Monitoring of Antibodies Titre Against Canine Distemper Virus in Ferrets Vaccinated with a Live Modified Vaccine

OpenAIRE

L. Pavlačík; V. Celer, Jr.; V. Kajerová; V. Jekl; Z. Knotek; I. Literák

2007-01-01

A group of five ferrets vaccinated against the canine distemper virus (CDV) was evaluated as to the onset of anti-CDV antibody production and the serum levels of the animals were monitored for one year. The ferrets were immunized with a live attenuated vaccine. The vaccination pattern was as follows: primary vaccination at the age of 6 weeks, fi rst revaccination at 30 days after primary vaccination, and second revaccination after another 30 days. Blood samples were taken prior to primary vac...

Surgical considerations and management of bilateral labially impacted canines

Directory of Open Access Journals (Sweden)

Yu-Shan Huang

2016-06-01

Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.

Approaches to canine health surveillance.

Science.gov (United States)

O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C

2014-01-01

Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.

Monitoring temporal microstructural variations of skeletal muscle tissues by multispectral Mueller matrix polarimetry

Science.gov (United States)

Dong, Yang; He, Honghui; He, Chao; Ma, Hui

2017-02-01

Mueller matrix polarimetry is a powerful tool for detecting microscopic structures, therefore can be used to monitor physiological changes of tissue samples. Meanwhile, spectral features of scattered light can also provide abundant microstructural information of tissues. In this paper, we take the 2D multispectral backscattering Mueller matrix images of bovine skeletal muscle tissues, and analyze their temporal variation behavior using multispectral Mueller matrix parameters. The 2D images of the Mueller matrix elements are reduced to the multispectral frequency distribution histograms (mFDHs) to reveal the dominant structural features of the muscle samples more clearly. For quantitative analysis, the multispectral Mueller matrix transformation (MMT) parameters are calculated to characterize the microstructural variations during the rigor mortis and proteolysis processes of the skeletal muscle tissue samples. The experimental results indicate that the multispectral MMT parameters can be used to judge different physiological stages for bovine skeletal muscle tissues in 24 hours, and combining with the multispectral technique, the Mueller matrix polarimetry and FDH analysis can monitor the microstructural variation features of skeletal muscle samples. The techniques may be used for quick assessment and quantitative monitoring of meat qualities in food industry.

The Effects of Orthodontic Forces during Canine Retraction Using Self-ligating Brackets on Gingival Crevicular Fluid Enzyme Activity, Canine Movement and Root Resorption

International Nuclear Information System (INIS)

Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin

2015-01-01

Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)

Identification and function analysis of canine stimulator of interferon gene (STING).

Science.gov (United States)

Zhang, Yuxiang; Zhu, Mengyan; Li, Gairu; Liu, Jie; Zhai, Xiaofeng; Wang, Ruyi; Zhang, Junyan; Xing, Gang; Gu, Jinyan; Yan, Liping; Lei, Jing; Sun, Haifeng; Shi, Zhiyu; Liu, Fei; Hu, Boli; Su, Shuo; Zhou, Jiyong

2017-12-01

Stimulator of interferon gene (STING) plays an important role in the cyclic GMP-AMP synthase (cGAS)-mediated activation of type I IFN responses. In this study, we identified and cloned canine STING gene. Full-length STING encodes a 375 amino acid product that shares the highest similarity with feline STING. Highest levels of mRNA of canine STING were detected in the spleen and lungs while the lowest levels in the heart and muscle. Analysis of its cellular localization showed that STING is localizes to the endoplasmic reticulum. STING overexpression induced the IFN response via the IRF3 and NF-κB pathways and up-regulated the expression of ISG15 and viperin. However, knockdown of STING did not inhibit the IFN-β response triggered by poly(dA:dT), poly(I:C), or SeV. Finally, overexpression of STING significantly inhibited the replication of canine influenza virus H3N2. Collectively, our findings indicate that STING is involved in the regulation of the IFN-β pathway in canine. Copyright © 2017 Elsevier Ltd. All rights reserved.

Lateral Cricoarytenoid Release: Development of a Novel Surgical Treatment Option for Adductor Spasmodic Dysphonia in a Canine Laryngeal Model.

Science.gov (United States)

Park, Andrea M; Paniello, Randal C

2016-09-01

To investigate the efficacy of a novel adductor muscle-releasing technique designed to decrease the force of vocal fold adduction, as a potential surgical therapy for patients with adductor spasmodic dysphonia (ADSD). Experimental animal study. A canine laryngeal model was used to assess the acute and sustained efficacy of a lateral cricoarytenoid (LCA) muscle release. A total of 34 canine hemilaryngeal preparations were divided among 7 experimental groups. The LCA muscle was separated from its cricoid cartilage origin via an open, anterior, submucosal approach. The laryngeal adductory pressures (LAP) were assessed pre- and post-muscle release via direct recurrent laryngeal nerve stimulation. Measurements were repeated at 1.5, 3, or 6 months postoperatively. Another study evaluated release of the thyroarytenoid (TA) muscle from its thyroid cartilage origin. Releasing the LCA muscle demonstrated a significant decrease in LAP acutely and was maintained at all 3 time points with the aid of a barrier (P < .05). Without the barrier, the LCA muscle reattached to the cricoid. Acute release of the TA muscle did not significantly decrease the LAP. The proposed LCA release procedure may provide patients with a permanent treatment option for ADSD. However, longer-term studies and human trials are needed. © The Author(s) 2016.

Pathophysiology, diagnosis, and treatment of canine hip dysplasia

International Nuclear Information System (INIS)

Cook, J.L.; Tomlinson, J.L.; Constantinescu, G.M.

1996-01-01

Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education

A novel noninvasive all optical technique to monitor physiology of an exercising muscle

Energy Technology Data Exchange (ETDEWEB)

Saxena, Vishal [Department of Radiology, University of Southern California, 4650 Sunset Blvd., Los Angeles, CA 90027 (United States); Marcu, Laura [Department of Bioengineering, University of California at Davis, Davis, CA 95616 (United States); Karunasiri, Gamani [Department of Physics, Naval Postgraduate School, Monterey, California 93943 (United States)], E-mail: Vsaxena@usc.edu

2008-11-07

An all optical technique based on near-infrared spectroscopy and mid-infrared imaging (MIRI) is applied as a noninvasive, in vivo tool to monitor the vascular status of skeletal muscle and the physiological changes that occur during exercise. A near-infrared spectroscopy (NIRS) technique, namely, steady state diffuse optical spectroscopy (SSDOS) along with MIRI is applied for monitoring the changes in the values of tissue oxygenation and thermometry of an exercising muscle. The NIRS measurements are performed at five discrete wavelengths in a spectral window of 650-850 nm and MIRI is performed in a spectral window of 8-12 {mu}m. The understanding of tissue oxygenation status and the behavior of the physiological parameters derived from thermometry may provide a useful insight into muscle physiology, therapeutic response and treatment.

A novel noninvasive all optical technique to monitor physiology of an exercising muscle

International Nuclear Information System (INIS)

Saxena, Vishal; Marcu, Laura; Karunasiri, Gamani

2008-01-01

An all optical technique based on near-infrared spectroscopy and mid-infrared imaging (MIRI) is applied as a noninvasive, in vivo tool to monitor the vascular status of skeletal muscle and the physiological changes that occur during exercise. A near-infrared spectroscopy (NIRS) technique, namely, steady state diffuse optical spectroscopy (SSDOS) along with MIRI is applied for monitoring the changes in the values of tissue oxygenation and thermometry of an exercising muscle. The NIRS measurements are performed at five discrete wavelengths in a spectral window of 650-850 nm and MIRI is performed in a spectral window of 8-12 μm. The understanding of tissue oxygenation status and the behavior of the physiological parameters derived from thermometry may provide a useful insight into muscle physiology, therapeutic response and treatment.

Cardiac involvement in canine babesiosis : review article

Directory of Open Access Journals (Sweden)

R.G. Lobetti

2005-06-01

Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.

Surgical Removal of a Canine Aortic Thromboembolism Secondary to Pancreatitis

Directory of Open Access Journals (Sweden)

Jill Narak

2015-01-01

Full Text Available A 7-year-old castrated male Pomeranian was evaluated on emergency for diagnostic work-up and treatment for acute nonpainful paraparesis. The neurologic examination suggested a L4-S3 myelopathy, but physical examination revealed lack of femoral pulses and rectal hypothermia, as well as a grade II/VI systolic heart murmur, so ischemic neuromyopathy was suspected. Clinicopathologic analysis revealed increased muscle enzymes and proteinuria. Abdominal ultrasonography confirmed aortic thromboembolism (ATE, and surgical histopathology diagnosed necrotizing pancreatitis. Surgical aortic thrombectomy was performed, and antithrombotic therapy was instituted. Pancreatitis was treated supportively. The dog was discharged to the owners after 10 days of hospitalization. Recheck examination 6 weeks after initial presentation revealed a normal neurologic examination and normal femoral pulses. The patient has had no further bouts of pancreatitis and remains neurologically normal 5 years after initial presentation. Canine ATE is relatively rare compared to the feline counterpart. Directed therapy for feline ATE is often not recommended, as underlying conditions are oftentimes ultimately fatal. Underlying etiologies for canine ATE include cardiovascular disease and endocrinopathies, but canine ATE secondary to pancreatitis has not yet been reported. Surgical removal of aortic thromboembolus should be considered as curative for pelvic limb dysfunction in the canine patient without a terminal underlying disease.

A Muscle Fibre Conduction Velocity Tracking ASIC for Local Fatigue Monitoring.

Science.gov (United States)

Koutsos, Ermis; Cretu, Vlad; Georgiou, Pantelis

2016-12-01

Electromyography analysis can provide information about a muscle's fatigue state by estimating Muscle Fibre Conduction Velocity (MFCV), a measure of the travelling speed of Motor Unit Action Potentials (MUAPs) in muscle tissue. MFCV better represents the physical manifestations of muscle fatigue, compared to the progressive compression of the myoelectic Power Spectral Density, hence it is more suitable for a muscle fatigue tracking system. This paper presents a novel algorithm for the estimation of MFCV using single threshold bit-stream conversion and a dedicated application-specified integrated circuit (ASIC) for its implementation, suitable for a compact, wearable and easy to use muscle fatigue monitor. The presented ASIC is implemented in a commercially available AMS 0.35 [Formula: see text] CMOS technology and utilizes a bit-stream cross-correlator that estimates the conduction velocity of the myoelectric signal in real time. A test group of 20 subjects was used to evaluate the performance of the developed ASIC, achieving good accuracy with an error of only 3.2% compared to Matlab.

A Noninvasive In Vitro Monitoring System Reporting Skeletal Muscle Differentiation.

Science.gov (United States)

Öztürk-Kaloglu, Deniz; Hercher, David; Heher, Philipp; Posa-Markaryan, Katja; Sperger, Simon; Zimmermann, Alice; Wolbank, Susanne; Redl, Heinz; Hacobian, Ara

2017-01-01

Monitoring of cell differentiation is a crucial aspect of cell-based therapeutic strategies depending on tissue maturation. In this study, we have developed a noninvasive reporter system to trace murine skeletal muscle differentiation. Either a secreted bioluminescent reporter (Metridia luciferase) or a fluorescent reporter (green fluorescent protein [GFP]) was placed under the control of the truncated muscle creatine kinase (MCK) basal promoter enhanced by variable numbers of upstream MCK E-boxes. The engineered pE3MCK vector, coding a triple tandem of E-Boxes and the truncated MCK promoter, showed twentyfold higher levels of luciferase activation compared with a Cytomegalovirus (CMV) promoter. This newly developed reporter system allowed noninvasive monitoring of myogenic differentiation in a straining bioreactor. Additionally, binding sequences of endogenous microRNAs (miRNAs; seed sequences) that are known to be downregulated in myogenesis were ligated as complementary seed sequences into the reporter vector to reduce nonspecific signal background. The insertion of seed sequences improved the signal-to-noise ratio up to 25% compared with pE3MCK. Due to the highly specific, fast, and convenient expression analysis for cells undergoing myogenic differentiation, this reporter system provides a powerful tool for application in skeletal muscle tissue engineering.

One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

Science.gov (United States)

Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

2018-01-23

To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.

Science.gov (United States)

Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D

2000-12-01

To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.

Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

Directory of Open Access Journals (Sweden)

Mostfa Shahabi

2017-09-01

Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.

Prostate histotripsy for BPH: initial canine results

Science.gov (United States)

Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.

2009-02-01

Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.

Comparison of the physiological properties of human periodontal-masseteric reflex evoked by incisor and canine stimulation

Directory of Open Access Journals (Sweden)

Hiroko eOhmori

2012-06-01

Full Text Available Introduction: The present study was designed to clarify whether the bilateral cooperation in the human periodontal-masseteric reflex (PMR differs between central incisors and canines. Methods: Surface array electrodes were placed on the bilateral masseter muscles to simultaneously record the firing activities of single motor units from both sides in 7 healthy adults. During light clenching, mechanical stimulation was applied to the right maxillary central incisor and canine to evoke the PMR. Unitary activity was plotted with respect to the background activity and firing frequency. The slope of the regression line (sRL and the correlation coefficient (CC between the central incisor and canine and the lateral differences between these values were compared. Results: There were significant differences in the sRL and CC, as well as lateral differences, between the central incisor- and canine-driven PMR. Discussion: These results suggest that the PMR differs depending on both the tooth position and laterality.

Permanent maxillary canines - review of eruption pattern and local etiological factors leading to impaction.

Science.gov (United States)

Sajnani, Anand K

2015-02-01

The position of the permanent maxillary canine at the angle of the mouth is strategically significant in maintaining the harmony and symmetry of the occlusal relationship. However, the maxillary canine is the second most frequently impacted tooth, with prevalence reported to be between 1% and 2%. Moreover, treatment of this condition is often complex and involves substantial time and financial cost. Hence, it is only prudent to monitor the eruption and identify the etiological factors that lead to impaction of the maxillary canine. Numerous researchers have tried to identify specific and nonspecific etiological factors responsible for displacement of canines. The purpose of this review was to track the development processes of maxillary canines and determine the hindrances that affect the eruption at different ages. Awareness of the eruption process and etiology of noneruption will help to reduce the incidence of impacted canines by allowing for early recognition and interceptive treatment. © 2013 Wiley Publishing Asia Pty Ltd.

Monitoring Progression of Amyotrophic Lateral Sclerosis Using Ultrasound Morpho-Textural Muscle Biomarkers: A Pilot Study.

Science.gov (United States)

Martínez-Payá, Jacinto J; Ríos-Díaz, José; Medina-Mirapeix, Francesc; Vázquez-Costa, Juan F; Del Baño-Aledo, María Elena

2018-01-01

The need is increasing for progression biomarkers that allow the loss of motor neurons in amyotrophic lateral sclerosis (ALS) to be monitored in clinical trials. In this prospective longitudinal study, muscle thickness, echointensity, echovariation and gray level co-occurrence matrix textural features are examined as possible progression ultrasound biomarkers in ALS patients during a 5-mo follow-up period. We subjected 13 patients to 3 measurements for 20 wk. They showed a significant loss of muscle, an evident tendency to loss of thickness and increased echointensity and echovariation. In regard to textural parameters, muscle heterogeneity tended to increase as a result of the neoformation of non-contractile tissue through denervation. Considering some limitations of the study, the quantitative muscle ultrasound biomarkers evaluated showed a promising ability to monitor patients affected by ALS. Copyright © 2018 World Federation for Ultrasound in Medicine and Biology. Published by Elsevier Inc. All rights reserved.

Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

NARCIS (Netherlands)

Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos

Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

NARCIS (Netherlands)

Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.

2011-01-01

INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

Posterior cricoarytenoid muscle electrophysiologic changes are predictive of vocal cord paralysis with recurrent laryngeal nerve compressive injury in a canine model.

Science.gov (United States)

Puram, Sidharth V; Chow, Harold; Wu, Che-Wei; Heaton, James T; Kamani, Dipti; Gorti, Gautham; Chiang, Feng Yu; Dionigi, Gianlorenzo; Barczynski, Marcin; Schneider, Rick; Dralle, Henning; Lorenz, Kerstin; Randolph, Gregory W

2016-12-01

Injury to the recurrent laryngeal nerve (RLN) is a dreaded complication of endocrine surgery. Intraoperative neural monitoring (IONM) has been increasingly utilized to assess the functional status of the RLN. Although the posterior cricoarytenoid muscle (PCA) is innervated by the RLN as the abductor of the larynx, PCA electromyography (EMG) is infrequently recorded during IONM and PCA activity after RLN compressive injury remains poorly characterized. Single-subject prospective animal study. We employed a canine model to identify postcricoid EMG correlates of postoperative vocal cord paralysis (VCP). Postcricoid electrode recordings were obtained before and after compressive RLN injury associated with VCP. Normative postcricoid recordings revealed mean amplitude of 1288 microvolt (μV) and latency of 8.2 millisecond (ms) with maximum (1 milliamp [mA]) vagal stimulation, and mean amplitude of 1807 μV and latency of 3.5 ms with maximum (1 mA) RLN stimulation. Following injury that was associated with VCP, there was 62.1% decrement in postcricoid EMG amplitude with maximum vagal stimulation and 80% decrement with maximum RLN stimulation. Threshold stimulation of the vagus increased by 23%, and there was a corresponding 42% decrease in amplitude. For RLN stimulation, latency increased by 17.3% following injury, whereas threshold stimulation increased by 61% with 35.5% decrement in EMG amplitude. Thus, if RLN amplitude decreases by ≥ 80%, with absolute amplitude of ≤ 300 μV or less and latency increase of ≥ 10%, RLN injury is likely associated with VCP. Our results predict postoperative VCP based on postcricoid electromyographic IONM and may guide surgical decision making. NA Laryngoscope, 126:2744-2751, 2016. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

Muscular dystrophy in a family of Labrador Retrievers with no muscle dystrophin and a mild phenotype.

Science.gov (United States)

Vieira, Natassia M; Guo, Ling T; Estrela, Elicia; Kunkel, Louis M; Zatz, Mayana; Shelton, G Diane

2015-05-01

Animal models of dystrophin deficient muscular dystrophy, most notably canine X-linked muscular dystrophy, play an important role in developing new therapies for human Duchenne muscular dystrophy. Although the canine disease is a model of the human disease, the variable severity of clinical presentations in the canine may be problematic for pre-clinical trials, but also informative. Here we describe a family of Labrador Retrievers with three generations of male dogs having markedly increased serum creatine kinase activity, absence of membrane dystrophin, but with undetectable clinical signs of muscle weakness. Clinically normal young male Labrador Retriever puppies were evaluated prior to surgical neuter by screening laboratory blood work, including serum creatine kinase activity. Serum creatine kinase activities were markedly increased in the absence of clinical signs of muscle weakness. Evaluation of muscle biopsies confirmed a dystrophic phenotype with both degeneration and regeneration. Further evaluations by immunofluorescence and western blot analysis confirmed the absence of muscle dystrophin. Although dystrophin was not identified in the muscles, we did not find any detectable deletions or duplications in the dystrophin gene. Sequencing is now ongoing to search for point mutations. Our findings in this family of Labrador Retriever dogs lend support to the hypothesis that, in exceptional situations, muscle with no dystrophin may be functional. Unlocking the secrets that protect these dogs from a severe clinical myopathy is a great challenge which may have important implications for future treatment of human muscular dystrophies. Copyright © 2015 Elsevier B.V. All rights reserved.

Repeated sugammadex reversal of muscle relaxation during lumbar spine surgery with intraoperative neurophysiological multimodal monitoring.

Science.gov (United States)

Errando, C L; Blanco, T; Díaz-Cambronero, Ó

2016-11-01

Intraoperative neurophysiological monitoring during spine surgery is usually acomplished avoiding muscle relaxants. A case of intraoperative sugammadex partial reversal of the neuromuscular blockade allowing adequate monitoring during spine surgery is presented. A 38 year-old man was scheduled for discectomy and vertebral arthrodesis throughout anterior and posterior approaches. Anesthesia consisted of total intravenous anesthesia plus rocuronium. Intraoperatively monitoring was needed, and the muscle relaxant reverted twice with low dose sugammadex in order to obtain adequate responses. The doses of sugammadex used were conservatively selected (0.1mg/kg boluses increases, total dose needed 0.4mg/kg). Both motor evoqued potentials, and electromyographic responses were deemed adequate by the neurophysiologist. If muscle relaxation was needed in the context described, this approach could be useful to prevent neurological sequelae. This is the first study using very low dose sugammadex to reverse rocuronium intraoperatively and to re-establish the neuromuscular blockade. Copyright © 2016 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

Percutaneous intradiscal ozone (O3)-injection: an experimental study in canines

International Nuclear Information System (INIS)

Yu Zhijian; He Xiaofeng; Chen Yong; Zeng Qingle; Liu Chihong; Zhao Zhongqing; Lu Yong; Li Yanhao

2002-01-01

Objective: To evaluate the influence of ozone on normal nucleus pulpous and the safety of intradiscal ozone-injection for the treatment of herniated lumbar disc. Methods: Ozone was injected into selected lumbar discs (3 ml) and the para-spinal space (7 ml) with 20 G Chiba needle under fluoroscopy in five canines. The ozone concentration was 30 μg/ml and 50 μg/ml respectively. Two discs were selected for each concentration. Total 20 discs were injected. Three of the canines were given one-time ozone-injection and were sacrificed for pathology one week, one month and two months respectively after the procedure, and the other two canines were given two-time ozone-injection and were sacrificed one month and two months respectively after the procedure. The specimens including nucleus pulpous, end-plate, spinal cord, nerve root, and greater psoas muscle were observed macroscopically and microscopically. Results: No serious behavior abnormalities were observed in all animals. The atrophy of nucleus pulpous could be observed one month after ozone-injection due to significant reduction of water and extensive proliferation of collagenous fiber. The influence on the atrophy of nucleus pulpous demonstrated no apparent difference between the selected two concentrations of ozone, but was more apparent with two-time injection than that with one-time injection. The end-plates increased slightly or moderately in thickness in 16 simples and a few of fibers in greater psoas muscle suffered slight atrophy in 5 samples. Conclusion: It is suggested that percutaneous intradiscal ozone-injection is a safe method, and can cause gradual atrophy of nucleus pulpous. This study provides the evidence of the feasibility and value of this procedure's application in clinics

Myogenic potential of canine craniofacial satellite cells

Directory of Open Access Journals (Sweden)

Rita Maria Laura La Rovere

2014-05-01

Full Text Available The skeletal fibres have different embryological origin; the extraocular and jaw-closer muscles develop from prechordal mesoderm while the limb and trunk muscles from somites. These different origins characterise also the adult muscle stem cells, known as satellite cells (SCs and responsible for the fibre growth and regeneration. The physiological properties of presomitic SCs and their epigenetics are poorly studied despite their peculiar characteristics to preserve muscle integrity during chronic muscle degeneration. Here we isolated SCs from canine somitic (SDM: vastus lateralis, rectus abdominus, gluteus superficialis, biceps femoris, psoas and presomitic (PSDM: lateral rectus, temporalis and retractor bulbi muscles as myogenic progenitor cells from young and old animals. In addition, SDM and PSDM satellite cells were obtained also from Golden retrievers affected by muscular dystrophy (GRMD. We characterised the lifespan, the myogenic potential and functions and oxidative stress of both somitic and presomitic SCs with the aim to reveal differences with ageing and between healthy and dystrophic animals. The different proliferation rate was consistent with higher telomerase activity in PSDM-SCs compared to SDM-SCs, although restricted at early passages. SDM-SCs express early (Pax7, MyoD and late (MyHC, Myogenin myogenic markers differently from PSDM-SCs resulting in a more efficient and faster cell differentiation. Taken together our results showed that PSDM-SCs elicit a stronger stem cell phenotype compared to SDM ones. Finally, myomiR expression profile reveals a unique epigenetic signature in GRMD satellite cells and miR-206, highly expressed in dystrophic SCs, seems to play a critical role in muscle degeneration. Thus, miR-206 could represent a potential target for novel therapeutic approaches.

Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

OpenAIRE

Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch

2017-01-01

Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...

Noninvasive monitoring of treatment response in a rabbit cyanide toxicity model reveals differences in brain and muscle metabolism

Science.gov (United States)

Kim, Jae G.; Lee, Jangwoen; Mahon, Sari B.; Mukai, David; Patterson, Steven E.; Boss, Gerry R.; Tromberg, Bruce J.; Brenner, Matthew

2012-10-01

Noninvasive near infrared spectroscopy measurements were performed to monitor cyanide (CN) poisoning and recovery in the brain region and in foreleg muscle simultaneously, and the effects of a novel CN antidote, sulfanegen sodium, on tissue hemoglobin oxygenation changes were compared using a sub-lethal rabbit model. The results demonstrated that the brain region is more susceptible to CN poisoning and slower in endogenous CN detoxification following exposure than peripheral muscles. However, sulfanegen sodium rapidly reversed CN toxicity, with brain region effects reversing more quickly than muscle. In vivo monitoring of multiple organs may provide important clinical information regarding the extent of CN toxicity and subsequent recovery, and facilitate antidote drug development.

Functional Segregation within the Muscles of Aquatic Propulsion in the Asiatic Water Monitor (Varanus salvator

Directory of Open Access Journals (Sweden)

Bruce Arthur Young

2016-09-01

Full Text Available Water monitor lizards (Varanus salvator swim using sinusoidal oscillations generated at the base of their long (50% of total body length tail. In an effort to determine which level of the structural/organizational hierarchy of muscle is associated with functional segregation between the muscles of the tail base, an array of muscle features — myosin heavy chain profiles, enzymatic fiber types, twitch and tetanic force production, rates of fatigue, muscle compliance, and electrical activity patterns — were quantitated. The two examined axial muscles, longissimus and iliocaudalis, were generally similar at the molecular, biochemical, and physiological levels, but differed at the biomechanics level and in their activation pattern. The appendicular muscle examined, caudofemoralis, differed from the axial muscles particularly at the molecular and physiological levels, and it exhibited a unique compliance profile and pattern of electrical activation. There were some apparent contradictions between the different structural/organizational levels examined. These contradictions, coupled with a unique myosin heavy chain profile, lead to the hypothesis that there are previously un-described molecular/biochemical specializations within varanid skeletal muscles.

Inorganic phosphate inhibits sympathetic neurotransmission in canine saphenous veins

International Nuclear Information System (INIS)

Edoute, Y.; Vanhoutte, P.M.; Shepherd, J.T.

1987-01-01

Inorganic phosphate has been proposed as the initiator of metabolic vasodilatation in active skeletal muscle. The present study was primarily designed to determine if this substance has an inhibitory effect on adrenergic neurotransmission. Rings of canine saphenous veins were suspended for isometric tension recording in organ chambers. A comparison was made of the ability of inorganic phosphate (3 to 14 mM) to relax rings contracted to the same degree by electrical stimulation, exogenous norepinephrine, and prostaglandin F/sub 2α/. The relaxation during electrical stimulation was significantly greater at all concentrations of phosphate. In strips of saphenous veins previously incubated with [ 3 H]norepinephrine, the depression of the contractile response caused by phosphate during electrical stimulated was accompanied by a significant reduction in the overflow of labeled neurotransmitter. Thus inorganic phosphate inhibits sympathetic neurotransmission and hence may have a key role in the sympatholysis in the active skeletal muscles during exercise. By contrast, in this preparation, it has a modest direct relaxing action on the vascular smooth muscle

Biomarkers of skeletal muscle and bone regeneration-adaptation to neurorehabilitation training strategies

OpenAIRE

Kern, Helmut; Carraro, Ugo; Marcante, Andrea; Baba, Alfonc; Piccione, Francesco; Esser, Karyn A.; Dyar, Kenneth A.; Ciciliot, Stefano; Tagliazucchi, Guidantonio Malagoli; Pallafacchina, Giorgia; Tothova, Jana; Argentini, Carla; Agatea, Lisa; Abraham, Reimar; Ahdesm?ki, Miika

2016-01-01

Functional recovery after peripheral nerve injury is reduced when axon growth is misdirected to reinnervate muscles other than their original targets.1-3 Here we review the effects of chronic electrical muscle stimulation (EMS) following peripheral nerve injury in rat, canine, and equine models of peripheral nerve injury. Specifically, we examine whether EMS accelerates reinnervation of muscular targets and if these targets are appropriately reinnervated by their original axons following nerv...

Impacted maxillary canines and root resorption of adjacent teeth: A retrospective observational study.

Science.gov (United States)

Guarnieri, R; Cavallini, C; Vernucci, R; Vichi, M; Leonardi, R; Barbato, E

2016-11-01

The prevalence of impacted maxillary canine is reported to be between 1% and 3%. The lack of monitoring and the delay in the treatment of the impacted canine can cause different complications such as: displacement of adjacent teeth, loss of vitality of neighbouring teeth, shortening of the dental arch, follicular cysts, canine ankylosis, recurrent infections, recurrent pain, internal resorption of the canine and the adjacent teeth, external resorption of the canine and the adjacent teeth, combination of these factors. An appropriate diagnosis, accurate predictive analysis and early intervention are likely to prevent such undesirable effects. The objective is to evaluate, by means of a retrospective observational study, the possibility of carrying out a predictive analysis of root resorption adjacent to the impacted canines by means of orthopantomographs, so as to limit the prescription of additional 3D radiography. 120 subjects with unilateral or bilateral maxillary impacted canine were examined and 50 patients with 69 impacted maxillary canine (22 male, 28 female; mean age: 11.7 years) satisfied the inclusion criteria of the study. These patients were subjected to a basic clinical and radiographic investigation (orthopantomographs and computerized tomography). All panoramic films were viewed under standardized conditions for the evaluation of two main variables: maxillary canine angulations (a, b, g angles) and the overlapping between the impacted teeth and the lateral incisor (Analysis of Lindauer). Binary logistic regression was used to estimate the likelihood of resorbed lateral incisors depending on sector location and angle measurements. Results indicated that b angle has the greatest influence on the prediction of root resorption (predictive value of b angle = 76%). If β angle <18° and Lindauer = I, the probability of resorption is 0.06. Evaluation of b angle and superimposition lateral incisor/impacted canine analysed on orthopantomographs could be one of

Chiral recognition of pinacidil and its 3-pyridyl isomer by canine cardiac and smooth muscle: Antagonism by sulfonylureas

International Nuclear Information System (INIS)

Steinberg, M.I.; Wiest, S.A.; Zimmerman, K.M.; Ertel, P.J.; Bemis, K.G.; Robertson, D.W.

1991-01-01

Pinacidil, a potassium channel opener (PCO), relaxes vascular smooth muscle by increasing potassium ion membrane conductance, thereby causing membrane hyperpolarization. PCOs also act on cardiac muscle to decrease action potential duration (APD) selectively. To examine the enantiomeric selectivity of pinacidil, the stereoisomers of pinacidil (a 4-pyridylcyanoguanidine) and its 3-pyridyl isomer (LY222675) were synthesized and studied in canine Purkinje fibers and cephalic veins. The (-)-enantiomers of both pinacidil and LY222675 were more potent in relaxing phenylephrine-contracted cephalic veins and decreasing APD than were their corresponding (+)-enantiomers. The EC50 values for (-)-pinacidil and (-)-LY222675 in relaxing cephalic veins were 0.44 and 0.09 microM, respectively. In decreasing APD, the EC50 values were 3.2 microM for (-)-pinacidil and 0.43 microM for (-)-LY222675. The eudismic ratio was greater for the 3-pyridyl isomer than for pinacidil in both cardiac (71 vs. 22) and vascular (53 vs. 17) tissues. (-)-LY222675 and (-)-pinacidil (0.1-30 microM) also increased 86Rb efflux from cephalic veins to a greater extent than did their respective optical antipodes. The antidiabetic sulfonylurea, glyburide (1-30 microM), shifted the vascular concentration-response curve of (-)-pinacidil to the right by a similar extent at each inhibitor concentration. Glipizide also antagonized the response to (-)-pinacidil, but was about 1/10 as potent with a maximal shift occurring at 10 and 30 microM. Glyburide antagonized the vascular relaxant effects of 0.3 microM (-)-LY222675 (EC50, 2.3 microM) and reversed the decrease in APD caused by 3 microM (-)-LY222675 (EC50, 1.9 microM). Nitroprusside did not alter 86Rb efflux, and vascular relaxation induced by sodium nitroprusside was unaffected by sulfonylureas

[Impact of a quality assurance program on the use of neuromuscular monitoring and reversal of muscle relaxants].

Science.gov (United States)

Motamed, C; Bourgain, J-L

2009-04-01

As part of a quality assurance in the anaesthesia department, this study was designed to enhance the rate of neuromuscular blockade monitoring for patients receiving muscle relaxant during anaesthesia. After approval of our local ethical committee, we assessed 200 computerized anaesthesia records in which neuromuscular relaxants were used. The following data were collected: demographic characteristics, durations of anaesthesia and surgery, use of neuromuscular monitoring, reversal agents and the quality of neuromuscular monitoring. The results were discussed with all anaesthesia providers of the department and an internal guideline was elaborated with the endpoint that all patients having muscle relaxants should have quantitative neuromuscular monitoring. Six months later, another assessment of 200 consecutive records collected the same data to check the efficiency of the elaborated guideline. The monitoring rate was of 67% at the first assessment and increased to 94% (passessment and was stable at the second assessment (50%). The rate of patients not monitored and not reversed decreased from 5 to 2% (pquality assurance program systematic quantitative monitoring of neuromuscular blockade can be significantly increased.

Serum Osteopontin as a Novel Biomarker for Muscle Regeneration in Duchenne Muscular Dystrophy.

Science.gov (United States)

Kuraoka, Mutsuki; Kimura, En; Nagata, Tetsuya; Okada, Takashi; Aoki, Yoshitsugu; Tachimori, Hisateru; Yonemoto, Naohiro; Imamura, Michihiro; Takeda, Shin'ichi

2016-05-01

Duchenne muscular dystrophy is a lethal X-linked muscle disorder. We have already reported that osteopontin (OPN), an inflammatory cytokine and myogenic factor, is expressed in the early dystrophic phase in canine X-linked muscular dystrophy in Japan, a dystrophic dog model. To further explore the possibility of OPN as a new biomarker for disease activity in Duchenne muscular dystrophy, we monitored serum OPN levels in dystrophic and wild-type dogs at different ages and compared the levels to other serum markers, such as serum creatine kinase, matrix metalloproteinase-9, and tissue inhibitor of metalloproteinase-1. Serum OPN levels in the dystrophic dogs were significantly elevated compared with those in wild-type dogs before and 1 hour after a cesarean section birth and at the age of 3 months. The serum OPN level was significantly correlated with the phenotypic severity of dystrophic dogs at the period corresponding to the onset of muscle weakness, whereas other serum markers including creatine kinase were not. Immunohistologically, OPN was up-regulated in infiltrating macrophages and developmental myosin heavy chain-positive regenerating muscle fibers in the dystrophic dogs, whereas serum OPN was highly elevated. OPN expression was also observed during the synergic muscle regeneration process induced by cardiotoxin injection. In conclusion, OPN is a promising biomarker for muscle regeneration in dystrophic dogs and can be applicable to boys with Duchenne muscular dystrophy. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

[Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

Science.gov (United States)

Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

2012-11-04

To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

Factors predicting the feasibility of monitoring lower-limb muscle motor evoked potentials in patients undergoing excision of spinal cord tumors.

Science.gov (United States)

Rajshekhar, Vedantam; Velayutham, Parthiban; Joseph, Mathew; Babu, K Srinivasa

2011-06-01

This prospective study on intraoperative muscle motor evoked potentials (MMEPs) from lower-limb muscles in patients undergoing surgery for spinal cord tumors was performed to: 1) determine preoperative clinical features that could predict successful recording of lower-limb MMEPs; 2) determine the muscle in the lower limb from which MMEPs could be most consistently obtained; 3) assess the need to monitor more than 1 muscle per limb; and 4) determine the effect of a successful baseline MMEP recording on early postoperative motor outcome. Of 115 consecutive patients undergoing surgery for spinal cord tumors, 110 were included in this study (44 intramedullary and 66 intradural extramedullary tumors). Muscle MEPs were generated using transcranial electrical stimulation under controlled anesthesia and were recorded from the tibialis anterior, quadriceps, soleus, and external anal sphincter muscles bilaterally. The effect of age (≤ 20 or > 20 years old), location of the tumor (intramedullary or extramedullary), segmental location of the tumor (cervical, thoracic, or lumbar), duration of symptoms (≤ 12 or > 12 months), preoperative functional grade (Nurick Grades 0-3 or 4-5), and muscle power (Medical Research Council Grades 0/5-3/5 or 4/5-5/5) on the success rate of obtaining MMEPs was studied using multiple regression analysis. The effect of the ability to monitor MMEPs on motor outcome at discharge from the hospital was also analyzed. The overall success rate for obtaining baseline lower-limb MMEPs was 68.2% (75 of 110 patients). Eighty-nine percent of patients with Nurick Grades 0-3 had successful MMEP recordings. Muscle MEPs could not be obtained in any patient in whom muscle power was 2/5 or less, but were obtained from 91.4% of patients with muscle power of 4/5 or more. Analysis showed that only preoperative Nurick grade (p ≤ 0.0001) and muscle power (p < 0.0001) were significant predictors of the likelihood of obtaining MMEPs. Responses were most consistently

Extraglandular and intraglandular vascularization of canine prostate.

Science.gov (United States)

Stefanov, Miroslav

2004-03-01

The literature on the vascularization of the canine prostate is reviewed and the clinical significance of prostate morphology is described. Scanning Electron Microscopy (SEM), combined with improved corrosion casting methods, reveal new morphological details that promise better diagnostics and treatment but also require expansion of clinical nomenclature. A proposal is made for including two previously unnamed veins in Nomina Anatomica Veterinaria (NAV). The canine prostate has two lobes with independent vascularization. Each lobe is supplied through the left and right a. prostatica, respectively. The a. prostatica sprouts three small vessels (cranial, middle, and caudal) towards the prostate gland. A. prostatica is a small-size artery whose wall structure is similar to the arteries of the muscular type. V. prostatica is a small-size valved vein. The canine prostate has capsular, parenchymal, and urethral vascular zones. The surface vessels of the capsule are predominantly veins and the diameter of arterial vessels is larger than that of the veins. The trabecular vessels are of two types: direct and branched. The prostate parenchyma is supplied by branches of the trabecular vessels. The periacinary capillaries are fenestrated and form a net in a circular pattern. The processes of the myoepithelial cells embrace both the acins and the periacinar capillaries. In the prostate ductal system. there are spermatozoa. The prostatic part of the urethra is supplied by an independent branch of a. prostatica. The prostatic urethral part is drained by v. prostatica, the vein of the urethral bulb and the ventral prostate veins. M. urethralis begins as early as the urethral prostatic part. The greater part of the white muscle fibers in m. urethralis suggest an enhanced anaerobic metabolism. Copyright 2004 Wiley-Liss, Inc.

Dual AAV Gene Therapy for Duchenne Muscular Dystrophy with a 7-kb Mini-Dystrophin Gene in the Canine Model.

Science.gov (United States)

Kodippili, Kasun; Hakim, Chady H; Pan, Xiufang; Yang, Hsiao T; Yue, Yongping; Zhang, Yadong; Shin, Jin-Hong; Yang, N Nora; Duan, Dongsheng

2018-03-01

Dual adeno-associated virus (AAV) technology was developed in 2000 to double the packaging capacity of the AAV vector. The proof of principle has been demonstrated in various mouse models. Yet, pivotal evidence is lacking in large animal models of human diseases. Here we report expression of a 7-kb canine ΔH2-R15 mini-dystrophin gene using a pair of dual AAV vectors in the canine model of Duchenne muscular dystrophy (DMD). The ΔH2-R15 minigene is by far the most potent synthetic dystrophin gene engineered for DMD gene therapy. We packaged minigene dual vectors in Y731F tyrosine-modified AAV-9 and delivered to the extensor carpi ulnaris muscle of a 12-month-old affected dog at the dose of 2 × 10 13 viral genome particles/vector/muscle. Widespread mini-dystrophin expression was observed 2 months after gene transfer. The missing dystrophin-associated glycoprotein complex was restored. Treatment also reduced muscle degeneration and fibrosis and improved myofiber size distribution. Importantly, dual AAV therapy greatly protected the muscle from eccentric contraction-induced force loss. Our data provide the first clear evidence that dual AAV therapy can be translated to a diseased large mammal. Further development of dual AAV technology may lead to effective therapies for DMD and many other diseases in human patients.

Behavioral and Locomotor Measurements Using an Open Field Activity Monitoring System for Skeletal Muscle Diseases

OpenAIRE

Tatem, Kathleen S.; Quinn, James L.; Phadke, Aditi; Yu, Qing; Gordish-Dressman, Heather; Nagaraju, Kanneboyina

2014-01-01

The open field activity monitoring system comprehensively assesses locomotor and behavioral activity levels of mice. It is a useful tool for assessing locomotive impairment in animal models of neuromuscular disease and efficacy of therapeutic drugs that may improve locomotion and/or muscle function. The open field activity measurement provides a different measure than muscle strength, which is commonly assessed by grip strength measurements. It can also show how drugs may affect other body sy...

Non-invasive monitoring of muscle blood perfusion by photoplethysmography: evaluation of a new application.

Science.gov (United States)

Sandberg, M; Zhang, Q; Styf, J; Gerdle, B; Lindberg, L-G

2005-04-01

To evaluate a specially developed photoplethysmographic (PPG) technique, using green and near-infrared light sources, for simultaneous non-invasive monitoring of skin and muscle perfusion. Evaluation was based on assessments of changes in blood perfusion to various provocations, such as post-exercise hyperaemia and hyperaemia following the application of liniment. The deep penetrating feature of PPG was investigated by measurement of optical radiation inside the muscle. Simultaneous measurements using ultrasound Doppler and the new PPG application were performed to elucidate differences between the two methods. Specific problems related to the influence of skin temperature on blood flow were highlightened, as well. Following static and dynamic contractions an immediate increase in muscle perfusion was shown, without increase in skin perfusion. Liniment application to the skin induced a rapid increase in skin perfusion, but not in muscle. Both similarities and differences in blood flow measured by Ultrasound Doppler and PPG were demonstrated. The radiant power measured inside the muscle, by use of an optical fibre, showed that the near-infrared light penetrates down to the vascular depth inside the muscle. The results of this study indicate the potentiality of the method for non-invasive measurement of local muscle perfusion, although some considerations still have to be accounted for, such as influence of temperature on blood perfusion.

Oral dosing of chemical indicators for in vivo monitoring of Ca2+ dynamics in insect muscle.

Directory of Open Access Journals (Sweden)

Ferdinandus

Full Text Available This paper proposes a remarkably facile staining protocol to visually investigate dynamic physiological events in insect tissues. We attempted to monitor Ca2+ dynamics during contraction of electrically stimulated living muscle. Advances in circuit miniaturization and insect neuromuscular physiology have enabled the hybridization of living insects and man-made electronic components, such as microcomputers, the result of which has been often referred as a Living Machine, Biohybrid, or Cyborg Insect. In order for Cyborg Insects to be of practical use, electrical stimulation parameters need to be optimized to induce desired muscle response (motor action and minimize the damage in the muscle due to the electrical stimuli. Staining tissues and organs as well as measuring the dynamics of chemicals of interest in muscle should be conducted to quantitatively and systematically evaluate the effect of various stimulation parameters on the muscle response. However, existing staining processes require invasive surgery and/or arduous procedures using genetically encoded sensors. In this study, we developed a non-invasive and remarkably facile method for staining, in which chemical indicators can be orally administered (oral dosing. A chemical Ca2+ indicator was orally introduced into an insect of interest via food containing the chemical indicator and the indicator diffused from the insect digestion system to the target muscle tissue. We found that there was a positive relationship between the fluorescence intensity of the indicator and the frequency of electrical stimulation which indicates the orally dosed indicator successfully monitored Ca2+ dynamics in the muscle tissue. This oral dosing method has a potential to globally stain tissues including neurons, and investigating various physiological events in insects.

Oral dosing of chemical indicators for in vivo monitoring of Ca2+ dynamics in insect muscle.

Science.gov (United States)

Ferdinandus; Arai, Satoshi; Ishiwata, Shin'ichi; Suzuki, Madoka; Sato, Hirotaka

2015-01-01

This paper proposes a remarkably facile staining protocol to visually investigate dynamic physiological events in insect tissues. We attempted to monitor Ca2+ dynamics during contraction of electrically stimulated living muscle. Advances in circuit miniaturization and insect neuromuscular physiology have enabled the hybridization of living insects and man-made electronic components, such as microcomputers, the result of which has been often referred as a Living Machine, Biohybrid, or Cyborg Insect. In order for Cyborg Insects to be of practical use, electrical stimulation parameters need to be optimized to induce desired muscle response (motor action) and minimize the damage in the muscle due to the electrical stimuli. Staining tissues and organs as well as measuring the dynamics of chemicals of interest in muscle should be conducted to quantitatively and systematically evaluate the effect of various stimulation parameters on the muscle response. However, existing staining processes require invasive surgery and/or arduous procedures using genetically encoded sensors. In this study, we developed a non-invasive and remarkably facile method for staining, in which chemical indicators can be orally administered (oral dosing). A chemical Ca2+ indicator was orally introduced into an insect of interest via food containing the chemical indicator and the indicator diffused from the insect digestion system to the target muscle tissue. We found that there was a positive relationship between the fluorescence intensity of the indicator and the frequency of electrical stimulation which indicates the orally dosed indicator successfully monitored Ca2+ dynamics in the muscle tissue. This oral dosing method has a potential to globally stain tissues including neurons, and investigating various physiological events in insects.

Three-year serologic immunity against canine parvovirus type 2 and canine adenovirus type 2 in dogs vaccinated with a canine combination vaccine.

Science.gov (United States)

Larson, L J; Schultz, R D

2007-01-01

A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.

Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

Directory of Open Access Journals (Sweden)

Anna McRee

2014-09-01

Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe.

Science.gov (United States)

McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A

2014-09-05

Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

Canine gastritis.

Science.gov (United States)

Webb, Craig; Twedt, David C

2003-09-01

Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.

Varied clinico-radiological presentations of transmigrated canines

Directory of Open Access Journals (Sweden)

Ishita Gupta

2015-01-01

Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.

Identification of a new genotype of canine distemper virus circulating in America.

Science.gov (United States)

Gámiz, César; Martella, Vito; Ulloa, Raúl; Fajardo, Raúl; Quijano-Hernandéz, Israel; Martínez, Simón

2011-08-01

Canine Distemper is a highly contagious viral systemic disease that affects a wide variety of terrestrial carnivores. Canine Distemper virus (CDV) appears genetically heterogeneous, markedly in the hemagglutinin protein (H), showing geographic patterns of diversification that are useful to monitor CDV molecular epidemiology. In Mexico the activity of canine distemper remains high in dogs, likely because vaccine prophylaxis coverage in canine population is under the levels required to control effectively the disease. By phylogenetic analysis based on the nucleoprotein (N) and on the H genes, Mexican CDV strains collected between 2007 and 2010 were distinguished into several genovariants, all which constituted a unique group, clearly distinct from field and vaccine strains circulating worldwide, but resembling a CDV strain, 19876, identified in Missouri, USA, 2004, that was genetically unrelated to other North-American CDV strains. Gathering information on the genetic heterogeneity of CDV on a global scale appears pivotal in order to investigate the origin and modalities of introduction of unusual/novel CDV strains, as well as to understand if vaccine breakthroughs or disease epidemics may be somewhat related to genetic/antigenic or biological differences between field and vaccine strains.

Skeletal muscle beta-receptors and isoproterenol-stimulated vasodilation in canine heart failure

International Nuclear Information System (INIS)

Frey, M.J.; Lanoce, V.; Molinoff, P.B.; Wilson, J.R.

1989-01-01

To investigate whether heart failure alters beta-adrenergic receptors on skeletal muscle and its associated vasculature, the density of beta-adrenergic receptors, isoproterenol-stimulated adenylate cyclase activity, and coupling of the guanine nucleotide-binding regulatory protein were compared in 18 control dogs and 16 dogs with heart failure induced by 5-8 wk of ventricular pacing at 260 beats/min. Hindlimb vascular responses to isoproterenol were compared in eight controls and eight of the dogs with heart failure. In dogs with heart failure, the density of beta-receptors on skeletal muscle was reduced in both gastrocnemius (control: 50 +/- 5; heart failure: 33 +/- 8 fmol/mg of protein) and semitendinosus muscle (control: 43 +/- 9; heart failure: 27 +/- 9 fmol/mg of protein, both P less than 0.05). Receptor coupling to the ternary complex, as determined by isoproterenol competition curves with and without guanosine 5'-triphosphate (GTP), was unchanged. Isoproterenol-stimulated adenylate cyclase activity was significantly decreased in semitendinosus muscle (control: 52.4 +/- 4.6; heart failure: 36.5 +/- 9.5 pmol.mg-1.min-1; P less than 0.05) and tended to be decreased in gastrocnemius muscle (control: 40.1 +/- 8.5; heart failure: 33.5 +/- 4.5 pmol.mg-1.min-1; P = NS). Isoproterenol-induced hindlimb vasodilation was not significantly different in controls and in dogs with heart failure. These findings suggest that heart failure causes downregulation of skeletal muscle beta-adrenergic receptors, probably due to receptor exposure to elevated catecholamine levels, but does not reduce beta-receptor-mediated vasodilation in muscle

Evaluation of mRNA expression levels and electrophysiological function of neuron-like cells derived from canine bone marrow stromal cells.

Science.gov (United States)

Nakano, Rei; Edamura, Kazuya; Sugiya, Hiroshi; Narita, Takanori; Okabayashi, Ken; Moritomo, Tadaaki; Teshima, Kenji; Asano, Kazushi; Nakayama, Tomohiro

2013-10-01

To investigate the in vitro differentiation of canine bone marrow stromal cells (BMSCs) into functional, mature neurons. Bone marrow from 6 adult dogs. BMSCs were isolated from bone marrow and chemically induced to develop into neurons. The morphology of the BMSCs during neuronal induction was monitored, and immunocytochemical analyses for neuron markers were performed after the induction. Real-time PCR methods were used to evaluate the mRNA expression levels of markers for neural stem or progenitor cells, neurons, and ion channels, and western blotting was used to assess the expression of neuronal proteins before and after neuronal induction. The electrophysiological properties of the neuron-like cells induced from canine BMSCs were evaluated with fluorescent dye to monitor Ca(2)+ influx. Canine BMSCs developed a neuron-like morphology after neuronal induction. Immunocytochemical analysis revealed that these neuron-like cells were positive for neuron markers. After induction, the cells' mRNA expression levels of almost all neuron and ion channel markers increased, and the protein expression levels of nestin and neurofilament-L increased significantly. However, the neuron-like cells derived from canine BMSCs did not have the Ca(2)+ influx characteristic of spiking neurons. Although canine BMSCs had neuron-like morphological and biochemical properties after induction, they did not develop the electrophysiological characteristics of neurons. Thus, these results have suggested that canine BMSCs could have the capacity to differentiate into a neuronal lineage, but the differentiation protocol used may have been insufficient to induce development into functional neurons.

Development of the canine tooth in the beagle

International Nuclear Information System (INIS)

Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.

1993-01-01

The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla

Ontogeny of canine dimorphism in extant hominoids.

Science.gov (United States)

Schwartz, G T; Dean, C

2001-07-01

Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.

Biochemical characterization of prostate-specific membrane antigen from canine prostate carcinoma cells.

Science.gov (United States)

Wu, Lisa Y; Johnson, Jacqueline M; Simmons, Jessica K; Mendes, Desiree E; Geruntho, Jonathan J; Liu, Tiancheng; Dirksen, Wessel P; Rosol, Thomas J; Davis, William C; Berkman, Clifford E

2014-05-01

Prostate-specific membrane antigen (PSMA) remains an important target for diagnostic and therapeutic application for human prostate cancer. Model cell lines have been recently developed to study canine prostate cancer but their PSMA expression and enzymatic activity have not been elucidated. The present study was focused on determining PSMA expression in these model canine cell lines and the use of fluorescent small-molecule enzyme inhibitors to detect canine PSMA expression by flow cytometry. Western blot and RT-PCR were used to determine the transcriptional and translational expression of PSMA on the canine cell lines Leo and Ace-1. An endpoint HPLC-based assay was used to monitor the enzymatic activity of canine PSMA and the potency of enzyme inhibitors. Flow cytometry was used to detect the PSMA expressed on Leo and Ace-1 cells using a fluorescently tagged PSMA enzyme inhibitor. Canine PSMA expression on the Leo cell line was confirmed by Western blot and RT-PCR, the enzyme activity, and flow cytometry. Kinetic parameters Km and Vmax of PSMA enzymatic activity for the synthetic substrate (PABGγG) were determined to be 393 nM and 220 pmol min(-1)  mg protein(-1) , respectively. The inhibitor core 1 and fluorescent inhibitor 2 were found to be potent reversible inhibitors (IC50  = 13.2 and 1.6 nM, respectively) of PSMA expressed on the Leo cell line. Fluorescent labeling of Leo cells demonstrated that the fluorescent PSMA inhibitor 2 can be used for the detection of PSMA-positive canine prostate tumor cells. Expression of PSMA on Ace-1 was low and not detectable by flow cytometry. The results described herein have demonstrated that PSMA is expressed on canine prostate tumor cells and exhibits similar enzymatic characteristics as human PSMA. The findings show that the small molecule enzyme inhibitors currently being studied for use in diagnosis and therapy of human prostate cancer can also be extended to include canine prostate cancer. Importantly

Three-year duration of immunity in dogs following vaccination against canine adenovirus type-1, canine parvovirus, and canine distemper virus.

Science.gov (United States)

Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

2005-01-01

A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.

Booster effect of canine distemper, canine parvovirus infection and infectious canine hepatitis combination vaccine in domesticated adult dogs.

Science.gov (United States)

Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki

2012-08-01

Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

Bilateral supernumerary primary maxillary canines

Directory of Open Access Journals (Sweden)

Santanu Mukhopadhyay

2018-01-01

Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.

9 CFR 113.306 - Canine Distemper Vaccine.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...

Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies

OpenAIRE

J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides

2002-01-01

Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...

Characterization of the canine urinary proteome.

Science.gov (United States)

Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E

2014-06-01

Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.

Duration of serological response to canine parvovirus-type 2, canine distemper virus, canine adenovirus type 1 and canine parainfluenza virus in client-owned dogs in Australia.

Science.gov (United States)

Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J

2012-12-01

To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.

Purification of infectious canine parvovirus from cell culture by affinity chromatography with monoclonal antibodies.

NARCIS (Netherlands)

J. Groen (Jan); N. Juntti; J.S. Teppema; F.G.C.M. Uytdehaag (Fons); A.D.M.E. Osterhaus (Albert); G.F. Rimmelzwaan (Guus)

1987-01-01

textabstractImmuno affinity chromatography with virus neutralizing monoclonal antibodies, directed to the haemagglutinating protein of canine parvovirus (CPV) was used to purify and concentrate CPV from infected cell culture. The procedure was monitored by testing the respective fractions in an

Antibody titers for canine parvovirus type-2, canine distemper virus, and canine adenovirus type-1 in adult household dogs.

Science.gov (United States)

Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki

2011-09-01

Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.

Mechanomyography-Based Wearable Monitor of Quasi-Isometric Muscle Fatigue for Motor Neural Prostheses.

Science.gov (United States)

Krueger, Eddy; Popović-Maneski, Lana; Nohama, Percy

2018-02-01

A motor neural prosthesis based on surface functional electrical stimulation (sFES) can restore functional movement (e.g., standing, walking) in patients with a spinal cord injury (SCI). sFES generates muscle contractions in antigravity muscles and allows balance-assisted standing. This induced standing has several benefits, such as improved cardiovascular function, decreased incidence of urinary infections, reduced joint contractures, and muscle atrophy. The duration of sFES assisted standing is limited due to the quick onset of muscle fatigue. Currently, there is no method available to reliably estimate real-time muscle fatigue during sFES. Simply monitoring the M-wave changes is not suitable due to the high signal disturbances that arise during multi-channel electrical stimulation. Mechanomyography (MMG) is immune to electrical stimulation artifacts and can be used to detect subtle vibrations on the surface of the skin related to activation of the underlying muscle's motor units (MU). The aim of this study was to develop a method for detecting muscle fatigue brought on by sFES. The method was tested in three different heads of the quadriceps muscle in SCI patients during electrically elicited quasi-isometric contraction. Six spinal cord-injured male volunteers, with no voluntary control of the quadriceps muscle participated in the study. Electrical bursts of voltage-controlled monophasic square pulses at frequencies of 1 kHz (50% duty cycle) at 50 Hz (15% duty cycle) were used to generate thigh muscle contractions that controlled the knee joint in the sagittal plane. The pulse amplitudes were set to position the knee joint at a 5° angle from the horizontal plane and when the knee angle dropped to 20° (e.g., the quadriceps were unable to hold the lower leg in the desired position), the test was terminated. Two data segments lasting 10 s each, at the beginning and end of each test, were analyzed. The muscle contraction was assessed by MMG sensors positioned on

A New Method to Individualize Monitoring of Muscle Recovery in Athletes.

Science.gov (United States)

Hecksteden, Anne; Pitsch, Werner; Julian, Ross; Pfeiffer, Mark; Kellmann, Michael; Ferrauti, Alexander; Meyer, Tim

2017-10-01

Assessment of muscle recovery is essential for the daily fine-tuning of training load in competitive sports, but individual differences may limit the diagnostic accuracy of group-based reference ranges. This article reports an attempt to develop individualized reference ranges using a Bayesian approach comparable to that developed for the Athlete Biological Passport. Urea and creatine kinase (CK) were selected as indicators of muscle recovery. For each parameter, prior distributions and repeated-measures SDs were characterized based on data of 883 squad athletes (1758 data points, 1-8 per athlete, years 2013-2015). Equations for the individualization procedure were adapted from previous material to allow for discrimination of 2 physiological states (recovered vs nonrecovered). Evaluation of classificatory performance was carried out using data from 5 consecutive weekly microcycles in 14 elite junior swimmers and triathletes. Blood samples were collected every Monday (recovered) and Friday according to the repetitive weekly training schedule over 5 wk. On the group level, changes in muscle recovery could be confirmed by significant differences in urea and CK and validated questionnaires. Group-based reference ranges were derived from that same data set to avoid overestimating the potential benefit of individualization. For CK, error rates were significantly lower with individualized classification (P vs group-based: test-pass error rate P = .008; test-fail error rate P < .001). For urea, numerical improvements in error rates failed to reach significance. Individualized reference ranges seem to be a promising tool to improve accuracy of monitoring muscle recovery. Investigating application to a larger panel of indicators is warranted.

Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

Science.gov (United States)

Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

2009-01-01

A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

Assessment of skeletal muscle fatigue of road maintenance workers based on heart rate monitoring and myotonometry

Directory of Open Access Journals (Sweden)

Kalkis Henrijs

2006-07-01

Full Text Available Abstract Objective This research work is dedicated to occupational health problems caused by ergonomic risks. The research object was road building industry, where workers have to work very intensively, have long work hours, are working in forced/constrained work postures and overstrain during the work specific parts of their bodies. The aim of this study was to evaluate the work heaviness degree and to estimate the muscle fatigue of workers after one week work cycle. The study group consisted of 10 road construction and maintenance workers and 10 pavers aged between 20 and 60 years. Methods Physical load were analyzed by measuring heart rate (HR, work postures (OWAS and perceived exertion (RPE. Assessments of the muscles strain and functional state (tone were carried out using myotonometric (MYO measurements. The reliability of the statistical processing of heart rate monitoring and myotonometry data was determined using correlating analysis. Results This study showed that that road construction and repairing works should be considered as a hard work according to average metabolic energy consumption 8.1 ± 1.5 kcal/min; paving, in its turn, was a moderately hard work according to 7.2 ± 1.1 kcal/min. Several muscle tone levels were identified allowing subdivision of workers into three conditional categories basing on muscle tone and fatigue: I – absolute muscle relaxation and ability to relax; II – a state of equilibrium, when muscles are able to adapt to the work load and are partly able to relax; and III – muscle fatigue and increased tone. It was also found out that the increase of muscle tone and fatigue mainly depend on workers physical preparedness and length of service, and less – on their age. Conclusion We have concluded that a complex ergonomic analysis consisting of heart rate monitoring, assessment of compulsive working postures and myotonometry is appropriate to assess the work heaviness degree and can provide prognosis of

Acquired muscle contractures in the dog and cat. A review of the literature and case report.

Science.gov (United States)

Taylor, J; Tangner, C H

2007-01-01

Canine and feline muscle contracture is reported to affect several different muscles, is associated with a number of predisposing factors, and a varying prognosis depending upon which muscle is affected. Most patients suffer some form of trauma weeks to months before the contracture is present. The clinical signs include: lameness, pain, weakness, decreased range of motion, a firmness noted throughout the entire muscle, and usually a characteristic gait. Pre-disposing factors for muscle contracture include: compartment syndrome, infection, trauma, repetitive strains, fractures, infectious diseases, immune-mediated diseases, neoplasia, and ischaemia. There does appear to be some breed and age predilection, however, the sex of the animal does not have an appreciable influence. In general, muscle contractures of the forelimb respond better to treatment and carry a better prognosis than muscle contractures of the hindlimb.

Use of a single bipolar electrode in the posterior arytenoid muscles for bilateral monitoring of the recurrent laryngeal nerves in thyroid surgery.

Science.gov (United States)

Haerle, Stephan; Sidler, D; Linder, Th; Mueller, W

2008-12-01

The aims were to assess the technical feasibility of using a single electrode in the posterior arytenoid muscles (PAM) for intraoperative monitoring of the recurrent laryngeal nerve (RLN) in thyroid surgery, to validate the new method against the insertion of electrodes placed in the vocal cord muscle, and to report the results of the clinical application of the new concept. A total of 52 patients were enrolled. The handling and safety of RLN monitoring was tested by simultaneous registration of the EMG response from vocal fold electrodes and PAM electrodes. Acoustically and electromyographically we found nearly the same values for the arytenoid muscles as for the vocal folds, although the signals taken from the vocal folds were slightly stronger. PAM recording using a single bipolar electrode is technically feasible and as reliable compared to the standard vocal cord monitoring.

Duchenne Muscular Dystrophy Gene Therapy in the Canine Model

Science.gov (United States)

2015-01-01

Abstract Duchenne muscular dystrophy (DMD) is an X-linked lethal muscle disease caused by dystrophin deficiency. Gene therapy has significantly improved the outcome of dystrophin-deficient mice. Yet, clinical translation has not resulted in the expected benefits in human patients. This translational gap is largely because of the insufficient modeling of DMD in mice. Specifically, mice lacking dystrophin show minimum dystrophic symptoms, and they do not respond to the gene therapy vector in the same way as human patients do. Further, the size of a mouse is hundredfolds smaller than a boy, making it impossible to scale-up gene therapy in a mouse model. None of these limitations exist in the canine DMD (cDMD) model. For this reason, cDMD dogs have been considered a highly valuable platform to test experimental DMD gene therapy. Over the last three decades, a variety of gene therapy approaches have been evaluated in cDMD dogs using a number of nonviral and viral vectors. These studies have provided critical insight for the development of an effective gene therapy protocol in human patients. This review discusses the history, current status, and future directions of the DMD gene therapy in the canine model. PMID:25710459

New and emerging pathogens in canine infectious respiratory disease.

Science.gov (United States)

Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J

2014-03-01

Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.

Genetics of Human and Canine Dilated Cardiomyopathy.

Science.gov (United States)

Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S

2015-01-01

Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...

Clinical and serological response of wild dogs (Lycaon pictus to vaccination against canine distemper, canine parvovirus infection and rabies

Directory of Open Access Journals (Sweden)

J. Van Heerden

2002-07-01

Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies.

Science.gov (United States)

van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E

2002-03-01

Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

9 CFR 113.317 - Parvovirus Vaccine (Canine).

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...

Application of xenogeneic anti-canine distemper virus antibodies in treatment of canine distemper puppies.

Science.gov (United States)

Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L

2016-11-01

The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.

Genetics of Human and Canine Dilated Cardiomyopathy

Directory of Open Access Journals (Sweden)

Siobhan Simpson

2015-01-01

Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

Possible mechanism for species difference on the toxicity of pivalic acid between dogs and rats

International Nuclear Information System (INIS)

Yamaguchi, Toshiro; Nakajima, Yoshitsugu; Nakamura, Yutaka

2006-01-01

In a high dose toxicity study of pivalic acid (PA), PA caused skeletal muscle disorder in dog, and a significant increase of pivaloyl carnitine (PC) was observed in canine muscle, but not in rat muscle. In order to understand species difference of the toxicity of PA, we compared the in vitro metabolism of PA among dog, rat and rabbit, especially focussing on the carnitine conjugate. Canine muscle showed low, but significant carnitine conjugating activity, while that of rat was negligible. Canine kidney mitochondria had significant activity in the pivaloyl CoA synthesis (7 nmol/mg protein/h), but muscle mitochondria showed only trace activity. Both kidney and muscle mitochondria displayed similar carnitine acyltransferase activity (2-3 nmol/mg protein/h) towards pivaloyl CoA. On the other hand, with respect to the activity of carnitine acyltransferase in the reverse direction using PC as substrate, canine muscle mitochondria showed higher activity than that of kidney mitochondria. This means that PC is not the final stable metabolite, but is converted easily to pivaloyl CoA in canine muscle. These results suggest one of the possible mechanisms for canine selective muscle disorder to be as follows. Only canine muscle can metabolize PA to its carnitine conjugate slowly, but significantly. In canine muscle, PC is not the final stable metabolite; it is easily converted to pivaloyl CoA. As carnitine conjugation is thought to be the only detoxification metabolic route in canine muscle, under certain circumstances such as carnitine deficiency, the risk of exposure with toxic pivaloyl CoA might increase and the CoASH pool in canine muscle might be exhausted, resulting in toxicity in canine muscle

Kinetics of canine dental calculus crystallization: an in vitro study on the influence of inorganic components of canine saliva.

Science.gov (United States)

Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H

2014-07-01

This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.

Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.

Science.gov (United States)

Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S

2017-06-03

Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.

HSP20 phosphorylation and airway smooth muscle relaxation

Directory of Open Access Journals (Sweden)

Mariam Ba

2009-06-01

Full Text Available Mariam Ba1, Cherie A Singer1, Manoj Tyagi2, Colleen Brophy3, Josh E Baker4, Christine Cremo4, Andrew Halayko5, William T Gerthoffer21Department of Pharmacology, University of Nevada School of Medicine, Reno, NV, USA; 2Department of Biochemistry and Molecular Biology, University of South Alabama, Mobile, AL, USA; 3Harrington Department of Biochemistry, Arizona State University, Tempe, AZ, USA; 4Department of Biochemistry and Molecular Biology, University of Nevada, Reno, NV, USA; 5Departments of Physiology and Internal Medicine, University of Manitoba, Winnipeg, MB, CanadaAbstract: HSP20 (HSPB6 is a small heat shock protein expressed in smooth muscles that is hypothesized to inhibit contraction when phosphorylated by cAMP-dependent protein kinase. To investigate this hypothesis in airway smooth muscle (ASM we showed that HSP20 was constitutively expressed as well as being inducible in cultured hASM cells by treatment with 1 µM isoproterenol or 10 µM salmeterol. In contrast, a mixture of proinflammatory mediators (interleukin-1β, tumor necrosis factor α, and interferon γ inhibited expression of HSP20 by about 50% in 48 hours. To determine whether phosphorylation of HSP20 is sufficient to induce relaxation, canine tracheal smooth muscle was treated with a cell permeant phosphopeptide that mimics the phosphorylation of HSP20. The HSP20 phosphopeptide antagonized carbacholinduced contraction by 60% with no change in myosin light chain phosphorylation. Recombinant full length HSP20 inhibited skeletal actin binding to smooth muscle myosin subfragment 1 (S1, and recombinant cell permeant TAT-HSP20 S16D mutant reduced F-actin filaments in cultured hASM cells. Carbachol stimulation of canine tracheal smooth muscle tissue caused redistribution of HSP20 from large macromolecular complexes (200–500 kDa to smaller complexes (<60 kDa. The results are consistent with HSP20 expression and macromolecular structure being dynamically regulated in airway

Effect of bevacizumab on angiogenesis and growth of canine osteosarcoma cells xenografted in athymic mice.

Science.gov (United States)

Scharf, Valery F; Farese, James P; Coomer, Alastair R; Milner, Rowan J; Taylor, David P; Salute, Marc E; Chang, Myron N; Neal, Dan; Siemann, Dietmar W

2013-05-01

Objective-To investigate the effects of bevacizumab, a human monoclonal antibody against vascular endothelial growth factor, on the angiogenesis and growth of canine osteosarcoma cells xenografted in mice. Animals-27 athymic nude mice. Procedures-To each mouse, highly metastasizing parent osteosarcoma cells of canine origin were injected into the left gastrocnemius muscle. Each mouse was then randomly allocated to 1 of 3 treatment groups: high-dose bevacizumab (4 mg/kg, IP), low-dose bevacizumab (2 mg/kg, IP), or control (no treatment). Tumor growth (the number of days required for the tumor to grow from 8 to 13 mm), vasculature, histomorphology, necrosis, and pulmonary metastasis were evaluated. Results-Mice in the high-dose bevacizumab group had significantly delayed tumor growth (mean ± SD, 13.4 ± 3.8 days; range, 9 to 21 days), compared with that for mice in the low-dose bevacizumab group (mean ± SD, 9.4 ± 1.5 days; range, 7 to 11 days) or control group (mean ± SD, 7. 2 ± 1.5 days; range, 4 to 9 days). Mice in the low-dose bevacizumab group also had significantly delayed tumor growth, compared with that for mice in the control group. Conclusions and Clinical Relevance-Results indicated that bevacizumab inhibited growth of canine osteosarcoma cells xenografted in mice, which suggested that vascular endothelial growth factor inhibitors may be clinically useful for the treatment of osteosarcoma in dogs. Impact for Human Medicine-Canine osteosarcoma is used as a research model for human osteosarcoma; therefore, bevacizumab may be clinically beneficial for the treatment of osteosarcoma in humans.

Feasibility For Measuring Transverse Area Ratios And Asymmetry Of Lumbosacral Region Paraspinal Muscles In Working Dogs Using Computed Tomography

Directory of Open Access Journals (Sweden)

Bethany eCain

2016-05-01

Full Text Available Objectives: Describe computed tomographic (CT anatomy of canine lumbosacral paraspinal muscles, a method for measuring paraspinal muscle transverse area ratios and asymmetry using CT, and application of this method in a small sample of working dogs with versus without lumbosacral pain.Methods: Published anatomy references and atlases were reviewed and discrepancies resolved by examination of anatomic specimens and multi-planar reformatted images to describe transverse CT anatomy of lumbosacral region paraspinal muscles. Sixteen Belgian malinois military working dogs were retrospectively recruited and assigned to lumbosacral pain positive versus negative groups based on medical record entries. A single observer unaware of dog group measured CT transverse areas of paraspinal muscles and adjacent vertebral bodies, in triplicate, for L5-S1 vertebral locations. A statistician compared muscle transverse area ratios and asymmetry at each vertebral location between groups. Results: The relative co-efficient of variation for triplicate CT area measurements averaged 2.15% (N=16. Multifidus lumborum (L6-7, psoas/iliopsoas (L5-6, L6-7, and sacrocaudalis dorsalis lateralis (L6-7, L7-S1 transverse area ratios were significantly smaller in dogs with lumbosacral pain (n=11 vs. without lumbosacral pain (n=5 (p< 0.05. Muscle asymmetry values were not significantly greater in dogs with vs. without lumbosacral pain. Clinical relevance: Computed tomographic morphometry of lumbosacral region paraspinal muscles is a feasible objective method for use in future evidence-based research studies in working dogs. Potential future research applications include determining whether decreased paraspinal muscle area ratios and/or increased paraspinal muscle asymmetry could be used as markers for preclinical lumbosacral pain in stoic dogs or risk factors for other injuries in high performance canine athletes; or determining whether core muscle strengthening exercise prescriptions

Reliability of mandibular canines as indicators for sexual dichotomy.

Science.gov (United States)

Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa

2013-02-01

Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.

Clinical Evaluation of Iliopsoas Strain with Findings from Diagnostic Musculoskeletal Ultrasound in Agility Performance Canines – 73 Cases

Directory of Open Access Journals (Sweden)

Robert Cullen

2017-06-01

Full Text Available Objective: Iliopsoas injury and strain is a commonly diagnosed disease process, especially amongst working and sporting canines. There has been very little published literature regarding iliopsoas injuries and there is no information regarding the ultrasound evaluation of abnormal iliopsoas muscles. This manuscript is intended to describe the ultrasound findings in 73 canine agility athletes who had physical examination findings consistent with iliopsoas discomfort. The population was chosen given the high incidence of these animals for the development of iliopsoas injury; likely due to repetitive stress.Methods: Medical records of 73 agility performance canines that underwent musculoskeletal ultrasound evaluation of bilateral iliopsoas muscle groups were retrospectively reviewed. Data included signalment, previous radiographic findings, and ultrasound findings. A 3-tier grading scheme for acute strains was used while the practitioner also evaluated for evidence of chronic injury and bursitis.Results: The majority of pathologies were localised to the tendon of insertion, with the majority being low grade I-II strains (80.8%. Tendon fibre disruption (71.2% and indistinct hypoechoic lesions (91.8% were the most common of acute changes noted. Hyperechoic chronic changes were noted in 84.9 percent of cases. Acute and chronic changes were commonly seen together (62.8%.Conclusion: Diagnostic musculoskeletal ultrasound was used to identify lesions of the iliopsoas tendon consistent with acute and chronic injury, as well as identifying the region of pathology. The majority of agility performance dogs had low grade acute strains based on the tiered system, with mixed acute and chronic lesions being noted frequently.Application: Diagnostic musculoskeletal ultrasound provides a non-invasive diagnostic modality for patients suspected of having an iliopsoas strain.

The Effect of Using a Modified Dentoalveolar Distractor on Canine Angulation following Rapid Canine Retraction: A Split-mouth Design Randomized Controlled Trial.

Science.gov (United States)

Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y

2016-01-01

New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.

Platelets Inhibit Migration of Canine Osteosarcoma Cells.

Science.gov (United States)

Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C

2017-01-01

The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.

9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...

Recombinant canine distemper virus serves as bivalent live vaccine against rabies and canine distemper.

Science.gov (United States)

Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao

2012-07-20

Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.

Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War

Science.gov (United States)

1981-06-05

anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges

Concomitant canine distemper, infectious canine hepatitis, canine parvoviral enteritis, canine infectious tracheobronchitis, and toxoplasmosis in a puppy.

Science.gov (United States)

Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes

2013-01-01

The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.

Canine Visceral Leishmaniasis in Wild Canines (Fox, Jackal, and Wolf in Northeastern Iran Using Parasitological, Serological, and Molecular Methods

Directory of Open Access Journals (Sweden)

Mehdi Mohebali

2016-10-01

Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.

Dynamic Penile Corpora Cavernosa Reconstruction Using Bilateral Innervated Gracilis Muscles: A Preclinical Investigation.

Science.gov (United States)

Yin, Zhuming; Liu, Liqiang; Xue, Bingjian; Fan, Jincai; Chen, Wenlin; Liu, Zheng

2018-03-07

Prosthesis-assisted penile reconstruction has been performed extensively to restore a cosmetically acceptable phallus. However, a large number of patients will undergo revision surgery for various prosthesis-related complications. To develop a 1-stage prosthesis-free dynamic cavernosa reconstruction method using bilateral innervated gracilis muscles and to investigate the feasibility and reliability of the surgical design. 10 fresh cadavers were dissected to assess the availability of bilateral gracilis muscles for functional cavernosa rebuilding. 11 mongrel female dogs were involved in the penile reconstruction surgery. The neophallus consisted of bilateral gracilis muscles as the neo-cavernosa, a right gracilis skin flap as the neourethra, and a lower abdominal flap with an anterior rectus sheath as the skin envelope and neo-tunica albuginea. The function and structure of the neo-phalli were assessed 7 months postoperatively. The neurovascular pedicle length of the gracilis muscles and the volume of the gracilis venter musculi were measured in the cadaveric investigation. The average dimensions of the canine neo-phalli at rest and during electrostimulated erection were obtained and the muscular fatigue-resistant curve was drawn. Histologic evaluations also were performed. The neurovascular pedicle length and volume of the gracilis muscles were sufficient to yield a nearly normal appearance of the neo-cavernosa in the cadaveric and animal studies. The muscular fatigue-resistant curve demonstrated adequate length, stiffness, and duration of erection of the neo-phalli to accomplish normal coitus. Histologic evaluations showed an intact neourethra and nearly normal muscle structure in the inner layer of the canine neo-cavernosa, except for significantly increased amount of collagen fibers and type I/III collagen ratio in the outer layer of the neo-cavernosa. The percentage of type II (fatigue-prone) muscle fibers did not change significantly. Our preclinical

3D Modelling and monitoring of denervated muscle under Functional Electrical Stimulation treatment and associated bone structural changes

Directory of Open Access Journals (Sweden)

Paolo Gargiulo

2011-03-01

Full Text Available A novel clinical rehabilitation method for patients who have permanent and non recoverable muscle denervation in the legs was developed in the frame of the European Project RISE. The technique is based on FES and the project results shows, in these severely disabled patients, restoration of muscle tissue and function. This study propose novel methods based on image processing technique and medical modelling to monitor growth in denervated muscle treated with FES. Geometrical and structural changes in muscle and bone are studied and modelled. Secondary effects on the bone mineral density produced by the stimulation treatment and due the elicited muscle contraction are also investigated. The restoration process in DDM is an important object of discussion since there isn’t yet a complete understanding of the mechanisms regulating growth in denervated muscle. This study approaches the problem from a macroscopic point of view, developing 3-dimensional models of the whole stimulated muscles and following changes in volume, geometry and density very accurately. The method is based on the acquisition of high resolution Spiral CT scans from patients who have long-term flaccid paraplegia and the use of special image processing tools allowing tissue discriminations and muscle segmentation. Three patients were measured at different points of time during 4 years of electrical stimulation treatment. In this study is quantitatively demonstrated the influences of FES treatment on the different quadriceps bellies. The rectus femoris muscle is positioned in the middle of the quadriceps and responds (in general better to stimulation. In a patient with abundant adipose tissue surrounding the quadriceps, rectus femoris almost doubled the volume during the FES treatment while in the other bellies the changes measured were minimal. The analysis of the density shows clearly a restoration of the muscular structure in the growing muscle. The remarkable increase of

Clinical and Statistical Study on Canine Impaction

Directory of Open Access Journals (Sweden)

Adina-Simona Coșarcă

2013-08-01

Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic

Serum Starvation-Induced Voltage-Gated Potassium Channel Kv7.5 Expression and Its Regulation by Sp1 in Canine Osteosarcoma Cells

Directory of Open Access Journals (Sweden)

Bo Hyung Lee

2014-01-01

Full Text Available The KCNQ gene family, whose members encode Kv7 channels, belongs to the voltage-gated potassium (Kv channel group. The roles of this gene family have been widely investigated in nerve and muscle cells. In the present study, we investigated several characteristics of Kv7.5, which is strongly expressed in the canine osteosarcoma cell line, CCL-183. Serum starvation upregulated Kv7.5 expression, and the Kv7 channel opener, flupirtine, attenuated cell proliferation by arresting cells in the G0/G1 phase. We also showed that Kv7.5 knockdown helps CCL-183 cells to proliferate. In an effort to find an endogenous regulator of Kv7.5, we used mithramycin A to reduce the level of the transcription factor Sp1, and it strongly inhibited the induction of Kv7.5 in CCL-183 cells. These results suggest that the activation of Kv7.5 by flupirtine may exert an anti-proliferative effect in canine osteosarcoma. Therefore, Kv7.5 is a possible molecular target for canine osteosarcoma therapy.

Podoplanin Expression in Canine Melanoma.

Science.gov (United States)

Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

2016-12-01

A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.

Brain and muscle oxygenation monitoring using near-infrared spectroscopy (NIRS) during all-night sleep

Science.gov (United States)

Zhang, Zhongxing; Khatami, Ramin

2013-03-01

The hemodynamic changes during natural human sleep are still not well understood. NIRS is ideally suited for monitoring the hemodynamic changes during sleep due to the properties of local measurement, totally safe application and good tolerance to motion. Several studies have been conducted using NIRS in both normal subjects and patients with various sleep disorders during sleep to characterize the hemodynamic changing patterns during different sleep stages and during different symptoms such as obstructive apneas. Here we assessed brain and muscle oxygenation changes in 7 healthy adults during all-night sleep with combined polysomnography measurement to test the notion if hemodynamic changes in sleep are indeed brain specific. We found that muscle and brain showed similar hemodynamic changes during sleep initiation. A decrease in HbO2 and tissue oxygenation index (TOI) while an increase in HHb was observed immediately after sleep onset, and an opposite trend was found after transition with progression to deeper slow-wave sleep (SWS) stage. Spontaneous low frequency oscillations (LFO) and very low frequency oscillations (VLFO) were smaller (Levene's test, psleep (LS) and rapid-eye-movement (REM) sleep in both brain and muscle. Spectral analysis of the NIRS signals measured from brain and muscle also showed reductions in VLFO and LFO powers during SWS with respect to LS and REM sleep. These results indicate a systemic attenuation rather than local cerebral reduction of spontaneous hemodynamic activity in SWS. A systemic physiological mechanism may exist to regulate the hemodynamic changes in brain and muscle during sleep.

A computerized MRI biomarker quantification scheme for a canine model of Duchenne muscular dystrophy.

Science.gov (United States)

Wang, Jiahui; Fan, Zheng; Vandenborne, Krista; Walter, Glenn; Shiloh-Malawsky, Yael; An, Hongyu; Kornegay, Joe N; Styner, Martin A

2013-09-01

Golden retriever muscular dystrophy (GRMD) is a widely used canine model of Duchenne muscular dystrophy (DMD). Recent studies have shown that magnetic resonance imaging (MRI) can be used to non-invasively detect consistent changes in both DMD and GRMD. In this paper, we propose a semiautomated system to quantify MRI biomarkers of GRMD. Our system was applied to a database of 45 MRI scans from 8 normal and 10 GRMD dogs in a longitudinal natural history study. We first segmented six proximal pelvic limb muscles using a semiautomated full muscle segmentation method. We then performed preprocessing, including intensity inhomogeneity correction, spatial registration of different image sequences, intensity calibration of T2-weighted and T2-weighted fat-suppressed images, and calculation of MRI biomarker maps. Finally, for each of the segmented muscles, we automatically measured MRI biomarkers of muscle volume, intensity statistics over MRI biomarker maps, and statistical image texture features. The muscle volume and the mean intensities in T2 value, fat, and water maps showed group differences between normal and GRMD dogs. For the statistical texture biomarkers, both the histogram and run-length matrix features showed obvious group differences between normal and GRMD dogs. The full muscle segmentation showed significantly less error and variability in the proposed biomarkers when compared to the standard, limited muscle range segmentation. The experimental results demonstrated that this quantification tool could reliably quantify MRI biomarkers in GRMD dogs, suggesting that it would also be useful for quantifying disease progression and measuring therapeutic effect in DMD patients.

European canine lymphoma network consensus recommendations for reporting flow cytometry in canine hematopoietic neoplasms.

Science.gov (United States)

Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W

2017-09-01

Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.

Vaccines for canine leishmaniasis

Directory of Open Access Journals (Sweden)

Clarisa B. Palatnik-De-Sousa

2012-04-01

Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans

Canine adenovirus type 1 in a fennec fox (Vulpes zerda).

Science.gov (United States)

Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku

2014-12-01

A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.

MicroRNAs as tumour suppressors in canine and human melanoma cells and as a prognostic factor in canine melanomas.

Science.gov (United States)

Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y

2013-06-01

Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.

Ambulatory diffuse optical tomography and multimodality physiological monitoring system for muscle and exercise applications

Science.gov (United States)

Hu, Gang; Zhang, Quan; Ivkovic, Vladimir; Strangman, Gary E.

2016-09-01

Ambulatory diffuse optical tomography (aDOT) is based on near-infrared spectroscopy (NIRS) and enables three-dimensional imaging of regional hemodynamics and oxygen consumption during a person's normal activities. Although NIRS has been previously used for muscle assessment, it has been notably limited in terms of the number of channels measured, the extent to which subjects can be ambulatory, and/or the ability to simultaneously acquire synchronized auxiliary data such as electromyography (EMG) or electrocardiography (ECG). We describe the development of a prototype aDOT system, called NINscan-M, capable of ambulatory tomographic imaging as well as simultaneous auxiliary multimodal physiological monitoring. Powered by four AA size batteries and weighing 577 g, the NINscan-M prototype can synchronously record 64-channel NIRS imaging data, eight channels of EMG, ECG, or other analog signals, plus force, acceleration, rotation, and temperature for 24+ h at up to 250 Hz. We describe the system's design, characterization, and performance characteristics. We also describe examples of isometric, cycle ergometer, and free-running ambulatory exercise to demonstrate tomographic imaging at 25 Hz. NINscan-M represents a multiuse tool for muscle physiology studies as well as clinical muscle assessment.

Countercurrent exchange of water in canine jejunum

International Nuclear Information System (INIS)

Ryu, K.H.; Grim, E.

1985-01-01

The possibility of countercurrent exchange of water molecules in canine intestinal villi has been examined. Tritium-labeled water ( 3 H 2 O) molecules were introduced either into the fluid lavaging the intestinal lumen or into the arterial blood supply for varying periods of time. Quickly frozen samples of intestinal tissue were sectioned such that isotopic concentrations at the villus tip, midvillus, villus base, and underlying submucosa and muscle could be determined. The villus concentration gradients observed were consistent with the existence of a countercurrent exchange but could also be explained by alternative arrangements. More convincing evidence of a countercurrent was obtained from experiments in which [ 14 C]inulin was introduced simultaneously with 3 H 2 O into the intestinal artery. The villus tip-to-base concentration ratio for 3 H 2 O was less than one while the ratio for inulin was greater than one, thus vitiating the alternative explanations and leading to the conclusion that the labeled water molecules must have undergone a countercurrent exchange

Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review

Directory of Open Access Journals (Sweden)

Parviz Torkzaban

2016-09-01

Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.

9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).

Science.gov (United States)

2010-01-01

... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...

New developments in canine hepatozoonosis in North America: a review

Science.gov (United States)

Little, Susan E; Allen, Kelly E; Johnson, Eileen M; Panciera, Roger J; Reichard, Mason V; Ewing, Sidney A

2009-01-01

Canine hepatozoonosis is caused by Hepatozoon canis and Hepatozoon americanum, apicomplexan parasites transmitted to dogs by ingestion of infectious stages. Although the two agents are phylogenetically related, specific aspects, including characteristics of clinical disease and the natural history of the parasites themselves, differ between the two species. Until recently, H. canis infections had not been clearly documented in North America, and autochthonous infection with H. americanum has yet to be reported outside of the southern United States. However, recent reports demonstrate H. canis is present in areas of North America where its vector tick, Rhipicephalus sanguineus, has long been endemic, and that the range of H. americanum is likely expanding along with that of its vector tick, Amblyomma maculatum; co-infections with the two organisms have also been identified. Significant intraspecific variation has been reported in the 18S rRNA gene sequence of both Hepatozoon spp.-infecting dogs, suggesting that each species may represent a complex of related genogroups rather than well-defined species. Transmission of H. americanum to dogs via ingestion of cystozoites in muscle of infected vertebrates was recently demonstrated, supporting the concept of predation as a means of natural transmission. Although several exciting advances have occurred in recent years, much remains to be learned about patterns of infection and the nature of clinical disease caused by the agents of canine hepatozoonosis in North America. PMID:19426444

Orthodontic Traction of Impacted Canine Using Cantilever

Directory of Open Access Journals (Sweden)

Cláudia Nakandakari

2016-01-01

Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.

Transmigration of mandibular canine – case report

International Nuclear Information System (INIS)

Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia

2014-01-01

Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation

Canine Parvovirus: Current Perspective

OpenAIRE

Nandi, S.; Kumar, Manoj

2010-01-01

Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...

Hepatozoonose canina: achados clínico-epidemiológicos em três casos Canine hepatozoonosis: clinic-epidemiological data in three cases

Directory of Open Access Journals (Sweden)

D.M. Aguiar

2004-06-01

Full Text Available Clinic-epidemiological data in canine infection by Hepatozoon canis were reported. Apatia, anorexia, prostaction, weight loss and muscle pain were the most-common clinical recognized signs. Blood smear was used as diagnosis method for the detection of H. canis gamonts in the neutrophils. Anaemia, leucocytosis, monocytosis and lymphopenia were observed in the haematological exams. Imidocarb dipropionate associated with tetracyclines and sulfamethoxasole-trimethoprim were used in therapy.

Evaluation of P16 expression in canine appendicular osteosarcoma.

Science.gov (United States)

Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K

2017-06-20

Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.

Cone beam computed tomography findings of impacted upper canines

Energy Technology Data Exchange (ETDEWEB)

Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)

2014-12-15

To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

Cone beam computed tomography findings of impacted upper canines

International Nuclear Information System (INIS)

Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio

2014-01-01

To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

Typing of Canine Parvovirus Strains Circulating in North-East China.

Science.gov (United States)

Zhao, H; Wang, J; Jiang, Y; Cheng, Y; Lin, P; Zhu, H; Han, G; Yi, L; Zhang, S; Guo, L; Cheng, S

2017-04-01

Canine parvovirus (CPV) is highly contagious and is a major cause of haemorrhagic enteritis and myocarditis in dogs. We investigated the genetic variation of emerging CPV strains by sequencing 64 CPV VP2 genes from 216 clinical samples of dogs from Heilongjiang, Jilin, Liaoning, Shandong and Hebei in 2014. Genetic analysis revealed that CPV-2b was predominant in Hebei and CPV-2a was predominant in the other four provinces. In addition, a CPV-2c strain has emerged in Shandong province. All samples had a Ser-Ala substitution at residue 297 and an Ile-Arg substitution at residue 324. Interestingly, in five separate canine samples, we found a mutation of Gln370 to Arg, until now detected only in isolates from pandas. The phylogenetic analysis showed clear distinctions between epidemic isolates and vaccine strains and between Chinese CPV-2c strains and CPV-2c strains found in other countries. Monitoring recent incidence of CPV strains enables evaluation and implementation of disease control strategies. © 2015 Blackwell Verlag GmbH.

Physiological effects of stress related to helicopter travel in Federal Emergency Management Agency search-and-rescue canines.

Science.gov (United States)

Perry, E; Gulson, N; Liu Cross, T-W; Swanson, K S

2017-01-01

Working canines are deployed by the Federal Emergency Management Agency (FEMA), as part of a National Disaster Response Plan. Stress associated with helicopter flight and the resulting physical effects on the dog are unknown. Our objective was to test the hypotheses that (1) helicopter travel affects the physiology and faecal microbiota of working canines, but that (2) physiological consequences of helicopter travel will not negatively affect their work performance. A total of nine FEMA canines were loaded onto helicopters and flown for 30 min in July 2015. Rectal temperature, behavioural stress indicators and saliva swabs (for cortisol) were collected at baseline, loading, mid-flight and post-flight. After flight, canines completed a standardised search exercise to monitor work performance. Faecal samples were collected for microbial DNA extraction and Illumina sequencing. All canines were on a standardised diet (CANIDAE ® Grain Free PURE Land ® ) for 3 weeks prior to the study. Visible indicators of stress were observed at loading and at mid-flight and corresponded with an increase ( P  travel did not affect search performance ( P  > 0·05). We found that α- and β-diversity measures of faecal microbiota were not affected ( P  > 0·05). Our data suggest that although helicopter travel may cause physiological changes that have been associated with stress in working dogs, it does not make an impact on their search performance or the stability of faecal microbiota.

Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.

Science.gov (United States)

Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano

2004-10-01

This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.

Skeletal maturity assessment using mandibular canine calcification stages

Directory of Open Access Journals (Sweden)

Vildana Džemidžić

2016-11-01

Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.

A new method for rapid Canine retraction

Directory of Open Access Journals (Sweden)

"Khavari A

2001-06-01

Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.

Orthotopic model of canine osteosarcoma in athymic rats for evaluation of stereotactic radiotherapy.

Science.gov (United States)

Schwartz, Anthony L; Custis, James T; Harmon, Joseph F; Powers, Barbara E; Chubb, Laura S; LaRue, Susan M; Ehrhart, Nicole P; Ryan, Stewart D

2013-03-01

To develop an orthotopic model of canine osteosarcoma in athymic rats as a model for evaluating the effects of stereotactic radiotherapy (SRT) on osteosarcoma cells. 26 athymic nude rats. 3 experiments were performed. In the first 2 experiments, rats were injected with 1 × 10(6) Abrams canine osteosarcoma cells into the proximal aspect of the tibia (n = 12) or distal aspect of the femur (6). Tumor engraftment and progression were monitored weekly via radiography, luciferase imaging, and measurement of urine pyridinoline concentration for 5 weeks and histologic evaluation after euthanasia. In the third experiment, 8 rats underwent canine osteosarcoma cell injection into the distal aspect of the femur and SRT was administered to the affected area in three 12-Gy fractions delivered on consecutive days (total radiation dose, 36 Gy). Percentage tumor necrosis and urinary pyridinoline concentrations were used to assess local tumor control. The short-term effect of SRT on skin was also evaluated. Tumors developed in 10 of 12 tibial sites and all 14 femoral sites. Administration of SRT to rats with femoral osteosarcoma was feasible and successful. Mean tumor necrosis of 95% was achieved histologically, and minimal adverse skin effects were observed. The orthotopic model of canine osteosarcoma in rats developed in this study was suitable for evaluating the effects of local tumor control and can be used in future studies to evaluate optimization of SRT duration, dose, and fractionation schemes. The model could also allow evaluation of other treatments in combination with SRT, such as chemotherapy or bisphosphonate, radioprotectant, or parathyroid hormone treatment.

Behavioral and locomotor measurements using an open field activity monitoring system for skeletal muscle diseases.

Science.gov (United States)

Tatem, Kathleen S; Quinn, James L; Phadke, Aditi; Yu, Qing; Gordish-Dressman, Heather; Nagaraju, Kanneboyina

2014-09-29

The open field activity monitoring system comprehensively assesses locomotor and behavioral activity levels of mice. It is a useful tool for assessing locomotive impairment in animal models of neuromuscular disease and efficacy of therapeutic drugs that may improve locomotion and/or muscle function. The open field activity measurement provides a different measure than muscle strength, which is commonly assessed by grip strength measurements. It can also show how drugs may affect other body systems as well when used with additional outcome measures. In addition, measures such as total distance traveled mirror the 6 min walk test, a clinical trial outcome measure. However, open field activity monitoring is also associated with significant challenges: Open field activity measurements vary according to animal strain, age, sex, and circadian rhythm. In addition, room temperature, humidity, lighting, noise, and even odor can affect assessment outcomes. Overall, this manuscript provides a well-tested and standardized open field activity SOP for preclinical trials in animal models of neuromuscular diseases. We provide a discussion of important considerations, typical results, data analysis, and detail the strengths and weaknesses of open field testing. In addition, we provide recommendations for optimal study design when using open field activity in a preclinical trial.

Simultaneous canine distemper encephalitis and canine parvovirus infection with distemper-associated cardiac necrosis in a pup

OpenAIRE

Headley,Selwyn Arlington; Saito,Taís Berelli

2003-01-01

Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...

Novel canine circovirus strains from Thailand: Evidence for genetic recombination.

Science.gov (United States)

Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E

2018-05-14

Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.

Smooth muscle adaptation after intestinal transection and resection.

Science.gov (United States)

Thompson, J S; Quigley, E M; Adrian, T E

1996-09-01

Changes in motor function occur in the intestinal remnant after intestinal resection. Smooth muscle adaptation also occurs, particularly after extensive resection. The time course of these changes and their interrelationship are unclear. Our aim was to evaluate changes in canine smooth muscle structure and function during intestinal adaptation after transection and resection. Twenty-five dogs underwent either transection (N = 10), 50% distal resection (N = 10), or 50% proximal resection (N = 5). Thickness and length of the circular (CM) and longitudinal (LM) muscle layers were measured four and 12 weeks after resection. In vitro length-tension properties and response to a cholinergic agonist were studied in mid-jejunum and mid-ileum. Transection alone caused increased CM length in the jejunum proximal to the transection but did not affect LM length or muscle thickness. A 50% resection resulted in increased length of CM throughout the intestine and thickening of CM and LM near the anastomosis. Active tension of jejunal CM increased transiently four weeks after resection. Active tension in jejunal LM was decreased 12 weeks after transection and resection. Sensitivity of CM to carbachol was similar after transection and resection. It is concluded that: (1) Structural adaptation of both circular and longitudinal muscle occurs after intestinal resection. (2) This process is influenced by the site of the intestinal remnant. (3) Only minor and transient changes occur in smooth muscle function after resection. (4) Factors other than muscle adaptation are likely involved in the changes in motor function seen following massive bowel resection.

Podoplanin Expression in Canine Melanoma

OpenAIRE

Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

2016-01-01

A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...

Finite element analysis of rapid canine retraction through reducing resistance and distraction

Directory of Open Access Journals (Sweden)

Junjie XUE

2014-01-01

Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.

Canine scent detection of canine cancer: a feasibility study

Directory of Open Access Journals (Sweden)

Dorman DC

2017-10-01

Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of

Pan-nitinol occluder and special delivery device for closure of patent ductus arteriosus: a canine-model feasibility study.

Science.gov (United States)

Jiang, Hai-bin; Bai, Yuan; Zong, Gang-jun; Han, Lin; Li, Wei-ping; Lu, Yang; Qin, Yong-wen; Zhao, Xian-xian

2013-01-01

The aim of this study was to evaluate a new type of occluder for patent ductus arteriosus. Patent ductus arteriosus was established in a canine model by anastomosing a length of autologous jugular vein to the descending aorta and the left pulmonary artery in an end-to-side fashion. Transcatheter closure of each patent ductus arteriosus was performed on 10 dogs, which were then monitored for as long as 6 months with aortography, echocardiography, and histologic evaluation. Transcatheter closure with use of the novel pan-nitinol device was successful in all canine models. Postoperative echocardiography showed that the location and shape of the occluders were normal, without any residual shunting. Further histologic evaluation confirmed that the occluder surface was completely endothelialized 3 months after implantation. Transcatheter patent ductus arteriosus closure with the pan-nitinol occluder can be performed safely and successfully in a canine model and shows good biological compatibility and low mortality rates.

Comparative trial of the canine parvovirus, canine distemper virus and canine adenovirus type 2 fractions of two commercially available modified live vaccines.

Science.gov (United States)

Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G

2006-11-25

The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.

Homogeneous Canine Chest Phantom Construction: A Tool for Image Quality Optimization.

Directory of Open Access Journals (Sweden)

Ana Luiza Menegatti Pavan

Full Text Available Digital radiographic imaging is increasing in veterinary practice. The use of radiation demands responsibility to maintain high image quality. Low doses are necessary because workers are requested to restrain the animal. Optimizing digital systems is necessary to avoid unnecessary exposure, causing the phenomenon known as dose creep. Homogeneous phantoms are widely used to optimize image quality and dose. We developed an automatic computational methodology to classify and quantify tissues (i.e., lung tissue, adipose tissue, muscle tissue, and bone in canine chest computed tomography exams. The thickness of each tissue was converted to simulator materials (i.e., Lucite, aluminum, and air. Dogs were separated into groups of 20 animals each according to weight. Mean weights were 6.5 ± 2.0 kg, 15.0 ± 5.0 kg, 32.0 ± 5.5 kg, and 50.0 ± 12.0 kg, for the small, medium, large, and giant groups, respectively. The one-way analysis of variance revealed significant differences in all simulator material thicknesses (p < 0.05 quantified between groups. As a result, four phantoms were constructed for dorsoventral and lateral views. In conclusion, the present methodology allows the development of phantoms of the canine chest and possibly other body regions and/or animals. The proposed phantom is a practical tool that may be employed in future work to optimize veterinary X-ray procedures.

Concentrations of elements in fish fillets, fish muscle plugs, and crayfish from the 2007 Missouri Department of Conservation General Contaminant Monitoring Program

Science.gov (United States)

May, Thomas W.; Walther, Michael J.; Brumbaugh, William G.; McKee, Michael J.

2009-01-01

This report presents the results of a contaminant monitoring survey conducted annually by the Missouri Department of Conservation to examine the levels of selected elemental contaminants in fish fillets, fish muscle plugs, and crayfish. Fillets of channel catfish (Ictalurus punctatus), bass (Micropterus salmoides, Micropterus dolomieu, Morone chrysops), walleye (Sander vitreus), common carp (Cyprinus carpio), lake sturgeon (Acipenser fulvescens), northern hog sucker (Hypentelium nigricans), and rainbow trout (Oncorhynchus mykiss) were collected from 21 sites as part of the Department's Fish Contaminant Monitoring Program. Long-pincered crayfish (Orconectes longidigitus) were collected from one site to assess trophic transfer of metals to fish. Fish muscle plugs were collected from smallmouth bass (Micropterus dolomieu) at two different locations from one site.

Bioimpedance system for monitoring muscle and cardiovascular activity in the stump of lower-limb amputees

International Nuclear Information System (INIS)

Hornero, G; Díaz, D; Casas, O

2013-01-01

A bioimpedance system for the continuous measurement of non-invasive physiological parameters in lower-limb amputees is presented. The aim of the system is to monitor as many physiological parameters as possible from a single bioimpedance electrode configuration. In this way, a simple, low-cost and low-size autonomous system is developed that is able to continuously monitor the amputee in different environments (home, work, etc). The system measures both electrical impedance myography and electrical impedance plethysmography in the stump with electrodes placed in the inside face of a silicone interface. Such a system allows for the monitoring of a patient's muscle activity, and heart and breath rate, thus enabling the study and continuous monitoring of prosthesis adaptation and improvement of patient's gait to reduce physiological stress. Additionally, it can prevent cardiovascular problems due to the effort involved in the use of prostheses, which can decrease the life expectancy of amputees with previous vascular diseases. Experimental results obtained from different amputees' test validate the purpose of the system. (paper)

Evaluation of the efficacy and duration of immunity of a canine combination vaccine against virulent parvovirus, infectious canine hepatitis virus, and distemper virus experimental challenges.

Science.gov (United States)

Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald

2004-01-01

The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.

Relaxation of soman-induced contracture of airway smooth muscle in vitro. (Reannouncement with new availability information)

Energy Technology Data Exchange (ETDEWEB)

Filbert, M.G.; Moore, D.H.; Adler, M.

1992-12-31

A possible role for beta-adrenergic agonists in the management of bronchoconstriction resulting from exposure to anticholinesterase compounds was investigated in vitro in canine tracheal smooth muscle. Norepinephrine, salbutamol and isoproterenol produced partial relaxation of soman-induced contractures. However, the relaxation induced was not sustained; muscle tensions returned to pretreatment levels within minutes despite the continued presence of beta-agonists. Increasing cAMP levels with the non beta-agonist bronchodilators such as thoophylline, a phosphodiesterase inhibitor, or forskolin, a specific stimulator of adenylate cyclase, resulted in more complete and longer lasting relaxation, suggesting that beta-adrenoceptor desensitization may contribute to the failure by beta-agonists to produce sustained relaxation. Nerve agents, Soman, Toxicity, Airway smooth muscle, In vitro, Physiology, Effects.

Quantitative muscle MRI as an assessment tool for monitoring disease progression in LGMD2I: a multicentre longitudinal study.

Directory of Open Access Journals (Sweden)

Tracey A Willis

Full Text Available Outcome measures for clinical trials in neuromuscular diseases are typically based on physical assessments which are dependent on patient effort, combine the effort of different muscle groups, and may not be sensitive to progression over short trial periods in slow-progressing diseases. We hypothesised that quantitative fat imaging by MRI (Dixon technique could provide more discriminating quantitative, patient-independent measurements of the progress of muscle fat replacement within individual muscle groups.To determine whether quantitative fat imaging could measure disease progression in a cohort of limb-girdle muscular dystrophy 2I (LGMD2I patients over a 12 month period.32 adult patients (17 male;15 female from 4 European tertiary referral centres with the homozygous c.826C>A mutation in the fukutin-related protein gene (FKRP completed baseline and follow up measurements 12 months later. Quantitative fat imaging was performed and muscle fat fraction change was compared with (i muscle strength and function assessed using standardized physical tests and (ii standard T1-weighted MRI graded on a 6 point scale.There was a significant increase in muscle fat fraction in 9 of the 14 muscles analyzed using the quantitative MRI technique from baseline to 12 months follow up. Changes were not seen in the conventional longitudinal physical assessments or in qualitative scoring of the T₁w images.Quantitative muscle MRI, using the Dixon technique, could be used as an important longitudinal outcome measure to assess muscle pathology and monitor therapeutic efficacy in patients with LGMD2I.

A rare case of canine anomaly - a possible algorithm for treating it.

Science.gov (United States)

Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore

2014-01-01

Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.

Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.

Science.gov (United States)

Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong

2017-06-01

Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.

Immunohistochemical Characterization of Canine Lymphomas

Directory of Open Access Journals (Sweden)

Roxana CORA

2017-11-01

Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.

Stem Cell-Associated Marker Expression in Canine Hair Follicles.

Science.gov (United States)

Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J

2016-03-01

Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.

Chlamydia in canine or feline coronary arteriosclerotic lesions

Directory of Open Access Journals (Sweden)

Grabarevic Zeljko

2011-09-01

Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.

Chlamydia in canine or feline coronary arteriosclerotic lesions.

Science.gov (United States)

Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas

2011-09-09

There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.

A novel bocavirus in canine liver

Directory of Open Access Journals (Sweden)

Li Linlin

2013-02-01

Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.

Genomic instability and telomere fusion of canine osteosarcoma cells.

Directory of Open Access Journals (Sweden)

Junko Maeda

Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.

Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.

Science.gov (United States)

Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H

2016-06-01

Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.

Canine index – A tool for sex determination

Directory of Open Access Journals (Sweden)

Shankar M. Bakkannavar

2015-12-01

Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.

Experiments with a homologous, inactivated canine parvovirus vaccine in vaccination programmers for dogs.

Science.gov (United States)

Wilson, J H; Hermann-Dekkers, W M

1982-01-01

The significance of canine parvovirus (CPV) infections as a permanent threat susceptible dogs, in particular pups, made the authors develop three liquid homologous inactivated adjuvant CPV vaccines that were compatible with existing canine vaccines and could be incorporated in current vaccination programmes. On vaccine (Kavak Parvo) contained only the CPV component, the second product (Kavak i-LP) also contained two inactivated leptospiral antigens, and the third vaccine (Kavak i-HLP) contained in addition an inactivated canine hepatitis virus. This paper reports on the studies conducted to test the safety and efficacy of the three products. They were used as such and as diluents for freeze dried vaccines containing live attenuated measles, distemper, and hepatitis viruses. The study was performed in a breeding kennel where all dogs were free from CPV antibodies and the nonvaccinated sentinels remained so for the course of the study. All vaccines proved to be safe in dogs of all ages, including pregnant bitches. The efficacy of the CPV component was studied both by monitoring antibody titres for more than a year and by challenge exposure of some dogs to virulent CPV. The results obtained from these studies prove that the CPV component used in the three vaccines can be incorporated as indicated in the recommended canine vaccination programmes. The observations that the inactivated CPV and hepatitis components do induce an active immunity in pups that are still protected by low levels of maternally derived antibodies against these viruses, make those vaccines very suitable in breeding kennels. Additional studies on a comparative basis are being continued in edemically CPV infected breeding kennels to quantify the significance of these observations in these special conditions.

Rate of retraction of anterior teeth after canine distraction

Directory of Open Access Journals (Sweden)

Litesh Singla

2017-01-01

Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.

Cryoplasty for Canine Iliac Artery Stenosis and its Impact on Expression of TIMP-2 and MMP-2.

Science.gov (United States)

Wu, Zhengzhong; Zang, Shengbing; Liu, Wenwen; Jiang, Na; Yang, Weizhu

2015-01-01

This study was performed to observe the effects of cryoplasty on canine iliac artery stenosis and the expression of tissue inhibition of matrix metalloproteinase 2 (TIMP-2) and matrix metalloproteinase 2 (MMP-2). We produced a reliable canine model to mimic the atherosclerotic stenosis in the iliac artery by suturing the artery followed by vessel ligation to create an injury to intimal and medial walls. Sixteen mongrel dogs with iliac artery stenosis were randomized to conventional balloon angioplasty (n = 8) or cryoplasty (n = 8). Four weeks posttreatment, the cryoplasty group with less collagen fibers and smooth muscle demonstrated significantly larger luminal diameter of iliac artery compared to the balloon angioplasty group (P < .001). Expression of TIMP-2 significantly increased and expression of MMP-2 significantly reduced in iliac artery of the cryoplasty group compared to conventional balloon angioplasty. Our study suggests cryoplasty might increase the expression of TIMP-2 and decrease the expression of MMP-2, thereby inhibiting vascular hyperplasia and collagen fibers synthesis of the stenotic vessels. © The Author(s) 2015.

Canine degenerative myelopathy: a model of human amyotrophic lateral sclerosis.

Science.gov (United States)

Nardone, Raffaele; Höller, Yvonne; Taylor, Alexandra C; Lochner, Piergiorgio; Tezzon, Frediano; Golaszewski, Stefan; Brigo, Francesco; Trinka, Eugen

2016-02-01

Canine degenerative myelopathy (CDM) represents a unique naturally occurring animal model for human amyotrophic lateral sclerosis (ALS) because of similar clinical signs, neuropathologic findings, and involvement of the superoxide dismutase 1 (SOD1) mutation. A definitive diagnosis can only be made postmortem through microscopic detection of axonal degeneration, demyelination and astroglial proliferation, which is more severe in the dorsal columns of the thoracic spinal cord and in the dorsal portion of the lateral funiculus. Interestingly, the muscle acetylcholine receptor complexes are intact in CDM prior to functional impairment, thus suggesting that muscle atrophy in CDM does not result from physical denervation. Moreover, since sensory involvement seems to play an important role in CDM progression, a more careful investigation of the sensory pathology in ALS is also warranted. The importance of SOD1 expression remains unclear, while oxidative stress and denatured ubiquinated proteins appear to play a crucial role in the pathogenesis of CDM. In this updated narrative review we performed a systematic search of the published studies on CDM that may shed light on the pathophysiological mechanisms of human ALS. A better understanding of the factors that determine the disease progression in CDM may be beneficial for the development of effective treatments for ALS. Copyright © 2015 Elsevier GmbH. All rights reserved.

Canine tooth size and fitness in male mandrills (Mandrillus sphinx).

Science.gov (United States)

Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean

2008-07-01

Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.

Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature

Directory of Open Access Journals (Sweden)

Gaurav Sharma

2011-01-01

Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.

Asymmetry in development (mineralisation of permanent mandibular canine roots

Directory of Open Access Journals (Sweden)

Burić Mirjana V.

2012-01-01

Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.

Simulated laparoscopy using a head-mounted display vs traditional video monitor: an assessment of performance and muscle fatigue.

Science.gov (United States)

Maithel, S K; Villegas, L; Stylopoulos, N; Dawson, S; Jones, D B

2005-03-01

The direction of visual gaze may be an important ergonomic factor that affects operative performance. We designed a study to determine whether a head-mounted display (HMD) worn by the surgeon would improve task performance and/or reduce muscle fatigue during a laparoscopic task when compared to the use of a traditional video monitor display (VMD). Surgical residents (n = 30) were enrolled in the study. A junior group, consisting of 15 postgraduate year (PGY) = 1 subjects with no previous laparoscopic experience, and a senior group, consisting of 15 PGY 4 and PGY 5 subjects with experience, completed a laparoscopic task that was repeated four times using the Computer Enhanced Laparoscopic Training System (CELTS). Groups alternated between using the HMD with the task placed in a downward frontal position and the VMD with the task at a 30 degrees lateral angle. The CELTS module assessed task completion time, depth perception, path length of instruments, response orientation, motion smoothness; the system then generated an overall score. Electromyography (EMG) was used to record sternocleidomastoid muscle activity. Display preference was surveyed. The senior residents performed better than the junior residents overall on all parameters (p < 0.05) except for motion smoothness, where there was no difference. In both groups, the HMD significantly improved motion smoothness when compared to the VMD (p < 0.05). All other parameters were equal. There was less muscle fatigue when using the VMD (p < 0.05). We found that 66% of the junior residents but only 20% of the senior residents preferred the HMD. The CELTS module demonstrated evidence of construct validity by differentiating the performances of junior and senior residents. By aligning the surgeon's visual gaze with the instruments, HMD improved smoothness of motion. Experienced residents preferred the traditional monitor display. Although the VMD produced less muscle fatigue, inexperienced residents preferred the HMD

Orthodontic management of buccally erupted ectopic canine with two case reports

Directory of Open Access Journals (Sweden)

Avesh Sachan

2012-01-01

Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.

Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel

International Nuclear Information System (INIS)

Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.

2005-01-01

Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old

Changes in canine electrocardiogram values from three thermal floors in Cundinamarca, Colombia

Directory of Open Access Journals (Sweden)

Marta Elena Sánchez Klinge

2008-06-01

Full Text Available The electrocardiogram is a written register of electric changes that take place in the heart during a heart cycle. The voltage changes are the result of depolarization and repolarization of heart muscle fibers that produce electric changes able to reach body surface and that are detected by electrodes connected to a galvanometer called electrocardiograph. Heart problems are detected with the electrocardiogram, but it is necessary to know the normal values of canine electrocardiogram in a tropical country because values can change compared with normal values reported in other places. The purpose is to show variations of electrocardiogram values from clinically healthy canines from Bogotá D. C at 2600 mosl, Fusagasugá at 1700 mosl and Girardot at 326 mosl. Studied animals were separated in six groups depending on the altitude over sea level and the animal weight (less than 15 Kg and more than 15 Kg. The electrocardiograms were taken with a one channel portable electrocardiograph and derivations I, II, III, aVR, aVL, aVF, CV6LL, CV6LU, CV5RL and V10 were included. Significant differences of electrocardiogram values were observed in derivation II, in relation to the altitude over sea level and to the animals weight, which acquires importance when a diagnose of heart abnormalities is needed from animals located at different altitudes over sea levels.

Constructive remodeling of biologic scaffolds is dependent on early exposure to physiologic bladder filling in a canine partial cystectomy model.

Science.gov (United States)

Boruch, Alan V; Nieponice, Alejandro; Qureshi, Irfan R; Gilbert, Thomas W; Badylak, Stephen F

2010-06-15

Biologic scaffolds composed of extracellular matrix (ECM) have been used to facilitate the constructive remodeling of several tissue types. Previous studies suggest that the ECM scaffold remodeling process is dependent on microenvironmental factors, including tissue-specific biomechanical loading. The objective of the present study was to evaluate the effects of long-term catheterization (LTC), with its associated inhibition of bladder filling and physiologic biomechanical loading, on ECM scaffold remodeling following partial cystectomy in a canine model. Reconstruction of the partial cystectomy site was performed using ECM scaffolds prepared from porcine small intestinal submucosa (SIS) or porcine urinary bladder matrix (UBM). Animals were randomly assigned to either a long-term catheterization (LTC) group (n=5, catheterized 28 d) or a short-term catheterization group (STC, n=5, catheterized 24 h), and scaffold remodeling was assessed by histologic methods at 4 and 12 wk postoperatively. By 4 wk, animals in the STC group showed a well-developed and highly differentiated urothelium, a robust vascularization network, abundant smooth muscle actin (SMA), and smooth muscle myosin heavy chain (smMHC) expressing spindle-shaped cells, and many neuronal processes associated with newly formed arterioles. In contrast, at 4 wk the scaffolds in LTC animals were not epithelialized, and did not express neuronal markers. The scaffolds in the LTC group developed a dense granulation tissue containing SMA+, smMHC-, spindle-shaped cells that were morphologically and phenotypically consistent with myofibroblasts, but not smooth muscle cells. By 12 wk postoperatively, the ECM scaffolds in the STC animals showed a constructive remodeling response, with a differentiated urothelium and islands of smooth muscle cells within the remodeled scaffold. In contrast, at 12 wk the scaffolds in LTC animals had a remodeling response more consistent with fibrosis even though catheters had been

Canine parvovirus: current perspective.

Science.gov (United States)

Nandi, S; Kumar, Manoj

2010-06-01

Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.

Consequences of crown shortening canine teeth in Greenland sled dogs

DEFF Research Database (Denmark)

Kortegaard, H E; Anthony Knudsen, T; Dahl, S

2015-01-01

OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...

Dental anomalies associated with buccally- and palatally-impacted maxillary canines.

Science.gov (United States)

Sajnani, Anand K; King, Nigel M

2014-08-01

The aim of the present study was to determine the association of both buccally- and palatally-impacted canines with other dental anomalies. This retrospective study was conducted on a population of 533 southern Chinese children and adolescents who had impacted maxillary canines that had been treated in the Paediatric Dentistry and Orthodontics Clinic, Prince Philip Dental Hospital, The University of Hong Kong, Hong Kong. Descriptions of the impacted canine and other associated anomalies were obtained from the case notes and radiographs. Clinical photographs and study casts were used, where available. A total of 253 (47.5%) patients with impacted maxillary canines were diagnosed with other dental anomalies. Microdontia was the most frequently-occurring anomaly reported in these patients, with the maxillary lateral incisor the most commonly affected tooth. Other odontogenic anomalies that were associated with both buccally- and palatally-impacted canines included hypodontia, supernumerary teeth, transposition of other teeth, enamel hypoplasia, other impacted teeth, and dens invaginatus. Both buccally- and palatally-impacted canines were found to be associated with other odontogenic anomalies. © 2013 Wiley Publishing Asia Pty Ltd.

SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.

Science.gov (United States)

Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi

2017-10-01

Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.

Overexpression of vimentin in canine prostatic carcinoma

DEFF Research Database (Denmark)

Rodrigues, M M P; Rema, A; Gärtner, F

2011-01-01

Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....

Vaccines for Canine Leishmaniasis

Directory of Open Access Journals (Sweden)

Faeze Foroughi-Parvar

2014-01-01

Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

Upper canine inclination influences the aesthetics of a smile.

Science.gov (United States)

Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S

2015-02-01

This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.

Treatment modalities of palatal impacted canines

OpenAIRE

Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona

2012-01-01

Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...

Health of periodontal tissues and resorption status after orthodontic treatment of impacted maxillary canines.

Science.gov (United States)

Oz, A Z; Ciger, S

2018-03-01

The aim of the present study was to evaluate the changes of incisor root resorption associated with impacted maxillary canines and health of periodontal tissues around maxillary canines erupted with orthodontic treatment. Twenty patients with a unilateral palatally impacted maxillary canine were included in the study. Cone-beam computed tomography images taken before and after orthodontic treatment were compared with the contralateral canines serving as control teeth. Root resorption was present in 10% of central and 40% of lateral incisors before treatment. After treatment, the incidence of resorption decreased. The thickness of the buccal bone surrounding the impacted canines was similar to that surrounding the contralateral canines, except in the apical area. Periodontal pocket depth and alveolar bone loss were greater for the impacted canine teeth than for the contralateral canines. Incisor root resorption associated with impacted canine teeth showed signs of repair after orthodontic treatment. Slight differences related to periodontal health were found between the previously impacted teeth and contralateral canine teeth.

Comprehensive characterization of commercially available canine training aids.

Science.gov (United States)

Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A

2014-09-01

Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine

Ultrasensitive, passive and wearable sensors for monitoring human muscle motion and physiological signals.

Science.gov (United States)

Cai, Feng; Yi, Changrui; Liu, Shichang; Wang, Yan; Liu, Lacheng; Liu, Xiaoqing; Xu, Xuming; Wang, Li

2016-03-15

Flexible sensors have attracted more and more attention as a fundamental part of anthropomorphic robot research, medical diagnosis and physical health monitoring. Here, we constructed an ultrasensitive and passive flexible sensor with the advantages of low cost, lightness and wearability, electric safety and reliability. The fundamental mechanism of the sensor is based on triboelectric effect inducing electrostatic charges on the surfaces between two different materials. Just like a plate capacitor, current will be generated while the distance or size of the parallel capacitors changes caused by the small mechanical disturbance upon it and therefore the output current/voltage will be produced. Typically, the passive sensor unambiguously monitors muscle motions including hand motion from stretch-clench-stretch, mouth motion from open-bite-open, blink and respiration. Moreover, this sensor records the details of the consecutive phases in a cardiac cycle of the apex cardiogram, and identify the peaks including percussion wave, tidal wave and diastolic wave of the radial pulse wave. To record subtle human physiological signals including radial pulsilogram and apex cardiogram with excellent signal/noise ratio, stability and reproducibility, the sensor shows great potential in the applications of medical diagnosis and daily health monitoring. Copyright © 2015 Elsevier B.V. All rights reserved.

The relationship between the Southern Oscillation Index, rainfall and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia.

Science.gov (United States)

Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P

2015-07-01

The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

Development of a Vaccine Incorporating Killed Virus of Canine Origin for the Prevention of Canine Parvovirus Infection

OpenAIRE

Povey, C.

1982-01-01

A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...

Evaluation of post-vaccination immunity to canine distemper and ...

African Journals Online (AJOL)

SERVER

2007-08-20

Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...

Evaluation of 99mTc-MDP bone imaging in monitoring the muscle-pedicle bone graft osteogenic activation

International Nuclear Information System (INIS)

Sang Shibiao; Wu Yiwei; Zhang Wei; Jiang Yimin; Chen Guangxiang; Dong Tianhua

2002-01-01

choice method for the early monitoring of the muscle-pedicle bone graft osteogenic activation

Canine as a biomedical research model: immunological, hematological, and oncological aspects

International Nuclear Information System (INIS)

Shifrine, M.; Wilson, F.D.

1980-01-01

The canine has been used as a biomedical research model in radiation studies by a number of laboratories supported primarily by the US Department of Energy and its predecessors. These studies were unique in that they covered the life spans of the canines and permitted the collection of data from birth to death under controlled conditions. Since these were multiparametric studies, an extensive data base has been established, not the least of which are normative values covering all biologic systems, including immunohematology. The canine model has also been extensively used by other groups, such as transplantation biologists. The virtues of the canine as a model in these and many other endeavors are becoming increasingly more apparent with the passing of time. One of the primary goals of this volume was to compile the knowledge and experience of researchers using the canine model and to focus their expertise on furthering the use of the canine for studies in immunology, hematology, and oncology. We have attempted to present some of the contemporary, diverse uses of the canine in biomedical research, emphasizing immunologic endpoints, and also to present in detail some of the latest technology used in such studies

Collagen and Glycosaminoglycan Profiles in the Canine Cervix during Different Stages of the Estrous Cycle and in Open- and Closed-Cervix Pyometra

Science.gov (United States)

LINHARATTANARUKSA, Pichanun; SRISUWATANASAGUL, Sayamon; PONGLOWHAPAN, Suppawiwat; KHALID, Muhammad; CHATDARONG, Kaywalee

2013-01-01

ABSTRACT The extracellular matrix of the cervix that comprises collagen, elastin, proteoglycans and glycosaminoglycans (GAGs) is thought to have an essential role in cervical relaxation. This study investigated the proportion of collagen and smooth muscle as well as the GAGs in cervices obtained from healthy bitches at different stages of the estrous cycle and bitches with open- and closed-cervix pyometra. Cervices were collected after ovariohysterectomy. The proportion of collagen to smooth muscle was determined using Masson’s trichrome staining. Alcian blue staining was used to evaluate the relative distribution of cervical GAGs. The proportion of cervical collagen relative to smooth muscle was higher at estrus compared to anestrus (P≤0.05). It was also higher (P≤0.05) in bitches with open- compared to those with closed-cervix pyometra. Overall, hyaluronan (HA) was the predominant GAG in the canine cervix. In the luminal epithelium, the staining intensity for HA was stronger in estrus than in anestrus (P≤0.05), but not in diestrus (P>0.05). On the contrary, the intensity for the combined keratan sulfate (KS) and heparan sulfate (HS) was stronger in anestrus than in estrus and diestrus (P≤0.05). In bitches with pyometra, the staining intensity of the stroma for KS and HS was weaker in open- compared to closed-cervix pyometra (P≤0.05). Collectively, the different profiles of collagen and GAG suggest that the metabolism of both collagen and GAGs in the canine cervix is associated with hormonal statuses during the estrous cycle and cervical patency of bitches with pathological uterine conditions, such as pyometra. PMID:24152876

Molecular detection of canine parvovirus in flies (Diptera) at open and closed canine facilities in the eastern United States.

Science.gov (United States)

Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan

2014-06-01

More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year

Identification of quantitative trait loci (QTL for canine hip dysplasia and canine elbow dysplasia in Bernese mountain dogs.

Directory of Open Access Journals (Sweden)

Sophia Pfahler

Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.

Feeding ecology and morphology of the upper canines in bears (carnivora: Ursidae).

Science.gov (United States)

Christiansen, Per

2008-07-01

The morphology and mechanical strength of the upper canines in all eight extant species of ursids is analyzed, and the findings are discussed in relation to feeding ecology. Ursids have proportionally smaller canines than other large carnivores with a specialized feeding ecology, such as large felids, and the upper canine morphology is both canid-like and felid-like. The giant panda is the most divergent species, and its short, blunt, and cone-like canines appear well adapted for tearing into bamboo. The almost equally herbivorous spectacled bear has a less derived canine morphology. The large canines of the sun bear are divergent from other ursine ursids, and may be an adaptation for tearing open tree trunks in search of insects. Discriminant Analysis is successful in separating ursid species on the basis of canine morphology, but the canines of ursine ursids, and also of the spectacled bear, show greater resemblance among the species than the marked differences in feeding ecology would suggest. This could be in part due to a short evolutionary history, and in part due to canines not having been subjected to much evolutionary selection as has been the case among other large carnivores, such as large felids. Ursids are probably evolutionarily and ecologically successful due to physical size and strength rather than a derived craniodental anatomy. Copyright 2008 Wiley-Liss, Inc.

Canine length in wild male baboons: maturation, aging and social dominance rank.

Directory of Open Access Journals (Sweden)

Jordi Galbany

Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.

Effects of body weight on antibody titers against canine parvovirus type 2, canine distemper virus, and canine adenovirus type 1 in vaccinated domestic adult dogs.

Science.gov (United States)

Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki

2012-10-01

The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.

IQGAP1 is an oncogenic target in canine melanoma.

Directory of Open Access Journals (Sweden)

Becky H Lee

Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.

Expression and function of survivin in canine osteosarcoma.

Science.gov (United States)

Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H

2012-01-01

Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.

American Canine Hepatozoonosis

Science.gov (United States)

Ewing, S. A.; Panciera, R. J.

2003-01-01

American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294

National clinical guidelines for management of the palatally ectopic maxillary canine.

Science.gov (United States)

Husain, J; Burden, D; McSherry, P; Morris, D; Allen, M

2012-08-01

This review summarises updated clinical guidelines produced by the Clinical Standards Committee of the Faculty of Dental Surgery, Royal College of Surgeons of England (FDSRCS). This guideline on the management of the palatally ectopic maxillary canine illustrates the information contained in the recently updated online version. The timely recognition of ectopic canines is important for the overall management of the dentition. This review illustrates five management strategies for ectopic permanent canines: interceptive treatment by extraction of the deciduous canine, surgical exposure and orthodontic alignment, surgical removal of the palatally ectopic permanent canine, auto-transplantation and no active treatment/leave and observe. The current available evidence for each of these management options has been evaluated and awarded a grade used by the Scottish Intercollegiate Guidelines Network.

Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report.

Science.gov (United States)

Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka

2016-07-01

Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.

Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.

Directory of Open Access Journals (Sweden)

Emily J Shields

Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.

Severe canine distemper outbreak in unvaccinated dogs in Mozambique

Directory of Open Access Journals (Sweden)

Julieta Zacarias

2016-07-01

Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

Management of an Unusual Ectopic Eruption of Maxillary Canine.

Science.gov (United States)

Aileni, Kaladhar Reddy; Rachala, Madhukar Reddy; Prathima, Chintakunta Reddy; Naveen, Pitalla Kumar; Soujanya, Donthula

2017-05-01

Transposition of teeth is a rare condition, with a prevalence of 0.3-0.4% in general population. They are more commonly observed in females, and may occur unilaterally/bilaterally with greater frequency of left side occurrence in unilateral transposition cases. A 17-year-old female patient reported with the chief complaint of unaesthetic smile. On clinical examination the patient was diagnosed with Angle's class I malocclusion with an ectopically erupted maxillary left canine labial to the left central incisor with retained deciduous canine. The treatment plan decided was to extract the retained deciduous canine, level and align the ectopic canine using an R-loop. The treatment for the patient was finished in 14 months and was retained using a fixed lingual retainer in the upper and lower arches.

Lipid-induced insulin resistance does not impair insulin access to skeletal muscle

Science.gov (United States)

Richey, Joyce M.; Castro, Ana Valeria B.; Broussard, Josiane L.; Ionut, Viorica; Bergman, Richard N.

2015-01-01

Elevated plasma free fatty acids (FFA) induce insulin resistance in skeletal muscle. Previously, we have shown that experimental insulin resistance induced by lipid infusion prevents the dispersion of insulin through the muscle, and we hypothesized that this would lead to an impairment of insulin moving from the plasma to the muscle interstitium. Thus, we infused lipid into our anesthetized canine model and measured the appearance of insulin in the lymph as a means to sample muscle interstitium under hyperinsulinemic euglycemic clamp conditions. Although lipid infusion lowered the glucose infusion rate and induced both peripheral and hepatic insulin resistance, we were unable to detect an impairment of insulin access to the lymph. Interestingly, despite a significant, 10-fold increase in plasma FFA, we detected little to no increase in free fatty acids or triglycerides in the lymph after lipid infusion. Thus, we conclude that experimental insulin resistance induced by lipid infusion does not reduce insulin access to skeletal muscle under clamp conditions. This would suggest that the peripheral insulin resistance is likely due to reduced cellular sensitivity to insulin in this model, and yet we did not detect a change in the tissue microenvironment that could contribute to cellular insulin resistance. PMID:25852002

The Ondersteport Canine distemper virus strain and measles ...

African Journals Online (AJOL)

Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...

Management of an impacted and transposed maxillary canine

Directory of Open Access Journals (Sweden)

Deepti A

2010-03-01

Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.

Comparative strain analysis of Anaplasma phagocytophilum infection and clinical outcomes in a canine model of granulocytic anaplasmosis.

Science.gov (United States)

Scorpio, Diana G; Dumler, J Stephen; Barat, Nicole C; Cook, Judith A; Barat, Christopher E; Stillman, Brett A; DeBisceglie, Kristen C; Beall, Melissa J; Chandrashekar, Ramaswamy

2011-03-01

A pilot study was conducted to determine whether existing human or canine strains of Anaplasma phagocytophilum would reproduce clinical disease in experimentally inoculated dogs similar to dogs with naturally acquired granulocytic anaplasmosis. Six hounds were inoculated intravenously with one human and two canine strains of A. phagocytophilum that were propagated in vitro in HL-60 cells or in infected autologous neutrophils. Infected dogs were monitored for lethargy, anorexia, petechiae, lymphadenopathy, and fever. Dogs were assessed for complete blood count (CBC), serum chemistry, and serology (IFA and SNAP® 4Dx®); for A. phagocytophilum blood load by quantitative polymerase chain reaction; and for cytokine production. Prominent clinical signs were generalized lymphadenopathy and scleral injection; only one dog developed fever lasting 4 days. Notable laboratory alterations included sustained leukopenia and thrombocytopenia in all dogs. A. phagocytophilum morulae were noted in blood between days 10 and 11, although all dogs retained A. phagocytophilum DNA in blood through day 60. All dogs seroconverted by days 10-15 by IFA, and by days 17-30 by SNAP 4Dx; cytokine analyses revealed 10-fold increases in interleukin-2 and interleukin-18 in the neutrophil-propagated 98E4 strain-infected dog. All A. phagocytophilum strains produced infection, although canine 98E4 strain reproduced clinical signs, hematologic changes, and inflammatory cytokine elevations most consistent with granulocytic anaplasmosis when recognized clinically. Therefore, this strain should be considered for use in future studies of A. phagocytophilum canine infection models.

The recombinant EHV-1 vector producing CDV hemagglutinin as potential vaccine against canine distemper.

Science.gov (United States)

Pan, Zihao; Liu, Jin; Ma, Jiale; Jin, Qiuli; Yao, Huochun; Osterrieder, Nikolaus

2017-10-01

Canine distemper virus (CDV), is a pantropic agent of morbillivirus that causes fetal disease in dogs. Base on a broad host rang of CDV, the continued vaccines inoculation is unavoidable to pose gene recombination risk in vaccine virus and wild virus. The current study presents the construction of novel vectors, using equine herpesvirus type 1 (EHV-1) expressing the canine distemper virus (CDV). The recent field strain hemagglutinin protein and nucleoprotein were used for the construction of the viral vector vaccines. Based on the Bacterial artificial chromosome (BAC) genomes of EHV-1 RacH strain, the recombinant EHV-1 vaccine virus encoding CDV hemagglutinin protein (EHV-H) or CDV nucleoprotein (EHV-N) was constructed separately. The constructed BACs were rescued after 72 h post infection, and the expression of H or N in the recombinant viruses was confirmed by western-blotting. Furthermore, high levels of neutralizing antibodies were induced persistently following vaccination in the groups EHV-H&EHV-N and EHV-H, but the EHV-N group. The groups of vaccinated EHV-H and EHV-H&EHV-N pups were monitored for clinical signs, whereas the vaccinated EHV-N group developed moderate symptoms. The present study demonstrated that EHV-1 based recombinant virus carrying CDV H could be a promising vaccine candidate against canine distemper. Copyright © 2017. Published by Elsevier Ltd.

Micro-computed tomography (CT) based assessment of dental regenerative therapy in the canine mandible model

Science.gov (United States)

Khobragade, P.; Jain, A.; Setlur Nagesh, S. V.; Andreana, S.; Dziak, R.; Sunkara, S. K.; Sunkara, S.; Bednarek, D. R.; Rudin, S.; Ionita, C. N.

2015-03-01

High-resolution 3D bone-tissue structure measurements may provide information critical to the understanding of the bone regeneration processes and to the bone strength assessment. Tissue engineering studies rely on such nondestructive measurements to monitor bone graft regeneration area. In this study, we measured bone yield, fractal dimension and trabecular thickness through micro-CT slices for different grafts and controls. Eight canines underwent surgery to remove a bone volume (defect) in the canine's jaw at a total of 44 different locations. We kept 11 defects empty for control and filled the remaining ones with three regenerative materials; NanoGen (NG), a FDA-approved material (n=11), a novel NanoCalcium Sulfate (NCS) material (n=11) and NCS alginate (NCS+alg) material (n=11). After a minimum of four and eight weeks, the canines were sacrificed and the jaw samples were extracted. We used a custombuilt micro-CT system to acquire the data volume and developed software to measure the bone yield, fractal dimension and trabecular thickness. The software used a segmentation algorithm based on histograms derived from volumes of interest indicated by the operator. Using bone yield and fractal dimension as indices we are able to differentiate between the control and regenerative material (p<0.005). Regenerative material NCS showed an average 63.15% bone yield improvement over the control sample, NCS+alg showed 55.55% and NanoGen showed 37.5%. The bone regeneration process and quality of bone were dependent upon the position of defect and time period of healing. This study presents one of the first quantitative comparisons using non-destructive Micro-CT analysis for bone regenerative material in a large animal with a critical defect model. Our results indicate that Micro-CT measurement could be used to monitor invivo bone regeneration studies for greater regenerative process understanding.

Aspects and clinical procedures of eruptive changes of permanent upper canines

Directory of Open Access Journals (Sweden)

Sheila Marcia Francisco

2012-04-01

Full Text Available INTRODUCTION: Even though the upper canine is the tooth that presents most eruption anomalies, after the third molars, canine retention prevalence in the population is quite low. Local, physiologic and pathologic factors can provide difficulties for the tooth eruptive process. The correct diagnosis in trying to prevent upper canine retention with ectopic eruption is fundamental to choose the ideal treatment, which can be performed by various methods. OBJECTIVE: The present paper has the purpose of approaching aspects related to impacted upper permanent canines by a literature review, including localization and treatment conducts.

A randomized clinical study of two interceptive approaches to palatally displaced canines.

Science.gov (United States)

Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela

2008-08-01

This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.

Binding of 125I-labeled endotoxin to bovine, canine, and equine platelets and endotoxin-induced agglutination of canine platelets

International Nuclear Information System (INIS)

Meyers, K.M.; Boehme, M.; Inbar, O.

1982-01-01

Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using 125 I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed

Morphology of palatally impacted canines: A case-controlled cone-beam volumetric tomography study.

Science.gov (United States)

Hettiarachchi, Pilana Vithanage Kalani Shihanika; Olive, Richard John; Monsour, Paul

2017-02-01

The aim of this study was to investigate the relationships between an apical curvature or a hook and the crown/root ratio in subjects with and without palatally impacted maxillary canines. An experimental group of 44 patients (17 boys, 27 girls; mean age, 13.6 years) with 59 palatally impacted maxillary canines was selected from the records of patients referred to a radiology practice for cone-beam imaging. If a patient had bilateral palatally impacted canines, 1 canine was randomly selected for analysis. The palatally impacted canine group was matched for age and sex with 49 normal subjects (25 boys, 24 girls; mean age, 13.2 years) with 98 canines. Cone-beam DICOM files were imported into In Vivo imaging software (version 5.3; Anatomage, San Jose, Calif) for analysis. The angulations and linear variables of the maxillary canines were measured by using the software measurement tools. Chi-square and independent t tests were used to test for differences between the groups. The presence of a hook at the apical third and other root curvature were significantly different between the 2 groups (P <0.001 and P <0.05, respectively). Of the 44 palatally impacted canines, 16 (36.4%) had an apical hook and only 1 canine in the control group had an apical hook (1.0%). The mean root length of the palatally impacted canines was 2.66 mm shorter (P <0.001), and the mean crown/root ratio was significantly greater for the palatally impacted canines compared with the nonimpacted group (P <0.001). Palatally impacted canines have a greater tendency to develop apical hooks and are less likely to develop other root curvatures than are nonimpacted canines. Also, they have shorter roots resulting in larger crown/root ratios compared with the control group. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

Canine detection of free-ranging brown treesnakes on Guam

Science.gov (United States)

Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.

2011-01-01

We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.

Cryopreservation of microencapsulated canine sperm.

Science.gov (United States)

Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu

2011-03-01

The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.

Alteration of the Canine Small-Intestinal Lactic Acid Bacterium Microbiota by Feeding of Potential Probiotics

OpenAIRE

Manninen, Titta J. K.; Rinkinen, Minna L.; Beasley, Shea S.; Saris, Per E. J.

2006-01-01

Five potentially probiotic canine fecal lactic acid bacterium (LAB) strains, Lactobacillus fermentum LAB8, Lactobacillus salivarius LAB9, Weissella confusa LAB10, Lactobacillus rhamnosus LAB11, and Lactobacillus mucosae LAB12, were fed to five permanently fistulated beagles for 7 days. The survival of the strains and their potential effects on the indigenous intestinal LAB microbiota were monitored for 17 days. Denaturing gradient gel electrophoresis (DGGE) demonstrated that the five fed LAB ...

Effect of Arctium lappa (burdock) extract on canine dermal fibroblasts.

Science.gov (United States)

Pomari, Elena; Stefanon, Bruno; Colitti, Monica

2013-12-15

Although the biological activities of Arctium lappa (burdock) have been already investigated in human and other species, data evaluating the molecular mechanisms have not been reported in the dog. In this study we analyzed for the first time the effect of a root extract of burdock on molecular responses in canine dermal fibroblasts with H2O2 stimulation (H group), with burdock treatment (B group) and with H2O2 stimulation and burdock treatment (BH group), using RNAseq technology. Differentially expressed genes (P<0.05) of H, B and BH groups in comparison to the untreated sample (negative control, C group) were identified with MeV software and were functional annotated and monitored for signaling pathways and candidate biomarkers using the Ingenuity Pathways Analysis (IPA). The expression profile of canine dermal fibroblasts treated with burdock extract with or without H2O2 stimulation, showed an up-regulation of mitochondrial superoxide dismutase (SOD2), disheveled 3 (DVL3) and chondroitin sulfate N-acetylgalactosaminyltransferase 2 (CSGALNACT2). The data suggested that burdock has implications in cell adhesion and gene expression with the modulation of Wnt/β catenin signaling and Chondroitin Sulphate Biosynthesis that are particularly important for the wound healing process. © 2013 Elsevier B.V. All rights reserved.

Safety of administering the canine melanoma DNA vaccine (Oncept) to cats with malignant melanoma - a retrospective study.

Science.gov (United States)

Sarbu, Luminita; Kitchell, Barbara E; Bergman, Philip J

2017-02-01

Objectives A xenogeneic human tyrosinase DNA vaccine was developed for treatment of dogs with oral malignant melanoma (Oncept; Merial). No studies have evaluated the safety or efficacy of this vaccine in cats. The purpose of this study was to evaluate the safety of the canine melanoma vaccine in cats diagnosed with melanoma. Methods Medical records were reviewed from cats diagnosed with malignant melanoma and treated with the canine melanoma DNA vaccine (Oncept). Data regarding signalment, melanoma location, treatments received, vaccine adverse effects and cause of death were collected. Results A total of 114 melanoma vaccines were administered to 24 cats. Seven cats (11.4%) had clinical adverse effects from a total of 13 vaccines classified as grade 1 or 2 based on the Veterinary Cooperative Oncology Group's common terminology criteria for adverse events v1.1. These included pain on vaccine administration, brief muscle fasciculation, transient inappetence, depression, nausea and mild increase in pigmentation at the injection site. Nineteen cats were deceased at study close. The most common cause of death was melanoma (14 cats). Hematological and biochemical changes were observed in six cats, five of which had concurrent disease or treatments that likely caused or greatly contributed to the laboratory abnormalities found. Therefore, these adverse events were considered unlikely to be caused by the melanoma vaccine. One cat had transient grade 1 hypoalbuminemia, which was possibly caused by the vaccination but not thoroughly evaluated. Conclusions and relevance The canine melanoma DNA vaccine can be safely administered to cats, with minimal risk of adverse effects.

Three-year rabies duration of immunity in dogs following vaccination with a core combination vaccine against canine distemper virus, canine adenovirus type-1, canine parvovirus, and rabies virus.

Science.gov (United States)

Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

2006-01-01

Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.

Management of impacted all canines with surgical exposure and alignment by orthodontic treatment

Directory of Open Access Journals (Sweden)

Radha Katiyar

2013-01-01

Full Text Available Canine impaction is a dental problem very often encountered in orthodontic practice. After the third molar, the canine is the most frequently impacted tooth. Bringing the impacted canine into a normal position is important for functional occlusion and the final esthetics of the orthodontic treatment. This article illustrates a peculiar case, in which all four permanent canines maintained their unerupted status at age of 16 years. All four impacted canines were surgically exposed, attachment bonded, traction given with K-9 spring and ideally positioned with fixed orthodontic mechanotherapy.

Fatal Canine Intoxications Linked to the Presence of Saxitoxins in Stranded Marine Organisms Following Winter Storm Activity

Directory of Open Access Journals (Sweden)

Andrew D. Turner

2018-02-01

Full Text Available At the start of 2018, multiple incidents of dog illnesses were reported following consumption of marine species washed up onto the beaches of eastern England after winter storms. Over a two-week period, nine confirmed illnesses including two canine deaths were recorded. Symptoms in the affected dogs included sickness, loss of motor control, and muscle paralysis. Samples of flatfish, starfish, and crab from the beaches in the affected areas were analysed for a suite of naturally occurring marine neurotoxins of dinoflagellate origin. Toxins causing paralytic shellfish poisoning (PSP were detected and quantified using two independent chemical testing methods in samples of all three marine types, with concentrations over 14,000 µg saxitoxin (STX eq/kg found in one starfish sample. Further evidence for PSP intoxication of the dogs was obtained with the positive identification of PSP toxins in a vomited crab sample from one deceased dog and in gastrointestinal samples collected post mortem from a second affected dog. Together, this is the first report providing evidence of starfish being implicated in a PSP intoxication case and the first report of PSP in canines.

FLT3 mutations in canine acute lymphocytic leukemia

International Nuclear Information System (INIS)

Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L

2011-01-01

FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias

Vaccine-induced canine distemper in a lesser panda.

Science.gov (United States)

Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J

1976-11-01

A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.

Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

International Nuclear Information System (INIS)

Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.

1974-01-01

Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

Canine hip dysplasia: significance of early bony spurring

International Nuclear Information System (INIS)

Morgan, J.P.

1987-01-01

It is the purpose of this study to call attention to new bone production that often occurs early in the sequence of pathological changes associated with canine hip dysplasia. New bone production extending to bony remodeling, as well as femoral head subluxation, both occur in the sequence of pathologic changes associated with canine hip dysplasia. Subluxation is considered primary, while osteoarthrosis is a secondary feature, and both are used in the diagnosis of canine hip dysplasia. This report concerns the significance of the presence of a solitary bony osteophyte, or spur, that is frequently evident on the caudal aspect of the femoral neck as viewed on the conventional ventrodorsal projection. This report utilizes findings from pelvic radiographs of 605 dogs (five breeds). There was a greater frequency (54%)of this bony change in cases diagnosed radiographically as dysplastic than in cases diagnosed as normal(15%).Thus, it is suggested that this minimal radiographic change can be used as an indicator of early canine hip dysplasia, especially in the absence of subluxation of the femoral head

Radiographic assessment of dental anomalies in patients with ectopic maxillary canines

DEFF Research Database (Denmark)

Sørensen, Helle Budtz; Artmann, Lone; Larsen, Helle Juul

2008-01-01

dental deviations in cases with either palatal or labial ectopic canines. Design. Panoramic and intra-oral radiographs from 50 patients with palatally located (38 females and 12 males) and 19 patients with labially located ectopic canines (11 females and 8 males), aged 10 years, 2 months-18 years, 1...... month, were analysed. Dental deviations registered were crown and root malformations, agenesis, and eruption deviations. Registrations were performed in the maxillary incisor field and in the dentition in general. Results. The study documented that palatally as well as labially located ectopic canines...... can occur in dentitions without other dental deviations. Dental deviations occurred in approximately two-thirds of all cases, more often in females and in cases with palatally located canines. More than half of the females with palatally located canines had deviations in the maxillary incisors...

Canine Babesiosis in China Caused by Babesia gibsoni: A Molecular Approach.

Directory of Open Access Journals (Sweden)

Da-Wei Yao

2014-06-01

Full Text Available To provide a point of reference to study the epidemiology and clinical expression of canine babesiosis in China.A total of 30 dogs infected with canine babesiosis were evaluated by mean of clinical history, physical examination, hematological, restriction fragment length polymorphism of PCR products (PCR-RFLP and sequencing analysis.The most prevalent clinical abnormalities were lethargy (100%, anorexia (100%, pale or icteric mucous membranes (80%, fever (70% and dark urine (70%. Hematology parameters revealed that anemia and thrombocytopenia were the major abnormalities in blood of dogs infected with canine babesia. The results of PCR-RFLP and sequencing analysis indicated that B. gibsoni was the main species responsible for canine babesiosis cases at the time of the study in Nanjing, China.The results provide valuable information for better understanding of the epidemiology of canine babesiosis in China.

Power Doppler Imaging in Acute Renal Vein Occlusion and Recanalization: a Canine Model

Energy Technology Data Exchange (ETDEWEB)

Yoo, So-Young; Kim, In-One; Kim, Young-Il; Lee, Kyoung Ho; Lee, Min Woo; Youn, Byung Jae; Kim, Woo Sun; Yeon, Kyung Mo [Seoul National University College of Medicine, Seoul (Korea, Republic of)

2008-04-15

Objective : To evaluate the dynamic changes of the power Doppler (PD) in acute renal vein occlusion and recanalization in a canine model. Materials and Methods : We performed a PD of the kidney during graded renal vein occlusion and recanalization induced by balloon inflation and deflation in nine dogs. The PD images were transferred to a personal computer, and the PD signals were quantified. Result : We observed the temporal change of the PD signal during renal vein occlusion and recanalization, with a decrease in the PD signal during occlusion and an increase during recanalization. The mean PD signal decreased gradually as the renal vein was occluded, and conversely increased gradually with sequential relief of occlusion. The sequential change of the mean value of the PD signal was statistically significant. Conclusion : The PD can detect a change in renal blood flow during acute renal vein occlusion and recanalization in a canine model. The PD may be used as a helpful tool for the early detection of acute renal vein thrombosis and the monitoring of renal perfusion.

Power Doppler Imaging in Acute Renal Vein Occlusion and Recanalization: a Canine Model

International Nuclear Information System (INIS)

Yoo, So-Young; Kim, In-One; Kim, Young-Il; Lee, Kyoung Ho; Lee, Min Woo; Youn, Byung Jae; Kim, Woo Sun; Yeon, Kyung Mo

2008-01-01

Objective : To evaluate the dynamic changes of the power Doppler (PD) in acute renal vein occlusion and recanalization in a canine model. Materials and Methods : We performed a PD of the kidney during graded renal vein occlusion and recanalization induced by balloon inflation and deflation in nine dogs. The PD images were transferred to a personal computer, and the PD signals were quantified. Result : We observed the temporal change of the PD signal during renal vein occlusion and recanalization, with a decrease in the PD signal during occlusion and an increase during recanalization. The mean PD signal decreased gradually as the renal vein was occluded, and conversely increased gradually with sequential relief of occlusion. The sequential change of the mean value of the PD signal was statistically significant. Conclusion : The PD can detect a change in renal blood flow during acute renal vein occlusion and recanalization in a canine model. The PD may be used as a helpful tool for the early detection of acute renal vein thrombosis and the monitoring of renal perfusion

The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D

Directory of Open Access Journals (Sweden)

MarkéŽta Vaňkov‡á

2016-01-01

Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.

Monitoring of Antibodies Titre Against Canine Distemper Virus in Ferrets Vaccinated with a Live Modified Vaccine

Directory of Open Access Journals (Sweden)

L. Pavlačík

2007-01-01

Full Text Available A group of five ferrets vaccinated against the canine distemper virus (CDV was evaluated as to the onset of anti-CDV antibody production and the serum levels of the animals were monitored for one year. The ferrets were immunized with a live attenuated vaccine. The vaccination pattern was as follows: primary vaccination at the age of 6 weeks, fi rst revaccination at 30 days after primary vaccination, and second revaccination after another 30 days. Blood samples were taken prior to primary vaccination and then at 30-day intervals (sampling 1 to 12. The whole experimental cycle covered the period of one year from primary vaccination (till the age of 1 year and 6 weeks. Serum samples were analysed for anti-CDV virus-neutralisation antibodies using a virus-neutralisation test using the Onderstepoort CDV strain. All ferrets had zero virus-neutralisation antibody titres before primary vaccination. Two ferrets produced virus-neutralisation antibodies as a response to first revaccination. A stable antibody level (titre 256 was maintained between months 4 and 11 after primary vaccination and a sudden increase in antibody titre (titres 512 and 1024 - 2048 occurred in both animals in months 11 and 12. The reason for the abrupt rise in antibody titres in the two animals remains unclear. No anti-CDV seroconversion was observed in the three remaining animals. Regarding the results obtained in this study we do not consider commonly recommended vaccination with a live attenuated anti-CDV vaccine as an effective method of antibodies induction against distemper in young ferrets.

Orthodontic-surgical treatment of bilateral maxillary canine impaction

Directory of Open Access Journals (Sweden)

Sumitra

2012-01-01

Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.

Radiologic study of the canine urethra

International Nuclear Information System (INIS)

Poogird, W.; Wood, A.K.W.

1986-01-01

The structure and function of the canine urethra were studied during retrograde and voiding urethrography in 9 male and 8 female dogs. The lumen of the prostatic portion of the urethra was variable in diameter. During retrograde urethrography, the lumen was narrow with streaks of contrast medium outlining mucosal folds, but during voiding, it was dilated and a spindle-shaped seminal hillock was detected. Retrograde urethrography revealed other regions of the urethra of males and females had a smooth radiographic outline. During voiding urethrography, characteristic identical urethral contractions were observed in the caudal portion of the pelvic urethra (male) and in the caudal half of the urethra (female). Contractions were progressive, occurred where striated muscle was present in the urethral wall, and resulted in an intermittent flow of urine from the urethra. In the male, contractions had a rate of 2.02 +/- 0.23 contraction/s and 1.65 +/- 0.53 in the females. Contractions may have a role in the controlled voiding of small volumes of urine necessary for the repeated marking of territory, in the passage of the ejaculate along the male urethra during copulation, and in the clearance of any residual urine from the urethra at the completion of micturition

Difficulties in estimating the human burden of canine rabies.

Science.gov (United States)

Taylor, Louise H; Hampson, Katie; Fahrion, Anna; Abela-Ridder, Bernadette; Nel, Louis H

2017-01-01

Current passive surveillance data for canine rabies, particularly for the regions where the burden is highest, are inadequate for appropriate decision making on control efforts. Poor enforcement of existing legislation and poor implementation of international guidance reduce the effectiveness of surveillance systems, but another set of problems relates to the fact that canine rabies is an untreatable condition which affects very poor sectors of society. This results in an unknown, but potentially large proportion of rabies victims dying outside the health system, deaths that are unlikely to be recorded by surveillance systems based on health center records. This article critically evaluates the potential sources of information on the number of human deaths attributable to canine rabies, and how we might improve the estimates required to move towards the goal of global canine rabies elimination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Measuring the interactions between different locations in a muscle to monitor localized muscle fatigue.

Science.gov (United States)

Bingham, Adrian; Arjunan, Sridhar P; Kumar, Dinesh K

2017-07-01

In this study we investigated a technique for estimating the progression of localized muscle fatigue. This technique measures the dependence between motor units using high density surface electromyogram (HD-sEMG) and is based on the Normalized Mutual Information (NMI) measure. The NMI between every pair combination of the electrode array is computed to measure the interactions between electrodes. Participants in the experiment had an array of 64 electrodes (16 by 4) placed over the TA of their dominate leg such that the columns of the array ran parallel with the muscle fibers. The HD-sEMG was recorded whilst the participants maintained an isometric dorsiflexion with their dominate foot until task failure at 40% and 80% of their maximum voluntary contraction (MVC). The interactions between different locations over the muscle were computed using the recorded HD-sEMG signals. The results show that the average interactions between various locations over the TA significantly increased during fatigue at both levels of contraction. This can be attributed to the dependence in the motor units.

Binding of /sup 125/I-labeled endotoxin to bovine, canine, and equine platelets and endotoxin-induced agglutination of canine platelets

Energy Technology Data Exchange (ETDEWEB)

Meyers, K.M.; Boehme, M.; Inbar, O.

1982-10-01

Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.

Headspace concentrations of explosive vapors in containers designed for canine testing and training: theory, experiment, and canine trials.

Science.gov (United States)

Lotspeich, Erica; Kitts, Kelley; Goodpaster, John

2012-07-10

It is a common misconception that the amount of explosive is the chief contributor to the quantity of vapor that is available to trained canines. In fact, this quantity (known as odor availability) depends not only on the amount of explosive material, but also the container volume, explosive vapor pressure and temperature. In order to better understand odor availability, headspace experiments were conducted and the results were compared to theory. The vapor-phase concentrations of three liquid explosives (nitromethane, nitroethane and nitropropane) were predicted using the Ideal Gas Law for containers of various volumes that are in use for canine testing. These predictions were verified through experiments that varied the amount of sample, the container size, and the temperature. These results demonstrated that the amount of sample that is needed to saturate different sized containers is small, predictable and agrees well with theory. In general, and as expected, once the headspace of a container is saturated, any subsequent increase in sample volume will not result in the release of more vapors. The ability of canines to recognize and alert to differing amounts of nitromethane has also been studied. In particular, it was found that the response of trained canines is independent of the amount of nitromethane present, provided it is a sufficient quantity to saturate the container in which it is held. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

A statistical model for predicting muscle performance

Science.gov (United States)

Byerly, Diane Leslie De Caix

The objective of these studies was to develop a capability for predicting muscle performance and fatigue to be utilized for both space- and ground-based applications. To develop this predictive model, healthy test subjects performed a defined, repetitive dynamic exercise to failure using a Lordex spinal machine. Throughout the exercise, surface electromyography (SEMG) data were collected from the erector spinae using a Mega Electronics ME3000 muscle tester and surface electrodes placed on both sides of the back muscle. These data were analyzed using a 5th order Autoregressive (AR) model and statistical regression analysis. It was determined that an AR derived parameter, the mean average magnitude of AR poles, significantly correlated with the maximum number of repetitions (designated Rmax) that a test subject was able to perform. Using the mean average magnitude of AR poles, a test subject's performance to failure could be predicted as early as the sixth repetition of the exercise. This predictive model has the potential to provide a basis for improving post-space flight recovery, monitoring muscle atrophy in astronauts and assessing the effectiveness of countermeasures, monitoring astronaut performance and fatigue during Extravehicular Activity (EVA) operations, providing pre-flight assessment of the ability of an EVA crewmember to perform a given task, improving the design of training protocols and simulations for strenuous International Space Station assembly EVA, and enabling EVA work task sequences to be planned enhancing astronaut performance and safety. Potential ground-based, medical applications of the predictive model include monitoring muscle deterioration and performance resulting from illness, establishing safety guidelines in the industry for repetitive tasks, monitoring the stages of rehabilitation for muscle-related injuries sustained in sports and accidents, and enhancing athletic performance through improved training protocols while reducing

Assessment of muscle fatigue using electromygraphm sensing

Science.gov (United States)

Helmi, Muhammad Hazimin Bin; Ping, Chew Sue; Ishak, Nur Elliza Binti; Saad, Mohd Alimi Bin Mohd; Mokhtar, Anis Shahida Niza Binti

2017-08-01

Muscle fatigue is condition of muscle decline in ability after undergoing any physical activity. Observation of the muscle condition of an athlete during training is crucial to prevent or minimize injury and able to achieve optimum performance in actual competition. The aim of this project is to develop a muscle monitoring system to detect muscle fatigue in swimming athlete. This device is capable to measure muscle stress level of the swimmer and at the same time provide indication of muscle fatigue level to trainer. Electromyography signal was recorded from the muscle movement while practicing the front crawl stroke repetitively. The time domain data was processed to frequency spectra in order to study the effect of muscle fatigue. The results show that the recorded EMG signal is able to sense muscle fatigue.

Display of neutralizing epitopes of Canine parvovirus and a T-cell epitope of the fusion protein of Canine distemper virus on chimeric tymovirus-like particles and its use as a vaccine candidate both against Canine parvo and Canine distemper.

Science.gov (United States)

Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar

2009-12-10

Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.

Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough).

Science.gov (United States)

Glickman, L T; Appel, M J

1981-08-01

Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.

Current practices and research updates on diabetes mellitus in canine

Directory of Open Access Journals (Sweden)

Pankaj Kumar

2014-11-01

Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.

Eruption of the maxillary canines in relation to skeletal maturity.

Science.gov (United States)

Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica

2008-05-01

Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.

Citizen science: a new direction in canine behavior research.

Science.gov (United States)

Hecht, Julie; Spicer Rice, Eleanor

2015-01-01

Researchers increasingly rely on members of the public to contribute to scientific projects-from collecting or identifying, to analyzing and disseminating data. The "citizen science" model proves useful to many thematically distinctive fields, like ornithology, astronomy, and phenology. The recent formalization of citizen science projects addresses technical issues related to volunteer participation--like data quality--so that citizen scientists can make longstanding, meaningful contributions to scientific projects. Since the late 1990s, canine science research has relied with greater frequency on the participation of the general public, particularly dog owners. These researchers do not typically consider the methods and technical issues that those conducting citizen science projects embrace and continue to investigate. As more canine science studies rely on public input, an in-depth knowledge of the benefits and challenges of citizen science can help produce relevant, high-quality data while increasing the general public's understanding of canine behavior and cognition as well as the scientific process. We examine the benefits and challenges of current citizen science models in an effort to enhance canine citizen science project preparation, execution, and dissemination. This article is part of a Special Issue entitled: Canine Behavior. Copyright © 2014 Elsevier B.V. All rights reserved.

Antiviral effect of lithium chloride on infection of cells by canine parvovirus.

Science.gov (United States)

Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun

2015-11-01

Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.

Morphological and ultrastructural evaluation of the golden retriever muscular dystrophy trachea, lungs, and diaphragm muscle.

Science.gov (United States)

Lessa, Thais Borges; de Abreu, Dilayla Kelly; Rodrigues, Márcio Nogueira; Brólio, Marina Pandolphi; Miglino, Maria Angélica; Ambrósio, Carlos Eduardo

2014-11-01

Duchenne muscular dystrophy (DMD) is a genetic disease, characterized by atrophy and muscle weakness. The respiratory failure is a common cause of early death in patients with DMD. Golden retriever muscular dystrophy (GRMD) is a canine model which has been extensively used for many advances in therapeutics applications. As the patients with DMD, the GRMD frequently died from cardiac and respiratory failure. Observing the respiratory failure in DMD is one of the major causes of mortality we aimed to describe the morphological and ultrastructural data of trachea, lungs (conductive and respiratory portion of the system), and diaphragm muscle using histological and ultrastructural analysis. The diaphragm muscle showed discontinuous fibers architecture, with different diameter; a robust perimysium inflammatory infiltrate and some muscle cells displayed central nuclei. GRMD trachea and lungs presented collagen fibers and in addition, the GRMD lungs showed higher of levels collagen fibers that could limit the alveolar ducts and alveoli distension. Therefore, the most features observed were the collagen areas and fibrosis. We suggested in this study that the collagen remodeling in the trachea, lungs, and diaphragm muscle may increase fibrosis and affect the trachea, lungs, and diaphragm muscle function that can be a major cause of respiratory failure that occur in patients with DMD. © 2014 Wiley Periodicals, Inc.

Age estimation by canines' pulp/tooth ratio in an Iranian population using digital panoramic radiography.

Science.gov (United States)

Dehghani, Mahdieh; Shadkam, Elaheh; Ahrari, Farzaneh; Dehghani, Mahboobe

2018-04-01

Age estimation in adults is an important issue in forensic science. This study aimed to estimate the chronological age of Iranians by means of pulp/tooth area ratio (AR) of canines in digital panoramic radiographs. The sample consisted of panoramic radiographs of 271 male and female subjects aged 16-64 years. The pulp/tooth area ratio (AR) of upper and lower canines was calculated by AutoCAD software. Data were subjected to correlation and regression analysis. There was a significant and inverse correlation between age and pulp/tooth area ratio of upper and lower canines (r=-0.794 for upper canine and r=-0.282 for lower canine; p-value<0.001). Linear regression equations were derived separately for upper, lower and both canines. The mean difference between actual and estimated age using upper canine was 6.07±1.7. The results showed that the pulp/tooth area ratios of canines are a reliable method for age estimation in Iranians. The pulp/tooth area ratio of upper canine was better correlated with chronological age than that of lower canine. Copyright © 2018 Elsevier B.V. All rights reserved.

Ultrasonographic evaluation of the canine shoulder.

Science.gov (United States)

Long, C D; Nyland, T G

1999-01-01

The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.

Parallel in vivo monitoring of pH in gill capillaries and muscles of fishes using microencapsulated biomarkers

Directory of Open Access Journals (Sweden)

Ekaterina Borvinskaya

2017-05-01

Full Text Available Tracking physiological parameters in different organs within the same organism simultaneously and in real time can provide an outstanding representation of the organism's physiological status. The state-of-the-art technique of using encapsulated fluorescent molecular probes (microencapsulated biomarkers is a unique tool that can serve as a platform for the development of new methods to obtain in vivo physiological measurements and is applicable to a broad range of organisms. Here, we describe a novel technique to monitor the pH of blood inside the gill capillaries and interstitial fluid of muscles by using microencapsulated biomarkers in a zebrafish model. The functionality of the proposed technique is shown by the identification of acidification under anesthesia-induced coma and after death. The pH in muscles reacts to hypoxia faster than that in the gill bloodstream, which makes both parameters applicable as markers of either local or bodily reactions.

Concentrations of elements in fish fillets, fish muscle plugs, and crayfish from the 2011 Missouri Department of Conservation general contaminant monitoring program

Science.gov (United States)

May, Thomas W.; Walther, Michael J.; Brumbaugh, William G.; McKee, Michael J.

2013-01-01

This report presents the results of a contaminant monitoring survey conducted annually by the Missouri Department of Conservation to examine the levels of selected elemental contaminants in fish fillets, fish muscle plugs, and crayfish. Fillet samples of yellow bullhead (Ameiurus natalis), golden redhorse (Moxostoma erythrurum), longear sunfish (Lepomis megalotis), and channel catfish (Ictalurus punctatus) were collected from six sites as part of the Missouri Department of Conservation’s Fish Contaminant Monitoring Program. Fish dorsal muscle plugs were collected from largemouth bass (Micropterus salmoides) at eight of the sites, and crayfish from two sites. Following preparation and analysis of the samples, highlights of the data were as follows: cadmium and lead residues were most elevated in crayfish tissue samples from the Big River at Cherokee Landing, with 1 to 8 micrograms per gram dry weight and 22 to 45 micrograms per gram dry weight, respectively. Some dorsal muscle plugs from largemouth bass collected from Clearwater Lake, Lake St. Louis, Noblett Lake, Hazel Creek Lake, and Harrison County Lake contained mercury residues (1.7 to 4.7 micrograms per gram dry weight) that exceeded the U.S. Environmental Protection Agency Water Quality Criterion of 1.5 micrograms per gram dry weight of fish tissue (equivalent to 0.30 micrograms per gram wet weight).

The Comparative Diagnostic Features of Canine and Human Lymphoma

Directory of Open Access Journals (Sweden)

Davis M. Seelig

2016-06-01

Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

The Comparative Diagnostic Features of Canine and Human Lymphoma.

Science.gov (United States)

Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A

2016-06-01

The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

Establishment of sexual dimorphism in north indian population by odontometric study of permanent maxillary canine teeth

Directory of Open Access Journals (Sweden)

Shalini Gupta

2014-01-01

Full Text Available Aim: To investigate whether sexual dimorphism can be established by odontometric study of permanent maxillary canine teeth as well as inter-canine width in north Indian population. Study Design: The study was carried out at department of oral and maxillofacial pathology, King George′s Medical University, Lucknow, India on students and patients reporting at OPD. Out of total 180 subjects examined 90 subjects were female and 90 were male. Impressions of the upper arch were made using alginate and casts poured in dental stone. The mesiodistal diameter (MD of the crown of permanent maxillary canine both on right and left sides and inter-canine width were measured. From these measurements, maxillary canine index was calculated. The percentage of sexual dimorphism (SD was assessed for all the parameters. Results: In the present study, the MD of maxillary canine for both right (P = 0.001 and left side (P = 0.005 was significantly higher among male subjects than females, Similar observation was found for inter-canine width too (P = 0.0001. However, the maxillary canine index for right and left was almost similar (P > 0.05 for both male and female subjects. The SD in right and left MDs of maxillary canine was 4.2% and 3.6% respectively. For, inter-canine width it was maximum (13.7%. However, SD in right and left canine index showed negative values (−2.1% and -0.9% respectively. Conclusion: There was SD in MD and inter-canine width of permanent maxillary canine teeth. SD was more on right permanent maxillary canine teeth than left permanent maxillary canine.

[Nonsurgical endodontic treatment of an invaginated canine].

Science.gov (United States)

Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P

1989-01-01

We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.

Canine babesiosis: from molecular taxonomy to control

Directory of Open Access Journals (Sweden)

Irwin Peter J

2009-03-01

Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

Genetic characterization of canine influenza A virus (H3N2) in Thailand.

Science.gov (United States)

Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn

2014-02-01

In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.

Diclofenac Prolongs Repolarization in Ventricular Muscle with Impaired Repolarization Reserve

Science.gov (United States)

Kristóf, Attila; Husti, Zoltán; Koncz, István; Kohajda, Zsófia; Szél, Tamás; Juhász, Viktor; Biliczki, Péter; Jost, Norbert; Baczkó, István; Papp, Julius Gy; Varró, András; Virág, László

2012-01-01

Background The aim of the present work was to characterize the electrophysiological effects of the non-steroidal anti-inflammatory drug diclofenac and to study the possible proarrhythmic potency of the drug in ventricular muscle. Methods Ion currents were recorded using voltage clamp technique in canine single ventricular cells and action potentials were obtained from canine ventricular preparations using microelectrodes. The proarrhythmic potency of the drug was investigated in an anaesthetized rabbit proarrhythmia model. Results Action potentials were slightly lengthened in ventricular muscle but were shortened in Purkinje fibers by diclofenac (20 µM). The maximum upstroke velocity was decreased in both preparations. Larger repolarization prolongation was observed when repolarization reserve was impaired by previous BaCl2 application. Diclofenac (3 mg/kg) did not prolong while dofetilide (25 µg/kg) significantly lengthened the QTc interval in anaesthetized rabbits. The addition of diclofenac following reduction of repolarization reserve by dofetilide further prolonged QTc. Diclofenac alone did not induce Torsades de Pointes ventricular tachycardia (TdP) while TdP incidence following dofetilide was 20%. However, the combination of diclofenac and dofetilide significantly increased TdP incidence (62%). In single ventricular cells diclofenac (30 µM) decreased the amplitude of rapid (IKr) and slow (IKs) delayed rectifier currents thereby attenuating repolarization reserve. L-type calcium current (ICa) was slightly diminished, but the transient outward (Ito) and inward rectifier (IK1) potassium currents were not influenced. Conclusions Diclofenac at therapeutic concentrations and even at high dose does not prolong repolarization markedly and does not increase the risk of arrhythmia in normal heart. However, high dose diclofenac treatment may lengthen repolarization and enhance proarrhythmic risk in hearts with reduced repolarization reserve. PMID:23300901

Glucosamine and chondroitin use in canines for osteoarthritis: A ...

African Journals Online (AJOL)

Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...

In Situ Immunofluorescent Staining of Autophagy in Muscle Stem Cells

KAUST Repository

Castagnetti, Francesco

2017-06-13

Increasing evidence points to autophagy as a crucial regulatory process to preserve tissue homeostasis. It is known that autophagy is involved in skeletal muscle development and regeneration, and the autophagic process has been described in several muscular pathologies and agerelated muscle disorders. A recently described block of the autophagic process that correlates with the functional exhaustion of satellite cells during muscle repair supports the notion that active autophagy is coupled with productive muscle regeneration. These data uncover the crucial role of autophagy in satellite cell activation during muscle regeneration in both normal and pathological conditions, such as muscular dystrophies. Here, we provide a protocol to monitor the autophagic process in the adult Muscle Stem Cell (MuSC) compartment during muscle regenerative conditions. This protocol describes the setup methodology to perform in situ immunofluorescence imaging of LC3, an autophagy marker, and MyoD, a myogenic lineage marker, in muscle tissue sections from control and injured mice. The methodology reported allows for monitoring the autophagic process in one specific cell compartment, the MuSC compartment, which plays a central role in orchestrating muscle regeneration.

Concentration of elements in whole-body fish, fish fillets, fish muscle plugs, and fish eggs from the 2008 Missouri Department of Conservation General Contaminant Monitoring Program

Science.gov (United States)

May, Thomas W.; Walther, Michael J.; Brumbaugh, William G.; McKee, Michael J.

2009-01-01

This report presents the results of a contaminant monitoring survey conducted annually by the Missouri Department of Conservation to examine the levels of selected elemental contaminants in whole-body fish, fish fillets, fish muscle plugs, and fish eggs. Whole-body, fillet, or egg samples of catfish (Ictalurus punctatus, Ictalurus furcatus, Pylodictis olivaris), largemouth bass (Micropterus salmoides), walleye (Sander vitreus), crappie (Pomoxis annularis, Pomoxis nigromaculatus), shovelnose sturgeon (Scaphirhynchus platorynchus), northern hog sucker (Hypentelium nigricans), and Missouri saddled darter (Etheostoma tetrazonum) were collected from 23 sites as part of the Missouri Department of Conservation's Fish Contaminant Monitoring Program. Fish dorsal muscle plugs also were collected from walleye (Sander vitreus) at one of the sites.

A case of unusual root morphology: Maxillary canine with two roots

Directory of Open Access Journals (Sweden)

Nagesh Bolla

2009-01-01

Full Text Available The case describes a 3 months follow-up of the treatment of a maxillary canine with two roots. Clinical examination revealed a maxillary canine with a large carious lesion and an exaggerated response to cold thermal tests. Radiographic examination revealed a large distal carious lesion that appeared to invade the pulp chamber. The radiograph also revealed what appeared to be an extra root in this permanent maxillary canine.

Passive in vivo elastography from skeletal muscle noise

International Nuclear Information System (INIS)

Sabra, Karim G.; Conti, Stephane; Roux, Philippe; Kuperman, W. A.

2007-01-01

Measuring the in vivo elastic properties of muscles (e.g., stiffness) provides a means for diagnosing and monitoring muscular activity. The authors demonstrated a passive in vivo elastography technique without an active external radiation source. This technique instead uses cross correlations of contracting skeletal muscle noise recorded with skin-mounted sensors. Each passive sensor becomes a virtual in vivo shear wave source. The results point to a low-cost, noninvasive technique for monitoring biomechanical in vivo muscle properties. The efficacy of the passive elastography technique originates from the high density of cross paths between all sensor pairs, potentially achieving the same sensitivity obtained from active elastography methods

Purification and partial characterization of canine S100A12.

Science.gov (United States)

Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M

2010-12-01

Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the

Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.

Science.gov (United States)

von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H

2008-05-01

Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.

Orthodontic Traction of Impacted Canine Using Cantilever

OpenAIRE

Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé

2016-01-01

The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...

Comparison of the dental anomalies found in maxillary canine-first premolar transposition cases with those in palatally displaced canine cases.

Science.gov (United States)

Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon

2016-02-01

To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Detection of canine pneumovirus in dogs with canine infectious respiratory disease.

Science.gov (United States)

Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe

2013-12-01

Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.

Oncolytic virotherapy in veterinary medicine: current status and future prospects for canine patients

Directory of Open Access Journals (Sweden)

Patil Sandeep S

2012-01-01

Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.

Vertical periodontal ligament distraction--a new method for aligning ankylosed and displaced canines.

Science.gov (United States)

Wilmes, Benedict; Drescher, Dieter

2009-05-01

In the course of a clinical pilot study we tested the vertical periodontal ligament (V-PDL) distraction as a means of aligning ankylosed upper canines. The objective of this study was to analyze the appropriateness und effectiveness of this method. The ankylosed upper canines of five female patients aged between 16 und 19 years were surgically exposed, luxated, and after a latency period of 5 to 7 days, distracted at a rate of 0.5 mm per day. The installed distractors were borne by the periodontal-mucosa, the periodontal-mucosa and the bone, or by the bone exclusively. We evaluated the distraction distance and time and degree of hard and soft tissue generation present in the region surrounding the distracted teeth. All canines were aligned after a mean distraction period of 43.2 days (+/- 3.6 days). The mean distraction distance was 10.8 mm. Three canines had defects at the cemento-enamel junction, and one canine had to be extracted due to a large defect at the root. Vertical PDL distraction is a minimally-invasive therapy to align ankylosed impacted canines. Even if the long-term prognosis of distracted canines with defects is uncertain, the patient benefits from the vertical PDL distraction because both hard and soft tissues are generated in the vicinity of the distracted canine.

Telomere length in normal and neoplastic canine tissues.

Science.gov (United States)

Cadile, Casey D; Kitchell, Barbara E; Newman, Rebecca G; Biller, Barbara J; Hetler, Elizabeth R

2007-12-01

To determine the mean telomere restriction fragment (TRF) length in normal and neoplastic canine tissues. 57 solid-tissue tumor specimens collected from client-owned dogs, 40 samples of normal tissue collected from 12 clinically normal dogs, and blood samples collected from 4 healthy blood donor dogs. Tumor specimens were collected from client-owned dogs during diagnostic or therapeutic procedures at the University of Illinois Veterinary Medical Teaching Hospital, whereas 40 normal tissue samples were collected from 12 control dogs. Telomere restriction fragment length was determined by use of an assay kit. A histologic diagnosis was provided for each tumor by personnel at the Veterinary Diagnostic Laboratory at the University of Illinois. Mean of the mean TRF length for 44 normal samples was 19.0 kilobases (kb; range, 15.4 to 21.4 kb), and the mean of the mean TRF length for 57 malignant tumors was 19.0 kb (range, 12.9 to 23.5 kb). Although the mean of the mean TRF length for tumors and normal tissues was identical, tumor samples had more variability in TRF length. Telomerase, which represents the main mechanism by which cancer cells achieve immortality, is an attractive therapeutic target. The ability to measure telomere length is crucial to monitoring the efficacy of telomerase inhibition. In contrast to many other mammalian species, the length of canine telomeres and the rate of telomeric DNA loss are similar to those reported in humans, making dogs a compelling choice for use in the study of human anti-telomerase strategies.

Controversial results of therapy with mesenchymal stem cells in the acute phase of canine distemper disease.

Science.gov (United States)

Pinheiro, A O; Cardoso, M T; Vidane, A S; Casals, J B; Passarelli, D; Alencar, A L F; Sousa, R L M; Fantinato-Neto, P; Oliveira, V C; Lara, V M; Ambrósio, C E

2016-05-23

Distemper disease is an infectious disease reported in several species of domestic and wild carnivores. The high mortality rate of animals infected with canine distemper virus (CDV) treated with currently available therapies has driven the study of new efficacious treatments. Mesenchymal stem cell (MSC)-based therapy is a promising therapeutic option for many degenerative, hereditary, and inflammatory diseases. Therefore, the aim of this study was to characterize stem cells derived from the canine fetal olfactory epithelium and to assess the systemic response of animals infected with CDV to symptomatic therapy and treatment with MSCs. Eight domestic mongrel dogs (N = 8) were divided into two groups: support group (SG) (N = 5) and support group + cell therapy (SGCT) (N = 3), which were monitored over 15 days. Blood samples were collected on days 0, 6, 9, 12, and 15 to assess blood count and serum biochemistry (urea, creatinine, alanine transferase, alkaline phosphatase, gamma-glutamyl transferase, total protein, albumin, and globulin), and urine samples were obtained on days 0 and 15 for urinary evaluation (urine I). The results showed a high mortality rate (SG = 4 and SGCT = 2), providing inadequate data on the clinical course of CDV infection. MSC therapy resulted in no significant improvement when administered during the acute phase of canine distemper disease, and a prevalence of animals with high mortality rate was found in both groups due to the severity of symptoms.

Determination of anti-canine IgG using a continuous filtration/dissolution system based on the formation of a high-molecular size immunocomplex.

Science.gov (United States)

Reyes, F D; Arce, C; Moreno, A; Fernández Romero, J M; Luque de Castro, M D

2001-10-31

A method for the determination of monoclonal antibody anti-canine-IgG based on a continuous filtration/dissolution system is presented as prototype for further developments. The basis of the system is the continuous formation of a high-molecular immunocomplex, which is temporally retained on a microfilter located prior to the detector. The immunochemical method consists of the development of a sandwich type heterogeneous non-competitive reaction to yield a high molecular immunocomplex, as a result of the affinity interaction between streptavidin and biotincanine IgG and the immunoreaction between canine IgG and mAb anti-canine IgG, which occurs in solution. Goat anti-mouse IgG labelled with peroxidase is used as tracer. The extension of the immunoreaction is monitored fluorimetrically via the condensation product between 4-hydroxyphenylacetic acid and hydrogen peroxide in the presence of the peroxidase retained on the filter. The method provides a dynamic range from 10(-4) to 500 mug l(-1) with an IC(50) of 0.554 mug 1(-1) (for a biotin-IgG dilution of 1:250, chi(2)=0.6085, r(2)=0.9991, n=14) and a precision, expressed as R.S.D.%, lower than 4.7%. After modifications, the method here proposed can be extended for monitoring analytes of interest in the agrochemical, food and environmental areas, as far as permitted by the availability to produce the corresponding monoclonal antibody.

Genetics of Human and Canine Dilated Cardiomyopathy

OpenAIRE

Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland

2015-01-01

Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...

Muscle-Derived Proteins as Serum Biomarkers for Monitoring Disease Progression in Three Forms of Muscular Dystrophy

Science.gov (United States)

Burch, Peter M.; Pogoryelova, Oksana; Goldstein, Richard; Bennett, Donald; Guglieri, Michela; Straub, Volker; Bushby, Kate; Lochmüller, Hanns; Morris, Carl

2015-01-01

Abstract Background: Identifying translatable, non-invasive biomarkers of muscular dystrophy that better reflect the disease pathology than those currently available would aid the development of new therapies, the monitoring of disease progression and the response to therapy. Objective: The goal of this study was to evaluate a panel of serum protein biomarkers with the potential to specifically detect skeletal muscle injury. Method: Serum concentrations of skeletal troponin I (sTnI), myosin light chain 3 (Myl3), fatty acid binding protein 3 (FABP3) and muscle-type creatine kinase (CKM) proteins were measured in 74 Duchenne muscular dystrophy (DMD), 38 Becker muscular dystrophy (BMD) and 49 Limb-girdle muscular dystrophy type 2B (LGMD2B) patients and 32 healthy controls. Results: All four proteins were significantly elevated in the serum of these three muscular dystrophy patient populations when compared to healthy controls, but, interestingly, displayed different profiles depending on the type of muscular dystrophy. Additionally, the effects of patient age, ambulatory status, cardiac function and treatment status on the serum concentrations of the proteins were investigated. Statistical analysis revealed correlations between the serum concentrations and certain clinical endpoints including forced vital capacity in DMD patients and the time to walk ten meters in LGMD2B patients. Serum concentrations of these proteins were also elevated in two preclinical models of muscular dystrophy, the mdx mouse and the golden-retriever muscular dystrophy dog. Conclusions: These proteins, therefore, are potential muscular dystrophy biomarkers for monitoring disease progression and therapeutic response in both preclinical and clinical studies. PMID:26870665

Orthodontic treatment of a complete transposed impacted maxillary canine

Directory of Open Access Journals (Sweden)

Pi-Huei Liu

2015-03-01

Full Text Available Tooth transposition is a positional interchange of two adjacent teeth. Transposition most often occurs at maxillary canine. Moving transposed teeth to their normal positions is challenging because this requires bodily movement and translation of one tooth to pass another. This procedure may cause damage to the teeth or supporting structures. We report a case of complete transposition of maxillary canine and lateral incisor. Transposed teeth were successfully moved orthodontically to their normal positions. Multiple mechanics were meticulously applied to achieve complete correction of the tooth positions and to minimize root resorption and/or periodontal defects of canine and lateral incisors. Factors concerning treatment planning for transposed teeth are discussed.

Tooth fractures in canine clinical practice

International Nuclear Information System (INIS)

Capik, I.; Ledecky, V.; Sevcik, A.

2001-01-01

Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients

Canine faecal contamination and parasitic risk in the city of Naples (southern Italy

Directory of Open Access Journals (Sweden)

Veneziano Vincenzo

2006-09-01

Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between

Current state of knowledge: the canine gastrointestinal microbiome.

Science.gov (United States)

Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S

2012-06-01

Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.

Molecular and serological surveillance of canine enteric viruses in stray dogs from Vila do Maio, Cape Verde.

Science.gov (United States)

Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis

2014-04-23

Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from

Molecular surveillance of traditional and emerging pathogens associated with canine infectious respiratory disease.

Science.gov (United States)

Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio

2016-08-30

A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.

Comparison of canine retraction using single and Siamese edgewise brackets: An in vivo study

Directory of Open Access Journals (Sweden)

Zeeshan Iqbal Bhat

2013-01-01

Full Text Available Objectives: The purpose of this study was to check the rate of canine retraction with bodily mechanics using two different pre-adjusted edgewise bracket Systems. Materials and Methods: A split mouth study with twenty patients who were randomly selected and allotted to a single operator. Duration of canine retraction, angulation of canine during its retraction, degree of Rotation, anchorage Loss, distance between canine and premolar at different time intervals were then evaluated, pre- (To, 3 months- (T1 and canine tip touches the second premolar- (T2. Descriptive statistics including mean values and standard deviations were calculated. Paired and unpaired t-test was performed to evaluate the differences between the groups. Results: Rotation and angulation of the canines did not show significant difference in both the systems. There was statistically significant difference (P<0.01 in anchorage loss between single wing and Siamese bracket being 2.65 ±1.41 mm and 1.31 ± 0.93 respectively. There was statistically significant intergroup difference (P<0.01 in canine movement i.e distance between canine and premolar was recorded as 4.72mm (15.06 ± 1.69 to 10.34 ± 1.68mm in single wing bracket and 6.25mm in Siamese (15.52 ± 1.41 to 9.27 ± 1.94. Conclusion: In cases where high anchorage is required and the rate of canine retraction is a concern, Siamese brackets pose a definite advantage over Single wing brackets.

Validation of anti-FXR1 antibodies in the canine species and application to an immunohistochemical study of canine oral melanomas

Directory of Open Access Journals (Sweden)

Laura Nordio

2017-05-01

Full Text Available FXR1 (Fragile X mental retardation-related protein 1 is a cytoplasmic RNA binding protein, which genetic expression has been related to metastatic potential in human melanoma. The aims of the present study were: the validation of two commercially available clones of polyclonal anti-human FXR1 antibody in dogs; their application to investigate FXR1 expression in a group of canine oral melanomas. Anti-FXR1 antibody was not previously validated in the canine species. Two different commercially available polyclonal anti-FXR1 antibodies (respectively made in goat and in rabbit were used. FXR1 protein in canine serum was identified by western blot after SDS-PAGE, using human serum as control. FXR1 immunohistochemical expression was tested in a series of normal tissues, that are expected to express FXR1, and in 31 cases of oral melanomas. The final immunohistochemical protocol used heat-induced unmasking and overnight incubation. FXR1 protein bands in canine serum were detected by tested antibodies, in a more specific way by the rabbit antibody. FXR1 immunohistochemical staining was positive in all tested organs, with different levels of expression. FXR1 was also expressed in 31/31 tested melanomas, with variable intensity and percentage of positive cells (Figure 1. Equal results were achieved with the two antibodies in 8 cases of melanoma, whereas there were variable differences in 22, and one case stained only with goat antibody. The rabbit antibody gave less background staining. This study validated anti-FXR1 antibodies for use in the canine species. This protein was expressed in various normal tissues, as well as in the tested neoplasms. Significance of different level of expression is undergoing evaluation with further studies.

Models of experimental saccular aneurysms of carotid arteries in canine

International Nuclear Information System (INIS)

Zhang Haixia; Cheng Yingsheng; Li Minghua

2006-01-01

Objective: To study the availability by making experimental saccular aneurysm models of carotid arteries in canine similar to human intracranial aneurysms. Methods: Twenty healthy canines with experimental saccular side-wall aneurysms of carotid arteries were created successfully by surgery. Results: Forty experimental saccular side-wall aneurysms of carotid arteries were created successfully with 36 aneurysms and parent arteries maintaining patency with each other and four spontaneously occluded confirmed by angiography. Model successful rate reached 90%. Conclusions: Experimental saccular side-wall aneurysms of carotid arteries in canines were one of best models created for simulating human intracranial aneurysms. (authors)

Testosterone biotransformation by the isolated perfused canine pancreas

International Nuclear Information System (INIS)

Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G.

1991-01-01

There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis

Testosterone biotransformation by the isolated perfused canine pancreas

Energy Technology Data Exchange (ETDEWEB)

Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))

1991-01-01

There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.

Influence of feeding on serum canine pancreatic lipase immunoreactivity concentrations

Directory of Open Access Journals (Sweden)

Steiner JM

2014-10-01

Full Text Available Jörg M Steiner, Craig G Ruaux, David A Williams Gastrointestinal Laboratory, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, USA Abstract: Measurement of serum concentration of pancreatic lipase immunoreactivity (PLI has been shown to be highly specific for exocrine pancreatic function and sensitive for the diagnosis of canine pancreatitis. Currently, it is recommended that food be withheld for at least 12 hours before collecting a blood sample for analysis from dogs. However, it is unknown whether feeding has any influence on serum canine PLI concentration. Thus, the goal of this study was to evaluate the influence of feeding on serum canine PLI concentrations in healthy dogs. Food was withheld from eight healthy adult Beagle dogs for at least 17 hours and a baseline serum sample (0 minutes was collected. Dogs were fed and serum samples were collected at 15, 30, 45, 60, 75, 90, 105, 150, 180, 210, 240, 300, 360, 420, and 480 minutes. There was no significant difference in serum canine PLI concentrations at any time after feeding (P=0.131. We conclude that feeding has no significant influence on serum canine PLI concentrations. Keywords: dog, pancreatic function, pancreatitis, biomarker, diagnostic test

Alkaline phosphatase activity in gingival crevicular fluid during canine retraction.

Science.gov (United States)

Batra, P; Kharbanda, Op; Duggal, R; Singh, N; Parkash, H

2006-02-01

The aim of the study was to investigate alkaline phosphatase activity in the gingival crevicular fluid (GCF) during orthodontic tooth movement in humans. Postgraduate orthodontic clinic. Ten female patients requiring all first premolar extractions were selected and treated with standard edgewise mechanotherapy. Canine retraction was done using 100 g sentalloy springs. Maxillary canine on one side acted as experimental site while the contralateral canine acted as control. Gingival crevicular fluid was collected from mesial and distal of canines before initiation of canine retraction (baseline), immediately after initiation of retraction, and on 1st, 7th, 14th and 21st day and the alkaline phosphatase activity was estimated. The results show significant (p < 0.05) changes in alkaline phosphatase activity on the 7th, 14th and 21st day on both mesial and distal aspects of the compared experimental and control sides. The peak in enzyme activity occurred on the 14th day of initiation of retraction followed by a significant fall in activity especially on the mesial aspect. The study showed that alkaline phosphatase activity could be successfully estimated in the GCF using calorimetric estimation assay kits. The enzyme activity showed variation according to the amount of tooth movement.

Extent and distribution of skeletal muscle necrosis after graded periods of complete ischemia

International Nuclear Information System (INIS)

Labbe, R.; Lindsay, T.; Walker, P.M.

1987-01-01

The management of an acutely ischemic extremity requires knowledge of the response of skeletal muscle (the largest component of the lower limb) to prolonged periods of complete normothermic ischemia. We have used the canine gracilis muscle model to evaluate the extent and distribution of ischemic necrosis after 3 and 5 hours of ischemia and 48 hours of reperfusion. Each muscle was cut into six slices, and the extent and distribution of postischemic necrosis identified by means of nitroblue tetrazolium staining and 99mTc pyrophosphate uptake. After 3, 4, and 5 hours of ischemia the extent of necrosis was 2.0% +/- 0.9%, 30.3% +/- 6.0%, and 90.1% +/- 3.5% (mean +/- SEM), respectively. A statistically significant correlation exists between the extent of necrosis and the uptake of 99mTc pyrophosphate uptake per gram of tissue (y = 1574.9x - 8.4, r = 0.84, p less than 0.001). Most necrosis was centrally located and found in the thickest portion of the muscle. We conclude that there is a graded response in the extent of skeletal muscle necrosis related to the length of ischemic stress rather than an ''all-or-none'' phenomenon. This central distribution of necrosis makes the usual external evaluation of ischemic damage clinically unreliable. In addition, since there was no enveloping fascia in this model, a compartment release alone may not prevent the development of skeletal muscle necrosis. This knowledge of the response of skeletal muscle to ischemia may lead to an improved clinical approach to an extremity suffering a prolonged ischemic insult

Orthodontic-surgical treatment of bilateral maxillary canine impaction

OpenAIRE

Sumitra

2012-01-01

A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle's Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth an...

Development of a Vaccine Incorporating Killed Virus of Canine Origin for the Prevention of Canine Parvovirus Infection

Science.gov (United States)

Povey, C.

1982-01-01

A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted form was immunogenic in 20 of 20 vaccinated dogs. The double adjuvanted vaccine is selected as the one of choice on the basis of best and most persistent seriological response. PMID:7039811

MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.

Science.gov (United States)

Lopez, Cecilia M; Yu, Peter Y; Zhang, Xiaoli; Yilmaz, Ayse Selen; London, Cheryl A; Fenger, Joelle M

2018-01-01

Osteosarcoma (OSA) is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease. RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes. These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.

MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.

Directory of Open Access Journals (Sweden)

Cecilia M Lopez

Full Text Available Osteosarcoma (OSA is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease.RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes.These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.

Homologous radioimmunoassay for canine prolactin and its application in various physiological states

International Nuclear Information System (INIS)

Graef, K.-J.; Friedreich, E.; Matthes, S.; Hasan, S.H.

1977-01-01

The purification of canine prolactin and the development of an homologous radioimmunoassay including several physiological studies in the Beagle dog are described. The assay measured immunoreactive canine prolactin with a sensitivity limit of 0.6 ng/ml. Purified canine luteinizing hormone gave no significant inhibition in the assay whereas purified canine growth hormone inhibited the binding of 125 I-labelled canine prolactin to antiserum only at very high dose levels. In Beagle dogs, basal serum prolactin concentrations were in the range 1 to 2 ng/ml in normal male, normal female (metoestrus and anoestrus) and oophorectomized-hysterectomized female dogs. The prolactin concentration in one sample of amniotic fluid was in the same range, while in hypophysectomized make dogs no serum prolactin could be detected by the assay system. Serum prolactin concentrations tended to increase during late pregnancy and parturition, remaining high during the first 9 days of lactation. In consequence, a negative correlation was suggested between serum prolactin and serum progesterone concentrations. (author)

Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus

Directory of Open Access Journals (Sweden)

Lourdes M. B. Pessoa

2016-01-01

Full Text Available The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.

Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus)

OpenAIRE

Pessoa, Lourdes M. B.; Roza, Marcello; Farias, Anderson; Jesus, Pedro Henrique de; Campbell, Rita de Cassia; Pinho, Mariângela Pereira de

2016-01-01

The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.

PMab-38 Recognizes Canine Podoplanin of Squamous Cell Carcinomas.

Science.gov (United States)

Kaneko, Mika K; Honma, Ryusuke; Ogasawara, Satoshi; Fujii, Yuki; Nakamura, Takuro; Saidoh, Noriko; Takagi, Michiaki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

2016-10-01

Podoplanin, a type I transmembrane protein, is expressed in lymphatic endothelial cells. Although we previously developed an anticanine podoplanin monoclonal antibody (mAb), PMab-38, immunohistochemistry (IHC) showed that it did not react with canine lymphatic endothelial cells. Here, we determined whether PMab-38 recognizes canine podoplanin of squamous cell carcinomas (SCCs) and clarified its epitope. In IHC, PMab-38 reacted with 83% of SCCs (15/18 cases). Flow cytometry showed that the epitope of PMab-38 was different from that of the platelet aggregation-stimulating domain of the N-terminus, which was detected by almost all antipodoplanin mAbs such as D2-40 or NZ-1. PMab-38 is expected to be useful for investigating the function of podoplanin in canine tumors.

Severe canine distemper outbreak in unvaccinated dogs in Mozambique.

Science.gov (United States)

Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G

2016-07-15

Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.

Diclofenac prolongs repolarization in ventricular muscle with impaired repolarization reserve.

Directory of Open Access Journals (Sweden)

Attila Kristóf

Full Text Available BACKGROUND: The aim of the present work was to characterize the electrophysiological effects of the non-steroidal anti-inflammatory drug diclofenac and to study the possible proarrhythmic potency of the drug in ventricular muscle. METHODS: Ion currents were recorded using voltage clamp technique in canine single ventricular cells and action potentials were obtained from canine ventricular preparations using microelectrodes. The proarrhythmic potency of the drug was investigated in an anaesthetized rabbit proarrhythmia model. RESULTS: Action potentials were slightly lengthened in ventricular muscle but were shortened in Purkinje fibers by diclofenac (20 µM. The maximum upstroke velocity was decreased in both preparations. Larger repolarization prolongation was observed when repolarization reserve was impaired by previous BaCl(2 application. Diclofenac (3 mg/kg did not prolong while dofetilide (25 µg/kg significantly lengthened the QT(c interval in anaesthetized rabbits. The addition of diclofenac following reduction of repolarization reserve by dofetilide further prolonged QT(c. Diclofenac alone did not induce Torsades de Pointes ventricular tachycardia (TdP while TdP incidence following dofetilide was 20%. However, the combination of diclofenac and dofetilide significantly increased TdP incidence (62%. In single ventricular cells diclofenac (30 µM decreased the amplitude of rapid (I(Kr and slow (I(Ks delayed rectifier currents thereby attenuating repolarization reserve. L-type calcium current (I(Ca was slightly diminished, but the transient outward (I(to and inward rectifier (I(K1 potassium currents were not influenced. CONCLUSIONS: Diclofenac at therapeutic concentrations and even at high dose does not prolong repolarization markedly and does not increase the risk of arrhythmia in normal heart. However, high dose diclofenac treatment may lengthen repolarization and enhance proarrhythmic risk in hearts with reduced repolarization reserve.

[Biological characteristics of a chimeric rabies virus expressing canine parvovirus VP2 protein].

Science.gov (United States)

Niu, Xue-Feng; Liu, Xiao-Hui; Sun, Zhao-Jin; Shi, He-He; Chen, Jing; Jiang, Bido; Sun, Jing-Chen; Guo, Xiao-Feng

2009-09-01

To obtain a bivalence vaccine against canine rabies virus and canine parvovirus, a chimeric rabies virus expressing canine parvovirus VP2 protein was generated by the technique of reverse genetics. It was shown that the chimeric virus designated as HEP-Flury (VP2) grew well on BHK-21 cells and the VP2 gene could still be stably expressed after ten passages on BHK-21 cells. Experiments on the mice immunized with the chimeric virus HEP-Flury (VP2) demonstrated that specific antibodies against rabies virus and canine parvovirus were induced in immunized mice after vaccination with the live chimeric virus.

Cellular endocytic compartment localization of expressed canine CD1 molecules

DEFF Research Database (Denmark)

Schjærff, Mette; Keller, Stefan M.; Affolter, Verena K.

2016-01-01

CD1 molecules are glycoproteins present primarily on dendritic cells (DCs), which recognize and presenta variety of foreign- and self-lipid antigens to T-cells. Humans have five different CD1 isoforms that sur-vey distinct cellular compartments allowing for recognition of a large repertoire...... onlya diminished GFP expression. In conclusion, canine CD1 transfectants show distinct localization patternsthat are similar to human CD1 proteins with the exception of the canine CD1d isoform, which most likelyis non-functional. These findings imply that canine CD1 localization overall resembles human...... CD1 traf-ficking patterns. This knowledge is important for the understanding of lipid antigen-receptor immunityin the dog....

Canine Gouging: A Taboo Resurfacing in Migrant Urban Population.

Science.gov (United States)

Noman, Anila Virani; Wong, Ferranti; Pawar, Ravikiran Ramakrishna

2015-01-01

Cosmopolitan cities have become a pool of migrants from different parts of the world, who carry their cultural beliefs and superstitions with them around the globe. Canine gouging is a kind of infant oral mutilation (IOM) which is widely practiced among rural population of Africa where the primary tooth bud of the deciduous canine is enucleated. The belief is that the life threatening illnesses in children like vomiting, diarrhoea, and fevers are caused by worms which infest on tooth buds. This case report is of a 15-year-old Somalian born boy, who presented at the dental institute with intermittent pain in his lower right permanent canine which was associated with a discharging intra oral buccal sinus. The tooth was endodontically treated and then restored with composite. General dental practitioners need to be vigilant when encountered with tooth presenting unusual morphology, unilateral missing tooth, and shift in the midline due to early loss of deciduous/permanent canines. Identification of any such dental mutilation practice will need further counselling of the individual and family members. It is the duty of every dental professional to educate and safeguard the oral and dental health of general public.

Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines

Directory of Open Access Journals (Sweden)

Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman

2011-01-01

Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.

Orthodontic management of bilaterally impacted mandibular canines in a growing patient

Directory of Open Access Journals (Sweden)

Rajaganesh J Gautam

2016-01-01

Full Text Available KK, an 11.9-year-old male patient, presented with the chief complaint of forwardly placed upper front teeth. Diagnosis revealed a Class II subdivision right malocclusion on an underlying Class I skeletal base with a horizontal growth pattern, bimaxillary proclination, crowding in the lower arch, over retained deciduous canines in the upper right and lower quadrants, an unerupted maxillary right permanent canine, and bilaterally impacted mandibular permanent canines, an increased overjet, and a deep overbite. He had a mild convex profile, a toothy smile with a nonconsonant smile arc and mildly protrusive lips. Treatment with a nonextraction treatment plan, which included surgical uncovering and orthodontic eruptive guidance of the impacted mandibular canines, with multibracket metallic fixed appliances, solved the patient′s complaints and achieved an esthetically pleasing and functionally adequate occlusal result.

Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.

OpenAIRE

McMaster, G K; Tratschin, J D; Siegl, G

1981-01-01

The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.

Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus

Directory of Open Access Journals (Sweden)

Sudarisman

2006-03-01

Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.

Comparative photoelastic study of dental and skeletal anchorages in the canine retraction

Directory of Open Access Journals (Sweden)

Cristiane Aparecida de Assis Claro

2014-01-01

Full Text Available OBJECTIVE: To compare dental and skeletal anchorages in mandibular canine retraction by means of a stress distribution analysis. METHODS: A photoelastic model was produced from second molar to canine, without the first premolar, and mandibular canine retraction was simulated by a rubber band tied to two types of anchorage: dental anchorage, in the first molar attached to adjacent teeth, and skeletal anchorage with a hook simulating the mini-implant. The forces were applied 10 times and observed in a circular polariscope. The stresses located in the mandibular canine were recorded in 7 regions. The Mann-Whitney test was employed to compare the stress in each region and between both anchorage systems. The stresses in the mandibular canine periradicular regions were compared by the Kruskal-Wallis test. RESULTS: Stresses were similar in the cervical region and the middle third. In the apical third, the stresses associated with skeletal anchorage were higher than the stresses associated with dental anchorage. The results of the Kruskal-Wallis test showed that the highest stresses were identified in the cervical-distal, apical-distal, and apex regions with the use of dental anchorage, and in the apical-distal, apical-mesial, cervical-distal, and apex regions with the use of skeletal anchorage. CONCLUSIONS: The use of skeletal anchorage in canine retraction caused greater stress in the apical third than the use of dental anchorage, which indicates an intrusive component resulting from the direction of the force due to the position of the mini-implant and the bracket hook of the canine.

Tumor microvessel density–associated mast cells in canine nodal lymphoma

Science.gov (United States)

Mann, Elizabeth; Whittington, Lisa

2014-01-01

Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4) was significantly higher (p < 0.05) than that in the control (0.83 ± 0.3) and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009). Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended. PMID:26770752

Tumor microvessel density–associated mast cells in canine nodal lymphoma

Directory of Open Access Journals (Sweden)

Moges Woldemeskel

2014-11-01

Full Text Available Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4 was significantly higher (p < 0.05 than that in the control (0.83 ± 0.3 and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009. Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended.

How far is the root apex of a unilateral impacted canine from the root apices' arch form?

Science.gov (United States)

Kim, Sung-Hun; Kim, You-Min; Oh, Sewoong; Kim, Seong-Sik; Park, Soo-Byung; Son, Woo-Sung; Kim, Yong-Il

2017-02-01

The purpose of this study was to determine the arch form of the root apices of normally erupting teeth and then determine the differences in the location of the apex of impacted canines relative to normally erupting canines. In addition, we sought to determine whether the labiopalatal position of the impacted canines influences the position of the apices. The study included 21 patients with unerupted canines that subsequently had a normal eruption, 21 patients with palatally impacted canines, 27 patients with labially impacted canines, and 17 patients with midalveolus impacted canines. Images were obtained using cone beam computed tomography, and the x, y, and z coordinates of the root apices were determined using Ondemand3D software (Cybermed Co., Seoul, Korea). Two-dimensional coordinates were converted from acquired 3-dimensional coordinates via projection on a palatal plane, and the Procrustes method was used to process the converted 2-dimensional coordinates and to draw the arch forms of the root apices. Finally, we measured the extent of root apex deviation from the arch forms of the root apices. Normally erupting canines showed that even though calcifications may be immature, their positions were aligned with a normal arch form. The root apices of the impacted canines were an average of 6.572 mm away from the root apices' arch form, whereas those of the contralateral nonimpacted canines were an average distance of 2.221 mm away, a statistically significant difference. The palatally impacted canines' root apices distribution tended toward the first premolar root apices. Incompletely calcified, unerupted teeth with a subsequent normal eruption showed a normal arch form of the root apices. The root apices of impacted canines were farther from the arch forms than were the nonimpacted canines. Also, the root apices of impacted canines in the palatal area showed distributions different from those of the other impacted canine groups. Copyright © 2017 American

The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.

Science.gov (United States)

Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki

2015-04-17

Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

Automated tru-cut imaging-guided core needle biopsy of canine ...

African Journals Online (AJOL)

The purpose of this study was to evaluate the diagnostic value of imaging-guided core needle biopsy for canine orbital mass diagnosis. A second excisional biopsy obtained during surgery or necropsy was used as the reference standard. A prospective feasibility study was conducted in 23 canine orbital masses at a single ...

Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

International Nuclear Information System (INIS)

Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma

2006-01-01

Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs

Feline and canine coronaviruses: common genetic and pathobiological features.

Science.gov (United States)

Le Poder, Sophie

2011-01-01

A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP) and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV) will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma.

Science.gov (United States)

Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid

2016-01-01

Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma.

Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

1999-08-02

Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

Directory of Open Access Journals (Sweden)

Otávio Valério Carvalho

2012-01-01

Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.

Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

Science.gov (United States)

Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo

2012-01-01

Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403

Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia

Directory of Open Access Journals (Sweden)

Víctor Acero P

2015-09-01

Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.

Compensatory canine angulation in angle Class II and III patients

Directory of Open Access Journals (Sweden)

Mauro Carlos Agner Busato

2009-09-01

Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.

European surveillance of emerging pathogens associated with canine infectious respiratory disease.

Science.gov (United States)

Mitchell, Judy A; Cardwell, Jacqueline M; Leach, Heather; Walker, Caray A; Le Poder, Sophie; Decaro, Nicola; Rusvai, Miklos; Egberink, Herman; Rottier, Peter; Fernandez, Mireia; Fragkiadaki, Eirini; Shields, Shelly; Brownlie, Joe

2017-12-01

Canine infectious respiratory disease (CIRD) is a major cause of morbidity in dogs worldwide, and is associated with a number of new and emerging pathogens. In a large multi-centre European study the prevalences of four key emerging CIRD pathogens; canine respiratory coronavirus (CRCoV), canine pneumovirus (CnPnV), influenza A, and Mycoplasma cynos (M. cynos); were estimated, and risk factors for exposure, infection and clinical disease were investigated. CIRD affected 66% (381/572) of the dogs studied, including both pet and kennelled dogs. Disease occurrence and severity were significantly reduced in dogs vaccinated against classic CIRD agents, canine distemper virus (CDV), canine adenovirus 2 (CAV-2) and canine parainfluenza virus (CPIV), but substantial proportions (65.7%; 201/306) of vaccinated dogs remained affected. CRCoV and CnPnV were highly prevalent across the different dog populations, with overall seropositivity and detection rates of 47% and 7.7% for CRCoV, and 41.7% and 23.4% for CnPnV, respectively, and their presence was associated with increased occurrence and severity of clinical disease. Antibodies to CRCoV had a protective effect against CRCoV infection and more severe clinical signs of CIRD but antibodies to CnPnV did not. Involvement of M. cynos and influenza A in CIRD was less apparent. Despite 45% of dogs being seropositive for M. cynos, only 0.9% were PCR positive for M. cynos. Only 2.7% of dogs were seropositive for Influenza A, and none were positive by PCR. Copyright © 2017 Elsevier B.V. All rights reserved.

Canine obesity: an overview.

Science.gov (United States)

Gossellin, J; Wren, J A; Sunderland, S J

2007-08-01

Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.

Peracute Infectious Canine Hepatitis

Directory of Open Access Journals (Sweden)

A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam

2012-05-01

Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.

Radioresistant canine hematopoietic cells

International Nuclear Information System (INIS)

Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.

1987-01-01

Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells

Life-long diseases need life-long treatment: long-term safety of ciclosporin in canine atopic dermatitis

Science.gov (United States)

Nuttall, Tim; Reece, Douglas; Roberts, Elizabeth

2014-01-01

Ciclosporin (Atopica; Novartis Animal Health) has been licensed for canine atopic dermatitis (AD) since 2002. Adverse events (AEs) have been reported in 55 per cent of 759 dogs in 15 clinical trials, but are rare in pharmacovigilance data (71.81 AEs/million capsules sold). Gastrointestinal reactions were most common, but were mild and rarely required intervention. Other AEs were rare (≤1 per cent in clinical trials; metabolism is not clinically significant for normal dogs. Concomitant treatment with most drugs is safe. Effects on cytochrome P450 and MDR1 P-glycoprotein activity may elevate plasma ciclosporin concentrations, but short-term changes are not clinically significant. Monitoring of complete blood counts, urinalysis or ciclosporin levels is not justified except with higher than recommended doses and/or long-term concurrent immunosuppressive drugs. Ciclosporin is not a contraindication for killed (including rabies) vaccines, but the licensed recommendation is that live vaccination is avoided during treatment. In conclusion, ciclosporin has a positive risk-benefit profile for the long-term management of canine AD. PMID:24682696

Detection of Arctic and European cluster of canine distemper virus in north and center of Iran.

Science.gov (United States)

Namroodi, Somayeh; Rostami, Amir; Majidzadeh-Ardebili, Keyvan; Ghalyanchi Langroudi, Arash; Morovvati, Abbas

2015-01-01

Canine distemper virus (CDV) creates a very contagious viral multi-systemic canine distemper (CD) disease that affects most species of Carnivora order. The virus is genetically heterogeneous, particularly in section of the hemagglutinin (H) gene. Sequence analysis of the H gene can be useful to investigate distinction of various lineages related to geographical distribution and CDV molecular epidemiology. Since vaccination program is conducted only in large cities of Iran, CD still remains as one of the major causes of death in dogs in this country. In order to monitor H gene, CDV has been detected in 14 out of 19 sampled dogs through the amplification of nucleoprotein (NP) gene in nested-PCR assay. In the next step 665 bp of H gene was amplified in 9 out of 14 NP-gene positive dogs. Phylogenetic analysis distinguished two distinct CDV genotypes in Iran. JN941238 has been embedded in European cluster and JN941239 has been embedded in Arctic cluster. Nucleic analysis has been shown high difference among both Iranian CDV lineages with CDV vaccine strains.

Transperineal in vivo fluence-rate dosimetry in the canine prostate during SnET2-mediated PDT

International Nuclear Information System (INIS)

Lilge, Lothar; Pomerleau-Dalcourt, Natalie; Douplik, Alexander; Selman, Steven H; Keck, Rick W; Szkudlarek, Maria; Pestka, Maciej; Jankun, Jerzy

2004-01-01

Advances in photodynamic therapy (PDT) treatment for prostate cancer can be achieved either by improving selectivity of the photosensitizer towards prostate gland tissue or improving the dosimetry by means of individualized treatment planning using currently available photosensitizers. The latter approach requires the ability to measure, among other parameters, the fluence rate at different positions within the prostate and the ability to derive the tissue optical properties. Here fibre optic probes are presented capable of measuring the fluence rate throughout large tissue volumes and a method to derive the tissue optical properties for different volumes of the prostate. The responsivity of the sensors is sufficient to detect a fluence rate of 0.1 mW cm -2 . The effective attenuation coefficient in the canine prostate at 660 nm is higher at the capsule (2.15 ± 0.19 cm -1 ) than in proximity of the urethra (1.84 ± 0.36 cm -1 ). Significant spatial and temporal intra- and inter-canine variability in the tissue optical properties was noted, highlighting the need for individualized monitoring of the fluence rate for improved dosimetry

Surgical innovations in canine gonadectomy

NARCIS (Netherlands)

Van Goethem, Bart

2016-01-01

In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated

[Consolidation of international guidelines for the management of canine populations in urban areas and proposal of performance indicators].

Science.gov (United States)

Garcia, Rita de Cassia Maria; Calderón, Néstor; Ferreira, Fernando

2012-08-01

The objective of this study is to propose a generic program for the management of urban canine populations with suggestion of performance indicators. The following international guidelines on canine population management were revised and consolidated: World Health Organization, World Organisation for Animal Health, World Society for the Protection of Animals, International Companion Animal Management Coalition, and the Food and Agriculture Organization. Management programs should cover: situation diagnosis, including estimates of population size; social participation with involvement of various sectors in the planning and execution of strategies; educational actions to promote humane values, animal welfare, community health, and responsible ownership (through purchase or adoption); environmental and waste management to eliminate sources of food and shelter; registration and identification of animals; animal health care, reproductive control; prevention and control of zoonoses; control of animal commerce; management of animal behavior and adequate solutions for abandoned animals; and laws regulating responsible ownership, prevention of abandonment and zoonoses. To monitor these actions, four groups of indicators are suggested: animal population indicators, human/animal interaction indicators, public service indicators, and zoonosis indicators. The management of stray canine populations requires political, sanitary, ethologic, ecologic, and humanitarian strategies that are socially acceptable and environmentally sustainable. Such measures must also include the control of zoonoses such as rabies and leishmaniasis, considering the concept of "one health," which benefits both the animals and people in the community.

Maxillary canine displacement and genetically determined predisposition to disturbed development of the dentition.

Science.gov (United States)

Stahl, Franka; Grabowski, Rosemarie

2003-05-01

The relationship between maxillary canine displacement and the simultaneous occurrence of "genetically determined predisposition to disturbed development of the dentition" as defined by Hoffmeister was investigated in 675 patients. Panoramic radiographs taken of each patient during the first and the second mixed dentition periods were evaluated. Canine inclination and the distance between the tip of the canine and a line connecting the cusps of the molars were computed in five different age groups according to Dausch-Neumann. Statistical analysis revealed 34 patients with "potential canine displacement", who exhibited further symptoms of "genetically determined predisposition to disturbed development of the dentition" significantly more frequently than the total group. The symptoms concerned were agenesia, displaced tooth buds, rotated or tilted incisors, aplasia and microdontia of lateral incisors. Careful follow-ups in patients with a predisposition to disturbed dental development enables risks to be anticipated and canine displacement to be detected at an early stage.

Expression of nociceptive ligands in canine osteosarcoma.

Science.gov (United States)

Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M

2015-01-01

Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.

Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features

Directory of Open Access Journals (Sweden)

Sophie Le Poder

2011-01-01

Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

THE REDUCED CANINE PANCREAS TO STUDY THE EFFECTS OF INTRAOPERATIVE RADIOTHERAPY

NARCIS (Netherlands)

HEIJMANS, HJ; MEHTA, D; KLEIBEUKER, JH; SLUITER, WJ; HOEKSTRA, HJ

1993-01-01

A canine model is described to study the tolerance of the pancreas to intra-operative radiotherapy (IORT). The canine pancreas is a horseshoe-shaped organ. To create a homogeneous delivery of IORT to the whole pancreas surgical manipulation is necessary which may induce pancreatitis. A resection of

Laparoscopic radical prostatectomy in the canine model.

Science.gov (United States)

Price, D T; Chari, R S; Neighbors, J D; Eubanks, S; Schuessler, W W; Preminger, G M

1996-12-01

The purpose of this study was to determine the feasibility of performing laparoscopic radical prostatectomy in a canine model. Laparoscopic radical prostatectomy was performed on six adult male canines. A new endoscopic needle driver was used to construct a secure vesicourethral anastomosis. Average operative time required to complete the procedure was 304 min (range 270-345 min). Dissection of the prostate gland took an average of 67 min (range 35-90 min), and construction of the vesicourethral anastomosis took 154 min (rage 80-240 min). There were no intraoperative complications and only one postoperative complication (anastomotic leak). Five of the six animals recovered uneventfully from the procedure, and their foley catheters were removed 10-14 days postoperatively after a retrograde cystourethrogram demonstrated an intact vesicourethral anastomosis. Four (80%) of the surviving animals were clinically continent within 10 days after catheter removal. Post mortem examination confirmed that the vesicourethral anastomosis was intact with no evidence of urine extravasation. These data demonstrate the feasibility of laparoscopic radical prostatectomy in a canine model, and suggest that additional work with this technique should be continued to develop its potential clinical application.

In Situ Immunofluorescent Staining of Autophagy in Muscle Stem Cells

KAUST Repository

Castagnetti, Francesco; Fiacco, Elisabetta; Imbriano, Carol; Latella, Lucia

2017-01-01

with productive muscle regeneration. These data uncover the crucial role of autophagy in satellite cell activation during muscle regeneration in both normal and pathological conditions, such as muscular dystrophies. Here, we provide a protocol to monitor

Characterization of canine osteosarcoma by array comparative genomic hybridization and RT-qPCR: signatures of genomic imbalance in canine osteosarcoma parallel the human counterpart.

Science.gov (United States)

Angstadt, Andrea Y; Motsinger-Reif, Alison; Thomas, Rachael; Kisseberth, William C; Guillermo Couto, C; Duval, Dawn L; Nielsen, Dahlia M; Modiano, Jaime F; Breen, Matthew

2011-11-01

Osteosarcoma (OS) is the most commonly diagnosed malignant bone tumor in humans and dogs, characterized in both species by extremely complex karyotypes exhibiting high frequencies of genomic imbalance. Evaluation of genomic signatures in human OS using array comparative genomic hybridization (aCGH) has assisted in uncovering genetic mechanisms that result in disease phenotype. Previous low-resolution (10-20 Mb) aCGH analysis of canine OS identified a wide range of recurrent DNA copy number aberrations, indicating extensive genomic instability. In this study, we profiled 123 canine OS tumors by 1 Mb-resolution aCGH to generate a dataset for direct comparison with current data for human OS, concluding that several high frequency aberrations in canine and human OS are orthologous. To ensure complete coverage of gene annotation, we identified the human refseq genes that map to these orthologous aberrant dog regions and found several candidate genes warranting evaluation for OS involvement. Specifically, subsequenct FISH and qRT-PCR analysis of RUNX2, TUSC3, and PTEN indicated that expression levels correlated with genomic copy number status, showcasing RUNX2 as an OS associated gene and TUSC3 as a possible tumor suppressor candidate. Together these data demonstrate the ability of genomic comparative oncology to identify genetic abberations which may be important for OS progression. Large scale screening of genomic imbalance in canine OS further validates the use of the dog as a suitable model for human cancers, supporting the idea that dysregulation discovered in canine cancers will provide an avenue for complementary study in human counterparts. Copyright © 2011 Wiley-Liss, Inc.

Eccentric Contraction-Induced Muscle Injury: Reproducible, Quantitative, Physiological Models to Impair Skeletal Muscle's Capacity to Generate Force.

Science.gov (United States)

Call, Jarrod A; Lowe, Dawn A

2016-01-01

In order to investigate the molecular and cellular mechanisms of muscle regeneration an experimental injury model is required. Advantages of eccentric contraction-induced injury are that it is a controllable, reproducible, and physiologically relevant model to cause muscle injury, with injury being defined as a loss of force generating capacity. While eccentric contractions can be incorporated into conscious animal study designs such as downhill treadmill running, electrophysiological approaches to elicit eccentric contractions and examine muscle contractility, for example before and after the injurious eccentric contractions, allows researchers to circumvent common issues in determining muscle function in a conscious animal (e.g., unwillingness to participate). Herein, we describe in vitro and in vivo methods that are reliable, repeatable, and truly maximal because the muscle contractions are evoked in a controlled, quantifiable manner independent of subject motivation. Both methods can be used to initiate eccentric contraction-induced injury and are suitable for monitoring functional muscle regeneration hours to days to weeks post-injury.

Detection and genetic characterization of Canine parvovirus and Canine coronavirus strains circulating in district of Tirana in Albania.

Science.gov (United States)

Cavalli, Alessandra; Desario, Costantina; Kusi, Ilir; Mari, Viviana; Lorusso, Eleonora; Cirone, Francesco; Kumbe, Ilirjan; Colaianni, Maria Loredana; Buonavoglia, Domenico; Decaro, Nicola

2014-07-01

An epidemiological survey for Canine parvovirus 2 (CPV-2) and Canine coronavirus (CCoV) was conducted in Albania. A total of 57 fecal samples were collected from diarrheic dogs in the District of Tirana during 2011-2013. The molecular assays detected 53 and 31 CPV- and CCoV-positive specimens, respectively, with mixed CPV-CCoV infections diagnosed in 28 dogs. The most frequently detected CPV type was 2a, whereas IIa was the predominant CCoV subtype. A better comprehension of the CPV-CCoV epidemiology in eastern European countries will help to assess the most appropriate vaccination strategies to prevent disease due to infections with these widespread agents of acute gastroenteritis in the dog.

Storage and allogeneic transplantation of peripheral nerve using a green tea polyphenol solution in a canine model

Directory of Open Access Journals (Sweden)

Noguchi Takashi

2010-11-01

Full Text Available Abstract Background In our previous study, allogeneic-transplanted peripheral nerve segments preserved for one month in a polyphenol solution at 4°C could regenerate nerves in rodents demonstrated the same extent of nerve regeneration as isogeneic fresh nerve grafts. The present study investigated whether the same results could be obtained in a canine model. Methods A sciatic nerve was harvested from a male beagle dog, divided into fascicules of Sry and β-actin to investigate whether cells of donor origin remained in the allogeneic nerve segments. FK506 concentration was measured in blood samples taken before the animals were killed. Results The total myelinated axon numbers and amplitudes of the muscle action potentials correlated significantly with the blood FK506 concentration. Few axons were observed in the allogeneic-transplanted nerve segments in the PA0.025 group. PCR showed clear Sry-specific bands in specimens from the PA0.1 and PA0.05 groups but not from the PA0.025 group. Conclusions Successful nerve regeneration was observed in the polyphenol-treated nerve allografts when transplanted in association with a therapeutic dose of FK506. The data indicate that polyphenols can protect nerve tissue from ischemic damage for one month; however, the effects of immune suppression seem insufficient to permit allogeneic transplantation of peripheral nerves in a canine model.

Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.

Science.gov (United States)

Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J

2014-03-01

Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (Posteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.

Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.

Science.gov (United States)

Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L

2016-02-19

Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.

Functional Characterization of Canine Interferon-Lambda

Science.gov (United States)

Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun

2014-01-01

In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142

Maxillary canine impactions related to impacted central incisors: two case reports.

Science.gov (United States)

Bayram, Mehmet; Ozer, Mete; Sener, Ismail

2007-09-01

The purpose of this case report is to describe the combined surgical and orthodontic treatment of two cases with an impacted maxillary central incisor and canine in the same quadrant and to discuss the causal relationship between them. The most common causes of canine impactions are usually the result of one or more factors such as a long path of eruption, tooth size-arch length discrepancies, abnormal position of the tooth bud, prolonged retention or early loss of the deciduous canine, trauma, the presence of an alveolar cleft, ankylosis, cystic or neoplastic formation, dilaceration of the root, supernumerary teeth, and odontomas. Although impaction of the maxillary central incisor is almost as prevalent as impacted canines its etiology is different. The principal factors involved in causing the anomaly are supernumerary teeth, odontomas, and trauma. Case #1: A 10.5-year-old girl in the early mixed dentition stage presented with a chief complaint of the appearance of her anterior teeth. She had a Class I skeletal pattern and a history of trauma to the maxillary central incisors at age five with premature exfoliation. Radiographs revealed an impacted upper right central incisor in the region of the nasal floor, delayed eruption of the maxillary permanent central incisor, and the adjacent lateral incisor was inclined toward the edentulous space. Treatment was done in two stages consisting of surgical exposure and traction of the impacted central incisor and fixed orthodontic treatment. Case #2: An 11.5-year-old girl presented for orthodontic treatment with the chief complaint of an unerupted tooth and the appearance of her upper anterior teeth. She was in the late mixed dentition period with a Class III skeletal pattern along with an anterior cross-bite with some maxillary transverse deficiency. The maxillary right canine and central incisor were absent, but the maxillary right deciduous canine was still present. Treatment included arch expansion followed by

Homogeneous Canine Chest Phantom Construction: A Tool for Image Quality Optimization.

Science.gov (United States)

Pavan, Ana Luiza Menegatti; Rosa, Maria Eugênia Dela; Giacomini, Guilherme; Bacchim Neto, Fernando Antonio; Yamashita, Seizo; Vulcano, Luiz Carlos; Duarte, Sergio Barbosa; Miranda, José Ricardo de Arruda; de Pina, Diana Rodrigues

2016-01-01

Digital radiographic imaging is increasing in veterinary practice. The use of radiation demands responsibility to maintain high image quality. Low doses are necessary because workers are requested to restrain the animal. Optimizing digital systems is necessary to avoid unnecessary exposure, causing the phenomenon known as dose creep. Homogeneous phantoms are widely used to optimize image quality and dose. We developed an automatic computational methodology to classify and quantify tissues (i.e., lung tissue, adipose tissue, muscle tissue, and bone) in canine chest computed tomography exams. The thickness of each tissue was converted to simulator materials (i.e., Lucite, aluminum, and air). Dogs were separated into groups of 20 animals each according to weight. Mean weights were 6.5 ± 2.0 kg, 15.0 ± 5.0 kg, 32.0 ± 5.5 kg, and 50.0 ± 12.0 kg, for the small, medium, large, and giant groups, respectively. The one-way analysis of variance revealed significant differences in all simulator material thicknesses (p optimize veterinary X-ray procedures.

Orthodontic treatment of a stubborn palatally ectopic canine: a case report.

Science.gov (United States)

Al-Musfir, Tumadher M; Morris, David O

2014-03-01

This is a case report that highlights a different treatment approach in dealing with palatally ectopic canines. The modified transpalatal arch with an 'active' arm was used to align a palatally ectopic canine with 'push' mechanics after the initial use of more conventional 'pull' mechanics (piggy-back archwire technique) had failed.

Successful experimental challenge of dogs with canine parvovirus-2.

OpenAIRE

Carman, S; Povey, C

1982-01-01

Withholding food from dogs for 24 hours prior to, and for 48 hours following oral challenge with a gut mucosal homogenate of canine parvovirus-2, was a successful means of reproducing gastroenteric signs of canine parvovirus-2 infection. Twenty-one of 24 dogs, which had previously received various vaccine preparations of mink enteritis virus or were unvaccinated, and which were starved at challenge, developed soft or liquid feces with large or without large clots of mucus. Altered feces were ...

Electron histochemical and autoradiographic studies of vascular smooth muscle cell

International Nuclear Information System (INIS)

Kameyama, Kohji; Aida, Takeo; Asano, Goro

1982-01-01

The authors have studied the vascular smooth muscle cell in the aorta and the arteries of brain, heart in autopsied cases, cholesterol fed rabbits and canine through electron histochemical and autoradiographic methods, using 3 H-proline and 3 H-thymidine. The vascular changes are variable presumably due to the functional and morphological difference of vessels. Aging, pathological condition and physiological requirement induce the disturbances of vascular functions as contractility. According to various pathological conditions, the smooth muscle cell altered their shape, surface properties and arrangement of subcellular organelles including changes in number. The morphological features of arteries during aging is characterized by the thickening of endothelium and media. Decreasing cellularity and increasing collagen contents in media. The autoradiographic and histochemical observations using periodic acid methenamine silver (PAM) and ruthenium red stains demonstrated that the smooth muscle cell is a connective tissue synthetic cell. The PAM impregnation have proved that the small bundle of microfilaments become associated with small conglomerate of collagen and elastic fibers. Cytochemical examination will provide sufficient evidence to establish the contribution of subcellular structure. The acid phosphatase play an important role in vascular disease and they are directly involved in cellular lipid metabolism in cholesterol fed animals, and the activity of Na-K ATPase on the plasma membrane may contribute to the regulation of vascular blood flow and vasospasms. Direct injury and subsequent abnormal contraction of smooth muscle cell may initiate increased permeability of plasma protein and lipid in the media layer and eventually may developed and enhance arteriosclerosis. (author)

Assessment of Periodontal Status of Surgically Exposed and Orthodontically Aligned Impacted Maxillary Canines

OpenAIRE

Adina Coșarcă; Mariana Păcurar; Cecilia Petrovan; Alina Ormenișan

2014-01-01

Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of t...

Bilateral Second Premolars Agenesia Together with a Unilateral Canine Radiculomegaly.

Science.gov (United States)

Kemoli, Arthur Musakulu; Junior, Thomas Munyao

2017-01-01

Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.

L-acetylcarnitine enhances functional muscle re-innervation.

Science.gov (United States)

Pettorossi, V E; Brunetti, O; Carobi, C; Della Torre, G; Grassi, S

1991-01-01

The efficacy of L-acetylcarnitine and L-carnitine treatment on motor re-innervation was analyzed by evaluating different muscular parameters describing functional muscle recovery after denervation and re-innervation. The results show that L-acetylcarnitine markedly enhances functional muscle re-innervation, which on the contrary is unaffected by L-carnitine. The medial gastrocnemius muscle was denervated by cutting the nerve at the muscle entry point. After 20 days the sectioned nerve was resutured into the medial gastrocnemius muscle, and the extent of re-innervation was monitored 45 days later. L-acetylcarnitine-treated animals show significantly higher twitch and tetanic tensions of re-innervated muscle. Furthermore the results, obtained by analysing the twitch time to peak and tetanic contraction-relaxation times, suggest that L-acetylcarnitine mostly affects the functional re-innervation of slow motor units. The possible mechanisms by which L-acetylcarnitine facilitates such motor and nerve recovery are discussed.

Recent advances in canine leptospirosis: focus on vaccine development

Directory of Open Access Journals (Sweden)

Klaasen HLBM

2015-06-01

Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis

Efficacy of feline anti-parvovirus antibodies in the treatment of canine parvovirus infection.

Science.gov (United States)

Gerlach, M; Proksch, A L; Unterer, S; Speck, S; Truyen, U; Hartmann, K

2017-07-01

This prospective, randomised, placebo-controlled, double-blinded study aimed to evaluate efficacy of commercially available feline anti-parvovirus antibodies in dogs with canine parvovirus infection. First, cross-protection of feline panleukopenia virus antibodies against canine parvovirus was evaluated in vitro. In the subsequent prospective clinical trial, 31 dogs with clinical signs of canine parvovirus infection and a positive faecal canine parvovirus polymerase chain reaction were randomly assigned to a group receiving feline panleukopenia virus antibodies (n=15) or placebo (n=16). All dogs received additional routine treatment. Clinical signs, blood parameters, time to clinical recovery and mortality were compared between the groups. Serum antibody titres and quantitative faecal polymerase chain reaction were compared on days 0, 3, 7, and 14. In vitro, canine parvovirus was fully neutralised by feline panleukopenia virus antibodies. There were no detected significant differences in clinical signs, time to clinical recovery, blood parameters, mortality, faecal virus load, or viral shedding between groups. Dogs in the placebo group showed a significant increase of serum antibody titres and a significant decrease of faecal virus load between day 14 and day 0, which was not detectable in dogs treated with feline panleukopenia virus antibodies. No significant beneficial effect of passively transferred feline anti-parvovirus antibodies in the used dosage regimen on the treatment of canine parvovirus infection was demonstrated. © 2017 British Small Animal Veterinary Association.

Impacted canines: Etiology, diagnosis, and orthodontic management

Directory of Open Access Journals (Sweden)

Ranjit Manne

2012-01-01

Full Text Available Impaction of maxillary and mandibular canines is a frequently encountered clinical problem, the treatment of which usually requires an interdisciplinary approach. Surgical exposure of the impacted tooth and the complex orthodontic mechanisms that are applied to align the tooth into the arch may lead to varying amounts of damage to the supporting structures of the tooth, not to mention the long treatment duration and the financial burden to the patient. Hence, it seems worthwhile to focus on the means of early diagnosis and interception of this clinical situation. In the present article, an overview of the incidence and sequelae, as well as the surgical, periodontal, and orthodontic considerations in the management of impacted canines is presented.

A re-evaluation of subspecific variation and canine dimorphism in woolly spider monkeys (Brachyteles arachnoides).

Science.gov (United States)

Leigh, S R; Jungers, W L

1994-12-01

A recent study suggests that differing populations of woolly spider monkeys exhibit a substantial degree of morphological, cytogenetic, and behavioral variation. We re-evaluate the differences between populations in the degree of canine tooth height sexual dimorphism and in the frequency of thumbs. Statistical analysis of variation in the degree of canine sexual dimorphism between these populations fails to provide strong evidence for subspecific variation: differences in the degree of canine dimorphism cannot be considered statistically significant. Differences between populations in the frequency of thumbs are, however, statistically significant. The lack of clear distinctions between populations in the degree of canine dimorphism complicates assessments of behavioral variation between these populations. We suggest that the level of geographic variation in woolly spider monkey canine dimorphism is not consistent with subspecific status.

Psychiatric Nurses' Views on Caring: Patients and Canine Companions.

Science.gov (United States)

King, Camille

2017-03-01

Psychiatric nurses are expert care providers for individuals with mental health needs. The art of caring spans across multiple species, is important to understand, and is universal whether intentions are toward individuals or animals. Pets are often cared for and viewed as family members. The current research examined psychiatric nurses' views on the similarities and differences of caring for patients and their pet dogs. Twenty-five nurses were interviewed. Similarities of caring for patients and canines included trusting relationships, companionship, daily basic needs, and improved communication through monitored body language. Differences in caring included personal expectations, unconditional love, and professional boundaries. Understanding the concepts of caring for patients and pet dogs will provide the opportunity for insight into familial versus professional relationships, improve communication with others, and strengthen the human-animal bond. [Journal of Psychosocial Nursing and Mental Health Services, 55(3), 46-52.]. Copyright 2017, SLACK Incorporated.

Adaptable piezoelectric hemispherical composite strips using a scalable groove technique for a self-powered muscle monitoring system.

Science.gov (United States)

Alluri, Nagamalleswara Rao; Vivekananthan, Venkateswaran; Chandrasekhar, Arunkumar; Kim, Sang-Jae

2018-01-18

Contrary to traditional planar flexible piezoelectric nanogenerators (PNGs), highly adaptable hemispherical shape-flexible piezoelectric composite strip (HS-FPCS) based PNGs are required to harness/measure non-linear surface motions. Therefore, a feasible, cost-effective and less-time consuming groove technique was developed to fabricate adaptable HS-FPCSs with multiple lengths. A single HS-CSPNG generates 130 V/0.8 μA and can also work as a self-powered muscle monitoring system (SP-MMS) to measure maximum human body part movements, i.e., spinal cord, throat, jaw, elbow, knee, foot stress, palm hand/finger force and inhale/exhale breath conditions at a time or at variable time intervals.

Cost-effectiveness of canine vaccination to prevent human rabies in rural Tanzania.

Science.gov (United States)

Fitzpatrick, Meagan C; Hampson, Katie; Cleaveland, Sarah; Mzimbiri, Imam; Lankester, Felix; Lembo, Tiziana; Meyers, Lauren A; Paltiel, A David; Galvani, Alison P

2014-01-21

The annual mortality rate of human rabies in rural Africa is 3.6 deaths per 100 000 persons. Rabies can be prevented with prompt postexposure prophylaxis, but this is costly and often inaccessible in rural Africa. Because 99% of human exposures occur through rabid dogs, canine vaccination also prevents transmission of rabies to humans. To evaluate the cost-effectiveness of rabies control through annual canine vaccination campaigns in rural sub-Saharan Africa. We model transmission dynamics in dogs and wildlife and assess empirical uncertainty in the biological variables to make probability-based evaluations of cost-effectiveness. Epidemiologic variables from a contact-tracing study and literature and cost data from ongoing vaccination campaigns. Two districts of rural Tanzania: Ngorongoro and Serengeti. 10 years. Health policymaker. Vaccination coverage ranging from 0% to 95% in increments of 5%. Life-years for health outcomes and 2010 U.S. dollars for economic outcomes. Annual canine vaccination campaigns were very cost-effective in both districts compared with no canine vaccination. In Serengeti, annual campaigns with as much as 70% coverage were cost-saving. Across a wide range of variable assumptions and levels of societal willingness to pay for life-years, the optimal vaccination coverage for Serengeti was 70%. In Ngorongoro, although optimal coverage depended on willingness to pay, vaccination campaigns were always cost-effective and lifesaving and therefore preferred. Canine vaccination was very cost-effective in both districts, but there was greater uncertainty about the optimal coverage in Ngorongoro. Annual canine rabies vaccination campaigns conferred extraordinary value and dramatically reduced the health burden of rabies. National Institutes of Health.

Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

Science.gov (United States)

Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2014-09-09

Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

Mandibular Canine Dimorphism in Establishing Sex Identity in the Lebanese Population

Directory of Open Access Journals (Sweden)

Fouad Ayoub

2014-01-01

Full Text Available Background and Objective. In forensic investigations, mandibular canines provide excellent materials to identify gender since they are more likely to survive disasters. The objective of this study was to investigate gender dimorphism by comparing the mesiodistal width of mandibular permanent canines and intercanine distance in a group of Lebanese population. Methods. Participants consisted of undergraduate students from the School of Dentistry, Lebanese University, for two academic years who fulfilled the inclusion criteria. Canine widths and intercanine distance were measured by one operator directly on dental casts using a digital caliper. Results. One hundred thirty-three Lebanese dental students (54 males and 69 females aged 18–25 were included in the study. The intercanine distance was significantly greater in males (P value 0.05 and females (P value > 0.05. The mean width of canine was greater than 7.188 mm for males. Conclusion. The parameters measured in the present study are of great help in sex identification in forensic investigations in the Lebanese adult population.

Increasing Incidence of Canine Leptospirosis in Switzerland

Directory of Open Access Journals (Sweden)

Andrea Major

2014-07-01

Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.

NCR1 Expression Identifies Canine Natural Killer Cell Subsets with Phenotypic Similarity to Human Natural Killer Cells

Directory of Open Access Journals (Sweden)

Jennifer Ann Foltz

2016-11-01

Full Text Available Canines spontaneously develop many cancers similar to humans - including osteosarcoma, leukemia, and lymphoma - offering the opportunity to study immune therapies in a genetically heterogeneous and immunocompetent environment. However, a lack of antibodies recognizing canine NK cell markers has resulted in suboptimal characterization and unknown purity of NK cell products, hindering the development of canine models of NK cell adoptive immunotherapy. To this end, we generated a novel antibody to canine NCR1 (NKp46, the putative species-wide marker of NK cells, enabling purification of NK cells for further characterization. We demonstrate that CD3-/NKp46+ cells in healthy and osteosarcoma-bearing canines have phenotypic similarity to human CD3-/NKp46+ NK cells, expressing mRNA for CD16 and the natural cytotoxicity receptors NKp30, NKp44, and NKp80. Functionally, we demonstrate with the calcein release assay that canine CD3-/NKp46+ cells kill canine tumor cell lines without prior sensitization and secrete IFN-γ, TNF-α, IL-8, IL-10, and GM-CSF as measured by Luminex. Like human NK cells, CD3-/NKp46+ cells expand rapidly on feeder cells expressing 4-1BBL and membrane-bound IL-21 (median= 20,283-fold in 21 days. Further, we identify a minor Null population (CD3-/CD21-/CD14-/NKp46- with reduced cytotoxicity against osteosarcoma cells, but similar cytokine secretion as CD3-/NKp46+ cells. Null cells in canines and humans have reduced expression of NKG2D, NKp44, and CD16 compared to NKp46+ NK cells, and can be induced to express NKp46 with further expansion on feeder cells. In conclusion, we have identified and characterized canine NK cells, including an NKp46- subset of canine and human NK cells, using a novel anti-canine NKp46 antibody, and report robust ex vivo expansion of canine NK cells sufficient for adoptive immunotherapy.

Sequence-independent VIDISCA-454 technique to discover new viruses in canine livers

NARCIS (Netherlands)

van der Heijden, Mitzi; de Vries, Michel; van Steenbeek, Frank G.; Favier, Robert P.; Deijs, Martin; Brinkhof, Bas; Rothuizen, Jan; van der Hoek, Lia; Penning, Louis C.

2012-01-01

In many mammals, viruses cause hepatitis. Despite many efforts a specific virus responsible for canine idiopathic hepatitis has not been identified. The discovery of a viral etiology in canine hepatitis will promote the development of specific drugs and vaccines for the treatment of idiopathic

78 FR 29698 - Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA

Science.gov (United States)

2013-05-21

...] Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA AGENCY: Animal and... Canine Lymphoma Vaccine, DNA. The environmental assessment, which is based on a risk analysis prepared to... biological product: Requester: Merial, Inc. Product: Canine Lymphoma Vaccine, DNA. Possible Field Test...

Functional Characterization of the Canine Heme-Regulated eIF2α Kinase: Regulation of Protein Synthesis

Directory of Open Access Journals (Sweden)

Kimon C. Kanelakis

2009-01-01

Full Text Available The heme-regulated inhibitor (HRI negatively regulates protein synthesis by phosphorylating eukaryotic initiation factor-2α (eIF2α thereby inhibiting protein translation. The importance of HRI in regulating hemoglobin synthesis in erythroid cells makes it an attractive molecular target in need of further characterization. In this work, we have cloned and expressed the canine form of the HRI kinase. The canine nucleotide sequence has 86%, 82%, and 81% identity to the human, mouse, and rat HRI, respectively. It was noted that an isoleucine residue in the ATP binding site of human, rat, and mouse HRI is replaced by a valine in the canine kinase. The expression of canine HRI protein by in vitro translation using wheat germ lysate or in Sf9 cells using a baculovirus expression system was increased by the addition of hemin. Following purification, the canine protein was found to be 72 kD and showed kinase activity determined by its ability to phosphorylate a synthetic peptide substrate. Quercetin, a kinase inhibitor known to inhibit mouse and human HRI, inhibits canine HRI in a concentration-dependent manner. Additionally, quercetin is able to increase de novo protein synthesis in canine reticulocytes. We conclude that the canine is a suitable model species for studying the role of HRI in erythropoiesis.

The Effect of Using Self-ligating Brackets on Maxillary Canine Retraction: A Split-mouth Design Randomized Controlled Trial.

Science.gov (United States)

Hassan, Siba E; Hajeer, Mohammad Y; Alali, Osama H; Kaddah, Ayham S

2016-06-01

The results of previous studies about the efficacy of using self-ligating brackets (SLBs) in controlling canine movement during retraction are not in harmony. Therefore, the current study aimed to compare the effects of using new passive SLBs on maxillary canine retraction with sliding mechanics vs conventional ligating brackets (CLBs) tied with metal ligatures. The sample comprised 15 adult patients (4 males, 11 females; 18-24 years) requiring bilateral extraction of maxillary first premolars. Units of randomization are the left or right maxillary canines within the same patient. The two maxillary canines in each patient were randomly assigned to one of the two groups in a simple split-mouth design. The canines in the SLBs group (n = 15) were bracketed with SLBs (Damon Q™), while the canines in the CLBs group (n = 15) were bracketed with conventional brackets (Mini Master Series). Transpalatal bars were used for anchorage. After leveling and alignment, 0.019 × 0.025" stainless steel working archwires were placed. Canines were retracted using a nickel-titanium close-coil springs with a 150 gm force. The amount and rate of maxillary canine retraction, canine rotation, and loss of anchorage were measured on study models collected at the beginning of canine retraction (T0) and 12 weeks later (T1). Differences were analyzed using paired-samples t-tests. The effect differences were statistically significant (p brackets gave better results compared to the CLBs in terms of rate of movement, amount of canine rotation following extraction, and anchorage loss.

Canine osteosarcoma cells exhibit resistance to aurora kinase inhibitors.

Science.gov (United States)

Cannon, C M; Pozniak, J; Scott, M C; Ito, D; Gorden, B H; Graef, A J; Modiano, J F

2015-03-01

We evaluated the effect of Aurora kinase inhibitors AZD1152 and VX680 on canine osteosarcoma cells. Cytotoxicity was seen in all four cell lines; however, half-maximal inhibitory concentrations were significantly higher than in human leukaemia and canine lymphoma cells. AZD1152 reduced Aurora kinase B phosphorylation, indicating resistance was not because of failure of target recognition. Efflux mediated by ABCB1 and ABCG2 transporters is one known mechanism of resistance against these drugs and verapamil enhanced AZD1152-induced apoptosis; however, these transporters were only expressed by a small percentage of cells in each line and the effects of verapamil were modest, suggesting other mechanisms contribute to resistance. Our results indicate that canine osteosarcoma cells are resistant to Aurora kinase inhibitors and suggest that these compounds are unlikely to be useful as single agents for this disease. Further investigation of these resistance mechanisms and the potential utility of Aurora kinase inhibitors in multi-agent protocols is warranted. © 2013 Blackwell Publishing Ltd.

An RCT on treatment of palatally displaced canines with RME and/or a transpalatal arch.

Science.gov (United States)

Baccetti, Tiziano; Sigler, Lauren M; McNamara, James A

2011-12-01

To investigate the effect of rapid maxillary expansion (RME) and/or transpalatal arch (TPA) therapy in combination with deciduous canine extraction on the eruption of palatally displaced canines (PDCs). Hundred and twenty subjects were enrolled in an RCT based on PDCs diagnosed on panoramic radiographs and they were randomly assigned to one of four study groups. Three treatment groups (TGs) (RME followed by TPA therapy plus extraction of deciduous canines, RME/TPA/EC group, 40 subjects; TPA therapy plus extraction of deciduous canines, TPA/EC group, 25 subjects; extraction of deciduous canines, EC group, 25 subjects) were analyzed. A control group (CG, 30 subjects) received no orthodontic treatment. Prevalence rates of eruption of PDCs in the three TGs were compared with the CG at T2. Predictive features at T1 for successful canine eruption were tested in the three TGs. The prevalence of canine eruption was 80 per cent for the RME/TPA/EC group, 79 per cent for the TPA/EC group, 62.5 per cent for the EC group, versus 28 per cent in the CG, with statistically significant differences between all the groups, with the exception of the comparison between RME/TPA/EC and TPA/EC. Predictive pretreatment variables for the success of treatment were less severe sectors of canine displacement, prepubertal stages of skeletal maturity, and an open root apex of PDCs. The use of a TPA in absence of RME can be equally effective than the RME/TPA combination in PDC cases not requiring maxillary expansion, thus reducing the burden of treatment for the patient.

Insulin binding characteristics in canine muscle tissue: effects of the estrous cycle phases

Directory of Open Access Journals (Sweden)

Álan G. Pöppl

Full Text Available Abstract: Hormonal fluctuations during the different estrous cycle are a well-recognized cause of insulin resistance in bitches, and little is known about insulin receptor binding or post-binding defects associated with insulin resistance in dogs. To evaluate insulin binding characteristics in muscle tissue of bitches during the estrous cycle, 17 owned bitches were used in the study (six in anestrus, five in estrus, and six in diestrus. An intravenous glucose tolerance test (IVGTT was performed in all patients by means of injection of 1mL/kg of a glucose 50% solution (500mg/kg, with blood sample collection for glucose determination at 0, 3, 5, 7, 15, 30, 45 and 60 minutes after glucose infusion. Muscle samples, taken after spaying surgery, were immediately frozen in liquid nitrogen and then stored at -80 ºC until the membranes were prepared by sequential centrifugation after being homogenized. For binding studies, membranes were incubated in the presence of 20,000cpm of human 125I-insulin and in increasing concentrations of unlabeled human regular insulin for cold saturation. The IVGTT showed no differences among bitches during the estrous cycle regarding baseline glycemia or glycemic response after glucose infusion. Two insulin binding sites - high-affinity and low-affinity ones - were detected by Scatchard analysis, and significant statistical differences were observed in the dissociation constant (Kd1 and maximum binding capacity (Bmax1 of the high-affinity binding sites. The Kd1 for the anestrus group (6.54±2.77nM/mg of protein was smaller (P<0.001 than for the estrus (28.54±6.94nM/mg of protein and diestrus (15.56±3.88nM/mg of protein groups. Bmax1 in the estrus (0.83±0.42nM/mg of protein and diestrus (1.24±0.24nM/mg of protein groups were also higher (P<0.001 than the values observed in anestrus (0.35±0.06nM/mg of protein. These results indicate modulation of insulin binding characteristics during different phases of the estrous

Bilateral second premolars agenesia together with a unilateral canine radiculomegaly

Directory of Open Access Journals (Sweden)

Arthur Musakulu Kemoli

2017-01-01

Full Text Available Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.

Interaction of trimebutine and Jo-1196 (fedotozine) with opioid receptors in the canine ileum

Energy Technology Data Exchange (ETDEWEB)

Allescher, H.D.; Ahmad, S.; Classen, M.; Daniel, E.E. (Technical Univ., Munich, (West Germany))

1991-05-01

Receptor binding of the opioid receptor antagonist, ({sup 3}H)diprenorphine, which has a similar affinity to the various opioid receptor subtypes, was characterized in subcellular fractions derived from either longitudinal or circular smooth muscle of the canine small intestine with their plexuses (myenteric plexus and deep muscular plexus, respectively) attached. The distribution of opioid binding activity showed a good correlation in the different fractions with the binding of the neuronal marker ({sup 3}H)saxitoxin but no correlation to the smooth muscle plasma membrane marker 5'-nucleotidase. The saturation data (Kd = 0.12 +/- 0.04 nM and maximum binding = 400 +/- 20 fmol/mg) and the data from kinetic experiments (Kd = 0.08 nmol) in the myenteric plexus were in good agreement with results obtained previously from the circular muscle/deep muscular plexus preparation. Competition experiments using selective drugs for mu (morphiceptin-analog (N-MePhe3-D-Pro4)-morphiceptin), delta (D-Pen2,5-enkephalin) and kappa (dynorphin 1-13, U50488-H) ligands showed the existence of all three receptor subtypes. The existence of kappa receptors was confirmed in saturation experiments using ({sup 3}H) ethylketocycloazocine as labeled ligand. Two putative opioid agonists, with effects on gastrointestinal motility, trimebutine and JO-1196 (fedotozin), were also examined. Trimebutine (Ki = 0.18 microM), Des-Met-trimebutine (Ki = 0.72 microM) and Jo-1196 (Ki = 0.19 microM) displaced specific opiate binding. The relative affinity for the opioid receptor subtypes was mu = 0.44, delta = 0.30 and kappa = 0.26 for trimebutine and mu = 0.25, delta = 0.22 and kappa = 0.52 for Jo-1196.

In vitro development of canine somatic cell nuclear transfer embryos in different culture media.

Science.gov (United States)

Kim, Dong-Hoon; No, Jin-Gu; Choi, Mi-Kyung; Yeom, Dong-Hyeon; Kim, Dong-Kyo; Yang, Byoung-Chul; Yoo, Jae Gyu; Kim, Min Kyu; Kim, Hong-Tea

2015-01-01

The objective of the present study was to investigate the effects of three different culture media on the development of canine somatic cell nuclear transfer (SCNT) embryos. Canine cloned embryos were cultured in modified synthetic oviductal fluid (mSOF), porcine zygote medium-3 (PZM-3), or G1/G2 sequential media. Our results showed that the G1/G2 media yielded significantly higher morula and blastocyst development in canine SCNT embryos (26.1% and 7.8%, respectively) compared to PZM-3 (8.5% and 0%or mSOF (2.3% and 0%) media. In conclusion, this study suggests that blastocysts can be produced more efficiently using G1/G2 media to culture canine SCNT embryos.

Canine spontaneous head and neck squamous cell carcinomas represent their human counterparts at the molecular level.

Directory of Open Access Journals (Sweden)

Deli Liu

2015-06-01

Full Text Available Spontaneous canine head and neck squamous cell carcinoma (HNSCC represents an excellent model of human HNSCC but is greatly understudied. To better understand and utilize this valuable resource, we performed a pilot study that represents its first genome-wide characterization by investigating 12 canine HNSCC cases, of which 9 are oral, via high density array comparative genomic hybridization and RNA-seq. The analyses reveal that these canine cancers recapitulate many molecular features of human HNSCC. These include analogous genomic copy number abnormality landscapes and sequence mutation patterns, recurrent alteration of known HNSCC genes and pathways (e.g., cell cycle, PI3K/AKT signaling, and comparably extensive heterogeneity. Amplification or overexpression of protein kinase genes, matrix metalloproteinase genes, and epithelial-mesenchymal transition genes TWIST1 and SNAI1 are also prominent in these canine tumors. This pilot study, along with a rapidly growing body of literature on canine cancer, reemphasizes the potential value of spontaneous canine cancers in HNSCC basic and translational research.

Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from giant panda and raccoon dogs in China

Science.gov (United States)

2013-01-01

Background Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. In this study, we sequenced and phylogenetic analyses of the hemagglutinin (H) genes from eight canine distemper virus (CDV) isolates obtained from seven raccoon dogs (Nyctereutes procyonoides) and a giant panda (Ailuropoda melanoleuca) in China. Results Phylogenetic analysis of the partial hemagglutinin gene sequences showed close clustering for geographic lineages, clearly distinct from vaccine strains and other wild-type foreign CDV strains, all the CDV strains were characterized as Asia-1 genotype and were highly similar to each other (91.5-99.8% nt and 94.4-99.8% aa). The giant panda and raccoon dogs all were 549Y on the HA protein in this study, irrespective of the host species. Conclusions These findings enhance our knowledge of the genetic characteristics of Chinese CDV isolates, and may facilitate the development of effective strategies for monitoring and controlling CDV for wild canids and non-cainds in China. PMID:23566727

Molecular biological and immunohistological characterization of canine dermal papilla cells and the evaluation of culture conditions.

Science.gov (United States)

Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu

2011-10-01

The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.

Orthodontic tooth movement after extraction of previously autotransplanted maxillary canines and ridge augmentation.

Science.gov (United States)

Collett, A R; Fletcher, B

2000-12-01

A case report is detailed in which autotransplanted maxillary canines were removed and the spaces closed. Substantial surrounding bone loss was associated with the upper right canine, and a bone graft was needed to reestablish normal dentoalveolar ridge morphology. Bone was taken from the maxillary tuberosity and placed in the canine extraction site, fixed with a bone screw, and covered with GoreTex. Seven months after placement of the bone graft, the GoreTex and stabilizing screw were removed to allow for consolidation of the bone. The upper left canine and lower second premolars were extracted, and fixed appliances were placed in both arches to align the teeth and close the spaces. Protraction of the upper right first premolar and retraction of the lateral incisor into the graft site were kept slow and constant with continued periodontal assessment. During the space closure, there was some concern that the bone in the graft site might resorb, leaving the teeth with compromised periodontal support. However, no significant periodontal attachment loss occurred despite ongoing concern about the amount of keratinized tissue. Perhaps the relatively slow rate of tooth movement provided for bone to be maintained and recreated ahead of the tooth. Almost complete closure of the upper canine extraction spaces was achieved. The upper premolars were substituted for the maxillary canines, and unfavorable prosthetic options were thus avoided. The lower arch was aligned, and the extraction spaces completely closed.

Magnetic resonance imaging, ultrasound and real-time ultrasound elastography of the thigh muscles in congenital muscle dystrophy

Energy Technology Data Exchange (ETDEWEB)

Drakonaki, Eleni E. [University of Crete, Radiology Department, Heraklion (Greece); Allen, Gina M. [Green Templeton College, Oxford (United Kingdom)

2010-04-15

Congenital muscle dystrophy includes a range of genetic disorders characterized by muscle weakness and contractures. We report the magnetic resonance (MR), ultrasound (US) and real-time sonoelastography (RTE) imaging findings of the thigh muscles of a 15-year-old boy with Bethlem myopathy diagnosed with clinical, electromyographic and histopathological criteria. Ultrasound and MR showed hyperechoic appearance and high signal intensity on T1- and T2-weighted sequences respectively at the periphery of the vastus lateralis and the long head of the biceps femoris muscles, and at a central area within the rectus femoris muscles. RTE was employed to examine the elastic properties of the muscle. The elastograms were presented as colour-coded maps superimposed on the B-mode images and revealed that the elastographic pattern correlated with the MR and US pattern of involvement. The abnormal muscle areas were stiffer (blue) than the normal-appearing areas (green), a finding that probably correlates with the presence of dystrophic collagen at the affected areas. This report suggests that RTE could be used as an additional imaging tool to evaluate the pattern of muscle changes in congenital myopathy. Further studies are needed to investigate the specificity and clinical value of RTE in the diagnosis and monitoring of neuromuscular disease. (orig.)

Magnetic resonance imaging, ultrasound and real-time ultrasound elastography of the thigh muscles in congenital muscle dystrophy

International Nuclear Information System (INIS)

Drakonaki, Eleni E.; Allen, Gina M.

2010-01-01

Congenital muscle dystrophy includes a range of genetic disorders characterized by muscle weakness and contractures. We report the magnetic resonance (MR), ultrasound (US) and real-time sonoelastography (RTE) imaging findings of the thigh muscles of a 15-year-old boy with Bethlem myopathy diagnosed with clinical, electromyographic and histopathological criteria. Ultrasound and MR showed hyperechoic appearance and high signal intensity on T1- and T2-weighted sequences respectively at the periphery of the vastus lateralis and the long head of the biceps femoris muscles, and at a central area within the rectus femoris muscles. RTE was employed to examine the elastic properties of the muscle. The elastograms were presented as colour-coded maps superimposed on the B-mode images and revealed that the elastographic pattern correlated with the MR and US pattern of involvement. The abnormal muscle areas were stiffer (blue) than the normal-appearing areas (green), a finding that probably correlates with the presence of dystrophic collagen at the affected areas. This report suggests that RTE could be used as an additional imaging tool to evaluate the pattern of muscle changes in congenital myopathy. Further studies are needed to investigate the specificity and clinical value of RTE in the diagnosis and monitoring of neuromuscular disease. (orig.)

"Fooling fido"--chemical and behavioral studies of pseudo-explosive canine training aids.

Science.gov (United States)

Kranz, William D; Strange, Nicholas A; Goodpaster, John V

2014-12-01

Genuine explosive materials are traditionally employed in the training and testing of explosive-detecting canines so that they will respond reliably to these substances. However, challenges arising from the acquisition, storage, handling, and transportation of explosives have given rise to the development of "pseudo-explosive" training aids. These products attempt to emulate the odor of real explosives while remaining inert. Therefore, a canine trained on a pseudo-explosive should respond to its real-life analog. Similarly, a canine trained on an actual explosive should respond to the pseudo-explosive as if it was real. This research tested those assumptions with a focus on three explosives: single-base smokeless powder, 2,4,6-trinitrotoluene (TNT), and a RDX-based plastic explosive (Composition C-4). Using gas chromatography-mass spectrometry with solid phase microextraction as a pre-concentration technique, we determined that the volatile compounds given off by pseudo-explosive products consisted of various solvents, known additives from explosive formulations, and common impurities present in authentic explosives. For example, simulated smokeless powders emitted terpenes, 2,4-dinitrotoluene, diphenylamine, and ethyl centralite. Simulated TNT products emitted 2,4- and 2,6-dinitrotoluene. Simulated C-4 products emitted cyclohexanone, 2-ethyl-1-hexanol, and dimethyldinitrobutane. We also conducted tests to determine whether canines trained on pseudo-explosives are capable of alerting to genuine explosives and vice versa. The results show that canines trained on pseudo-explosives performed poorly at detecting all but the pseudo-explosives they are trained on. Similarly, canines trained on actual explosives performed poorly at detecting all but the actual explosives on which they were trained.

Morphological study of maxillary canine region based on CT

International Nuclear Information System (INIS)

Yamada, Maiko; Takamori, Hitoshi; Ide, Yoshiaki; Yosue, Takashi

2010-01-01

The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)

Non-Invasive monitoring of diaphragmatic timing by means of surface contact sensors: An experimental study in dogs

Directory of Open Access Journals (Sweden)

Galdiz Batxi

2004-09-01

Full Text Available Abstract Background Non-invasive monitoring of respiratory muscle function is an area of increasing research interest, resulting in the appearance of new monitoring devices, one of these being piezoelectric contact sensors. The present study was designed to test whether the use of piezoelectric contact (non-invasive sensors could be useful in respiratory monitoring, in particular in measuring the timing of diaphragmatic contraction. Methods Experiments were performed in an animal model: three pentobarbital anesthetized mongrel dogs. The motion of the thoracic cage was acquired by means of a piezoelectric contact sensor placed on the costal wall. This signal is compared with direct measurements of the diaphragmatic muscle length, made by sonomicrometry. Furthermore, to assess the diaphragmatic function other respiratory signals were acquired: respiratory airflow and transdiaphragmatic pressure. Diaphragm contraction time was estimated with these four signals. Using diaphragm length signal as reference, contraction times estimated with the other three signals were compared with the contraction time estimated with diaphragm length signal. Results The contraction time estimated with the TM signal tends to give a reading 0.06 seconds lower than the measure made with the DL signal (-0.21 and 0.00 for FL and DP signals, respectively, with a standard deviation of 0.05 seconds (0.08 and 0.06 for FL and DP signals, respectively. Correlation coefficients indicated a close link between time contraction estimated with TM signal and contraction time estimated with DL signal (a Pearson correlation coefficient of 0.98, a reliability coefficient of 0.95, a slope of 1.01 and a Spearman's rank-order coefficient of 0.98. In general, correlation coefficients and mean and standard deviation of the difference were better in the inspiratory load respiratory test than in spontaneous ventilation tests. Conclusion The technique presented in this work provides a non

Does contemporary canine diet cause cancer? ; A review

Directory of Open Access Journals (Sweden)

Joseph B Gentzel

2013-07-01

Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer

Three-dimensional localization of impacted canines and root resorption assessment using cone beam computed tomography.

Science.gov (United States)

Almuhtaseb, Eyad; Mao, Jing; Mahony, Derek; Bader, Rawan; Zhang, Zhi-xing

2014-06-01

The purpose of this study was to develop a new way to localize the impacted canines from three dimensions and to investigate the root resorption of the adjacent teeth by using cone beam computed tomography (CBCT). Forty-six patients undergoing orthodontic treatments and having impacted canines in Tongji Hospital were examined. The images of CBCT scans were obtained from KaVo 3D exam vision. Angular and linear measurements of the cusp tip and root apex according to the three planes (mid-sagittal, occlusal and frontal) have been taken using the cephalometric tool of the InVivo Dental Anatomage Version 5.1.10. The measurements of the angular and linear coordinates of the maxillary and mandibular canines were obtained. Using this technique the operators could envision the location of the impacted canine according to the three clinical planes. Adjacent teeth root resorption of 28.26 % was in the upper lateral incisors while 17.39% in upper central incisors, but no lower root resorption was found in our samples. Accurate and reliable localization of the impacted canines could be obtained from the novel analysis system, which offers a better surgical and orthodontic treatment for the patients with impacted canines.

Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.

Science.gov (United States)

Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D

2014-12-01

Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis.

The Impact of Muscle Disuse on Muscle Atrophy in Severely Burned Rats

Science.gov (United States)

2010-12-01

fascia around the opened wound were retracted to make a reservoir to hold warm mineral oil to maintain the temperature between 36.5°C to 37.5°C monitored...EDL) as the representative fast-twitch muscle. The EDL is a dorsi flexor, while the PL is a planter flexor. It is possible, as with HLU, plantar

Canine parvovirus in asymptomatic feline carriers.

Science.gov (United States)

Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D

2012-05-25

Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog

Electroencephalography as a diagnostic technique for canine neurological diseases

Directory of Open Access Journals (Sweden)

Wrzosek Marcin

2016-06-01

Full Text Available Electroencephalography (EEG is a non-invasive examination method for the assessment of functional central nervous system (CNS disturbances. In human medicine it has a special importance as a diagnostic tool for epilepsy. Although many studies were done on the use of EEG for diagnostics of canine central nervous system disorders, the technique is still not applied routinely. The purpose of this paper was to review the use of the electroencephalography in canine neurological disorders of central nervous system diagnosis and assess the future perspectives of this technique in veterinary medicine.

Distribution of Penicillin G Residues in Culled Dairy Cow Muscles: Implications for Residue Monitoring

Science.gov (United States)

The U.S. Food and Drug Administration sets tolerances for veterinary drug residues in muscle, but does not specify which type of muscle should be analyzed. In order to determine if antibiotic residue levels are dependent on muscle type, 7 culled dairy cows were dosed with Penicillin G (Pen G) from ...

Subcellular distribution of calcium-binding proteins and a calcium-ATPase in canine pancreas

International Nuclear Information System (INIS)

Nigam, S.K.; Towers, T.

1990-01-01

Using a 45Ca blot-overlay assay, we monitored the subcellular fractionation pattern of several Ca binding proteins of apparent molecular masses 94, 61, and 59 kD. These proteins also appeared to stain blue with Stains-All. Additionally, using a monoclonal antiserum raised against canine cardiac sarcoplasmic reticulum Ca-ATPase, we examined the subcellular distribution of a canine pancreatic 110-kD protein recognized by this antiserum. This protein had the same electrophoretic mobility as the cardiac protein against which the antiserum was raised. The three Ca binding proteins and the Ca-ATPase cofractionated into the rough microsomal fraction (RM), previously shown to consist of highly purified RER, in a pattern highly similar to that of the RER marker, ribophorin I. To provide further evidence for an RER localization, native RM were subjected to isopycnic flotation in sucrose gradients. The Ca binding proteins and the Ca-ATPase were found in dense fractions, along with ribophorin I. When RM were stripped of ribosomes with puromycin/high salt, the Ca binding proteins and the Ca-ATPase exhibited a shift to less dense fractions, as did ribophorin I. We conclude that, in pancreas, the Ca binding proteins and Ca-ATPase we detect are localized to the RER (conceivably a subcompartment of the RER) or, possibly, a structure intimately associated with the RER

Canine distemper virus detection in asymptomatic and non vaccinated dogs

Directory of Open Access Journals (Sweden)

Helen L. Del Puerto

2010-02-01

Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

Experimental study of pulmonary thromboembolism ischemia-reperfusion injury in canine model

International Nuclear Information System (INIS)

Li Jianjun; Zhai Renyou; Zhang Dongpo; Huang Qiang; Yu Ping; Dai Dingke; Bao Na

2009-01-01

Objective: To establish a canine model of pulmonary thromboembolism ischemia- reperfusion injury (PTE IRI) that may be used for imaging study. Methods: Ten male and 10 female healthy mongrel canines with (18.6±0.8) kg/body weight, were used. A Swan-Ganz catheter was introduced into the right internal jugular vein via a preset percutaneous sheath using the Seldinger technique, and then was with further insertion the pulmonary artery. Balloon occlusion of the right inferior lobe pulmonary artery for 4 hours was followed by removing the catheter and ending with 4 hours of reperfusion. CT was performed before ischemia, 4 h after ischemia and 4 h after reperfusion. At last, dogs were killed and the bilateral inferior lung tissues were prepared for the examination by light and electronic microscopy. Results: All canine models were successfully developed pulmonary thromboembolism ischemia-reperfusion injury. The examination of CT, light and electron microscopy consistently indicated the presence of permeability pulmonary edema after reperfusion. Conclusions: A closed-chest canine model in vivo of pulmonary thromboembolism ischemia-reperfusion injury can be established with virtual pathophysiological process in human and be as well as for imaging experimental study. (authors)

A survey of canine tick-borne diseases in India

Directory of Open Access Journals (Sweden)

Coleman Glen T

2011-07-01

Full Text Available Abstract Background There are few published reports on canine Babesia, Ehrlichia, Anaplasma, Hepatozoon and haemotropic Mycoplasma infections in India and most describe clinical disease in individual dogs, diagnosed by morphological observation of the microorganisms in stained blood smears. This study investigated the occurrence and distribution of canine tick-borne disease (TBD pathogens using a combination of conventional and molecular diagnostic techniques in four cities in India. Results On microscopy examination, only Hepatozoon gamonts were observed in twelve out of 525 (2.3%; 95% CI: 1.2, 4 blood smears. Using polymerase chain reaction (PCR, a total of 261 from 525 dogs (49.7%; 95% CI: 45.4, 54.1 in this study were infected with one or more canine tick-borne pathogen. Hepatozoon canis (30%; 95% CI: 26.0, 34.0 was the most common TBD pathogen found infecting dogs in India followed by Ehrlichia canis (20.6%; 95% CI: 17.2, 24.3, Mycoplasma haemocanis (12.2%; 95% CI: 9.5, 15.3, Anaplasma platys (6.5%; 95% CI: 4.5, 8.9, Babesia vogeli (5.5%, 95% CI: 3.7, 7.8 and Babesia gibsoni (0.2%, 95% CI: 0.01, 1.06. Concurrent infection with more than one TBD pathogen occurred in 39% of cases. Potential tick vectors, Rhipicephalus (most commonly and/or Haemaphysalis ticks were found on 278 (53% of dogs examined. Conclusions At least 6 species of canine tick-borne pathogens are present in India. Hepatozoon canis was the most common pathogen and ticks belonging to the genus Rhipicephalus were encountered most frequently. Polymerase chain reaction was more sensitive in detecting circulating pathogens compared with peripheral blood smear examination. As co-infections with canine TBD pathogens were common, Indian veterinary practitioners should be cognisant that the discovery of one such pathogen raises the potential for multiple infections which may warrant different clinical management strategies.

The ACB technique: a biomagentic tool for monitoring gastrointestinal contraction directly from smooth muscle in dogs

International Nuclear Information System (INIS)

Américo, Madileine F; Andreis, Uilian; Miranda, José Ricardo A; Oliveira, Ricardo B; Corá, Luciana A; Marques, Rozemeire G; Romeiro, Fernando G

2010-01-01

The aim of this paper was to verify whether AC biosusceptometry (ACB) is suitable for monitoring gastrointestinal (GI) contraction directly from smooth muscle in dogs, comparing with electrical recordings simultaneously. All experiments were performed in dogs with magnetic markers implanted under the serosa of the right colon and distal stomach, and their movements were recorded by ACB. Monopolar electrodes were implanted close to the magnetic markers and their electric potentials were recorded by electromyography (EMG). The effects of neostigmine, hyoscine butylbromide and meal on gastric and colonic parameters were studied. The ACB signal from the distal stomach was very similar to EMG; in the colonic recordings, however, within the same low-frequency band, ACB and EMG signals were characterized by simultaneity or a widely changeable frequency profile with time. ACB recordings were capable of demonstrating the changes in gastric and colonic motility determined by pharmacological interventions as well as by feeding. Our results reinforce the importance of evaluating the mechanical and electrical components of motility and show a temporal association between them. ACB and EMG are complementary for studying motility, with special emphasis on the colon. ACB offers an accurate method for monitoring in vivo GI motility

New hominin fossils from Kanapoi, Kenya, and the mosaic evolution of canine teeth in early hominins

Directory of Open Access Journals (Sweden)

J. Michael Plavcan

2012-03-01

Full Text Available Whilst reduced size, altered shape and diminished sexual dimorphism of the canine–premolar complex are diagnostic features of the hominin clade, little is known about the rate and timing of changes in canine size and shape in early hominins. The earliest Australopithecus, Australopithecus anamensis, had canine crowns similar in size to those of its descendant Australopithecus afarensis, but a single large root alveolus has suggested that this species may have had larger and more dimorphic canines than previously recognised. Here we present three new associated dentitions attributed to A. anamensis, recently recovered from the type site of Kanapoi, Kenya, that provide evidence of canine evolution in early Australopithecus. These fossils include the largest mandibular canine root in the hominin fossil record. We demonstrate that, although canine crown height did not differ between these species, A. anamensis had larger and more dimorphic roots, more like those of extant great apes and Ardipithecus ramidus, than those of A. afarensis. The canine and premolar occlusal shapes of A. anamensis also resemble those of Ar. ramidus, and are intermediary between extant great apes and A. afarensis. A. afarensis achieved Homo-like maxillary crown basal proportions without a reduction in crown height. Thus, canine crown size and dimorphism remained stable during the early evolution of Australopithecus, but mandibular root dimensions changed only later within the A. anamensis–afarensis lineage, coincident with morphological changes in the canine–premolar complex. These observations suggest that selection on canine tooth crown height, shape and root dimensions was not coupled in early hominin evolution, and was not part of an integrated adaptive package.

Molecular characterization of the canine HMGB1.

Science.gov (United States)

Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I

2003-01-01

Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel

Comparative analysis of the surface exposed proteome of two canine osteosarcoma cell lines and normal canine osteoblasts.

Science.gov (United States)

Milovancev, Milan; Hilgart-Martiszus, Ian; McNamara, Michael J; Goodall, Cheri P; Seguin, Bernard; Bracha, Shay; Wickramasekara, Samanthi I

2013-06-13

Osteosarcoma (OSA) is the most common primary bone tumor of dogs and carries a poor prognosis despite aggressive treatment. An improved understanding of the biology of OSA is critically needed to allow for development of novel diagnostic, prognostic, and therapeutic tools. The surface-exposed proteome (SEP) of a cancerous cell includes a multifarious array of proteins critical to cellular processes such as proliferation, migration, adhesion, and inter-cellular communication. The specific aim of this study was to define a SEP profile of two validated canine OSA cell lines and a normal canine osteoblast cell line utilizing a biotinylation/streptavidin system to selectively label, purify, and identify surface-exposed proteins by mass spectrometry (MS) analysis. Additionally, we sought to validate a subset of our MS-based observations via quantitative real-time PCR, Western blot and semi-quantitative immunocytochemistry. Our hypothesis was that MS would detect differences in the SEP composition between the OSA and the normal osteoblast cells. Shotgun MS identified 133 putative surface proteins when output from all samples were combined, with good consistency between biological replicates. Eleven of the MS-detected proteins underwent analysis of gene expression by PCR, all of which were actively transcribed, but varied in expression level. Western blot of whole cell lysates from all three cell lines was effective for Thrombospondin-1, CYR61 and CD44, and indicated that all three proteins were present in each cell line. Semi-quantitative immunofluorescence indicated that CD44 was expressed at much higher levels on the surface of the OSA than the normal osteoblast cell lines. The results of the present study identified numerous differences, and similarities, in the SEP of canine OSA cell lines and normal canine osteoblasts. The PCR, Western blot, and immunocytochemistry results, for the subset of proteins evaluated, were generally supportive of the mass spectrometry data

Soluble Form of Canine Transferrin Receptor Inhibits Canine Parvovirus Infection In Vitro and In Vivo

Science.gov (United States)

Wen, Jiexia; Pan, Sumin; Liang, Shuang; Zhong, Zhenyu; He, Ying; Lin, Hongyu; Li, Wenyan; Wang, Liyue; Li, Xiujin; Zhong, Fei

2013-01-01

Canine parvovirus (CPV) disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR) was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR)) possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo. PMID:24089666

Soluble Form of Canine Transferrin Receptor Inhibits Canine Parvovirus Infection In Vitro and In Vivo

Directory of Open Access Journals (Sweden)

Jiexia Wen

2013-01-01

Full Text Available Canine parvovirus (CPV disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo.

3D enamel thickness in Neandertal and modern human permanent canines.

Science.gov (United States)

Buti, Laura; Le Cabec, Adeline; Panetta, Daniele; Tripodi, Maria; Salvadori, Piero A; Hublin, Jean-Jacques; Feeney, Robin N M; Benazzi, Stefano

2017-12-01

Enamel thickness figures prominently in studies of human evolution, particularly for taxonomy, phylogeny, and paleodietary reconstruction. Attention has focused on molar teeth, through the use of advanced imaging technologies and novel protocols. Despite the important results achieved thus far, further work is needed to investigate all tooth classes. We apply a recent approach developed for anterior teeth to investigate the 3D enamel thickness of Neandertal and modern human (MH) canines. In terms of crown size, the values obtained for both upper and lower unworn/slightly worn canines are significantly greater in Neandertals than in Upper Paleolithic and recent MH. The 3D relative enamel thickness (RET) is significantly lower in Neandertals than in MH. Moreover, differences in 3D RET values between the two groups appear to decrease in worn canines beginning from wear stage 3, suggesting that both the pattern and the stage of wear may have important effects on the 3D RET value. Nevertheless, the 3D average enamel thickness (AET) does not differ between the two groups. In both groups, 3D AET and 3D RET indices are greater in upper canines than in lower canines, and overall the enamel is thicker on the occlusal half of the labial aspect of the crown, particularly in MH. By contrast, the few early modern humans investigated show the highest volumes of enamel while for all other components of 3D enamel, thickness this group holds an intermediate position between Neandertals and recent MH. Overall, our study supports the general findings that Neandertals have relatively thinner enamel than MH (as also observed in molars), indicating that unworn/slightly worn canines can be successfully used to discriminate between the two groups. Further studies, however, are needed to understand whether these differences are functionally related or are the result of pleiotropic or genetic drift effects. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Phylogenetic analysis of Austrian canine distemper virus strains from clinical samples from dogs and wild carnivores.

Science.gov (United States)

Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K

2011-04-09

Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.

Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma

OpenAIRE

Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid

2016-01-01

Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA.

Science.gov (United States)

Folitse, R D; Kodie, D O; Amemor, E; Dei, D; Tasiame, W; Burimuah, V; Emikpe, B O

2018-01-01

Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT ® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α 0.05 . We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection.

DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA

Science.gov (United States)

Folitse, R. D; Kodie, D.O; Amemor, E.; Dei, D.; Tasiame, W.; Burimuah, V.; Emikpe, B.O

2018-01-01

Background: Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Materials and Methods: Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α0.05 Results: We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. Conclusion: The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection. PMID:29302647

Canine Detection of Illict Drugs: Sensory Apparatus Technology

National Research Council Canada - National Science Library

Morrison, Edward

2000-01-01

This report describes basic anatomical and physiological observations of the peripheral canine olfactory system, provided by means of investigations into its structural and molecular characteristics...

Coryneform bacteria associated with canine otitis externa

DEFF Research Database (Denmark)

Aalbæk, Bent; Bemis, David A.; Schjærff, Mette

2010-01-01

This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...

Antigenic typing Polish isolates of canine parvovirus

Energy Technology Data Exchange (ETDEWEB)

Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)

1995-12-31

Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.

Antigenic typing Polish isolates of canine parvovirus

International Nuclear Information System (INIS)

Mizak, B.; Plucienniczak, A.

1995-01-01

Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs

Assessment of periodontal status following the alignment of impacted permanent maxillary canine teeth.

Science.gov (United States)

Szarmach, I J; Szarmach, J; Waszkiel, D; Paniczko, A

2006-01-01

The aim of the study was to assess the effect of orthodontic movement of the impacted canines after surgical exposure and alignment on the periodontal status of the transpositioned and adjacent teeth as well as to compare certain parameters with those of spontaneously erupted teeth. Twenty-four patients (mean age 18.4 +/- 3.66) with unilaterally impacted 24 canines were enrolled in the study. The following parameters were assessed: pocket depth (PD), clinical attachment level (CAL), platelet index (PI) of Silness and Löe, and modified sulcus bleeding index (SBI). Optic density of the alveolar bone along the root surface of the aligned canine was analysed based on digital radiological images made with the right angle technique. Control group consisted of spontaneously erupted teeth. In comparison to the control group, in the orthodonticaly treated group PD was found to increase on the mesial buccal and palatal surfaces of the first premolar (p aligned canine (p aligned tooth were statistically significant (p alignment zone and the control, and there was no link between the method of treatment and periodontal status, either. The alignment of the impacted permanent maxillary canines poses a risk of periodontal deterioration. Patients subjected to surgical-orthodontic treatment require periodic periodontal follow-ups.

An assessment of the relationship between cervical vertebrae maturation index and eruption of permanent maxillary canines

Directory of Open Access Journals (Sweden)

D S Kothavade

2012-01-01

Full Text Available Aim : The purpose of the present study was to establish the relationship between the eruption of permanent maxillary canines and cervical vertebral maturation stages (CVMs to assess an alternative method for determining time of canine eruption in the late mixed dentition. Materials and Methods : One hundred and twenty subjects with erupting permanent maxillary canines were observed both intraorally and radiographically with orthopantamograms. Lateral cephalograms were recorded to divide subjects according to CVM stage into prepeak (CS1 and CS2, peak (CS3 and CS4 and postpeak (CS5 and CS6 groups of puberty. Statistical Analysis : The differences between the prevalence rates of canine eruption in different groups of puberty were estimated using ′z test′. Results : Prepeak group comprised of forty six subjects, peak group sixty eight subjects and postpeak group six subjects. The differences in prevalence rates between peak and prepeak and between peak and postpeak groups were noticed highly significant (p<0.001, while prevalence rates between peak and postpeak was found less significant ( p0 <0.01. Conclusion : Eruption of the permanent maxillary canine can occur at any CVM stage till end of the puberty or after puberty (CS1-CS6. Thus, an absence of maxillary canine during or after postpeak stage of puberty (CS5 or CS6 suggests delayed eruption and canine impaction.

Overexpression of IGF-1 attenuates skeletal muscle damage and accelerates muscle regeneration and functional recovery after disuse

Science.gov (United States)

Ye, Fan; Mathur, Sunita; Liu, Min; Borst, Stephen E.; Walter, Glenn A.; Sweeney, H. Lee; Vandenborne, Krista

2014-01-01

Skeletal muscle is a highly dynamic tissue that responds to endogenous and external stimuli, including alterations in mechanical loading and growth factors. In particular, the antigravity soleus muscle experiences significant muscle atrophy during disuse and extensive muscle damage upon reloading. Since insulin-like growth factor-1 (IGF-1) has been implicated as a central regulator of muscle repair and modulation of muscle size, we examined the effect of viral mediated overexpression of IGF-1 on the soleus muscle following hindlimb cast immobilization and upon reloading. Recombinant IGF-1 cDNA virus was injected into one of the posterior hindlimbs of the mice, while the contralateral limb was injected with saline (control). At 20 weeks of age, both hindlimbs were immobilized for two weeks to induce muscle atrophy in the soleus and ankle plantar flexor muscle group. Subsequently, the mice were allowed to reambulate and muscle damage and recovery was monitored over a period of 2 to 21 days. The primary finding of this study was that IGF-1 overexpression attenuated reloading-induced muscle damage in the soleus muscle, and accelerated muscle regeneration and force recovery. Muscle T2 assessed by MRI, a nonspecific marker of muscle damage, was significantly lower in IGF-1 injected, compared to contralateral soleus muscles at 2 and 5 days reambulation (P<0.05). The reduced prevalence of muscle damage in IGF-1 injected soleus muscles was confirmed on histology, with a lower fraction area of abnormal muscle tissue in IGF-I injected muscles at 2 days reambulation (33.2±3.3%vs 54.1±3.6%, P<0.05). Evidence of the effect of IGF-1 on muscle regeneration included timely increases in the number of central nuclei (21% at 5 days reambulation), paired-box transcription factor 7 (36% at 5 days), embryonic myosin (37% at 10 days), and elevated MyoD mRNA (7-fold at 2 days) in IGF-1 injected limbs (P<0.05). These findings demonstrate a potential role of IGF-1 in protecting unloaded

Cathepsin K expression and activity in canine osteosarcoma.

Science.gov (United States)

Schmit, J M; Pondenis, H C; Barger, A M; Borst, L B; Garrett, L D; Wypij, J M; Neumann, Z L; Fan, T M

2012-01-01

Cathepsin K (CatK) is a lysosomal protease with collagenolytic activity, and its secretion by osteoclasts is responsible for degrading organic bone matrix. People with pathologic bone resorption have higher circulating CatK concentrations. Canine osteosarcoma (OS) cells will possess CatK, and its secretion will be cytokine inducible. Circulating CatK concentrations will be increased in dogs with OS, and will be a surrogate marker of bone resorption. Fifty-one dogs with appendicular OS and 18 age- and weight-matched healthy control dogs. In a prospective study, expressions of CatK mRNA and protein were investigated in OS cells. The inducible secretion and proteolytic activity of CatK from OS cells was assessed in vitro. Serum CatK concentrations were quantified in normal dogs and dogs with OS and its utility as a bone resorption marker was evaluated in dogs with OS treated with palliative radiation and antiresorptive agents. Canine OS cells contain preformed CatK within cytoplasmic vesicles. In OS cells, TGFβ1 induced the secretion of CatK, which degraded bone-derived type I collagen in vitro. CatK concentrations were higher in dogs with OS than healthy dogs (11.3 ± 5.2 pmol/L versus 8.1 ± 5.0 pmol/L, P = .03). In a subset of dogs with OS, pretreatment CatK concentrations gradually decreased after palliative radiation and antiresorptive treatment, from 9.3 ± 3.2 pmol/L to 5.0 ± 3.1 pmol/L, P = .03. Canine OS is associated with pathologic bone resorption, and CatK inhibitors might aid in the management of canine OS-related malignant osteolysis. Copyright © 2011 by the American College of Veterinary Internal Medicine.

Epidemiology of canine gastrointestinal helminths in sub-Saharan Africa

Directory of Open Access Journals (Sweden)

Nozyechi Ngulube Chidumayo

2018-02-01

Full Text Available Abstract Background Dogs have a close association with humans providing companionship, security and a source of dietary protein. However, dogs are also potential carriers of zoonotic pathogens. Dogs, therefore, pose a public health risk and a good understanding of canine diseases is important for planning and implementing control measures. The aim of this study was to characterise canine helminthiasis in sub-Saharan Africa using a systematic approach. Methods Pubmed and Google Scholar were searched for relevant primary studies published from 2000. Forty-one eligible studies were included in the meta-analysis. Pooled prevalences were estimated using the quality effects model. Results and conclusions Twenty-six genera of enteric helminths were reported and the pooled estimate of canine helminthiasis was 71% (95% CI: 63–79%. Species of Ancylostoma and Toxocara, causative agents of larva migrans in humans, were the most frequently reported helminths with pooled estimated prevalences of 41% (95% CI: 32–50% and 22% (95% CI: 16–29%, respectively. Dipylidium caninum and Taenia spp. were the most frequently reported cestodes with pooled estimated prevalences of 20% (95% CI: 12–29% and 9% (95% CI: 5–15%, respectively. Trematodes were rarely reported. There was a high level of heterogeneity in most pooled estimates (I2 ˃ 80%. The results of this study show that canine helminthiasis is highly prevalent in sub-Saharan Africa and there is need for regular deworming programmes to improve the health status of the dogs and minimise the potential health risk to humans.

Canine trypanosomosis: Clinical observations and morphological ...

African Journals Online (AJOL)

Clinical and pathological aspects of canine trypanosomosis were determined in naturally infected dogs presented to the Veterinary Teaching Hospital, Federal University of Agriculture, Abeokuta, at different times between 2012 and 2013. The breeds, sexes, ages and body weights of the dogs were recorded. Clinical signs ...

The unerupted maxillary canine - a post-surgical review.

LENUS (Irish Health Repository)

O'Dowling, Ian

2009-10-01

The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.

The unerupted maxillary canine--a post-surgical review.

Science.gov (United States)

O'Dowling, Ian

2009-01-01

The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.

Real-time Monitoring of High Intensity Focused Ultrasound (HIFU) Ablation of In Vitro Canine Livers Using Harmonic Motion Imaging for Focused Ultrasound (HMIFU).

Science.gov (United States)

Grondin, Julien; Payen, Thomas; Wang, Shutao; Konofagou, Elisa E

2015-11-03

Harmonic Motion Imaging for Focused Ultrasound (HMIFU) is a technique that can perform and monitor high-intensity focused ultrasound (HIFU) ablation. An oscillatory motion is generated at the focus of a 93-element and 4.5 MHz center frequency HIFU transducer by applying a 25 Hz amplitude-modulated signal using a function generator. A 64-element and 2.5 MHz imaging transducer with 68kPa peak pressure is confocally placed at the center of the HIFU transducer to acquire the radio-frequency (RF) channel data. In this protocol, real-time monitoring of thermal ablation using HIFU with an acoustic power of 7 W on canine livers in vitro is described. HIFU treatment is applied on the tissue during 2 min and the ablated region is imaged in real-time using diverging or plane wave imaging up to 1,000 frames/second. The matrix of RF channel data is multiplied by a sparse matrix for image reconstruction. The reconstructed field of view is of 90° for diverging wave and 20 mm for plane wave imaging and the data are sampled at 80 MHz. The reconstruction is performed on a Graphical Processing Unit (GPU) in order to image in real-time at a 4.5 display frame rate. 1-D normalized cross-correlation of the reconstructed RF data is used to estimate axial displacements in the focal region. The magnitude of the peak-to-peak displacement at the focal depth decreases during the thermal ablation which denotes stiffening of the tissue due to the formation of a lesion. The displacement signal-to-noise ratio (SNRd) at the focal area for plane wave was 1.4 times higher than for diverging wave showing that plane wave imaging appears to produce better displacement maps quality for HMIFU than diverging wave imaging.

Canine distemper spillover in domestic dogs from urban wildlife.

Science.gov (United States)

Kapil, Sanjay; Yeary, Teresa J

2011-11-01

Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.

Relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction

Directory of Open Access Journals (Sweden)

Anísio Bueno de Carvalho

2012-12-01

Full Text Available OBJECTIVE: The purpose was to obtain information about the relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction. METHODS: Seventy-three patients with canine impaction and 73 control patients, without canine impaction, were evaluated. The mesiodistal distances of the maxillary lateral incisors adjacent to the impacted canines and the correspondent mandibular lateral incisors were measured. The adjacent lateral incisors were classified in: 1 - absent, 2 - small, 3 - peg-shaped, 4 - standard. RESULTS: The results showed that among the patients with impacted canines, there were 21 anomalous teeth (small and peg-shaped and among the control patients there were only three small and peg-shaped teeth, with a statistically significant difference (p = 0.001. No patients were found with impacted canines and absent lateral incisors. CONCLUSION: It was concluded that in patients with anomalous lateral incisors (small and peg-shaped there is a probability to present impacted canines and this must be considered.OBJETIVO: o objetivo foi obter informação sobre a relação existente entre a agenesia e/ou anomalia de forma de incisivos laterais superiores e impacção de caninos. MÉTODOS: foram avaliados 73 pacientes com impacção de caninos e 73 pacientes controle, sem impacção de caninos. Foram medidas as distâncias mesiodistais dos incisivos laterais superiores adjacentes aos caninos impactados e os incisivos laterais correspondentes inferiores. Os incisivos laterais adjacentes foram classificados em: 1 - ausentes; 2 - pequenos; 3 - conoides; 4 - normais. RESULTADOS: os resultados mostraram que no grupo de pacientes com caninos impactados foram encontrados 22 dentes anômalos (pequenos e conoides, e no grupo controle apenas três dentes pequenos e conoides, sendo uma diferença estatisticamente significativa (p=0,001. Não foram encontrados pacientes com canino impactado e incisivo lateral ausente. CONCLUS�

Vulnerability of cultured canine lung tumor cells to NK cell-mediated cytolysis

International Nuclear Information System (INIS)

Haley, P.J.; Kohr, J.M.; Kelly, G.; Muggenburg, B.A.; Guilmette, B.A.

1988-01-01

Five cell lines, designated as canine lung epithelial cell (CLEP), derived from radiation induced canine lung tumors and canine thyroid adeno-carcinoma (CTAC) cells were compared for their susceptibility to NK cell-mediated cytolysis using peripheral blood lymphocytes from normal, healthy Beagle dogs as effector cells. Effector cells and chromium 51 radiolabeled target cells were incubated for 16 h at ratios of 12.5:1, 25:1, 50:1, and 100:1. Increasing cytolysis was observed for all cell lines as the effector-to-target-cell ratios increased from 12.5:1 to 100:1. The percent cytotoxicity was significantly less for all lung tumor cell lines as compared to CTAC at the 100:1 ratio. One lung tumor cell line, CLEP-9, had 85% of the lytic vulnerability of the CTAC cell line and significantly greater susceptibility to NK cell-mediated lysis than all of the other lung tumor cell lines. Susceptibility to NK cell cytolysis did not correlate with in vivo malignant behavior of the original tumor. These data suggest that cultured canine lung tumor cells are susceptible to NK cell cytolytic activity in vitro and that at least one of these cell lines (CLEP-9) is a candidate for substitution of the standard canine NK cell target, CTAC, in NK cell assays. The use of lung tumor cells in NK cell assays may provide greater insight into the control of lung tumors by immune mechanisms. (author)

Panoramic radiological study to identify locally displaced maxillary canines in Bangladeshi population

International Nuclear Information System (INIS)

Alif, Sheikh Mohammad; Haque, Sejuty; Nimmi, Naima; Ashraf, Ali; Khan, Saeed Hossain; Khan, Mahfujul Haq

2011-01-01

This study was performed to determine the prevalence of maxillary canine impaction on a basis of a single panoramic radiograph in Bangladeshi population. A random sample of seven hundred panoramic radiographs was collected from the patient record of a dental clinic. All the selected panoramic radiographs were taken from January 2009 to August 2010 by a single panoramic radiograph machine with the same exposure time (19 seconds) for all radiographs. One hundred and twenty panoramic radiographs were excluded to minimize the selection bias. In a dim lit room, an observer assessed the radiographs on a standard radiographic light box. The position of the impacted maxillary canine was recorded in line with the longitudinal axis of a tooth using the edge of a metal ruler. Data were subsequently put on SPSS 11.5 software and chi-square (x 2 ) tests were applied to find out the association. Among 580 panoramic radiographs it was found that impacted maxillary canines were present in only 7 (1.2%) radiographs. A statistical significant difference was found between the age of the patients and the vertical position of the impacted canines (p=0.000) and between the age of the patients and the horizontal position of the impacted canines (p=0.003). The prevalence was found to be low compared with the present study from the limitation of panoramic image. Further study needs to include three-dimensional imaging modality.

A comparative study between mixed-type tumours from human salivary and canine mammary glands

International Nuclear Information System (INIS)

Genelhu, Marisa CLS; Cardoso, Sérgio V; Gobbi, Helenice; Cassali, Geovanni D

2007-01-01

In comparative pathology, canine mammary tumours have special interest because of their similarities with human breast cancer. Mixed tumours are uncommon lesions in the human breast, but they are found most frequently in the mammary gland of the female dogs and in the human salivary glands. The aim of the study was to compare clinical, morphological and immunohistochemical features of human salivary and canine mammary gland mixed tumours, in order to evaluate the latter as an experimental model for salivary gland tumours. Ten examples of each mixed tumour type (human pleomorphic adenoma and carcinomas ex-pleomorphic adenomas and canine mixed tumour and metaplastic carcinoma) were evaluated. First, clinical and morphologic aspects of benign and malignant variants were compared between the species. Then, streptavidin-biotin-peroxidase immunohistochemistry was performed to detect the expression of cytokeratins, vimentin, p63 protein, estrogen receptor, β-catenin, and E-cadherin. After standardization, similar age and site distributions were observed in human and canine tumours. Histological similarities were identified in the comparison of the benign lesions as well. Metaplastic carcinomas also resembled general aspects of carcinomas ex-pleomorphic adenomas in morphological evaluation. Additionally, immunohistochemical staining further presented similar antigenic expression between lesions. There are many similar features between human salivary and canine mammary gland mixed tumours. This observation is of great relevance for those interested in the study and management of salivary gland tumours, since canine lesions may constitute useful comparative models for their investigations

The effect of intraosseous local anesthesia of 4% articaine with 1:100,000 epinephrine on pulpal blood flow and pulpal anesthesia of mandibular molars and canines.

Science.gov (United States)

Vongsavan, Kadkao; Samdrup, Tshering; Kijsamanmith, Kanittha; Rirattanapong, Praphasri; Vongsavan, Noppakun

2018-05-10

The aim of this study was to determine the effect of intraosseous (IO) anesthesia with 4% articaine and 1:100,000 epinephrine on pulpal blood flow (PBF) and pulpal anesthesia of mandibular first molars and canines in human subjects. Ten healthy volunteers with intact mandibular first molar and canine were given an osteocentral technique of IO injection using the Quick Sleeper 5 system and 4% articaine with 1:100,000 epinephrine at distal site of mandibular first molar. The PBF was monitored by a laser Doppler flowmeter (LDF). Pulpal anesthesia was assessed with an electric pulp tester (EPT). IO injection caused a decrease in PBF in molars from 6.31 ± 3.85 perfusion units (P.U.) before injection to 2.51 ± 2.53 P.U. 1 min after injection (P anesthesia in the molars, the mean onset was 2.40 ± 0.84 min and the mean duration was 38 ± 16.19 min. In the canines, there was a decrease in the sensitivity to EPT but complete pulpal anesthesia was not achieved. IO injection distal to mandibular first molar caused a decrease in PBF and successful pulpal anesthesia in first molar, but not in canine. Both PBF and EPT readings returned to normal, suggesting that pulpal ischemia may not occur. IO anesthesia is safe to use as a primary technique in teeth with normal pulp.

Flexion relaxation of the hamstring muscles during lumbar-pelvic rhythm.

Science.gov (United States)

Sihvonen, T

1997-05-01

This study investigated the simultaneous activity of back muscles and hamstring muscles during sagittal forward body flexion and extension in healthy persons. The study was cross-sectional. A descriptive study of paraspinal and hamstring muscle activity in normal persons during lumbar-pelvic rhythm. A university hospital. Forty healthy volunteers (21 men, 19 women, ages 17 to 48 years), all without back pain or other pain syndromes. Surface electromyography (EMG) was used to follow activities in the back and the hamstring muscles. With movement sensors, real lumbar flexion was separated from simultaneous pelvic motion by monitoring the components of motion with a two-inclinometer method continuously from the initial upright posture into full flexion. All signals were sampled during real-time monitoring for off-line analyses. Back muscle activity ceased (ie, flexion relaxation [FR] occurred) at lumbar flexion with a mean of 79 degrees. Hamstring activity lasted longer and EMG activity ceased in the hamstrings when nearly full lumbar flexion (97%) was reached. After this point total flexion and pelvic flexion continued further, so that the last part of lumbar flexion and the last part of pelvic flexion happened without back muscle activity or hamstring bracing, respectively. FR of the back muscles during body flexion has been well established and its clinical significance in low back pain has been confirmed. In this study, it was shown for the first time that the hip extensors (ie, hamstring muscles) relax during forward flexion but with different timing. FR in hamstrings is not dependent on or coupled firmly with back muscle behavior in spinal disorders and the lumbar pelvic rhythm can be locally and only partially disturbed.

Immunohistochemical expression study of proapoptotic BH3-only protein bad in canine nonneoplastic tissues and canine lymphomas.

Science.gov (United States)

Dettwiler, M; Croci, M; Vaughan, L; Guscetti, F

2013-09-01

The BH3-only protein Bad is a proapoptotic Bcl-2 family member that acts as a sensitizer in intrinsic apoptosis by inactivating antiapoptotic members through heterodimer formation. Bad has been shown to contribute to tumorigenesis, including lymphoma formation in humans and mice, through alteration in expression or functional status. Here, its immunohistochemical expression was analyzed in canine nonneoplastic and lymphoma tissues using tissue microarrays. Bad was expressed in the cytoplasm of a wide range of nonneoplastic tissues, especially epithelial cells. Nonneoplastic lymph nodes displayed weak immunostaining in the follicular germinal centers only. Immunoblotting supported these observations but also revealed presence of nonspecific labeling in some organs. Of 81 lymphomas, 29 (35.8%) displayed moderate to strong immunohistochemical Bad labeling, and a significant expression increase was found in lymphomas (especially B cell and double negative) compared to nonneoplastic lymph nodes. These findings warrant further investigations of the functional status, the involvement of partner proteins, and a possible impact of Bad on prognosis in canine lymphoma.

Detection of canine distemper virus nucleocapsid protein gene in canine peripheral blood mononuclear cells by RT-PCR.

Science.gov (United States)

Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T

1995-06-01

For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.

Cytotoxic action of Brazilian propolis in vitro on canine osteosarcoma cells.

Science.gov (United States)

Cinegaglia, N C; Bersano, P R O; Búfalo, M C; Sforcin, J M

2013-09-01

Osteosarcoma (OSA) is a primary bone neoplasm frequently diagnosed in dogs. The biology of OSA in pet dogs is identical to that of pediatric patients, and it has been considered an excellent model in vivo to study human OSA. Since the individual response to chemotherapy is unpredictable and considering that propolis is a natural product with several biological properties, this work evaluated the cytotoxic action of propolis on canine OSA cells. The primary cell culture of canine OSA was obtained from the tumor of a dog with OSA. Cell viability was assessed after incubation with propolis, 70% ethanol (propolis solvent), and carboplatin after 6, 24, 48, and 72 h. Cell viability was analyzed by the crystal violet method. Data showed that canine OSA cells were sensitive to propolis in a dose- and time-dependent manner and had a distinct morphology compared to control. Its solvent (70% ethanol) had no effect on cell viability, suggesting that the cytotoxic action was exclusively due to propolis. Our propolis sample exerted a cytotoxic effect on canine OSA cells, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment. Copyright © 2012 John Wiley & Sons, Ltd.

Canine serum C-reactive protein as a quantitative marker of the inflammatory stimulus of aseptic elective soft tissue surgery.

Science.gov (United States)

Kjelgaard-Hansen, Mads; Strom, Henriette; Mikkelsen, Lars F; Eriksen, Thomas; Jensen, Asger L; Luntang-Jensen, Michael

2013-09-01

C-reactive protein (CRP) is an established serum marker for the presence of systemic inflammation in dogs. Results from previous experimental and clinical studies suggest that CRP concentrations also quantitatively reflect the degree and progress of an inflammatory process, suggesting its use for inflammation monitoring. The objective was to investigate whether the canine CRP response in serum correlates with the amount of trauma and the consequent inflammatory response after 3 standard aseptic soft-tissue surgical procedures in 3 groups of dogs. A total of 24 client-owned intact female dogs of various breeds were enrolled in a clinical study with random allocation into 2 surgical groups, for either conventional, open-approach ovariohysterectomy (OVH; n = 14) or laparoscopic assisted OVH (n = 10). In addition, a group of 8 male Beagles from a laboratory animal facility underwent vasectomy, serving as the third and mildest surgical trauma group. Serum CRP was measured pre- and at 4, 8, 12, 23, and 27 hours postsurgery. Cumulative concentration over time and point concentrations of CRP were correlated with the surgical trauma impact level. There was a significant surgery trauma-related difference in cumulative CRP concentrations among the 3 groups, and also in the 12 hours postsurgery concentration. The CRP response varied according to the degree of surgical trauma on 3 standardized levels, thus supporting the use of canine serum concentrations of CRP as an inflammatory activity indicator and monitoring marker. © 2013 American Society for Veterinary Clinical Pathology.

Mechanical properties of canine osteosarcoma-affected antebrachia.

Science.gov (United States)

Steffey, Michele A; Garcia, Tanya C; Daniel, Leticia; Zwingenberger, Allison L; Stover, Susan M

2017-05-01

To determine the influence of neoplasia on the biomechanical properties of canine antebrachia. Ex vivo biomechanical study. Osteosarcoma (OSA)-affected canine antebrachia (n = 12) and unaffected canine antebrachia (n = 9). Antebrachia were compressed in axial loading until failure. A load-deformation curve was used to acquire the structural mechanical properties of neoplastic and unaffected specimens. Structural properties and properties normalized by body weight (BW) and radius length were compared using analysis of variance (ANOVA). Modes of failure were compared descriptively. Neoplastic antebrachia fractured at, or adjacent to, the OSA in the distal radial diaphysis. Unaffected antebrachia failed via mid-diaphyseal radial fractures with a transverse cranial component and an oblique caudal component. Structural mechanical properties were more variable in neoplastic antebrachia than unaffected antebrachia, which was partially attributable to differences in bone geometry related to dog size. When normalized by dog BW and radial length, strength, stiffness, and energy to yield and failure, were lower in neoplastic antebrachia than in unaffected antebrachia. OSA of the distal radial metaphysis in dogs presented for limb amputation markedly compromises the structural integrity of affected antebrachia. However, biomechanical properties of affected bones was sufficient for weight-bearing, as none of the neoplastic antebrachia fractured before amputation. The behavior of tumor invaded bone under cyclic loading warrants further investigations to evaluate the viability of in situ therapies for bone tumors in dogs. © 2017 The American College of Veterinary Surgeons.

Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro

Directory of Open Access Journals (Sweden)

Cintia Xavier de Mello

2014-12-01

Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.

Assessment of Periodontal Status of Surgically Exposed and Orthodontically Aligned Impacted Maxillary Canines

Directory of Open Access Journals (Sweden)

Adina Coșarcă

2014-02-01

Full Text Available Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of teeth. Conclusions: The assessed periodontal indices may signal the appearance of a periodontal disease around the teeth that were surgically and orthodontically treated

Canine Distemper Viral Inclusions in Blood Cells of Four Vaccinated Dogs

OpenAIRE

McLaughlin, Bruce G.; Adams, Pamela S.; Cornell, William D.; Elkins, A. Darrel

1985-01-01

Four cases of canine distemper were detected by the presence of numerous cytoplasmic inclusions in various circulating blood cells. Fluorescent antibody techniques and electron microscopy confirmed the identity of the viral inclusions. The cases occurred in the same geographic area and within a short time span. All four dogs had been vaccinated against canine distemper, but stress or other factors may have compromised their immune status. The possibility of an unusually virulent virus strain ...

BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

Science.gov (United States)

Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B

2015-01-01

BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

Nd : YAG surgical laser effects in canine prostate tissue: temperature and damage distribution

NARCIS (Netherlands)

van Nimwegen, S. A.; L'Eplattenier, H. F.; Rem, A. I.; van der Lugt, J. J.; Kirpensteijn, J.

2009-01-01

An in vitro model was used to predict short-term, laser-induced, thermal damage in canine prostate tissue. Canine prostate tissue samples were equipped with thermocouple probes to measure tissue temperature at 3, 6, 9 and 12 mm depths. The tissue surface was irradiated with a Nd:YAG laser in contact

Assessment of Growth Using Mandibular Canine Calcification Stages and Its Correlation with Modified MP3 Stages.

Science.gov (United States)

Nayak, Reshma; Nayak, Us Krishna; Hegde, Gautam

2010-01-01

Orthodontic diagnosis and treatment planning for growing children must involve growth prediction, especially in the treatment of skeletal problems. Studies have shown that a strong association exists between skeletal maturity and dental calcification stages. The present study was therefore taken up to provide a simple and practical method for assessing skeletal maturity using a dental periapical film and standard dental X-ray machine, to compare the developmental stages of the mandibular canine with that of developmental stages of modified MP3 and to find out if any correlation exists, to determine if the developmental stages of the mandibular canine alone can be used as a reliable indicator for assessment of skeletal maturity. A total of 160 periapical radiographs (80 males and 80 females), of the mandibular right canine and the MP3 region was taken and assessed according to the Dermirjian's stages of dental calcification and the modified MP3 stages. The correlation between the developmental stages of MP3 and the mandibular right canine in male and female groups, is of high statistical significance (p = 0.001). The correlation coefficient between MP3 stages and developmental stages of mandibular canine and chronological age in male and females was found to be not significant. The correlation between the mandibular canine calcification stages and MP3 stages was found to be significant. The developmental stages of the mandibular canine could be used very reliably as a sole indicator for assessment of skeletal maturity.

A CBCT Investigation of the Association between Sella-Turcica Bridging and Maxillary Palatal Canine Impaction

Directory of Open Access Journals (Sweden)

Pamela M. Ortiz

2018-01-01

Full Text Available Objectives. To investigate the association between unilateral/bilateral maxillary canine impaction and sella-turcica bridging using CBCT imaging. Methods. This retrospective comparative study analyzed 76 CBCT images of the craniofacial complex including sella-turcica. The impacted cuspid group consisted of thirty-eight subjects (7 males, 31 females; mean age, 14.6 ± 3.2 years diagnosed with unilateral (left n=14, right n=11 or bilateral (n=13 palatal canine impaction. The control group included thirty-eight subjects matched by sex (7 males, 31 females; mean age, 19.5 ± 3.6 years with no impaction. Multinomial logistic regression analysis was used to determine the association between unilateral/bilateral canine impaction and right and left sella-turcica bridging. Results. The prevalence of sella-turcica bridging was 59.3% and 50% in the impacted canine and control groups, respectively. Although the odds for unilateral canine impaction were increased in the right and left sella-turcica bridging groups compared to the controls, the difference was not statistically significant. The risk of bilateral impaction was different between the two sides of sella-turcica bridging, but, again, the findings were not statistically significant. Conclusion. Contrary to previous 2D studies, there is no statistically significant association between unilateral/bilateral palatal canine impaction and sella-turcica bridging when using 3D CBCT.

Stimulation with Concanavalin-A Induces IL-17 Production by Canine Peripheral T Cells

Directory of Open Access Journals (Sweden)

Michelle G. Ritt

2015-04-01

Full Text Available The characteristics of canine IL-17-producing cells are incompletely understood. Expression of mRNA encoding orthologs of IL-17 and the IL-17 receptor has been documented in tissues from dogs with arthritis, inflammatory bowel disease, and lymphoma; however, no associations have been found between IL-17 gene expression and disease phenotype in these conditions. Robust assessment of the role of IL-17-producing cells in dogs will require measuring the frequency of these cells in health and disease in balance with other lymphocyte subsets. The aim of this study was to confirm that the T-cell IL-17 response in dogs is evolutionarily conserved. Canine peripheral blood mononuclear cells were stimulated with Concanavalin A with or without polarizing cytokines. We used a canine specific IL-17 ELISA and flow cytometry to identify IL-17-producing T cells. Accumulation of intracellular IL-17 was observed in stimulated CD4 and CD8 T cells. The addition of pro-inflammatory cytokines appeared to enhance polarization of canine CD4 T cells to the Th17 phenotype. Conversely, the addition of IL-2 in the presence of TGF-β resulted in expansion of Treg cells. We conclude that canine IL-17-producing cells behave similarly to those from humans and mice when stimulated with mitogens and polarized with pro-inflammatory or immune regulatory cytokines.

Automation of gender determination in human canines using artificial intelligence

Directory of Open Access Journals (Sweden)

F. Fidya

2017-09-01

Full Text Available Background: Gender determination is an important aspect of the identification process. The tooth represents a part of the human body that indicates the nature of sexual dimorphism. Artificial intelligence enables computers to perform to the same standard the same tasks as those carried out by humans. Several methods of classification exist within an artificial intelligence approach to identifying sexual dimorphism in canines. Purpose: This study aimed to quantify the respective accuracy of the Naive Bayes, decision tree, and multi-layer perceptron (MLP methods in identifying sexual dimorphism in canines. Methods: A sample of results derived from 100 measurements of the diameter of mesiodistal, buccolingual, and diagonal upper and lower canine jaw models of both genders were entered into an application computer program that implements the algorithm (MLP. The analytical process was conducted by the program to obtain a classification model with testing being subsequently carried out in order to obtain 50 new measurement results, 25 each for males and females. A comparative analysis was conducted on the program-generated information. Results: The accuracy rate of the Naive Bayes method was 82%, while that of the decision tree and MLP amounted to 84%. The MLP method had an absolute error value lower than that of its decision tree counterpart. Conclusion: The use of artificial intelligence methods produced a highly accurate identification process relating to the gender determination of canine teeth. The most appropriate method was the MLP with an accuracy rate of 84%.

Experimental research of covered stent implanted in canine hepatic artery

International Nuclear Information System (INIS)

Zhou Bing; Liu Linxiang; Li Minghua; Wang Yongli; Cheng Yongde

2007-01-01

Objective: To evaluate the feasibility of success rate of implantation, post-procedure stenosis rate, apposition ability and endothelialization level, etc. for implantation with balloon-expandable covered stent in canine hepatic artery. Methods: 8 adult canines were implanted with balloon-expendable stents covered by expandable poly Teflon ester membrane (e-PTFEM). Follow-up DSA was performed immediately, 2, 4 and 12 wk after the procedure. The canines were sacrificed for histopathologic examination and statistical analysis with correlation of implantation manenvor and angiographic manifestations. Results: 8 cases were all implanted with the covered stents in proper hepatic artery/right hepatic artery successfully; showing good apposition ability and non-opacification of the separated branches. 2 cases showed intraluminal obvious stenosis( > 50%)of the stent at 2 weeks follow-up, so did 3 cases at 12 weeks follow-up, and the total stenosis rate was 37.5% and 5 cases manifested full endothelialization (3 different locations of the sample all manifested full endothelialization), 3 cased manifested partial endothelialization (at least 1 location of the sample didn't show full endothelialization), and the two terminal parts were easier to get endothelialization than the central part. Before and after the stent implantation, hepatic function of all cases didn't demonstrate any obvious changes. Conclusions: Balloon-expandable covered stent can be implanted in canine hepatic artery. successfully, with good apposition ability, full endothelialization, and no influence on hepatic function. (authors)

Revertant fibers in the mdx murine model of Duchenne muscular dystrophy: an age- and muscle-related reappraisal.

Directory of Open Access Journals (Sweden)

Sarah R Pigozzo

Full Text Available Muscles in Duchenne dystrophy patients are characterized by the absence of dystrophin, yet transverse sections show a small percentage of fibers (termed "revertant fibers" positive for dystrophin expression. This phenomenon, whose biological bases have not been fully elucidated, is present also in the murine and canine models of DMD and can confound the evaluation of therapeutic approaches. We analyzed 11 different muscles in a cohort of 40 mdx mice, the most commonly model used in pre-clinical studies, belonging to four age groups; such number of animals allowed us to perform solid ANOVA statistical analysis. We assessed the average number of dystrophin-positive fibers, both absolute and normalized for muscle size, and the correlation between their formation and the ageing process. Our results indicate that various muscles develop different numbers of revertant fibers, with different time trends; besides, they suggest that the biological mechanism(s behind dystrophin re-expression might not be limited to the early development phases but could actually continue during adulthood. Importantly, such finding was seen also in cardiac muscle, a fact that does not fit into the current hypothesis of the clonal origin of "revertant" myonuclei from satellite cells. This work represents the largest, statistically significant analysis of revertant fibers in mdx mice so far, which can now be used as a reference point for improving the evaluation of therapeutic approaches for DMD. At the same time, it provides new clues about the formation of revertant fibers/cardiomyocytes in dystrophic skeletal and cardiac muscle.

Extrusion processing : effects on dry canine diets

NARCIS (Netherlands)

Tran, Q.D.

2008-01-01

Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying.

Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the

Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

International Nuclear Information System (INIS)

Pang, Lisa Y.; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J.

2011-01-01

Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology

Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

Energy Technology Data Exchange (ETDEWEB)

Pang, Lisa Y., E-mail: lisa.pang@ed.ac.uk; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J. [Royal (Dick) School of Veterinary Studies and Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG (United Kingdom)

2011-03-30

Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology.

Effect of rapid maxillary expansion and transpalatal arch treatment associated with deciduous canine extraction on the eruption of palatally displaced canines: A 2-center prospective study.

Science.gov (United States)

Sigler, Lauren M; Baccetti, Tiziano; McNamara, James A

2011-03-01

Our aim was to investigate the effect of rapid maxillary expansion and transpalatal arch therapy combined with deciduous canine extraction on the eruption rate of palatally displaced canines (PDCs) in patients in the late mixed dentition in a 2-center prospective study. Seventy subjects were enrolled based on PDCs diagnosed on panoramic radiographs. The treatment group (TG, 40 subjects) underwent RME followed by TPA therapy and extraction of the deciduous canines. The control group (CG, 30 subjects) received no orthodontic treatment. At the start of the trial, panoramic radiographs and dental casts were compared between the TG and the CG with the Mann-Whitney U test (P anomalies was reported. No statistically significant difference was found for any measurement at the start of the trial between the 2 groups. The prevalence rates of eruption of the maxillary canines were 80% for the TG and 28% in the CG, a statistically significant difference (chi-square =16.26, P mixed dentition with PDCs. Pretreatment variables indicating success of treatment on the eruption of PDCs were less severe sectors of displacement, prepubertal stages of skeletal maturity, and open root apices of PDCs. Several dental anomalies were associated significantly with PDCs, thus confirming the genetic etiology of this eruption disturbance. Copyright © 2011 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

Comparative Analysis of Human and Canine Campylobacter upsaliensis Isolates by Amplified Fragment Length Polymorphism

DEFF Research Database (Denmark)

Damborg, Peter; Guardabassi, Luca; Pedersen, Karl

2008-01-01

Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...

To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age.

Science.gov (United States)

Malik, Pooja; Rana, Vivek; Rehani, Usha

2012-01-01

The purpose of this study was to assess skeletal age and establish relationship between mandibular canine calcification and skeletal age. The study included 147 females aged 10 to 13 years. The subjects were divided into three groups: Group I-comprising of 10 to 11 years old female; Group II-comprising of 11 to 12 years old female; Group III-12 to 13 years female. OPG and hand and wrist radiographs of left side for each subject were taken with prior consent of their parents. The calcification status of canine was evaluated from orthopantomograms according to scores given in Demirjian's method. The stages of ossification of various carpal bones were evaluated using radiographic atlas of Greulich-Pyle and skeletal age was calculated. Data collected was statistically analyzed. The results drawn from this study showed that a strong correlation was observed for canine calcification stage F for 10 to 11 years and for stage G in 11 to 12 years and 12 to 13 years respectively. How to cite this article: Malik P, Rana V, Rehani U. To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age. Int J Clin Pediatr Dent 2012;5(1): 14-19.

Histologic prognosticators in feline osteosarcoma: a comparison with phenotypically similar canine osteosarcoma.

Science.gov (United States)

Dimopoulou, Maria; Kirpensteijn, Jolle; Moens, Hester; Kik, Marja

2008-07-01

To investigate the histologic characteristics of feline osteosarcoma (OS) and compare the histologic data with phenotypically comparable canine OS. The effects of histologic and clinical variables on survival statistics were evaluated. Retrospective study. Cats (n=62) and dogs (22). Medical records of 62 cats with OS were reviewed for clinically relevant data. Clinical outcome was obtained by telephone interview. Histologic characteristics of OS were classified using a standardized grading system. Histologic characteristics in 22 feline skeletal OS were compared with 22 canine skeletal OS of identical location and subtype. Prognostic variables for clinical outcome were determined using multivariate analysis. Feline OS was characterized by moderate to abundant cellular pleomorphism, low mitotic index, small to moderate amounts of matrix, high cellularity, and a moderate amount of necrosis. There was no significant difference between histologic variables in feline and canine OS. Histologic grade, surgery, and mitotic index significantly influenced clinical outcome as determined by multivariate analysis. Tumor invasion into vessels was not identified as a significant prognosticator. Feline and canine skeletal OS have similar histologic but different prognostic characteristics. Prognosis for cats with OS is related to histologic grade and mitotic index of the tumor.

Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012-2013.

Science.gov (United States)

Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted; Andresen, Lars; Chrièl, Mariann; Hagberg, Emma; Jensen, Mette Kragh; Hansen, Mette Sif; Hjulsager, Charlotte Kristiane; Struve, Tina

2015-09-30

During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit in biosecurity on the mink farms. The aim of this study was to investigate the extent and association of specific biosecurity measures with the outbreak. The study was carried out in an epidemiological case-control design. The case group consisted of the 61 farms, which had a confirmed outbreak of canine distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case farms, indicating that the control farms had a better biosecurity or were not equally exposed to canine distemper virus. Generally, all farms had very few specific precautions at the gate entrance in respect to human visitors as well as animals. The use of biosecurity measures was very variable in both case and control farms. Not using plastic boot covers, presence of dogs and cats, presence of demarcated area for changing clothes when entering and leaving the farm area and presence of hand washing facilities significantly lowered the odds of the farm having a canine distemper virus outbreak. The results of the study indicate that consistent use of correct vaccination strategies, implementation of biosecurity measures and limiting human and animal access to the mink farm can be