Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia
Directory of Open Access Journals (Sweden)
Víctor Acero P
2015-09-01
Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.
Canine leishmaniosis in the Old and New Worlds: unveiled similarities and differences.
Dantas-Torres, Filipe; Solano-Gallego, Laia; Baneth, Gad; Ribeiro, Vitor Marcio; de Paiva-Cavalcanti, Milena; Otranto, Domenico
2012-12-01
Canine leishmaniosis is a potentially life-threatening disease which is spreading geographically in the Old and New Worlds, where different diagnostic procedures, treatments, and control strategies are currently in place. This Opinion article outlines the similarities and differences between canine leishmaniosis in the Old and New Worlds, with emphasis on South America and Europe. Finally, it calls the attention of veterinary and public health authorities to standardize and improve practices for diagnosing, treating, and preventing the disease. Copyright © 2012 Elsevier Ltd. All rights reserved.
Novel Areas for Prevention and Control of Canine Leishmaniosis.
Miró, Guadalupe; Petersen, Christine; Cardoso, Luís; Bourdeau, Patrick; Baneth, Gad; Solano-Gallego, Laia; Pennisi, Maria Grazia; Ferrer, Lluís; Oliva, Gaetano
2017-09-01
There have been multiple recent advances regarding tools for the control and prevention of canine leishmaniosis (CanL), including new preventative vaccines. In this review, these advances are evaluated based on control targets, including vector and parasite. Leishvet recommendations are provided for control practices based on the dog's risk of infection. New topical insecticide formulations have proven to be effective in preventing sand fly bites, and subsequently infection. Parasite control occurs through chemotherapeutic or immunologic means, which decrease or prevent transmission to other animals, including humans. Leishmaniosis control programs that include a combination of coordinated measures, either in individuals or for prevention across reservoir populations, are required. Copyright © 2017 Elsevier Ltd. All rights reserved.
Gramiccia, M
2011-09-08
The leishmanioses are diseases caused by protozoa of the genus Leishmania, parasites infecting numerous mammal species, including humans, and transmitted by the bite of phlebotomine sand flies. They are a large group of diseases ranging over inter-tropical zones of America and Africa, and extend into temperate regions of Latin America, Europe and Asia. Pet animals are found infected with different Leishmania species but Leishmania infantum is the most widespread being dogs the main reservoir of zoonotic visceral leishmaniosis (ZVL). Dogs are very susceptible to this parasite and may suffer from a complex syndrome, canine leishmaniosis (CanL), one of the major zoonoses globally causing severe fatal disease in this animal. Infections in cats and horses have also been reported in areas where CanL is diagnosed. In Europe dogs and cats are common companion animals and their health is of great concern, therefore management of leishmaniosis in pets generally follows that of human ZVL. The recent spread of Leishmania infections in non-endemic territories has been monitored by means of canine surveys, which represent a suitable approach because of the dog's role as a sentinel host. New tools have been developed for the surveillance and control of ZVL. A number of insecticide-based preparations have been specifically registered for dog protection against sand fly bites, with elevated efficacy for both individual and mass protection. Copyright © 2011 Elsevier B.V. All rights reserved.
Regional parasite density in the skin of dogs with symptomatic canine leishmaniosis.
Saridomichelakis, Manolis N; Koutinas, Alexander F; Olivry, Thierry; Dunston, Stan M; Farmaki, Rania; Koutinas, Christos K; Petanides, Theodoros
2007-08-01
In canine leishmaniosis, the parasitic density of the skin may be important for the infection of sandflies, and increased accumulation of inflammatory cells infected with Leishmania is believed to occur in dermal areas subjected to mechanical trauma. Parasite density and inflammatory responses in the upper and lower dermis of three body sites: flank (control site), dorsal muzzle (sandfly feeding site), and footpads (mechanical stress sites) were thus investigated in 15 dogs with symptomatic leishmaniosis. Parasite density did not differ between the control and tested sites or between the upper and lower dermis, apart from the footpads where it was higher in the upper dermis, and there was no correlation with severity of the macroscopic lesions or inflammatory infiltrate, except for the lower footpad dermis. No selective accumulation of the parasite in the muzzle that would favour its transmission to sandflies occurred, and the mechanical stress imposed on the footpads was not associated with increased parasitic density, or with inflammatory infiltrate.
Directory of Open Access Journals (Sweden)
Esther Torrent
2018-01-01
Full Text Available The aims of the study were to determine whether symmetric dimethylarginine (SDMA was increased in dogs with leishmaniosis and to assess its relationship with creatinine concentration and urinary protein : creatinine ratio (UPC to determine its utility as a marker of early excretory dysfunction. Fifty-three dogs with leishmaniosis classified according to the LeishVet clinical staging (stage I, n=5, stage II, n=30; stage III, n=12; stage IV, n=6 were selected and compared with 41 clinically healthy dogs. Thirty-nine dogs with leishmaniosis were also followed up for six months. SDMA concentrations on the day of diagnosis were significantly higher in dogs with leishmaniosis with respect to control dogs and in dogs from LeishVet stage IV when compared with the other stages. Increased UPC (>0.5, SDMA (>19 μg/dL, and creatinine concentrations (≥1.4 mg/dL were found in 47.1%, 15.1%, and 9.4% of dogs with leishmaniosis, respectively. SDMA concentration was increased in 24% of proteinuric dogs, in 7% of nonproteinuric dogs, and in four of five dogs with increased creatinine. SDMA concentration ≥ 25 μg/dL was associated with clinical chronic kidney disease (CKD after six months. Our results did not demonstrate advantages in using SDMA concentration as an early marker of CKD when compared to creatinine and UPC in canine leishmaniosis.
Disseminated feline leishmaniosis due to Leishmania infantum in Southern France.
Ozon, C; Marty, P; Pratlong, F; Breton, C; Blein, M; Lelièvre, A; Haas, P
1998-02-28
A fortuitously discovered case of feline leishmaniosis is reported. The parasites were found in the skin and the bone marrow of a domestic female cat that spontaneously died after a few weeks of evolution. Serological tests for FeLV, FIV and PIF virus detection gave negative results. By using Western blot serology, a characteristic pattern of leishmaniosis was obtained and by performing an isoenzyme electrophoresis, a Leishmania infantum MON-1 strain was identified. The same zymodeme is implicated in most of the canine and human leishmaniosis in Southern Europe. A study on the prevalence of asymptomatic feline leismaniosis is foreseen.
Miró, Guadalupe; López-Vélez, Rogelio
2018-04-30
The initiative One World, "One Health" tries to rapidly detect emerging or reemerging human and animal infectious diseases and prevent epidemiological situations such as deforestation, some agricultural practices or the appearance of new foci of leishmaniosis due to Leishmania infantum with alternative reservoirs. With this objective in mind, we here consider leishmaniosis in the Mediterranean basin and compare its current clinical management from two perspectives: that of a veterinarian specialized in infectious and parasitic diseases, and that of a physician specialized in infectious tropical diseases. We thus prepared a list of 10 key questions from epidemiology to control of the disease in both species: dogs and humans. This issue requires a concise and clear response to help animal and human health clinicians to improve their clinical management and understanding of this important zoonosis. Our ultimate aim is to update and bring together the information available backed by sound scientific evidence. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Domenico Otranto
Full Text Available Dogs are the main reservoir hosts of Leishmania infantum, the agent of human zoonotic visceral leishmaniosis. This study investigated the efficacy of a polymer matrix collar containing a combination of 10% imidacloprid and 4.5% flumethrin as a novel prophylactic measure to prevent L. infantum infections in young dogs from a hyper-endemic area of southern Italy, with a view towards enhancing current control strategies against both human and canine leishmaniosis.The study was carried out on 124 young dogs, of which 63 were collared (Group A while 61 were left untreated (Group B, from March-April 2011 until March 2012. Blood and skin samples were collected at baseline (April 2011 and at the first, second, third and fourth follow-up time points (July, September 2011 and November 2011, and March 2012, respectively. Bone marrow and conjunctiva were sampled at baseline and at the fourth follow-up. Serological, cytological and molecular tests were performed to detect the presence of L. infantum in the different tissues collected. At the end of the trial, no dog from Group A proved positive for L. infantum at any follow-up, whereas 22 dogs from Group B were infected (incidence density rate = 45.1%; therefore, the combination of 10% imidacloprid and 4.5% flumethrin was 100% efficacious for the prevention of L. infantum infection in young dogs prior to their first exposure to the parasite in a hyper-endemic area for CanL.The use of collars containing 10% imidacloprid and 4.5% flumethrin conferred long-term protection against infection by L. infantum to dogs located in a hyper-endemic area, thus representing a reliable and sustainable strategy to decrease the frequency and spread of this disease among the canine population which will ultimately result in the reduction of associated risks to human health.
Directory of Open Access Journals (Sweden)
Naucke Torsten J
2012-04-01
Full Text Available Abstract Background Canine leishmaniosis (CanL is a zoonotic disease caused by Leishmania (L. infantum. It is endemic to several tropical and subtropical countries but also to the Mediterranean region. It is transmitted by phlebotomine sandflies but occasional non-vector transmissions have been reported, including vertical and horizontal transmission. Findings The authors report a case of CanL in a female boxer dog from Dusseldorf, Germany, that had never been in an endemic region. A serum sample from the bitch was tested positive for antibodies against Leishmania (IFAT 1:2,000, ELISA 72. The bitch had whelped three litters, and one puppy from the third litter was also found to be seropositive for Leishmania antibodies (IFAT 1:4,000, ELISA 78. Conclusions Up to now, despite intensive searching, the occurrence of sandflies could not be proved in the bitch's region of origin. Thus, vertical and horizontal transmission are to be discussed as possible ways of infection. This may be the first report of venereal and vertical transmission of L. infantum in naturally infected dogs in Germany.
Baneth, Gad; Yasur-Landau, Daniel; Gilad, Matan; Nachum-Biala, Yaarit
2017-03-13
Infection and clinical disease associated with Leishmania major and Leishmania tropica, two common agents of human cutaneous leishmaniosis, have rarely been reported in dogs. This study describes dogs infected with these Leishmania spp. prevalent in the Middle East and North Africa, and compares the serological response of dogs infected with Leishmania infantum, L. major or L. tropica to whole promastigote antigen enzyme-linked immunosorbent assay (ELISA) of each species and to rK39 dipstick. Leishmania major infection in a 5-month-old male dog was associated with alopecic and ulcerative periocular and limb skin lesions which responded to allopurinol treatment. Infection was detected by skin and blood polymerase chain reaction (PCR) and confirmed by DNA sequencing but the dog was seronegative. Leishmania tropica infection was detected in a 3-month-old female dog co-infected with Babesia vogeli and Anaplasma platys and with no skin lesions. PCR and DNA sequencing of the blood and parasite culture were positive for L. tropica. Sera from 11 dogs infected with L. infantum, L. major or L. tropica were reactive with all three Leishmania spp. antigens except for sera from a dog with L. major infection. No significant differences were found between reactivity of dog sera to the antigen of the infecting species, or to the other Leishmania spp. antigens. Sera from dogs infected with L. infantum and L. tropica were positive with the rK39 antigen kit, while dogs with L. major infection were seronegative. Skin lesions in L. major infected dogs from this study and previous reports (n = 2) were ulcerative and located on the muzzle, feet and foot pads and not associated with generalized lymphadenomegaly and splenomegaly. In previous L. tropica infections, skin lesions were proliferative mucocutaneous in young dogs (n = 2), or associated with widespread dermatitis, lymphadenomegaly and splenomegaly in older dogs with similarity to L. infantum infection (n = 2). This
Directory of Open Access Journals (Sweden)
Maria Fernanda Alves-Martin
2017-11-01
Full Text Available Objective: To analyze the prevalence of feline leishmaniosis in 55 asymptomatic cats or assess clinical disease in a visceral leishmaniasis-endemic area using parasitological, serological and molecular techniques. Methods: Fifty-five adult domestic and non-purebred cats held at an animal shelter in a rural area of the municipality of Ilha Solteira, São Paulo, Brazil, a region endemic for canine visceral leishmaniosis, were evaluated. A total of 5 mL of blood was collected from each animal, for blood culture, serological (indirect fluorescent antibody test, soluble extract ELISA, ELISA recombinant K39 antigen and molecular tests (PCR. At the time of blood collection, the cats underwent clinical evaluation for the presence of clinical signs. Results: Flagellate protozoa were found in nine blood cultures (16.4%. Seropositivity by indirect fluorescent antibody test was observed in 32 serum samples (62.7%. ELISA-SE showed seropositivity in 37 cats (72.5%, while ELISA-rK39 revealed positive results in 11 cats (21.6%. Leishmania spp. was detected by PCR in whole blood samples from five cats (9.1%. Based on clinical evaluation, it was possible to detect the presence of clinical signs (alopecia, emaciation, pinna lesions, nose lesions, skin lesions in 30 animals (54.5%. Conclusions: To the knowledge of the authors, this is the first report of Leishmania spp. in domestic cats in the epidemiological cycle of leishmaniosis in the studied area, requiring more attention in the establishment of preventive steps to control this disease.
Directory of Open Access Journals (Sweden)
Grevot A.
2005-09-01
Full Text Available Leishmaniosis caused by Leishmania infantum is an endemic zoonosis present in the Mediterranean area. Canidae (dog and fox constitute the main reservoir hosts for the parasite, whilst wild rodents or the cat can be carriers of the protozoan and are considered as secondary potential reservoirs. This paper describes a case of disseminated feline leishmaniosis with cutaneous (ulcerative, visceral (spleen and lymph nodes and blood involvement in a FIV-FelV positive cat. The microscopic identification of the Leishmania infection was initially made on a skin biopsy of the temporal area, where a squamous cell carcinoma was diagnosed. The diagnosis of the disease was achieved by several serological techniques (ELISA, IFAT and Western-blot. The strain was obtained by blood culture, characterized by electrophoresis of isoenzymes and identified as Leishmania infantum zymodeme MON-1. Since the infection due to L. infantum is a zoonosis, the potential feline reservoir should be more investigated. Serological analysis by Western blot on domestic cats provides a useful tool. In veterinary practice, feline leishmaniosis should be systematically included in the differential diagnosis when compatible cutaneous lesions are present, especially in the endemic areas of canine leishmaniosis.
Leishmaniosis of companion animals in Europe: an update.
Pennisi, Maria Grazia
2015-02-28
gingivostomatitis, hypergammaglobulinemia, and normocytic normochromic anemia. Cats have been empirically treated with some drugs used in dogs. Due to polymorphic clinical picture and the insidious progressive course, leishmaniosis can persist for a long time before dogs or cats are brought to a veterinarian and so diagnosis can be delayed. Exotic or new Leishmania spp. have been reported in humans, animals and vectors in Europe. This changing situation requires attention in Europe for designing epidemiological studies and control measures. Copyright © 2014 Elsevier B.V. All rights reserved.
Tratamiento con miltefosina de la leishmaniosis cutánea diseminada
Directory of Open Access Journals (Sweden)
Lina María González
2006-10-01
Full Text Available La leishmaniosis cutánea diseminada es una forma escasa de leishmaniosis, que se caracterizapor la diseminación sanguínea del parasito que lleva a la aparición de múltiples nódulos yplacas en la piel de todo el cuerpo y aun de la mucosa nasal. Se diferencia de la leishmaniosiscutánea difusa en que la alteración de la inmunidad celular es menor y las lesiones puedentener una descamación epidérmica, en cambio en la leishmaniosis difusa las lesiones sonnodulares y hay una anergia celular específica contra el parásito. En este artículo se describeel caso de un paciente colombiano con Leishmaniosis cutánea diseminada causada por L(Vpanamensis que inicialmente tuvo falla terapéutica al ser tratado con Glucantime y AnfotericinaB y quien curó de sus lesiones al recibir tratamiento con Miltefosine.
Directory of Open Access Journals (Sweden)
Carla Maia
2015-07-01
Full Text Available Case summary This is the first clinical report of feline viscerocutaneous leishmaniosis caused by Leishmania infantum genotype E associated with an invasive squamous cell carcinoma (SCC in a domestic cat from Portugal. Initially, the cat presented a single cutaneous lesion in the right nostril. A fine-needle aspiration was performed and Leishmania amastigotes were observed without the presence of cells compatible with neoplasia. Systemic treatment with allopurinol was started. One year later, the cat presented a crateriform non-encapsulated and badly delineated mass in the nasal planum, with naso-oral fistulation and nasal destruction. Histologically, the skin mass consisted on an ulcerative plaque-like lesion with a nasal SCC. Leishmania infantum MON-1 parasites were detected by histopathology, culture and PCR of the skin mass, submandibular and popliteal lymph nodes, liver and spleen. Restriction enzyme analysis revealed genotype E, previously identified in humans and dogs living in the same region. Relevance and novel information This is, to the best of our knowledge, the first clinical report of feline viscerocutaneous leishmaniosis caused by L infantum genotype E. The detection and isolation of parasites from a cat that are genetically identical to the ones obtained from humans and dogs with visceral leishmaniosis highlights the need to clarify whether cats play a role in the epidemiology of this parasitic zoonosis. From a clinical point of view, this case reinforces the importance of including leishmaniosis in the differential diagnoses of feline pathology, especially in cats with cutaneous lesions.
Leishmaniosis cutanea: manifestación clínica inusual
Directory of Open Access Journals (Sweden)
Aidé Sandoval-Juárez
Full Text Available Las manifestaciones clínicas de la leishmaniosis son variables y están relacionadas con la especie infectante, su relación con el medioambiente y con la respuesta inmune del hospedero. Se presenta un caso de leishmaniosis andina cutánea tardía con una manifestación extensa. El caso se confirmó a través de estudios microbiológicos e inmunológicos, la identificación se realizó mediante secuenciamiento del gen del citocromo b, determinándose la especie como Leishmania (Leishmania amazonensis. La paciente recibió tratamiento con estibogluconato sódico y al término de la terapia, mostró mejoría clínica de las lesiones. Se recomienda considerar a la leishmaniosis en el diagnóstico diferencial cuando se atienda ulceras crónicas dermatológicas atípicas.
Simpson, Siobhan; Dunning, Mark David; de Brot, Simone; Grau-Roma, Llorenç; Mongan, Nigel Patrick; Rutland, Catrin Sian
2017-10-24
Osteosarcoma (OSA) is a rare cancer in people. However OSA incidence rates in dogs are 27 times higher than in people. Prognosis in both species is relatively poor, with 5 year OSA survival rates in people not having improved in decades. For dogs, 1 year survival rates are only around ~ 45%. Improved and novel treatment regimens are urgently required to improve survival in both humans and dogs with OSA. Utilising information from genetic studies could assist in this in both species, with the higher incidence rates in dogs contributing to the dog population being a good model of human disease. This review compares the clinical characteristics, gross morphology and histopathology, aetiology, epidemiology, and genetics of canine and human OSA. Finally, the current position of canine OSA genetic research is discussed and areas for additional work within the canine population are identified.
Epidemiological study of canine parvovirus infection in and around Bhubaneswar, Odisha, India
Directory of Open Access Journals (Sweden)
Monalisa Behera
2015-01-01
Full Text Available Aim: An epidemiological study of canine parvovirus infection in dogs in and around Bhubaneswar, Odisha was conducted between December 2012 to March 2013 and prevalence rate was studied on the basis of age, breed, and sex. Materials and Methods: A total of 71 fecal samples from suspected diarrheic dogs were collected in sterile phosphate buffer saline (10% W/V and examined by polymerase chain reaction (PCR for detection of canine parvo virus infection, followed by epidemiological study in relation to age, breed, and sex. Results: Of 71 samples analyzed, 29 (40.85% were found to be positive by PCR assay. The infection was higher in Deshi/local breeds (34.48%, followed by German shepherd (17.24%, equal incidences in mixed and Labrador retriever (10.34%, Rottweiler and German spitz showed 6.90% each and finally lower incidences in four breeds (3.45% such as Dalmatians, Nea politan mastiff, Pug and Great Dane. Age-wise prevalence study revealed the infection being more in the age group of 3-6 months (41.37%, followed by equal incidences of 27.59% in 1-3 months and 6-12 months age group, and a low incidence in age groups above 12 months (3.45%. The incidence was predominantly higher in males (86.21% than females (13.79%. Conclusions: The epidemiological analysis revealed that the breed wise prevalence was found to be more in Deshi breeds as compared to others, age groups below 6 months were found to be more prone to parvovirus infection and males were mostly infected.
Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo
2018-01-23
To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.
Cutaneous leishmaniosis in a horse from northern Portugal
Gama, Adelina; Elias, Joana; Ribeiro, Ana J.; Alegria, Nuno; Schallig, Henk D. F. H.; Silva, Filipe; Santarém, Nuno; Cardoso, Luís; Cotovio, Mário
2014-01-01
The first case of cutaneous leishmaniosis in a horse from the north of Portugal, with a 1.5 cm in diameter ulcerated nodular lesion on the left face, is reported. The skin nodule was surgically excised and assessed by histopathology, including an immunohistochemistiy method applied for the first
Directory of Open Access Journals (Sweden)
R. Casero
2010-06-01
Full Text Available La leishmaniosis es una parasitosis de evolución crónica; en Argentina, sus agentes etiológicos principales pertenecen al complejo Leishmania (Viannia braziliensis, habitualmente asociado a lesiones cutáneas y mucocutáneas. Informamos en este trabajo un caso de leishmaniosis laríngea en un hombre de 29 años procedente de Jujuy, quien a raíz de múltiples subdiagnósticos portaba esta parasitosis desde hacía 20 años. En el año 2008 este paciente consulta por disfonía crónica y trastornos en las vías aéreas superiores, refiere que fue sometido a terapias con tuberculostáticos, antifúngicos y corticoides desde 2002. Diferentes biopsias y fibroscopías revelaron los siguientes diagnósticos: laringitis granulomatosa inespecífica, laringitis compatible con tuberculosis, laringitis compatible con histoplasmosis, linfoma Natural Killer extraganglionar a células pequeñas. Finalmente, estudios realizados en nuestro hospital demostraron la presencia de una laringe granulomatosa en toda su extensión, amastigotes intra y extracelulares de Leishmania spp., ausencia de formas compatibles con Micobacterias e Histoplasma, y laringitis crónica vinculable a Leishmania spp. El paciente realizó tratamiento con antimoniato de N-metil-glucamina y demostró una muy buena evolución clínica tras ser examinado 2 meses después. Si bien la leishmaniosis laríngea como lesión única no es la presentación prevalente de esta zoonosis, su estudio amerita especial atención en pacientes tratados con corticoides, pues esto evitará un diagnóstico tardío y las mayores consecuencias asociadas a la morbimortalidad propia de esta parasitosis.Leishmaniosis is a chronic parasitic disease, which in Argentina is mainly caused by protozoa belonging to the Leishmania (Viannia braziliensis complex, leading to cutaneous and mucosal pathologies. We report a rare case of laryngeal leishmaniosis in a 29 year-old man from Jujuy province, Argentina, who had been
Dumont, Pascal; Fankhauser, Becky; Bouhsira, Emilie; Lienard, Emmanuel; Jacquiet, Philippe; Beugnet, Frederic; Franc, Michel
2015-01-27
Two successive laboratory experiments (A and B) were conducted to confirm the efficacy of a new fipronil and permethrin combination to repel and kill Phlebotomus perniciosus sandflies when applied once topically on dogs. Due to the difficulty to get enough available dogs and sandflies in one run, the study was divided into 2 experiments which had exactly the same design, and were conducted at the same place, with the same technicians. They compared dogs treated with a combination containing 67.6 mg/mL fipronil + 504.8 mg/mL permethrin (Frontect/Frontline Tri-Act, Merial) to untreated dogs. The treatments were applied topically once on Day 0. Sandfly exposures were performed on Days 1, 7, 14, 21 and 29 with 80 P. perniciosus female sandflies. After 60 min, sandflies were assessed for vitality and engorgement status. Live sandflies were kept in an insectary and observed for mortality counts 4 h after the exposure period ended. Percent sandfly repellency on treated dogs was 98.2, 98.5, 99.2, 90.9 and 90.3%, for Days 1, 7, 14, 21, and 29, respectively. There was a significant difference (p ≤ 0.05) between the treated and control groups in both experiments and for the pooled data on every assessment day. Insecticidal efficacy on treated dogs at 4 h post-exposure on Days 1, 7, 14, 21 and 29 was 98.7, 99.7, 96.8, 93.4, and 78.9%, respectively. There was a significant difference between the treated and control groups for live sandflies observed at 4 h post-exposure for all assessment days (p 80%) against P. perniciosus which lasted for 29 days after application. The repellent effect was accompanied by a significant insecticidal effect on sandflies. The results suggest that in endemic areas, the application of the fipronil-permethrin combination could be integrated into canine leishmaniosis prevention program.
Directory of Open Access Journals (Sweden)
Ivan Darío Vélez
1994-01-01
Full Text Available Se hizo un Inventario de fauna flebotomínea en Isla Fuerte, Bolívar, costa caribe colombiana. Se demostró por primera vez en dicha Isla la presencia de Lu. evansi, Lu. gomezi y Lu. trinidadensis. La presencia de Lu. Evansi (91.7% de las 73 capturas, vector principal de la leishmaniosis visceral en la costa caribe colombiana, convierte a Isla Fuerte en una zona de riesgo potencial de transmisión de leishmaniosis visceral.
An inventory was made of phiebotomidae fauna in Isla Fuerte, Bolívar, on the caribbean colombian coast. The presence of Lu. evansi was demonstrated for the first time in that island and this species constituted 91.7% of 73 captures. Therefore the island becomes a potential risk for transmission of visceralleish. maniosis since Lu. evansi its main vector.
Nota preliminar sobre Leishmaniosis natural en perros
Directory of Open Access Journals (Sweden)
Arístides Herrer
1948-12-01
Full Text Available En una provincia del Perú donde es, endémica la Leishmaniosis tegumentaria conocida con el nombre de Uta, por espacio de algo más de dos años se han llevado a cabo detenidos estudios en busca del reservorio de dicha enfermedad, comprendiendo estas investigaciones principalmente a los, animales domésticos de la región. La primera serie, de observaciones, realizadas entre Mayo, 1945 y julio, 1946, consta de 469 animales. Durante este período el autor esperaba encontrar en los animales infectados lesiones de la piel ulceradas en forma semejante a lo que sucede en el hombre, cosa que no le fué posible verificar en ningún caso. Informado del aspecto macroscópico de las lesiones en el perro, por medio de infecciones experimentales que obtuviera en el laboratorio, prosiguió sus observaciones con 496 animales más, consiguiendo demostrar la infecciones natural en 40 perros. Un hecho importante en estas infecciones es que con frecuencia no dan lugar a ninguna alteración macroscópica de la piel. La incidencia de la infección natural del perro coincide en líneas generales con la humana, además de que en varias oportunidades los animales infectados procedían de las mismas habitaciones donde había uno o más casos de leishmaniosis tegumentaria entre sus dueños.
Directory of Open Access Journals (Sweden)
Iván Darío Vélez Bernal
1994-04-01
Full Text Available
Se realizó una prospección entomológica en la Isla de Santa Cruz de Mompox entre los días 23 y 29 de diciembre de 1993, con el fin de determinar si se trata de una zona de riesgo potencial de Infección por Leishmania; para ello se practicaron capturas de flebotomíneos en sitios de reposo diurno y con trampas de luz tipo CDC y Shannon, colocadas simultáneamente en el perl y el extradomicilio. Se colectaron 367 ejemplares de flebotomíneos cuya Identificación demostró por primera vez la presencia en la Isla de siete especies de Lutzomyia entre las cuales se encuentran Lu. panamensis y Lu. gomezi, vectoras de leishmaniosis cutánea y Lu. evansi vectora principal de la forma visceral en la Costa Caribe Colombiana; el hallazgo demuestra que la isla es una zona de riesgo potencial para leishmaniosis cutánea y visceral.
An entomological survey was carried out at the island of Santa Cruz of Mompox between December 23 and 29, 1993, In order to determine if there is a potential risk for Leishmania infection. Phlebotominae were captured at sites of diurnal rest as well as using CDC and Shannon light traps, simultaneously located at extra and peridomiciliary sites. 367 specimens were collected, among them 7 species of Lutzomyia including Lu. panamensis and Lu. gomezi vectors of cutaneous leishmaniosis; also Lu. evansi, the main vector of visceral leishmaniosis In the Colombian Caribbean Coast. This is the first report implicating this island as a potential risk site for cutaneous and visceral leishmaniosis.
Canine rabies epidemiology in Araçatuba and neighborhood, Northwestern São Paulo State - Brazil
Directory of Open Access Journals (Sweden)
Silva Luzia Helena Queiroz da
2004-01-01
Full Text Available Epidemiological characteristics of canine rabies in the northwest region of São Paulo State (Araçatuba region, Brazil, from 1993 to 1997 are presented. Out of 1,984 dogs, a total of 351 (17.7% were positive for rabies diagnosis; 89% (312/351 of these occurred in urban areas and 85% (266/312 of the urban positive cases were among owned dogs. The mean age of the rabid dogs was 34 months and 61% were male. Aggressive behavior was observed in 77% of rabid dogs, followed by lack of coordination and paralysis (42% and 48% of these dogs were responsible biting people or other animals. Information about vaccination status was obtained from 182 records and 51% of rabid dogs were non-vaccinated. The number of unvaccinated rabid dogs indicates a low vaccination index and this factor added to the high dog/man ratio must have contributed to the canine rabies epizootic observed in the studied area.
New and emerging pathogens in canine infectious respiratory disease.
Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J
2014-03-01
Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.
José Fernández; Felio Bello; Myriam Consuelo López; Ligia Inés Moncada; Jimmy Jolman Vargas; Martha Stella Ayala; Rubén Santiago Nicholls; Carlos Alberto Lozano
2006-01-01
Introducción. La leishmaniosis visceral canina en áreas endémicas de Colombia se constituye en un factor de riesgo para la salud pública, dado el carácter zoonótico de la enfermedad. Durante el año 2004 se registraron 96 casos de leishmaniosis visceral humana en el país, de los cuales cinco correspondieron al departamento del Huila, zona de influencia del vector Lutzomyia longipalpis. Objetivo. Determinar la prevalencia de anticuerpos IgG contra Leishmania chagasi en sueros de caninos rec...
Directory of Open Access Journals (Sweden)
Jobin Thomas
2014-11-01
Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.
Seroprevalence of Leishmaniasis Among Dogs Living in a Municipal Dog and Cat Shelter in Edirne.
Düzbeyaz, Ayşe; Şakru, Nermin; Töz, Seray
2016-06-01
In this study, we aimed to investigate the seroprevalence of canine leishmaniosis among dogs that live in the town center due to a lack of data on the prevalence of canine leishmaniasis (CanL) in Edirne. In the present study, 37 dogs living in a municipal dog and cat shelter in Edirne were screened for leishmaniosis by the ındirect fluorescent antibody test. All samples were found to be seronegative. Our study is a preliminary study for Edirne. We wish to perform a large-scale seroepidemiological study with a larger number of dogs from different regions and identify Phlebotomus species.
Molecular epidemiology of canine parvovirus in Morocco.
Amrani, Nadia; Desario, Costantina; Kadiri, Ahlam; Cavalli, Alessandra; Berrada, Jaouad; Zro, Khalil; Sebbar, Ghizlane; Colaianni, Maria Loredana; Parisi, Antonio; Elia, Gabriella; Buonavoglia, Canio; Malik, Jamal; Decaro, Nicola
2016-07-01
Since it first emergence in the mid-1970's, canine parvovirus 2 (CPV-2) has evolved giving rise to new antigenic variants termed CPV-2a, CPV-2b and CPV-2c, which have completely replaced the original strain and had been variously distributed worldwide. In Africa limited data are available on epidemiological prevalence of these new types. Hence, the aim of the present study was to determine circulating variants in Morocco. Through TaqMan-based real-time PCR assay, 91 samples, collected from symptomatic dogs originating from various cities between 2011 and 2015, were diagnosed. Positive specimens were characterised by means of minor groove binder (MGB) probe PCR. The results showed that all samples but one (98.9%) were CPV positive, of which 1 (1.1%) was characterised as CPV-2a, 43 (47.7%) as CPV-2b and 39 (43.3%) as CPV-2c. Interestingly, a co-infection with CPV-2b and CPV-2c was detected in 4 (4.4%) samples and 3 (3.3%) samples were not characterised. Sequencing of the full VP2 gene revealed these 3 uncharacterised strains as CPV-2c, displaying a change G4068A responsible for the replacement of aspartic acid with asparagine at residue 427, impacting the MGB probe binding. In this work we provide a better understanding of the current status of prevailing CPV strains in northern Africa. Copyright © 2016 Elsevier B.V. All rights reserved.
Canine Babesiosis in China Caused by Babesia gibsoni: A Molecular Approach.
Directory of Open Access Journals (Sweden)
Da-Wei Yao
2014-06-01
Full Text Available To provide a point of reference to study the epidemiology and clinical expression of canine babesiosis in China.A total of 30 dogs infected with canine babesiosis were evaluated by mean of clinical history, physical examination, hematological, restriction fragment length polymorphism of PCR products (PCR-RFLP and sequencing analysis.The most prevalent clinical abnormalities were lethargy (100%, anorexia (100%, pale or icteric mucous membranes (80%, fever (70% and dark urine (70%. Hematology parameters revealed that anemia and thrombocytopenia were the major abnormalities in blood of dogs infected with canine babesia. The results of PCR-RFLP and sequencing analysis indicated that B. gibsoni was the main species responsible for canine babesiosis cases at the time of the study in Nanjing, China.The results provide valuable information for better understanding of the epidemiology of canine babesiosis in China.
M.B. Salinas Granell; A. Tabanera de Lucio
2013-01-01
Antecedentes y objetivos: La incorporación de estudios epidemiológicos y métodos de análisis de costes suponen herramientas de primer orden dentro de la Sanidad Militar. Permiten optimizar los recursos y estructuras disponibles, manteniendo así la eficacia y efectividad en la lucha frente a las enfermedades, una de ellas la Leishmaniosis. La epidemiología de campo, se nos presenta como una útil herramienta para alcanzar nuestro objetivo sanitario estratégico que es el de controlar esta enferm...
Leishmaniosis cutánea en Colombia y género Gender and cutaneous leishmaniasis in Colombia
Directory of Open Access Journals (Sweden)
Iván Darío Velez
2001-02-01
Full Text Available En Colombia, tradicionalmente se ha visto la leishmaniosis como un problema de Salud Pública para hombres adultos dado que se considera que la transmisión es selvática y que ellos empiezan a infectarse cuando entran a los biotopos del vector con el fin de utilizar los recursos naturales. Sin embargo, el Programa de Estudio y Control de Enfermedades Tropicales (PECET ha observado iguales proporciones de hombres y mujeres con leishmaniosis activa y pruebas cutáneas positivas. Algunos factores, hasta ahora nunca analizados, parecen distorsionar el patrón de la enfermedad y al parecer existen diferencias inherentes al género relacionadas con el acceso a la atención en salud. Como consecuencia, el sufrimiento humano no es aliviado y las repercusiones socio-económicas para las amas de casa son significativas. El Ministerio de Salud subestima la magnitud de la transmisión intra y peridomiciliaria y la detección de casos activos se descuida para mujeres, por lo cual se deben mejorar los programas de control de leishmaniosis, especialmente en lo relacionado con la detección de casos activos, entrenamiento y educación, de tal forma que el diagnóstico se realice en forma más rápida.Leishmaniasis in Colombia has traditionally been seen as a health risk for adult males, as they become infected when they enter the vector's biotopes to tap natural resources. National health statistics seem to confirm this theory. However, during field studies, the Program for the Study and Control of Tropical Diseases (PECET observed both equal proportions of men and women with active leishmaniasis and delayed hypersensitivity skin tests and equal proportions of males and females having had contact with the parasite from early childhood. Several factors that have not been analyzed in depth in Colombia thus far appear to distort the disease's epidemiological pattern in the country, and gender-linked differences in access to health care appear to exist. As a
A serological study of Leishmania infantum in dogs of Khorasan Razavi province, Iran.
Sabzevari, S; Razmi, G R; Naghibi, A; Khoshnegah, J
2013-10-01
Leishmania infantum is the principal agent of visceral leishmaniosis (kala-azar) in all areas of Iran. The disease is endemic in Fars, Ardabil, East Azerbaijan and Bushehr provinces while it is sporadic in other parts of the country. Dog as a member of canidae family is the main animal reservoir host of kala-azar. The present study was carried out to determine the sero-prevalence of canine leishmaniosis in Mashhad, the capital city of Khorasan Razavi Province, in the north east of Iran. Two-hundred and nine dogs in two different classes including stray and sheepdogs were selected for this cross-sectional study. The blood samples were collected and tested by indirect immunofluorescent antibody test for detection of anti-Leishmania infantum antibodies. The results showed that 16/209 (7.6 %) of blood samples were positive. The sero-prevalence rates in stray and sheepdogs were 11/94 (11.7 %) and 5/115 (4.3 %), respectively (p < 0.05). Based on the results obtained, it is concluded that visceral leishmaniosis is distributed among dogs of this area, also sero-prevalence of canine leishmaniosis in stray dogs higher than sheepdogs.
Molecular Epidemiology of Canine Parvovirus, Europe
Desario, Costantina; Addie, Diane D.; Martella, Vito; Vieira, Maria João; Elia, Gabriella; Zicola, Angelique; Davis, Christopher; Thompson, Gertrude; Thiry, Ethienne; Truyen, Uwe; Buonavoglia, Canio
2007-01-01
Canine parvovirus (CPV), which causes hemorrhagic enteritis in dogs, has 3 antigenic variants: types 2a, 2b, and 2c. Molecular method assessment of the distribution of the CPV variants in Europe showed that the new variant CPV-2c is widespread in Europe and that the viruses are distributed in different countries. PMID:17953097
Campos, Roseane; Santos, Márcio; Tunon, Gabriel; Cunha, Luana; Magalhães, Lucas; Moraes, Juliana; Ramalho, Danielle; Lima, Sanmy; Pacheco, José Antônio; Lipscomb, Michael; Ribeiro de Jesus, Amélia; Pacheco de Almeida, Roque
2017-05-11
Visceral leishmaniasis (VL) is a systemic disease endemic in tropical countries and transmitted through sand flies. In particular, Canis familiaris (or domesticated dogs) are believed to be a major urban reservoir for the parasite causing the disease Leishmania. The average number of human VL cases was 58 per year in the state of Sergipe. The city of Aracaju, capital of Sergipe in Northeastern Brazil, had 159 cases of VL in humans. Correlatively, the percentage of serologically positive dogs for leishmaniasis increased from 4.73% in 2008 to 12.69% in 2014. Thus, these studies aimed to delineate the spatial distribution and epidemiological aspects of human and canine VL as mutually supportive for increased incidence. The number of human cases of VL and the frequency of canine positive serology for VL both increased between 2008 and 2014. Spatial distribution analyses mapped areas of the city with the highest concentration of human and canine VL cases. The neighbourhoods that showed the highest disease frequency were located on the outskirts of the city and in urbanised areas or subjected to development. Exponential increase in VL-positive dogs further suggests that the disease is expanding in urban areas, where it can serve as a reservoir for transmission of dogs to humans via the sand fly vector.
Directory of Open Access Journals (Sweden)
Roseane Campos
2017-05-01
Full Text Available Visceral leishmaniasis (VL is a systemic disease endemic in tropical countries and transmitted through sand flies. In particular, Canis familiaris (or domesticated dogs are believed to be a major urban reservoir for the parasite causing the disease Leishmania. The average number of human VL cases was 58 per year in the state of Sergipe. The city of Aracaju, capital of Sergipe in Northeastern Brazil, had 159 cases of VL in humans. Correlatively, the percentage of serologically positive dogs for leishmaniasis increased from 4.73% in 2008 to 12.69% in 2014. Thus, these studies aimed to delineate the spatial distribution and epidemiological aspects of human and canine VL as mutually supportive for increased incidence. The number of human cases of VL and the frequency of canine positive serology for VL both increased between 2008 and 2014. Spatial distribution analyses mapped areas of the city with the highest concentration of human and canine VL cases. The neighbourhoods that showed the highest disease frequency were located on the outskirts of the city and in urbanised areas or subjected to development. Exponential increase in VL-positive dogs further suggests that the disease is expanding in urban areas, where it can serve as a reservoir for transmission of dogs to humans via the sand fly vector.
Marquez, Ellen de Souza; de Castro, Edilene Alcântara; Nabut, Luciene Biazono; da Costa-Ribeiro, Magda Clara Vieira; Dela Coletta Troiano Araújo, Ludmilla; Poubel, Saloe Bispo; Gonçalves, André Luiz; Cruz, Mariza Fordellone Rosa; Dos Santos Trad, Ana Paula Millet Evangelista; Dias, Rafael Andre Ferreira; Navarro, Italmar Teodorico; Thomaz-Soccol, Vanete
2017-08-30
Environmental changes have occurred over the years, altering the eco-epidemiological pattern of leishmaniosis in the State of Paraná, Brazil, involving the pillars of the cycle (parasite, vectors, reservoir, and environment) and their interaction. Much has been discussed about the dog's role as a reservoir of the Leishmania (Viannia) braziliensis Vianna, 1911 transmission cycle. However, this question remains unanswered. The purpose of this study was to investigate, using parasitological and molecular methods, different samples in eight naturally infected dogs from an endemic rural locality where only L. (V.) braziliensis is present, and where human cases have been previously notified. Blood and biopsied organ samples from naturally infected dogs were analyzed by culture media, PCR, random amplified polymorphic DNA and sequencing methodologies. Only skin lesions from all dogs yielded positive cultures and when PCR was performed, L. (V.) braziliensis DNA was amplified from intact skin, peripheral blood, bone marrow, spleen, liver and lymph nodes. RAPD was also applied to isolates from the skin lesions, exhibiting the genetic variability of the parasite identified. To confirm which species of Leishmania was amplified in PCR, the sequencing method was performed, verifying 100% similarity with the Viannia subgenus. This study showed that L. (V.) braziliensis can spread to other sites besides the ulcerous lesions, such as intact skin, peripheral blood and internal organs, making it possibility for dogs to serve as active sources of parasite transmission. For definitive proof, xenodiagnostic test on intact skin of infected dogs, should be done. Copyright © 2017 Elsevier B.V. All rights reserved.
Prevalence and epidemiology of canine and feline heartworm infection in Taiwan.
Lu, Ta-Li; Wong, Jun-Yue; Tan, Ta-Lun; Hung, Yong-Wei
2017-11-09
Heartworm, Dirofilaria immitis, has long been recognized in Taiwanese dogs but feline heartworm infection has been largely overlooked by veterinarians and pet owners. The main goal of this study was to determine the prevalence and epidemiology of canine and feline heartworm infection in Taiwan. Household dogs and cats were selected from 103 veterinary hospitals in 13 cities throughout Taiwan. All animals were at least 1 year old, had received no heartworm prevention for more than 1 year, and had lived in the same city for at least 1 year. Client consent was obtained and an owner questionnaire was completed for each patient. Blood samples were collected from each canine patient and tested at each veterinary hospital for microfilariae and for circulating antigen. A positive result on either test was considered to confirm mature heartworm infection. Blood was collected from each feline patient and examined for microfilariae and a feline heartworm antigen/antibody test was performed. Descriptive statistics were used for heartworm prevalence. Multivariate logistic regression analysis was used to determine the relationships between heartworm infection and multiple risk factors. A total of 2064 household dogs and 616 household cats from 103 veterinary hospitals throughout Taiwan were included in the study. The overall prevalence of canine heartworm disease was 22.8% (471/2064). In heartworm-positive dogs, 63% were both microfilaria positive and antigen positive, 35% were microfilaria negative and antigen positive, and only 2% were microfilaria positive and antigen negative. In the comparison of different life style groups, outdoor dogs (N = 797) had significantly higher heartworm prevalence rate than indoor dogs (N = 1267; p = 0.000). The heartworm prevalence rate in dogs presented with dyspnea and cough was as high as 51%. The overall prevalence of antibody-positive cats was 6.7% (41/616) and the antigen-positive prevalence rate was 3.1% (19/616). In 41 antibody
Cavalli, Alessandra; Desario, Costantina; Kusi, Ilir; Mari, Viviana; Lorusso, Eleonora; Cirone, Francesco; Kumbe, Ilirjan; Colaianni, Maria Loredana; Buonavoglia, Domenico; Decaro, Nicola
2014-07-01
An epidemiological survey for Canine parvovirus 2 (CPV-2) and Canine coronavirus (CCoV) was conducted in Albania. A total of 57 fecal samples were collected from diarrheic dogs in the District of Tirana during 2011-2013. The molecular assays detected 53 and 31 CPV- and CCoV-positive specimens, respectively, with mixed CPV-CCoV infections diagnosed in 28 dogs. The most frequently detected CPV type was 2a, whereas IIa was the predominant CCoV subtype. A better comprehension of the CPV-CCoV epidemiology in eastern European countries will help to assess the most appropriate vaccination strategies to prevent disease due to infections with these widespread agents of acute gastroenteritis in the dog.
Genetics of Human and Canine Dilated Cardiomyopathy.
Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
Genetics of Human and Canine Dilated Cardiomyopathy
Directory of Open Access Journals (Sweden)
Siobhan Simpson
2015-01-01
Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
Attipa, Charalampos; Solano-Gallego, Laia; Papasouliotis, Kostas; Soutter, Francesca; Morris, David; Helps, Chris; Carver, Scott; Tasker, Séverine
2018-03-20
In the Mediterranean basin, Leishmania infantum is a major cause of disease in dogs, which are frequently co-infected with other vector-borne pathogens (VBP). However, the associations between dogs with clinical leishmaniosis (ClinL) and VBP co-infections have not been studied. We assessed the risk of VBP infections in dogs with ClinL and healthy controls. We conducted a prospective case-control study of dogs with ClinL (positive qPCR and ELISA antibody for L. infantum on peripheral blood) and clinically healthy, ideally breed-, sex- and age-matched, control dogs (negative qPCR and ELISA antibody for L. infantum on peripheral blood) from Paphos, Cyprus. We obtained demographic data and all dogs underwent PCR on EDTA-blood extracted DNA for haemoplasma species, Ehrlichia/Anaplasma spp., Babesia spp., and Hepatozoon spp., with DNA sequencing to identify infecting species. We used logistic regression analysis and structural equation modelling (SEM) to evaluate the risk of VBP infections between ClinL cases and controls. From the 50 enrolled dogs with ClinL, DNA was detected in 24 (48%) for Hepatozoon spp., 14 (28%) for Mycoplasma haemocanis, 6 (12%) for Ehrlichia canis and 2 (4%) for Anaplasma platys. In the 92 enrolled control dogs, DNA was detected in 41 (45%) for Hepatozoon spp., 18 (20%) for M. haemocanis, 1 (1%) for E. canis and 3 (3%) for A. platys. No Babesia spp. or "Candidatus Mycoplasma haematoparvum" DNA was detected in any dog. No statistical differences were found between the ClinL and controls regarding age, sex, breed, lifestyle and use of ectoparasitic prevention. A significant association between ClinL and E. canis infection (OR = 12.4, 95% CI: 1.5-106.0, P = 0.022) was found compared to controls by multivariate logistic regression. This association was confirmed using SEM, which further identified that younger dogs were more likely to be infected with each of Hepatozoon spp. and M. haemocanis, and dogs with Hepatozoon spp. were more likely to
Directory of Open Access Journals (Sweden)
D.M. Aguiar
2004-06-01
Full Text Available Clinic-epidemiological data in canine infection by Hepatozoon canis were reported. Apatia, anorexia, prostaction, weight loss and muscle pain were the most-common clinical recognized signs. Blood smear was used as diagnosis method for the detection of H. canis gamonts in the neutrophils. Anaemia, leucocytosis, monocytosis and lymphopenia were observed in the haematological exams. Imidocarb dipropionate associated with tetracyclines and sulfamethoxasole-trimethoprim were used in therapy.
Epidemiology of canine gastrointestinal helminths in sub-Saharan Africa
Directory of Open Access Journals (Sweden)
Nozyechi Ngulube Chidumayo
2018-02-01
Full Text Available Abstract Background Dogs have a close association with humans providing companionship, security and a source of dietary protein. However, dogs are also potential carriers of zoonotic pathogens. Dogs, therefore, pose a public health risk and a good understanding of canine diseases is important for planning and implementing control measures. The aim of this study was to characterise canine helminthiasis in sub-Saharan Africa using a systematic approach. Methods Pubmed and Google Scholar were searched for relevant primary studies published from 2000. Forty-one eligible studies were included in the meta-analysis. Pooled prevalences were estimated using the quality effects model. Results and conclusions Twenty-six genera of enteric helminths were reported and the pooled estimate of canine helminthiasis was 71% (95% CI: 63–79%. Species of Ancylostoma and Toxocara, causative agents of larva migrans in humans, were the most frequently reported helminths with pooled estimated prevalences of 41% (95% CI: 32–50% and 22% (95% CI: 16–29%, respectively. Dipylidium caninum and Taenia spp. were the most frequently reported cestodes with pooled estimated prevalences of 20% (95% CI: 12–29% and 9% (95% CI: 5–15%, respectively. Trematodes were rarely reported. There was a high level of heterogeneity in most pooled estimates (I2 ˃ 80%. The results of this study show that canine helminthiasis is highly prevalent in sub-Saharan Africa and there is need for regular deworming programmes to improve the health status of the dogs and minimise the potential health risk to humans.
Comunicación preliminar sobre dos casos de leishmaniosis visceral
Directory of Open Access Journals (Sweden)
Álvaro Gómez Vargas
1960-04-01
Full Text Available La Leishmaniosis visceral, o Kalaazar, es una enfermedad febril producida por un protozoario (Leisbmania donovani, que causa una alta mortalidad (85 a 95%, y que se puede presentar en forma epidémica o endémica en los países tropicales y subtropicales. Esta enfermedad fue descubierta en la India; más tarde se vio que existe también en la China e Indochina. En Europa se disemina al sur de Rusia y en los países litorales del Mediterráneo. En América ha sido descrita en Paraguay, Argentina, Brasil, Bolivia, Colombia, Venezuela, Perú, Guatemala y México.
[Canine and human rabies in Conakry: epidemiology and preventive aspects].
Youla, A S; Traore, F A; Sako, F B; Feda, R M; Emeric, M A
2014-02-01
In Guinea, stray dogs are present in large numbers in public places and around landfills. The objectives of this study were to determine the frequency of human exposure to rabies risk, the cases of human and canine rabies and to describe the epidemiological profile of the cases. This retrospective and descriptive study was conducted in health and veterinarian facilities within the city of Conakry. All records of patients admitted in these facilities because of animal bites and veterinary records for aggression by domestic animals from 2002 to 2012, so, during an 11-year period, were collected. During the study period, 7 994 people were concerned by domestic animal bites. Males were the most affected with 60.4% of all cases. Students represented the higher class with 36.0%, followed by workers (18%). The majority of injuries were to the lower limbs (54.4%). The dog has been implicated in the attacks in 98.8% of cases. Among the 2 916 biting dogs which were placed under observation, 14 developed clinical rabies. Among those assaulted, 11 cases of rabies were reported. From 7 994 victims of domestic animal bites, 2 634 received post-exposure prophylaxis and the dropout rate was 51%. Rabies is a real risk in Conakry. Provisions in terms of public health strategy must be taken to minimize it.
Directory of Open Access Journals (Sweden)
Elisa B. Neuwald
2014-04-01
Full Text Available This paper describes the epidemiological, clinical and immunohistochemical characteristics of canine lymphomas diagnosed in the region of Porto Alegre, Brazil. Thirty dogs were enrolled in the study; most of them were male (60%, mixed-breed (23% and middle-aged or older. The majority (87% of affected dogs showed the multicentric form. The B-cell phenotype was most frequently detected (62%; 37% of the animals were in clinical stage IV, and 83% were classified as sub-stage "b". Lymphadenopathy was observed in 67% of the cases, and dyspnea, prostration, decreased appetite and vomiting were the most common clinical signs encountered. Anemia was a frequently encountered laboratory alteration (57%, as were leukocytosis (40%, thrombocytopenia (33%, lymphopenia (30%, hyperglobulinemia (20% and hypercalcemia (13%. The results of this study indicate that the clinical features of dogs with lymphoma in the region of Porto Alegre are similar to those observed worldwide.
Recent advances in canine leptospirosis: focus on vaccine development
Directory of Open Access Journals (Sweden)
Klaasen HLBM
2015-06-01
Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis
Toll-like receptors and cytokines in the brain and in spleen of dogs with visceral leishmaniosis.
Grano, Fernanda G; Dos S Silva, José Eduardo; Melo, Guilherme D; de Souza, Milena S; Lima, Valéria M F; Machado, Gisele F
2018-04-15
Visceral leishmaniosis (VL) is a multisystem disease that affects domestic dogs and can have several clinical manifestations, including some rare reports of neurological clinical signs, or it may remain asymptomatic, depending on the individual immune response against the Leishmania parasite. VL involves immune system sensors, such as the Toll-like receptors (TLRs), that are related to innate immunity and inflammation. Previously, we have reported the presence of brain inflammation in infected dogs. Here, we investigated the gene expression profile of TLRs 1-10 in the brain and the spleen of infected dogs, along with the production of proinflammatory cytokines (TNF-α, IFN-γ, IL-1β and IL-6) with the aim of explaining the origin of brain inflammation. The gene expression of TLRs has varied according to the tissue evaluated. In the brain, TLR-4 was only up-regulated in a small subpopulation of infected dogs, while in the spleen, we detected an increase in TLR-5 and TLR-9 transcripts, as well as a reduction in TLRs 2-4 and TLR-10. All cytokines except IL-6 were detected in infected dogs. Moreover, we detected Leishmania DNA in all infected dogs in both tissues evaluated. In the histopathological analysis, we observed a predominance of lymphoplasmacytic infiltrate, mainly in leptomeninges and choroid plexuses, ranging from mild to intense. This study provides the first insight into the TLRs profile in the brain and the spleen during canine VL and provides support to confirm the involvement of sensors of the innate immune system sensors against L. infantum parasites. Copyright © 2018 Elsevier B.V. All rights reserved.
Canine and feline obesity: a review of pathophysiology, epidemiology, and clinical management
Directory of Open Access Journals (Sweden)
Loftus JP
2014-12-01
Full Text Available John P Loftus, Joseph J Wakshlag Cornell University College of Veterinary Medicine, Veterinary Medical Center, Ithaca, NY, USAAbstract: Canine and feline obesity rates have reached pandemic proportions and are similar to those in humans, with approximately 30%–40% of dogs and cats being overweight to obese. Obesity has been associated with other health problems, including osteoarthritis, renal disease, skin disease, insulin resistance, and neoplasia in dogs, while in cats obesity is associated with dermatological issues, diabetes mellitus, neoplasia, and urolithiasis. The health issues appear to be slightly different across the two species, which may be due to some inherent differences in the hormonal milieu involved in obesity that differs between the dog and the cat. In this review, we discuss the complicated nature of the pathogenesis of obesity, the hormonal stimulus for orexigenic and anorexigenic behavior, adipose tissue as an endocrine organ, and most importantly, clinical management of the number one disease in canine and feline medicine.Keywords: obesity, canine, feline, veterinary
Ito, Marcos Massayuki; Catanhêde, Lilian Motta; Katsuragawa, Tony Hiroshi; Silva Junior, Cipriano Ferreira da; Camargo, Luis Marcelo Aranha; Mattos, Ricardo de Godoi; Vilallobos-Salcedo, Juan Miguel
2015-01-01
Mucosal leishmaniosis (ML) is a severe clinical form of leishmaniosis. Complex factors related to the parasite and the host are attributed to the development of mucosal lesions. Leishmania RNA virus 1 (LRV1) can disrupt immune response, and may be the main determinant of severity of the disease; it should be investigated. To study the existence of clinical differences between patients with ML with endosymbiosis by LRV1 and. those without it. A cross-sectional cohort study with clinical evaluation, polymerase chain reaction (PCR) detection of Leishmania, species classification, and search of LRV1 was performed. Only patients with confirmed diagnosis of ML by positive PCR and with nasal mucosa injuries were included in this analysis. Out of 37 patients, 30 (81.1%) were diagnosed with Leishmania braziliensis, five (13.5%) with Leishmania guyanensis, and two (5.4%) with mixed infection of L. braziliensis and L. guyanensis. LVR1 virus was present in 26 (70.3%) of the cases. Correlation between clinical phenotype and presence of LRV1 was not observed, although the frequency of the virus is two-fold higher in mucosal lesions than that found in the literature on skin lesions in the same geographical area. Copyright © 2015 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.
Prevalence and risk factors for canine obesity surveyed in veterinary practices in Beijing, China.
Mao, Junfu; Xia, Zhaofei; Chen, Jiangnan; Yu, Jinhai
2013-11-01
An epidemiological survey of canine obesity was carried out in Beijing, China. Cases (n=2391, 7 districts) were collected at 14 animal hospitals between April 2008 and April 2011. The body condition score (scales of 1-5) was used to assess obesity of the dogs (Burkholder and Toll, 2000; Laflamme, 1997). Obesity rates were analyzed with respect to breed, age, sex, neutering, food control, feeding frequency, reproduction status, food type, nutritional supplements, living environment, feeding time, number of pets per household, feeding purpose, activity control, exercise duration, exercise status and exercise type. The overall canine obesity rate was 44.4% in this survey. The risk factors for dog obesity were food type (non-commercial food, OR=1.377, pobesity was high in pugs (70.7%), Cocker Spaniel (69.4%), Pekingese (51.9%), Pomeranian (54.6%) and Golden Retriever (51.9%). This is the first report of the epidemiology of canine obesity in China. Copyright © 2013 Elsevier B.V. All rights reserved.
Serological and molecular survey of Leishmania infection in dogs from Luanda, Angola
Vilhena, Hugo; Granada, Sara; Oliveira, Ana Cristina; Schallig, Henk D. F. H.; Nachum-Biala, Yaarit; Cardoso, Luís; Baneth, Gad
2014-01-01
Canine leishmaniosis (CanL) due to Leishmania infantum is a global zoonosis endemic in more than 70 countries in Europe, North Africa, Asia and America; however, data on this infection is scarce from southern Africa. The aim of this study was to survey dogs in Luanda, Angola, for Leishmania
An epidemiological study of environmental factors associated with canine obesity.
Courcier, E A; Thomson, R M; Mellor, D J; Yam, P S
2010-07-01
To assess the relationships between socioeconomic and other environmental factors with canine obesity. This was a cross-sectional questionnaire study of dog owners attending five primary veterinary practices in the UK. Owners were asked about dog age, neuter status, feeding habits, dog exercise, household income and owner age. The body condition score of the dogs was also assessed. Factors hypothesised to be associated with obesity were investigated. In total, data from 696 questionnaires were evaluated. Out of those data evaluated, 35.3% of dogs (n=246) were classed as an ideal body shape, 38.9% (n=271) were overweight, 20.4% (n=142) were obese and 5.3% (n=37) were underweight. Identified risk factors associated with obesity included owner age, hours of weekly exercise, frequency of snacks/treats and personal income. Environmental risk factors associated with canine obesity are multifactorial and include personal income, owner age, frequency of snacks/treats and amount of exercise the dog receives. Awareness about health risks associated with obesity in dogs is significantly less in people in lower income brackets. This phenomenon is recognised in human obesity.
American Canine Hepatozoonosis
Ewing, S. A.; Panciera, R. J.
2003-01-01
American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294
Martínez Urrea, José
2009-01-01
Discurso de inauguración del curso 2009 de la Reial Acadèmia de Medicina de la Comunitat Valenciana por el Ilmo. Sr. Dr. D. José Martínez Urrea: El endemismo por paludismo, lepra, leishmaniosis y leptospirosis en la provincia de Castellón, a mediados del siglo XX. Vivencias personales.
Directory of Open Access Journals (Sweden)
Coleman Glen T
2010-04-01
Full Text Available Abstract Despite the combination of favourable climate for parasites and vectors, and large populations of stray dogs, information concerning the epidemiology, diagnosis and management of canine vector-borne diseases in India is limited. However, with the country's expanding economy and adaptation to western culture, higher expectations and demands are being placed on veterinary surgeons for improved knowledge of diseases and control. This review aims to provide an overview of the current state of knowledge of these diseases in India and identify existing knowledge gaps in the literature which need to be addressed. The available literature on this subject, although limited, suggests that a number of canine vector-borne diseases such as filariasis, babesiosis and ehrlichiosis are endemic throughout India, as diagnosed mostly by morphological methods. Detailed investigations of the epidemiology and zoonotic potential of these pathogens has been neglected. Further study is essential to develop a better understanding of the diversity of canine vector-borne diseases in India, and their significance for veterinary and public health.
Directory of Open Access Journals (Sweden)
Selwyn Arligton Headley
2012-10-01
Full Text Available This article provides a critical review of current epidemiological trends of canine distemper virus (CDV and syndromes related to canine distemper encephalitis (CDE with specific reference to the situation in Brazil. Epidemiological data relative to susceptible animal populations, prevalence, seasonal occurrence, and age-related patterns associated with CDV are discussed. The participation of mongrel dogs in maintaining CDV within rural and semi-urban canine populations and their importance in the epidemiology of canine distemper is highlighted. The economic impact of treating the clinical manifestations associated with CDV-induced infections in Brazil is estimated. Additionally, neurological and neuropathological manifestations of CDV in Brazil are discussed, and a novel manifestation of CDE is proposed. Esse manuscrito fornece uma revisão crítica das tendências epidemiológicas associadas ao vírus da cinomose canina (CDV e às síndromes relacionadas à encefalite por cinomose com referência específica à situação no Brasil. Os dados epidemiológicos relativos às populações de animais suscetíveis, prevalência, sazonalidade e os padrões relacionados à idade foram discutidos. Também é enfocada nessa revisão a participação de cães de rua na manutenção do CDV nas populações caninas nas áreas rurais e nas regiões semiurbanas e a sua importância na epidemiologia da cinomose. Foi ainda estimado o impacto econômico relacionado ao tratamento das manifestações clínicas associadas à cinomose no Brasil. Adicionalmente, as manifestações neurológicas e neuropatológicas da cinomose no Brasil são discutidas e uma manifestação neuropatológica inédita da infecção é sugerida.
Energy Technology Data Exchange (ETDEWEB)
De Nardo, P. [Istituto Superiore di Sanita`, Rome (Italy). Lab. di Medicina Veterinaria
1996-12-01
Canine pleural mesothelioma represents a `sentinel health event` because of the role of asbestos exposure in its etiology and pathogenesis. The observation of such event may thus trigger prevention-oriented remedial actions. This is especially due to the relatively short induction-latency time of canine mesothelioma, i.e. eight-nine years, versus the corresponding induction-latency time in humans (on average about thirty years). The observation of cases of canine mesothelioma may concur to the detection of previously unrecognized hazardous exposures to asbestos. On this ground, the epidemiologic surveillance of canine mesothelioma in Italy is suggested.
Canine parvovirus--a review of epidemiological and diagnostic aspects, with emphasis on type 2c.
Decaro, Nicola; Buonavoglia, Canio
2012-02-24
Canine parvovirus type 2 (CPV-2) emerged in late 1970s causing severe epizootics in kennels and dog shelters worldwide. Soon after its emergence, CPV-2 underwent genetic evolution giving rise consecutively to two antigenic variants, CPV-2a and CPV-2b that replaced progressively the original type. In 2000, a new antigenic variant, CPV-2c, was detected in Italy and rapidly spread to several countries. In comparison to the original type CPV-2, the antigenic variants display increased pathogenicity in dogs and extended host range, being able to infect and cause disease in cats. Epidemiological survey indicate that the newest type CPV-2c is becoming prevalent in different geographic regions and is often associated to severe disease in adult dogs and also in dogs that have completed the vaccination protocols. However, the primary cause of failure of CPV vaccination is interference by maternally derived immunity. Diagnosis of CPV infection by traditional methods has been shown to be poorly sensitive, especially in the late stages of infections. New diagnostic approaches based on molecular methods have been developed for sensitive detection of CPV in clinical samples and rapid characterisation of the viral type. Continuous surveillance will help assess whether there is a real need to update currently available vaccines and diagnostic tests. Copyright © 2011 Elsevier B.V. All rights reserved.
Identification of a new genotype of canine distemper virus circulating in America.
Gámiz, César; Martella, Vito; Ulloa, Raúl; Fajardo, Raúl; Quijano-Hernandéz, Israel; Martínez, Simón
2011-08-01
Canine Distemper is a highly contagious viral systemic disease that affects a wide variety of terrestrial carnivores. Canine Distemper virus (CDV) appears genetically heterogeneous, markedly in the hemagglutinin protein (H), showing geographic patterns of diversification that are useful to monitor CDV molecular epidemiology. In Mexico the activity of canine distemper remains high in dogs, likely because vaccine prophylaxis coverage in canine population is under the levels required to control effectively the disease. By phylogenetic analysis based on the nucleoprotein (N) and on the H genes, Mexican CDV strains collected between 2007 and 2010 were distinguished into several genovariants, all which constituted a unique group, clearly distinct from field and vaccine strains circulating worldwide, but resembling a CDV strain, 19876, identified in Missouri, USA, 2004, that was genetically unrelated to other North-American CDV strains. Gathering information on the genetic heterogeneity of CDV on a global scale appears pivotal in order to investigate the origin and modalities of introduction of unusual/novel CDV strains, as well as to understand if vaccine breakthroughs or disease epidemics may be somewhat related to genetic/antigenic or biological differences between field and vaccine strains.
Emerging arthropod-borne diseases of companion animals in Europe.
Beugnet, Frederic; Marié, Jean-Lou
2009-08-26
Vector-borne diseases are caused by parasites, bacteria or viruses transmitted by the bite of hematophagous arthropods (mainly ticks and mosquitoes). The past few years have seen the emergence of new diseases, or re-emergence of existing ones, usually with changes in their epidemiology (i.e. geographical distribution, prevalence, and pathogenicity). The frequency of some vector-borne diseases of pets is increasing in Europe, i.e. canine babesiosis, granulocytic anaplasmosis, canine monocytic ehrlichiosis, thrombocytic anaplasmosis, and leishmaniosis. Except for the last, these diseases are transmitted by ticks. Both the distribution and abundance of the three main tick species, Rhipicephalus sanguineus, Dermacentor reticulatus and Ixodes ricinus are changing. The conditions for such changes involve primarily human factors, such as travel with pets, changes in human habitats, social and leisure activities, but climate changes also have a direct impact on arthropod vectors (abundance, geographical distribution, and vectorial capacity). Besides the most known diseases, attention should be kept on tick-borne encephalitis, which seems to be increasing in western Europe, as well as flea-borne diseases like the flea-transmitted rickettsiosis. Here, after consideration of the main reasons for changes in tick vector ecology, an overview of each "emerging" vector-borne diseases of pets is presented.
First molecular detection of Leishmania tarentolae-like DNA in Sergentomyia minuta in Spain.
Bravo-Barriga, Daniel; Parreira, Ricardo; Maia, Carla; Blanco-Ciudad, Juan; Afonso, Maria Odete; Frontera, Eva; Campino, Lenea; Pérez-Martín, Juan Enrique; Serrano Aguilera, Francisco Javier; Reina, David
2016-03-01
Phlebotomine sand flies (Diptera, Psychodidae) are vectors of multiple Leishmania species, among which Leishmania infantum stands out as a being frequently pathogenic to humans and dogs in Mediterranean countries. In this study, Sergentomyia minuta sand flies were collected using CDC miniature light traps in different 431 biotopes from Southwest Spain. A total of 114 females were tested for the presence of Leishmania DNA by targeting ITS-1 and cyt-B sequences by PCR. Leishmania DNA was detected in one S. minuta. Characterization of the obtained DNA sequences by phylogenetic analyses revealed close relatedness with Leishmania tarentolae Wenyon, 1921 as well as with both human and canine pathogenic strains of Asian origin (China), previously described as Leishmania sp. To our knowledge, this is the first report of phlebotomine sand flies naturally infected with L. tarentolae-like in Spain. The possible infection of sand flies with novel Leishmania species should be taken into consideration in epidemiological studies of vector species in areas where leishmaniosis is endemic.
Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis
2014-04-23
Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from
Occurrence of canine parvovirus in dogs from Henan province of China in 2009-2014.
Zhao, Zhanqin; Liu, Huisheng; Ding, Ke; Peng, Chunping; Xue, Qiao; Yu, Zuhua; Xue, Yun
2016-07-04
There is no information concerning the genotype of Canine parvovirus (CPV) currently circulating in Henan province, China. Therefore, the aim of the present study was to provide insights into the epidemiology and molecular characterization of CPV circulating in Henan province from 2009 to 2014. Nineteen thousand nine hundred seven dogs from pet hospitals in the cities of Luoyang, Anyang, Jiaozuo, Sanmenxia, Xinxiang, Zhengzhou in Henan province between 2009 and 2014 were investigated. Over the 6-year period, 1169 CPV-positive cases were identified and the morbidity of CPV infection ranged from 4.16 to 8.06 %, although morbidity was not significant (P > 0.05) between 2009 and 2014. Factors associated with morbidity included sampling season, dog age, breed, vaccination status, and sex. CPV co-infection with coccidium (10.00 %), canine distemper virus (4.79 %), hookworm (2.40 %), canine coronavirus (1.11 %), roundworm (1.03 %), tapeworm (0.17 %) and Babesia spp. (0.09 %) were observed. The new CPV-2a variant was more prevalent than the new CPV-2b variant in Henan province. CPV 2c was not observed in this study. The epidemiology of CPV infection and identification of the circulating genotypes in Henan province, China from 2009 to 2014 determined that the new CPV-2a variant was more prevalent.
Cost-effectiveness of canine vaccination to prevent human rabies in rural Tanzania.
Fitzpatrick, Meagan C; Hampson, Katie; Cleaveland, Sarah; Mzimbiri, Imam; Lankester, Felix; Lembo, Tiziana; Meyers, Lauren A; Paltiel, A David; Galvani, Alison P
2014-01-21
The annual mortality rate of human rabies in rural Africa is 3.6 deaths per 100 000 persons. Rabies can be prevented with prompt postexposure prophylaxis, but this is costly and often inaccessible in rural Africa. Because 99% of human exposures occur through rabid dogs, canine vaccination also prevents transmission of rabies to humans. To evaluate the cost-effectiveness of rabies control through annual canine vaccination campaigns in rural sub-Saharan Africa. We model transmission dynamics in dogs and wildlife and assess empirical uncertainty in the biological variables to make probability-based evaluations of cost-effectiveness. Epidemiologic variables from a contact-tracing study and literature and cost data from ongoing vaccination campaigns. Two districts of rural Tanzania: Ngorongoro and Serengeti. 10 years. Health policymaker. Vaccination coverage ranging from 0% to 95% in increments of 5%. Life-years for health outcomes and 2010 U.S. dollars for economic outcomes. Annual canine vaccination campaigns were very cost-effective in both districts compared with no canine vaccination. In Serengeti, annual campaigns with as much as 70% coverage were cost-saving. Across a wide range of variable assumptions and levels of societal willingness to pay for life-years, the optimal vaccination coverage for Serengeti was 70%. In Ngorongoro, although optimal coverage depended on willingness to pay, vaccination campaigns were always cost-effective and lifesaving and therefore preferred. Canine vaccination was very cost-effective in both districts, but there was greater uncertainty about the optimal coverage in Ngorongoro. Annual canine rabies vaccination campaigns conferred extraordinary value and dramatically reduced the health burden of rabies. National Institutes of Health.
Directory of Open Access Journals (Sweden)
Carolina Guadalupe Sosa-Gutierrez
2013-01-01
Full Text Available Ehrlichia canis is a rickettsial intracellular obligate bacterial pathogen and agent of canine monocytic ehrlichiosis. The prevalence of this disease in veterinary medicine can vary depending on the diagnostic method used and the geographic location. One hundred and fifty-two canine blood samples from six veterinary clinics and two shelters from Sinaloa State (Mexico were analyzed in this study. All animals were suspected of having Canine Monocytic Ehrlichiosis (CME. The diagnostic methods used were the ELISA (Snap4Dx, IDEXX together with blood smear and platelet count. From all dogs blood samples analyzed, 74.3% were positive to E. canis by ELISA and 40.1% were positive by blood smear. The sensitivity and specificity observed in the ELISA test were 78.8% and 86.7%. In addition, thrombocytopenia was presented in 87.6% of positive dogs. The predominant clinical manifestations observed were fever, anorexia, depression, lethargy, and petechiae. Consequently, this is the first report in which the morulae were visualized in the blood samples, and E. canis-specific antibodies were detected in dogs from Sinaloa, Northwest of Mexico.
Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.
Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D
2000-12-01
To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.
Directory of Open Access Journals (Sweden)
Mostfa Shahabi
2017-09-01
Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.
Tasić, Aleksandar; Tasić-Otašević, Suzana; Gabrielli, Simona; Miladinović-Tasić, Nataša; Ignjatović, Aleksandra; Dorđević, Jovana; Dimitrijević, Sanda; Cancrini, Gabriella
2012-12-01
In 2009 canine filarial infections were investigated in two northern areas of Serbia (Pančevo and Veliko Gradište), applying morphometry, biochemical staining, and immunological kit to detect Dirofilaria immitis antigens, and two home-made ELISAs to detect antibodies to D. repens and D. immitis somatic/metabolic polyproteins. Moreover, molecular tools were applied to analyze the phylogenetic relationships of the isolates. The microfilariae detected in 21/122 dogs (17.2%) were identified as D. repens (n=21) and D. immitis (n=2). D. immitis antigens were found in another 13 animals with occult infection. All of the 15 heartworm-positive dogs also had antibodies to this parasite, which were detected in another 13 subjects, indicating an overall D. immitis seroprevalence rate of 22.9%. Serology for D. repens revealed evidence of antibodies in 42.6% of the dogs, but was negative for 4 microfilaremic dogs. As for the two different areas, the prevalence of microfilariae and/or D. immitis antigens, mainly due to D. repens microfilaremic animals, was not significantly higher in Veliko Gradište (33.3%) than in Pančevo (22%). However, serology showed a different epidemiological picture. Heartworm infection occurred more often in both areas, and antibodies to dirofilarial nematodes were detected in 72.9% of dogs living in Pančevo, a rate higher than in those living in Veliko Gradište (57.1%). No risk factors for infection were found, confirming the uselessness of prophylactic drugs against D. repens, and suggesting the presence in these areas of sunrise- or sunset-biting mosquitoes as important vectors. The results indicate the need for both appropriate entomological studies and further research on the intra-species variability shown by D. repens.
Su, Shuo; Yuan, Ziguo; Chen, Jidang; Xie, Jiexiong; Li, Huatao; Huang, Zhen; Zhang, Minze; Du, Guohao; Chen, Zhongming; Tu, Liqing; Zou, Yufei; Miao, Junhao; Wang, Hui; Jia, Kun; Li, Shoujun
2013-06-01
A H3N2 canine influenza virus, A/canine/Guangdong/3/2011 (H3N2), was isolated from roaming dogs in rural China. Sequence and phylogenetic analysis of eight gene segments revealed that the A/canine/Guangdong/3/2011 (H3N2) was most similar to a recent H3N2 canine influenza virus isolated in cats from South Korea, which originated from an avian strain. To our knowledge, this is the first report of an avian-origin H3N2 CIV which was isolated from roaming dogs in China. The epidemiologic information provided herein suggests that continued study is required to determine if this virus could be established in the roaming dog population in rural China and pose potential threats to public health.
Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K
2011-04-09
Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.
Canine and feline obesity: a review of pathophysiology, epidemiology, and clinical management
Wakshlag, Joseph J; Loftus,John
2014-01-01
John P Loftus, Joseph J Wakshlag Cornell University College of Veterinary Medicine, Veterinary Medical Center, Ithaca, NY, USAAbstract: Canine and feline obesity rates have reached pandemic proportions and are similar to those in humans, with approximately 30%–40% of dogs and cats being overweight to obese. Obesity has been associated with other health problems, including osteoarthritis, renal disease, skin disease, insulin resistance, and neoplasia in dogs, while in cats obesity is...
Clegg, S. R.; Coyne, K. P.; Parker, J.; Dawson, S.; Godsall, S. A.; Pinchbeck, G.; Cripps, P. J.; Gaskell, R. M.; Radford, A. D.
2011-01-01
Canine parvovirus type 2 (CPV-2) is a severe enteric pathogen of dogs, causing high mortality in unvaccinated dogs. After emerging, CPV-2 spread rapidly worldwide. However, there is now some evidence to suggest that international transmission appears to be more restricted. In order to investigate the transmission and evolution of CPV-2 both nationally and in relation to the global situation, we have used a long-range PCR to amplify and sequence the full VP2 gene of 150 canine parvoviruses obtained from a large cross-sectional sample of dogs presenting with severe diarrhea to veterinarians in the United Kingdom, over a 2-year period. Among these 150 strains, 50 different DNA sequence types (S) were identified, and apart from one case, all appeared unique to the United Kingdom. Phylogenetic analysis provided clear evidence for spatial clustering at the international level and for the first time also at the national level, with the geographical range of some sequence types appearing to be highly restricted within the United Kingdom. Evolution of the VP2 gene in this data set was associated with a lack of positive selection. In addition, the majority of predicted amino acid sequences were identical to those found elsewhere in the world, suggesting that CPV VP2 has evolved a highly fit conformation. Based on typing systems using key amino acid mutations, 43% of viruses were CPV-2a, and 57% CPV-2b, with no type 2 or 2c found. However, phylogenetic analysis suggested complex antigenic evolution of this virus, with both type 2a and 2b viruses appearing polyphyletic. As such, typing based on specific amino acid mutations may not reflect the true epidemiology of this virus. The geographical restriction that we observed both within the United Kingdom and between the United Kingdom and other countries, together with the lack of CPV-2c in this population, strongly suggests the spread of CPV within its population may be heterogeneously subject to limiting factors. This cross
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos
Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.
2011-01-01
INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Is the Dog a Possible Reservoir for Cutaneous Leishmaniasis in Suriname?
Directory of Open Access Journals (Sweden)
Alida Kent
2013-01-01
Full Text Available Cutaneous leishmaniasis (CL is an emerging disease in Suriname, with at least 200 cases per year. Little is known about the biology of CL in the country. The most important parasite species is Leishmania Viannia guyanensis, but possible vectors and reservoirs are hardly incriminated. In the present study, it was investigated whether the dog could possibly be a zoonotic reservoir for the disease in Suriname. Forty-seven dogs were examined for overt clinical signs of leishmaniasis, and blood samples were collected on filter paper for serology (direct agglutination test and molecular biology (by polymerase chain reaction. Three dogs had clinical signs that could be compatible with canine cutaneous leishmaniosis: dermatitis (two or nasal lesion (one. Two dogs were seropositive with DAT (titre > 1 : 1600, and three animals had a borderline titre (1 : 800. All other animals (n=42 were DAT negative. PCR analysis found Leishmania DNA equivalent to 1 parasite per mL in only one dog at a first round of analysis, but this animal was negative after retesting. The clinical, serological, and molecular data show some preliminary lines of evidence that canine leishmaniosis is present in Suriname, but further studies are needed to incriminate the reservoir, including a possible sylvatic cycle.
Seroepidemiology of Canine parvovirus infection in dogs
Directory of Open Access Journals (Sweden)
Indrawati Sendow
2004-10-01
Full Text Available Canine parvovirus is an acute and fatal viral disease in dogs. A total of 209 local, cross breed and breed dogs sera from Kodya Bogor, Kabupaten Bogor, Sukabumi, and Jakarta, had been tested using Haemagglutination Inhibition Test (HI with pig red blood cells. A total of 64 breed and cross breed dogs from Sukabumi and Kodya Bogor, were used as a sentinel dogs to study the epidemiology of Canine parvovirus (CPV infection and its immunological responses caused by vaccination. The results indicated that 78% (95 breed and cross bred dogs and 59% (51 local dogs had antibody to CPV. Sentinel dogs results indicated that dogs had been vaccinated showed antibody response with the varied titre dependant upon prevaccination titre. Low prevaccinated titre gave better response than protective level titre. From 19 puppies observed, Maternal antibodi were still detected until 5 weeks old puppies. First vaccination given at less than 3 months old, should be boosted after 3 months old puppied. Antibodi titre produced by natural infection will keep untill 2 years. These data concluded that the dog condition and time of vaccination will affect the optimum antibody response.
Cha, Se-Yeoun; Kim, Eun-Ju; Kang, Min; Jang, Sang-Ho; Lee, Hae-Beom; Jang, Hyung-Kwan
2012-09-01
Raccoon dogs (Nyctereutes procyonoides) are widespread and common in South Korea. In 2011, we obtained serum samples from 102 wild raccoon dogs to survey their exposure to canine distemper virus (CDV). Forty-five of the 102 animals (44.1%) were seropositive. Field cases of canine distemper in wild raccoon dogs from 2010 to 2011 were investigated. Fourteen cases of CDV infection were identified by a commercially available CDV antigen detection kit. These cases were used for virus isolation and molecular analysis. Sequence analysis of hemagglutinin genes indicated that all viruses isolated belonged to the Asia-2 genotype. H protein residues which are related to the receptor and host specificity (residues 530 and 549) were analyzed. A glutamic acid (E) residue is present at 530 in all isolates. At 549, a histidine (H) residue was found in five isolates and tyrosine (Y) residue was found in 6 isolates. Our study demonstrated that CDV infection was widespread in wild raccoon dogs in South Korea. Copyright © 2012 Elsevier Ltd. All rights reserved.
Mozos, E; Pérez, J; Day, M J; Lucena, R; Ginel, P J
1999-04-01
This paper describes the clinicopathological and immunohistochemical aspects of the skin lesions in three dogs with leishmaniosis and generalized demodicosis. Diffuse alopecia, crusts, folliculitis and furunculosis, as commonly seen in generalized demodicosis, were prominent in all the dogs. MicroIscopically, there was a diffuse and perifollicular superficial and deep granulomatous dermatitis and, in two dogs, both Copyright Demodex canis mites and Leishmania spp. amastigotes were observed in the same lesions. Numerous Mac387(+)macrophages were observed in the inflammatory infiltrates, but macrophages loaded with amastigotes were Mac387(-). In all cases, immunoreactive CD3 lymphocytes were sparse, both in the granulomatous and perifollicular infiltrates. There were numerous IgG+, IgG4(+)-secreting plasma cells in areas of folliculitis and furunculosis and fewer IgG2(+), IgG3(+), IgA+and IgM+-secreting plasma cells in the inflammatory infiltrate. In all cases, MHC Class II was expressed by the majority of dermal macrophages and dendritic cells, as well as by lymphocytes and fibroblasts. The paucity of CD3(+)lymphocytes, usually abundant in D. canis lesions, points to leishmania-induced cell-mediated immunosuppression as a predisposing factor for generalized demodicosis. 1999 W.B. Saunders and Company Ltd.
Acosta-Jamett, G; Surot, D; Cortés, M; Marambio, V; Valenzuela, C; Vallverdu, A; Ward, M P
2015-08-05
To assess whether the seroprevalence of canine distemper virus (CDV) and canine parvovirus (CPV) in domestic dogs is higher in urban versus rural areas of the Araucanía region in Chile and risk factors for exposure, a serosurvey and questionnaire survey at three, urban-rural paired sites was conducted from 2009 to 2012. Overall, 1161 households were interviewed of which 71% were located in urban areas. A total of 501 blood samples were analysed. The overall CDV and CPV seroprevalences were 61% (CI 90%: 58-70%) and 47% (CI 90%: 40-49%), and 89% (CI 90%: 85-92%) and 72% (CI 90%: 68-76%) in urban and rural areas, respectively. The higher seroprevalence in domestic dogs in urban areas suggests that urban domestic dogs might be a maintenance host for both CDV and CPV in this region. Due to the presence of endangered wild canids populations in areas close to these domestic populations, surveillance and control of these pathogens in urban dog populations is needed a priority. Copyright © 2015 Elsevier B.V. All rights reserved.
Leishmania spp. Epidemiology of Canine Leishmaniasis in the Yucatan Peninsula
Directory of Open Access Journals (Sweden)
A. López-Céspedes
2012-01-01
Full Text Available Canine Leishmaniasis is widespread in various Mexican states, where different species of Leishmania have been isolated from dogs. In the present study, we describe the detection of L. braziliensis, L. infantum, and L. mexicana in serum of dogs from the states of Yucatan and Quintana Roo in the Yucatan Peninsula (Mexico. A total of 412 sera were analyzed by ELISA using the total extract of the parasite and the iron superoxide dismutase excreted by different trypanosomatids as antigens. We found the prevalence of L. braziliensis to be 7.52%, L. infantum to be 6.07%, and L. mexicana to be 20.63%, in the dog population studied. The results obtained with ELISA using iron superoxide dismutase as the antigen were confirmed by western blot analysis with its greater sensitivity, and the agreement between the two techniques was very high.
Leishmania spp. epidemiology of canine leishmaniasis in the Yucatan Peninsula.
López-Céspedes, A; Longoni, S S; Sauri-Arceo, C H; Sánchez-Moreno, M; Rodríguez-Vivas, R I; Escobedo-Ortegón, F J; Barrera-Pérez, M A; Bolio-González, M E; Marín, C
2012-01-01
Canine Leishmaniasis is widespread in various Mexican states, where different species of Leishmania have been isolated from dogs. In the present study, we describe the detection of L. braziliensis, L. infantum, and L. mexicana in serum of dogs from the states of Yucatan and Quintana Roo in the Yucatan Peninsula (Mexico). A total of 412 sera were analyzed by ELISA using the total extract of the parasite and the iron superoxide dismutase excreted by different trypanosomatids as antigens. We found the prevalence of L. braziliensis to be 7.52%, L. infantum to be 6.07%, and L. mexicana to be 20.63%, in the dog population studied. The results obtained with ELISA using iron superoxide dismutase as the antigen were confirmed by western blot analysis with its greater sensitivity, and the agreement between the two techniques was very high.
Nasal and oral masses in a dog.
Levy, Esther; Mylonakis, Mathios E; Saridomichelakis, Manolis N; Polizopoulou, Zoe S; Psychogios, Vassilios; Koutinas, Alexander F
2006-03-01
A 5-year-old, intact male, stray dog was presented in poor body condition, with pallor, muzzle deformity, multiple oozing fistulas with grass awns, bilateral sanguinopurulent nasal discharge and a fleshy friable mass occupying part of the hard palate. A friable mass occupying both nasal cavities was found on rhinoscopy. The dog had moderate nonregenerative normochromic-microcytic anemia, thrombocytopenia, hyperglobulinemia, and hypoalbuminemia. Cytologic preparations of the nasal and oral masses contained a neoplastic population of round cells with intracytoplasmic and extracellular vacuoles. Leishmania amastigotes also were observed, in the cytoplasm of macrophages and, occasionally, within neoplastic cells. A diagnosis of transmissible venereal tumor and concurrent leishmaniosis was made. Treatment with vincristine and allopurinol resulted in complete resolution of clinical signs and disappearance of the masses. The presence of amastigotes in neoplastic TVT cells may suggest an alternative mode of transmission of canine leishmaniosis where these diseases co-exist.
Major Parasitic Zoonoses Associated with Dogs and Cats in Europe
DEFF Research Database (Denmark)
Baneth, G.; Thamsborg, S M; Otranto, D
2016-01-01
Some of the most important zoonotic infectious diseases are associated with parasites transmitted from companion animals to man. This review describes the main parasitic zoonoses in Europe related to dogs and cats, with particular emphasis on their current epidemiology. Toxoplasmosis, leishmaniosis...
Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch
2017-01-01
Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...
Čabanová, Viktória; Miterpáková, Martina; Druga, Michal; Hurníková, Zuzana; Valentová, Daniela
2018-02-01
Over a period of intervening years, the distribution of two canine cardiopulmonary metastrongylid nematodes, Angiostrongylus vasorum and Crenosoma vulpis, has been recognised in Central Europe. Here, we report the first epidemiological research conducted in red foxes from Slovakia and the potential influence of selected environmental variables on the parasites' occurrence, quantified by logistic regression. The environmental models revealed that distribution of C. vulpis is not significantly influenced by any environmental variables, and the parasite is present in the whole area under study. Models for A. vasorum revealed some weak influence of environmental variables, as it tends to occur in drier areas with lower proportion of forest. Moreover, A. vasorum shows a typical spatial clustering and occurs in endemic foci identified mainly in the eastern part of Slovakia. A cluster of A. vasorum infection foci was also found in the north-eastern region, where the average winter air temperature regularly falls below - 10 °C.
Canine and feline cardiopulmonary parasitic nematodes in Europe: emerging and underestimated
Directory of Open Access Journals (Sweden)
Conboy Gary
2010-07-01
Full Text Available Abstract Cardiopulmonary nematodes of dogs and cats cause parasitic diseases of central relevance in current veterinary practice. In the recent past the distribution of canine and feline heartworms and lungworms has increased in various geographical areas, including Europe. This is true especially for the metastrongyloids Aelurostrongylus abstrusus, Angiostrongylus vasorum and Crenosoma vulpis, the filarioid Dirofilaria immitis and the trichuroid Eucoleus aerophilus (syn. Capillaria aerophila. The reasons of this emergence are little known but many drivers such as global warming, changes in vector epidemiology and movements in animal populations, may be taken into account. The purpose of this article is to review the knowledge of the most important heartworm and lungworm infections of dogs and cats in Europe. In particular recent advances in epidemiology, clinical and control are described and discussed.
Risk assessment for canine leishmaniasis spreading in the north of Italy
Directory of Open Access Journals (Sweden)
Giulia Morosetti
2009-11-01
Full Text Available The incidence of zoonotic visceral leishmaniasis has not only been recognized but is, in fact, increasing in territories of northern continental Italy previously regarded as non-endemic. Recent findings of sporadic autochthonous canine infections and the presence of phlebotomine vectors in some provinces of north-eastern Italy have stimulated risk assessment for the spreading of leishmaniasis in the autonomous province of Bolzano-South Tyrol, the northernmost territory of the Italian eastern Alps. In July 2008, 61 phlebotomine sand flies (Diptera, Psychodidae were caught and identified as Phlebotomus perniciosus and Sergentomyia minuta. This is the first record in South Tyrol of P. perniciosus, the most competent vector of Leishmania infantum in Mediterranean countries. Leishmania serology on local dogs kept in kennels gave negative results, while only imported canine leishmaniasis cases were reported by local veterinarians through a questionnaire survey. Bio-geographic aspects and epidemiological consequences are analyzed in relation with the risk of leishmaniasis introduction into the area.
Molecular epidemiology of canine parvovirus in southern India
Directory of Open Access Journals (Sweden)
V. M. Vivek Srinivas,
2013-08-01
Full Text Available Aim: The present study was conducted to isolate and characterize canine parvovirus circulating in Southern India by genetic analysis of VP2 capsid protein gene.Materials and Methods: In this study, 128 samples were collected from nine different locations covering five Southern Indian states (Pondicherry, Tamil Nadu, Kerala, Andhra Pradesh and Karnataka . Out of 128 samples, 69 samples were found to be positive by PCR assay. Out of 69 positive samples, 36 were randomly selected and processed for virus isolation. Twenty viruses could be isolated successfully and 18 randomly selected isolate were subjected to VP2 gene sequence analysis along with 6 random clinical samples.Result: Seventeen isolates and 5 clinical samples were characterized as New CPV-2a (CPV2a with 297-Ser→Ala. But one isolate and one clinical sample had amino acids variations which were characteristics of New CPV-2b. The phylogenetic analysis revealed that one of the field isolates was found to be phylogenetically closely related to New CPV-2b strains of India; rest other sequences was found to share ancestral origins with New CPV-2a reference strains of Japan, China, Thailand and India.Conclusion: The present study revealed that the predominant CPV strain circulating in Southern India is New CPV-2a. There is also enough indication of New CPV-2b strain from different states of Southern India.
Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted; Andresen, Lars; Chrièl, Mariann; Hagberg, Emma; Jensen, Mette Kragh; Hansen, Mette Sif; Hjulsager, Charlotte Kristiane; Struve, Tina
2015-09-30
During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit in biosecurity on the mink farms. The aim of this study was to investigate the extent and association of specific biosecurity measures with the outbreak. The study was carried out in an epidemiological case-control design. The case group consisted of the 61 farms, which had a confirmed outbreak of canine distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case farms, indicating that the control farms had a better biosecurity or were not equally exposed to canine distemper virus. Generally, all farms had very few specific precautions at the gate entrance in respect to human visitors as well as animals. The use of biosecurity measures was very variable in both case and control farms. Not using plastic boot covers, presence of dogs and cats, presence of demarcated area for changing clothes when entering and leaving the farm area and presence of hand washing facilities significantly lowered the odds of the farm having a canine distemper virus outbreak. The results of the study indicate that consistent use of correct vaccination strategies, implementation of biosecurity measures and limiting human and animal access to the mink farm can be
Rabies Epidemiology and Control in Ecuador
Ortiz-Prado, Esteban; Ponce-Zea, Jorge; Ramirez, Dario; Stewart-Ibarra, Anna M.; Armijos, Luciana; Yockteng, Jaime; Cárdenas, Washington B.
2016-01-01
Objective: Describe the epidemiology and the control effort for rabies in Ecuador. Methods: This observational study included data from the Ecuadorian National Institute of Census and Statistics (INEC), and mortality and morbidity data reported by the Ministry of Public Health and the National Institute for Social Security. We conducted a phylogeny analyses to compare the N gene from the Challenge Virus Standard (CVS) vaccine strain used in Ecuador with published Cosmopolitan, Asian and Sylvatic strains. Descriptive and inferential statistics were used to determine the significance of the data. Results: In 1996 Ecuador suffered the highest rate of rabies per capita in the Americas, with an incidence rate of 0.56 cases per 100 000 people per year. Human and canine rabies showed a sharp decline until 2012. Between 1994 and 2014, we found a correlation of 0.925 (pEcuador. The incidence of human and canine rabies, also known as urban rabies, has clearly decreased due to massive canine vaccination campaigns. Phylogenetic analysis of the prevailing vaccine used in the country showed a clear separation from bat-derived rabies, the source of recent rabies outbreaks. Efforts are ongoing to develop rabies vaccines that are highly specific to the rabies virus genotype circulating in the region, including sylvatic rabies. These efforts include the implementation of reverse genetics to generate recombinant virus coding for the prevailing glycoprotein gene. PMID:26493436
Rabies Epidemiology and Control in Ecuador.
Ortiz-Prado, Esteban; Ponce-Zea, Jorge; Ramirez, Dario; Stewart-Ibarra, Anna M; Armijos, Luciana; Yockteng, Jaime; Cardenas, Washington Bolivar
2015-07-12
Describe the epidemiology and the control effort for rabies in Ecuador. This observational study included data from the Ecuadorian National Institute of Census and Statistics (INEC), and mortality and morbidity data reported by the Ministry of Public Health and the National Institute for Social Security. We conducted a phylogeny analyses to compare the N gene from the Challenge Virus Standard (CVS) vaccine strain used in Ecuador with published Cosmopolitan, Asian and Sylvatic strains. Descriptive and inferential statistics were used to determine the significance of the data. In 1996 Ecuador suffered the highest rate of rabies per capita in the Americas, with an incidence rate of 0.56 cases per 100 000 people per year. Human and canine rabies showed a sharp decline until 2012. Between 1994 and 2014, we found a correlation of 0.925 (pEcuador. The incidence of human and canine rabies, also known as urban rabies, has clearly decreased due to massive canine vaccination campaigns. Phylogenetic analysis of the prevailing vaccine used in the country showed a clear separation from bat-derived rabies, the source of recent rabies outbreaks. Efforts are ongoing to develop rabies vaccines that are highly specific to the rabies virus genotype circulating in the region, including sylvatic rabies. These efforts include the implementation of reverse genetics to generate recombinant virus coding for the prevailing glycoprotein gene.
Hosein, Shazia; Rodríguez-Cortés, Alhelí; Blake, Damer P.; Allenspach, Karin; Alberola, Jordi; Solano-Gallego, Laia
2015-01-01
Canine leishmaniosis (CanL) due to Leishmania infantum is a chronic zoonotic systemic disease resulting from complex interactions between protozoa and the canine immune system. Toll-like receptors (TLRs) are essential components of the innate immune system and facilitate the early detection of many infections. However, the role of TLRs in CanL remains unknown and information describing TLR transcription during infection is extremely scarce. The aim of this research project was to investigate the impact of L. infantum infection on canine TLR transcription using a susceptible model. The objectives of this study were to evaluate transcription of TLRs 2, 3, 4 and 9 by means of quantitative reverse transcription polymerase chain reaction (qRT-PCR) in skin, spleen, lymph node and liver in the presence or absence of experimental L. infantum infection in Beagle dogs. These findings were compared with clinical and serological data, parasite densities in infected tissues and transcription of IL-17, IL-22 and FoxP3 in different tissues in non-infected dogs (n = 10), and at six months (n = 24) and 15 months (n = 7) post infection. Results revealed significant down regulation of transcription with disease progression in lymph node samples for TLR3, TLR4, TLR9, IL-17, IL-22 and FoxP3. In spleen samples, significant down regulation of transcription was seen in TLR4 and IL-22 when both infected groups were compared with controls. In liver samples, down regulation of transcription was evident with disease progression for IL-22. In the skin, upregulation was seen only for TLR9 and FoxP3 in the early stages of infection. Subtle changes or down regulation in TLR transcription, Th17 cytokines and FoxP3 are indicative of the silent establishment of infection that Leishmania is renowned for. These observations provide new insights about TLR transcription, Th17 cytokines and Foxp3 in the liver, spleen, lymph node and skin in CanL and highlight possible markers of disease susceptibility in
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
Full-genome analysis of a canine pneumovirus causing acute respiratory disease in dogs, Italy.
Directory of Open Access Journals (Sweden)
Nicola Decaro
Full Text Available An outbreak of canine infectious respiratory disease (CIRD associated to canine pneumovirus (CnPnV infection is reported. The outbreak occurred in a shelter of the Apulia region and involved 37 out of 350 dogs that displayed cough and/or nasal discharge with no evidence of fever. The full-genomic characterisation showed that the causative agent (strain Bari/100-12 was closely related to CnPnVs that have been recently isolated in the USA, as well as to murine pneumovirus, which is responsible for respiratory disease in mice. The present study represents a useful contribution to the knowledge of the pathogenic potential of CnPnV and its association with CIRD in dogs. Further studies will elucidate the pathogenicity and epidemiology of this novel pneumovirus, thus addressing the eventual need for specific vaccines.
DEFF Research Database (Denmark)
Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold
2014-01-01
BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was
Larson, L J; Schultz, R D
2007-01-01
A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.
Directory of Open Access Journals (Sweden)
Anna McRee
2014-09-01
Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A
2014-09-05
Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
Webb, Craig; Twedt, David C
2003-09-01
Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.
Varied clinico-radiological presentations of transmigrated canines
Directory of Open Access Journals (Sweden)
Ishita Gupta
2015-01-01
Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.
Leishmaniosis tegumentaria en Las Lomitas, Provincia de Formosa, Argentina, 1992-2001
Directory of Open Access Journals (Sweden)
O. D. Salomón
2002-12-01
Full Text Available Entre 1992 y el 2001 el hospital de Las Lomitas notificó 85 casos de leishmaniosis tegumentaria, 72.9% en hombres, 91.8% en mayores de 10 años, y el 10.5% con manifestación mucosa. La presentación clínica más frecuente fue la úlcera simple en miembros inferiores. Las características epidemiológicas y clínicas fueron compatibles con la infección debida a Leishmania (Viannia braziliensis. La distribución anual de aparición de lesiones fue bimodal, la abundancia mostró asociación con el caudal del río Bermejo y la precipitación pluvial del año anterior. La intradermorreacción y la anamnesis sugieren como principal actividad de riesgo la pesca en el río. Se colectaron 1018 Phlebotominae, Lutzomyia neivai (97.1%, L. migonei (2.3% y L. cortelezzii (0.6%, la proporción peridomicilio/bosque en galería del río Bermejo fue 1/9, en composición semejante a las poblaciones del mismo río en la provincia de Salta. El incremento de casos observado desde 1992, la ejecución de obras de desarrollo que implican cambios ambientales, y la potencialidad de instalación de un ciclo periurbano vuelven necesario implementar un programa de vigilancia activa entomológica y de casos en el área chaqueña.
Directory of Open Access Journals (Sweden)
Pablo S.B. de Oliveira
Full Text Available ABSTRACT: Canine parvovirus type 2c (CPV-2c emerged in Europe in the early 2000’s and rapidly spread out worldwide. Clinical and molecular data have demonstrated its circulation in Brazilian dogs, yet detailed descriptions of cases are still lacking. This article describes the epidemiological, clinical and pathological features of 24 cases of CPV-2c-associated disease in dogs submitted to veterinary clinics and laboratory diagnosis in southern Brazil (2014-2016. Most affected dogs presented signs/lesions suggestive of parvovirus enteritis: diarrhea, vomiting, hyperemia and hemorrhage of the serous membrane of the small intestine, diffuse segmental granulation, atrophy of the villi, necrosis and fusion of crypts, squamous metaplasia and epithelial syncytia. A number of cases presented features divergent from the classical presentations, including a wide variation in the color of feces (reddish and/or yellowish, light-brownish, orange-brown and brownish, involvement of adults (4/24 and vaccinated dogs (12/24, extensive involvement of the small intestine (8/20 and the presence of pulmonary edema (7/24 and convulsions (3/24. Feces and intestinal fragments submitted to PCR for the CPV-2 VP2 gene and to virus isolation in cell culture yielded positive results in 100% and 58.3% (14/24 of the cases, respectively. Nucleotide sequencing revealed a high nucleotide identity in VP2 (99.4 to 100% and a consistent mutation at amino acid 426 (asparagine to glutamic acid, considered a signature of CPV-2c. These results confirm the involvement of CPV-2c in the described cases and demonstrate the importance of CPV-2c infection among Brazilian dogs, calling attention of veterinarians to correctly diagnose the disease, mainly considering the frequent atypical presentations.
Development of the canine tooth in the beagle
International Nuclear Information System (INIS)
Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.
1993-01-01
The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla
Albrechtová, Kateřina; Sedlák, Kamil; Petrželková, Klára J; Hlaváč, Jan; Mihalca, Andrei D; Lesingirian, Alison; Kanyari, Paul W N; Modrý, David
2011-12-15
Samples of blood (serum, smears and blood preserved with ethanol) were collected from dogs during a vaccination campaign in northern Kenya in the years 2006 and 2007. Blood was screened for filarial parasites using molecular and microscopy methods and sera were tested for antibodies against canine distemper virus (CDV). Parasitological examination revealed the presence of two species of canine filariae: Acanthocheilonema dracunculoides and A. reconditum. The DNA from the former species was detected in 58% dogs sampled in 2006 and 36% dogs sampled in 2007, whereas the latter was found only in 4.2% samples collected in 2007. Microfilariae were found in 33.8% blood smears collected in 2006 and 10.6% blood smears collected in 2007. The seroprevalence of CDV was 33.4% in 2006 and 11.2% in 2007. The effect of sex, age and CDV-seropositivity/seronegativity on the occurrence of A. dracunculoides was evaluated. Infection by A. dracunculoides was more common in males and in dogs with a positive antibody titer for canine distemper, but evenly distributed among different age groups. The difference in the prevalence of A. dracunculoides in two isolated mountain ranges was not statistically significant. Methodologies available for detection and determination of canine filariae are compared, underlining methodical pitfalls arising through the determination of less common filarial species. The role of single epidemiological factors and possible association between canine distemper and filariasis are discussed. Copyright © 2011 Elsevier B.V. All rights reserved.
Ontogeny of canine dimorphism in extant hominoids.
Schwartz, G T; Dean, C
2001-07-01
Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.
Influence of apoptosis on liver and spleen resistance in dogs with visceral leishmaniosis.
Moreira, Pamela Rodrigues Reina; Franciscato, Douglas Augusto; Rossit, Sabrina Micelli; Munari, Danísio Prado; Vasconcelos, Rosemeri de Oliveira
2016-01-01
The aim of this study was to evaluate apoptosis and parasite load in the liver and spleen of dogs with visceral leishmaniosis (VL), using immunohistochemistry. Liver and spleen samples from 71 dogs with VL were used. The parasite load in the spleen and liver showed significant difference between organs in infected group (P=0.0219). The density of the parasite load in the spleen (median=2.4) was higher than liver (median=0.8). Immunodetection of apoptotic cells was predominant in lymphocytes and differ between the infected and control group in spleen (P=0.0307) and liver (P=0.0346). There was a significant correlation between apoptosis and parasite load (P = 0.0084; r=0.3104) only in the spleen of the infected group, where it was observed that, when increasing the number of apoptotic cells increases the parasitic load. It was concluded that the liver and spleen of infected dogs presented greater numbers of cells undergoing apoptosis (lymphocytes) than the control group, thus suggesting that this process may be contributing towards the survival of Leishmania in these organs, because lymphocyte in apoptosis did not have the ability to present and recognize the antigen, allowing the survival of the parasite.
Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2005-01-01
A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki
2012-08-01
Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
Bilateral supernumerary primary maxillary canines
Directory of Open Access Journals (Sweden)
Santanu Mukhopadhyay
2018-01-01
Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.
Directory of Open Access Journals (Sweden)
José Fernández
2006-10-01
Full Text Available Introducción. La leishmaniosis visceral canina en áreas endémicas de Colombia se constituye en un factor de riesgo para la salud pública, dado el carácter zoonótico de la enfermedad. Durante el año 2004 se registraron 96 casos de leishmaniosis visceral humana en el país, de los cuales cinco correspondieron al departamento del Huila, zona de influencia del vector Lutzomyia longipalpis. Objetivo. Determinar la prevalencia de anticuerpos IgG contra Leishmania chagasi en sueros de caninos recolectados en los municipios de Rivera, Palermo, Villavieja, Algeciras y la comuna 8 de la ciudad de Neiva, Huila, Colombia. Materiales y métodos. Se realizó una encuesta epidemiológica a los propietarios de 610 caninos y previo consentimiento se llevó a cabo examen clínico general y recolección de muestra de sangre de cada una de las mascotas. Los sueros fueron analizados mediante el test de ELISA empleando como antígeno promastigotes de Leishmania chagasi, de la cepa MHOM/CO/84/CL044B. El análisis de datos empleó estadística descriptiva. Resultados. En la población canina 85% fueron mestizos, la edad promedio fue 2,5 años y 67,3% de los animales fueron machos. Al examen clínico las manifestaciones más frecuentes fueron: onicogrifosis 24,3%, linfadenitis 10% y lesiones cutáneas 5%. La frecuencia de anticuerpos IgG contra Leishmania chagasi en la comuna 8 de la ciudad de Neiva fue 28,1%, en Villavieja 28%, en Rivera 14,9%, en Palermo 10% y en Algeciras 5,1%. Adicionalmente, se observó un promedio de cinco personas convivientes por canino seropositivo. Conclusiones. Estos datos demuestran la exposición de los caninos que habitan los ambientes rurales y urbanos de las zonas en estudio a Leishmania chagasi y deben tenerse en cuenta para el fortalecimiento de los programas de control y prevención de esta zoonosis en el Sistema General de Seguridad Social en Salud.
9 CFR 113.306 - Canine Distemper Vaccine.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...
J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides
2002-01-01
Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...
Characterization of the canine urinary proteome.
Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E
2014-06-01
Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.
Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J
2012-12-01
To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.
International Nuclear Information System (INIS)
Stankeova, S.; Kaser-Hotz, B.; Crompton, N.E.A.; Blattmann, H.; Theiler, P.; Emery, G.C.; Roos, M.
2003-01-01
Background: Evaluation of radiation-induced apoptosis in T-lymphocytes was developed for human medicine in order to predict the sensitivity of individual patients to radiation therapy and has regular use in cases of suspected hypersensitivity. A major goal of the present study was to evaluate the usefulness of the apoptosis assay in veterinary medicine for application in radiation sensitivity testing. The main goal was to examine potential changes in sensitivity of T-lymphocytes to radiation-induced apoptosis during the course of radiation treatment. This is a clear example of the advantageous use of spontaneous canine tumors to augment human cancer research. Material and Methods: Blood was collected in heparin tubes, diluted 1:10 in RPMI medium, irradiated with X-rays and incubated for 48 h. T-lymphocytes were labeled using FITC-conjugated antibodies, erythrocytes were lysed, and DNA stained with propidium iodide. For cell analysis, a Becton Dickinson FACScan flow cytometer was used. Radiation-induced apoptosis in T-lymphocytes was quantified. Blood samples from tumor-bearing dogs were taken before the first fraction and at the end of radiation therapy. Results: Apoptosis in lymphocytes is dependent on donor age and donor weight. Tumor-bearing dogs when compared with healthy dogs showed no significant differences in levels of induced apoptosis. No significant changes were seen in the levels of radiation-induced apoptosis in blood taken before, during, or after radiation therapy. Conclusion: The leukocyte apoptosis assay can be successfully applied to canine patients, and a wide spectrum of sensitivities to radiation-induced apoptosis is observed. The sensitivity of a patient's peripheral blood T-lymphocytes to radiation-induced apoptosis does not change as a result of the trauma of radiotherapy during the course of tumor treatment. (orig.)
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki
2011-09-01
Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.
Cheng, Yi; Ji, Yikuan; Wang, Yu; Sun, Leilei; Huang, Jiaxin
2012-01-01
A widespread hemorrhagic gastroenteritis in young dogs occurred in South China. A virulent field canine parvovirus (CPV) strain, SC02/2011, was isolated from a puppy showing enteric signs in Guangdong, China. The genome of CPV strain SC02/2011 was sequenced and analyzed, which will promote a better understanding of the molecular epidemiology and genetic diversity of CPV field isolates in South China. PMID:23166228
Molecular differentiation of three canine and feline hookworms in South China through HRM analysis.
Wang, M W; Yan, X X; Hang, J X; Shi, X L; Fu, Y Q; Zhang, P; Yang, F; Pan, W D; Li, G Q
2018-02-05
To investigate the prevalence of canine and feline hookworms in South China, and to assess the risk of zoonotic hookworms to humans, one pair of primers (HRM-F/HRM-R) was designed to establish a high-resolution melting (HRM) method based on internal transcribed spacer 1 (ITS-1) rDNA for the detection of Ancylostoma ceylanicum, A. caninum and A. tubaeforme infection. The results showed that the HRM for the three hookworms produced different melting-curve profiles, where melting temperature (T m) values were 84.50°C for A. ceylanicum, 82.25°C for A. caninum and 81.73°C for A. tubaeforme, respectively. The reproducibility of intra- and inter-assay melting curves was almost perfect. The lowest concentration detected was about 5.69 ×10-4 g/μl. The HRM detection results from 18 canine and feline hookworm samples were in complete accordance with their sequencing results. The HRM method was more sensitive than the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique in the detection of 98 clinical samples. It is concluded that the HRM method can differentiate between A. ceylanicum, A. caninum, A. tubaeforme and their mixed infections, which may provide important technical support for the zoonotic risk assessment and molecular epidemiological survey of canine and feline hookworms.
Transmission dynamics and prospects for the elimination of canine rabies.
Directory of Open Access Journals (Sweden)
Katie Hampson
2009-03-01
Full Text Available Rabies has been eliminated from domestic dog populations in Western Europe and North America, but continues to kill many thousands of people throughout Africa and Asia every year. A quantitative understanding of transmission dynamics in domestic dog populations provides critical information to assess whether global elimination of canine rabies is possible. We report extensive observations of individual rabid animals in Tanzania and generate a uniquely detailed analysis of transmission biology, which explains important epidemiological features, including the level of variation in epidemic trajectories. We found that the basic reproductive number for rabies, R0, is very low in our study area in rural Africa (approximately 1.2 and throughout its historic global range (<2. This finding provides strong support for the feasibility of controlling endemic canine rabies by vaccination, even near wildlife areas with large wild carnivore populations. However, we show that rapid turnover of domestic dog populations has been a major obstacle to successful control in developing countries, thus regular pulse vaccinations will be required to maintain population-level immunity between campaigns. Nonetheless our analyses suggest that with sustained, international commitment, global elimination of rabies from domestic dog populations, the most dangerous vector to humans, is a realistic goal.
9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.
2010-01-01
... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...
Directory of Open Access Journals (Sweden)
Vianney Tricou
2016-02-01
Full Text Available Although rabies represents an important public health threat, it is still a neglected disease in Asia and Africa where it causes tens of thousands of deaths annually despite available human and animal vaccines. In the Central African Republic (CAR, an endemic country for rabies, this disease remains poorly investigated.To evaluate the extent of the threat that rabies poses in the CAR, we analyzed data for 2012 from the National Reference Laboratory for Rabies, where laboratory confirmation was performed by immunofluorescence and PCR for both animal and human suspected cases, and data from the only anti-rabies dispensary of the country and only place where post-exposure prophylaxis (PEP is available. Both are located in Bangui, the capital of the CAR. For positive samples, a portion of the N gene was amplified and sequenced to determine the molecular epidemiology of circulating strains.In 2012, 966 exposed persons visited the anti-rabies dispensary and 632 received a post-exposure rabies vaccination. More than 90% of the exposed persons were from Bangui and its suburbs and almost 60% of them were under 15-years of age. No rabies-related human death was confirmed. Of the 82 samples from suspected rabid dogs tested, 69 were confirmed positive. Most of the rabid dogs were owned although unvaccinated. There was a strong spatiotemporal correlation within Bangui and within the country between reported human exposures and detection of rabid dogs (P<0.001. Phylogenetic analysis indicated that three variants belonging to Africa I and II lineages actively circulated in 2012.These data indicate that canine rabies was endemic in the CAR in 2012 and had a detrimental impact on human health as shown by the hundreds of exposed persons who received PEP. Implementation of effective public health interventions including mass dog vaccination and improvement of the surveillance and the access to PEP are urgently needed in this country.
Directory of Open Access Journals (Sweden)
J. Van Heerden
2002-07-01
Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E
2002-03-01
Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
9 CFR 113.317 - Parvovirus Vaccine (Canine).
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...
Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L
2016-11-01
The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.
Epidemiological analyses on animal parasitoses: recent activity of the I.M.I.P.P.V.
Battelli, G; Capelli, G; Martini, M; Poglayen, G; Restani, R; Roda, R
1989-01-01
The paper presents a selected review of the epidemiological analyses performed in recent years (1984-1988) in the Institute of Malattie Infettive, Profilassi e Polizia Veterinaria of the University of Bologna on animal parasitoses, with special reference to the evaluation of some risk factors of bovine, swine and canine helminthoses, and to the validity of the coprological test for some parasites of the red fox.
Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H
2014-07-01
This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.
Environmental tobacco smoke and canine urinary cotinine level
International Nuclear Information System (INIS)
Bertone-Johnson, Elizabeth R.; Procter-Gray, Elizabeth; Gollenberg, Audra L.; Ryan, Michele B.; Barber, Lisa G.
2008-01-01
Epidemiologic studies of companion animals such as dogs have been established as models for the relationship between exposure to environmental tobacco smoke (ETS) and cancer risk in humans. While results from these studies are provocative, pet owner report of a dog's ETS exposure has not yet been validated. We have evaluated the relationship between dog owner's report of household smoking by questionnaire and dog's urinary cotinine level. Between January and October 2005, dog owners presenting their pet for non-emergency veterinary care at the Foster Hospital for Small Animals at Cummings School of Veterinary Medicine, Tufts University, were asked to complete a 10-page questionnaire measuring exposure to household ETS in the previous 24 h and other factors. A free-catch urine sample was also collected from dogs. Urinary cotinine level was assayed for 63 dogs, including 30 whose owners reported household smoking and 33 unexposed dogs matched on age and month of enrollment. Urinary cotinine level was significantly higher in dogs exposed to household smoking in the 24 h before urine collection compared to unexposed dogs (14.6 ng/ml vs. 7.4 ng/ml; P=0.02). After adjustment for other factors, cotinine level increased linearly with number of cigarettes smoked by all household members (P=0.004). Other canine characteristics including age, body composition and nose length were also associated with cotinine level. Findings from our study suggest that household smoking levels as assessed by questionnaire are significantly associated with canine cotinine levels
Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.
Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S
2017-06-03
Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.
Reliability of mandibular canines as indicators for sexual dichotomy.
Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa
2013-02-01
Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.
Approaches to canine health surveillance.
O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C
2014-01-01
Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.
2013-01-01
Background In this study, we sequenced and phylogenetic analyses of the VP2 genes from twelve canine parvovirus (CPV) strains obtained from eleven domestic dogs and a giant panda (Ailuropoda melanoleuca) in China. A novel canine parvovirus (CPV) was detected from the giant panda in China. Results Nucleotide and phylogenetic analysis of the capsid protein VP2 gene classified the CPV as a new CPV-2a type. Substitution of Gln for Arg at the conserved 370 residue in CPV presents an unusual variation in the new CPV-2a amino acid sequence of the giant panda and is further evidence for the continuing evolution of the virus. Conclusions These findings extend the knowledge on CPV molecular epidemiology of particular relevance to wild carnivores. PMID:23706032
Directory of Open Access Journals (Sweden)
Amanda Codeço de OLIVEIRA
2015-08-01
Full Text Available SUMMARY American visceral leishmaniasis is a vector-borne zoonosis in expansion in Brazil. Dogs are the main urban reservoir. Departing from a case of canine visceral leishmaniasis (CVL in Jacaré, Niterói, Rio de Janeiro State, an epidemiological canine and entomological study was performed to assess the extension of the disease at the location. Sample was collected around the case and the dogs identified by serological tests (rapid double platform immunochromatographic exams, immunoenzymatic assay/ELISA, indirect immunofluorescence/IFAT. The parasitological diagnosis was performed in animals positive in at least one of these tests. The entomological study was carried out by using light traps and manual collection. The associations between canine variables and outcome (ELISA and IFAT reagents were assessed by the chi-square test and adjusted by multivariate logistic regression for those associations with p < 0.1 in the bivariate analysis. Seventeen cases of CVL were detected among 110 evaluated dogs (prevalence of 15.5%. Presence of ectoparasites (OR 6.5; 95% CI 1.1-37.4, animals with clinical signs (OR 9.5; 95% CI 1.2-76.6, and previous cases of CVL in the same house (OR 17.9; 95% CI 2.2-147.1 were associated with the outcome. Lutzomyia longipalpiswas not detected. Our results are indicative of an ongoing transmission in the area.
Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y
2016-01-01
New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.
Platelets Inhibit Migration of Canine Osteosarcoma Cells.
Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C
2017-01-01
The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.
9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...
Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao
2012-07-20
Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.
Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War
1981-06-05
anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges
Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes
2013-01-01
The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.
Phenotypic characterization of canine Malassezia spp., isolates
Directory of Open Access Journals (Sweden)
Angélica Hurtado-Suárez
2016-09-01
Full Text Available Objective. To characterize and identify yeasts of the genus Malassezia by phenotypic features. Materials and methods. First, the macroscopic and microscopic morphological characteristics were described. In addition we performed biochemical and physiological assays as Tweens and Cremophor, including more. Results. Our results evidenced of 105 isolates obtained from dogs diagnosed with external otitis, it was possible to identify two distinct species from 46 isolates within the Malassezia genus: 36.19% (n=38 were identified as M. pachydermatis and 7.62% (n=8 as M. furfur. According to phenotypic patterns the remaining 56.19% (n=59 were reported as Malassezia spp., possibly corresponding to M. furfur and/or M. pachydermatis. Conclusions. Results emphasize the necessity to characterize according to species. It is not feasible to define Malassezia by species based on morphological, biochemical, and physiological findings. Therefore, molecular genotyping should be performed to identify markers allowing a more precise isolate identification. This would broaden our epidemiological knowledge regarding different species involved in canine otitis pathologies.
Directory of Open Access Journals (Sweden)
Maria T.S. Frade
2015-02-01
Full Text Available Infections by free-living amoebae can cause systemic disease in animals and humans. We describe the epidemiological, clinical and pathological aspects of disseminated acanthamoebiasis associated with canine distemper in three dogs of the semiarid region of Paraíba, Northeastern Brazil. Affected dogs developed progressive neurological and respiratory signs that progressed to death within in two to 20 days. Gross lesions were irregular and with yellow-reddish nodules randomly distributed in the lungs, heart, kidneys, spleen, lymph nodes, adrenals, and intestine. One dog had foci of malacia in the parietal cortex and another one in nucleus of brain basis. Histologically, pyogranulomas with areas of necrosis and hemorrhage in all organs affected were observed, associated with myriads of intralesional amoebic trophozoites. All three cases were concomitant canine distemper, that possibly triggered immunosuppression in the dogs. The diagnosis was performed through microscopic findings of infection by free-living amoebae and confirmed Acanthamoeba sp. by immunohistochemistry
Directory of Open Access Journals (Sweden)
Mehdi Mohebali
2016-10-01
Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.
Directory of Open Access Journals (Sweden)
Charles Porter
2001-04-01
Full Text Available
Lutzomyia evansi (Núñez-Tovar, 1924, Lutzomyia longipalpis
(Lutz y Neiva, 1912 y Lutzomyia cruzi (Mangabeira, 1938, son los
vectores de Leishmania infantum Nicolle, 1908, en el neotrópico. Lu. evansi ha sido incriminada como vector en zonas rurales de la Costa Caribe Colombiana, y algunas zonas de Venezuela y Nicaragua. A pesar de que esta especie reviste gran importancia en Salud Pública, no existen a la fecha estudios sobre su variabilidad genética, desconociéndose si existe o no flujo genético entre las poblaciones rurales y urbanas, endémicas y no endémicas de leishmaniosis visceral (LV. Con base en los genes mitocondriales Citocromo b, RNA de transferencia para Serina, subunidades uno y cuatro de la NADH deshidrogenasa, se estudió la variabilidad genética entre las distintas poblaciones de Lu. evansi en la Costa Caribe, incluyendo la población
geográficamente aislada de Isla Fuerte, y una población de Venezuela.
Clinical and Statistical Study on Canine Impaction
Directory of Open Access Journals (Sweden)
Adina-Simona Coșarcă
2013-08-01
Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic
Epidemiological evolution of canine parvovirus in the Portuguese domestic dog population.
Miranda, Carla; Parrish, Colin R; Thompson, Gertrude
2016-02-01
Since its emergence, canine parvovirus type 2 (CPV-2) has caused disease pandemics with severe gastroenteritis signs, infecting especially puppies. As a consequence of CPV rapid evolution a variety of genetic and antigenic variants have been reported circulating worldwide. The detection of additional variants of CPV circulating in the dog population in Portugal suggests monitoring of the disease is useful. The objectives of this study were to further detect and characterize circulating field variants from suspected CPV diseased dogs that were admitted to veterinary clinics distributed throughout the country, during 2012-2014. Of the 260 fecal samples collected, 198 were CPV positive by PCR, and CPV antigen was detected in 61/109 samples by Immunochromatographic (IC) test. The restriction fragment length polymorphism (RFLP) analysis of 167 samples revealed that 86 were the CPV-2c. Sequence analysis of the 198 strains confirmed that CPV-2c were the dominant variant (51.5%), followed by CPV-2b (47.5%) and CPV-2a (1%). The variants were irregularly distributed throughout the country and some were detected with additional non-synonymous mutations in the VP2 gene. Phylogenetic analysis demonstrated that the isolates were similar to other European strains, and that this virus continues to evolve. Copyright © 2015 Elsevier B.V. All rights reserved.
Podoplanin Expression in Canine Melanoma.
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-12-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.
Genetic characterization of canine parvovirus from dogs in Pakistan.
Shabbir, M Z; Sohail, M U; Chaudhary, U N; Yaqub, W; Rashid, I; Saleem, M H; Munir, M
Canine parvoviruses (CPV) exist as antigenic variants with varying frequencies and genetic variabilities across the globe. Given the endemicity and high prevalence in Pakistan, we characterized the CPVs originating from dogs-population to elucidate viral diversity and evolution. Fecal samples from clinically diseased pups (n = 17) of different breeds and age (2-6 months) were processed for hemagglutination assay (HA), and later for partial amplification of VP2 gene sequence and amino acid analysis. A total of 11 samples (64.71%) were found positive both in hemagglutination and PCR assays. Phylogenetic and evolutionary analysis demonstrated higher genetic heterogeneity in studied strains and constituted seven clusters within the CPV-2a group, however, they shared high level of identity with Chinese strains. Further studies are necessary to elucidate genetic analysis and epidemiology of CPV variants across a wide geographical area of the country.
Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W
2017-09-01
Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.
Vaccines for canine leishmaniasis
Directory of Open Access Journals (Sweden)
Clarisa B. Palatnik-De-Sousa
2012-04-01
Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans
Canine adenovirus type 1 in a fennec fox (Vulpes zerda).
Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku
2014-12-01
A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.
Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y
2013-06-01
Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.
Schmalfuss, A; Stenhagen, K R; Tveit, A B; Crossner, C-G; Espelid, I
2016-04-01
This was to determine the prevalence, distribution of affected teeth and severity of MIH in adolescents from Northern Norway. It was part of a cross-sectional health survey Fit Futures including 16-year-olds from two neighbouring municipalities, Tromsø and Balsfjord. The prevalence of MIH was 13.9% (110 of 794). The maxillary first permanent molars (FPMs) were 1.6 times more frequently affected than in the mandible (P MIH. The buccal surfaces were most often affected in FPMs. More severe lesions were found in the mandibular FPMs compared with the maxillary FPMs (P = 0.002). In the lower canines, only opacities were recorded, while in the upper jaw 13.0% of the affected canines showed PEBs. The distribution of MIH in the dentition was not symmetrical. The prevalence of MIH (13.9%) in the study population of 16-year-olds from Northern Norway is consistent with previous Scandinavian reports. The distribution pattern shows that one participant in four with MIH had at least one affected canine. Further studies are needed to describe the localisation of defects on the enamel surface and to relate these findings to enamel thickness and the duration of amelogenesis.
Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D
2015-01-01
Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance.
Detection of Arctic and European cluster of canine distemper virus in north and center of Iran.
Namroodi, Somayeh; Rostami, Amir; Majidzadeh-Ardebili, Keyvan; Ghalyanchi Langroudi, Arash; Morovvati, Abbas
2015-01-01
Canine distemper virus (CDV) creates a very contagious viral multi-systemic canine distemper (CD) disease that affects most species of Carnivora order. The virus is genetically heterogeneous, particularly in section of the hemagglutinin (H) gene. Sequence analysis of the H gene can be useful to investigate distinction of various lineages related to geographical distribution and CDV molecular epidemiology. Since vaccination program is conducted only in large cities of Iran, CD still remains as one of the major causes of death in dogs in this country. In order to monitor H gene, CDV has been detected in 14 out of 19 sampled dogs through the amplification of nucleoprotein (NP) gene in nested-PCR assay. In the next step 665 bp of H gene was amplified in 9 out of 14 NP-gene positive dogs. Phylogenetic analysis distinguished two distinct CDV genotypes in Iran. JN941238 has been embedded in European cluster and JN941239 has been embedded in Arctic cluster. Nucleic analysis has been shown high difference among both Iranian CDV lineages with CDV vaccine strains.
Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review
Directory of Open Access Journals (Sweden)
Parviz Torkzaban
2016-09-01
Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.
9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).
2010-01-01
... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...
Orthodontic Traction of Impacted Canine Using Cantilever
Directory of Open Access Journals (Sweden)
Cláudia Nakandakari
2016-01-01
Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.
Transmigration of mandibular canine – case report
International Nuclear Information System (INIS)
Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia
2014-01-01
Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation
Canine Parvovirus: Current Perspective
Nandi, S.; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...
Kraiss, A; Kraft, W; Gothe, R
1987-01-01
A review is presented on the biology of the causative agent, epidemiology, pathogenesis, clinical features, diagnosis and therapy of canine Sarcoptes scabiei infestation. This survey includes also clinical data of the period 1978-1986 in the Small Animal Hospital, Munich Veterinary Faculty. Several skin scrapings are usually necessary for diagnosis. For therapy application of acaricides once a week, altogether at least three times is sufficient. Simultaneously a decontamination of the dog's surroundings should be carried out.
Evaluation of P16 expression in canine appendicular osteosarcoma.
Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K
2017-06-20
Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.
Cone beam computed tomography findings of impacted upper canines
Energy Technology Data Exchange (ETDEWEB)
Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)
2014-12-15
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
Cone beam computed tomography findings of impacted upper canines
International Nuclear Information System (INIS)
Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio
2014-01-01
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
Prevalence of canine parvovirus infection in Grand Tunis, Tunisia
Directory of Open Access Journals (Sweden)
Ghada Tagorti
2018-03-01
Results: The overall prevalence of CPV-2 was 32.14% (n=54/168. A total number of 54 young dogs, aging 1 to 7 months, of American Staffordshire terrier, German shepherd, Rottweiler and Spaniel breeds were affected. There was no sex predisposition and German shepherd was the over-represented breed (n=33/54; 61.11%. The prevalence of clinical cases below the three months old was 70.37% (n=38/54 with autumn (n=27/54; 50% as the most common season of infection. Furthermore, the study showed that 87.04% (n=47/54 of CPV-2 unvaccinated young dogs were positive. Conclusion: This work was a new descriptive study concerning canine parvovirus infection in the Grand Tunis; further studies are required to better characterize the epidemiology of CPV-2 infection in Tunisia. [J Adv Vet Anim Res 2018; 5(1.000: 93-97
Canine angiostrongylosis: recent advances in diagnosis, prevention, and treatment
Directory of Open Access Journals (Sweden)
Di Cesare A
2014-12-01
Full Text Available Angela Di Cesare, Donato Traversa Faculty of Veterinary Medicine, University of Teramo, Teramo, Italy Abstract: Angiostrongylus vasorum is a parasitic nematode affecting the heart and pulmonary arteries of wild (eg, foxes and domestic canids. The parasite has an indirect life cycle in which slugs and snails act as intermediate hosts. In the last few years the parasite has spread outside the traditional endemic foci, and there is a rise of documented cases of canine angiostrongylosis across Europe. Angiostrongylus vasorum causes cardiopulmonary disorders and coagulopathies, along with different nonspecific clinical signs. Fatal infections are frequently reported. Given the severity of the infection and the recent geographic spreading of the parasite, this article reviews and discusses the current knowledge of A. vasorum, with a special focus on recent insights on diagnosis, prevention, and treatment of dog angiostrongylosis. Keywords: Angiostrongylus vasorum, dog, epidemiology, diagnostic approaches, control, therapy
Directory of Open Access Journals (Sweden)
Halos Lénaïg
2014-01-01
Full Text Available The incidence of canine babesiosis may vary considerably from one country to another depending on the distribution of the causative parasite species and their specific vectors. The aim of the present study was to evaluate the clinical occurrence of canine babesiosis diagnosed in European veterinary clinics and propose an updated map of the disease distribution in Western Europe. Questionnaires were sent to companion animal veterinary clinics in Spain, France, Benelux, Germany and Austria. The annual number of babesiosis cases in 2010, the number of practitioners in the clinic and the location of the clinic were recorded. The total numbers of dogs and practitioners in each country were used for definition of the reference populations and the annual incidence of canine babesiosis was calculated by dividing the total number of reported babesiosis cases by the total number of dogs in the veterinary practices involved in the study. Data were georeferenced for distribution map construction. The overall annual incidence of clinical babesiosis amongst the investigated dog population was 0.7%, with significant variations amongst countries and regions. Three epidemiological situations were described: (i Spain, with co-existence of several species of piroplasms and patchy distribution of babesiosis, (ii France, with overall presence of babesiosis due to Babesia canis and local variations and (iii Benelux, Germany and Austria, with overall low prevalence of the disease associated with localised description related either to imported cases or to small autochthonous foci of B. canis infection.
Halos, Lénaïg; Lebert, Isabelle; Abrial, David; Danlois, Fabien; Garzik, Karin; Rodes, Daniel; Schillmeier, Monika; Ducrot, Christian; Guillot, Jacques
2014-01-01
The incidence of canine babesiosis may vary considerably from one country to another depending on the distribution of the causative parasite species and their specific vectors. The aim of the present study was to evaluate the clinical occurrence of canine babesiosis diagnosed in European veterinary clinics and propose an updated map of the disease distribution in Western Europe. Questionnaires were sent to companion animal veterinary clinics in Spain, France, Benelux, Germany and Austria. The annual number of babesiosis cases in 2010, the number of practitioners in the clinic and the location of the clinic were recorded. The total numbers of dogs and practitioners in each country were used for definition of the reference populations and the annual incidence of canine babesiosis was calculated by dividing the total number of reported babesiosis cases by the total number of dogs in the veterinary practices involved in the study. Data were georeferenced for distribution map construction. The overall annual incidence of clinical babesiosis amongst the investigated dog population was 0.7%, with significant variations amongst countries and regions. Three epidemiological situations were described: (i) Spain, with co-existence of several species of piroplasms and patchy distribution of babesiosis, (ii) France, with overall presence of babesiosis due to Babesia canis and local variations and (iii) Benelux, Germany and Austria, with overall low prevalence of the disease associated with localised description related either to imported cases or to small autochthonous foci of B. canis infection. PMID:24626325
International Nuclear Information System (INIS)
Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin
2015-01-01
Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)
Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.
Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano
2004-10-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.
Skeletal maturity assessment using mandibular canine calcification stages
Directory of Open Access Journals (Sweden)
Vildana Džemidžić
2016-11-01
Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.
A new method for rapid Canine retraction
Directory of Open Access Journals (Sweden)
"Khavari A
2001-06-01
Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.
Headley,Selwyn Arlington; Saito,Taís Berelli
2003-01-01
Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...
Novel canine circovirus strains from Thailand: Evidence for genetic recombination.
Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E
2018-05-14
Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.
Podoplanin Expression in Canine Melanoma
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-01-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...
Finite element analysis of rapid canine retraction through reducing resistance and distraction
Directory of Open Access Journals (Sweden)
Junjie XUE
2014-01-01
Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.
Canine scent detection of canine cancer: a feasibility study
Directory of Open Access Journals (Sweden)
Dorman DC
2017-10-01
Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of
Cortese, Laura; Annunziatella, Mariangela; Palatucci, Anna Teresa; Lanzilli, Sarah; Rubino, Valentina; Di Cerbo, Alessandro; Centenaro, Sara; Guidetti, Gianandrea; Canello, Sergio; Terrazzano, Giuseppe
2015-12-03
Clinical appearance and evolution of Canine Leishmaniosis (CL) are the consequence of complex interactions between the parasite and the genetic and immunological backgrounds. We investigated the effect of an immune-modulating diet in CL. Dogs were treated with anti- Leishmania pharmacological therapy combined with standard diet (SD Group) or with the immune-modulating diet (IMMD Group). CD3+ CD4+ Foxp3+ Regulatory T cells (Treg) and CD3+ CD4+ IFN-γ + T helper 1 (Th1) were analyzed by flow cytometry. All sick dogs showed low platelet number at diagnosis (T0). A platelet increase was observed after six months (T6) SD Group, with still remaining in the normal range at twelve months (T12). IMMD Group showed an increase in platelet number becoming similar to healthy dogs at T6 and T12. An increase of CD4/CD8 ratio was revealed in SD Group after three months (T3), while at T6 and at T12 the values resembled to T0. The increase in CD4/CD8 ratio at T3 was maintained at T6 and T12 in IMMD Group. A reduction in the percentage of Treg of all sick dogs was observed at T0. A recovery of Treg percentage was observed only at T3 in SD Group, while this effect disappeared at T6 and T12. In contrast, Treg percentage became similar to healthy animals in IMDD Group at T3, T6 and T12. Sick dogs showed an increase of Th1 cells at T0 as compared with healthy dogs. We observed the occurrence of a decrease of Th1 cells from T3 to T12 in SD Group, although a trend of increase was observed at T6 and T12. At variance, IMMD Group dogs showed a progressive decrease of Th1 cells, whose levels became similar to healthy controls at T6 and T12. The immune-modulating diet appears to regulate the immune response in CL during the standard pharmacological treatment. The presence of nutraceuticals in the diet correlates with the decrease of Th1 cells and with the increase of Treg in sick dogs. Therefore, the administration of the specific dietary supplement improved the clinical response to the
Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G
2006-11-25
The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.
Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald
2004-01-01
The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.
A rare case of canine anomaly - a possible algorithm for treating it.
Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore
2014-01-01
Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.
Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.
Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong
2017-06-01
Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.
Surgical considerations and management of bilateral labially impacted canines
Directory of Open Access Journals (Sweden)
Yu-Shan Huang
2016-06-01
Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.
Immunohistochemical Characterization of Canine Lymphomas
Directory of Open Access Journals (Sweden)
Roxana CORA
2017-11-01
Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.
Stem Cell-Associated Marker Expression in Canine Hair Follicles.
Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J
2016-03-01
Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.
Navarro, Ryan; Nair, Rajeev; Peda, Andrea; Aung, Meiji Soe; Ashwinie, G S; Gallagher, Christa A; Malik, Yashpal S; Kobayashi, Nobumichi; Ghosh, Souvik
2017-08-15
Although canine parvovirus (CPV) and canine enteric coronavirus (CCoV) are important enteric pathogens of dogs and have been studied extensively in different parts of the world, there are no reports on these viruses from the Caribbean region. During 2015-2016, a total of 104 diarrheic fecal samples were collected from puppies and adult dogs, with or without hemorrhagic gastroenteritis, on the Caribbean island of St. Kitts (KNA). By PCR, 25 (24%, n=104) samples tested positive for CPV. Based on analysis of the complete deduced VP2 amino acid sequences, 20 of the KNA CPV strains were assigned to new CPV-2a (also designated as CPV-2a-297A). On the other hand, the VP2 genes of the remaining 5 strains were partially characterized, or could not be sequenced. New CPV-2a was the predominant CPV variant in St. Kitts, contrasting the molecular epidemiology of CPV variants reported in most studies from nearby North and South American countries. By RT-PCR, CCoVs were detected in 5 samples (4.8%, n=104). Based on analysis of partial M-protein gene, the KNA CCoV strains were assigned to CCoV-I genotype, and were closely related to CCoV-I strains from Brazil. To our knowledge, this is the first report on detection and genetic diversity of CPV and CCoV in dogs from the Caribbean region, and underscores the importance of similar studies in the other Caribbean islands. Copyright © 2017 Elsevier B.V. All rights reserved.
Chlamydia in canine or feline coronary arteriosclerotic lesions
Directory of Open Access Journals (Sweden)
Grabarevic Zeljko
2011-09-01
Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
Chlamydia in canine or feline coronary arteriosclerotic lesions.
Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas
2011-09-09
There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
A novel bocavirus in canine liver
Directory of Open Access Journals (Sweden)
Li Linlin
2013-02-01
Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.
A compendium of canine normal tissue gene expression.
Directory of Open Access Journals (Sweden)
Joseph Briggs
Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.
Genomic instability and telomere fusion of canine osteosarcoma cells.
Directory of Open Access Journals (Sweden)
Junko Maeda
Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.
Directory of Open Access Journals (Sweden)
Cui Shang-jin
2010-05-01
Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.
2010-01-01
A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759
Atopic dermatitis: a restropective study of associated factors in a dermopathic canine population
Directory of Open Access Journals (Sweden)
Cristina Fernandes do Amarante
2015-12-01
Full Text Available ABSTRACT. Amarante C.F., Ramadinha R.R. & Pereira M.J.S. Atopic dermatitis: a restropective study of associated factors in a dermopathic canine population. [Dermatite atópica: um estudo retrospectivo dos fatores associados em uma população canina dermopata.] Revista Brasileira de Medicina Veteriná- ria, 37(Supl.1:13-17, 2015. Curso de Pós-Graduação em Ciências Veterinárias, Instituto de Veterinária, Universidade Federal Rural do Rio de Janeiro, BR 465, Km 7, Seropédica, RJ 23897-970, Brasil. E-mail: cristinaf.amarante@gmail.com Canine atopic dermatitis (AD is a pruriginous inflammatory disease related to the production of IgE antibodies and frequently, diagnosed in the clinical veterinary practice. However, there are many controversies about the predisposing factors. The objective of this study was to analyze the contribution of the sex, age, breed, castration, time of year, the use of perfume and cleaning products as predisposing factors for the occurrence of AD using binomial generalized linear regression model estimating the prevalence ratio as a measure of effect. The clinical records of 2,280 dogs attended by the Section of Dermatology Small Animal Hospital of the Rural Federal University of Rio de Janeiro, between 2005 and 2010, were reviewed and 1,462 dogs were included in the study. Bivariate and multivariate analyses were performed using a generalized binomial linear regression model. Significance was set at a p-value of ≤ 0.05. Atopic dermatitis was diagnosed in 36.1% (528/1462 of the canine population studied and was associated with females [PR= 1.204 (1.048 to 1.384], adults [PR= 2.045 (1.542 to 2.711], the dry season [PR= 0.840 (0.734 to 0.962], the use of perfumes [PR= 1.271 (1.089 to 1.483]. Thus, atopic dermatitis prevalence in the study population was higher in females, adults, in which applied perfumes and in the rainy season. . This study constitutes a new approach to the epidemiological aspects of canine atopic
Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.
Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H
2016-06-01
Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.
Canine index – A tool for sex determination
Directory of Open Access Journals (Sweden)
Shankar M. Bakkannavar
2015-12-01
Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.
Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.
Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara
2018-04-01
Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.
Rate of retraction of anterior teeth after canine distraction
Directory of Open Access Journals (Sweden)
Litesh Singla
2017-01-01
Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.
Millán, Javier; Chirife, Andrea D; Altet, Laura
2015-03-01
The role of wildlife in the epidemiology of leishmaniosis in under debate, and determining whether infection with Leishmania infantum causes illness in wild carnivores is important to determine its potential role as a reservoir. To provide for the first time serum biochemistry reference values for the common genet (Genetta genetta), and to determine variations associated with L. infantum infection. Twenty-five serum biochemistry parameters were determined in 22 wild-caught genets. Blood samples were analyzed for L. infantum DNA by means of real-time polymerase chain reaction (PCR). Two female genets were positive for L. infantum DNA but did not show any external clinical sign upon physical examination. Among other variations in the biochemistry values of these genets, one presented a higher concentration of gamma-globulins and cholesterol, whereas the other genet presented increased creatinine, bilirubin, and chloride levels when compared to uninfected females. Sex-related differences in some parameters were also reported. Infection with L. infantum may sometimes be accompanied by abnormal serum biochemistry in wild carnivores. Clinical disease may occur in L. infantum-infected wild carnivores. This has implications in the epidemiology of leishmaniosis. In addition, the data provided here would also be useful as reference values for researchers or rehabilitators working with the common genet.
Canine tooth size and fitness in male mandrills (Mandrillus sphinx).
Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean
2008-07-01
Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.
Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature
Directory of Open Access Journals (Sweden)
Gaurav Sharma
2011-01-01
Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.
The first canine visceral leishmaniasis outbreak in Campinas, State of São Paulo Southeastern Brazil
Directory of Open Access Journals (Sweden)
Andrea Paula Bruno von Zuben
2014-06-01
Full Text Available Introduction Early detection of American visceral leishmaniasis (AVL outbreak in animals is crucial for controlling this disease in non-endemic areas. Methods Epidemiological surveillance (2009-2012 was performed in Campinas, State of São Paulo, Brazil. Results In 2009, Leishmania chagasi was positively identified in four dogs. Entomological research and three serological studies (2010-2012 were undertaken as monitoring measures; these approaches revealed a moderate prevalence of Leishmania present in 4% of the canine population. Nyssomyia whitmani and Lutzomyia longipalpis were the predominant species identified. Conclusions Detection of an AVL outbreak in dogs in an area with an evolving natural landscape containing sand flies is crucial for control programs.
Asymmetry in development (mineralisation of permanent mandibular canine roots
Directory of Open Access Journals (Sweden)
Burić Mirjana V.
2012-01-01
Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.
Canine visceral leishmaniasis as a systemic fibrotic disease
Silva, Lucelia C; Castro, Rodrigo S; Figueiredo, Maria M; Michalick, Marilene S M; Tafuri, Washington L; Tafuri, Wagner L
2013-01-01
We propose that canine visceral leishmaniasis (CVL) is a systemic fibrotic disease, as evidenced by the wide distribution of fibrosis that we have found in the dogs suffering from chronic condition. The inflammatory cells apparently direct fibrosis formation. Twenty-four cases (symptomatic dogs) were identified from a total of one hundred and five cases that had been naturally infected with Leishmania chagasi and had been documented during an epidemiological survey of CVL carried out by the metropolitan area of the municipality of Belo Horizonte, MG, Brazil. The histological criterion was intralobular liver fibrosis, as has been described previously in dogs with visceral leishmaniasis. In addition to the findings in the liver, here we describe and quantify conspicuous and systemic deposition of collagen in other organs, including spleen, cervical lymph nodes, lung and kidney of all the infected symptomatic dogs. Thus we report that there is a systematic fibrotic picture in these animals, where inflammatory cells appear to direct fibrosis in all organs that have been studied. Therefore we propose that CVL is a systemic fibrotic disease. PMID:23419132
Orthodontic management of buccally erupted ectopic canine with two case reports
Directory of Open Access Journals (Sweden)
Avesh Sachan
2012-01-01
Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.
Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel
International Nuclear Information System (INIS)
Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.
2005-01-01
Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old
Canine parvovirus: current perspective.
Nandi, S; Kumar, Manoj
2010-06-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.
Consequences of crown shortening canine teeth in Greenland sled dogs
DEFF Research Database (Denmark)
Kortegaard, H E; Anthony Knudsen, T; Dahl, S
2015-01-01
OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...
Dental anomalies associated with buccally- and palatally-impacted maxillary canines.
Sajnani, Anand K; King, Nigel M
2014-08-01
The aim of the present study was to determine the association of both buccally- and palatally-impacted canines with other dental anomalies. This retrospective study was conducted on a population of 533 southern Chinese children and adolescents who had impacted maxillary canines that had been treated in the Paediatric Dentistry and Orthodontics Clinic, Prince Philip Dental Hospital, The University of Hong Kong, Hong Kong. Descriptions of the impacted canine and other associated anomalies were obtained from the case notes and radiographs. Clinical photographs and study casts were used, where available. A total of 253 (47.5%) patients with impacted maxillary canines were diagnosed with other dental anomalies. Microdontia was the most frequently-occurring anomaly reported in these patients, with the maxillary lateral incisor the most commonly affected tooth. Other odontogenic anomalies that were associated with both buccally- and palatally-impacted canines included hypodontia, supernumerary teeth, transposition of other teeth, enamel hypoplasia, other impacted teeth, and dens invaginatus. Both buccally- and palatally-impacted canines were found to be associated with other odontogenic anomalies. © 2013 Wiley Publishing Asia Pty Ltd.
SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.
Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi
2017-10-01
Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.
Overexpression of vimentin in canine prostatic carcinoma
DEFF Research Database (Denmark)
Rodrigues, M M P; Rema, A; Gärtner, F
2011-01-01
Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....
Vaccines for Canine Leishmaniasis
Directory of Open Access Journals (Sweden)
Faeze Foroughi-Parvar
2014-01-01
Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.
Upper canine inclination influences the aesthetics of a smile.
Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S
2015-02-01
This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.
Treatment modalities of palatal impacted canines
Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona
2012-01-01
Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...
Oz, A Z; Ciger, S
2018-03-01
The aim of the present study was to evaluate the changes of incisor root resorption associated with impacted maxillary canines and health of periodontal tissues around maxillary canines erupted with orthodontic treatment. Twenty patients with a unilateral palatally impacted maxillary canine were included in the study. Cone-beam computed tomography images taken before and after orthodontic treatment were compared with the contralateral canines serving as control teeth. Root resorption was present in 10% of central and 40% of lateral incisors before treatment. After treatment, the incidence of resorption decreased. The thickness of the buccal bone surrounding the impacted canines was similar to that surrounding the contralateral canines, except in the apical area. Periodontal pocket depth and alveolar bone loss were greater for the impacted canine teeth than for the contralateral canines. Incisor root resorption associated with impacted canine teeth showed signs of repair after orthodontic treatment. Slight differences related to periodontal health were found between the previously impacted teeth and contralateral canine teeth.
Comprehensive characterization of commercially available canine training aids.
Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A
2014-09-01
Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine
Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P
2015-07-01
The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...
Evaluation of post-vaccination immunity to canine distemper and ...
African Journals Online (AJOL)
SERVER
2007-08-20
Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...
da Costa, Andréa Pereira; Costa, Francisco Borges; Soares, Herbert Sousa; Ramirez, Diego Garcia; de Carvalho Araújo, Andreina; da Silva Ferreira, Juliana Isabel Giuli; Tonhosolo, Renata; Dias, Ricardo Augusto; Gennari, Solange Maria; Marcili, Arlei
2015-12-01
Environment influences the composition, distribution, and behavior of the vectors and mammalian hosts involved in the transmission of visceral leishmaniasis (VL), affecting the epidemiology of the disease. In Brazil, the urbanization process and canine cases of VL are indicators for local health authorities. This study aimed to investigate the occurrence of the canine visceral leishmaniasis (CVL) in Maranhão State, Brazil. Blood samples collected from 960 dogs from six municipalities and six different ecosystems (Baixada Maranhense, Mangue, Mata dos Cocais, Amazônia, Cerrado, and Restinga) to serological tests (enzyme-linked immunosorbent assay [ELISA], indirect fluorescence antibody test [IFAT], and chromatographic immunoassay methods [Dual Path Platform technology, DPP(®)]) and parasitological diagnosis. From serological tests, 11.14% (107) of the dogs were positive for CVL, with 59.16% (568), 14.5% (148), and 131% (126) positives to ELISA, DPP, and IFAT tests, respectively. Only seven animals (0.73%) were positive in a parasitological test. We also performed parasite isolation and phylogenetic characterization. All isolates of dogs obtained from Maranhão were grouped in a single branch with Leishmania infantum chagasi from Brazil. The ecosystem Amazonia presented the highest positivity rates to CVL in serological and parasitological tests. Brazilian biomes/ecosystems suffer large degradation and may favor, depending on climatic conditions, the installation of new diseases. In the case of VL, dogs are reservoirs of parasites and sentinels for human infection.
Directory of Open Access Journals (Sweden)
Fred da Silva Julião
2009-06-01
Full Text Available The goal of the present work was to investigate the occurence of canine Visceral Leishmaniasis (VL in Itapuã, Cajazeiras and Pau da Lima sanitary districts (SD, all belonging to the city of Salvador. In order to achieve it, a canine epidemiological and entomological surveys were applied as an epidemiological questionnaire to the owners of the animals sampled and to the veterinary physicians of the city. The study detected six VL seropositive dogs among the eight hundred and eleven ones randomly sampled. It was not possible to determine the autoctonous condition for L. chagasi infection. One animal was positive by culture of splenic material and in the entomologic survey of the vector, Lutzomyia longipalpis, none was captured. Veterinary clinicians from 41.7% of the clinics evaluated reported the diagnostic of, at least, one VL case in Salvador domiciliated dogs. The SD of Itapuã, Cajazeiras and Pau da Lima presented VL transmission risk once there is Leishmania parasite occurrence in the municipality, verified in this study by splenic culturing of an animal aspirative puncture, previous record of vector (L. longipalpis presence in the Itapuã district by the Bahia State Health Agency (SESAB and canine VL diagnostics by veterinary doctors from clinics all around the city of Salvador. This work is the first epidemiological analysis of this zoonosis in these SD and they point out the need to perform sampled entomological and serological surveys in all areas of the city. The development of a VL surveillance system may contribute for monitoring the disease in Salvador.Objetivou-se com este estudo investigar a ocorrência da Leishmaniose Visceral (LV canina nos Distritos Sanitários (DS de Itapuã, Cajazeiras e Pau da Lima, pertencentes ao município de Salvador, por meio da realização de inquérito sorológico canino; inquérito entomológico, aplicação de questionário epidemiológico aos proprietários dos animais amostrados e a m
Directory of Open Access Journals (Sweden)
Charalampos Attipa
2017-11-01
Full Text Available Case summary A 6-year-old female neutered domestic shorthair cat from Cyprus was presented with multiple ulcerated skin nodules. Cytology and histopathology of the lesions revealed granulomatous dermatitis with intracytoplasmic organisms, consistent with amastigotes of Leishmania species. Biochemistry identified a mild hyperproteinaemia. Blood extraction and PCR detected Leishmania species, Hepatozoon species and ‘ Candidatus Mycoplasma haemominutum’ (CMhm DNA. Subsequent sequencing identified Hepatozoon felis . Additionally, the rRNA internal transcribed spacer 1 locus of Leishmania infantum was partially sequenced and phylogeny showed it to cluster with species derived from dogs in Italy and Uzbekistan, and a human in France. Allopurinol treatment was administered for 6 months. Clinical signs resolved in the second month of treatment with no deterioration 8 months post-treatment cessation. Quantitative PCR and ELISA were used to monitor L infantum blood DNA and antibody levels. The cat had high L infantum DNA levels pretreatment that gradually declined during treatment but increased 8 months post-treatment cessation. Similarly, ELISA revealed high levels of antibodies pretreatment, which gradually declined during treatment and increased slightly 8 months post-treatment cessation. The cat remained PCR positive for CMhm and Hepatozoon species throughout the study. There was no clinical evidence of relapse 24 months post-treatment. Relevance and novel information To our knowledge, this is the first clinical report of a cat with leishmaniosis with H felis and CMhm coinfections. The high L infantum DNA levels post-treatment cessation might indicate that although the lesions had resolved, prolonged or an alternative treatment could have been considered.
Canine as a biomedical research model: immunological, hematological, and oncological aspects
International Nuclear Information System (INIS)
Shifrine, M.; Wilson, F.D.
1980-01-01
The canine has been used as a biomedical research model in radiation studies by a number of laboratories supported primarily by the US Department of Energy and its predecessors. These studies were unique in that they covered the life spans of the canines and permitted the collection of data from birth to death under controlled conditions. Since these were multiparametric studies, an extensive data base has been established, not the least of which are normative values covering all biologic systems, including immunohematology. The canine model has also been extensively used by other groups, such as transplantation biologists. The virtues of the canine as a model in these and many other endeavors are becoming increasingly more apparent with the passing of time. One of the primary goals of this volume was to compile the knowledge and experience of researchers using the canine model and to focus their expertise on furthering the use of the canine for studies in immunology, hematology, and oncology. We have attempted to present some of the contemporary, diverse uses of the canine in biomedical research, emphasizing immunologic endpoints, and also to present in detail some of the latest technology used in such studies
Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan
2014-06-01
More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year
Directory of Open Access Journals (Sweden)
Sophia Pfahler
Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.
Feeding ecology and morphology of the upper canines in bears (carnivora: Ursidae).
Christiansen, Per
2008-07-01
The morphology and mechanical strength of the upper canines in all eight extant species of ursids is analyzed, and the findings are discussed in relation to feeding ecology. Ursids have proportionally smaller canines than other large carnivores with a specialized feeding ecology, such as large felids, and the upper canine morphology is both canid-like and felid-like. The giant panda is the most divergent species, and its short, blunt, and cone-like canines appear well adapted for tearing into bamboo. The almost equally herbivorous spectacled bear has a less derived canine morphology. The large canines of the sun bear are divergent from other ursine ursids, and may be an adaptation for tearing open tree trunks in search of insects. Discriminant Analysis is successful in separating ursid species on the basis of canine morphology, but the canines of ursine ursids, and also of the spectacled bear, show greater resemblance among the species than the marked differences in feeding ecology would suggest. This could be in part due to a short evolutionary history, and in part due to canines not having been subjected to much evolutionary selection as has been the case among other large carnivores, such as large felids. Ursids are probably evolutionarily and ecologically successful due to physical size and strength rather than a derived craniodental anatomy. Copyright 2008 Wiley-Liss, Inc.
Canine length in wild male baboons: maturation, aging and social dominance rank.
Directory of Open Access Journals (Sweden)
Jordi Galbany
Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki
2012-10-01
The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.
IQGAP1 is an oncogenic target in canine melanoma.
Directory of Open Access Journals (Sweden)
Becky H Lee
Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.
Expression and function of survivin in canine osteosarcoma.
Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H
2012-01-01
Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.
Directory of Open Access Journals (Sweden)
Alfonso J. Rodríguez-Morales
2010-03-01
Full Text Available Objetivos. Evaluar las posibles asociaciones entre el índice de desarrollo humano (IDH y sus componentes, y la incidencia de Leishmaniosis cutánea (LC en cuatro estados endémicos de Venezuela (Mérida, Trujillo, Lara y Sucre en el período 1994 al 2003. Materiales y métodos. La data socioeconómica (clasificada de acuerdo al Banco Mundial se obtuvo del Instituto Nacional de Estadística y la epidemiológica del Ministerio de Salud, ambos de Venezuela. Para este estudio ecológico se evaluó la variación anual de las variables y se realizó modelos de regresión. Resultados. El IDH varió en el período, de 0,6746 en 1994 a 0,8144 en 2003 (p=0,90, asimismo, se observó un aumento de la incidencia acumulada de Leishmaniosis, en especial del año 1998 (7,3 casos/100 000 hab a 1999 (11,3 casos/100 000 hab. Al analizar con los modelos de regresión lineal, se observó que la relación entre las variables epidemiológicas y sociales era diferente a nivel de los Estados evaluados. Para Mérida y Trujillo se observó un descenso significativo de la incidencia de LC con relación al aumento del porcentaje de alfabetización (pObjectives. Assess potential relationships between the Human Development Index (HDI and its components and the incidence of cutaneous leishmaniasis (CL in four endemic States of Venezuela (Mérida, Trujillo, Lara and Sucre in the period 1994-2003. Material and methods. Socioeconomical data (classified according the World Bank was obtained from the National Institute of Statistics, and the epidemiological data from the Ministry of Health, both from Venezuela. For this ecological study the annual variation of the variables was assessed and also regression models were done. Results. The HDI varied in the period from 0.6746 in 1994 to 0.8144 in 2003 (p=0.90. During this time an increase in the cumulative incidence of Leishmaniasis was observed, particularly from 1998 (7.3 cases/100,000 pop to 1999 (11.3 cases/100,000 pop. Analyzing
National clinical guidelines for management of the palatally ectopic maxillary canine.
Husain, J; Burden, D; McSherry, P; Morris, D; Allen, M
2012-08-01
This review summarises updated clinical guidelines produced by the Clinical Standards Committee of the Faculty of Dental Surgery, Royal College of Surgeons of England (FDSRCS). This guideline on the management of the palatally ectopic maxillary canine illustrates the information contained in the recently updated online version. The timely recognition of ectopic canines is important for the overall management of the dentition. This review illustrates five management strategies for ectopic permanent canines: interceptive treatment by extraction of the deciduous canine, surgical exposure and orthodontic alignment, surgical removal of the palatally ectopic permanent canine, auto-transplantation and no active treatment/leave and observe. The current available evidence for each of these management options has been evaluated and awarded a grade used by the Scottish Intercollegiate Guidelines Network.
Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report.
Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka
2016-07-01
Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.
Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.
Directory of Open Access Journals (Sweden)
Emily J Shields
Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.
Severe canine distemper outbreak in unvaccinated dogs in Mozambique
Directory of Open Access Journals (Sweden)
Julieta Zacarias
2016-07-01
Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique
Management of an Unusual Ectopic Eruption of Maxillary Canine.
Aileni, Kaladhar Reddy; Rachala, Madhukar Reddy; Prathima, Chintakunta Reddy; Naveen, Pitalla Kumar; Soujanya, Donthula
2017-05-01
Transposition of teeth is a rare condition, with a prevalence of 0.3-0.4% in general population. They are more commonly observed in females, and may occur unilaterally/bilaterally with greater frequency of left side occurrence in unilateral transposition cases. A 17-year-old female patient reported with the chief complaint of unaesthetic smile. On clinical examination the patient was diagnosed with Angle's class I malocclusion with an ectopically erupted maxillary left canine labial to the left central incisor with retained deciduous canine. The treatment plan decided was to extract the retained deciduous canine, level and align the ectopic canine using an R-loop. The treatment for the patient was finished in 14 months and was retained using a fixed lingual retainer in the upper and lower arches.
Cardiac involvement in canine babesiosis : review article
Directory of Open Access Journals (Sweden)
R.G. Lobetti
2005-06-01
Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.
The Ondersteport Canine distemper virus strain and measles ...
African Journals Online (AJOL)
Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...
Management of an impacted and transposed maxillary canine
Directory of Open Access Journals (Sweden)
Deepti A
2010-03-01
Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.
Aspects and clinical procedures of eruptive changes of permanent upper canines
Directory of Open Access Journals (Sweden)
Sheila Marcia Francisco
2012-04-01
Full Text Available INTRODUCTION: Even though the upper canine is the tooth that presents most eruption anomalies, after the third molars, canine retention prevalence in the population is quite low. Local, physiologic and pathologic factors can provide difficulties for the tooth eruptive process. The correct diagnosis in trying to prevent upper canine retention with ectopic eruption is fundamental to choose the ideal treatment, which can be performed by various methods. OBJECTIVE: The present paper has the purpose of approaching aspects related to impacted upper permanent canines by a literature review, including localization and treatment conducts.
A randomized clinical study of two interceptive approaches to palatally displaced canines.
Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela
2008-08-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.
International Nuclear Information System (INIS)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-01-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using 125 I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed
[Epidemiology of human rabies in China, 2016].
Li, Y R; Zhu, L L; Zhu, W Y; Tao, X Y
2018-01-10
Objective: To understand the epidemiological characteristics of human rabies in China in 2016 and provide evidence for the control and prevention of human rabies. Methods: The incidence data of human rabies in China in 2016 were collected from national infectious disease reporting information management system. The surveillance data were collected from provinces of Shandong, Guizhou, Anhui, Hunan, Jiangsu and Guangxi Zhuang Autonomous Region. Excel 2013 software was used to process and summarize the data, the epidemiological characteristics of human rabies in China in 2016 were described by using indicators such as morbidity, mortality and constituent ratio. Results: A total of 644 human rabies cases were reported in 28 provinces in China in 2016, a decrease of 19.60% (157/801) compared with 2015. The provinces reporting high incidences of human rabies were Henan, Hunan, Guangxi and Guizhou, accounting for 39.44% (254/644) of the total cases. One case was reported in Qinghai province and Xinjiang Uygur Autonomous Region respectively. The male to female ratio of the cases was 2.14∶1 (439/205), and the majority of the patients were farmers (444/644). Surveillance points in 6 provinces reported 1 281 340 persons seeking post-exposure treatment, of whom 1 018 367 were treated for dog bite or scratch. A total of 764 234 persons completed the vaccination series, accounting for 63.90% (764 234/1 195 956) of the persons with grade Ⅱ and Ⅲ exposures, and 28.89% (165 677/573 571) of the persons with grade Ⅲ exposure were treated with passive immunization product. The average density of dogs in each surveillance area was 7.03/100 persons, the average canine immunization rate was 37.64%. Conclusion: The incidence of human rabies has remained decline in China in 2016, the number of the affected provinces has increased and that has the tendency of spreading to low-risk regions. The cases mainly occurred in men and farmers, and caused by dog bite or scratch. It is
Morphology of palatally impacted canines: A case-controlled cone-beam volumetric tomography study.
Hettiarachchi, Pilana Vithanage Kalani Shihanika; Olive, Richard John; Monsour, Paul
2017-02-01
The aim of this study was to investigate the relationships between an apical curvature or a hook and the crown/root ratio in subjects with and without palatally impacted maxillary canines. An experimental group of 44 patients (17 boys, 27 girls; mean age, 13.6 years) with 59 palatally impacted maxillary canines was selected from the records of patients referred to a radiology practice for cone-beam imaging. If a patient had bilateral palatally impacted canines, 1 canine was randomly selected for analysis. The palatally impacted canine group was matched for age and sex with 49 normal subjects (25 boys, 24 girls; mean age, 13.2 years) with 98 canines. Cone-beam DICOM files were imported into In Vivo imaging software (version 5.3; Anatomage, San Jose, Calif) for analysis. The angulations and linear variables of the maxillary canines were measured by using the software measurement tools. Chi-square and independent t tests were used to test for differences between the groups. The presence of a hook at the apical third and other root curvature were significantly different between the 2 groups (P <0.001 and P <0.05, respectively). Of the 44 palatally impacted canines, 16 (36.4%) had an apical hook and only 1 canine in the control group had an apical hook (1.0%). The mean root length of the palatally impacted canines was 2.66 mm shorter (P <0.001), and the mean crown/root ratio was significantly greater for the palatally impacted canines compared with the nonimpacted group (P <0.001). Palatally impacted canines have a greater tendency to develop apical hooks and are less likely to develop other root curvatures than are nonimpacted canines. Also, they have shorter roots resulting in larger crown/root ratios compared with the control group. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.
Canine detection of free-ranging brown treesnakes on Guam
Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.
2011-01-01
We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.
Cryopreservation of microencapsulated canine sperm.
Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu
2011-03-01
The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.
Dog Ecology and Barriers to Canine Rabies Control in the Republic of Haiti, 2014-2015.
Schildecker, S; Millien, M; Blanton, J D; Boone, J; Emery, A; Ludder, F; Fenelon, N; Crowdis, K; Destine, A; Etheart, M; Wallace, R M
2017-10-01
An estimated 59 000 persons die annually of infection with the rabies virus worldwide, and dog bites are responsible for 95% of these deaths. Haiti has the highest rate of animal and human rabies in the Western Hemisphere. This study describes the status of animal welfare, animal vaccination, human bite treatment, and canine morbidity and mortality in Haiti in order to identify barriers to rabies prevention and control. An epidemiologic survey was used for data collection among dog owners during government-sponsored vaccination clinics at fourteen randomly selected sites from July 2014 to April 2015. A total of 2005 surveys were collected and data were analysed using parametric methods. Over 50% of owned dogs were allowed to roam freely, a factor associated with rabies transmission. More than 80% of dog owners reported experiencing barriers to accessing rabies vaccination for their dogs. Nearly one-third of the dog population evaluated in this study died in the year preceding the survey (32%) and 18% of these deaths were clinically consistent with rabies. Dog bites were commonly reported, with more than 3% of the study population bitten within the year preceding the survey. The incidence of canine rabies in Haiti is high and is exacerbated by low access to veterinary care, free-roaming dog populations and substandard animal welfare practices. Programmes to better understand the dog ecology and development of methods to improve access to vaccines are needed. Rabies deaths are at historical lows in the Western Hemisphere, but Haiti and the remaining canine rabies endemic countries still present a significant challenge to the goal of rabies elimination in the region. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.
Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2006-01-01
Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.
Management of impacted all canines with surgical exposure and alignment by orthodontic treatment
Directory of Open Access Journals (Sweden)
Radha Katiyar
2013-01-01
Full Text Available Canine impaction is a dental problem very often encountered in orthodontic practice. After the third molar, the canine is the most frequently impacted tooth. Bringing the impacted canine into a normal position is important for functional occlusion and the final esthetics of the orthodontic treatment. This article illustrates a peculiar case, in which all four permanent canines maintained their unerupted status at age of 16 years. All four impacted canines were surgically exposed, attachment bonded, traction given with K-9 spring and ideally positioned with fixed orthodontic mechanotherapy.
FLT3 mutations in canine acute lymphocytic leukemia
International Nuclear Information System (INIS)
Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L
2011-01-01
FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias
Vaccine-induced canine distemper in a lesser panda.
Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J
1976-11-01
A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.
Alpha-1-antitrypsin studies: canine serum and canine surfactant protein
International Nuclear Information System (INIS)
Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.
1974-01-01
Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)
Detection of canine distemper virus serum neutralizing antibodies in captive U.S. phocids.
Clancy, Meredith M; Gamble, Kathryn C; Travis, Dominic A
2013-03-01
Antibodies to morbilliviruses have been documented in free-ranging pinnipeds throughout populations in the Atlantic and Arctic Oceans, but not from the Pacific Ocean. As a symbolic geographic barrier between the exposed Atlantic and naive Pacific populations, the captive phocid population in North America had undocumented serologic status. In this study, canine distemper virus (CDV) serum neutralization assays were used to assess the prevalence of antibodies in this population with participation of 25 U.S. institutions from grey seals (Halichoerus grypus, n = 6) and harbor seals (Phoca vitulina, n = 108). Historic and environmental risk factors associated with the epidemiology of distemper virus were collected by survey. Based on antibodies to canine distemper virus, the prevalence of exposure in this population was 25.5%, with 28 seals (grey, n = 2; harbor, n = 26) demonstrating antibody titers > or = 1:16, and positive titers ranged from 1:4 to 1:1,536. By survey analysis, strong associations with seropositive status were identified for captive origin (P = 0.013) and movement among institutions (P = 0.024). Size of population has positive correlation with likelihood of seropositive seals at an institution (P = 0.020). However, no major husbandry or enclosure-based risk factors were identified in institutions with seropositive seals, and no interaction between individual or institutional risk factors was identified. Previously undocumented prior to this study, CDV antibodies were measured in harbor seals (n = 2) recently stranded from the Pacific coast.
Canine hip dysplasia: significance of early bony spurring
International Nuclear Information System (INIS)
Morgan, J.P.
1987-01-01
It is the purpose of this study to call attention to new bone production that often occurs early in the sequence of pathological changes associated with canine hip dysplasia. New bone production extending to bony remodeling, as well as femoral head subluxation, both occur in the sequence of pathologic changes associated with canine hip dysplasia. Subluxation is considered primary, while osteoarthrosis is a secondary feature, and both are used in the diagnosis of canine hip dysplasia. This report concerns the significance of the presence of a solitary bony osteophyte, or spur, that is frequently evident on the caudal aspect of the femoral neck as viewed on the conventional ventrodorsal projection. This report utilizes findings from pelvic radiographs of 605 dogs (five breeds). There was a greater frequency (54%)of this bony change in cases diagnosed radiographically as dysplastic than in cases diagnosed as normal(15%).Thus, it is suggested that this minimal radiographic change can be used as an indicator of early canine hip dysplasia, especially in the absence of subluxation of the femoral head
Radiographic assessment of dental anomalies in patients with ectopic maxillary canines
DEFF Research Database (Denmark)
Sørensen, Helle Budtz; Artmann, Lone; Larsen, Helle Juul
2008-01-01
dental deviations in cases with either palatal or labial ectopic canines. Design. Panoramic and intra-oral radiographs from 50 patients with palatally located (38 females and 12 males) and 19 patients with labially located ectopic canines (11 females and 8 males), aged 10 years, 2 months-18 years, 1...... month, were analysed. Dental deviations registered were crown and root malformations, agenesis, and eruption deviations. Registrations were performed in the maxillary incisor field and in the dentition in general. Results. The study documented that palatally as well as labially located ectopic canines...... can occur in dentitions without other dental deviations. Dental deviations occurred in approximately two-thirds of all cases, more often in females and in cases with palatally located canines. More than half of the females with palatally located canines had deviations in the maxillary incisors...
Wu, Jing; Gao, Xin-Tao; Hou, Shao-Hua; Guo, Xiao-Yu; Yang, Xue-Shong; Yuan, Wei-Feng; Xin, Ting; Zhu, Hong-Fei; Jia, Hong
2015-10-01
Fifty-five samples (15.62%) collected from dogs and cats were identified as canine parvovirus (CPV) infection in Beijing during 2010-2013. The nucleotide identities and aa similarities were 98.2-100% and 97.7-100%, respectively, when compared with the reference isolates. Also, several synonymous and non-synonymous mutations were also recorded for the first time. New CPV-2a was dominant, accounting for 90.90% of the samples. Two of the 16 samples collected from cats were identified as new CPV-2a (12.5%), showing nucleotide identities of 100% with those from dogs. Twelve samples (15.78%) collected from completely immunized dogs were found to be new CPV-2a, which means CPV-2 vaccines may not provide sufficient protection for the epidemic strains.
The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D
Directory of Open Access Journals (Sweden)
Markéta Vaňková
2016-01-01
Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.
Directory of Open Access Journals (Sweden)
Verônica Baldim de Oliveira
2012-12-01
Full Text Available A retrospective study of etiology, antimicrobial susceptibility profile and multiple drug resistance, and major epidemiological aspects were investigated in 616 cases of canine otitis. Staphylococcus ? hemolitic (26.27%, Malassezia pachydermatis (12.35%, and Pseudomonas aeruginosa (8.8% were the most common microorganisms identified. The isolates were susceptible mainly to norfloxacin (89.62%, gentamicin (83.25%, and ofloxacin (80.16%. High occurrence of resistance of isolates was observed to neomicin (30.84% and cephalexin (27.63%. Multiple drug resistance to three or more and five or more of antimicrobials tested was observed in 34.9% and 15.5% of isolates, respectively. The cases of canine otitis occurred predominantly in first years of age, in mixed breeds animals, at autumn season. The presence of itch, bad smell, and secretion in ear conduct were the major signs observed at clinical examination. Estudo retrospectivo da etiologia, perfil de sensibilidade microbiana, ocorrência de multirresistência dos isolados e os principais aspectos epidemiológicos foram investigados em 616 casos de otite canina. Staphylococcus ? hemolítico (26,27%, Malassezia pachydermatis (12,35% e Pseudomonas aeruginosa (8,8% foram os micro-organismos mais frequentes. Os isolados foram sensíveis “in vitro” principalmente a norfloxacina (89,62%, gentamicina (83,25% e ofloxacina (80,16%. Alta ocorrência de resistência das linhagens foi observada frente à neomicina (30,84% e cefalexina (27,63%. A ocorrência de resistência múltipla a três ou mais e cinco ou mais dos antimicrobianos foi observada em, respectivamente, 34,9% e 15,5% dos isolados. Os casos ocorreram predominantemente nos primeiros anos de idade, em animais sem raça definida, no período do outono. A presença de prurido, mau cheiro e secreção no conduto auditivo foram os principais sinais observados ao exame clínico.
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Directory of Open Access Journals (Sweden)
Sumitra
2012-01-01
Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.
Prostate histotripsy for BPH: initial canine results
Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.
2009-02-01
Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.
Difficulties in estimating the human burden of canine rabies.
Taylor, Louise H; Hampson, Katie; Fahrion, Anna; Abela-Ridder, Bernadette; Nel, Louis H
2017-01-01
Current passive surveillance data for canine rabies, particularly for the regions where the burden is highest, are inadequate for appropriate decision making on control efforts. Poor enforcement of existing legislation and poor implementation of international guidance reduce the effectiveness of surveillance systems, but another set of problems relates to the fact that canine rabies is an untreatable condition which affects very poor sectors of society. This results in an unknown, but potentially large proportion of rabies victims dying outside the health system, deaths that are unlikely to be recorded by surveillance systems based on health center records. This article critically evaluates the potential sources of information on the number of human deaths attributable to canine rabies, and how we might improve the estimates required to move towards the goal of global canine rabies elimination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Mariana Caetano Teixeira
2016-12-01
Full Text Available Leishmaniosis are zoonoses that present several clinical manifestations in humans and have dogs as their main reservoir in the urban environment. Visceral leishmaniasis (VL is the most severe form of the parasitosis and has been increasing in Brazil, despite the actions of public health agencies. Until 2002, the State of Rio Grande do Sul (RS was considered free of human and canine leishmaniasis. The first human case of cutaneous leishmaniasis in RS was recorded in 2003. In 2009, the first autochthonous cases of human VL and canine visceral leishmaniasis (CVL were confirmed in São Borja, RS, and the occurrence of the insect vector was recorded for the first time in the state. In 2010, the first confirmed case of CVL was reported and seropositive dogs were identified in the city of Porto Alegre, RS. Given the importance of this zoonosis and the difficulties of a reliable diagnosis in dogs, this study aimed to identify epidemiological aspects of CVL in dogs in an area of Porto Alegre where cases of the disease have been reported. A total of 300 blood samples were collected from dogs in this area, which were then tested by the methods of RT-DPP® and ELISA for diagnosis of Leishmania infantum. An epidemiological questionnaire was completed by dog owners, containing aspects related to care of the animals, characteristics of their environment, and their living conditions. We observed that 83% (250/300 of the studied dogs were of mixed breed, 58% (175/300 were female, 78% (238/300 slept outdoors, and 61% (183/300 shared their living quarters with other species. Clinically, we observed that 90% (270/300 of the animals were infested by ectoparasites, 70% (210/300 had dermatopathies, 24% (72/300 presented weight loss and anorexia, and 22% (65/300 had ocular disorders. The results of the two serological tests were 100% concordant for the three seropositive samples (1%, and the remaining 297 (99% were negative for both tests. We conclude that despite the
Yi, Li; Cheng, Shipeng; Xu, Hongli; Wang, Jianke; Cheng, Yuening; Yang, Shen; Luo, Bin
2012-01-01
A combined reverse-transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of the canine distemper virus (CDV). A pair of primers (P1/P2) was used to detect both CDV wild-type strains and vaccines. Another pair (P3/P4) was used to detect only CDV wild-type strains. A 335bp fragment was amplified from the genomic RNA of the vaccine and wild-type strains. A 555bp fragment was amplified specifically from the genomic RNA of the wild-type strains. No amplification was achieved for the uninfected cells, cells infected with canine parvovirus, canine coronavirus, or canine adenovirus. The combined RT-PCR method detected effectively and differentiated the CDV wild-type and vaccine strains by two separate RT-PCRs. The method can be used for clinical detection and epidemiological surveillance. The phylogenetic analysis of the hemagglutinin gene of the local wild-type CDV strains revealed that the seven local isolates all belonged to the Asia-1 lineage, and were clustered closely with one another at the same location. These results suggested that the CDV genotype Asia-1 is circulating currently in domestic dogs in China. Copyright © 2011 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Maria Alexandra Basso
2016-02-01
Full Text Available Case summary This work describes the diagnosis and successful treatment of a 2-year-old domestic cat infected with Leishmania species and presenting fever, and ulcerative and nodular skin lesions after being treated for pyodermatitis for 1 year without clinical improvement. After anamnesis the cat was submitted to a complete clinical examination. Blood was collected for determination of haematological and biochemical parameters, detection of feline leukaemia virus (FeLV, feline immunodeficiency virus (FIV, feline coronavirus (FCoV and Leishmania amastigotes. Fine-needle aspiration puncture from the skin nodules was also performed. After definitive diagnosis the animal was treated and followed up over a 2 year period. The animal tested negative for FIV-specific antibodies, FeLV antigen and feline coronavirus RNA. Leishmania amastigotes in the skin nodules were confirmed by cytology and molecular diagnosis. Treatment was initiated with allopurinol, resulting in a slight clinical improvement. Thus, N-methyl-glucamine antimoniate was added and administered for 30 days, with complete closure of the ulcerative lesions in the hindlimbs requiring a surgical approach. Close monitoring of the patient in the following 24 months indicated that combined therapy was safe and clinical cure was achieved without further relapses or side effects. Relevance and novel information Considering the increasing number of feline leishmaniosis cases and the inconsistent results of most therapeutic protocols described in the literature, the use of new approaches, especially in refractory cases, is essential. Although the use of allopurinol and N-methyl-glucamine antimoniate is off-label in cats, in this case the combination treatment was followed by an extensive analytical monitoring, supporting their safety and effectiveness.
Energy Technology Data Exchange (ETDEWEB)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-10-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.
Lotspeich, Erica; Kitts, Kelley; Goodpaster, John
2012-07-10
It is a common misconception that the amount of explosive is the chief contributor to the quantity of vapor that is available to trained canines. In fact, this quantity (known as odor availability) depends not only on the amount of explosive material, but also the container volume, explosive vapor pressure and temperature. In order to better understand odor availability, headspace experiments were conducted and the results were compared to theory. The vapor-phase concentrations of three liquid explosives (nitromethane, nitroethane and nitropropane) were predicted using the Ideal Gas Law for containers of various volumes that are in use for canine testing. These predictions were verified through experiments that varied the amount of sample, the container size, and the temperature. These results demonstrated that the amount of sample that is needed to saturate different sized containers is small, predictable and agrees well with theory. In general, and as expected, once the headspace of a container is saturated, any subsequent increase in sample volume will not result in the release of more vapors. The ability of canines to recognize and alert to differing amounts of nitromethane has also been studied. In particular, it was found that the response of trained canines is independent of the amount of nitromethane present, provided it is a sufficient quantity to saturate the container in which it is held. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Attipa, Charalampos; Neofytou, Kyriaki; Yiapanis, Christos; Martínez-Orellana, Pamela; Baneth, Gad; Nachum-Biala, Yaarit; Brooks-Brownlie, Harriet; Solano-Gallego, Laia; Tasker, Séverine
2017-01-01
A 6-year-old female neutered domestic shorthair cat from Cyprus was presented with multiple ulcerated skin nodules. Cytology and histopathology of the lesions revealed granulomatous dermatitis with intracytoplasmic organisms, consistent with amastigotes of Leishmania species. Biochemistry identified a mild hyperproteinaemia. Blood extraction and PCR detected Leishmania species, Hepatozoon species and ' Candidatus Mycoplasma haemominutum' (CMhm) DNA. Subsequent sequencing identified Hepatozoon felis . Additionally, the rRNA internal transcribed spacer 1 locus of Leishmania infantum was partially sequenced and phylogeny showed it to cluster with species derived from dogs in Italy and Uzbekistan, and a human in France. Allopurinol treatment was administered for 6 months. Clinical signs resolved in the second month of treatment with no deterioration 8 months post-treatment cessation. Quantitative PCR and ELISA were used to monitor L infantum blood DNA and antibody levels. The cat had high L infantum DNA levels pretreatment that gradually declined during treatment but increased 8 months post-treatment cessation. Similarly, ELISA revealed high levels of antibodies pretreatment, which gradually declined during treatment and increased slightly 8 months post-treatment cessation. The cat remained PCR positive for CMhm and Hepatozoon species throughout the study. There was no clinical evidence of relapse 24 months post-treatment. To our knowledge, this is the first clinical report of a cat with leishmaniosis with H felis and CMhm coinfections. The high L infantum DNA levels post-treatment cessation might indicate that although the lesions had resolved, prolonged or an alternative treatment could have been considered.
Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar
2009-12-10
Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.
Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough).
Glickman, L T; Appel, M J
1981-08-01
Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.
Current practices and research updates on diabetes mellitus in canine
Directory of Open Access Journals (Sweden)
Pankaj Kumar
2014-11-01
Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.
Eruption of the maxillary canines in relation to skeletal maturity.
Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica
2008-05-01
Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.
Citizen science: a new direction in canine behavior research.
Hecht, Julie; Spicer Rice, Eleanor
2015-01-01
Researchers increasingly rely on members of the public to contribute to scientific projects-from collecting or identifying, to analyzing and disseminating data. The "citizen science" model proves useful to many thematically distinctive fields, like ornithology, astronomy, and phenology. The recent formalization of citizen science projects addresses technical issues related to volunteer participation--like data quality--so that citizen scientists can make longstanding, meaningful contributions to scientific projects. Since the late 1990s, canine science research has relied with greater frequency on the participation of the general public, particularly dog owners. These researchers do not typically consider the methods and technical issues that those conducting citizen science projects embrace and continue to investigate. As more canine science studies rely on public input, an in-depth knowledge of the benefits and challenges of citizen science can help produce relevant, high-quality data while increasing the general public's understanding of canine behavior and cognition as well as the scientific process. We examine the benefits and challenges of current citizen science models in an effort to enhance canine citizen science project preparation, execution, and dissemination. This article is part of a Special Issue entitled: Canine Behavior. Copyright © 2014 Elsevier B.V. All rights reserved.
Antiviral effect of lithium chloride on infection of cells by canine parvovirus.
Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun
2015-11-01
Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.
Dehghani, Mahdieh; Shadkam, Elaheh; Ahrari, Farzaneh; Dehghani, Mahboobe
2018-04-01
Age estimation in adults is an important issue in forensic science. This study aimed to estimate the chronological age of Iranians by means of pulp/tooth area ratio (AR) of canines in digital panoramic radiographs. The sample consisted of panoramic radiographs of 271 male and female subjects aged 16-64 years. The pulp/tooth area ratio (AR) of upper and lower canines was calculated by AutoCAD software. Data were subjected to correlation and regression analysis. There was a significant and inverse correlation between age and pulp/tooth area ratio of upper and lower canines (r=-0.794 for upper canine and r=-0.282 for lower canine; p-value<0.001). Linear regression equations were derived separately for upper, lower and both canines. The mean difference between actual and estimated age using upper canine was 6.07±1.7. The results showed that the pulp/tooth area ratios of canines are a reliable method for age estimation in Iranians. The pulp/tooth area ratio of upper canine was better correlated with chronological age than that of lower canine. Copyright © 2018 Elsevier B.V. All rights reserved.
Ultrasonographic evaluation of the canine shoulder.
Long, C D; Nyland, T G
1999-01-01
The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.
The Comparative Diagnostic Features of Canine and Human Lymphoma
Directory of Open Access Journals (Sweden)
Davis M. Seelig
2016-06-01
Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
The Comparative Diagnostic Features of Canine and Human Lymphoma.
Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A
2016-06-01
The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
Directory of Open Access Journals (Sweden)
Shalini Gupta
2014-01-01
Full Text Available Aim: To investigate whether sexual dimorphism can be established by odontometric study of permanent maxillary canine teeth as well as inter-canine width in north Indian population. Study Design: The study was carried out at department of oral and maxillofacial pathology, King George′s Medical University, Lucknow, India on students and patients reporting at OPD. Out of total 180 subjects examined 90 subjects were female and 90 were male. Impressions of the upper arch were made using alginate and casts poured in dental stone. The mesiodistal diameter (MD of the crown of permanent maxillary canine both on right and left sides and inter-canine width were measured. From these measurements, maxillary canine index was calculated. The percentage of sexual dimorphism (SD was assessed for all the parameters. Results: In the present study, the MD of maxillary canine for both right (P = 0.001 and left side (P = 0.005 was significantly higher among male subjects than females, Similar observation was found for inter-canine width too (P = 0.0001. However, the maxillary canine index for right and left was almost similar (P > 0.05 for both male and female subjects. The SD in right and left MDs of maxillary canine was 4.2% and 3.6% respectively. For, inter-canine width it was maximum (13.7%. However, SD in right and left canine index showed negative values (−2.1% and -0.9% respectively. Conclusion: There was SD in MD and inter-canine width of permanent maxillary canine teeth. SD was more on right permanent maxillary canine teeth than left permanent maxillary canine.
[Nonsurgical endodontic treatment of an invaginated canine].
Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P
1989-01-01
We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.
Canine babesiosis: from molecular taxonomy to control
Directory of Open Access Journals (Sweden)
Irwin Peter J
2009-03-01
Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.
Genetic characterization of canine influenza A virus (H3N2) in Thailand.
Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn
2014-02-01
In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.
Glucosamine and chondroitin use in canines for osteoarthritis: A ...
African Journals Online (AJOL)
Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...
A case of unusual root morphology: Maxillary canine with two roots
Directory of Open Access Journals (Sweden)
Nagesh Bolla
2009-01-01
Full Text Available The case describes a 3 months follow-up of the treatment of a maxillary canine with two roots. Clinical examination revealed a maxillary canine with a large carious lesion and an exaggerated response to cold thermal tests. Radiographic examination revealed a large distal carious lesion that appeared to invade the pulp chamber. The radiograph also revealed what appeared to be an extra root in this permanent maxillary canine.
Kwon, Seung-Joo; Kim, Yoon-Hee; Oh, Hyun-Hee; Choi, Ul-Soo
2017-10-01
This report describes a dog infected with Hepatozoon canis, the first canine infection in the Republic of Korea. A 2-year-old intact male Maltese dog presented with anorexia and depression. Physical examinations revealed mild dehydration and hyperthermia (39.8°C), and blood analysis showed pancytopenia. Diff-Quik staining of blood smear specimens showed the presence of ellipsoidal shaped structures (gamonts of H. canis) within a small number of neutrophils. Real-time PCR analysis using whole blood confirmed infection by H. canis. The clinical condition of the dog improved after symptomatic treatment and administration of doxycycline. Although a molecular epidemiologic survey in Korea showed H. canis infection of dogs, to our knowledge this is the first report of a dog infection in Korea molecularly shown to be H. canis.
Bichaud, Laurence; Souris, Marc; Mary, Charles; Ninove, Laëtitia; Thirion, Laurence; Piarroux, Raphaël P; Piarroux, Renaud; De Lamballerie, Xavier; Charrel, Rémi N
2011-09-01
Sand flies are recognised vectors of parasites in the genus Leishmania and a number of arthropod-borne viruses, in particular viruses within the genus Phlebovirus, family Bunyaviridae. In southern France, Toscana phlebovirus (TOSV) is recognized as a prominent cause of summer meningitis. Since Leishmania and TOSV have a common vector (Phlebotomus perniciosus), an epidemiologic link has been assumed for a long time. However, there is no scientific evidence of such a link between human leishmaniosis and phleboviral infections. To identify a possible link, we investigated the presence and distribution of antibodies against these two microorganisms (i) in individuals and (ii) at a spatial level in the city of Marseille (south-eastern France). Five hundred sera were selected randomly in the biobank of the Department of Parasitology of the Public Hospitals of Marseille. All sera were previously tested for IgG against Leishmania by Western Blotting, and TOSV IgG were detected by indirect immunofluorescence. The seropositivity rates were 21.4% for TOSV and 28% for Leishmania. Statistical analysis demonstrated that seropositivity for one pathogen was significantly associated with seropositivity to the other pathogen. This result provided the first robust evidence for the existence of an epidemiological relationship between Leishmania infantum and TOSV. Addresses of tested patients were geolocalized and integrated into Geographical Information System software, in order to test spatial relationship between the two pathogens. Spatial analysis did not allow to identify (i) specific patterns for the spatial distribution of positive serological results for TOSV or Leishmania, and (ii) a spatial relationship between Leishmania and TOSV positive serological results. This may reflect the fact that the sample studied was not powerful enough to demonstrate either a spatial clustering or co-location, i.e. that the actual risk exposure area is smaller than the mean of distance between
Directory of Open Access Journals (Sweden)
Laurence Bichaud
2011-09-01
Full Text Available Sand flies are recognised vectors of parasites in the genus Leishmania and a number of arthropod-borne viruses, in particular viruses within the genus Phlebovirus, family Bunyaviridae. In southern France, Toscana phlebovirus (TOSV is recognized as a prominent cause of summer meningitis. Since Leishmania and TOSV have a common vector (Phlebotomus perniciosus, an epidemiologic link has been assumed for a long time. However, there is no scientific evidence of such a link between human leishmaniosis and phleboviral infections. To identify a possible link, we investigated the presence and distribution of antibodies against these two microorganisms (i in individuals and (ii at a spatial level in the city of Marseille (south-eastern France. Five hundred sera were selected randomly in the biobank of the Department of Parasitology of the Public Hospitals of Marseille. All sera were previously tested for IgG against Leishmania by Western Blotting, and TOSV IgG were detected by indirect immunofluorescence. The seropositivity rates were 21.4% for TOSV and 28% for Leishmania. Statistical analysis demonstrated that seropositivity for one pathogen was significantly associated with seropositivity to the other pathogen. This result provided the first robust evidence for the existence of an epidemiological relationship between Leishmania infantum and TOSV. Addresses of tested patients were geolocalized and integrated into Geographical Information System software, in order to test spatial relationship between the two pathogens. Spatial analysis did not allow to identify (i specific patterns for the spatial distribution of positive serological results for TOSV or Leishmania, and (ii a spatial relationship between Leishmania and TOSV positive serological results. This may reflect the fact that the sample studied was not powerful enough to demonstrate either a spatial clustering or co-location, i.e. that the actual risk exposure area is smaller than the mean of
Purification and partial characterization of canine S100A12.
Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M
2010-12-01
Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the
Directory of Open Access Journals (Sweden)
Pablo Javier Patiño Grajales
1998-02-01
Full Text Available El papel de las sub poblaciones de células TCD4+, Th1 y Th2, ha sido bien estudiado en la infección por Leishmania major en el modelo murino experimental. Las cepas singénicas de ratones que desarrollan el fenotipo Th1 (células que secretan principalmente IL-2, IFN-y y TNF-!3 son resistentes a la infección por este protozoo. En contraste, las que desarrollan el fenotipo Th2 (células que secretan principalmente IL-4, IL-5, IL-6, IL-10 e IL-13 son susceptibles a ella. Los estudios recientes indican que la IL-4 es una señal esencial en la estimulación primaria y maduración de las células Th2, mientras que IL-12 permite la maduración de las células Th1. Adicionalmente, IL.4 e IFN-y ejercen efectos reguladores opuestos sobre las células Th1 y Th2 respectivamente. Por otra parte, varios estudios han establecido claramente que la subpoblación de linfocitos TCD8+ también contribuye a la resolución de la enfermedad y la resistencia contra la reinfección en leishmaniosis cutánea. En los humanos, aunque la respuesta inmune dirigida contra el parásito es menos polarizada que en el ratón, se ha evidenciado una clara tendencia hacia la producción del fenotipo Th1 en las formas menos severas de la enfermedad. La identificación de subpoblaciones de células T humanas que se correlacionen con susceptibilidad o resistencia a la infección podría ayudar al desarrollo de ensayos in vitro para identificar antígenos de Leishmania que estimulen una respuesta inmune protectora y que puedan evaluarse como candidatos en el desarrollo de una vacuna capaz de controlar la infección. The role of TCD4+ cell subsets, Th1 and Th2, has been studied in the infection by Leishmania major in the murine model. The development of the Th1 phenotype in inbred strains of mice (cells that mainly secrete IL.2, IFN.y and TNF.13 are associated with resistance to L. major infection. In contrast, Th2 phenotype (cells that mainly secrete IL.4, IL.5, IL.6, IL.10 and IL
Guarnieri, R; Cavallini, C; Vernucci, R; Vichi, M; Leonardi, R; Barbato, E
2016-11-01
The prevalence of impacted maxillary canine is reported to be between 1% and 3%. The lack of monitoring and the delay in the treatment of the impacted canine can cause different complications such as: displacement of adjacent teeth, loss of vitality of neighbouring teeth, shortening of the dental arch, follicular cysts, canine ankylosis, recurrent infections, recurrent pain, internal resorption of the canine and the adjacent teeth, external resorption of the canine and the adjacent teeth, combination of these factors. An appropriate diagnosis, accurate predictive analysis and early intervention are likely to prevent such undesirable effects. The objective is to evaluate, by means of a retrospective observational study, the possibility of carrying out a predictive analysis of root resorption adjacent to the impacted canines by means of orthopantomographs, so as to limit the prescription of additional 3D radiography. 120 subjects with unilateral or bilateral maxillary impacted canine were examined and 50 patients with 69 impacted maxillary canine (22 male, 28 female; mean age: 11.7 years) satisfied the inclusion criteria of the study. These patients were subjected to a basic clinical and radiographic investigation (orthopantomographs and computerized tomography). All panoramic films were viewed under standardized conditions for the evaluation of two main variables: maxillary canine angulations (a, b, g angles) and the overlapping between the impacted teeth and the lateral incisor (Analysis of Lindauer). Binary logistic regression was used to estimate the likelihood of resorbed lateral incisors depending on sector location and angle measurements. Results indicated that b angle has the greatest influence on the prediction of root resorption (predictive value of b angle = 76%). If β angle <18° and Lindauer = I, the probability of resorption is 0.06. Evaluation of b angle and superimposition lateral incisor/impacted canine analysed on orthopantomographs could be one of
Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.
von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H
2008-05-01
Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.
Little evidence of seasonal variation of natural infection by Leishmania infantum in dogs in Spain.
Fernández-Bellon, H; Solano-Gallego, L; Rodríguez-Cortés, A; Ferrer, L; Gallego, M; Alberola, J; Ramis, A
2008-08-01
Leishmania infantum, the etiological agent of canine leishmaniosis in the Mediterranean region, is vectored by Phlebotomus spp sandflies, which are active during the warmer months of the year. In order to determine whether seasonality in transmission induces seasonal changes in the prevalence of infection by L. infantum and of parasite-specific immune response, two groups of dogs, one in February (n=37) and another in October (n=42), were studied. Clinical signs compatible with leishmaniosis, as well as presence of microscopic skin lesions in the muzzle were recorded for all dogs. Assays were also performed for detection of L. infantum parasites in muzzle skin samples (PCR, immunohistochemistry and culture), specific serum antibodies (ELISA), and specific lymphocyte proliferation and interferon-gamma production. Although prevalence of non-specific clinical signs increased significantly after the sandfly season, this was not the case for Leishmania-specific markers: positivity by PCR (24% vs. 21%) or immunohistochemistry (3% vs. 2%) of muzzle skin samples, as well as lymphocyte proliferation (59% vs. 50%) or interferon-gamma production (21% vs. 27%) were similar in February and in October. Only prevalence of positive specific antibody titers increased noticeably in October (8% vs. 20%), although this was not statistically significant. Overall, the sandfly season did not have a marked impact on the prevalence L. infantum infection or parasite-specific immune responses analyzed in this study.
Canine and Human Dirofilariosis in the Rostov Region (Southern Russia
Directory of Open Access Journals (Sweden)
Vladimir Kartashev
2011-01-01
Full Text Available Epidemiological data on canine and human dirofilariosis in the Rostov Region (Southern Russia are presented. Prevalence of Dirofilaria spp. infections in 795 autochthonous dogs, assessed by the Knott test, was 20.25%. The highest prevalence was found in Novocherkassk (38.3% and Rostov-on-Don (18.5%, while prevalences were lower in other points of the region. Prevalence of D. repens was 44.7%, prevalence of D. immitis was 30.3%, and coinfections were observed in 25.0% of the dog population. A case finding study carried out during 9 years (2000–2009 revealed 131 cases of human dirofilariosis in the Rostov Region, 129 of subcutaneous dirofilariosis and 2 of pulmonary dirofilariosis. Seroprevalence among 317 healthy blood donors from the Rostov Region was 10.4%, while seroprevalence in policemen living in Rostov city and working in training dogs was 19%. These data show high infection rates of Dirofilaria spp. in both human and dog populations of Rostov, probably because of the existence of favorable conditions for the transmission in this region.
Orthodontic Traction of Impacted Canine Using Cantilever
Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé
2016-01-01
The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...
Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon
2016-02-01
To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Detection of canine pneumovirus in dogs with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe
2013-12-01
Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.
Directory of Open Access Journals (Sweden)
Patil Sandeep S
2012-01-01
Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.
Wilmes, Benedict; Drescher, Dieter
2009-05-01
In the course of a clinical pilot study we tested the vertical periodontal ligament (V-PDL) distraction as a means of aligning ankylosed upper canines. The objective of this study was to analyze the appropriateness und effectiveness of this method. The ankylosed upper canines of five female patients aged between 16 und 19 years were surgically exposed, luxated, and after a latency period of 5 to 7 days, distracted at a rate of 0.5 mm per day. The installed distractors were borne by the periodontal-mucosa, the periodontal-mucosa and the bone, or by the bone exclusively. We evaluated the distraction distance and time and degree of hard and soft tissue generation present in the region surrounding the distracted teeth. All canines were aligned after a mean distraction period of 43.2 days (+/- 3.6 days). The mean distraction distance was 10.8 mm. Three canines had defects at the cemento-enamel junction, and one canine had to be extracted due to a large defect at the root. Vertical PDL distraction is a minimally-invasive therapy to align ankylosed impacted canines. Even if the long-term prognosis of distracted canines with defects is uncertain, the patient benefits from the vertical PDL distraction because both hard and soft tissues are generated in the vicinity of the distracted canine.
Andrade, Ana Rachel Oliveira de; Nunes, Vânia Lúcia Brandão; Galati, Eunice Aparecida Bianchi; de Arruda, Carla Cardozo Pinto; Santos, Mirella Ferreira da Cunha; Rocca, Maria Elizabeth Gizi; Aquino, Ricardo Braga
2009-01-01
The aims of this study were to carry out a serological survey of canine leishmaniasis and identify the phlebotomine fauna in the urban area of Bonito, Mato Grosso do Sul. The serological survey was conducted on a sample of 303 dogs, by means of the indirect immunofluorescence test. Phlebotomines were captured using automated light traps. The serological survey found that 30% of the dogs were seropositive, both from the center and from all districts of the town. A total of 2,772 specimens of phlebotomines were caught and the species most found was Lutzomyia longipalpis (90.4%), which corroborated its role as the vector of for canine visceral leishmaniasis in the region. Phlebotomines of the species Bichromomyia flaviscutellata (the main vector for Leishmania (Leishmania) amazonensis) and Nyssomyia whitmani (the vector for Leishmania (Viannia) brasiliensis) were also caught. The findings indicate the need for continuous epidemiological surveillance, with attention towards diminishing the vector breeding sites and the transmission of these diseases in that region.
Genetics of Human and Canine Dilated Cardiomyopathy
Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...
Orthodontic treatment of a complete transposed impacted maxillary canine
Directory of Open Access Journals (Sweden)
Pi-Huei Liu
2015-03-01
Full Text Available Tooth transposition is a positional interchange of two adjacent teeth. Transposition most often occurs at maxillary canine. Moving transposed teeth to their normal positions is challenging because this requires bodily movement and translation of one tooth to pass another. This procedure may cause damage to the teeth or supporting structures. We report a case of complete transposition of maxillary canine and lateral incisor. Transposed teeth were successfully moved orthodontically to their normal positions. Multiple mechanics were meticulously applied to achieve complete correction of the tooth positions and to minimize root resorption and/or periodontal defects of canine and lateral incisors. Factors concerning treatment planning for transposed teeth are discussed.
Wild canids as sentinels of ecological health: a conservation medicine perspective.
Aguirre, A Alonso
2009-03-26
canine vector-borne diseases or antibodies to these pathogens have been identified in wild canids including visceral leishmaniosis, Lyme disease, heartworm, hepatozoonosis and anaplasmosis to name a few. These reports are relatively recent as they relate to wildlife-domestic animal interactions, globalisation, translocations, habitat fragmentation and climate change. These pathogens and their relationship to wild canids are described herein. Further research needs to be performed to elucidate the role of the 36 extant species of wild canids in the epidemiology of canine vector-borne diseases.
Tooth fractures in canine clinical practice
International Nuclear Information System (INIS)
Capik, I.; Ledecky, V.; Sevcik, A.
2001-01-01
Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients
Canine faecal contamination and parasitic risk in the city of Naples (southern Italy
Directory of Open Access Journals (Sweden)
Veneziano Vincenzo
2006-09-01
Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between
Current state of knowledge: the canine gastrointestinal microbiome.
Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S
2012-06-01
Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.
Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio
2016-08-30
A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.
Comparison of canine retraction using single and Siamese edgewise brackets: An in vivo study
Directory of Open Access Journals (Sweden)
Zeeshan Iqbal Bhat
2013-01-01
Full Text Available Objectives: The purpose of this study was to check the rate of canine retraction with bodily mechanics using two different pre-adjusted edgewise bracket Systems. Materials and Methods: A split mouth study with twenty patients who were randomly selected and allotted to a single operator. Duration of canine retraction, angulation of canine during its retraction, degree of Rotation, anchorage Loss, distance between canine and premolar at different time intervals were then evaluated, pre- (To, 3 months- (T1 and canine tip touches the second premolar- (T2. Descriptive statistics including mean values and standard deviations were calculated. Paired and unpaired t-test was performed to evaluate the differences between the groups. Results: Rotation and angulation of the canines did not show significant difference in both the systems. There was statistically significant difference (P<0.01 in anchorage loss between single wing and Siamese bracket being 2.65 ±1.41 mm and 1.31 ± 0.93 respectively. There was statistically significant intergroup difference (P<0.01 in canine movement i.e distance between canine and premolar was recorded as 4.72mm (15.06 ± 1.69 to 10.34 ± 1.68mm in single wing bracket and 6.25mm in Siamese (15.52 ± 1.41 to 9.27 ± 1.94. Conclusion: In cases where high anchorage is required and the rate of canine retraction is a concern, Siamese brackets pose a definite advantage over Single wing brackets.
Directory of Open Access Journals (Sweden)
Laura Nordio
2017-05-01
Full Text Available FXR1 (Fragile X mental retardation-related protein 1 is a cytoplasmic RNA binding protein, which genetic expression has been related to metastatic potential in human melanoma. The aims of the present study were: the validation of two commercially available clones of polyclonal anti-human FXR1 antibody in dogs; their application to investigate FXR1 expression in a group of canine oral melanomas. Anti-FXR1 antibody was not previously validated in the canine species. Two different commercially available polyclonal anti-FXR1 antibodies (respectively made in goat and in rabbit were used. FXR1 protein in canine serum was identified by western blot after SDS-PAGE, using human serum as control. FXR1 immunohistochemical expression was tested in a series of normal tissues, that are expected to express FXR1, and in 31 cases of oral melanomas. The final immunohistochemical protocol used heat-induced unmasking and overnight incubation. FXR1 protein bands in canine serum were detected by tested antibodies, in a more specific way by the rabbit antibody. FXR1 immunohistochemical staining was positive in all tested organs, with different levels of expression. FXR1 was also expressed in 31/31 tested melanomas, with variable intensity and percentage of positive cells (Figure 1. Equal results were achieved with the two antibodies in 8 cases of melanoma, whereas there were variable differences in 22, and one case stained only with goat antibody. The rabbit antibody gave less background staining. This study validated anti-FXR1 antibodies for use in the canine species. This protein was expressed in various normal tissues, as well as in the tested neoplasms. Significance of different level of expression is undergoing evaluation with further studies.
Models of experimental saccular aneurysms of carotid arteries in canine
International Nuclear Information System (INIS)
Zhang Haixia; Cheng Yingsheng; Li Minghua
2006-01-01
Objective: To study the availability by making experimental saccular aneurysm models of carotid arteries in canine similar to human intracranial aneurysms. Methods: Twenty healthy canines with experimental saccular side-wall aneurysms of carotid arteries were created successfully by surgery. Results: Forty experimental saccular side-wall aneurysms of carotid arteries were created successfully with 36 aneurysms and parent arteries maintaining patency with each other and four spontaneously occluded confirmed by angiography. Model successful rate reached 90%. Conclusions: Experimental saccular side-wall aneurysms of carotid arteries in canines were one of best models created for simulating human intracranial aneurysms. (authors)
Testosterone biotransformation by the isolated perfused canine pancreas
International Nuclear Information System (INIS)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G.
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis
Testosterone biotransformation by the isolated perfused canine pancreas
Energy Technology Data Exchange (ETDEWEB)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.
Influence of feeding on serum canine pancreatic lipase immunoreactivity concentrations
Directory of Open Access Journals (Sweden)
Steiner JM
2014-10-01
Full Text Available Jörg M Steiner, Craig G Ruaux, David A Williams Gastrointestinal Laboratory, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, USA Abstract: Measurement of serum concentration of pancreatic lipase immunoreactivity (PLI has been shown to be highly specific for exocrine pancreatic function and sensitive for the diagnosis of canine pancreatitis. Currently, it is recommended that food be withheld for at least 12 hours before collecting a blood sample for analysis from dogs. However, it is unknown whether feeding has any influence on serum canine PLI concentration. Thus, the goal of this study was to evaluate the influence of feeding on serum canine PLI concentrations in healthy dogs. Food was withheld from eight healthy adult Beagle dogs for at least 17 hours and a baseline serum sample (0 minutes was collected. Dogs were fed and serum samples were collected at 15, 30, 45, 60, 75, 90, 105, 150, 180, 210, 240, 300, 360, 420, and 480 minutes. There was no significant difference in serum canine PLI concentrations at any time after feeding (P=0.131. We conclude that feeding has no significant influence on serum canine PLI concentrations. Keywords: dog, pancreatic function, pancreatitis, biomarker, diagnostic test
Alkaline phosphatase activity in gingival crevicular fluid during canine retraction.
Batra, P; Kharbanda, Op; Duggal, R; Singh, N; Parkash, H
2006-02-01
The aim of the study was to investigate alkaline phosphatase activity in the gingival crevicular fluid (GCF) during orthodontic tooth movement in humans. Postgraduate orthodontic clinic. Ten female patients requiring all first premolar extractions were selected and treated with standard edgewise mechanotherapy. Canine retraction was done using 100 g sentalloy springs. Maxillary canine on one side acted as experimental site while the contralateral canine acted as control. Gingival crevicular fluid was collected from mesial and distal of canines before initiation of canine retraction (baseline), immediately after initiation of retraction, and on 1st, 7th, 14th and 21st day and the alkaline phosphatase activity was estimated. The results show significant (p < 0.05) changes in alkaline phosphatase activity on the 7th, 14th and 21st day on both mesial and distal aspects of the compared experimental and control sides. The peak in enzyme activity occurred on the 14th day of initiation of retraction followed by a significant fall in activity especially on the mesial aspect. The study showed that alkaline phosphatase activity could be successfully estimated in the GCF using calorimetric estimation assay kits. The enzyme activity showed variation according to the amount of tooth movement.
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Sumitra
2012-01-01
A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle's Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth an...
Directory of Open Access Journals (Sweden)
Maria Rita Donalisio
2017-07-01
Full Text Available Leishmaniasis is a rapidly expanding zoonosis that shows increasing urbanization. Concern exists regarding the role of wildlife in visceral leishmaniasis (VL transmission, due to frequent natural or anthropogenic environmental changes that facilitate contact between wildlife, humans and their pets. The municipality of Campinas, in southeastern Brazil, initially recorded VL in 2009, when the first autochthonous case was confirmed in a dog living in an upscale residential condominium, located inside an environmentally protected area (EPA. Since then, disease transmission remains restricted to dogs inhabiting two geographically contiguous condominiums within the EPA.We conducted a cross-sectional study of the VL focus to investigate Leishmania spp. infection in domestic dogs, wild mammals and sand flies using molecular tools and recommended serological techniques. Canine seroprevalences of 1.5% and 1.2% were observed in 2013 and 2015, respectively. Six insect species, confirmed or suspected vectors or potential transmitters of Leishmania, were identified. Two specimens of the main L. (L. infantum vector in Brazil, Lutzomyia longipalpis, were captured in the EPA. Natural infection by L. (L. infantum was recorded in one Expapillata firmatoi specimen and two Pintomyia monticola. Natural infection by L. (L. infantum and Leishmania subgenus Viannia was also detected in two white-eared opossums (Didelphis albiventris, a known reservoir of VL. Geographical coordinates of each sampling of infected animals were plotted on a map of the EPA, demonstrating proximity between these animals, human residences, including the dogs positive for VL, and forest areas.The EPA, which is inhabited by humans, has an active VL focus. The risk of establishing and maintaining disease transmission foci in similar scenarios, i.e. wild areas that undergo environmental modifications, is evident. Moreover, different epidemiological profiles of VL must be included to elaborate
Donalisio, Maria Rita; Paiz, Laís Moraes; da Silva, Vanessa Gusmon; Richini-Pereira, Virgínia Bodelão; von Zuben, Andrea Paula Bruno; Castagna, Claudio Luiz; Motoie, Gabriela; Hiramoto, Roberto Mitsuyoshi; Tolezano, José Eduardo
2017-07-01
Leishmaniasis is a rapidly expanding zoonosis that shows increasing urbanization. Concern exists regarding the role of wildlife in visceral leishmaniasis (VL) transmission, due to frequent natural or anthropogenic environmental changes that facilitate contact between wildlife, humans and their pets. The municipality of Campinas, in southeastern Brazil, initially recorded VL in 2009, when the first autochthonous case was confirmed in a dog living in an upscale residential condominium, located inside an environmentally protected area (EPA). Since then, disease transmission remains restricted to dogs inhabiting two geographically contiguous condominiums within the EPA. We conducted a cross-sectional study of the VL focus to investigate Leishmania spp. infection in domestic dogs, wild mammals and sand flies using molecular tools and recommended serological techniques. Canine seroprevalences of 1.5% and 1.2% were observed in 2013 and 2015, respectively. Six insect species, confirmed or suspected vectors or potential transmitters of Leishmania, were identified. Two specimens of the main L. (L.) infantum vector in Brazil, Lutzomyia longipalpis, were captured in the EPA. Natural infection by L. (L.) infantum was recorded in one Expapillata firmatoi specimen and two Pintomyia monticola. Natural infection by L. (L.) infantum and Leishmania subgenus Viannia was also detected in two white-eared opossums (Didelphis albiventris), a known reservoir of VL. Geographical coordinates of each sampling of infected animals were plotted on a map of the EPA, demonstrating proximity between these animals, human residences, including the dogs positive for VL, and forest areas. The EPA, which is inhabited by humans, has an active VL focus. The risk of establishing and maintaining disease transmission foci in similar scenarios, i.e. wild areas that undergo environmental modifications, is evident. Moreover, different epidemiological profiles of VL must be included to elaborate prevention and
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted form was immunogenic in 20 of 20 vaccinated dogs. The double adjuvanted vaccine is selected as the one of choice on the basis of best and most persistent seriological response. PMID:7039811
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Lopez, Cecilia M; Yu, Peter Y; Zhang, Xiaoli; Yilmaz, Ayse Selen; London, Cheryl A; Fenger, Joelle M
2018-01-01
Osteosarcoma (OSA) is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease. RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes. These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Directory of Open Access Journals (Sweden)
Cecilia M Lopez
Full Text Available Osteosarcoma (OSA is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease.RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes.These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
Homologous radioimmunoassay for canine prolactin and its application in various physiological states
International Nuclear Information System (INIS)
Graef, K.-J.; Friedreich, E.; Matthes, S.; Hasan, S.H.
1977-01-01
The purification of canine prolactin and the development of an homologous radioimmunoassay including several physiological studies in the Beagle dog are described. The assay measured immunoreactive canine prolactin with a sensitivity limit of 0.6 ng/ml. Purified canine luteinizing hormone gave no significant inhibition in the assay whereas purified canine growth hormone inhibited the binding of 125 I-labelled canine prolactin to antiserum only at very high dose levels. In Beagle dogs, basal serum prolactin concentrations were in the range 1 to 2 ng/ml in normal male, normal female (metoestrus and anoestrus) and oophorectomized-hysterectomized female dogs. The prolactin concentration in one sample of amniotic fluid was in the same range, while in hypophysectomized make dogs no serum prolactin could be detected by the assay system. Serum prolactin concentrations tended to increase during late pregnancy and parturition, remaining high during the first 9 days of lactation. In consequence, a negative correlation was suggested between serum prolactin and serum progesterone concentrations. (author)
Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus
Directory of Open Access Journals (Sweden)
Lourdes M. B. Pessoa
2016-01-01
Full Text Available The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.
Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus)
Pessoa, Lourdes M. B.; Roza, Marcello; Farias, Anderson; Jesus, Pedro Henrique de; Campbell, Rita de Cassia; Pinho, Mariângela Pereira de
2016-01-01
The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.
PMab-38 Recognizes Canine Podoplanin of Squamous Cell Carcinomas.
Kaneko, Mika K; Honma, Ryusuke; Ogasawara, Satoshi; Fujii, Yuki; Nakamura, Takuro; Saidoh, Noriko; Takagi, Michiaki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-10-01
Podoplanin, a type I transmembrane protein, is expressed in lymphatic endothelial cells. Although we previously developed an anticanine podoplanin monoclonal antibody (mAb), PMab-38, immunohistochemistry (IHC) showed that it did not react with canine lymphatic endothelial cells. Here, we determined whether PMab-38 recognizes canine podoplanin of squamous cell carcinomas (SCCs) and clarified its epitope. In IHC, PMab-38 reacted with 83% of SCCs (15/18 cases). Flow cytometry showed that the epitope of PMab-38 was different from that of the platelet aggregation-stimulating domain of the N-terminus, which was detected by almost all antipodoplanin mAbs such as D2-40 or NZ-1. PMab-38 is expected to be useful for investigating the function of podoplanin in canine tumors.
Severe canine distemper outbreak in unvaccinated dogs in Mozambique.
Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G
2016-07-15
Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.
DEFF Research Database (Denmark)
Heske, Linda; Berendt, Mette; Jäderlund, Karin Hultin
2014-01-01
Canine epilepsy is one of the most common neurological conditions in dogs but the actual incidence of the disease remains unknown. A Swedish animal insurance database has previously been shown useful for the study of disease occurrence in companion animals. The dogs insured by this company...... represent a unique population for epidemiological studies, because they are representative of the general dog population in Sweden and are followed throughout their life allowing studies of disease incidence to be performed. The database covers 50% of all insured dogs (in the year 2012) which represents 40......% of the national dog population. Most commonly, dogs are covered by both veterinary care insurance and life insurance. Previous studies have shown that the general data quality is good, but the validity of a specific diagnosis should be examined carefully before using the database for incidence calculations...
[Biological characteristics of a chimeric rabies virus expressing canine parvovirus VP2 protein].
Niu, Xue-Feng; Liu, Xiao-Hui; Sun, Zhao-Jin; Shi, He-He; Chen, Jing; Jiang, Bido; Sun, Jing-Chen; Guo, Xiao-Feng
2009-09-01
To obtain a bivalence vaccine against canine rabies virus and canine parvovirus, a chimeric rabies virus expressing canine parvovirus VP2 protein was generated by the technique of reverse genetics. It was shown that the chimeric virus designated as HEP-Flury (VP2) grew well on BHK-21 cells and the VP2 gene could still be stably expressed after ten passages on BHK-21 cells. Experiments on the mice immunized with the chimeric virus HEP-Flury (VP2) demonstrated that specific antibodies against rabies virus and canine parvovirus were induced in immunized mice after vaccination with the live chimeric virus.
Cellular endocytic compartment localization of expressed canine CD1 molecules
DEFF Research Database (Denmark)
Schjærff, Mette; Keller, Stefan M.; Affolter, Verena K.
2016-01-01
CD1 molecules are glycoproteins present primarily on dendritic cells (DCs), which recognize and presenta variety of foreign- and self-lipid antigens to T-cells. Humans have five different CD1 isoforms that sur-vey distinct cellular compartments allowing for recognition of a large repertoire...... onlya diminished GFP expression. In conclusion, canine CD1 transfectants show distinct localization patternsthat are similar to human CD1 proteins with the exception of the canine CD1d isoform, which most likelyis non-functional. These findings imply that canine CD1 localization overall resembles human...... CD1 traf-ficking patterns. This knowledge is important for the understanding of lipid antigen-receptor immunityin the dog....
Canine Gouging: A Taboo Resurfacing in Migrant Urban Population.
Noman, Anila Virani; Wong, Ferranti; Pawar, Ravikiran Ramakrishna
2015-01-01
Cosmopolitan cities have become a pool of migrants from different parts of the world, who carry their cultural beliefs and superstitions with them around the globe. Canine gouging is a kind of infant oral mutilation (IOM) which is widely practiced among rural population of Africa where the primary tooth bud of the deciduous canine is enucleated. The belief is that the life threatening illnesses in children like vomiting, diarrhoea, and fevers are caused by worms which infest on tooth buds. This case report is of a 15-year-old Somalian born boy, who presented at the dental institute with intermittent pain in his lower right permanent canine which was associated with a discharging intra oral buccal sinus. The tooth was endodontically treated and then restored with composite. General dental practitioners need to be vigilant when encountered with tooth presenting unusual morphology, unilateral missing tooth, and shift in the midline due to early loss of deciduous/permanent canines. Identification of any such dental mutilation practice will need further counselling of the individual and family members. It is the duty of every dental professional to educate and safeguard the oral and dental health of general public.
Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines
Directory of Open Access Journals (Sweden)
Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman
2011-01-01
Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.
Orthodontic management of bilaterally impacted mandibular canines in a growing patient
Directory of Open Access Journals (Sweden)
Rajaganesh J Gautam
2016-01-01
Full Text Available KK, an 11.9-year-old male patient, presented with the chief complaint of forwardly placed upper front teeth. Diagnosis revealed a Class II subdivision right malocclusion on an underlying Class I skeletal base with a horizontal growth pattern, bimaxillary proclination, crowding in the lower arch, over retained deciduous canines in the upper right and lower quadrants, an unerupted maxillary right permanent canine, and bilaterally impacted mandibular permanent canines, an increased overjet, and a deep overbite. He had a mild convex profile, a toothy smile with a nonconsonant smile arc and mildly protrusive lips. Treatment with a nonextraction treatment plan, which included surgical uncovering and orthodontic eruptive guidance of the impacted mandibular canines, with multibracket metallic fixed appliances, solved the patient′s complaints and achieved an esthetically pleasing and functionally adequate occlusal result.
França, Raqueli T; Da Silva, Aleksandro S; Loretti, Alexandre P; Mazzanti, Cinthia M; Lopes, Sonia T A
2014-09-01
Canine rangeliosis (popular names: "nambi-uvú", i.e. ``bleeding ears''; "peste de sangue", i.e. ``bleeding plague''; and "febre amarela dos cães", i.e. ``yellow fever of dogs'') is a tick-borne haemolytic and haemorrhagic disease caused by the protozoan parasite Rangelia vitalii which infects erythrocytes, leukocytes, and endothelial cells of blood capillaries. Rangelia vitalii was first reported as a novel piroplasm of dogs in 1910 in Brazil, a discovery that was met with skepticism at that time. Canine rangeliosis has been diagnosed in domestic dogs not only in Brazil but also in other South American countries (Argentina and Uruguay). Rangelia vitalii infection has also been found incidentally in Brazil in wild dogs (Cerdocyon thous, the crab-eating fox). Despite the fact that researchers in the early 1900s suggested that R. vitalii was a hitherto unidentified piroplasm that would be transmitted by the tick Amblyomma aureolatum, it was not until 2012 that these hypotheses were actually confirmed by PCR and transmission studies. Molecular studies have shown that R. vitalii is related to the Babesia sensu strictu clade, but genetically different from other morphologically similar species of Babesia that infect dogs. Another difference between Babesia spp. and R. vitalii is the ability of R. vitalii to invade endothelial cells, erythrocytes, and leukocytes. Experimental infection in dogs has successfully reproduced the clinical picture and pathology of the natural disease. In this article, epidemiology, clinical signs, laboratory findings, pathogenetic mechanisms including oxidative stress and immune response, necropsy findings, microscopic lesions, diagnosis, and treatment of canine rangeliosis are reviewed. What is currently known about this protozoal disease since its first report over a century ago is presented herein. Copyright © 2014 Elsevier GmbH. All rights reserved.
Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.
McMaster, G K; Tratschin, J D; Siegl, G
1981-01-01
The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.
Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus
Directory of Open Access Journals (Sweden)
Sudarisman
2006-03-01
Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.
Comparative photoelastic study of dental and skeletal anchorages in the canine retraction
Directory of Open Access Journals (Sweden)
Cristiane Aparecida de Assis Claro
2014-01-01
Full Text Available OBJECTIVE: To compare dental and skeletal anchorages in mandibular canine retraction by means of a stress distribution analysis. METHODS: A photoelastic model was produced from second molar to canine, without the first premolar, and mandibular canine retraction was simulated by a rubber band tied to two types of anchorage: dental anchorage, in the first molar attached to adjacent teeth, and skeletal anchorage with a hook simulating the mini-implant. The forces were applied 10 times and observed in a circular polariscope. The stresses located in the mandibular canine were recorded in 7 regions. The Mann-Whitney test was employed to compare the stress in each region and between both anchorage systems. The stresses in the mandibular canine periradicular regions were compared by the Kruskal-Wallis test. RESULTS: Stresses were similar in the cervical region and the middle third. In the apical third, the stresses associated with skeletal anchorage were higher than the stresses associated with dental anchorage. The results of the Kruskal-Wallis test showed that the highest stresses were identified in the cervical-distal, apical-distal, and apex regions with the use of dental anchorage, and in the apical-distal, apical-mesial, cervical-distal, and apex regions with the use of skeletal anchorage. CONCLUSIONS: The use of skeletal anchorage in canine retraction caused greater stress in the apical third than the use of dental anchorage, which indicates an intrusive component resulting from the direction of the force due to the position of the mini-implant and the bracket hook of the canine.
Sajnani, Anand K
2015-02-01
The position of the permanent maxillary canine at the angle of the mouth is strategically significant in maintaining the harmony and symmetry of the occlusal relationship. However, the maxillary canine is the second most frequently impacted tooth, with prevalence reported to be between 1% and 2%. Moreover, treatment of this condition is often complex and involves substantial time and financial cost. Hence, it is only prudent to monitor the eruption and identify the etiological factors that lead to impaction of the maxillary canine. Numerous researchers have tried to identify specific and nonspecific etiological factors responsible for displacement of canines. The purpose of this review was to track the development processes of maxillary canines and determine the hindrances that affect the eruption at different ages. Awareness of the eruption process and etiology of noneruption will help to reduce the incidence of impacted canines by allowing for early recognition and interceptive treatment. © 2013 Wiley Publishing Asia Pty Ltd.
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Mann, Elizabeth; Whittington, Lisa
2014-01-01
Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4) was significantly higher (p < 0.05) than that in the control (0.83 ± 0.3) and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009). Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended. PMID:26770752
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Directory of Open Access Journals (Sweden)
Moges Woldemeskel
2014-11-01
Full Text Available Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4 was significantly higher (p < 0.05 than that in the control (0.83 ± 0.3 and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009. Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended.
How far is the root apex of a unilateral impacted canine from the root apices' arch form?
Kim, Sung-Hun; Kim, You-Min; Oh, Sewoong; Kim, Seong-Sik; Park, Soo-Byung; Son, Woo-Sung; Kim, Yong-Il
2017-02-01
The purpose of this study was to determine the arch form of the root apices of normally erupting teeth and then determine the differences in the location of the apex of impacted canines relative to normally erupting canines. In addition, we sought to determine whether the labiopalatal position of the impacted canines influences the position of the apices. The study included 21 patients with unerupted canines that subsequently had a normal eruption, 21 patients with palatally impacted canines, 27 patients with labially impacted canines, and 17 patients with midalveolus impacted canines. Images were obtained using cone beam computed tomography, and the x, y, and z coordinates of the root apices were determined using Ondemand3D software (Cybermed Co., Seoul, Korea). Two-dimensional coordinates were converted from acquired 3-dimensional coordinates via projection on a palatal plane, and the Procrustes method was used to process the converted 2-dimensional coordinates and to draw the arch forms of the root apices. Finally, we measured the extent of root apex deviation from the arch forms of the root apices. Normally erupting canines showed that even though calcifications may be immature, their positions were aligned with a normal arch form. The root apices of the impacted canines were an average of 6.572 mm away from the root apices' arch form, whereas those of the contralateral nonimpacted canines were an average distance of 2.221 mm away, a statistically significant difference. The palatally impacted canines' root apices distribution tended toward the first premolar root apices. Incompletely calcified, unerupted teeth with a subsequent normal eruption showed a normal arch form of the root apices. The root apices of impacted canines were farther from the arch forms than were the nonimpacted canines. Also, the root apices of impacted canines in the palatal area showed distributions different from those of the other impacted canine groups. Copyright © 2017 American
The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.
Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki
2015-04-17
Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
Automated tru-cut imaging-guided core needle biopsy of canine ...
African Journals Online (AJOL)
The purpose of this study was to evaluate the diagnostic value of imaging-guided core needle biopsy for canine orbital mass diagnosis. A second excisional biopsy obtained during surgery or necropsy was used as the reference standard. A prospective feasibility study was conducted in 23 canine orbital masses at a single ...
Wu, Lisa Y; Johnson, Jacqueline M; Simmons, Jessica K; Mendes, Desiree E; Geruntho, Jonathan J; Liu, Tiancheng; Dirksen, Wessel P; Rosol, Thomas J; Davis, William C; Berkman, Clifford E
2014-05-01
Prostate-specific membrane antigen (PSMA) remains an important target for diagnostic and therapeutic application for human prostate cancer. Model cell lines have been recently developed to study canine prostate cancer but their PSMA expression and enzymatic activity have not been elucidated. The present study was focused on determining PSMA expression in these model canine cell lines and the use of fluorescent small-molecule enzyme inhibitors to detect canine PSMA expression by flow cytometry. Western blot and RT-PCR were used to determine the transcriptional and translational expression of PSMA on the canine cell lines Leo and Ace-1. An endpoint HPLC-based assay was used to monitor the enzymatic activity of canine PSMA and the potency of enzyme inhibitors. Flow cytometry was used to detect the PSMA expressed on Leo and Ace-1 cells using a fluorescently tagged PSMA enzyme inhibitor. Canine PSMA expression on the Leo cell line was confirmed by Western blot and RT-PCR, the enzyme activity, and flow cytometry. Kinetic parameters Km and Vmax of PSMA enzymatic activity for the synthetic substrate (PABGγG) were determined to be 393 nM and 220 pmol min(-1) mg protein(-1) , respectively. The inhibitor core 1 and fluorescent inhibitor 2 were found to be potent reversible inhibitors (IC50 = 13.2 and 1.6 nM, respectively) of PSMA expressed on the Leo cell line. Fluorescent labeling of Leo cells demonstrated that the fluorescent PSMA inhibitor 2 can be used for the detection of PSMA-positive canine prostate tumor cells. Expression of PSMA on Ace-1 was low and not detectable by flow cytometry. The results described herein have demonstrated that PSMA is expressed on canine prostate tumor cells and exhibits similar enzymatic characteristics as human PSMA. The findings show that the small molecule enzyme inhibitors currently being studied for use in diagnosis and therapy of human prostate cancer can also be extended to include canine prostate cancer. Importantly
Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors
International Nuclear Information System (INIS)
Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma
2006-01-01
Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs
Feline and canine coronaviruses: common genetic and pathobiological features.
Le Poder, Sophie
2011-01-01
A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP) and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV) will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Directory of Open Access Journals (Sweden)
Otávio Valério Carvalho
2012-01-01
Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo
2012-01-01
Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403
Compensatory canine angulation in angle Class II and III patients
Directory of Open Access Journals (Sweden)
Mauro Carlos Agner Busato
2009-09-01
Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.
European surveillance of emerging pathogens associated with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Leach, Heather; Walker, Caray A; Le Poder, Sophie; Decaro, Nicola; Rusvai, Miklos; Egberink, Herman; Rottier, Peter; Fernandez, Mireia; Fragkiadaki, Eirini; Shields, Shelly; Brownlie, Joe
2017-12-01
Canine infectious respiratory disease (CIRD) is a major cause of morbidity in dogs worldwide, and is associated with a number of new and emerging pathogens. In a large multi-centre European study the prevalences of four key emerging CIRD pathogens; canine respiratory coronavirus (CRCoV), canine pneumovirus (CnPnV), influenza A, and Mycoplasma cynos (M. cynos); were estimated, and risk factors for exposure, infection and clinical disease were investigated. CIRD affected 66% (381/572) of the dogs studied, including both pet and kennelled dogs. Disease occurrence and severity were significantly reduced in dogs vaccinated against classic CIRD agents, canine distemper virus (CDV), canine adenovirus 2 (CAV-2) and canine parainfluenza virus (CPIV), but substantial proportions (65.7%; 201/306) of vaccinated dogs remained affected. CRCoV and CnPnV were highly prevalent across the different dog populations, with overall seropositivity and detection rates of 47% and 7.7% for CRCoV, and 41.7% and 23.4% for CnPnV, respectively, and their presence was associated with increased occurrence and severity of clinical disease. Antibodies to CRCoV had a protective effect against CRCoV infection and more severe clinical signs of CIRD but antibodies to CnPnV did not. Involvement of M. cynos and influenza A in CIRD was less apparent. Despite 45% of dogs being seropositive for M. cynos, only 0.9% were PCR positive for M. cynos. Only 2.7% of dogs were seropositive for Influenza A, and none were positive by PCR. Copyright © 2017 Elsevier B.V. All rights reserved.
Gossellin, J; Wren, J A; Sunderland, S J
2007-08-01
Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.
Peracute Infectious Canine Hepatitis
Directory of Open Access Journals (Sweden)
A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam
2012-05-01
Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.
Radioresistant canine hematopoietic cells
International Nuclear Information System (INIS)
Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.
1987-01-01
Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells
Serological and molecular survey of Leishmania infection in dogs from Luanda, Angola.
Vilhena, Hugo; Granada, Sara; Oliveira, Ana Cristina; Schallig, Henk D F H; Nachum-Biala, Yaarit; Cardoso, Luís; Baneth, Gad
2014-03-24
Canine leishmaniosis (CanL) due to Leishmania infantum is a global zoonosis endemic in more than 70 countries in Europe, North Africa, Asia and America; however, data on this infection is scarce from southern Africa. The aim of this study was to survey dogs in Luanda, Angola, for Leishmania infection. One hundred-and-three dogs presented to a veterinary medical centre in Luanda were serologically and molecularly assessed for Leishmania with the direct agglutination test (DAT) and polymerase chain reaction (PCR). Two dogs were seropositive, with DAT titres of 800 and ≥6400; the latter was also found to be PCR-positive and confirmed to be infected with L. infantum by DNA sequence analysis. No other dog was found to be PCR-positive. The first dog had been imported from Portugal, but the latter had never left Angola (neither had its parents), strongly suggesting an autochthonous infection. Although other cases of CanL have previously been described in the country, this is the first reported study of canine Leishmania infection at the population level, as well as the first report on the molecular characterization of L. infantum in dogs from Angola.
GENETIC CHARACTERIZATION OF CANINE PARVOVIRUS IN SYMPATRIC FREE-RANGING WILD CARNIVORES IN PORTUGAL.
Miranda, Carla; Santos, Nuno; Parrish, Colin; Thompson, Gertrude
2017-10-01
Since its emergence in the 1970s, canine parvovirus (CPV) has been reported in domestic and nondomestic carnivores worldwide with severe implications on their health and survival. Here, we aim to better understand CPV circulation in multihost-pathogens systems by characterizing CPV DNA or viruses in 227 free-ranging wild carnivores of 12 species from Portugal. Collected samples during 1995-2011 were analyzed by PCR and sequence analysis. The canine parvovirus DNA was detected in 4 (2%) animals of two species, namely in wolves (Canis lupus; 3/63, 5%, 95% confidence interval=1.6-3.15) and in a stone marten (Martes foina; 1/36, 3%, 95% confidence interval=0.5-14.2). Viruses in two wolves had VP2 residue 426 as aspartic acid (so-called CPV-2b) and the third had VP2 residue 426 as asparagine (CPV-2a), while the virus in the stone marten uniquely had VP2 residue 426 as glutamic acid (CPV-2c). The comparative analysis of the full-length VP2 gene of our isolates showed other nonsynonymous mutations. The phylogenetic analysis demonstrated that the sequences from wolves clustered together, showing a close relationship with European domestic dogs (Canis lupus familiaris) and wolf strains while the viral sequence from the stone marten grouped with other viruses contained the glutamic acid VP2 426 along with raccoon (Procyon lotor), bobcat (Lynx rufus), and domestic dog strains. This study confirmed that wild carnivores in Portugal are infected by CPV variants, strongly suggesting viral transmission between the wild and domestic populations and suggesting a need for a better understanding of the epidemiology of the disease and its management in wild populations.
Surgical innovations in canine gonadectomy
Van Goethem, Bart
2016-01-01
In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated
Attipa, Charalampos; Neofytou, Kyriaki; Yiapanis, Christos; Martínez-Orellana, Pamela; Baneth, Gad; Nachum-Biala, Yaarit; Brooks-Brownlie, Harriet; Solano-Gallego, Laia; Tasker, Séverine
2017-01-01
Case summary A 6-year-old female neutered domestic shorthair cat from Cyprus was presented with multiple ulcerated skin nodules. Cytology and histopathology of the lesions revealed granulomatous dermatitis with intracytoplasmic organisms, consistent with amastigotes of Leishmania species. Biochemistry identified a mild hyperproteinaemia. Blood extraction and PCR detected Leishmania species, Hepatozoon species and ‘Candidatus Mycoplasma haemominutum’ (CMhm) DNA. Subsequent sequencing identified Hepatozoon felis. Additionally, the rRNA internal transcribed spacer 1 locus of Leishmania infantum was partially sequenced and phylogeny showed it to cluster with species derived from dogs in Italy and Uzbekistan, and a human in France. Allopurinol treatment was administered for 6 months. Clinical signs resolved in the second month of treatment with no deterioration 8 months post-treatment cessation. Quantitative PCR and ELISA were used to monitor L infantum blood DNA and antibody levels. The cat had high L infantum DNA levels pretreatment that gradually declined during treatment but increased 8 months post-treatment cessation. Similarly, ELISA revealed high levels of antibodies pretreatment, which gradually declined during treatment and increased slightly 8 months post-treatment cessation. The cat remained PCR positive for CMhm and Hepatozoon species throughout the study. There was no clinical evidence of relapse 24 months post-treatment. Relevance and novel information To our knowledge, this is the first clinical report of a cat with leishmaniosis with H felis and CMhm coinfections. The high L infantum DNA levels post-treatment cessation might indicate that although the lesions had resolved, prolonged or an alternative treatment could have been considered. PMID:29163980
Stahl, Franka; Grabowski, Rosemarie
2003-05-01
The relationship between maxillary canine displacement and the simultaneous occurrence of "genetically determined predisposition to disturbed development of the dentition" as defined by Hoffmeister was investigated in 675 patients. Panoramic radiographs taken of each patient during the first and the second mixed dentition periods were evaluated. Canine inclination and the distance between the tip of the canine and a line connecting the cusps of the molars were computed in five different age groups according to Dausch-Neumann. Statistical analysis revealed 34 patients with "potential canine displacement", who exhibited further symptoms of "genetically determined predisposition to disturbed development of the dentition" significantly more frequently than the total group. The symptoms concerned were agenesia, displaced tooth buds, rotated or tilted incisors, aplasia and microdontia of lateral incisors. Careful follow-ups in patients with a predisposition to disturbed dental development enables risks to be anticipated and canine displacement to be detected at an early stage.
Expression of nociceptive ligands in canine osteosarcoma.
Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M
2015-01-01
Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.
Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features
Directory of Open Access Journals (Sweden)
Sophie Le Poder
2011-01-01
Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
THE REDUCED CANINE PANCREAS TO STUDY THE EFFECTS OF INTRAOPERATIVE RADIOTHERAPY
HEIJMANS, HJ; MEHTA, D; KLEIBEUKER, JH; SLUITER, WJ; HOEKSTRA, HJ
1993-01-01
A canine model is described to study the tolerance of the pancreas to intra-operative radiotherapy (IORT). The canine pancreas is a horseshoe-shaped organ. To create a homogeneous delivery of IORT to the whole pancreas surgical manipulation is necessary which may induce pancreatitis. A resection of
Laparoscopic radical prostatectomy in the canine model.
Price, D T; Chari, R S; Neighbors, J D; Eubanks, S; Schuessler, W W; Preminger, G M
1996-12-01
The purpose of this study was to determine the feasibility of performing laparoscopic radical prostatectomy in a canine model. Laparoscopic radical prostatectomy was performed on six adult male canines. A new endoscopic needle driver was used to construct a secure vesicourethral anastomosis. Average operative time required to complete the procedure was 304 min (range 270-345 min). Dissection of the prostate gland took an average of 67 min (range 35-90 min), and construction of the vesicourethral anastomosis took 154 min (rage 80-240 min). There were no intraoperative complications and only one postoperative complication (anastomotic leak). Five of the six animals recovered uneventfully from the procedure, and their foley catheters were removed 10-14 days postoperatively after a retrograde cystourethrogram demonstrated an intact vesicourethral anastomosis. Four (80%) of the surviving animals were clinically continent within 10 days after catheter removal. Post mortem examination confirmed that the vesicourethral anastomosis was intact with no evidence of urine extravasation. These data demonstrate the feasibility of laparoscopic radical prostatectomy in a canine model, and suggest that additional work with this technique should be continued to develop its potential clinical application.
Angstadt, Andrea Y; Motsinger-Reif, Alison; Thomas, Rachael; Kisseberth, William C; Guillermo Couto, C; Duval, Dawn L; Nielsen, Dahlia M; Modiano, Jaime F; Breen, Matthew
2011-11-01
Osteosarcoma (OS) is the most commonly diagnosed malignant bone tumor in humans and dogs, characterized in both species by extremely complex karyotypes exhibiting high frequencies of genomic imbalance. Evaluation of genomic signatures in human OS using array comparative genomic hybridization (aCGH) has assisted in uncovering genetic mechanisms that result in disease phenotype. Previous low-resolution (10-20 Mb) aCGH analysis of canine OS identified a wide range of recurrent DNA copy number aberrations, indicating extensive genomic instability. In this study, we profiled 123 canine OS tumors by 1 Mb-resolution aCGH to generate a dataset for direct comparison with current data for human OS, concluding that several high frequency aberrations in canine and human OS are orthologous. To ensure complete coverage of gene annotation, we identified the human refseq genes that map to these orthologous aberrant dog regions and found several candidate genes warranting evaluation for OS involvement. Specifically, subsequenct FISH and qRT-PCR analysis of RUNX2, TUSC3, and PTEN indicated that expression levels correlated with genomic copy number status, showcasing RUNX2 as an OS associated gene and TUSC3 as a possible tumor suppressor candidate. Together these data demonstrate the ability of genomic comparative oncology to identify genetic abberations which may be important for OS progression. Large scale screening of genomic imbalance in canine OS further validates the use of the dog as a suitable model for human cancers, supporting the idea that dysregulation discovered in canine cancers will provide an avenue for complementary study in human counterparts. Copyright © 2011 Wiley-Liss, Inc.
Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.
Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J
2014-03-01
Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (Posteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.
Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.
Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L
2016-02-19
Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.
Functional Characterization of Canine Interferon-Lambda
Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun
2014-01-01
In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142
[Eco-epidemiology: towards epidemiology of complexity].
Bizouarn, Philippe
2016-05-01
In order to solve public health problems posed by the epidemiology of risk factors centered on the individual and neglecting the causal processes linking the risk factors with the health outcomes, Mervyn Susser proposed a multilevel epidemiology called eco-epidemiology, addressing the interdependence of individuals and their connection with molecular, individual, societal, environmental levels of organization participating in the causal disease processes. The aim of this epidemiology is to integrate more than a level of organization in design, analysis and interpretation of health problems. After presenting the main criticisms of risk-factor epidemiology focused on the individual, we will try to show how eco-epidemiology and its development could help to understand the need for a broader and integrative epidemiology, in which studies designed to identify risk factors would be balanced by studies designed to answer other questions equally vital to public health. © 2016 médecine/sciences – Inserm.
Maxillary canine impactions related to impacted central incisors: two case reports.
Bayram, Mehmet; Ozer, Mete; Sener, Ismail
2007-09-01
The purpose of this case report is to describe the combined surgical and orthodontic treatment of two cases with an impacted maxillary central incisor and canine in the same quadrant and to discuss the causal relationship between them. The most common causes of canine impactions are usually the result of one or more factors such as a long path of eruption, tooth size-arch length discrepancies, abnormal position of the tooth bud, prolonged retention or early loss of the deciduous canine, trauma, the presence of an alveolar cleft, ankylosis, cystic or neoplastic formation, dilaceration of the root, supernumerary teeth, and odontomas. Although impaction of the maxillary central incisor is almost as prevalent as impacted canines its etiology is different. The principal factors involved in causing the anomaly are supernumerary teeth, odontomas, and trauma. Case #1: A 10.5-year-old girl in the early mixed dentition stage presented with a chief complaint of the appearance of her anterior teeth. She had a Class I skeletal pattern and a history of trauma to the maxillary central incisors at age five with premature exfoliation. Radiographs revealed an impacted upper right central incisor in the region of the nasal floor, delayed eruption of the maxillary permanent central incisor, and the adjacent lateral incisor was inclined toward the edentulous space. Treatment was done in two stages consisting of surgical exposure and traction of the impacted central incisor and fixed orthodontic treatment. Case #2: An 11.5-year-old girl presented for orthodontic treatment with the chief complaint of an unerupted tooth and the appearance of her upper anterior teeth. She was in the late mixed dentition period with a Class III skeletal pattern along with an anterior cross-bite with some maxillary transverse deficiency. The maxillary right canine and central incisor were absent, but the maxillary right deciduous canine was still present. Treatment included arch expansion followed by
Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K
2016-12-01
Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.
Orthodontic treatment of a stubborn palatally ectopic canine: a case report.
Al-Musfir, Tumadher M; Morris, David O
2014-03-01
This is a case report that highlights a different treatment approach in dealing with palatally ectopic canines. The modified transpalatal arch with an 'active' arm was used to align a palatally ectopic canine with 'push' mechanics after the initial use of more conventional 'pull' mechanics (piggy-back archwire technique) had failed.
Awareness and control of canine leishmaniosis: A survey among Spanish and French veterinarians
E.A. le Rutte (Epke); van Straten, R. (Roosmarijn); Overgaauw, P.A.M. (Paul A.M.)
2018-01-01
textabstractZoonotic visceral leishmaniasis (ZVL) is a parasitic disease affecting dogs and humans, which is transmitted by female sandflies. Over the last decade, disease prevalence has increased fivefold in parts of southern Europe, where an estimated 2.5 million dogs are infected. This increase
Directory of Open Access Journals (Sweden)
Eduar E. Bejarano
2001-06-01
Full Text Available La controversia en torno a la posición taxonómica de los flebotomineos, debida en parte a dificultades morfológicas, ha evidenciado la necesidad de buscar nuevas herramientas que permitan no sólo establecer una clasificación más acorde con los procesos evolutivos que han experimentado estos insectos, sino también diferenciar los taxones que conforman los complejos de especies. Con la aparición de las técnicas de biología molecular, el estudio del genoma en insectos vectores de enfermedades se ha convertido en un paso importante en la resolución de muchos conflictos taxonómicos. Las caracteristicas del ADN mitocondrial, entre las que se destacan su rápida evolución y la facilidad con la que se puede aislar y manipular, han favorecido su elección como marcador molecular para estudios de taxonomía. Recientemente, el polimorfisrno de algunos genes mitocondriales comenzó a utilizarse para explorar las relaciones filogenéticas y evolutivas en especies de los géneros Lutzomyia y Phlebotomus. La presente revisión recopila la literatura disponible sobre los principales grupos de flebotomíneos estudiados, los genes mitocondriales más utilizados y su contribución a la clasificación de los vectores de leishmaniosis.
Successful experimental challenge of dogs with canine parvovirus-2.
Carman, S; Povey, C
1982-01-01
Withholding food from dogs for 24 hours prior to, and for 48 hours following oral challenge with a gut mucosal homogenate of canine parvovirus-2, was a successful means of reproducing gastroenteric signs of canine parvovirus-2 infection. Twenty-one of 24 dogs, which had previously received various vaccine preparations of mink enteritis virus or were unvaccinated, and which were starved at challenge, developed soft or liquid feces with large or without large clots of mucus. Altered feces were ...
Wyllie, S E; Kelman, M; Ward, M P
2016-07-01
To determine the status and distribution of distemper in Australian dogs and ferrets. Retrospective case series. Cases were identified via a national voluntary disease reporting system, veterinarian groups and a national laboratory database. The geographic distribution, seasonal distribution, signalment and clinical presentation of cases were described using maps and frequency distributions. A total of 48 individually affected dogs and ferrets in 27 case groups were identified, including eight confirmed case groups (> one individual). Confirmed cases were more common in summer and on the central coast of New South Wales and southern Victoria, and occurred exclusively in young, unvaccinated dogs. For dogs there was no obvious sex predilection. A mortality rate of 100% in ferrets and up to 77% in dogs was estimated. Neurological, gastrointestinal and respiratory were the most commonly reported systems affected in dogs and ferrets. There was no evidence that any large, unreported outbreaks occurred during the study period. Continuation of vaccination against canine distemper virus is justified within Australia, particularly for younger dogs. Veterinarians should continue to consider distemper in their differential diagnosis of cases with neurological, gastrointestinal and respiratory presentation. © 2016 Australian Veterinary Association.
Adina Coșarcă; Mariana Păcurar; Cecilia Petrovan; Alina Ormenișan
2014-01-01
Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of t...
Directory of Open Access Journals (Sweden)
Érica Chaves Lúcio
2014-06-01
Full Text Available Distemper is caused by a Morbillivirus and has worldwide distribution, the dog being the major reservoir for this virus. Transmission occurs by aerosols and the virus can be excreted at the end of the acute phase. It is a disease with no predilection for race, age or sex; however the literature suggests that puppies are most affected. In this study were analyzed serum samples from pet dogs in the city districts and neighborhoods of Garanhuns Boa Vista, Cohab 1, Cohab 2, Magano and center during the period from August to December 2012. Samples were collected from dogs older than three months, not vaccinated against distemper. To produce the maps of geographical distribution of animals were collected coordinates for each home visit. Of the samples analyzed, 90.38% were positive, and 28.72% had high antibody concentration, 47.88% and 23.40% average concentration or low. By analyzing the distribution by districts observed a higher prevalence of infection in neighborhoods with Cohab 2 100.00% and Cohab 1 with 96.00%; Boa Vista with 93.10%; Magano with 78.26%; center with 50.00%. This study did not identify any variable associated with infection related to sex and 100.0% of the animals, including positive and negative, were not castrated. It was shown that 75.0% of the animals had never been taken to the veterinarian, and of these, 94.8% were positive, a fact that may be related to higher seropositivity in these animals. The results of this study show that the canine distemper virus is widespread in the canine population of Garanhuns, Pernambuco, highlights the importance of epidemiological studies to characterize the real situation of infection by this virus in canine populations, in order to reduce damage to animal health caused by this agent.
Bilateral Second Premolars Agenesia Together with a Unilateral Canine Radiculomegaly.
Kemoli, Arthur Musakulu; Junior, Thomas Munyao
2017-01-01
Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.
Brazilian canine hepatozoonosis Hepatozoonose canina brasileira
Directory of Open Access Journals (Sweden)
Lucia Helena O'Dwyer
2011-09-01
Full Text Available The genus Hepatozoon includes hundreds of species that infect birds, reptiles, amphibians and mammals, in all continents with tropical and subtropical climates. Two species have been described in domestic dogs: H. canis, reported in Europe, Asia, Africa, South America and the United States; and H. americanum, which so far has only been diagnosed in the United States. In Brazil, the only species found infecting dogs is H. canis. The objective of this review was to detail some aspects of canine hepatozoonosis, caused by H. canis, and the main points of its biology, transmission, pathogenicity, symptoms, epidemiology and diagnostic methods, with emphasis on research developed in Brazil.O gênero Hepatozoon compreende centenas de espécies que infectam aves, répteis, anfíbios e mamíferos, em todos os continentes de clima tropical e subtropical. No cão doméstico duas espécies são descritas, H. canis e H. americanum; a primeira presente na Europa, Ásia, África, América do Sul e nos Estados Unidos da América do Norte (EUA, e a segunda, diagnosticada até o momento somente nos EUA. No Brasil, a espécie que infecta o cão foi caracterizada como H. canis. Esta revisão objetiva detalhar alguns aspectos da hepatozoose canina, causada pelo H. canis e principais pontos de biologia, transmissão, patogenia e sintomas, epidemiologia e métodos de diagnóstico, enfatizando as pesquisas desenvolvidas no Brasil.
Canine parvovirus in vaccinated dogs: a field study.
Miranda, C; Thompson, G
2016-04-16
The authors report a field study that investigated the canine parvovirus (CPV) strains present in dogs that developed the disease after being vaccinated. Faecal samples of 78 dogs that have been vaccinated against CPV and later presented with clinical signs suspected of parvovirus infection were used. Fifty (64.1 per cent) samples tested positive by PCR for CPV. No CPV vaccine type was detected. The disease by CPV-2b occurred in older and female dogs when compared with that by CPV-2c. The clinical signs presented by infected dogs were similar when any of both variants were involved. In most cases of disease, the resulting infection by field variants occurred shortly after CPV vaccination. Two dogs that had been subjected to a complete vaccination schedule and presented with clinical signs after 10 days of vaccination, had the CPV-2c variant associated. The phylogenetic studies showed a close relationship of the isolates in vaccinated dogs to European field strains. Despite the limited sample size in this study, the findings point to the significance of the continuous molecular typing of the virus as a tool to monitor the prevalent circulating CPV strains and access the efficacy of current vaccines. Adjustments on the vaccine types to be used may have to be evaluated again according to each epidemiological situation in order to achieve the dog's optimal immune protection against CPV.
Efficacy of feline anti-parvovirus antibodies in the treatment of canine parvovirus infection.
Gerlach, M; Proksch, A L; Unterer, S; Speck, S; Truyen, U; Hartmann, K
2017-07-01
This prospective, randomised, placebo-controlled, double-blinded study aimed to evaluate efficacy of commercially available feline anti-parvovirus antibodies in dogs with canine parvovirus infection. First, cross-protection of feline panleukopenia virus antibodies against canine parvovirus was evaluated in vitro. In the subsequent prospective clinical trial, 31 dogs with clinical signs of canine parvovirus infection and a positive faecal canine parvovirus polymerase chain reaction were randomly assigned to a group receiving feline panleukopenia virus antibodies (n=15) or placebo (n=16). All dogs received additional routine treatment. Clinical signs, blood parameters, time to clinical recovery and mortality were compared between the groups. Serum antibody titres and quantitative faecal polymerase chain reaction were compared on days 0, 3, 7, and 14. In vitro, canine parvovirus was fully neutralised by feline panleukopenia virus antibodies. There were no detected significant differences in clinical signs, time to clinical recovery, blood parameters, mortality, faecal virus load, or viral shedding between groups. Dogs in the placebo group showed a significant increase of serum antibody titres and a significant decrease of faecal virus load between day 14 and day 0, which was not detectable in dogs treated with feline panleukopenia virus antibodies. No significant beneficial effect of passively transferred feline anti-parvovirus antibodies in the used dosage regimen on the treatment of canine parvovirus infection was demonstrated. © 2017 British Small Animal Veterinary Association.
Impacted canines: Etiology, diagnosis, and orthodontic management
Directory of Open Access Journals (Sweden)
Ranjit Manne
2012-01-01
Full Text Available Impaction of maxillary and mandibular canines is a frequently encountered clinical problem, the treatment of which usually requires an interdisciplinary approach. Surgical exposure of the impacted tooth and the complex orthodontic mechanisms that are applied to align the tooth into the arch may lead to varying amounts of damage to the supporting structures of the tooth, not to mention the long treatment duration and the financial burden to the patient. Hence, it seems worthwhile to focus on the means of early diagnosis and interception of this clinical situation. In the present article, an overview of the incidence and sequelae, as well as the surgical, periodontal, and orthodontic considerations in the management of impacted canines is presented.
Leigh, S R; Jungers, W L
1994-12-01
A recent study suggests that differing populations of woolly spider monkeys exhibit a substantial degree of morphological, cytogenetic, and behavioral variation. We re-evaluate the differences between populations in the degree of canine tooth height sexual dimorphism and in the frequency of thumbs. Statistical analysis of variation in the degree of canine sexual dimorphism between these populations fails to provide strong evidence for subspecific variation: differences in the degree of canine dimorphism cannot be considered statistically significant. Differences between populations in the frequency of thumbs are, however, statistically significant. The lack of clear distinctions between populations in the degree of canine dimorphism complicates assessments of behavioral variation between these populations. We suggest that the level of geographic variation in woolly spider monkey canine dimorphism is not consistent with subspecific status.
Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2014-09-09
Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.
Identification and function analysis of canine stimulator of interferon gene (STING).
Zhang, Yuxiang; Zhu, Mengyan; Li, Gairu; Liu, Jie; Zhai, Xiaofeng; Wang, Ruyi; Zhang, Junyan; Xing, Gang; Gu, Jinyan; Yan, Liping; Lei, Jing; Sun, Haifeng; Shi, Zhiyu; Liu, Fei; Hu, Boli; Su, Shuo; Zhou, Jiyong
2017-12-01
Stimulator of interferon gene (STING) plays an important role in the cyclic GMP-AMP synthase (cGAS)-mediated activation of type I IFN responses. In this study, we identified and cloned canine STING gene. Full-length STING encodes a 375 amino acid product that shares the highest similarity with feline STING. Highest levels of mRNA of canine STING were detected in the spleen and lungs while the lowest levels in the heart and muscle. Analysis of its cellular localization showed that STING is localizes to the endoplasmic reticulum. STING overexpression induced the IFN response via the IRF3 and NF-κB pathways and up-regulated the expression of ISG15 and viperin. However, knockdown of STING did not inhibit the IFN-β response triggered by poly(dA:dT), poly(I:C), or SeV. Finally, overexpression of STING significantly inhibited the replication of canine influenza virus H3N2. Collectively, our findings indicate that STING is involved in the regulation of the IFN-β pathway in canine. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mandibular Canine Dimorphism in Establishing Sex Identity in the Lebanese Population
Directory of Open Access Journals (Sweden)
Fouad Ayoub
2014-01-01
Full Text Available Background and Objective. In forensic investigations, mandibular canines provide excellent materials to identify gender since they are more likely to survive disasters. The objective of this study was to investigate gender dimorphism by comparing the mesiodistal width of mandibular permanent canines and intercanine distance in a group of Lebanese population. Methods. Participants consisted of undergraduate students from the School of Dentistry, Lebanese University, for two academic years who fulfilled the inclusion criteria. Canine widths and intercanine distance were measured by one operator directly on dental casts using a digital caliper. Results. One hundred thirty-three Lebanese dental students (54 males and 69 females aged 18–25 were included in the study. The intercanine distance was significantly greater in males (P value 0.05 and females (P value > 0.05. The mean width of canine was greater than 7.188 mm for males. Conclusion. The parameters measured in the present study are of great help in sex identification in forensic investigations in the Lebanese adult population.
Increasing Incidence of Canine Leptospirosis in Switzerland
Directory of Open Access Journals (Sweden)
Andrea Major
2014-07-01
Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.
Directory of Open Access Journals (Sweden)
Jennifer Ann Foltz
2016-11-01
Full Text Available Canines spontaneously develop many cancers similar to humans - including osteosarcoma, leukemia, and lymphoma - offering the opportunity to study immune therapies in a genetically heterogeneous and immunocompetent environment. However, a lack of antibodies recognizing canine NK cell markers has resulted in suboptimal characterization and unknown purity of NK cell products, hindering the development of canine models of NK cell adoptive immunotherapy. To this end, we generated a novel antibody to canine NCR1 (NKp46, the putative species-wide marker of NK cells, enabling purification of NK cells for further characterization. We demonstrate that CD3-/NKp46+ cells in healthy and osteosarcoma-bearing canines have phenotypic similarity to human CD3-/NKp46+ NK cells, expressing mRNA for CD16 and the natural cytotoxicity receptors NKp30, NKp44, and NKp80. Functionally, we demonstrate with the calcein release assay that canine CD3-/NKp46+ cells kill canine tumor cell lines without prior sensitization and secrete IFN-γ, TNF-α, IL-8, IL-10, and GM-CSF as measured by Luminex. Like human NK cells, CD3-/NKp46+ cells expand rapidly on feeder cells expressing 4-1BBL and membrane-bound IL-21 (median= 20,283-fold in 21 days. Further, we identify a minor Null population (CD3-/CD21-/CD14-/NKp46- with reduced cytotoxicity against osteosarcoma cells, but similar cytokine secretion as CD3-/NKp46+ cells. Null cells in canines and humans have reduced expression of NKG2D, NKp44, and CD16 compared to NKp46+ NK cells, and can be induced to express NKp46 with further expansion on feeder cells. In conclusion, we have identified and characterized canine NK cells, including an NKp46- subset of canine and human NK cells, using a novel anti-canine NKp46 antibody, and report robust ex vivo expansion of canine NK cells sufficient for adoptive immunotherapy.
Sequence-independent VIDISCA-454 technique to discover new viruses in canine livers
van der Heijden, Mitzi; de Vries, Michel; van Steenbeek, Frank G.; Favier, Robert P.; Deijs, Martin; Brinkhof, Bas; Rothuizen, Jan; van der Hoek, Lia; Penning, Louis C.
2012-01-01
In many mammals, viruses cause hepatitis. Despite many efforts a specific virus responsible for canine idiopathic hepatitis has not been identified. The discovery of a viral etiology in canine hepatitis will promote the development of specific drugs and vaccines for the treatment of idiopathic
2013-05-21
...] Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA AGENCY: Animal and... Canine Lymphoma Vaccine, DNA. The environmental assessment, which is based on a risk analysis prepared to... biological product: Requester: Merial, Inc. Product: Canine Lymphoma Vaccine, DNA. Possible Field Test...
Directory of Open Access Journals (Sweden)
Kimon C. Kanelakis
2009-01-01
Full Text Available The heme-regulated inhibitor (HRI negatively regulates protein synthesis by phosphorylating eukaryotic initiation factor-2α (eIF2α thereby inhibiting protein translation. The importance of HRI in regulating hemoglobin synthesis in erythroid cells makes it an attractive molecular target in need of further characterization. In this work, we have cloned and expressed the canine form of the HRI kinase. The canine nucleotide sequence has 86%, 82%, and 81% identity to the human, mouse, and rat HRI, respectively. It was noted that an isoleucine residue in the ATP binding site of human, rat, and mouse HRI is replaced by a valine in the canine kinase. The expression of canine HRI protein by in vitro translation using wheat germ lysate or in Sf9 cells using a baculovirus expression system was increased by the addition of hemin. Following purification, the canine protein was found to be 72 kD and showed kinase activity determined by its ability to phosphorylate a synthetic peptide substrate. Quercetin, a kinase inhibitor known to inhibit mouse and human HRI, inhibits canine HRI in a concentration-dependent manner. Additionally, quercetin is able to increase de novo protein synthesis in canine reticulocytes. We conclude that the canine is a suitable model species for studying the role of HRI in erythropoiesis.
Hassan, Siba E; Hajeer, Mohammad Y; Alali, Osama H; Kaddah, Ayham S
2016-06-01
The results of previous studies about the efficacy of using self-ligating brackets (SLBs) in controlling canine movement during retraction are not in harmony. Therefore, the current study aimed to compare the effects of using new passive SLBs on maxillary canine retraction with sliding mechanics vs conventional ligating brackets (CLBs) tied with metal ligatures. The sample comprised 15 adult patients (4 males, 11 females; 18-24 years) requiring bilateral extraction of maxillary first premolars. Units of randomization are the left or right maxillary canines within the same patient. The two maxillary canines in each patient were randomly assigned to one of the two groups in a simple split-mouth design. The canines in the SLBs group (n = 15) were bracketed with SLBs (Damon Q™), while the canines in the CLBs group (n = 15) were bracketed with conventional brackets (Mini Master Series). Transpalatal bars were used for anchorage. After leveling and alignment, 0.019 × 0.025" stainless steel working archwires were placed. Canines were retracted using a nickel-titanium close-coil springs with a 150 gm force. The amount and rate of maxillary canine retraction, canine rotation, and loss of anchorage were measured on study models collected at the beginning of canine retraction (T0) and 12 weeks later (T1). Differences were analyzed using paired-samples t-tests. The effect differences were statistically significant (p brackets gave better results compared to the CLBs in terms of rate of movement, amount of canine rotation following extraction, and anchorage loss.
Canine osteosarcoma cells exhibit resistance to aurora kinase inhibitors.
Cannon, C M; Pozniak, J; Scott, M C; Ito, D; Gorden, B H; Graef, A J; Modiano, J F
2015-03-01
We evaluated the effect of Aurora kinase inhibitors AZD1152 and VX680 on canine osteosarcoma cells. Cytotoxicity was seen in all four cell lines; however, half-maximal inhibitory concentrations were significantly higher than in human leukaemia and canine lymphoma cells. AZD1152 reduced Aurora kinase B phosphorylation, indicating resistance was not because of failure of target recognition. Efflux mediated by ABCB1 and ABCG2 transporters is one known mechanism of resistance against these drugs and verapamil enhanced AZD1152-induced apoptosis; however, these transporters were only expressed by a small percentage of cells in each line and the effects of verapamil were modest, suggesting other mechanisms contribute to resistance. Our results indicate that canine osteosarcoma cells are resistant to Aurora kinase inhibitors and suggest that these compounds are unlikely to be useful as single agents for this disease. Further investigation of these resistance mechanisms and the potential utility of Aurora kinase inhibitors in multi-agent protocols is warranted. © 2013 Blackwell Publishing Ltd.
An RCT on treatment of palatally displaced canines with RME and/or a transpalatal arch.
Baccetti, Tiziano; Sigler, Lauren M; McNamara, James A
2011-12-01
To investigate the effect of rapid maxillary expansion (RME) and/or transpalatal arch (TPA) therapy in combination with deciduous canine extraction on the eruption of palatally displaced canines (PDCs). Hundred and twenty subjects were enrolled in an RCT based on PDCs diagnosed on panoramic radiographs and they were randomly assigned to one of four study groups. Three treatment groups (TGs) (RME followed by TPA therapy plus extraction of deciduous canines, RME/TPA/EC group, 40 subjects; TPA therapy plus extraction of deciduous canines, TPA/EC group, 25 subjects; extraction of deciduous canines, EC group, 25 subjects) were analyzed. A control group (CG, 30 subjects) received no orthodontic treatment. Prevalence rates of eruption of PDCs in the three TGs were compared with the CG at T2. Predictive features at T1 for successful canine eruption were tested in the three TGs. The prevalence of canine eruption was 80 per cent for the RME/TPA/EC group, 79 per cent for the TPA/EC group, 62.5 per cent for the EC group, versus 28 per cent in the CG, with statistically significant differences between all the groups, with the exception of the comparison between RME/TPA/EC and TPA/EC. Predictive pretreatment variables for the success of treatment were less severe sectors of canine displacement, prepubertal stages of skeletal maturity, and an open root apex of PDCs. The use of a TPA in absence of RME can be equally effective than the RME/TPA combination in PDC cases not requiring maxillary expansion, thus reducing the burden of treatment for the patient.
Bilateral second premolars agenesia together with a unilateral canine radiculomegaly
Directory of Open Access Journals (Sweden)
Arthur Musakulu Kemoli
2017-01-01
Full Text Available Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.
In vitro development of canine somatic cell nuclear transfer embryos in different culture media.
Kim, Dong-Hoon; No, Jin-Gu; Choi, Mi-Kyung; Yeom, Dong-Hyeon; Kim, Dong-Kyo; Yang, Byoung-Chul; Yoo, Jae Gyu; Kim, Min Kyu; Kim, Hong-Tea
2015-01-01
The objective of the present study was to investigate the effects of three different culture media on the development of canine somatic cell nuclear transfer (SCNT) embryos. Canine cloned embryos were cultured in modified synthetic oviductal fluid (mSOF), porcine zygote medium-3 (PZM-3), or G1/G2 sequential media. Our results showed that the G1/G2 media yielded significantly higher morula and blastocyst development in canine SCNT embryos (26.1% and 7.8%, respectively) compared to PZM-3 (8.5% and 0%or mSOF (2.3% and 0%) media. In conclusion, this study suggests that blastocysts can be produced more efficiently using G1/G2 media to culture canine SCNT embryos.
Directory of Open Access Journals (Sweden)
Deli Liu
2015-06-01
Full Text Available Spontaneous canine head and neck squamous cell carcinoma (HNSCC represents an excellent model of human HNSCC but is greatly understudied. To better understand and utilize this valuable resource, we performed a pilot study that represents its first genome-wide characterization by investigating 12 canine HNSCC cases, of which 9 are oral, via high density array comparative genomic hybridization and RNA-seq. The analyses reveal that these canine cancers recapitulate many molecular features of human HNSCC. These include analogous genomic copy number abnormality landscapes and sequence mutation patterns, recurrent alteration of known HNSCC genes and pathways (e.g., cell cycle, PI3K/AKT signaling, and comparably extensive heterogeneity. Amplification or overexpression of protein kinase genes, matrix metalloproteinase genes, and epithelial-mesenchymal transition genes TWIST1 and SNAI1 are also prominent in these canine tumors. This pilot study, along with a rapidly growing body of literature on canine cancer, reemphasizes the potential value of spontaneous canine cancers in HNSCC basic and translational research.
Rabies and canine distemper virus epidemics in the red fox population of northern Italy (2006-2010).
Nouvellet, Pierre; Donnelly, Christl A; De Nardi, Marco; Rhodes, Chris J; De Benedictis, Paola; Citterio, Carlo; Obber, Federica; Lorenzetto, Monica; Pozza, Manuela Dalla; Cauchemez, Simon; Cattoli, Giovanni
2013-01-01
Since 2006 the red fox (Vulpes vulpes) population in north-eastern Italy has experienced an epidemic of canine distemper virus (CDV). Additionally, in 2008, after a thirteen-year absence from Italy, fox rabies was re-introduced in the Udine province at the national border with Slovenia. Disease intervention strategies are being developed and implemented to control rabies in this area and minimise risk to human health. Here we present empirical data and the epidemiological picture relating to these epidemics in the period 2006-2010. Of important significance for epidemiological studies of wild animals, basic mathematical models are developed to exploit information collected from the surveillance program on dead and/or living animals in order to assess the incidence of infection. These models are also used to estimate the rate of transmission of both diseases and the rate of vaccination, while correcting for a bias in early collection of CDV samples. We found that the rate of rabies transmission was roughly twice that of CDV, with an estimated effective contact between infected and susceptible fox leading to a new infection occurring once every 3 days for rabies, and once a week for CDV. We also inferred that during the early stage of the CDV epidemic, a bias in the monitoring protocol resulted in a positive sample being almost 10 times more likely to be collected than a negative sample. We estimated the rate of intake of oral vaccine at 0.006 per day, allowing us to estimate that roughly 68% of the foxes would be immunised. This was confirmed by field observations. Finally we discuss the implications for the eco-epidemiological dynamics of both epidemics in relation to control measures.
Surgical Removal of a Canine Aortic Thromboembolism Secondary to Pancreatitis
Directory of Open Access Journals (Sweden)
Jill Narak
2015-01-01
Full Text Available A 7-year-old castrated male Pomeranian was evaluated on emergency for diagnostic work-up and treatment for acute nonpainful paraparesis. The neurologic examination suggested a L4-S3 myelopathy, but physical examination revealed lack of femoral pulses and rectal hypothermia, as well as a grade II/VI systolic heart murmur, so ischemic neuromyopathy was suspected. Clinicopathologic analysis revealed increased muscle enzymes and proteinuria. Abdominal ultrasonography confirmed aortic thromboembolism (ATE, and surgical histopathology diagnosed necrotizing pancreatitis. Surgical aortic thrombectomy was performed, and antithrombotic therapy was instituted. Pancreatitis was treated supportively. The dog was discharged to the owners after 10 days of hospitalization. Recheck examination 6 weeks after initial presentation revealed a normal neurologic examination and normal femoral pulses. The patient has had no further bouts of pancreatitis and remains neurologically normal 5 years after initial presentation. Canine ATE is relatively rare compared to the feline counterpart. Directed therapy for feline ATE is often not recommended, as underlying conditions are oftentimes ultimately fatal. Underlying etiologies for canine ATE include cardiovascular disease and endocrinopathies, but canine ATE secondary to pancreatitis has not yet been reported. Surgical removal of aortic thromboembolus should be considered as curative for pelvic limb dysfunction in the canine patient without a terminal underlying disease.
Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu
2011-10-01
The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.
Directory of Open Access Journals (Sweden)
Buchari Lapau
2011-01-01
Full Text Available Makalah ini pertama kali menjelaskan perlu adanya profesi kesehatan masyarakat dalam rangka pembangunan kesehatan. Lalu dijelaskan apa profesi itu dan standar keberadaan profesi, atas dasar mana dapat ditetapkan bahwa pelayanan epidemiologi merupakan salah satu profesi. Dalam rangka pembinaan profesi kesehatan masyarakat, IAKMI dan APTKMI telah membentuk Majelis Kolegium Kesehatan Masyarakat Indonesia (MKKMI yang terdiri atas 8 kolegium antara lain Kolegium Epidemiologi, yang telah menyusun Standar Profesi Epidemiologi yang terdiri atas beberapa standar. Masing-masing standar dijelaskan mulai dari kurikulum, standar pelayanan epidmiologi, profil epidemiolog kesehatan, peran epidemiolog kesehatan, fungsi epidemiolog kesehatan, standar kompetensi epidemiologi, dan standar pendidikan profesi epidemiologi.
Collett, A R; Fletcher, B
2000-12-01
A case report is detailed in which autotransplanted maxillary canines were removed and the spaces closed. Substantial surrounding bone loss was associated with the upper right canine, and a bone graft was needed to reestablish normal dentoalveolar ridge morphology. Bone was taken from the maxillary tuberosity and placed in the canine extraction site, fixed with a bone screw, and covered with GoreTex. Seven months after placement of the bone graft, the GoreTex and stabilizing screw were removed to allow for consolidation of the bone. The upper left canine and lower second premolars were extracted, and fixed appliances were placed in both arches to align the teeth and close the spaces. Protraction of the upper right first premolar and retraction of the lateral incisor into the graft site were kept slow and constant with continued periodontal assessment. During the space closure, there was some concern that the bone in the graft site might resorb, leaving the teeth with compromised periodontal support. However, no significant periodontal attachment loss occurred despite ongoing concern about the amount of keratinized tissue. Perhaps the relatively slow rate of tooth movement provided for bone to be maintained and recreated ahead of the tooth. Almost complete closure of the upper canine extraction spaces was achieved. The upper premolars were substituted for the maxillary canines, and unfavorable prosthetic options were thus avoided. The lower arch was aligned, and the extraction spaces completely closed.
Sandwich-dot enzyme-linked immunosorbent assay for the detection of canine distemper virus
Li, Zhi; Zhang, Yanlong; Wang, Huiguo; Jin, Jinhua; Li, Wenzhe
2013-01-01
A sandwich-dot enzyme-linked immunosorbent assay (dot ELISA) was developed for the detection of canine distemper virus (CDV). In 56 dogs suspected to have CD the rates of detection of CDV antigen in samples of blood lymphocytes and palpebral conjunctiva by dot ELISA and ELISA were, respectively, 91% (49/54) and 81% (44/54) for the lymphocyte samples and 88% (28/32) and 75% (24/32) for the conjunctival samples. The CDV detection limits were 10 ng/50 μL for dot ELISA and 40 ng/50 μL for ELISA. The reliability of dot ELISA relative to electron microscopy was 96% with 22 samples: all 21 samples in which CDV particles were observed by electron microscopy yielded positive results with dot ELISA; the single sample in which particles were not observed yielded false-positive results with dot ELISA. The results indicate that the dot ELISA developed can serve as a reliable rapid diagnostic test in suspected cases of CD and also be useful for epidemiologic surveillance of the disease. PMID:24124274
"Fooling fido"--chemical and behavioral studies of pseudo-explosive canine training aids.
Kranz, William D; Strange, Nicholas A; Goodpaster, John V
2014-12-01
Genuine explosive materials are traditionally employed in the training and testing of explosive-detecting canines so that they will respond reliably to these substances. However, challenges arising from the acquisition, storage, handling, and transportation of explosives have given rise to the development of "pseudo-explosive" training aids. These products attempt to emulate the odor of real explosives while remaining inert. Therefore, a canine trained on a pseudo-explosive should respond to its real-life analog. Similarly, a canine trained on an actual explosive should respond to the pseudo-explosive as if it was real. This research tested those assumptions with a focus on three explosives: single-base smokeless powder, 2,4,6-trinitrotoluene (TNT), and a RDX-based plastic explosive (Composition C-4). Using gas chromatography-mass spectrometry with solid phase microextraction as a pre-concentration technique, we determined that the volatile compounds given off by pseudo-explosive products consisted of various solvents, known additives from explosive formulations, and common impurities present in authentic explosives. For example, simulated smokeless powders emitted terpenes, 2,4-dinitrotoluene, diphenylamine, and ethyl centralite. Simulated TNT products emitted 2,4- and 2,6-dinitrotoluene. Simulated C-4 products emitted cyclohexanone, 2-ethyl-1-hexanol, and dimethyldinitrobutane. We also conducted tests to determine whether canines trained on pseudo-explosives are capable of alerting to genuine explosives and vice versa. The results show that canines trained on pseudo-explosives performed poorly at detecting all but the pseudo-explosives they are trained on. Similarly, canines trained on actual explosives performed poorly at detecting all but the actual explosives on which they were trained.
Morphological study of maxillary canine region based on CT
International Nuclear Information System (INIS)
Yamada, Maiko; Takamori, Hitoshi; Ide, Yoshiaki; Yosue, Takashi
2010-01-01
The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)
Pathophysiology, diagnosis, and treatment of canine hip dysplasia
International Nuclear Information System (INIS)
Cook, J.L.; Tomlinson, J.L.; Constantinescu, G.M.
1996-01-01
Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education
Does contemporary canine diet cause cancer? ; A review
Directory of Open Access Journals (Sweden)
Joseph B Gentzel
2013-07-01
Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer
Almuhtaseb, Eyad; Mao, Jing; Mahony, Derek; Bader, Rawan; Zhang, Zhi-xing
2014-06-01
The purpose of this study was to develop a new way to localize the impacted canines from three dimensions and to investigate the root resorption of the adjacent teeth by using cone beam computed tomography (CBCT). Forty-six patients undergoing orthodontic treatments and having impacted canines in Tongji Hospital were examined. The images of CBCT scans were obtained from KaVo 3D exam vision. Angular and linear measurements of the cusp tip and root apex according to the three planes (mid-sagittal, occlusal and frontal) have been taken using the cephalometric tool of the InVivo Dental Anatomage Version 5.1.10. The measurements of the angular and linear coordinates of the maxillary and mandibular canines were obtained. Using this technique the operators could envision the location of the impacted canine according to the three clinical planes. Adjacent teeth root resorption of 28.26 % was in the upper lateral incisors while 17.39% in upper central incisors, but no lower root resorption was found in our samples. Accurate and reliable localization of the impacted canines could be obtained from the novel analysis system, which offers a better surgical and orthodontic treatment for the patients with impacted canines.
Norwegian or Crusted Sarcoptic Mange in Two Leishmanial Dogs.
Kaltsogianni, Flora; Farmaki, Rania; Koutinas, Alexander F
Norwegian or crusted scabies (N/CS) is a rare skin disease with very few cases reported in the dog or the cat. Two adult, stray dogs were admitted in our clinic with a generalized, multifocal to diffuse and nonpruritic dermatitis that was characterized by severe crusting, scaling, and ulceration. In both instances, leishmaniosis and N/CS were diagnosed by immunofluorescent antibody test serology, lymph node cytology, and skin scrapings in which high numbers of Sarcoptes mites were found. The combination of miticidal and antileishmanial treatment, supported by topical treatment and nutritional support, resulted in the complete resolution of the skin lesions and spectacular improvement of the body condition in both cases. Dog 1 eventually died from end-stage kidney disease attributed to leishmaniosis-associated glomerulonephritis, whereas the also proteinuric dog 2 remains clinically healthy. The manifestation of the rare type of N/CS in these dogs could be attributed to cell-mediated immunosuppression, which was most likely induced by leishmaniosis and malnutrition. The necessity of searching for leishmaniosis in those scabietic cases, especially in the endemic areas of leishmaniosis, is strongly recommended.
Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.
Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D
2014-12-01
Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis.
Canine parvovirus in asymptomatic feline carriers.
Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D
2012-05-25
Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog
Ballart, C; Alcover, M M; Portús, M; Gállego, M
2012-02-01
Canine leishmaniasis (CanL) is a widespread disease present in 42 countries. It is considered of epidemiological importance because of its role as a reservoir of human leishmaniasis. Knowledge of the real distribution of CanL and its emergence and/or re-emergence is of great importance in order to determine the extension of the disease. This work reports the detection of CanL in a farm dog located in a Pyrenean area of northwest Catalonia (Spain) where the disease was previously unknown. Since the dog had never left the region and sandfly vectors, Phlebotomus ariasi and P. perniciosus, were present in the farm the case is considered as autochthonous and is the first to be published in this region of Spain. Copyright © 2011 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.
Electroencephalography as a diagnostic technique for canine neurological diseases
Directory of Open Access Journals (Sweden)
Wrzosek Marcin
2016-06-01
Full Text Available Electroencephalography (EEG is a non-invasive examination method for the assessment of functional central nervous system (CNS disturbances. In human medicine it has a special importance as a diagnostic tool for epilepsy. Although many studies were done on the use of EEG for diagnostics of canine central nervous system disorders, the technique is still not applied routinely. The purpose of this paper was to review the use of the electroencephalography in canine neurological disorders of central nervous system diagnosis and assess the future perspectives of this technique in veterinary medicine.
Canine distemper virus detection in asymptomatic and non vaccinated dogs
Directory of Open Access Journals (Sweden)
Helen L. Del Puerto
2010-02-01
Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom
Experimental study of pulmonary thromboembolism ischemia-reperfusion injury in canine model
International Nuclear Information System (INIS)
Li Jianjun; Zhai Renyou; Zhang Dongpo; Huang Qiang; Yu Ping; Dai Dingke; Bao Na
2009-01-01
Objective: To establish a canine model of pulmonary thromboembolism ischemia- reperfusion injury (PTE IRI) that may be used for imaging study. Methods: Ten male and 10 female healthy mongrel canines with (18.6±0.8) kg/body weight, were used. A Swan-Ganz catheter was introduced into the right internal jugular vein via a preset percutaneous sheath using the Seldinger technique, and then was with further insertion the pulmonary artery. Balloon occlusion of the right inferior lobe pulmonary artery for 4 hours was followed by removing the catheter and ending with 4 hours of reperfusion. CT was performed before ischemia, 4 h after ischemia and 4 h after reperfusion. At last, dogs were killed and the bilateral inferior lung tissues were prepared for the examination by light and electronic microscopy. Results: All canine models were successfully developed pulmonary thromboembolism ischemia-reperfusion injury. The examination of CT, light and electron microscopy consistently indicated the presence of permeability pulmonary edema after reperfusion. Conclusions: A closed-chest canine model in vivo of pulmonary thromboembolism ischemia-reperfusion injury can be established with virtual pathophysiological process in human and be as well as for imaging experimental study. (authors)
A survey of canine tick-borne diseases in India
Directory of Open Access Journals (Sweden)
Coleman Glen T
2011-07-01
Full Text Available Abstract Background There are few published reports on canine Babesia, Ehrlichia, Anaplasma, Hepatozoon and haemotropic Mycoplasma infections in India and most describe clinical disease in individual dogs, diagnosed by morphological observation of the microorganisms in stained blood smears. This study investigated the occurrence and distribution of canine tick-borne disease (TBD pathogens using a combination of conventional and molecular diagnostic techniques in four cities in India. Results On microscopy examination, only Hepatozoon gamonts were observed in twelve out of 525 (2.3%; 95% CI: 1.2, 4 blood smears. Using polymerase chain reaction (PCR, a total of 261 from 525 dogs (49.7%; 95% CI: 45.4, 54.1 in this study were infected with one or more canine tick-borne pathogen. Hepatozoon canis (30%; 95% CI: 26.0, 34.0 was the most common TBD pathogen found infecting dogs in India followed by Ehrlichia canis (20.6%; 95% CI: 17.2, 24.3, Mycoplasma haemocanis (12.2%; 95% CI: 9.5, 15.3, Anaplasma platys (6.5%; 95% CI: 4.5, 8.9, Babesia vogeli (5.5%, 95% CI: 3.7, 7.8 and Babesia gibsoni (0.2%, 95% CI: 0.01, 1.06. Concurrent infection with more than one TBD pathogen occurred in 39% of cases. Potential tick vectors, Rhipicephalus (most commonly and/or Haemaphysalis ticks were found on 278 (53% of dogs examined. Conclusions At least 6 species of canine tick-borne pathogens are present in India. Hepatozoon canis was the most common pathogen and ticks belonging to the genus Rhipicephalus were encountered most frequently. Polymerase chain reaction was more sensitive in detecting circulating pathogens compared with peripheral blood smear examination. As co-infections with canine TBD pathogens were common, Indian veterinary practitioners should be cognisant that the discovery of one such pathogen raises the potential for multiple infections which may warrant different clinical management strategies.
Directory of Open Access Journals (Sweden)
Sara María Robledo Restrepo
2000-03-01
Full Text Available This review summarizes relevant information about the immune response triggered during leishmaniosis, a disease of great importance from the epidemiological point of view, since it is endemic in Colombia and other countries. We emphasize on human leishmaniosis; nevertheless, some important findings in the murine model are also mentioned. This information allows to conclude that Leishmania infection is a complex and coordinated process, which includes adhesion and entrance of the parasite into the host cells and its survival inside them. Events that mediate the infection process may influence its result in terms of elimination of the parasite or development of the disease, through induction or not of an effective specific immune response which involves host cell activation and parasite destruction. La presente revisión tiene como objetivo resumir la información más relevante acerca de la respuesta inmune que se desencadena durante la leishmaniosis, una enfermedad de gran importancia desde el punto de vista epidemiológico dado que es endémica en Colombia y otros países. Aunque la respuesta inmune en la leishmaniosis es un tema que se ha estudiado ampliamente en las infecciones por especies de Leishmania del Viejo Mundo, particularmente Leishmania major y Leishmania donovani y en el modelo murino, la presente revisión hace énfasis en la leishmaniosis humana. Algunos hallazgos importantes en el modelo murino también se mencionan. La información contenida en la revisión, en su mayoría, proviene de publicaciones derivadas de investigaciones, las cuales se seleccionaron con base en la calidad del trabajo realizado y en los aportes de sus resultados en el avance del conocimiento sobre las infecciones en humanos. La síntesis de la información seleccionada nos permite concluir que la infección por Leishmania es un proceso complejo y coordinado que incluye la adherencia y entrada del parásito a la célula hospedera y su posterior
New hominin fossils from Kanapoi, Kenya, and the mosaic evolution of canine teeth in early hominins
Directory of Open Access Journals (Sweden)
J. Michael Plavcan
2012-03-01
Full Text Available Whilst reduced size, altered shape and diminished sexual dimorphism of the canine–premolar complex are diagnostic features of the hominin clade, little is known about the rate and timing of changes in canine size and shape in early hominins. The earliest Australopithecus, Australopithecus anamensis, had canine crowns similar in size to those of its descendant Australopithecus afarensis, but a single large root alveolus has suggested that this species may have had larger and more dimorphic canines than previously recognised. Here we present three new associated dentitions attributed to A. anamensis, recently recovered from the type site of Kanapoi, Kenya, that provide evidence of canine evolution in early Australopithecus. These fossils include the largest mandibular canine root in the hominin fossil record. We demonstrate that, although canine crown height did not differ between these species, A. anamensis had larger and more dimorphic roots, more like those of extant great apes and Ardipithecus ramidus, than those of A. afarensis. The canine and premolar occlusal shapes of A. anamensis also resemble those of Ar. ramidus, and are intermediary between extant great apes and A. afarensis. A. afarensis achieved Homo-like maxillary crown basal proportions without a reduction in crown height. Thus, canine crown size and dimorphism remained stable during the early evolution of Australopithecus, but mandibular root dimensions changed only later within the A. anamensis–afarensis lineage, coincident with morphological changes in the canine–premolar complex. These observations suggest that selection on canine tooth crown height, shape and root dimensions was not coupled in early hominin evolution, and was not part of an integrated adaptive package.
Molecular characterization of the canine HMGB1.
Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I
2003-01-01
Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel
Milovancev, Milan; Hilgart-Martiszus, Ian; McNamara, Michael J; Goodall, Cheri P; Seguin, Bernard; Bracha, Shay; Wickramasekara, Samanthi I
2013-06-13
Osteosarcoma (OSA) is the most common primary bone tumor of dogs and carries a poor prognosis despite aggressive treatment. An improved understanding of the biology of OSA is critically needed to allow for development of novel diagnostic, prognostic, and therapeutic tools. The surface-exposed proteome (SEP) of a cancerous cell includes a multifarious array of proteins critical to cellular processes such as proliferation, migration, adhesion, and inter-cellular communication. The specific aim of this study was to define a SEP profile of two validated canine OSA cell lines and a normal canine osteoblast cell line utilizing a biotinylation/streptavidin system to selectively label, purify, and identify surface-exposed proteins by mass spectrometry (MS) analysis. Additionally, we sought to validate a subset of our MS-based observations via quantitative real-time PCR, Western blot and semi-quantitative immunocytochemistry. Our hypothesis was that MS would detect differences in the SEP composition between the OSA and the normal osteoblast cells. Shotgun MS identified 133 putative surface proteins when output from all samples were combined, with good consistency between biological replicates. Eleven of the MS-detected proteins underwent analysis of gene expression by PCR, all of which were actively transcribed, but varied in expression level. Western blot of whole cell lysates from all three cell lines was effective for Thrombospondin-1, CYR61 and CD44, and indicated that all three proteins were present in each cell line. Semi-quantitative immunofluorescence indicated that CD44 was expressed at much higher levels on the surface of the OSA than the normal osteoblast cell lines. The results of the present study identified numerous differences, and similarities, in the SEP of canine OSA cell lines and normal canine osteoblasts. The PCR, Western blot, and immunocytochemistry results, for the subset of proteins evaluated, were generally supportive of the mass spectrometry data
Visceral Leishmaniasis in Iran: Review of the Epidemiological and Clinical Features
Directory of Open Access Journals (Sweden)
Mehdi Mohebali
2013-09-01
northwestern Iran; Ph. major s.l. (=Ph. neglectus, Ph. keshishiani, and Ph. alexandri in southern parts of Iran were molecularly and/or parasitologically positive for L. infantum infections. The zoonotic form of VL (ZVL caused by L. infantum occurs sporadically in all geographical zones of Iran but in northwestern and southern parts of the country the disease is endemic. DAT as an appropriate and potential tool has been used for sero-diagnosis and sero- epidemiological of VL among humans as well as domestic and wild canines.
Wen, Jiexia; Pan, Sumin; Liang, Shuang; Zhong, Zhenyu; He, Ying; Lin, Hongyu; Li, Wenyan; Wang, Liyue; Li, Xiujin; Zhong, Fei
2013-01-01
Canine parvovirus (CPV) disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR) was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR)) possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo. PMID:24089666
Directory of Open Access Journals (Sweden)
Jiexia Wen
2013-01-01
Full Text Available Canine parvovirus (CPV disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo.
3D enamel thickness in Neandertal and modern human permanent canines.
Buti, Laura; Le Cabec, Adeline; Panetta, Daniele; Tripodi, Maria; Salvadori, Piero A; Hublin, Jean-Jacques; Feeney, Robin N M; Benazzi, Stefano
2017-12-01
Enamel thickness figures prominently in studies of human evolution, particularly for taxonomy, phylogeny, and paleodietary reconstruction. Attention has focused on molar teeth, through the use of advanced imaging technologies and novel protocols. Despite the important results achieved thus far, further work is needed to investigate all tooth classes. We apply a recent approach developed for anterior teeth to investigate the 3D enamel thickness of Neandertal and modern human (MH) canines. In terms of crown size, the values obtained for both upper and lower unworn/slightly worn canines are significantly greater in Neandertals than in Upper Paleolithic and recent MH. The 3D relative enamel thickness (RET) is significantly lower in Neandertals than in MH. Moreover, differences in 3D RET values between the two groups appear to decrease in worn canines beginning from wear stage 3, suggesting that both the pattern and the stage of wear may have important effects on the 3D RET value. Nevertheless, the 3D average enamel thickness (AET) does not differ between the two groups. In both groups, 3D AET and 3D RET indices are greater in upper canines than in lower canines, and overall the enamel is thicker on the occlusal half of the labial aspect of the crown, particularly in MH. By contrast, the few early modern humans investigated show the highest volumes of enamel while for all other components of 3D enamel, thickness this group holds an intermediate position between Neandertals and recent MH. Overall, our study supports the general findings that Neandertals have relatively thinner enamel than MH (as also observed in molars), indicating that unworn/slightly worn canines can be successfully used to discriminate between the two groups. Further studies, however, are needed to understand whether these differences are functionally related or are the result of pleiotropic or genetic drift effects. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA.
Folitse, R D; Kodie, D O; Amemor, E; Dei, D; Tasiame, W; Burimuah, V; Emikpe, B O
2018-01-01
Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT ® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α 0.05 . We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection.
DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA
Folitse, R. D; Kodie, D.O; Amemor, E.; Dei, D.; Tasiame, W.; Burimuah, V.; Emikpe, B.O
2018-01-01
Background: Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Materials and Methods: Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α0.05 Results: We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. Conclusion: The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection. PMID:29302647
Canine Detection of Illict Drugs: Sensory Apparatus Technology
National Research Council Canada - National Science Library
Morrison, Edward
2000-01-01
This report describes basic anatomical and physiological observations of the peripheral canine olfactory system, provided by means of investigations into its structural and molecular characteristics...
Coryneform bacteria associated with canine otitis externa
DEFF Research Database (Denmark)
Aalbæk, Bent; Bemis, David A.; Schjærff, Mette
2010-01-01
This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...
Antigenic typing Polish isolates of canine parvovirus
Energy Technology Data Exchange (ETDEWEB)
Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)
1995-12-31
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.
Antigenic typing Polish isolates of canine parvovirus
International Nuclear Information System (INIS)
Mizak, B.; Plucienniczak, A.
1995-01-01
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs
Szarmach, I J; Szarmach, J; Waszkiel, D; Paniczko, A
2006-01-01
The aim of the study was to assess the effect of orthodontic movement of the impacted canines after surgical exposure and alignment on the periodontal status of the transpositioned and adjacent teeth as well as to compare certain parameters with those of spontaneously erupted teeth. Twenty-four patients (mean age 18.4 +/- 3.66) with unilaterally impacted 24 canines were enrolled in the study. The following parameters were assessed: pocket depth (PD), clinical attachment level (CAL), platelet index (PI) of Silness and Löe, and modified sulcus bleeding index (SBI). Optic density of the alveolar bone along the root surface of the aligned canine was analysed based on digital radiological images made with the right angle technique. Control group consisted of spontaneously erupted teeth. In comparison to the control group, in the orthodonticaly treated group PD was found to increase on the mesial buccal and palatal surfaces of the first premolar (p aligned canine (p aligned tooth were statistically significant (p alignment zone and the control, and there was no link between the method of treatment and periodontal status, either. The alignment of the impacted permanent maxillary canines poses a risk of periodontal deterioration. Patients subjected to surgical-orthodontic treatment require periodic periodontal follow-ups.
Directory of Open Access Journals (Sweden)
D S Kothavade
2012-01-01
Full Text Available Aim : The purpose of the present study was to establish the relationship between the eruption of permanent maxillary canines and cervical vertebral maturation stages (CVMs to assess an alternative method for determining time of canine eruption in the late mixed dentition. Materials and Methods : One hundred and twenty subjects with erupting permanent maxillary canines were observed both intraorally and radiographically with orthopantamograms. Lateral cephalograms were recorded to divide subjects according to CVM stage into prepeak (CS1 and CS2, peak (CS3 and CS4 and postpeak (CS5 and CS6 groups of puberty. Statistical Analysis : The differences between the prevalence rates of canine eruption in different groups of puberty were estimated using ′z test′. Results : Prepeak group comprised of forty six subjects, peak group sixty eight subjects and postpeak group six subjects. The differences in prevalence rates between peak and prepeak and between peak and postpeak groups were noticed highly significant (p<0.001, while prevalence rates between peak and postpeak was found less significant ( p0 <0.01. Conclusion : Eruption of the permanent maxillary canine can occur at any CVM stage till end of the puberty or after puberty (CS1-CS6. Thus, an absence of maxillary canine during or after postpeak stage of puberty (CS5 or CS6 suggests delayed eruption and canine impaction.
Cathepsin K expression and activity in canine osteosarcoma.
Schmit, J M; Pondenis, H C; Barger, A M; Borst, L B; Garrett, L D; Wypij, J M; Neumann, Z L; Fan, T M
2012-01-01
Cathepsin K (CatK) is a lysosomal protease with collagenolytic activity, and its secretion by osteoclasts is responsible for degrading organic bone matrix. People with pathologic bone resorption have higher circulating CatK concentrations. Canine osteosarcoma (OS) cells will possess CatK, and its secretion will be cytokine inducible. Circulating CatK concentrations will be increased in dogs with OS, and will be a surrogate marker of bone resorption. Fifty-one dogs with appendicular OS and 18 age- and weight-matched healthy control dogs. In a prospective study, expressions of CatK mRNA and protein were investigated in OS cells. The inducible secretion and proteolytic activity of CatK from OS cells was assessed in vitro. Serum CatK concentrations were quantified in normal dogs and dogs with OS and its utility as a bone resorption marker was evaluated in dogs with OS treated with palliative radiation and antiresorptive agents. Canine OS cells contain preformed CatK within cytoplasmic vesicles. In OS cells, TGFβ1 induced the secretion of CatK, which degraded bone-derived type I collagen in vitro. CatK concentrations were higher in dogs with OS than healthy dogs (11.3 ± 5.2 pmol/L versus 8.1 ± 5.0 pmol/L, P = .03). In a subset of dogs with OS, pretreatment CatK concentrations gradually decreased after palliative radiation and antiresorptive treatment, from 9.3 ± 3.2 pmol/L to 5.0 ± 3.1 pmol/L, P = .03. Canine OS is associated with pathologic bone resorption, and CatK inhibitors might aid in the management of canine OS-related malignant osteolysis. Copyright © 2011 by the American College of Veterinary Internal Medicine.
Canine trypanosomosis: Clinical observations and morphological ...
African Journals Online (AJOL)
Clinical and pathological aspects of canine trypanosomosis were determined in naturally infected dogs presented to the Veterinary Teaching Hospital, Federal University of Agriculture, Abeokuta, at different times between 2012 and 2013. The breeds, sexes, ages and body weights of the dogs were recorded. Clinical signs ...
The unerupted maxillary canine - a post-surgical review.
LENUS (Irish Health Repository)
O'Dowling, Ian
2009-10-01
The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.
The unerupted maxillary canine--a post-surgical review.
O'Dowling, Ian
2009-01-01
The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.
Spread of Leishmania infantum in Europe with dog travelling.
Maia, Carla; Cardoso, Luís
2015-09-30
Leishmania infantum is the etiological agent of canine leishmaniosis (CanL) in Europe, where it is endemic in the Mediterranean region, with dogs being considered the major reservoir of the parasite for humans and other mammalian hosts. The main transmission mode of Leishmania is by the bite of infected phlebotomine sand fly insects (genus Phlebotomus), which are the only proven vectors of this zoonotic protozoan. Less common, non-vectorial transmission between dogs include infection through transfused blood products from infected donors, transplacental and venereal transmission. CanL has exhibited an expansion to new locations in Europe, mainly northwards, either by territorial contiguity, often in association with global warming that favours vectorial transmission, or by the long-distance importation of infected dogs. The increasing incidence of CanL in countries where the disease is not endemic is challenging owners, veterinarians and government authorities. Most infected dogs in these new areas have been relocated from or travelled with their owners to endemic regions, but in some cases transmission might have also been autochthonous. In the absence of prophylactic measures, the introduction of infected dogs in areas previously free of endemic CanL but which have competent sand fly vectors can result in a potential persistence of L. infantum. The spread of L. infantum in Europe is reviewed with a focus on transmission, epidemiology and geographic distribution of endemic and non-endemic CanL, infection and disease in humans and animal hosts other than dogs, together with prevention and additional control strategies. Copyright © 2015 Elsevier B.V. All rights reserved.
Canine distemper spillover in domestic dogs from urban wildlife.
Kapil, Sanjay; Yeary, Teresa J
2011-11-01
Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.
Relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction
Directory of Open Access Journals (Sweden)
Anísio Bueno de Carvalho
2012-12-01
Full Text Available OBJECTIVE: The purpose was to obtain information about the relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction. METHODS: Seventy-three patients with canine impaction and 73 control patients, without canine impaction, were evaluated. The mesiodistal distances of the maxillary lateral incisors adjacent to the impacted canines and the correspondent mandibular lateral incisors were measured. The adjacent lateral incisors were classified in: 1 - absent, 2 - small, 3 - peg-shaped, 4 - standard. RESULTS: The results showed that among the patients with impacted canines, there were 21 anomalous teeth (small and peg-shaped and among the control patients there were only three small and peg-shaped teeth, with a statistically significant difference (p = 0.001. No patients were found with impacted canines and absent lateral incisors. CONCLUSION: It was concluded that in patients with anomalous lateral incisors (small and peg-shaped there is a probability to present impacted canines and this must be considered.OBJETIVO: o objetivo foi obter informação sobre a relação existente entre a agenesia e/ou anomalia de forma de incisivos laterais superiores e impacção de caninos. MÉTODOS: foram avaliados 73 pacientes com impacção de caninos e 73 pacientes controle, sem impacção de caninos. Foram medidas as distâncias mesiodistais dos incisivos laterais superiores adjacentes aos caninos impactados e os incisivos laterais correspondentes inferiores. Os incisivos laterais adjacentes foram classificados em: 1 - ausentes; 2 - pequenos; 3 - conoides; 4 - normais. RESULTADOS: os resultados mostraram que no grupo de pacientes com caninos impactados foram encontrados 22 dentes anômalos (pequenos e conoides, e no grupo controle apenas três dentes pequenos e conoides, sendo uma diferença estatisticamente significativa (p=0,001. Não foram encontrados pacientes com canino impactado e incisivo lateral ausente. CONCLUS
Vulnerability of cultured canine lung tumor cells to NK cell-mediated cytolysis
International Nuclear Information System (INIS)
Haley, P.J.; Kohr, J.M.; Kelly, G.; Muggenburg, B.A.; Guilmette, B.A.
1988-01-01
Five cell lines, designated as canine lung epithelial cell (CLEP), derived from radiation induced canine lung tumors and canine thyroid adeno-carcinoma (CTAC) cells were compared for their susceptibility to NK cell-mediated cytolysis using peripheral blood lymphocytes from normal, healthy Beagle dogs as effector cells. Effector cells and chromium 51 radiolabeled target cells were incubated for 16 h at ratios of 12.5:1, 25:1, 50:1, and 100:1. Increasing cytolysis was observed for all cell lines as the effector-to-target-cell ratios increased from 12.5:1 to 100:1. The percent cytotoxicity was significantly less for all lung tumor cell lines as compared to CTAC at the 100:1 ratio. One lung tumor cell line, CLEP-9, had 85% of the lytic vulnerability of the CTAC cell line and significantly greater susceptibility to NK cell-mediated lysis than all of the other lung tumor cell lines. Susceptibility to NK cell cytolysis did not correlate with in vivo malignant behavior of the original tumor. These data suggest that cultured canine lung tumor cells are susceptible to NK cell cytolytic activity in vitro and that at least one of these cell lines (CLEP-9) is a candidate for substitution of the standard canine NK cell target, CTAC, in NK cell assays. The use of lung tumor cells in NK cell assays may provide greater insight into the control of lung tumors by immune mechanisms. (author)
International Nuclear Information System (INIS)
Alif, Sheikh Mohammad; Haque, Sejuty; Nimmi, Naima; Ashraf, Ali; Khan, Saeed Hossain; Khan, Mahfujul Haq
2011-01-01
This study was performed to determine the prevalence of maxillary canine impaction on a basis of a single panoramic radiograph in Bangladeshi population. A random sample of seven hundred panoramic radiographs was collected from the patient record of a dental clinic. All the selected panoramic radiographs were taken from January 2009 to August 2010 by a single panoramic radiograph machine with the same exposure time (19 seconds) for all radiographs. One hundred and twenty panoramic radiographs were excluded to minimize the selection bias. In a dim lit room, an observer assessed the radiographs on a standard radiographic light box. The position of the impacted maxillary canine was recorded in line with the longitudinal axis of a tooth using the edge of a metal ruler. Data were subsequently put on SPSS 11.5 software and chi-square (x 2 ) tests were applied to find out the association. Among 580 panoramic radiographs it was found that impacted maxillary canines were present in only 7 (1.2%) radiographs. A statistical significant difference was found between the age of the patients and the vertical position of the impacted canines (p=0.000) and between the age of the patients and the horizontal position of the impacted canines (p=0.003). The prevalence was found to be low compared with the present study from the limitation of panoramic image. Further study needs to include three-dimensional imaging modality.
A comparative study between mixed-type tumours from human salivary and canine mammary glands
International Nuclear Information System (INIS)
Genelhu, Marisa CLS; Cardoso, Sérgio V; Gobbi, Helenice; Cassali, Geovanni D
2007-01-01
In comparative pathology, canine mammary tumours have special interest because of their similarities with human breast cancer. Mixed tumours are uncommon lesions in the human breast, but they are found most frequently in the mammary gland of the female dogs and in the human salivary glands. The aim of the study was to compare clinical, morphological and immunohistochemical features of human salivary and canine mammary gland mixed tumours, in order to evaluate the latter as an experimental model for salivary gland tumours. Ten examples of each mixed tumour type (human pleomorphic adenoma and carcinomas ex-pleomorphic adenomas and canine mixed tumour and metaplastic carcinoma) were evaluated. First, clinical and morphologic aspects of benign and malignant variants were compared between the species. Then, streptavidin-biotin-peroxidase immunohistochemistry was performed to detect the expression of cytokeratins, vimentin, p63 protein, estrogen receptor, β-catenin, and E-cadherin. After standardization, similar age and site distributions were observed in human and canine tumours. Histological similarities were identified in the comparison of the benign lesions as well. Metaplastic carcinomas also resembled general aspects of carcinomas ex-pleomorphic adenomas in morphological evaluation. Additionally, immunohistochemical staining further presented similar antigenic expression between lesions. There are many similar features between human salivary and canine mammary gland mixed tumours. This observation is of great relevance for those interested in the study and management of salivary gland tumours, since canine lesions may constitute useful comparative models for their investigations
Molecular typing of a novel canine parvovirus type 2a mutant circulating in Italy.
Mira, Francesco; Dowgier, Giulia; Purpari, Giuseppa; Vicari, Domenico; Di Bella, Santina; Macaluso, Giusi; Gucciardi, Francesca; Randazzo, Vincenzo; Decaro, Nicola; Guercio, Annalisa
2018-07-01
Canine parvovirus (CPV) is the etiological agent of a severe viral disease of dogs. After its emergence in late 1970s, the CPV original type (CPV-2) was rapidly and totally replaced by three antigenic variants named CPV-2a, CPV-2b and CPV-2c. CPV has an evolutionary rate nearest to those of RNA viruses, with consequences on disease diagnosis and epidemiology. This paper reports the molecular characterization of eight CPV-2a strains collected from dogs in Italy in 2016-2017. Genetic analysis was conducted on a CPV genomic region encompassing both open reading frames (ORFs) encoding for nonstructural (NS1-NS2) and structural proteins (VP1-VP2). Sequence analysis indicates new and unreported sequence changes, mainly affecting the VP2 gene, which included the mutation Tyr324Leu. This study represents the first evidence of a new CPV-2a mutant (VP2 324Leu) and illustrates the importance of a continuous molecular survey in order to obtain more information on effective spread of new CPV mutants. Copyright © 2018 Elsevier B.V. All rights reserved.
Dettwiler, M; Croci, M; Vaughan, L; Guscetti, F
2013-09-01
The BH3-only protein Bad is a proapoptotic Bcl-2 family member that acts as a sensitizer in intrinsic apoptosis by inactivating antiapoptotic members through heterodimer formation. Bad has been shown to contribute to tumorigenesis, including lymphoma formation in humans and mice, through alteration in expression or functional status. Here, its immunohistochemical expression was analyzed in canine nonneoplastic and lymphoma tissues using tissue microarrays. Bad was expressed in the cytoplasm of a wide range of nonneoplastic tissues, especially epithelial cells. Nonneoplastic lymph nodes displayed weak immunostaining in the follicular germinal centers only. Immunoblotting supported these observations but also revealed presence of nonspecific labeling in some organs. Of 81 lymphomas, 29 (35.8%) displayed moderate to strong immunohistochemical Bad labeling, and a significant expression increase was found in lymphomas (especially B cell and double negative) compared to nonneoplastic lymph nodes. These findings warrant further investigations of the functional status, the involvement of partner proteins, and a possible impact of Bad on prognosis in canine lymphoma.
Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T
1995-06-01
For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.
Cytotoxic action of Brazilian propolis in vitro on canine osteosarcoma cells.
Cinegaglia, N C; Bersano, P R O; Búfalo, M C; Sforcin, J M
2013-09-01
Osteosarcoma (OSA) is a primary bone neoplasm frequently diagnosed in dogs. The biology of OSA in pet dogs is identical to that of pediatric patients, and it has been considered an excellent model in vivo to study human OSA. Since the individual response to chemotherapy is unpredictable and considering that propolis is a natural product with several biological properties, this work evaluated the cytotoxic action of propolis on canine OSA cells. The primary cell culture of canine OSA was obtained from the tumor of a dog with OSA. Cell viability was assessed after incubation with propolis, 70% ethanol (propolis solvent), and carboplatin after 6, 24, 48, and 72 h. Cell viability was analyzed by the crystal violet method. Data showed that canine OSA cells were sensitive to propolis in a dose- and time-dependent manner and had a distinct morphology compared to control. Its solvent (70% ethanol) had no effect on cell viability, suggesting that the cytotoxic action was exclusively due to propolis. Our propolis sample exerted a cytotoxic effect on canine OSA cells, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment. Copyright © 2012 John Wiley & Sons, Ltd.
Rabies and canine distemper virus epidemics in the red fox population of northern Italy (2006-2010.
Directory of Open Access Journals (Sweden)
Pierre Nouvellet
Full Text Available Since 2006 the red fox (Vulpes vulpes population in north-eastern Italy has experienced an epidemic of canine distemper virus (CDV. Additionally, in 2008, after a thirteen-year absence from Italy, fox rabies was re-introduced in the Udine province at the national border with Slovenia. Disease intervention strategies are being developed and implemented to control rabies in this area and minimise risk to human health. Here we present empirical data and the epidemiological picture relating to these epidemics in the period 2006-2010. Of important significance for epidemiological studies of wild animals, basic mathematical models are developed to exploit information collected from the surveillance program on dead and/or living animals in order to assess the incidence of infection. These models are also used to estimate the rate of transmission of both diseases and the rate of vaccination, while correcting for a bias in early collection of CDV samples. We found that the rate of rabies transmission was roughly twice that of CDV, with an estimated effective contact between infected and susceptible fox leading to a new infection occurring once every 3 days for rabies, and once a week for CDV. We also inferred that during the early stage of the CDV epidemic, a bias in the monitoring protocol resulted in a positive sample being almost 10 times more likely to be collected than a negative sample. We estimated the rate of intake of oral vaccine at 0.006 per day, allowing us to estimate that roughly 68% of the foxes would be immunised. This was confirmed by field observations. Finally we discuss the implications for the eco-epidemiological dynamics of both epidemics in relation to control measures.
KUBO, Shotaro; TATENO, Morihiro; ICHIKAWA, Yasuaki; ENDO, Yasuyuki
2015-01-01
Tick-borne diseases are often encountered in canine clinical practice. In the present study, a molecular epidemiological survey of dogs in Japan was conducted to understand the prevalence and geographical distribution of Babesia spp., Hepatozoon spp., Ehrlichia spp. and Anaplasma spp. Pathogen-derived DNA in blood samples obtained from 722 dogs with a history of exposure to ticks and/or fleas was examined by PCR. The prevalence of Babesia gibsoni, Babesia odocoilei-like species, Hepatozoon canis and Ehrlichia spp./Anaplasma spp. was 2.4% (16/722), 0.1% (1/722), 2.5% (18/722) and 1.5% (11/722), respectively. While B. gibsoni and Ehrlichia spp./Anaplasma spp. were detected in the western part of Japan, H. canis was detected in Tohoku area in addition to western and central parts of Japan. PMID:25947226
Montoya-Alonso, J A; Carretón, E; Morchón, R; Silveira-Viera, L; Falcón, Y; Simón, F
2016-01-30
Cardiopulmonary dirofilariosis (heartworm) is a zoonotic vector borne disease caused by Dirofilaria immitis which affects domestic dogs and cats. Two of the seven Canary Islands are historically hyperendemic areas of dirofilariosis, although no epidemiological study has ever been carried out which includes the other islands. The aim of the study was to complete the epidemiological status of cardiopulmonary dirofilariosis in the canine and feline population throughout all the Canary Islands. 1643 client-owned dogs and 707 client-owned cats were tested for D. immitis antigens (dogs), and anti-D. immitis and anti-Wolbachia antibodies (cats). The prevalence of canine dirofilariosis in the Canary Islands was 15.7%, and the seroprevalence of feline dirofilariosis was 18.1%. A remarkable disparity was found when evaluating the results by island separately, which ranged from from 0% in Lanzarote and El Hierro, low prevalences and seroprevalences in Fuerteventura (1.8% and 2.5% in dogs and cats, respectively), to higher prevalences on the other 4 islands; ranging between 15.7% (dogs) and 14.3% (cats) in La Palma 22.5% (dogs) and 24.1% (cats) in Tenerife. In addition, prevalences and seroprevalences were very variable within each island, these differences being associated to local climate conditions. The distribution and prevalence of dirofilariosis in the Canary Islands is heterogeneous and related to climate, demographic factors and management of pets in the studied areas. Dirofilariosis remains hyperendemic in 4 of the 7 Islands. Since D. immitis is a zoonosis, veterinary and health authorities should be aware of the current prevalence and seroprevalence of animal dirofilariosis. The results show the need for awareness raising campaigns to promote the implementation of prophylactic measures in pets, in order to achieve a decrease in the prevalence of animal dirofilariosis in the Canary Islands. Copyright © 2015 Elsevier B.V. All rights reserved.
Mechanical properties of canine osteosarcoma-affected antebrachia.
Steffey, Michele A; Garcia, Tanya C; Daniel, Leticia; Zwingenberger, Allison L; Stover, Susan M
2017-05-01
To determine the influence of neoplasia on the biomechanical properties of canine antebrachia. Ex vivo biomechanical study. Osteosarcoma (OSA)-affected canine antebrachia (n = 12) and unaffected canine antebrachia (n = 9). Antebrachia were compressed in axial loading until failure. A load-deformation curve was used to acquire the structural mechanical properties of neoplastic and unaffected specimens. Structural properties and properties normalized by body weight (BW) and radius length were compared using analysis of variance (ANOVA). Modes of failure were compared descriptively. Neoplastic antebrachia fractured at, or adjacent to, the OSA in the distal radial diaphysis. Unaffected antebrachia failed via mid-diaphyseal radial fractures with a transverse cranial component and an oblique caudal component. Structural mechanical properties were more variable in neoplastic antebrachia than unaffected antebrachia, which was partially attributable to differences in bone geometry related to dog size. When normalized by dog BW and radial length, strength, stiffness, and energy to yield and failure, were lower in neoplastic antebrachia than in unaffected antebrachia. OSA of the distal radial metaphysis in dogs presented for limb amputation markedly compromises the structural integrity of affected antebrachia. However, biomechanical properties of affected bones was sufficient for weight-bearing, as none of the neoplastic antebrachia fractured before amputation. The behavior of tumor invaded bone under cyclic loading warrants further investigations to evaluate the viability of in situ therapies for bone tumors in dogs. © 2017 The American College of Veterinary Surgeons.
Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro
Directory of Open Access Journals (Sweden)
Cintia Xavier de Mello
2014-12-01
Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.
Directory of Open Access Journals (Sweden)
Adina Coșarcă
2014-02-01
Full Text Available Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of teeth. Conclusions: The assessed periodontal indices may signal the appearance of a periodontal disease around the teeth that were surgically and orthodontically treated
Canine Distemper Viral Inclusions in Blood Cells of Four Vaccinated Dogs
McLaughlin, Bruce G.; Adams, Pamela S.; Cornell, William D.; Elkins, A. Darrel
1985-01-01
Four cases of canine distemper were detected by the presence of numerous cytoplasmic inclusions in various circulating blood cells. Fluorescent antibody techniques and electron microscopy confirmed the identity of the viral inclusions. The cases occurred in the same geographic area and within a short time span. All four dogs had been vaccinated against canine distemper, but stress or other factors may have compromised their immune status. The possibility of an unusually virulent virus strain ...
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B
2015-01-01
BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
Nd : YAG surgical laser effects in canine prostate tissue: temperature and damage distribution
van Nimwegen, S. A.; L'Eplattenier, H. F.; Rem, A. I.; van der Lugt, J. J.; Kirpensteijn, J.
2009-01-01
An in vitro model was used to predict short-term, laser-induced, thermal damage in canine prostate tissue. Canine prostate tissue samples were equipped with thermocouple probes to measure tissue temperature at 3, 6, 9 and 12 mm depths. The tissue surface was irradiated with a Nd:YAG laser in contact
Nayak, Reshma; Nayak, Us Krishna; Hegde, Gautam
2010-01-01
Orthodontic diagnosis and treatment planning for growing children must involve growth prediction, especially in the treatment of skeletal problems. Studies have shown that a strong association exists between skeletal maturity and dental calcification stages. The present study was therefore taken up to provide a simple and practical method for assessing skeletal maturity using a dental periapical film and standard dental X-ray machine, to compare the developmental stages of the mandibular canine with that of developmental stages of modified MP3 and to find out if any correlation exists, to determine if the developmental stages of the mandibular canine alone can be used as a reliable indicator for assessment of skeletal maturity. A total of 160 periapical radiographs (80 males and 80 females), of the mandibular right canine and the MP3 region was taken and assessed according to the Dermirjian's stages of dental calcification and the modified MP3 stages. The correlation between the developmental stages of MP3 and the mandibular right canine in male and female groups, is of high statistical significance (p = 0.001). The correlation coefficient between MP3 stages and developmental stages of mandibular canine and chronological age in male and females was found to be not significant. The correlation between the mandibular canine calcification stages and MP3 stages was found to be significant. The developmental stages of the mandibular canine could be used very reliably as a sole indicator for assessment of skeletal maturity.
Directory of Open Access Journals (Sweden)
Pamela M. Ortiz
2018-01-01
Full Text Available Objectives. To investigate the association between unilateral/bilateral maxillary canine impaction and sella-turcica bridging using CBCT imaging. Methods. This retrospective comparative study analyzed 76 CBCT images of the craniofacial complex including sella-turcica. The impacted cuspid group consisted of thirty-eight subjects (7 males, 31 females; mean age, 14.6 ± 3.2 years diagnosed with unilateral (left n=14, right n=11 or bilateral (n=13 palatal canine impaction. The control group included thirty-eight subjects matched by sex (7 males, 31 females; mean age, 19.5 ± 3.6 years with no impaction. Multinomial logistic regression analysis was used to determine the association between unilateral/bilateral canine impaction and right and left sella-turcica bridging. Results. The prevalence of sella-turcica bridging was 59.3% and 50% in the impacted canine and control groups, respectively. Although the odds for unilateral canine impaction were increased in the right and left sella-turcica bridging groups compared to the controls, the difference was not statistically significant. The risk of bilateral impaction was different between the two sides of sella-turcica bridging, but, again, the findings were not statistically significant. Conclusion. Contrary to previous 2D studies, there is no statistically significant association between unilateral/bilateral palatal canine impaction and sella-turcica bridging when using 3D CBCT.
Stimulation with Concanavalin-A Induces IL-17 Production by Canine Peripheral T Cells
Directory of Open Access Journals (Sweden)
Michelle G. Ritt
2015-04-01
Full Text Available The characteristics of canine IL-17-producing cells are incompletely understood. Expression of mRNA encoding orthologs of IL-17 and the IL-17 receptor has been documented in tissues from dogs with arthritis, inflammatory bowel disease, and lymphoma; however, no associations have been found between IL-17 gene expression and disease phenotype in these conditions. Robust assessment of the role of IL-17-producing cells in dogs will require measuring the frequency of these cells in health and disease in balance with other lymphocyte subsets. The aim of this study was to confirm that the T-cell IL-17 response in dogs is evolutionarily conserved. Canine peripheral blood mononuclear cells were stimulated with Concanavalin A with or without polarizing cytokines. We used a canine specific IL-17 ELISA and flow cytometry to identify IL-17-producing T cells. Accumulation of intracellular IL-17 was observed in stimulated CD4 and CD8 T cells. The addition of pro-inflammatory cytokines appeared to enhance polarization of canine CD4 T cells to the Th17 phenotype. Conversely, the addition of IL-2 in the presence of TGF-β resulted in expansion of Treg cells. We conclude that canine IL-17-producing cells behave similarly to those from humans and mice when stimulated with mitogens and polarized with pro-inflammatory or immune regulatory cytokines.
Automation of gender determination in human canines using artificial intelligence
Directory of Open Access Journals (Sweden)
F. Fidya
2017-09-01
Full Text Available Background: Gender determination is an important aspect of the identification process. The tooth represents a part of the human body that indicates the nature of sexual dimorphism. Artificial intelligence enables computers to perform to the same standard the same tasks as those carried out by humans. Several methods of classification exist within an artificial intelligence approach to identifying sexual dimorphism in canines. Purpose: This study aimed to quantify the respective accuracy of the Naive Bayes, decision tree, and multi-layer perceptron (MLP methods in identifying sexual dimorphism in canines. Methods: A sample of results derived from 100 measurements of the diameter of mesiodistal, buccolingual, and diagonal upper and lower canine jaw models of both genders were entered into an application computer program that implements the algorithm (MLP. The analytical process was conducted by the program to obtain a classification model with testing being subsequently carried out in order to obtain 50 new measurement results, 25 each for males and females. A comparative analysis was conducted on the program-generated information. Results: The accuracy rate of the Naive Bayes method was 82%, while that of the decision tree and MLP amounted to 84%. The MLP method had an absolute error value lower than that of its decision tree counterpart. Conclusion: The use of artificial intelligence methods produced a highly accurate identification process relating to the gender determination of canine teeth. The most appropriate method was the MLP with an accuracy rate of 84%.
Experimental research of covered stent implanted in canine hepatic artery
International Nuclear Information System (INIS)
Zhou Bing; Liu Linxiang; Li Minghua; Wang Yongli; Cheng Yongde
2007-01-01
Objective: To evaluate the feasibility of success rate of implantation, post-procedure stenosis rate, apposition ability and endothelialization level, etc. for implantation with balloon-expandable covered stent in canine hepatic artery. Methods: 8 adult canines were implanted with balloon-expendable stents covered by expandable poly Teflon ester membrane (e-PTFEM). Follow-up DSA was performed immediately, 2, 4 and 12 wk after the procedure. The canines were sacrificed for histopathologic examination and statistical analysis with correlation of implantation manenvor and angiographic manifestations. Results: 8 cases were all implanted with the covered stents in proper hepatic artery/right hepatic artery successfully; showing good apposition ability and non-opacification of the separated branches. 2 cases showed intraluminal obvious stenosis( > 50%)of the stent at 2 weeks follow-up, so did 3 cases at 12 weeks follow-up, and the total stenosis rate was 37.5% and 5 cases manifested full endothelialization (3 different locations of the sample all manifested full endothelialization), 3 cased manifested partial endothelialization (at least 1 location of the sample didn't show full endothelialization), and the two terminal parts were easier to get endothelialization than the central part. Before and after the stent implantation, hepatic function of all cases didn't demonstrate any obvious changes. Conclusions: Balloon-expandable covered stent can be implanted in canine hepatic artery. successfully, with good apposition ability, full endothelialization, and no influence on hepatic function. (authors)
Extrusion processing : effects on dry canine diets
Tran, Q.D.
2008-01-01
Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying.
Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the
International Nuclear Information System (INIS)
Pang, Lisa Y.; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J.
2011-01-01
Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology
Energy Technology Data Exchange (ETDEWEB)
Pang, Lisa Y., E-mail: lisa.pang@ed.ac.uk; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J. [Royal (Dick) School of Veterinary Studies and Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG (United Kingdom)
2011-03-30
Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology.
Sigler, Lauren M; Baccetti, Tiziano; McNamara, James A
2011-03-01
Our aim was to investigate the effect of rapid maxillary expansion and transpalatal arch therapy combined with deciduous canine extraction on the eruption rate of palatally displaced canines (PDCs) in patients in the late mixed dentition in a 2-center prospective study. Seventy subjects were enrolled based on PDCs diagnosed on panoramic radiographs. The treatment group (TG, 40 subjects) underwent RME followed by TPA therapy and extraction of the deciduous canines. The control group (CG, 30 subjects) received no orthodontic treatment. At the start of the trial, panoramic radiographs and dental casts were compared between the TG and the CG with the Mann-Whitney U test (P anomalies was reported. No statistically significant difference was found for any measurement at the start of the trial between the 2 groups. The prevalence rates of eruption of the maxillary canines were 80% for the TG and 28% in the CG, a statistically significant difference (chi-square =16.26, P mixed dentition with PDCs. Pretreatment variables indicating success of treatment on the eruption of PDCs were less severe sectors of displacement, prepubertal stages of skeletal maturity, and open root apices of PDCs. Several dental anomalies were associated significantly with PDCs, thus confirming the genetic etiology of this eruption disturbance. Copyright © 2011 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.
DEFF Research Database (Denmark)
Damborg, Peter; Guardabassi, Luca; Pedersen, Karl
2008-01-01
Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...
To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age.
Malik, Pooja; Rana, Vivek; Rehani, Usha
2012-01-01
The purpose of this study was to assess skeletal age and establish relationship between mandibular canine calcification and skeletal age. The study included 147 females aged 10 to 13 years. The subjects were divided into three groups: Group I-comprising of 10 to 11 years old female; Group II-comprising of 11 to 12 years old female; Group III-12 to 13 years female. OPG and hand and wrist radiographs of left side for each subject were taken with prior consent of their parents. The calcification status of canine was evaluated from orthopantomograms according to scores given in Demirjian's method. The stages of ossification of various carpal bones were evaluated using radiographic atlas of Greulich-Pyle and skeletal age was calculated. Data collected was statistically analyzed. The results drawn from this study showed that a strong correlation was observed for canine calcification stage F for 10 to 11 years and for stage G in 11 to 12 years and 12 to 13 years respectively. How to cite this article: Malik P, Rana V, Rehani U. To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age. Int J Clin Pediatr Dent 2012;5(1): 14-19.
Dimopoulou, Maria; Kirpensteijn, Jolle; Moens, Hester; Kik, Marja
2008-07-01
To investigate the histologic characteristics of feline osteosarcoma (OS) and compare the histologic data with phenotypically comparable canine OS. The effects of histologic and clinical variables on survival statistics were evaluated. Retrospective study. Cats (n=62) and dogs (22). Medical records of 62 cats with OS were reviewed for clinically relevant data. Clinical outcome was obtained by telephone interview. Histologic characteristics of OS were classified using a standardized grading system. Histologic characteristics in 22 feline skeletal OS were compared with 22 canine skeletal OS of identical location and subtype. Prognostic variables for clinical outcome were determined using multivariate analysis. Feline OS was characterized by moderate to abundant cellular pleomorphism, low mitotic index, small to moderate amounts of matrix, high cellularity, and a moderate amount of necrosis. There was no significant difference between histologic variables in feline and canine OS. Histologic grade, surgery, and mitotic index significantly influenced clinical outcome as determined by multivariate analysis. Tumor invasion into vessels was not identified as a significant prognosticator. Feline and canine skeletal OS have similar histologic but different prognostic characteristics. Prognosis for cats with OS is related to histologic grade and mitotic index of the tumor.
A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article
Directory of Open Access Journals (Sweden)
S. Gur
2009-05-01
Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.
Epidemiología de campo y epidemiología social Field epidemiology and social epidemiology
Directory of Open Access Journals (Sweden)
Javier Segura del Pozo
2006-03-01
Full Text Available Mediante la comparación de la epidemiología de campo y la epidemiología social, se pretende reflexionar sobre los imaginarios no explícitos que operan en ambos ámbitos, necesariamente convergentes, sobre los obstáculos de la práctica epidemiológica actual para alcanzar su función social y sobre la necesidad de cambiar las bases epistemológicas, metodológicas y prácticas que operan en la epidemiología, empezando por la formación del epidemiólogo de campo. La epidemiología de campo tiende a la acción sin marco teórico. La epidemiología social, por el contrario, tiende a los desarrollos teóricos (reflexión e investigación sobre los determinantes sociales alejados de la acción, debido a los limitantes para cambiar las políticas públicas. Otras diferencias se sitúan en el nivel de intervención (micro/macroespacios, el objeto de intervención (control del brote frente a control de las desigualdades y en la forma de articular la comunicación con la sociedad. Se asemejan en la preocupación por el método, la predominancia de una orientación positivista y condicionada por la estadística, aunque en proceso de cierta apertura epistemológica, la tensión experimentada entre relacionarse con un mundo virtual de bases de datos o con la sociedad real, su situación en la periferia del sistema político-social-institucional-profesional y por estar abocadas a la frustración profesional. Finalmente, se formulan 10 interrogantes a los epidemiólogos de campo sobre su práctica actual, a través de los cuales se podría evaluar si están realizando una epidemiología social, y se sugieren cambios para introducir en la formación y práctica del epidemiólogo.Comparing field epidemiology and social epidemiology, we pretend to think about the no explicit images and meanings operating in both necessary convergent fields, about the obstacles present in epidemiological practice to fulfil its social function and about the necessity of
The effects of sulforaphane on canine osteosarcoma proliferation and invasion.
Rizzo, V L; Levine, C B; Wakshlag, J J
2017-09-01
Recent evidence in in vitro and in vivo models suggests that sulforaphane (SFN), found in raw cruciferous vegetables, may have utility in chemoprevention, as an antineoplastic agent and as a free radical scavenger. The effects of SFN alone or with doxorubicin on cell viability were examined, as well as cell cycle kinetics, invasion capabilities and apoptosis in three canine osteosarcoma cell line (D17, OS 2.4 and HMPOS). Results showed that SFN could not induce cell death at potentially physiological concentrations (canine osteosarcoma. © 2016 John Wiley & Sons Ltd.
Construct canine intracranial aneurysm model by endovascular technique
International Nuclear Information System (INIS)
Liang Xiaodong; Liu Yizhi; Ni Caifang; Ding Yi
2004-01-01
Objective: To construct canine bifurcation aneurysms suitable for evaluating the exploration of endovascular devices for interventional therapy by endovascular technique. Methods: The right common carotid artery of six dogs was expanded with a pliable balloon by means of endovascular technique, then embolization with detached balloon was taken at their originations DAS examination were performed on 1, 2, 3 d after the procedurse. Results: 6 aneurysm models were created in six dogs successfully with the mean width and height of the aneurysms decreasing in 3 days. Conclusions: This canine aneurysm model presents the virtue in the size and shape of human cerebral bifurcation saccular aneurysms on DSA image, suitable for developing the exploration of endovascular devices for aneurismal therapy. The procedure is quick, reliable and reproducible. (authors)
Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment
Energy Technology Data Exchange (ETDEWEB)
Kim, Jong-Hyuk, E-mail: jhkim@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Robinson, Sally [Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Sharkey, Leslie C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); O' Brien, Timothy D. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Dickerson, Erin B. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Modiano, Jaime F., E-mail: modiano@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States)
2014-04-15
Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated
Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment
International Nuclear Information System (INIS)
Kim, Jong-Hyuk; Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C.; Robinson, Sally; Sharkey, Leslie C.; O'Brien, Timothy D.; Dickerson, Erin B.; Modiano, Jaime F.
2014-01-01
Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated
Wallis, Corrin V; Lowden, Preena; Marshall-Jones, Zoe V; Hilton, Anthony C
2018-02-26
Salmonella enterica is a recognised cause of diarrhoea in dogs and humans, yet the potential for transfer of salmonellosis between dogs and their owners is unclear, with reported evidence both for and against Salmonella as a zoonotic pathogen. A collection of 174 S. enterica isolates from clinical infections in humans and dogs were analysed for serotype distribution, carbon source utilisation, chemical and antimicrobial sensitivity profiles. The aim of the study was to understand the degree of conservation in phenotypic characteristics of isolates across host species. Serovar distribution across human and canine isolates demonstrated nine serovars common to both host species, 24 serovars present in only the canine collection and 39 solely represented within the human collection. Significant differences in carbon source utilisation profiles and ampicillin, amoxicillin and chloramphenicol sensitivity profiles were detected in isolates of human and canine origin. Differences between the human and canine Salmonella collections were suggestive of evolutionary separation, with canine isolates better able to utilise several simple sugars than their human counterparts. Generally higher minimum inhibitory concentrations of three broad-spectrum antimicrobials, commonly used in veterinary medicine, were also observed in canine S. enterica isolates. Differential carbon source utilisation and antimicrobial sensitivity profiles in pathogenic Salmonella isolated from humans and dogs are suggestive of distinct reservoirs of infection for these hosts. Although these findings do not preclude zoonotic or anthroponotic potential in salmonellae, the separation of carbon utilisation and antibiotic profiles with isolate source is indicative that infectious isolates are not part of a common reservoir shared frequently between these host species.
Canine and incisor microwear in pitheciids and Ateles reflects documented patterns of tooth use.
Delezene, Lucas K; Teaford, Mark F; Ungar, Peter S
2016-09-01
Platyrrhine species differ in the extent to and the manner in which they use their incisors and canines during food ingestion. For example, Ateles uses its anterior teeth to process mechanically nondemanding soft fruits, while the sclerocarp-harvesting pitheciids rely extensively on these teeth to acquire and process more demanding foods. Pitheciids themselves vary in anterior tooth use, with the pitheciines (Cacajao, Chiropotes, and Pithecia) noted to use their robust canines in a variety of ways to predate seeds, while Callicebus, which rarely predates seeds, uses its incisors and exceptionally short canines to scrape tough mesocarp from fruits. To investigate the relationship between tooth use and dental wear, microwear textures were investigated for the anterior teeth of these five genera of platyrrhine primates. Using a white light confocal microscope, 12 microwear texture attributes that reflect feature size, anisotropy, density, and complexity were recorded from high-resolution epoxy casts of the incisors and canines of adult wild-collected Brazilian specimens of Ateles, Callicebus, Cacajao, Chiropotes, and Pithecia. Pitheciine canines tend to have deep microwear features and complex, anisotropic microwear textures, while Ateles anterior teeth tend to have very small features, low feature density, and less complex and anisotropic surfaces. Callicebus incisor and canine microwear is generally intermediate in size and complexity between those extremes. These findings align with expectations from reported field observations of tooth use and illustrate the potential for using microwear texture analysis to infer patterns of anterior tooth use in extinct primates. Am J Phys Anthropol 161:6-25, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Development of an Arthroscopic Joint Capsule Injury Model in the Canine Shoulder.
Directory of Open Access Journals (Sweden)
David Kovacevic
Full Text Available The natural history of rotator cuff tears can be unfavorable as patients develop fatty infiltration and muscle atrophy that is often associated with a loss of muscle strength and shoulder function. To facilitate study of possible biologic mechanisms involved in early degenerative changes to rotator cuff muscle and tendon tissues, the objective of this study was to develop a joint capsule injury model in the canine shoulder using arthroscopy.Arthroscopic surgical methods for performing a posterior joint capsulectomy in the canine shoulder were first defined in cadavers. Subsequently, one canine subject underwent bilateral shoulder joint capsulectomy using arthroscopy, arthroscopic surveillance at 2, 4 and 8 weeks, and gross and histologic examination of the joint at 10 weeks.The canine subject was weight-bearing within eight hours after index and follow-up surgeries and had no significant soft tissue swelling of the shoulder girdle or gross lameness. Chronic synovitis and macroscopic and microscopic evidence of pathologic changes to the rotator cuff bony insertions, tendons, myotendinous junctions and muscles were observed.This study demonstrates feasibility and proof-of-concept for a joint capsule injury model in the canine shoulder. Future work is needed to define the observed pathologic changes and their role in the progression of rotator cuff disease. Ultimately, better understanding of the biologic mechanisms of early progression of rotator cuff disease may lead to clinical interventions to halt or slow this process and avoid the more advanced and often irreversible conditions of large tendon tears with muscle fatty atrophy.
Expression of monocarboxylate transporter 1 in oral and ocular canine melanocytic tumors.
Shimoyama, Y; Akihara, Y; Kirat, D; Iwano, H; Hirayama, K; Kagawa, Y; Ohmachi, T; Matsuda, K; Okamoto, M; Kadosawa, T; Yokota, H; Taniyama, H
2007-07-01
Solid tumors are composed of a heterogeneous population of cells surviving in various concentrations of oxygen. In a hypoxic environment, tumor cells generally up-regulate glycolysis and, therefore, generate more lactate that must be expelled from the cell through proton transporters to prevent intracellular acidosis. Monocarboxylate transporter 1 (MCT1) is a major proton transporter in mammalian cells that transports monocarboxylates, such as lactate and pyruvate, together with a proton across the plasma membrane. Melanocytic neoplasia occurs frequently in dogs, but the prognosis is highly site-dependent. In this study, 50 oral canine melanomas, which were subdivided into 3 histologic subtypes, and 17 ocular canine melanocytic neoplasms (14 melanocytomas and 3 melanomas) were used to examine and compare MCT1 expression. Immunohistochemistry using a polyclonal chicken anti-rat MCT1 antibody showed that most oral melanoma exhibited cell membrane staining, although there were no significant differences observed among the 3 histologic subtypes. In contrast, the majority of ocular melanocytic tumors were not immunoreactive. Additionally, we documented the presence of a 45-kDa band in cell membrane protein Western blots, and sequencing of a reverse transcriptase polymerase chain reaction band of expected size confirmed its identity as a partial canine MCT1 transcript in 3 oral tumors. Increased MCT1 expression in oral melanomas compared with ocular melanocytic tumors may reflect the very different biology between these tumors in dogs. These results are the first to document canine MCT1 expression in canine tumors and suggest that increased MCT1 expression may provide a potential therapeutic target for oral melanoma.
Migrastatin analogues inhibit canine mammary cancer cell migration and invasion.
Directory of Open Access Journals (Sweden)
Kinga Majchrzak
Full Text Available BACKGROUND: Cancer spread to other organs is the main cause of death of oncological patients. Migration of cancer cells from a primary tumour is the crucial step in the complex process of metastasis, therefore blocking this process is currently the main treatment strategy. Metastasis inhibitors derived from natural products, such as, migrastatin, are very promising anticancer agents. Thus, the aim of our study was to investigate the effect of six migrastatin analogues (MGSTA-1 to 6 on migration and invasion of canine mammary adenocarcinoma cell lines isolated from primary tumours and their metastases to the lungs. Canine mammary tumours constitute a valuable tool for studying multiple aspect of human cancer. RESULTS: OUR RESULTS SHOWED THAT TWO OF SIX FULLY SYNTHETIC ANALOGUES OF MIGRASTATIN: MGSTA-5 and MGSTA-6 were potent inhibitors of canine mammary cancer cells migration and invasion. These data were obtained using the wound healing test, as well as trans-well migration and invasion assays. Furthermore, the treatment of cancer cells with the most effective compound (MGSTA-6 disturbed binding between filamentous F-actin and fascin1. Confocal microscopy analyses revealed that treatment with MGSTA-6 increased the presence of unbound fascin1 and reduced co-localization of F-actin and fascin1 in canine cancer cells. Most likely, actin filaments were not cross-linked by fascin1 and did not generate the typical filopodial architecture of actin filaments in response to the activity of MGSTA-6. Thus, administration of MGSTA-6 results in decreased formation of filopodia protrusions and stress fibres in canine mammary cancer cells, causing inhibition of cancer migration and invasion. CONCLUSION: Two synthetic migrastatin analogues (MGSTA-5 and MGSTA-6 were shown to be promising compounds for inhibition of cancer metastasis. They may have beneficial therapeutic effects in cancer therapy in dogs, especially in combination with other anticancer drugs
Detection of Ammonium Nitrate Variants by Canine: A Study of Generalization between Like Substances
2018-04-30
Memorandum Report Homemade explosive Detector dog Canine behavior/ learning Ammonium nitrate Canine training 61-4687-08 Office...varying temperatures and humidities...presence of contaminants, the form in which the AN is found (i.e. prill, ground, or crystalline), and environmental conditions (i.e. temperature and
Nasolacrimal obstruction caused by root abscess of the upper canine in a cat.
Anthony, James M G; Sandmeyer, Lynne S; Laycock, Amanda R
2010-03-01
A 10-year-old, castrated male domestic short hair cat was presented to the Small Animal Clinic at the Western College of Veterinary Medicine with a presenting complaint of chronic, ocular discharge from the left eye. Ocular examination confirmed epiphora and mucopurulent discharge but there were no apparent reasons for the ocular discharge, and nasolacrimal obstruction was suspected. The cat had swelling of the left side of the face, severe periodontal disease and a fractured upper left canine tooth with pulpal exposure. Dacryocystorhinography revealed narrowing of the nasolacrimal duct above the root of the fractured upper left canine and dental radiographs showed a severe periapical lucency at the apex of the upper left canine tooth. The fractured canine tooth was removed. Subsequently, the ocular discharge and facial swelling resolved. After 2 years, the epiphora has never reoccurred. This is a noteworthy case because a suspected root abscess resulted in extralumenal compression of the nasolacrimal duct, which shows the importance of a thorough oral examination when nasolacrimal obstruction is evident.
Characterization of STAT3 activation and expression in canine and human osteosarcoma
Directory of Open Access Journals (Sweden)
Li Pui-Kai
2009-03-01
Full Text Available Abstract Background Dysregulation of signal transducer and activator of transcription 3 (STAT3 has been implicated as a key participant in tumor cell survival, proliferation, and metastasis and is often correlated with a more malignant tumor phenotype. STAT3 phosphorylation has been demonstrated in a subset of human osteosarcoma (OSA tissues and cell lines. OSA in the canine population is known to exhibit a similar clinical behavior and molecular biology when compared to its human counterpart, and is often used as a model for preclinical testing of novel therapeutics. The purpose of this study was to investigate the potential role of STAT3 in canine and human OSA, and to evaluate the biologic activity of a novel small molecule STAT3 inhibitor. Methods To examine STAT3 and Src expression in OSA, we performed Western blotting and RT-PCR. OSA cells were treated with either STAT3 siRNA or small molecule Src (SU6656 or STAT3 (LLL3 inhibitors and cell proliferation (CyQUANT, caspase 3/7 activity (ELISA, apoptosis (Western blotting for PARP cleavage and/or viability (Wst-1 were determined. Additionally, STAT3 DNA binding after treatment was determined using EMSA. Expression of STAT3 targets after treatment was demonstrated with Western blotting, RT-PCR, or gel zymography. Results Our data demonstrate that constitutive activation of STAT3 is present in a subset of canine OSA tumors and human and canine cell lines, but not normal canine osteoblasts. In both canine and human OSA cell lines, downregulation of STAT3 activity through inhibition of upstream Src family kinases using SU6656, inhibition of STAT3 DNA binding and transcriptional activities using LLL3, or modulation of STAT3 expression using siRNA, all resulted in decreased cell proliferation and viability, ultimately inducing caspase-3/7 mediated apoptosis in treated cells. Furthermore, inhibition of either Src or STAT3 activity downregulated the expression of survivin, VEGF, and MMP2, all known
Characterization of STAT3 activation and expression in canine and human osteosarcoma
International Nuclear Information System (INIS)
Fossey, Stacey L; Liao, Albert T; McCleese, Jennifer K; Bear, Misty D; Lin, Jiayuh; Li, Pui-Kai; Kisseberth, William C; London, Cheryl A
2009-01-01
Dysregulation of signal transducer and activator of transcription 3 (STAT3) has been implicated as a key participant in tumor cell survival, proliferation, and metastasis and is often correlated with a more malignant tumor phenotype. STAT3 phosphorylation has been demonstrated in a subset of human osteosarcoma (OSA) tissues and cell lines. OSA in the canine population is known to exhibit a similar clinical behavior and molecular biology when compared to its human counterpart, and is often used as a model for preclinical testing of novel therapeutics. The purpose of this study was to investigate the potential role of STAT3 in canine and human OSA, and to evaluate the biologic activity of a novel small molecule STAT3 inhibitor. To examine STAT3 and Src expression in OSA, we performed Western blotting and RT-PCR. OSA cells were treated with either STAT3 siRNA or small molecule Src (SU6656) or STAT3 (LLL3) inhibitors and cell proliferation (CyQUANT), caspase 3/7 activity (ELISA), apoptosis (Western blotting for PARP cleavage) and/or viability (Wst-1) were determined. Additionally, STAT3 DNA binding after treatment was determined using EMSA. Expression of STAT3 targets after treatment was demonstrated with Western blotting, RT-PCR, or gel zymography. Our data demonstrate that constitutive activation of STAT3 is present in a subset of canine OSA tumors and human and canine cell lines, but not normal canine osteoblasts. In both canine and human OSA cell lines, downregulation of STAT3 activity through inhibition of upstream Src family kinases using SU6656, inhibition of STAT3 DNA binding and transcriptional activities using LLL3, or modulation of STAT3 expression using siRNA, all resulted in decreased cell proliferation and viability, ultimately inducing caspase-3/7 mediated apoptosis in treated cells. Furthermore, inhibition of either Src or STAT3 activity downregulated the expression of survivin, VEGF, and MMP2, all known transcriptional targets of STAT3. These data
Directory of Open Access Journals (Sweden)
Xinyu Wang
Full Text Available To trace the evolution of canine coronavirus (CCoV, 201 stool samples from diarrheic dogs in northeast China were subjected to reverse transcription-polymerase chain reactions (RT-PCRs targeting the partial M and S genes of CCoV, followed by an epidemiological analysis. M gene RT-PCRs showed that 28.36% (57/201 of the samples were positive for CCoV; of the 57 positive samples, CCoV-I and CCoV-II accounted for 15.79% (9/57 and 84.21% (48/57, respectively. A sequence comparison of the partial M gene revealed nucleotide homologies of 88.4%-100% among the 57 CCoV strains, and 88.7%-96.2% identity between the 57 CCoV strains and the Chinese reference strain HF3. The CCoV-I and CCoV-II strains exhibited genetic diversity when compared with reference strains from China and other countries. The 57 CCoV strains exhibited high co-infection rates with canine kobuvirus (CaKV (33.33% and canine parvovirus-2 (CPV-2 (31.58%. The CCoV prevalence in diarrheic dogs differed significantly with immunization status, regions, seasons, and ages. Moreover, 28 S genes were amplified from the 57 CCoV-positive samples, including 26 CCoV-IIa strains, one CCoV-IIb strain, and one CCoV-I strain. A sequence comparison of the partial S gene revealed 86.3%-100% nucleotide identity among the 26 CCoV-IIa strains, and 89.6%-92.2% identity between the 26 CCoV-IIa strains and the Chinese reference strain V1. The 26 CCoV-IIa strains showed genetic diversity when compared with reference strains from China and other countries. Our data provide evidence that CCoV-I, CCoV-IIa, and CCoV-IIb strains co-circulate in the diarrhoetic dogs in northeast China, high co-infection rates with CaKV and CPV-2 were observed, and the CCoV-II strains exhibited high prevalence and genetic diversity.
Ertan Erdinc, Aslihan M
2008-01-01
Impaction of maxillary canines is a common orthodontic anomaly that causes facial and dentoalveolar system problems, both functional and esthetic. A combination of surgery and orthodontics is important in bringing impacted canines to their ideal position in the dental arch. In this case report of a 14-year-old patient with impacted right and left maxillary canines, the crowns of these teeth were surgically exposed, brackets were bonded, and light orthodontic forces were delivered for 2 years to align the teeth in the dental arch.
Kim, S-J; Kwon, Y-H; Hwang, C-J
2016-05-01
The objective of this study was to compare the biomechanical characteristics between two types of self-ligating brackets and conventional metal brackets using finite element analysis of a vertically displaced canine model focusing on the desired force on the canine and undesirable forces on adjacent teeth. Three-dimensional finite element models of the maxillary dentition with 1-mm, 2-mm, and 3-mm vertically displaced canines were constructed. Two different self-ligating brackets (In-Ovation C and Smart clip) and a conventional metal bracket (Micro-arch) were modeled. After a 0.016-inch NiTi (0.40 mm, round) wire was engaged, the displacement of each tooth was calculated using x-, y-, and z-coordinates, and the tensile and compressive stresses were calculated. The extrusion and maximal tensile stress of the canine differed little between the three brackets, but the intrusion and minimal compressive stress values of the adjacent teeth differed considerably and were highest in the Smart clip and least in the In-Ovation C. The extrusion and maximal tensile stress of the canine in the 3-mm displacement model was less than that in the 2-mm displacement model, and the intrusion and minimal compressive stress of the adjacent teeth increased with the degree of displacement. Self-ligating brackets were not superior to conventional brackets in leveling a vertically displaced canine. A continuous arch wire may not be recommended for leveling of severely displaced canines whether using self-ligating or conventional brackets. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Behling-Kelly, Erica
2016-03-01
The evaluation of lipoprotein metabolism in small animal medicine is hindered by the lack of a gold standard method and paucity of validation data to support the use of automated chemistry methods available in the typical veterinary clinical pathology laboratory. The physical and chemical differences between canine and human lipoproteins draw into question whether the transference of some of these human methodologies for the study of canine lipoproteins is valid. Validation of methodology must go hand in hand with exploratory studies into the diagnostic or prognostic utility of measuring specific lipoproteins in veterinary medicine. The goal of this study was to compare one commercially available wet-chemistry method to manual and automated lipoprotein electrophoresis in the analysis of canine lipoproteins. Canine lipoproteins from 50 dogs were prospectively analyzed by 2 electrophoretic methods, one automated and one manual method, and one wet-chemistry method. Electrophoretic methods identified a higher proportion of low-density lipoproteins than the wet-chemistry method. Automated electrophoresis occasionally failed to identify very low-density lipoproteins. Wet-chemistry methods designed for evaluation of human lipoproteins are insensitive to canine low-density lipoproteins and may not be applicable to the study of canine lipoproteins. Automated electrophoretic methods will likely require significant modifications if they are to be used in the analysis of canine lipoproteins. Studies aimed at determining the impact of a disease state on lipoproteins should thoroughly investigate the selected methodology prior to the onset of the study. © 2016 American Society for Veterinary Clinical Pathology.
Amorim, Irina; Freitas, Daniela P; Magalhães, Ana; Faria, Fátima; Lopes, Célia; Faustino, Augusto M; Smet, Annemieke; Haesebrouck, Freddy; Reis, Celso A; Gärtner, Fátima
2014-08-01
The gastric mucosa of dogs is often colonized by non-Helicobacter pylori helicobacters (NHPH), while H. pylori is the predominant gastric Helicobacter species in humans. The colonization of the human gastric mucosa by H. pylori is highly dependent on the recognition of host glycan receptors. Our goal was to define the canine gastric mucosa glycophenotype and to evaluate the capacity of different gastric Helicobacter species to adhere to the canine gastric mucosa. The glycosylation profile in body and antral compartments of the canine gastric mucosa, with focus on the expression of histo-blood group antigens was evaluated. The in vitro binding capacity of FITC-labeled H. pylori and NHPH to the canine gastric mucosa was assessed in cases representative of the canine glycosylation pattern. The canine gastric mucosa lacks expression of type 1 Lewis antigens and presents a broad expression of type 2 structures and A antigen, both in the surface and glandular epithelium. Regarding the canine antral mucosa, H. heilmannii s.s. presented the highest adhesion score whereas in the body region the SabA-positive H. pylori strain was the strain that adhered more. The canine gastric mucosa showed a glycosylation profile different from the human gastric mucosa suggesting that alternative glycan receptors may be involved in Helicobacter spp. binding. Helicobacter pylori and NHPH strains differ in their ability to adhere to canine gastric mucosa. Among the NHPH, H. heilmannii s.s. presented the highest adhesion capacity in agreement with its reported colonization of the canine stomach. © 2014 John Wiley & Sons Ltd.
uPAR EXPRESSION IN CANINE NORMAL PROSTATE AND WITH PROLIFERATIVE DISORDERS
Directory of Open Access Journals (Sweden)
Mariana Rodrigues Faleiro
2013-06-01
Full Text Available Prostatic lesions such as prostatic intraepithelial neoplasia (PIN and proliferative inflammatory atrophy (PIA are studied in human and canine species due to their malignance potential. The plasminogen activator (PA system has been suggested to play a central role in cell adhesion, angiogenesis, inflammation, and tumor invasion. The urokinase-type plasminogen activator receptor (uPAR is a component of the PA, with a range of expression in tumor and stromal cells. In this study, uPAR expression in both canine normal prostates and with proliferative disorders (benign prostatic hyperplasia-BPH, proliferative inflammatory atrophy-PIA, prostatic intraepithelial neoplasia-PIN, and carcinoma-PC was evaluated by immunohistochemistry in a tissue microarray (TMA slide to establish the role of this enzyme in extracellular matrix (ECM remodeling and in the processes of tissue invasion. A total of 298 cores and 355 diagnoses were obtained, with 36 (10.1% normal prostates, 46 (13.0% with BPH, 128 (36.1% with PIA, 74 (20.8% with PIN and 71 (20.0% with PC. There is variation in the expression of uPAR in canine prostate according to the lesion, with lower expression in normal tissue and with BPH, and higher expression in tissue with PIA, PIN and PC. The high expression of uPAR in inflammatory and neoplastic microenvironment indicates increased proteolytic activity in canine prostates with PIA, PIN, and PC.
Duque-García, Yeison; Echeverri-Zuluaga, Manuela; Trejos-Suarez, Juanita; Ruiz-Saenz, Julian
2017-03-01
Since its identification in 1978, Canine parvovirus type 2 (CPV-2) has been considered a pathogen of great importance in the canine population because it causes severe enteritis with high mortality rates in pups. CPV-2 is a virus belonging to the family Parvoviridae. Currently, there are three described antigenic variants (CPV-2a, CPV-2b, and CPV-2c). CPV-2c is an emerging virus that is seen as a global health hazard. The objective of this work was to confirm the presence of CPV-2 in dogs with acute gastroenteritis compatible with parvovirus and to molecularly characterize the antigenic variants circulating in two regions of Colombia. An analytical cross-sectional study was conducted with fecal samples collected from 71 dogs showing signs of acute diarrhea. The samples were processed and polymerase chain reaction (PCR), restriction fragment length polymorphism analysis (RFLP), sequencing and phylogenetic analysis was performed to detect and characterize CPV. A total of 70.42% of the individuals were confirmed positive for CPV-2. Statistically differences were found in the presentation of CPV-2 between the evaluated regions. Phylogenetic analyses confirmed the presence of the antigenic variants CPV-2a/2b. Moreover, we found the presence of two conserved substitutions Asn428Asp and Ala514Ser in the VP2 protein suggesting the presence of a possible new CPV-2a variant circulating in Colombia. This study demonstrates the importance of the CPV 2a/2b in the region and highlights the importance of performing molecular studies for the early detection of new antigenic variants of CPV-2. Copyright © 2017 Elsevier B.V. All rights reserved.
Penetration of ASM 981 in canine skin: a comparative study.
Gutzwiller, Meret E Ricklin; Reist, Martin; Persohn, Elke; Peel, John E; Roosje, Petra J
2006-01-01
ASM 981 has been developed for topical treatment of inflammatory skin diseases. It specifically inhibits the production and release of pro-inflammatory cytokines. We measured the skin penetration of ASM 981 in canine skin and compared penetration in living and frozen skin. To make penetration of ASM 981 visible in dog skin, tritium labelled ASM 981 was applied to a living dog and to defrosted skin of the same dog. Using qualitative autoradiography the radioactive molecules were detected in the lumen of the hair follicles until the infundibulum, around the superficial parts of the hair follicles and into a depth of the dermis of 200 to 500 microm. Activity could not be found in deeper parts of the hair follicles, the dermis or in the sebaceous glands. Penetration of ASM 981 is low in canine skin and is only equally spread in the upper third of the dermis 24 hours after application. Penetration in frozen skin takes even longer than in living canine skin but shows the same distribution.
Adjuvant therapy with carboplatin and pamidronate for canine appendicular osteosarcoma.
Kozicki, A R; Robat, C; Chun, R; Kurzman, I D
2015-09-01
Amputation and chemotherapy are the mainstay of treatment for canine appendicular osteosarcoma (OSA). In vitro studies have demonstrated anti-tumour activity of pamidronate against canine OSA. The purpose of this study was to assess the safety of adding pamidronate to standard post-operative carboplatin chemotherapy in 17 dogs with appendicular OSA treated with limb amputation. Median disease-free interval (DFI) and median survival time (MST) were evaluated as secondary endpoints. Incidence of side effects and treatment outcomes were compared to 14 contemporary control patients treated with carboplatin alone. There were no identified side effects to the pamidronate treatment. The median DFI for the study group was 185 days compared to 172 days for the control group (P = 0.90). The MST of the study group was 311 days compared to 294 days for the control group (P = 0.89). Addition of pamidronate to carboplatin chemotherapy for the treatment of canine appendicular OSA is safe and does not impair efficacy of standard carboplatin treatment. © 2013 Blackwell Publishing Ltd.
Surgical treatments of the impacted canine tooth in young dogs
International Nuclear Information System (INIS)
Amimoto, A.; Iwamoto, S.; Hachimura, H.; Sasaki, K.; Taura, Y.; Nakama, S.; Yamanouchi, T.
1993-01-01
Surgical treatments of the impacted canine tooth were carried out in 8 young dogs, and the results were successful in 12 out of 14 cases (85.7%). The treatments consisting of surgical correction by immediate tipping movement, fenestration of the gingiva, and removal of the impacted tooth, were applied to 14 cases radiographically showing the immature tooth root and no abnormalities in the tooth root or alveolar bone. Impacted teeth were seen in 8 regions of the maxilla and 6 regions of the mandible. Mesioversion was seen in almost all maxillary impacted teeth, while linguoversion or lingual mesioversion in all mandibular cases. Surgical correction was carried out by immediate tipping movement after removal of the retained deciduous canine with or without resection of the alveolar bone. Fixation of the moved teeth was done using a wedge made from the deciduous canine root, which was driven into the vacant alveolar cavity after moving. An additional fixation using a steel wire and/or self-curing resin was done, if necessary
Nonsurgical, nonextraction management of impacted maxillary canine
Directory of Open Access Journals (Sweden)
Jasneet Singh
2018-01-01
Full Text Available NS, a 12 year 2 months old female patient, presented with the chief complaint of irregular teeth. Diagnosis revealed skeletal Class II jaw base relation, with average (toward vertical growth pattern, dentoalveolar angles Class I molar relationship with severe crowding in upper and moderate crowding in the lower arch, normally positioned maxillary incisors but proclined lower incisors, “V” shape constricted maxillary arch with first premolar in crossbite, overretained deciduous molar and a high placed buccoversion canine in the first quadrant and an impacted canine in the second quadrant, constricted mandibular arch with first premolar blocked out in the third quadrant. Treatment with a nonsurgical, nonextraction treatment plan by expansion of the upper arch and taking advantage of natural eruptive forces of the tooth was planned. The final outcome solved the patient's complaints and achieved an esthetically pleasing and functionally adequate occlusal result.
Measurement of lower canine clinical crown index in male and female for gender identification
Directory of Open Access Journals (Sweden)
Rita Dewi Handayani
2007-11-01
Full Text Available The purpose of this research was to acquire the value index of clinical crown lower jaw canine male and female, and to prove whether the index of male's canine is bigger than female's. The samples of the research was the students of Faculty of Dentistry Universitas Padjadjaran class of 1998 until 2001 by using proportional random sampling method according to the criteria and also adjust with the numbers of male and female composition in per class. The characteristic of the research was analytical descriptive with survey technique. The result of t test statistic measurement was that index of clinical crown tower jaw canine of mate was 1.50 and female was 1.21, by using reliance 95%. The inference of the research showed that the index of clinical crown lower jaw canine of male was significantly bigger than female's. The result of the research can be used as auxiliary data from the techniques to process gender identification in odontology forensic.
Brusveen, Elin Marie Gravdal; Brudvik, Pongsri; Bøe, Olav Egil; Mavragani, Maria
2012-04-01
The purpose of the study was to evaluate impacted maxillary canines as risk factor for orthodontic apical root resorption. The sample comprised 66 patients treated with fixed appliances. Thirty-two patients with a unilateral impacted maxillary canine, which was distanced from the roots of the incisors at a preliminary phase of treatment before bonding, formed the impaction group, and 34 patients without impactions served as the controls. Root shortening was calculated by using pretreatment and posttreatment intraoral radiographs. Inclination of the eruption path of the impacted canine relative to the midline, axis of the lateral incisor, and nasal line, root development, and the medial and vertical positions of the impacted tooth were recorded on orthopantomograms and lateral cephalometric films. The follicle/tooth ratio was evaluated by using periapical radiographs. No significant difference in apical resorption of the maxillary incisors was detected between the impaction and control groups, or between the incisors of the impacted and contralateral sides in the same subject. Likewise, no difference in the severity of root resorption was found between the incisors of impacted side alone and the incisors of the control group. Mesial and vertical inclinations of the impacted canines were negatively related to a lateral incisor's root resorption. No correlations were found between resorption and medial or vertical position of the crown of the canine. The follicle/tooth ratio was significantly related to the mesial inclination of the impacted canine, but not to root resorption. An impacted maxillary canine, after being distanced from the incisor roots, does not seem to be a risk factor for apical root resorption during orthodontic treatment. Copyright © 2012 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.
Rabies and Canine Distemper Virus Epidemics in the Red Fox Population of Northern Italy (2006–2010)
De Benedictis, Paola; Citterio, Carlo; Obber, Federica; Lorenzetto, Monica; Pozza, Manuela Dalla; Cauchemez, Simon; Cattoli, Giovanni
2013-01-01
Since 2006 the red fox (Vulpes vulpes) population in north-eastern Italy has experienced an epidemic of canine distemper virus (CDV). Additionally, in 2008, after a thirteen-year absence from Italy, fox rabies was re-introduced in the Udine province at the national border with Slovenia. Disease intervention strategies are being developed and implemented to control rabies in this area and minimise risk to human health. Here we present empirical data and the epidemiological picture relating to these epidemics in the period 2006–2010. Of important significance for epidemiological studies of wild animals, basic mathematical models are developed to exploit information collected from the surveillance program on dead and/or living animals in order to assess the incidence of infection. These models are also used to estimate the rate of transmission of both diseases and the rate of vaccination, while correcting for a bias in early collection of CDV samples. We found that the rate of rabies transmission was roughly twice that of CDV, with an estimated effective contact between infected and susceptible fox leading to a new infection occurring once every 3 days for rabies, and once a week for CDV. We also inferred that during the early stage of the CDV epidemic, a bias in the monitoring protocol resulted in a positive sample being almost 10 times more likely to be collected than a negative sample. We estimated the rate of intake of oral vaccine at 0.006 per day, allowing us to estimate that roughly 68% of the foxes would be immunised. This was confirmed by field observations. Finally we discuss the implications for the eco-epidemiological dynamics of both epidemics in relation to control measures. PMID:23630599
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Directory of Open Access Journals (Sweden)
Mehdi Hayat Shahi
Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.