconstriction was 4.0 (good in both the phenylephrine and cocaine groups ( P=0.84. Median blood loss was 50 ml in the phenylephrine group and 62.5 ml in the cocaine group ( P=0.49. In secondary analyses, phenylephrine was shown to be non-inferior to cocaine on both quality of vasoconstriction (non-inferiority delta of 1 point, P=0.009 and estimated blood loss (non-inferiority delta of 25 ml, P=0.028. The frequency of ventricular ectopy, ST segment changes or blood pressure changes after nasal packing was not significantly different between the two groups. Conclusion: Phenylephrine in a concentration of 0.5% is not different from 4% cocaine on the quality of vasoconstriction in septoplasty. Given the abuse potential of cocaine and the added administrative burden associated with its handling, phenylephrine might serve as an alternative.

  10. Bone tumor

    Science.gov (United States)

    Tumor - bone; Bone cancer; Primary bone tumor; Secondary bone tumor ... The cause of bone tumors is unknown. They often occur in areas of the bone that grow rapidly. Possible causes include: Genetic defects ...

  11. Experimental Forelimb Allotransplantation in Canine Model

    Science.gov (United States)

    2016-01-01

    As reconstructive transplantation is gaining popularity as a viable alternative for upper limb amputees, it is becoming increasingly important for plastic surgeons to renew surgical skills and knowledge of this area. Forelimb allotransplantation research has been performed previously in rodent and swine models. However, preclinical canine forelimb allotransplantation studies are lacking in the literature. The purpose of this paper is to provide an overview of the surgical skills necessary to successfully perform forelimb transplantation in canines as a means to prepare for clinical application. A total of 18 transplantation operations on canines were performed. The recipient limb was shortened at the one-third proximal forearm level. The operation was performed in the following order: bones (two reconstructive plates), muscles and tendons (separately sutured), nerves (median, ulnar, and radial nerve), arteries (two), and veins (two). The total mean time of transplantation was 5 hours ± 30 minutes. All of the animals that received transplantation were treated with FK-506 (tacrolimus, 2 mg/kg) for 7 days after surgery. Most allografts survived with perfect viability without vascular problems during the early postoperative period. The canine forelimb allotransplantation model is well qualified to be a suitable training model for standard transplantation and future research work. PMID:27597952

  12. Seroprevalence of Canine Distemper Virus in Cats

    OpenAIRE

    Ikeda, Yasuhiro; Nakamura, Kazuya; Miyazawa, Takayuki; Chen, Ming-Chu; Kuo, Tzong-Fu; Lin, James A; Mikami, Takeshi; Kai, Chieko; TAKAHASHI, Eiji

    2001-01-01

    A seroepidemiological survey of canine distemper virus (CDV) infection in Asian felids revealed that the prevalence of antibodies varied depending on region and, in some cases, exposure to dogs. The serologic pattern in cats with antibodies indicated that they had likely been exposed to field strains rather than typical CDV vaccine strains.

  13. Canine Distemper Outbreak in Rhesus Monkeys, China

    OpenAIRE

    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang; Hu, Rongliang

    2011-01-01

    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People’s Republic of China. Approximately 10,000 animals were infected (25%–60% disease incidence); 5%–30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain.

  14. Experimental Forelimb Allotransplantation in Canine Model.

    Science.gov (United States)

    Hong, Sa-Hyeok; Eun, Seok-Chan

    2016-01-01

    As reconstructive transplantation is gaining popularity as a viable alternative for upper limb amputees, it is becoming increasingly important for plastic surgeons to renew surgical skills and knowledge of this area. Forelimb allotransplantation research has been performed previously in rodent and swine models. However, preclinical canine forelimb allotransplantation studies are lacking in the literature. The purpose of this paper is to provide an overview of the surgical skills necessary to successfully perform forelimb transplantation in canines as a means to prepare for clinical application. A total of 18 transplantation operations on canines were performed. The recipient limb was shortened at the one-third proximal forearm level. The operation was performed in the following order: bones (two reconstructive plates), muscles and tendons (separately sutured), nerves (median, ulnar, and radial nerve), arteries (two), and veins (two). The total mean time of transplantation was 5 hours ± 30 minutes. All of the animals that received transplantation were treated with FK-506 (tacrolimus, 2 mg/kg) for 7 days after surgery. Most allografts survived with perfect viability without vascular problems during the early postoperative period. The canine forelimb allotransplantation model is well qualified to be a suitable training model for standard transplantation and future research work. PMID:27597952

  15. Overexpression of vimentin in canine prostatic carcinoma

    DEFF Research Database (Denmark)

    Rodrigues, M M P; Rema, A; Gärtner, F;

    2011-01-01

    is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...

  16. Canine specific ELISA for coagulation factor VII

    DEFF Research Database (Denmark)

    Knudsen, Tom; Kjelgaard-Hansen, Mads; Tranholm, Mikael;

    2011-01-01

    available to date. In this study, a canine specific ELISA for measurement of FVII:Ag in plasma was developed and validated. The FVII:Ag ELISA correctly diagnosed homozygous and heterozygous hereditary FVII deficiency. Together with activity based assays, such as FVII:C, the FVII:Ag ELISA should be valuable...

  17. Canine notoedric mange: a case report.

    Science.gov (United States)

    Leone, Federico

    2007-04-01

    Notoedric mange is a cutaneous ectoparasitic disease of cats caused by Notoedres cati, a mite belonging to the Sarcoptidae family. The disease occurs in felids, occasionally in other mammals and in humans. The canine form, even if cited by some authors, has never been documented. This report describes for the first time a case of notoedric mange in a dog.

  18. Canine retraction with J hook headgear.

    Science.gov (United States)

    Ayala Perez, C; de Alba, J A; Caputo, A A; Chaconas, S J

    1980-11-01

    Several methods have been described for accomplishing distal movement of canines without losing posterior anchorage. An accepted method in canine retraction is the use of headgear with J hooks. Since it incorporates extraoral anchorage, it is most effective in maximum-anchorage cases. It was the purpose of this study to analyze the distribution of force transmitted to the alveolus and surrounding structures by means of photoelastic visualization, utilizing J hook headgear for maxillary canine retraction. A three-dimensional model representing a human skull was used. This model was constructed with different birefringent materials to simulate bone, teeth, and periodontal membranes. Three different vectors of force were applied representing high-, medium-, and low-pull headgear, which were placed at angles of 40, 20, and 0 degrees to the occlusal plane. The photoelastic analysis was made by means of a circular-transmission polariscope arrangement, and the photoelastic data were recorded photographically. The stress areas created by the three different vectors of force were associated with various degrees of canine tipping. This effect was greater with the low-pull force component than with the medium-pull traction. The high-pull headgear produced the least tipping tendency, being closer to a bodily movemment effect. Further, stresses were transmitted to deeper structures of the simulated facial bones; these regions were the frontozygomatic, zygomaticomaxillary, and zygomaticotemporal sutures.

  19. 18F-FDG Positron Emission Tomography – An Innovative Technique for the Diagnosis of a Canine Lameness

    OpenAIRE

    Mann, Kelly; Hart, Juliette; Duerr, Felix

    2016-01-01

    Introduction Positron emission tomography (PET) imaging with fluorine-18-fluorodeoxyglucose (18F-FDG) is widely known for its use in the diagnosis and tracking of primary and metastatic tumors via uptake and retention of the radiopharmaceutical by hypermetabolic cells. 18F-FDG is also used to study the normal physiology of glucose uptake, metabolism, and muscle activity during and after exercise. Background A pilot study adding PET imaging to the diagnostic evaluation of canine patients under...

  20. Results of rhinoplasties of the nasal tip in Cienfuegos

    Directory of Open Access Journals (Sweden)

    Bernardo Félix Canto Vidal

    2015-04-01

    Full Text Available Background: the rhinoplasty of the nasal tip is one of the most difficult and challenging plastic surgeries the surgeon dedicated to the nasal deformities faces. Objective: exposing the results of the rhinoplasty accomplished to patients with nasal deformities. Methods: a descriptive study of results obtained in 145 patients who had a surgery to correct nasal deformities. They were attended at Dr. Gustavo Aldereguía Lima University General Hospital of Cienfuegos, in a period of 10 years. Results: in 56 patients surgery was headed for embracing the nasal tip; in 45 patients to the rotation of the nasal tip; and in 44 patients to the projection of the nasal tip. The technique of the banner with graft of cartilage of the septum and the ear was used. Conclusion: in the analyzed period, the rhinoplasty accomplished in the province of Cienfuegos had satisfactory results, because the patient’s expectations were satisfied with a reduction of the costs of risks for them due to the use of local anesthesia.

  1. Sense of smell in patients with bilateral nasal polyposis

    Directory of Open Access Journals (Sweden)

    Savović Slobodan N.

    2004-01-01

    Full Text Available Introduction Sense of smell is susceptible to various changes, both in physiological and in numerous pathological conditions. Of quantitative disorders of smell, hyposmia and anosmia are quite common, whereas of qualitative disorders parosmia is most frequent. The aim of this paper was to examine impact of bilateral nasal polyposis on olfactory function. Material and methods The research was carried out at the Nose, Ear and Throat Clinic in Novi Sad. It included 80 examinees, 40 (20 male, 20 female with bilateral nasal polyposis, while 40 examinees belonged to the control group (20 male, 20 female without symptoms of nasal polyposes. Fortunato-Niccolini olfactometer was used for this examination. Results and discussion In patients with bilateral nasal polyposis the average perception threshold values for examined odors were 15.50 ccm of odorous air, while in the control group they were 10,20 ccm of odorous air. The average identification threshold values for examined odors in patients with bilateral nasal polyposis were 18.80 ccm of odorous air, while in the control group they were 13.55 ccm of scented air. T-test showed that values of both tresholds were statistically significantly higher (p< 0,01 in patients with bilateral nasal polyposis in relation to the control group. Conclusion Olfactory deficit in patients with bilateral nasal polyposis is explained by difficult or impossible passage of odors into the olfactory region.

  2. An approach to the nasal septum in children.

    Science.gov (United States)

    Healy, G B

    1986-11-01

    Surgery of the nasal septum has long been discouraged in the pediatric population. Concerns about growth and development of the nose have led surgeons to adopt an extremely cautious attitude toward the correction of nasal septal deformities in childhood. More recently, studies have shown that with proper preservation of septal cartilage, surgery can be safely undertaken in this area. Frequently, however, exposure to the nasal septum is limited in small children due to the size of the nasal vestibule. Sublabial septoplasty has been safely carried out now in ten patients ranging in age from 4 to 9 years. This approach allows for complete access to the nasal septum while avoiding any external cosmetic deformity. The nasal septum has been preserved in all cases through morsalization and repositioning. Growth and development of the nose has been followed for up to 60 months without evidence of deformity or alteration. Sublabial septoplasty would, therefore, appear to be a safe and cosmetically acceptable approach to the correction of severe nasal septal deformities of childhood. PMID:3773624

  3. NASAL IN SITU GEL: A NOVEL DRUG DELIVERY SYSTEM

    Directory of Open Access Journals (Sweden)

    Dhrupesh panchal

    2012-06-01

    Full Text Available Over the past few decades, advances in the in situ gel technologies have spurred development in manymedical and biomedical applications including controlled drug delivery. Many novel in situ gel baseddelivery matrices have been designed and fabricated to fulfill the ever increasing needs of thepharmaceutical and medical fields. In situ gelling systems are liquid at room temperature but undergogelation when in contact with body fluids or change in pH. In situ gel forming drug delivery is a type ofmucoadhesive drug delivery system. The formation of gel depends on factors like temperaturemodulation, pH change, presence of ions and ultraviolet irradiation from which the drug gets released ina sustained and controlled manner. Nasal delivery is a promising drug delivery option where commondrug administrations such as intravenous, intramuscular or oral are inapplicable. Recently, it has beenshown that many drugs have better bioavailability by nasal route than the oral route. This has beenattributed to rich vasculature and a highly permeable structure of the nasal mucosa coupled withavoidance of hepatic first-pass elimination, gut wall metabolism and/or destruction in thegastrointestinal tract. The physiology of the nose presents obstacles but offers a promising route for noninvasivesystemic delivery of numerous therapies and debatably drug delivery route to the brain. Thusthis review focuses on nasal drug delivery, various aspects of nasal anatomy and physiology, nasal drugabsorption mechanisms, various nasal drug delivery systems and their applications in drug delivery.

  4. PRL-3 expression in nasal sinus squamous cell carcinoma

    Institute of Scientific and Technical Information of China (English)

    Zi-Hui Chen; Min-Ying Li

    2016-01-01

    Objective:To investigate the relationship between liver regeneration phosphatase-3 (PRL-3) with differentiation extent of nasal sinus squamous cell carcinoma, and molecular biological effects on the pathogenesis of nasal sinus squamous cell carcinoma to comprehend its relevance, so as to make early diagnosis of patients, and to give guidance to the prognosis. Methods:Immunohistochemistry was used to detect PRL-3 in 30 cases of different degrees of sinus nasal squamous cell carcinoma. 20 cases of normal nasal cavity of mucosa tissues were set as control. Results:The PRL-3 in all levels of sinonasal squamous cell carcinoma tissues, there was a significant difference compared with the normal nasal mucosa (P<0.05), squamous cell carcinoma and its expression increased with the grade with enhanced trend. Conclusions:PRL-3 expression increased significantly in sinonasal squamous cell carcinoma than in nasal polyp tissue, showed that it may be associated with squamous cell carcinoma of nasal sinus squamous cell carcinoma, may be the early event.

  5. Brain-targeted nasal clonazepam microspheres

    Directory of Open Access Journals (Sweden)

    Shaji J

    2009-01-01

    Full Text Available Gelatin-chitosan mucoadhesive microspheres of clonazepam were prepared using the emulsion cross linking method. Mirospheres were evaluated using the in vitro and ex vivo drug release patterns. In vivo CNS drug distribution studies were carried out in rats by administering the clonazepam microspheres intra-nasally and clonazepam solution intravenously. From the drug levels in plasma and CSF, drug targeting index and drug targeting efficiency were calculated. Results obtained indicated that intranasally administered clonazepam microspheres resulted in higher brain levels with a drug targeting index of 2.12. Gelatin-chitosan cross linked mucoadhesive microspheres have the potential to be developed as a brain-targeted drug delivery system for clonazepam.

  6. Clinical study and image diagnosis of nasal bone fracture

    Energy Technology Data Exchange (ETDEWEB)

    Ogawa, Takenori; Suzuki, Naohiro; Okitsu, Takuji [Sendai City Hospital (Japan)

    2002-01-01

    In this study we reviewed the clinical features, diagnoses and treatments of 232 cases of nasal bone fracture cases treated at our department from January 1994 to June 2000. A marked predominance of males in the age range of 10-29 years was noted. Analysis of the causes of the nasal fractures were attributed to fighting (66 cases), traffic accidents (64 cases), sports (56 cases) and others (46 cases). The external appearance of nasal fractures were divided into 5 types, 85 cases of the displacement type, 27 cases of the depressed type, 32 of the mixed type, 56 of the non-deformation type and 32 of the unclassified type because of facial swelling. The sensitivity of conventional X-ray examination in identifying nasal fractures was 75.6%. Computed tomography scan (CT scan) was performed in 196 patients and showed that the middle and lower portions of nasal bones were fractured more easily than those of the upper portion. Nasal septum fracture occurred in 22 cases (11.2%). Other facial fractures combined with nasal fracture were found in 40 cases (20.4%). The type of combined fracture depended on the cause of the injury, for example, the combination of nasal and blow-out fracture was often caused by fighting, and many combined fractures of more than two facial bones resulted from traffic accidents. A total of 83 patients (35.8%) received reduction of the nasal bone fractures under general anaesthesia. The measurement of irradiation of each radiological examination revealed that the exposed dose of the newest model CT was similar to that of the conventional X-ray examination and tomography. (author)

  7. Canine visceral leishmaniasis in Sicily.

    Science.gov (United States)

    Orndorff, G R; Cooper, B A; Smith, W; Ryan, J R

    2000-01-01

    The Sicilian province of Catania is an active foci for human visceral leishmaniasis (VL) in the Mediterranean area. Approximately 10 to 15 cases of VL are diagnosed via hospital admissions each year in this community. Recently, an increase in VL case reporting by Sicilian physicians was noted, with 38 and 37 VL cases in 1996 and 1997, respectively. Before 1995, there were no reported VL cases among U.S. military personnel or their family members living in Sicily. However, since 1996, there have been four cases referred to Walter Reed Army Medical Center for diagnosis and treatment, all involving the children of personnel assigned to Naval Air Station Sigonella. Exposure histories for all infected individuals excluded exposure to Leishmania parasites outside of Sicily. All patients lived in areas where vectoring sandflies are present. All had dogs as family pets. To evaluate the level of infection among dogs owned by Navy personnel and their families, U.S. Navy Environmental and Preventive Medicine Unit 7, in a collaborative study with the U.S. Army Veterinary Clinic, Naval Air Station Sigonella, and the Walter Reed Army Institute of Research, performed clinical evaluation and serological testing of 50 dogs residing with U.S. personnel assigned to Naval Air Station Sigonella. The data indicate a high exposure rate to Leishmania (60% of the animals tested had elevated immunoglobulin M antibody levels) in the study population, suggesting that they were infected with Leishmania infantum. Distribution of seropositive dogs by sex was equal. Most of the dogs studied appeared to be in good health. However, inapparent infection of dogs, seen by Italian veterinarians, has been observed throughout all areas of Catania. Sandflies responsible for vectoring L. infantum were trapped in the same locations as the dogs sampled in this study. The level of subclinical infection was 75% among seropositive dogs. The overall level of canine infection observed was higher than expected

  8. Using acoustic sensors to discriminate between nasal and mouth breathing.

    Science.gov (United States)

    Curran, Kevin; Yuan, Peng; Coyle, Damian

    2012-01-01

    The recommendation to change breathing patterns from the mouth to the nose can have a significantly positive impact upon the general well being of the individual. We classify nasal and mouth breathing by using an acoustic sensor and intelligent signal processing techniques. The overall purpose is to investigate the possibility of identifying the differences in patterns between nasal and mouth breathing in order to integrate this information into a decision support system which will form the basis of a patient monitoring and motivational feedback system to recommend the change from mouth to nasal breathing.

  9. [Nasal breath recovery and rhinoplasty in cleft lip and palate patient with unilateral choanal atresia].

    Science.gov (United States)

    Chkadua, T Z; Ivanova, M D; Daminov, R O; Brusova, L A; Savvateeva, D M

    2016-01-01

    The paper presents the analysis of clinical case of endoscopic nasal breath restoration and elimination of the secondary cleft lip nasal deformity in 27 years old patient with unilateral choanal atresia and secondary nasal deformity after rhinocheiloplasty. Preoperative examination revealed the absence of nasal breathing on collateral side due to complete bone choanal atresia. Surgical treatment included endoscopic choanal repair, elimination of the secondary nasal deformity, septoplasty, conchotomy and lateroposition of the inferior conchae. The treatment resulted in nasal breath restoration and elimination of nasal deformity. Long-term follow-up at 1 and 12 months post-operatively proved stable positive aesthetic and functional results. PMID:26925564

  10. Estudo radiográfico digital indireto do efeito da expansão de maxila cirurgicamente assistida (EMCA sobre o septo nasal Indirect digital radiographic study about the effect of surgically assisted maxillary expansion (SAME on the nasal septum

    Directory of Open Access Journals (Sweden)

    Eduardo Sanches Gonçales

    2007-10-01

    maxillary expansion is achieved by means of surgical-orthodontic procedures (known as surgically assisted maxillary expansion - SAME that can cause some effects on the nasal cavity and septum. AIM: To evaluate the behavior of the nasal septum after the procedures of SAME. METHODS: Post-anterior cephalometric and maxillary occlusal radiographs, taken by conventional technique and therefore digitalized, were analyzed from 16 patients undergone SAME. For all patients, the SAME technique consisted of subtotal Le Fort I osteotomy. The radiographs were taken before the surgical procedure, right after (mediate post-operatory time or after the expansion, and thereafter digitalized and measured using DIGORA program. Also, the distances between teeth (canines, first premolars, second premolars, first molars and second molars were registered. RESULTS: The statistical treatment showed an increase in interdental and intermaxillary distances, along with an increase in the width of the base of piriform aperture and in the distances between the base of lateral wall of the piriform aperture and nasal septum. CONCLUSION: SAME is an efficient procedure that seems not to influence the septum position.

  11. Canine neoplasia and exposure to uranium mill tailings in Mesa County, Colorado

    International Nuclear Information System (INIS)

    A canine cancer registry was established for Mesa County, Colorado in order to collect material for a case control analysis of exposure to uranium tailings. Between 1979 and 1981, 212 cases of canine cancer were confirmed histologically. Based on the address provided at the time of diagnosis, 33 dogs (15.6%) lived in a house with some exposure to uranium tailings. A control group, comprised of dogs with a histologic diagnosis other than cancer, was stratified according to hospital and matched with cases on a 1:1 basis. No significant differences were noted with respect to exposure to uranium tailings for total cancers or cancers of specific sites including lymph node, breast, liver, testicle and bone. The overall estimated relative risk was 0.70 (95% CI 0.04 to 1.16). Canine population estimates were derived for Mesa County in order to develop crude incidence rates for the major types and sites of cancer. Crude rates were compared with those published previously for Alameda County, California and Tulsa County, Oklahoma. Mesa County rates for total cancer incidence, connective tissue tumors and non melanoma skin cancer were higher than those reported for Alameda County. When compared with Tulsa County, Mesa County rates for total cancer, breast cancer, melanoma and mastocytoma were lower than expected while rates for osteosarcoma, hemangiosarcoma and fibrosarcoma significantly exceeded expected values

  12. Vitamin D Receptor, Retinoid X Receptor, Ki-67, Survivin, and Ezrin Expression in Canine Osteosarcoma

    Directory of Open Access Journals (Sweden)

    John Davies

    2012-01-01

    Full Text Available Canine osteosarcoma (OS is an aggressive malignant bone tumor. Prognosis is primarily determined by clinical parameters. Vitamin D has been postulated as a novel therapeutic option for many malignancies. Upon activation, vitamin D receptors (VDRs combine with retinoid receptor (RXR forming a heterodimer initiating a cascade of events. Vitamin D's antineoplastic activity and its mechanism of action in OS remain to be clearly established. Expression of VDR, RXR, Ki-67, survivin, and ezrin was studied in 33 archived, canine OS specimens. VDR, RXR, survivin, and ezrin were expressed in the majority of cases. There was no statistically significant difference in VDR expression in relationship with tumor grade, type, or locations or animal breed, age, and/or sex. No significant association (p=0.316 between tumor grade and Ki-67 expression was found; in particular, no difference in Ki-67 expression between grades 2 and 3 OSs was found, while a negative correlation was noted between Ki-67 and VDR expression (ρ=−0.466, a positive correlation between survivin and RXR expression was found (p=0.374. A significant relationship exists between VDR and RXR expression in OSs and proliferative/apoptosis markers. These results establish a foundation for elucidating mechanisms by which vitamin D induces antineoplastic activity in OS.

  13. Effects of canine serum collected from dogs at different estrous cycle stages on in vitro nuclear maturation of canine oocytes.

    Science.gov (United States)

    Oh, Hyun Ju; Fibrianto, Yuda Heru; Kim, Min Kyu; Jang, Goo; Hossein, M Shamim; Kim, Hye Jin; Kang, Sung Keun; Lee, Byeong Chun; Hwang, Woo Suk

    2005-08-01

    Canine oocytes are ovulated at prophase of the first meiotic division and undergo maturation in the distal part of the oviduct for at least 48-72 h. Because of these differences from other domestic mammals, the efficiency of in vitro maturation (IVM) of canine oocyte is very low. The present study was conducted to evaluate the effects of canine serum on IVM of canine oocytes recovered from ovaries in various reproductive states (follicular, luteal or anestrous stages). Oocytes were recovered by mincing ovaries from bitches presented for ovariohysterectomy at various stages of the estrous cycle. Heat-inactivated canine serum was prepared with blood taken from dogs at the anestrous, estrous or diestrous stage of the estrous cycle as determined by progesterone concentration and vaginal cytology. Oocytes were cultured for 72 h in tissue culture medium (TCM)-199 supplemented with 10% canine anestrous, estrous or diestrous serum or fetal bovine serum (FBS) (experiment 1), or supplemented with 0 (control), 5%, 10% or 20% canine estrous serum (experiment 2). In experiment 1, IVM of oocytes collected at the follicular stage of the estrous cycle to metaphase II (MII) stage was higher (p < 0.05) with canine estrous serum (14.2%) than with canine anestrous (5.2%) or diestrous serum (6.3%), FBS (2.2%) or in the control (2.2%). In experiment 2, oocytes collected at the follicular stage of the estrous cycle cultured in TCM-199 with 10% canine estrous serum showed a higher maturation rate to MII stage (13.5%, p < 0.05) compared with those cultured with 5% (1.3% MII) or 20% canine estrous serum (5.1% MII) or the control (2.7% MII). In conclusion, our results demonstrate that supplementing culture medium with 10% canine estrous serum improves IVM of canine follicular stage oocytes. PMID:16261767

  14. Tumor-associated macrophages promote tumor cell proliferation in nasopharyngeal NK/T-cell lymphoma

    OpenAIRE

    Liu, Yixiong; Fan, Linni; Wang, Yingmei; Li, Peifeng; Zhu, Jin; Wang, Lu; Zhang, Weichen; Zhang, Yuehua; Huang, Gaosheng

    2014-01-01

    Objective: To explore the relationship between the number of tumor-associated macrophages (TAMs) and proliferative activity of tumor cells and the relationship between two macrophage biomarkers CD68 and CD163 in nasopharyngeal NK/T-cell lymphoma. Methods: Immunohistochemistry was used to reconfirm the diagnosis of nasal NK/T-cell lymphoma and detect the numbers of TAMs and the ki-67 label index of the tumor cells in all 31 cases. In addition, 12 cases of inflammatory cases were collected as c...

  15. Radiation/hyperthermia in canine hemangiopericytomas: A large animal model for therapeutic response

    International Nuclear Information System (INIS)

    X-irradiation followed by microwave induced hyperthermia resulted in a 91% objective response rate in 11 dogs with naturally occurring hemangiopericytomas. The authors used a novel statistical procedure to quantitatively evaluate the clinical behavior of locally invasive, non-metastatic tumors undergoing therapy for control of local disease. Utilizing a small sample size, the procedure demonstrated distribution of the data and classical parametric and non-parametric statistical methods, including setting confidence limits on the population mean and placing tolerance limits on a population percentage. Similarities of canine and human hemangiopericytomas were observed. Application of the statistical methods to human and animal trials were apparent

  16. Claudin-1, -3, -4 and -7 gene expression analyses in canine prostate carcinoma and mammary tissue derived cell lines.

    Science.gov (United States)

    Hammer, S C; Nagel, S; Junginger, J; Hewicker-Trautwein, M; Wagner, S; Heisterkamp, A; Ngezahayo, A; Nolte, I; Murua Escobar, H

    2016-01-01

    Claudins (CLDNs) are transmembrane proteins localised in the cell membrane of epithelial cells composing a structural and functional component of the tight junction protein complexes. In canine tumors deregulations of the CLDN expression patterns were described immunohistochemically. Targeting of claudin proteins has further been evaluated to establish novel therapeutic approaches by directed claudin binding. Precondition for the development of claudin targeting approaches in canine cells is the possibility to characterise claudin expression specifically and the availability of claudin positive cell lines. Herein PCR/qPCR assays were established allowing a rapid qualitative and quantitative characterisation of CLDN-1, -3, -4 and -7 gene expression in canine cell lines and tissues. Further commercially available antibodies were used to verify CLDN gene expression on protein level by Western blots. The developed assays were used to analyse six canine cell lines derived from mammary and prostate tissue for their CLDN-1, -3, -4 and -7 expressions. The canine cell line DT08/40 (prostate transitional cell carcinoma) was used for the establishment of specific CLDNs -1, -3, -4 and -7PCR/qPCR. The designed assays were verified by amplicon cloning and sequencing. Gene expressions were verified on protein level by Western blot. Additionally further cell lines were analysed for their CLDN-1, -3, -4 and -7 expression on mRNA and protein level (mammary derived cell lines: MTH53A (non-neoplastic), ZMTH3 (adenoma), MTH52C (carcinoma); prostate derived cell lines: DT08/46 and CT1258 (both adenocarcinoma).The screened cell lines showed expression for the CLDNs as follows: DT08/46 and DT08/40: CLDN-1, -3, -4 and -7 positive; CT1258: CLDN-1, -3, -4 and -7 negative; ZMTH3 and MTH52C: CLDN-1 and -7 positive, CLDN-3 and -4 negative; MTH53A: CLDN-1, -3 and -4 negative, CLDN-7 positive. Western blot analyses reflect the detected CLDN-1, -3, -4 and -7 expressions in the analysed cell

  17. Nasal Drug Delivery : In Vitro Studies on Factors Influencing Permeability and Implications on Absorption

    OpenAIRE

    Wadell, Cecilia

    2002-01-01

    Nasal delivery is a feasible alternative to oral or parenteral administration for some drugs because of the high permeability of the nasal epithelium, rapid drug absorption across this membrane and avoidance of hepatic first-pass metabolism. The main objective of this thesis was to investigate factors influencing the permeability of the nasal mucosa to various compounds and to evaluate implications for drug absorption via the nasal route. Porcine nasal mucosa mounted in an Ussing chamber sys...

  18. Oxygenation and Exercise Performance-Enhancing Effects Attributed to the Breathe-Right Nasal Dilator

    OpenAIRE

    Trocchio, Marc; Fisher, Jean; Wimer, Jeffrey W.; Parkman, Anna W.

    1995-01-01

    Recently, many professional football players have elected to wear spring-loaded nasal dilators during competition. Many athletes believe that wearing the “Breathe-Right” nasal dilator will increase nasal gas conduction and oxygenation to their body, subsequently improving their performance. The purpose of this experiment was to investigate the advantages of wearing a nasal dilator while performing aerobic and anaerobic exercise, as opposed to not wearing a nasal dilator. It was hypothesized t...

  19. Preliminary stages before nasal reconstruction using forehead flap: restoring perinasal subunits and nostril patency

    Directory of Open Access Journals (Sweden)

    Victor Diniz de Pochat

    2015-03-01

    Full Text Available Due to the complex three-dimensional structure of the nose, the repair of the nasal defect requires reconstruction of three different layers: skin envelope, osteocartilaginous framework and nasal lining. Before nasal reconstruction can be accomplished, the nose must rest on a stable platform to avoid late nasal obstructions, and septal deviations resulting from scar contraction. We present three cases of nasal reconstruction using a forehead flap in which we performed a preliminary stage to increase reliability of outcomes.

  20. Combined orthodontic-surgical management of a transmigrated mandibular canine.

    Science.gov (United States)

    Cavuoti, Serena; Matarese, Giovanni; Isola, Gaetano; Abdolreza, Jamilian; Femiano, Felice; Perillo, Letizia

    2016-07-01

    The presence of an impacted mandibular canine is one of the most difficult challenges that an orthodontist will meet. Orthodontic treatment is planned on an individual basis after thoroughly considering the patient's overall facial and dentoskeletal characteristics; the duration, risks, and costs of treatment; patient preferences; and the orthodontist's experience. This article reports an orthodontic treatment of a boy, age 12.9 years, with an impacted mandibular canine in the permanent dentition that was successfully managed. Radiographic analysis indicated a transmigration of the mandibular right canine. The orthodontic treatment plan included extraction of the deciduous right canine followed by surgical exposure and ligation of the permanent canine. Eruption was properly guided, and the correct position of the tooth was achieved. This challenging treatment approach is described in detail, including the mechanics used to align the impacted canine. PMID:26502299

  1. Nasal Aspergillosis in a Dog: A Case Report

    Directory of Open Access Journals (Sweden)

    Camilo Padilla Peñuela

    2014-07-01

    Full Text Available Nasal aspergillosis is a major chronic disease affecting the nostrils in dogs. Clinical sinology is typical in every chronic nasal disease. Epistaxis and occasional pain occurs. Rhinoscopic assessment of the area evidences findings associated with the pathology and allows collecting samples for cytology and culture. Systemic therapy with oral antifungals has had variable utility, but now it has been replaced by direct topical medication to the affected area. This article describes the case of a 4-years-old male dog, submitted to consultation by unilateral muco-bloody nasal discharge with a week of evolution. The patient was treated by another vet center with cyclonamine and vitamin K for a possible clotting disorder. After a series of tests that included rhinoscopy and fungal culture, nasal aspergillosis was diagnosed. Intranasal clotrimazole was applied twice and it allowed the resolution of the clinical signs.

  2. Zicam-induced damage to mouse and human nasal tissue.

    Directory of Open Access Journals (Sweden)

    Jae H Lim

    Full Text Available Intranasal medications are used to treat various nasal disorders. However, their effects on olfaction remain unknown. Zicam (zinc gluconate; Matrixx Initiatives, Inc, a homeopathic substance marketed to alleviate cold symptoms, has been implicated in olfactory dysfunction. Here, we investigated Zicam and several common intranasal agents for their effects on olfactory function. Zicam was the only substance that showed significant cytotoxicity in both mouse and human nasal tissue. Specifically, Zicam-treated mice had disrupted sensitivity of olfactory sensory neurons to odorant stimulation and were unable to detect novel odorants in behavioral testing. These findings were long-term as no recovery of function was observed after two months. Finally, human nasal explants treated with Zicam displayed significantly elevated extracellular lactate dehydrogenase levels compared to saline-treated controls, suggesting severe necrosis that was confirmed on histology. Our results demonstrate that Zicam use could irreversibly damage mouse and human nasal tissue and may lead to significant smell dysfunction.

  3. Reconstruction of the Nasal Septum Using Polydioxanone Plate

    NARCIS (Netherlands)

    M. Boenisch; G.J.N. Trenite

    2010-01-01

    Objectives: To evaluate the usefulness of resorbable polydioxanone plate attached to nasal septal cartilage in external septoplasty, to assess its mechanical stability until healing of cartilage fragments, and to describe the surgical technique and clinical experience. Design: External septoplasty w

  4. Columnar cell lesions of the canine mammary gland: pathological features and immunophenotypic analysis

    Directory of Open Access Journals (Sweden)

    Cassali Geovanni D

    2010-02-01

    Full Text Available Abstract Background It has been suggested that columnar cell lesions indicate an alteration of the human mammary gland involved in the development of breast cancer. They have not previously been described in canine mammary gland. The aim of this paper is describe the morphologic spectrum of columnar cell lesions in canine mammary gland specimens and their association with other breast lesions. Methods A total of 126 lesions were subjected to a comprehensive morphological review based upon the human breast classification system for columnar cell lesions. The presence of preinvasive (epithelial hyperplasia and in situ carcinoma and invasive lesions was determined and immunophenotypic analysis (estrogen receptor (ER, progesterone receptor (PgR, high molecular weight cytokeratin (34βE-12, E-cadherin, Ki-67, HER-2 and P53 was perfomed. Results Columnar cell lesions were identified in 67 (53.1% of the 126 canine mammary glands with intraepithelial alterations. They were observed in the terminal duct lobular units and characterized at dilated acini may be lined by several layers of columnar epithelial cells with elongated nuclei. Of the columnar cell lesions identified, 41 (61.2% were without and 26 (38.8% with atypia. Association with ductal hyperplasia was observed in 45/67 (67.1%. Sixty (89.5% of the columnar cell lesions coexisted with neoplastic lesions (20 in situ carcinomas, 19 invasive carcinomas and 21 benign tumors. The columnar cells were ER, PgR and E-cadherin positive but negative for cytokeratin 34βE-12, HER-2 and P53. The proliferation rate as measured by Ki-67 appeared higher in the lesions analyzed than in normal TDLUs. Conclusions Columnar cell lesions in canine mammary gland are pathologically and immunophenotypically similar to those in human breast. This may suggest that dogs are a suitable model for the comparative study of noninvasive breast lesions.

  5. Neurologic abnormalities as the predominant signs of neoplasia of the nasal cavity in dogs and cats: seven cases (1973-1986)

    International Nuclear Information System (INIS)

    Neurologic abnormalities were the predominant historic and physical findings in 5 dogs and 2 cats with primary nasal cavity tumors that had invaded the cranial vault. Seizures, behavior changes, and obtundation were the most common signs. Other neurologic signs included paresis, ataxia, circling, visual deficit, and proprioceptive deficit. Although 1 dog and 2 cats had historic findings of mild respiratory disease, no physical abnormalities related to the respiratory tract were found in any of the 7 animals. Nasal cavity neoplasia was suggested by radiographic and computed tomographic studies and was confirmed histopathologically in each case. The nasal tumor types in the 5 dogs were epidermoid carcinoma (n = 1), adenocarcinoma (n = 2), solid carcinoma (n = 1), and anaplastic chondrosarcoma (n = 1). An esthesioneuroblastoma was found in each cat. Radiation therapy was effective for 3 months in palliating the clinical signs in the 2 dogs in which it was used. Neoplasia of the nasal cavity should be considered in the differential diagnosis for animals with neurologic signs suggestive of cerebral disorders

  6. Canine oral biofilms: Cultural, molecular, and in vitro studies.

    OpenAIRE

    Elliott, D. R.

    2006-01-01

    The canine oral microbiota is poorly understood compared to that of humans. The aim of this work was to improve understanding of the canine oral microbiota. This was achieved by surveying the canine oral microbiota, determining coaggregation interactions between its members, and developing a laboratory microcosm. Bacteria were isolated from the dental plaque and saliva of dogs, and isolates were identified by comparative 16S rRNA gene sequencing. From 339 isolates, 84 phylotypes belonging to ...

  7. Portrait of a Canine Probiotic – from Gut to Gut

    OpenAIRE

    O'Mahony, D.; Murphy, K. Barry; MacSharry, J.; Boileau, T.; Sunvold, G.; Reinhart, G.; Kiely, B.; Shanahan, F; O'Mahony, L.

    2009-01-01

    Abstract The gastrointestinal environment is a complex interactive system involving the host, ingested dietary components, and numerous microbial species. We hypothesised that isolation and screening of Lactobacilli and Bifidobacteria adherent to healthy canine gastrointestinal tissue would yield strains with commensal activity in canines. The aims of this study were 1) to isolate a bank of commensal organisms from the canine gastrointestinal tract; 2) to screen these novel microbi...

  8. Nasal mucosa in workers exposed to formaldehyde: a pilot study.

    OpenAIRE

    Boysen, M; Zadig, E; Digernes, V; Abeler, V; Reith, A.

    1990-01-01

    This study evaluates the histological changes, especially the presence of possible precancerous lesions, in the nasal mucosa of workers exposed to formaldehyde. Nasal biopsies of 37 workers occupationally exposed to formaldehyde for more than five years and 37 age matched referents showed a higher degree of metaplastic alterations in the former group. In addition, three cases of epithelial dysplasia were observed among the exposed. These results indicate that formaldehyde may be potentially c...

  9. [Design of the Rolling Type Nasal Feeding Perfusion Apparatus].

    Science.gov (United States)

    Yu, Dong; Yang, Yonghuan; Hu, Huiqin; Luo, Hongjun; Feng, Yunhao; Hao, Xiali

    2015-09-01

    At present, the existing problem in nasal feeding perfusion apparatus is laborious and instability. Designing the rolling type perfusion apparatus by using a roller pump, the problem is solved. Compared with the traditional perfusion apparatus, the advantage lies in liquid carrying only need once and simulating human swallowing process. Through testing and verification, the apparatus can be used in nasal feeding perfusion for elderly or patients.

  10. Trek1 contributes to maintaining nasal epithelial barrier integrity.

    Science.gov (United States)

    Jiang, Jing; Liu, Jiang-Qi; Li, Jing; Li, Meng; Chen, Hong-Bin; Yan, Hao; Mo, Li-Hua; Qiu, Shu-Qi; Liu, Zhi-Gang; Yang, Ping-Chang

    2015-01-01

    Epithelial barrier integrity is critical to maintain the homeostasis in the body. The regulatory mechanism of the epithelial barrier function has not been fully understood. This study aims to elucidate the role of the TWIK-related potassium channel-1 (Trek1) in the regulation of the epithelial barrier function of the nasal mucosa. In this study, the levels of Trek1 were assessed by real time RT-PCR and Western blotting. The epithelial barrier function of the rat nasal epithelia was evaluated by the Ussing chamber system. The results showed that Trek1 was detected in the human and rat nasal epithelia, which were significantly lower in patients and rats with allergic rhinitis than that in healthy controls. Exposure to the signature T helper 2 cytokine, interleukin (IL)-4, markedly suppressed the expression of Trek1 in the nasal mucosa via up regulating the expression of the histone deacetylase (HDAC)1. The IL-4-induced rat nasal epithelial barrier dysfunction could be blocked by HDAC1 inhibitor (Trichostatin A), or sodium butyrate, or administration of Clostridium Butyricum. We conclude that Trek1 is critical to maintain the nasal epithelial barrier function. PMID:25778785

  11. Treatment of Rhinitis Sicca Anterior with Ectoine Containing Nasal Spray

    Directory of Open Access Journals (Sweden)

    Uwe Sonnemann

    2014-01-01

    Full Text Available Objectives. The safety and efficacy of ectoine nasal spray and ectoine nasal spray with dexpanthenol in the treatment of rhinitis sicca were evaluated in two studies. Design and Methods. Two noninterventional observational studies were performed to evaluate the efficacy and safety of a nasal spray containing ectoine (study 1 and ectoine/dexpanthenol (study 2 over a period of two weeks including comparable numbers of patients suffering from rhinitis sicca anterior. Patients and physicians were asked to rate the efficacy in reducing symptoms and the tolerability over the treatment phase. Results. The treatment in both studies resulted in a clinical and statistical significant reduction of the main diagnosis parameters, nasal airway obstruction, and crust formation. There was also a significant reduction in the secondary diagnosis parameters in both studies. Importantly, the tolerability was very good. During the whole observational study, neither patients nor doctors stopped the medication due to unwanted effects. Conclusion. Rhinitis sicca could be successfully treated with a nasal spray containing ectoine and a nasal spray combining ectoine with dexpanthenol. The combination of both substances led to slight advantages.

  12. Concha bullosa and the nasal middle meatus obstructive syndrome

    Directory of Open Access Journals (Sweden)

    Perić Aleksandar

    2008-01-01

    Full Text Available Background. Concha bullosa (CB is pneumatization of the middle turbinate and one of the most common anatomic variation of the sinonasal region. It is found in about 25% of the population. Middle meatus obstructive syndrome (MMOS is, usually connected with CB. The main symptoms of this syndrome are headaches, impaired nasal breathing and hyposmia. Headache is the most common symptom and it may occur due to contact between a CB and other structures of the nasal cavity. Case report. We presented a case of 32 year-old-woman with headaches, located in the orbital and the left frontal region. The headaches were intermittent and corresponding to the nasal cycle. After neurologic and alergic examination, endoscopic nasal examination demonstrated a septal deviation to the right side and a large middle turbinate in the left side of the nasal cavity. Coronal computerized tomography (CT of the paranasal sinuses demonstrated the septal deformation and pneumatization of the left middle turbinate. Diagnosis was confirmed by lidocaine test. In the functional endoscopic surgery (FESS, the lateral lamela of the anterior CB was removed. At the same time, the septoplasty was done. At the control examination, the patient was without symptoms. Conclusion. Although CB is the common anatomic variation of the nasal cavity, MMOS is rare. Headache (rhinogenic origin is the most important symptom. Surgical treatment is the lateral resection of the CB in the FESS technique and the septoplasty.

  13. Validation of commercially available automated canine-specific immunoturbidimetric method for measuring canine C-reactive protein

    DEFF Research Database (Denmark)

    Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold;

    2014-01-01

    with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was ..., there was good agreement between the validated human CRP assay and the new canine-specific assay. Healthy dogs had CRP concentrations that were less than the limit of quantification of the Gentian cCRP method (6.8 mg/L). CONCLUSIONS: The new canine-specific immunoturbidimetric CRP assay is a reliable and rapid......BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE...

  14. The diagnostic contribution of computed tomography in intranasal carcinoma with retrobulbar, oral and brain invasion in a canine: case report

    International Nuclear Information System (INIS)

    Intranasal tumors are uncommon and in most cases are malignant, aggressive and with low to moderate potential for metastasis. Clinical signs are usually caused by progressive obstruction of the upper airways. The test cytopathological also is a diagnosis method, but the definitive diagnosis is made by histopathological. Computed tomography (CT) is recommended to treatment planning. A poodle was attended at the veterinary hospital with a clinical history of epistaxis and nasal and ocular secretions, seizures and severe dyspnoea. The animal underwent to radiographic examination of the chest and skull as well as helical computed tomography of the nasal cavity and brain before and after the administration of intravenous contrast. The CT findings revealed an expansive bilateral nasal cavity neoformation, with involvement of the retrobulbar space, right frontal sinus, brain and oral cavity, suggesting a neoplastic or an infectious process. The CT examination allowed the material collection, directly from the mass, to cytological examination, providing the diagnosis of carcinoma. CT also allowed the determination of the unfavorable prognosis of the patient and the treatment planning which not included the surgical excision of the neoformation. Although CT was not conclusive in the diagnosis of carcinoma, it was essential to accurately define the extent of the lesion, to guide the collection of material directly from the tumor and to determine the prognosis of the animal, proving to be an extremely useful tool in cases of tumors intranasal in dogs. (author)

  15. Nasalance and nasality at experimental velopharyngeal openings in palatal prosthesis: a case study

    Science.gov (United States)

    LIMA-GREGIO, Aveliny Mantovan; MARINO, Viviane Cristina de Castro; PEGORARO-KROOK, Maria Inês; BARBOSA, Plinio Almeida; AFERRI, Homero Carneiro; DUTKA, Jeniffer de Cassia Rillo

    2011-01-01

    The use of prosthetic devices for correction of velopharyngeal insufficiency (VPI) is an alternative treatment for patients with conditions that preclude surgery and for those individuals with a hypofunctional velopharynx (HV) with a poor prognosis for the surgical repair of VPI. Understanding the role and measuring the outcome of prosthetic treatment of velopharyngeal dysfunction requires the use of tools that allow for documenting pre- and post-treatment outcomes. Experimental openings in speech bulbs have been used for simulating VPI in studies documenting changes in aerodynamic, acoustic and kinematics aspects of speech associated with the use of palatal prosthetic devices. The use of nasometry to document changes in speech associated with experimental openings in speech bulbs, however, has not been described in the literature. Objective This single-subject study investigated nasalance and nasality at the presence of experimental openings drilled through the speech bulb of a patient with HV. Material and Methods Nasometric recordings of the word "pato" were obtained under 4 velopharyngeal conditions: no-opening (control condition), no speech bulb, speech bulb with a 20 mm2 opening, and speech bulb with 30 mm2 opening. Five speech-language pathologists performed auditory-perceptual ratings while the subject read an oral passage under all conditions. Results Kruskal-Wallis test showed significant difference among conditions (p=0.0002), with Scheffé post hoc test indicating difference from the no-opening condition. Conclusion The changes in nasalance observed after drilling holes of known sizes in a speech bulb suggest that nasometry reflect changes in transfer of sound energy related to different sizes of velopharyngeal opening. PMID:22230996

  16. Lymphomatoidgastropathy mimicking extranodal NK/T cell lymphoma, nasal type: A case report

    Institute of Scientific and Technical Information of China (English)

    Tomohiro Terai; Mitsushige Sugimoto; Hiroki Uozaki; Tetsushi Kitagawa; Mana Kinoshita; Satoshi Baba; Takanori Yamada; Satoshi Osawa; Ken Sugimoto

    2012-01-01

    Extranodal natural killer (NK)/T-cell lymphoma,nasal type,exhibits aggressive tumor behavior and carries a poor prognosis.Recently,lymphomatoid gastropathy with NK/T cell infiltration into gastric mucosa has been recognized as a pseudo-malignant disease which regresses without treatment.Because the conventional immunohistochemical criteria of lymphomatoid gastropathy is similar to that of extranodal NK/T-cell lymphoma nasal type,it is difficult to distinguish between the two conditions by histopathological evaluation only.Here,we report a rare case of lymphomatoid gastropathy in a 57-year-old female.Gastroendoscopy on routine check-up revealed elevated reddish lesions < 1 cm in diameter in the gastric fornix and body.Although repeat endoscopies at 1 and 6 mo later revealed no gastric lesions at any locations without any treatments,at 12 mo later gastric lymphomatoid lesions recurred at gastric fornix and body.Histological examination of endoscopic biopsy specimens at 12 mo showed atypical NK cell infiltration with CD3+,CD4-,CD5-,CD7+,CD8-,CD20-,CD30-,CD56+,CD79a-and T-cell-restricted intracellular antigen-1+ into gastric mucosa.After treatment for Helicobacter pylori (H.pylori) eradication,the lesions disappeared in all locations of the gastric fornix and body over the subsequent 12 mo.Here,we report a case of H.pylori-positive lymphomatoid gastropathy with massive NK-cell proliferation,and also review the literature concerning newly identified lymphomatoid gastropathy based on comparison of extra nodal NK/T-cell lymphoma nasal type.In any case,these lesions are evaluated with biopsy specimens,the possibility of this benign entity should be considered,and excessive treatment should be carefully avoided.Close follow-up for this case of lymphomatoid gastropathy is necessary to exclude any underlying malignancy.

  17. Computed tomography and magnetic resonance imaging findings of nasal cavity hemangiomas according to histological type

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jun Ho; Park, Sun Won; Lim, Myung Kwan; Kim, Yeo Ju; Lee, Ha Young [Dept. of Radiology, Inha University School of Medicine, Incheon (Korea, Republic of); Kim, Soo Jin [Dept. of Radiology, Seoul National University College of Medicine, Seoul (Korea, Republic of); Jang, Tae Young [Dept. of Otolaryngology-Head and Neck Surgery, Inha University School of Medicine, Incheon (Korea, Republic of); Kang, Young Hye [Dept. of Radiology, nha University Hospital, Incheon (Korea, Republic of)

    2015-06-15

    To compare computed tomography (CT) and magnetic resonance imaging (MRI) findings between two histological types of nasal hemangiomas (cavernous hemangioma and capillary or lobular capillary hemangioma). CT (n = 20; six pre-contrast; 20 post-enhancement) and MRI (n = 7) images from 23 patients (16 men and seven women; mean age, 43 years; range, 13-73 years) with a pathologically diagnosed nasal cavity hemangioma (17 capillary and lobular capillary hemangiomas and six cavernous hemangiomas) were reviewed, focusing on lesion location, size, origin, contour, enhancement pattern, attenuation or signal intensity (SI), and bony changes. The 17 capillary and lobular hemangiomas averaged 13 mm (range, 4-37 mm) in size, and most (n = 13) were round. Fourteen capillary hemangiomas had marked or moderate early phase enhancement on CT, which dissipated during the delayed phase. Four capillary hemangiomas on MRI showed marked enhancement. Bony changes were usually not seen on CT or MRI (seen on five cases, 29.4%). Half of the lesions (2/4) had low SI on T1-weighted MRI images and heterogeneously high SI with signal voids on T2-weighted images. The six cavernous hemangiomas were larger than the capillary type (mean, 20.5 mm; range, 10-39 mm) and most had lobulating contours (n = 4), with characteristic enhancement patterns (three centripetal and three multifocal nodular), bony remodeling (n = 4, 66.7%), and mild to moderate heterogeneous enhancement during the early and delayed phases. CT and MRI findings are different between the two histological types of nasal hemangiomas, particularly in the enhancement pattern and size, which can assist in preoperative diagnosis and planning of surgical tumor excision.

  18. Breed predisposition to canine gastric carcinoma

    DEFF Research Database (Denmark)

    Seim-Wikse, Tonje; Jörundsson, Einar; Nødtvedt, Ane;

    2013-01-01

    Previous research has indicated a breed predisposition to gastric carcinoma in dogs. However, results to date are inconsistent since several studies have failed to prove such a predisposition. Better knowledge of breeds at risk could facilitate early detection of gastric carcinoma in dogs. The ai...... of the study was to retrospectively investigate the proportion and possible breed predisposition to canine gastric carcinoma using the Norwegian Canine Cancer Register for calculations of proportional morbidity ratios (PMRs) for the period 1998-2009.......Previous research has indicated a breed predisposition to gastric carcinoma in dogs. However, results to date are inconsistent since several studies have failed to prove such a predisposition. Better knowledge of breeds at risk could facilitate early detection of gastric carcinoma in dogs. The aim...

  19. Antigenic typing Polish isolates of canine parvovirus

    Energy Technology Data Exchange (ETDEWEB)

    Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)

    1995-12-31

    Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.

  20. Coryneform bacteria associated with canine otitis externa

    DEFF Research Database (Denmark)

    Aalbæk, Bent; Bemis, David A.; Schjærff, Mette;

    2010-01-01

    This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...

  1. Aggressive Calcifying Epithelial Odontogenic Tumor of the Maxillary Sinus with Extraosseous Oral Mucosal Involvement: A Case Report

    OpenAIRE

    Vidya Rani; Mahaboob Kadar Masthan; Babu Aravindha; Sankari Leena

    2016-01-01

    Calcifying epithelial odontogenic tumors are benign odontogenic neoplasms whose occurrence in the maxillary sinus is rare. Maxillary tumors tend to be locally aggressive and may rapidly involve the surrounding vital structures. We report a case of a large calcifying epithelial odontogenic tumor of the maxilla, involving the maxillary sinus in a 48-year-old woman. The tumor was largely intraosseous. In the canine and first premolar regions, the loss of bone could be palpated but the oral mucos...

  2. Effectiveness of septoplasty versus non-surgical management for nasal obstruction due to a deviated nasal septum in adults: study protocol for a randomized controlled trial

    NARCIS (Netherlands)

    Egmond, M.M.H.T. van; Rovers, M.M.; Hendriks, C.T.; Heerbeek, N. van

    2015-01-01

    BACKGROUND: Septoplasty, i.e., surgical correction of the deviated nasal septum, is the most common ear, nose and throat (ENT) operation in adults. Currently the main indication to perform septoplasty is nasal obstruction. However, the effectiveness of septoplasty for nasal obstruction in adults wit

  3. Extrusion processing : effects on dry canine diets

    OpenAIRE

    Tran, Q.D.

    2008-01-01

    Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying. Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the nutritional and physical quality of the product. Effects of extrusion on the feed quality for other animals than pets have been well recognized. Our studies investigated to what extent extrusion and/or drying of a c...

  4. Cardiac troponin I levels in canine pyometra

    OpenAIRE

    Hagman Ragnvi; Lagerstedt Anne-Sofie; Fransson Boel A; Bergström Annika; Häggström Jens

    2007-01-01

    Abstract Background Myocardial injury may contribute to unexpected deaths due to pyometra. To detect myocardial damage, measurement of cardiac troponin I (cTnI) is currently the most sensitive and specific method. The aims of the present study were to evaluate presence of myocardial damage in canine pyometra by analysis of cTnI, to explore whether myocardial injury was associated with systemic inflammatory response syndrome (SIRS) and to evaluate whether other clinical or laboratory parameter...

  5. Microbiological and histopathological aspects of canine pyometra

    OpenAIRE

    Coggan, Jennifer Anne; Melville, Priscilla Anne; de Oliveira, Clair Motos; Faustino, Marcelo; Moreno, Andréa Micke; Benites, Nilson Roberti

    2008-01-01

    As pyometra is recognized as one of the main causes of disease and death in the bitch the purposes of this study were to evaluate microbiological and histopathological aspects of canine pyometra and to research the virulence factors of the E. coli isolates identifying possible risks to human health. The microbiological isolation from the intrauterine contents of 100 dogs with pyometra was carried out and the virulence factors in the E. coli strains were identified using PCR method. This study...

  6. Remote detection of explosives using trained canines

    International Nuclear Information System (INIS)

    Use of dogs is a search method which combines high probability of detection, speed of search, and low cost. It was concluded that the canine could be used for explosive screening of personnel, but that it was imperative that the dog be in a position remote from employees and employee traffic. A study was made of the design of booths and air flow for this purpose. Results of tests and conclusions are given and discussed

  7. Treatment of canine scabies with milbemycin oxime.

    Science.gov (United States)

    Miller, W H; de Jaham, C; Scott, D W; Cayatte, S M; Bagladi, M S; Buerger, R G

    1996-04-01

    The purpose of this study was to determine the efficacy of orally administered milbemycin oxime in the treatment of canine scabies. Forty dogs were treated. Mean drug dosage for all dogs was approximately 2 mg/kg body weight. Twenty-seven dogs received 3 doses separated by 7 d, and 13 dogs received 2 doses separated by 14 d. All dogs were clinically normal following treatment and no adverse reactions were detected.

  8. Microbial profile of canine persistent wound infections

    Directory of Open Access Journals (Sweden)

    A. Padhy

    2014-04-01

    Full Text Available Aim: To analyse the microbial profile of canine persistent wound infections. Materials and Methods: The total wound samples (n=172 taken from both traumatic (140 and post-surgical (32 persistent wounds in canines were processed for routine microbial isolation and identification during a period of 15 months. Results: Staphylococcus intermedius was found to be the predominant isolate from all types of wounds under study. It was followed by Staphylococcus aureus, Pseudomonas aeruginosa, E. coli, Pasteurella spp., Corynaebacterium spp. and Bacillus spp. From different traumatic wounds of dogs, S. intermedius (92/140=65.7% and from surgical wounds, P. aeruginosa (24/32=75% were found to be the predominant isolates recovered whereas the most commonly isolated bacterial genus in both traumatic and surgical wounds of dogs was Staphylococcus spp. Conclusion: Canine wounds are polymicrobial in nature. Hence proper microbial laboratory diagnosis and presence of multiple organisms in a wound are to be taken into consideration for effective treatment of persistent wound infections in dogs.

  9. Canine kobuviruses in diarrhoeic dogs in Italy.

    Science.gov (United States)

    Di Martino, Barbara; Di Felice, Elisabetta; Ceci, Chiara; Di Profio, Federica; Marsilio, Fulvio

    2013-09-27

    Canine kobuviruses (CaKVs) are newly recognized picornaviruses recently detected in dogs in the US. By molecular analysis of the whole genome, CaKV that appeared genetically closest to the murine kobuvirus (MuKV) and to the human Aichi virus (AiV), may be classified in the Kobuvirus genus as new genotype (CaKV type 1) within the species Aichivirus A. To date, there are no information on the epidemiology of these novel viruses in other continents. In this study, by screening a collection of 256 dog fecal samples either from diarrhoeic or asymptomatic animals, CaKV was identified in six specimens with an overall prevalence of 2.34% (6/256). All the positive dogs presented diarrhea and were found to be infected by CaKV alone or in mixed infections with canine coronavirus (CCoV) and/or canine parvovirus type 2 (CPV-2). By molecular analysis of the partial 3D gene, all the strains detected displayed a close relatedness with the CaKVs recently identified in the US. This study provides evidence that CaKVs circulate in diarrhoeic dogs in Italy and are not geographically restricted to the North American continent, where they were first signaled. PMID:23806200

  10. Cytodiagnostics of canine lymphomas - possibilities and limitations.

    Science.gov (United States)

    Sapierzyński, R; Kliczkowska-Klarowicz, K; Jankowska, U; Jagielski, D

    2016-01-01

    Malignant lymphomas are one of the most common malignant tumours occurring in dogs. The basic method of lymphoma diagnosis in human, as well as in canine oncology is histopathology supported by immunohistochemistry. It was suggested that in veterinary medicine excisional biopsy of lymph node and histopathology should be considered only where the cytologic diagnosis is equivocal or needs to be confirmed. There are at least three basic reasons for which cytological examination ought to be accepted as a sufficient and reliable diagnostic method for lymphoma in dogs. Firstly, most dog owners consider the fine-needle biopsy as an acceptable non-harmful method of sample collection. Secondly, an increasing number of studies recommend cytology as an accurate test for diagnosing and subtyping canine lymphoma. Finally, the vast majority of canine lymphoma subtypes belong to 4-5 categories characterized by a typical cytological picture. Immunocytochemical staining of cytological smears gives new diagnostic possibilities, such as detection of markers better characterizing given growth or a potential goal for target therapy in individual cases (for example inhibitors of platelet-derived growth factor). PMID:27487521

  11. Use of quantitative real-time RT-PCR to investigate the correlation between viremia and viral shedding of canine distemper virus, and infection outcomes in experimentally infected dogs.

    Science.gov (United States)

    Sehata, Go; Sato, Hiroaki; Ito, Toshihiro; Imaizumi, Yoshitaka; Noro, Taichi; Oishi, Eiji

    2015-07-01

    We used real-time RT-PCR and virus titration to examine canine distemper virus (CDV) kinetics in peripheral blood and rectal and nasal secretions from 12 experimentally infected dogs. Real-time RT-PCR proved extremely sensitive, and the correlation between the two methods for rectal and nasal (r=0.78, 0.80) samples on the peak day of viral RNA was good. Although the dogs showed diverse symptoms, viral RNA kinetics were similar; the peak of viral RNA in the symptomatic dogs was consistent with the onset of symptoms. These results indicate that real-time RT-PCR is sufficiently sensitive to monitor CDV replication in experimentally infected dogs regardless of the degree of clinical manifestation and suggest that the peak of viral RNA reflects active CDV replication. PMID:25728411

  12. Use of quantitative real-time RT-PCR to investigate the correlation between viremia and viral shedding of canine distemper virus, and infection outcomes in experimentally infected dogs.

    Science.gov (United States)

    Sehata, Go; Sato, Hiroaki; Ito, Toshihiro; Imaizumi, Yoshitaka; Noro, Taichi; Oishi, Eiji

    2015-07-01

    We used real-time RT-PCR and virus titration to examine canine distemper virus (CDV) kinetics in peripheral blood and rectal and nasal secretions from 12 experimentally infected dogs. Real-time RT-PCR proved extremely sensitive, and the correlation between the two methods for rectal and nasal (r=0.78, 0.80) samples on the peak day of viral RNA was good. Although the dogs showed diverse symptoms, viral RNA kinetics were similar; the peak of viral RNA in the symptomatic dogs was consistent with the onset of symptoms. These results indicate that real-time RT-PCR is sufficiently sensitive to monitor CDV replication in experimentally infected dogs regardless of the degree of clinical manifestation and suggest that the peak of viral RNA reflects active CDV replication.

  13. An adenomatoid odontogenic tumor in disguise.

    Science.gov (United States)

    Dhirawani, Rajesh B; Pathak, Sanyog; Mallikaarjuna, K; Sharma, Ankit

    2016-01-01

    Adenomatoid odontogenic tumor (AOT) is a slowly growing benign tumor of the oral cavity. It accounts of 3-7% of all odontogenic tumors. It is seen to occur commonly in the anterior maxilla. The tumor is usually associated with an impacted tooth with maxillary canine being the most common tooth. AOT is seen in a younger group, especially below 20 years with a female preponderance. AOT occurs in two main variants: Central or intraosseous which is more common and second is peripheral which is rare. Radiologically, it represents as a radiolucent lesion with radiopaque foci usually an impacted or a supernumerary tooth. With a close clinical and radiographic resemblance to dentigerous cyst correct diagnosis and treatment is necessary. AOT being benign in nature requires a conservative management with enucleation. This is a case report of a 13-year-old girl with an AOT occurring in the anterior maxillary region. PMID:27461816

  14. Nasal toxicity, carcinogenicity, and olfactory uptake of metals.

    Science.gov (United States)

    Sunderman, F W

    2001-01-01

    Occupational exposures to inhalation of certain metal dusts or aerosols can cause loss of olfactory acuity, atrophy of the nasal mucosa, mucosal ulcers, perforated nasal septum, or sinonasal cancer. Anosmia and hyposmia have been observed in workers exposed to Ni- or Cd-containing dusts in alkaline battery factories, nickel refineries, and cadmium industries. Ulcers of the nasal mucosa and perforated nasal septum have been reported in workers exposed to Cr(VI) in chromate production and chrome plating, or to As(III) in arsenic smelters. Atrophy of the olfactory epithelium has been observed in rodents following inhalation of NiSO4 or alphaNi3S2. Cancers of the nose and nasal sinuses have been reported in workers exposed to Ni compounds in nickel refining, cutlery factories, and alkaline battery manufacture, or to Cr(VI) in chromate production and chrome plating. In animals, several metals (eg, Al, Cd, Co, Hg, Mn, Ni, Zn) have been shown to pass via olfactory receptor neurons from the nasal lumen through the cribriform plate to the olfactory bulb. Some metals (eg, Mn, Ni, Zn) can cross synapses in the olfactory bulb and migrate via secondary olfactory neurons to distant nuclei of the brain. After nasal instillation of a metal-containing solution, transport of the metal via olfactory axons can occur rapidly, within hours or a few days (eg, Mn), or slowly over days or weeks (eg, Ni). The olfactory bulb tends to accumulate certain metals (eg, Al, Bi, Cu, Mn, Zn) with greater avidity than other regions of the brain. The molecular mechanisms responsible for metal translocation in olfactory neurons and deposition in the olfactory bulb are unclear, but complexation by metal-binding molecules such as carnosine (beta-alanyl-L-histidine) may be involved. PMID:11314863

  15. MEASUREMENT OF NASAL FIGURE BY MAGNETIC RESONANCE IMAGING

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objective To get the basic data of nasal figure of the Han nationality individuals in Xi'an area and provide for junsprudence and the reconstruction of skull. Methods Nasal height, length, depth and breadth of 313cases in Xi'an area, which had different age and sex, were measured by magnetic resonance imaging (MRI). Results Image of MRI could clearly show the figure of nose and the position we selected were correct and accuracy. The specific data were: Nasal length (male:34. 47±4.29 ~52.20±3.47, female:33. 11±3.33~46. 94±3.83); Nasal height(male: 39.22±3.68~59.49±2.30, female: 33.89±3.95~51.75±3.68); Nasal depth(male: 11.89±1.76~16.68±2.48, female: 10.69±1. 81~16.46±2.04);Nasal breadth(male: 33. 09±3. 83~42. 49±2.72,female:32.00±1.94~38. 86±2.61). So the results were credible. Conclusion The nasal figure of individuals in Xi'an area is different as their different age and sex. It promotes that the influence factors of age and sex must be considered in the facial reconstruction and medico legally reconstructing skull.

  16. The effects of naris occlusion on mouse nasal turbinate development.

    Science.gov (United States)

    Coppola, David M; Craven, Brent A; Seeger, Johannes; Weiler, Elke

    2014-06-15

    Unilateral naris occlusion, a standard method for causing odor deprivation, also alters airflow on both sides of the nasal cavity. We reasoned that manipulating airflow by occlusion could affect nasal turbinate development given the ubiquitous role of environmental stimuli in ontogenesis. To test this hypothesis, newborn mice received unilateral occlusion or sham surgery and were allowed to reach adulthood. Morphological measurements were then made of paraffin sections of the whole nasal cavity. Occlusion significantly affected the size, shape and position of turbinates. In particular, the nasoturbinate, the focus of our quantitative analysis, had a more delicate appearance on the occluded side relative to the open side. Occlusion also caused an increase in the width of the dorsal meatus within the non-occluded and occluded nasal fossae, compared with controls, and the position of most turbinates was altered. These results suggest that a mechanical stimulus from respiratory airflow is necessary for the normal morphological development of turbinates. To explore this idea, we estimated the mechanical forces on turbinates caused by airflow during normal respiration that would be absent as a result of occlusion. Magnetic resonance imaging scans were used to construct a three-dimensional model of the mouse nasal cavity that provided the input for a computational fluid dynamics simulation of nasal airflow. The simulation revealed maximum shear stress values for the walls of turbinates in the 1 Pa range, a magnitude that causes remodeling in other biological tissues. These observations raise the intriguing possibility that nasal turbinates develop partly under the control of respiratory mechanical forces.

  17. The role of radiation therapy in the treatment of malignant melanoma in the nasal cavity and nasopharynx-case report

    International Nuclear Information System (INIS)

    Purpose: Primary mucosal malignant melanoma of the nasal cavity, paranasal sinuses, and nasopharynx (hereinafter referred to collectively as the sinonasal tract, i.e., sinonasal tract mucosal malignant melanomas [SNMMs]) is rare, accounting for between 0.3% and 2% of all malignant melanomas and about 4% of head and neck melanomas. Surgery is the treatment of choice for sinonasal mucosal malignant melanomas, especially complete resection of the tumor with sufficient free margins. Radiotherapy has controversial role in the treatment. Melanoma cells are traditionally considered as radioresistant because they have a high capacity for repair of sublethal damages, in particular when we used a conventional fractionation. Therefore, hypo fractionation considered as a reasonable treatment regimen for this disease. Case: In this paper, we have reported the patient with intranasal cavity malignant melanoma. Functional endoscopic sinus surgery was performed to excise the nasal cavity tumor. However, using positron emission tomography/computed tomography scan with fluorodeoxyglucose was diagnosed residual nasopharyngeal tumor. Then, intracavitary brachytherapy for nasopharynx was further administered. Solitary metastatic cervical nodal involvement which was completely removed has been occurred 6 months after the end of brachytherapy. Even with the regional disease progression, we used external radiation therapy, as a modality of treatment. Conclusion: We decided to show this case report because of its rarity and the possible use of radiotherapy. (author)

  18. PET/CT aids the staging of and radiotherapy planning for early-stage extranodal natural killer/T-cell lymphoma, nasal type: A case series

    OpenAIRE

    MacDonald Shannon L; Mulroy Liam; Wilke Derek R; Burrell Steven

    2011-01-01

    Abstract Extranodal natural killer/T-cell lymphoma (ENKTL), nasal type, is a rare form of non-Hodgkin lymphoma. Treatment of ENKTL primarily relies on radiation; thus, proper delineation of target volumes is critical. Currently, the ideal modalities for delineation of gross tumor volume for ENKTL are unknown. We describe three consecutive cases of localized ENKTL that presented to the Nova Scotia Cancer Centre in Halifax, Nova Scotia. All patients had a planning CT and MRI as well as a planni...

  19. Human Flt3L generates dendritic cells from canine peripheral blood precursors: implications for a dog glioma clinical trial.

    Directory of Open Access Journals (Sweden)

    Weidong Xiong

    Full Text Available BACKGROUND: Glioblastoma multiforme (GBM is the most common primary brain tumor in adults and carries a dismal prognosis. We have developed a conditional cytotoxic/immunotherapeutic approach using adenoviral vectors (Ads encoding the immunostimulatory cytokine, human soluble fms-like tyrosine kinase 3 ligand (hsFlt3L and the conditional cytotoxic molecule, i.e., Herpes Simplex Type 1- thymide kinase (TK. This therapy triggers an anti-tumor immune response that leads to tumor regression and anti-tumor immunological memory in intracranial rodent cancer models. We aim to test the efficacy of this immunotherapy in dogs bearing spontaneous GBM. In view of the controversy regarding the effect of human cytokines on dog immune cells, and considering that the efficacy of this treatment depends on hsFlt3L-stimulated dendritic cells (DCs, in the present work we tested the ability of Ad-encoded hsFlt3L to generate DCs from dog peripheral blood and compared its effects with canine IL-4 and GM-CSF. METHODOLOGY/PRINCIPAL FINDINGS: Our results demonstrate that hsFlT3L expressed form an Ad vector, generated DCs from peripheral blood cultures with very similar morphological and phenotypic characteristics to canine IL-4 and GM-CSF-cultured DCs. These include phagocytic activity and expression of CD11c, MHCII, CD80 and CD14. Maturation of DCs cultured under both conditions resulted in increased secretion of IL-6, TNF-alpha and IFN-gamma. Importantly, hsFlt3L-derived antigen presenting cells showed allostimulatory potential highlighting their ability to present antigen to T cells and elicit their proliferation. CONCLUSIONS/SIGNIFICANCE: These results demonstrate that hsFlt3L induces the proliferation of canine DCs and support its use in upcoming clinical trials for canine GBM. Our data further support the translation of hsFlt3L to be used for dendritic cells' vaccination and gene therapeutic approaches from rodent models to canine patients and its future

  20. 9 CFR 113.317 - Parvovirus Vaccine (Canine).

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... parvovirus susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood samples...