
Sample records for canine hypoadrenocorticism part

  1. Primary hypoadrenocorticism in ten cats. (United States)

    Peterson, M E; Greco, D S; Orth, D N


    Primary hypoadrenocorticism was diagnosed in ten young to middle-aged cats of mixed breeding. Five of the cats were male, and five were female. Historic signs included lethargy (n = 10), anorexia (n = 10), weight loss (n = 9), vomiting (n = 4), and polyuria (n = 3). Dehydration (n = 9), hypothermia (n = 8), prolonged capillary refill time (n = 5), weak pulse (n = 5), collapse (n = 3), and sinus bradycardia (n = 2) were found on physical examination. Results of initial laboratory tests revealed anemia (n = 3), absolute lymphocytosis (n = 2), absolute eosinophilia (n = 1), and azotemia and hyperphosphatemia (n = 10). Serum electrolyte changes included hyponatremia (n = 10), hyperkalemia (n = 9), hypochloremia (n = 9), and hypercalcemia (n = 1). The diagnosis of primary adrenocortical insufficiency was established on the basis of results of adrenocorticotropic hormone (ACTH) stimulation tests (n = 10) and endogenous plasma ACTH determinations (n = 7). Initial therapy for hypoadrenocorticism included intravenous administration of 0.9% saline and dexamethasone and intramuscular administration of desoxycorticosterone acetate in oil. Three cats were euthanatized shortly after diagnosis because of poor clinical response. Results of necropsy examination were unremarkable except for complete destruction of both adrenal cortices. Seven cats were treated chronically with oral prednisone or intramuscular methylprednisolone acetate for glucocorticoid supplementation and with oral fludrocortisone acetate or intramuscular injections of repository desoxycorticosterone pivalate for mineralocorticoid replacement. One cat died after 47 days of therapy from unknown causes; the other six cats are still alive and well after 3 to 70 months of treatment. PMID:2469793

  2. Metastatic canine mammary carcinomas can be identified by a gene expression profile that partly overlaps with human breast cancer profiles

    International Nuclear Information System (INIS)

    Similar to human breast cancer mammary tumors of the female dog are commonly associated with a fatal outcome due to the development of distant metastases. However, the molecular defects leading to metastasis are largely unknown and the value of canine mammary carcinoma as a model for human breast cancer is unclear. In this study, we analyzed the gene expression signatures associated with mammary tumor metastasis and asked for parallels with the human equivalent. Messenger RNA expression profiles of twenty-seven lymph node metastasis positive or negative canine mammary carcinomas were established by microarray analysis. Differentially expressed genes were functionally characterized and associated with molecular pathways. The findings were also correlated with published data on human breast cancer. Metastatic canine mammary carcinomas had 1,011 significantly differentially expressed genes when compared to non-metastatic carcinomas. Metastatic carcinomas had a significant up-regulation of genes associated with cell cycle regulation, matrix modulation, protein folding and proteasomal degradation whereas cell differentiation genes, growth factor pathway genes and regulators of actin organization were significantly down-regulated. Interestingly, 265 of the 1,011 differentially expressed canine genes are also related to human breast cancer and, vice versa, parts of a human prognostic gene signature were identified in the expression profiles of the metastatic canine tumors. Metastatic canine mammary carcinomas can be discriminated from non-metastatic carcinomas by their gene expression profiles. More than one third of the differentially expressed genes are also described of relevance for human breast cancer. Many of the differentially expressed genes are linked to functions and pathways which appear to be relevant for the induction and maintenance of metastatic progression and may represent new therapeutic targets. Furthermore, dogs are in some aspects suitable as a

  3. Canine Distemper (United States)

    Although this brochure provides basic information about canine distemper, your veterinarian is always your best source of ... Consult your veterinarian for more information about canine distemper and its prevention. And Now A Note On ...

  4. Canine parvoviruses in New Zealand form a monophyletic group distinct from the viruses circulating in other parts of the world. (United States)

    Ohneiser, S A; Hills, S F; Cave, N J; Passmore, D; Dunowska, M


    Canine parvovirus 2 (CPV-2) is a well-recognized cause of acute haemorrhagic enteritis in dogs worldwide. The aim of the current study was to identify which CPV-2 subtypes circulate among dogs in New Zealand, and to investigate the evolutionary patterns of contemporary CPV-2 viruses. Faecal samples were collected from 79 dogs with suspected CPV-2 infection over the period of 13 months, and tested for the presence of CPV-2 DNA by PCR. Of 70 positive samples, 69 were subtyped as CPV-2a and one as CPV-2. A majority of CPV-2 positive samples were collected from unvaccinated or not-fully vaccinated puppies ≤6 months of age. The haplotype network produced from New Zealand CPV-2 sequences showed no structure when assessed based on location, vaccination status or age of the animals sampled. International haplotype network indicated that, unlike CPV-2 from other countries, the population of CPV-2 in New Zealand appeared to be monophyletic. PMID:26031569

  5. Canine mastocytosis


    Paiva, D.; Mendonça, A; Vala, Helena


    Mastocytosis is a mast cell disorder in which its exaggerated proliferation can occur in two forms: systemic and cutaneous (Davis et al., 1992). Because canine mastocytosis is a rare situation of controversial and difficult diagnosis, the goal of this study consists in a current revision of this subject, in order to sensitize the veterinary staff to its severity, with particular focus on the information the veterinary nurse must hold to better apply a specialized nursing care with the hig...

  6. Canine and feline megaesophagus

    International Nuclear Information System (INIS)

    Megaesophagus is rare in cats and occurs as a congenital or secondary acquired disorder. In dogs, megaesophagus can occur as a congenital disorder, as a secondary acquired disorder, or as an adult-onset idiopathic disease. This article reviews the anatomy, pathogenesis, causes, clinical signs, diagnosis, and management of megaesophagus. Pathogenesis includes experimental evidence that evaluates the neural pathway of affected patients. The many disease that can cause megaesophagus are delineated. Discussion focuses on the most common causes-myasthenia gravis, hypoadrenocorticism and possibly hypothyroidism, and the obstructive lesions of the esophagus (vascular ring anomalies, tumors, granulomas, strictures, and foreign bodies). The most common clinical sign associated with megaesophagus is regurgitation. Traditional as well as newer techniques (i.e., manometry and nuclear scintigraphy) for evaluating esophageal motility are presented. Definitive diagnosis requires identification of a dilated esophagus on survey thoracic radiographs or a barium esophagogram. Medical management, including alternative feeding methods and the role of prokinetic drugs, is discussed

  7. A systematic review of the efficacy of prophylactic control measures for naturally-occurring canine leishmaniosis, part I: vaccinations. (United States)

    Wylie, C E; Carbonell-Antoñanzas, M; Aiassa, E; Dhollander, S; Zagmutt, F J; Brodbelt, D C; Solano-Gallego, L


    Canine leishmaniosis (CanL) is an important zoonotic disease; however, the efficacy of available vaccines for the prevention of naturally-occurring Leishmania infantum (L. infantum) infection in dogs remains unclear. The objective of this review was to determine the efficacy of currently available vaccines to prevent naturally-occurring L. infantum infection in dogs. Four bibliographic databases (CAB Direct 2011, Web of Science 2011, U.S. National Library of Medicine 2011 and Literatura Latino Americana e do Caribe em Ciências da Saúde) were searched along with eight sets of conference proceedings and the International Veterinary Information Service (IVIS) database, from 1980 to November 2012. Randomised controlled trials (RCTs), non-randomised clinical trials (NRCTs), cohort studies and case-control studies that investigated vaccine efficacy for natural L. infantum infection in dogs were eligible for inclusion. Two review authors independently assessed each study against the inclusion criteria, independently extracted relevant data from all included studies and assessed the risk of methodological shortcomings in each individual study. The odds ratio (OR) and absolute risk reduction (ARR) for dichotomous outcomes and mean difference for continuous outcomes were calculated. Meta-analysis was not performed due to heterogeneity of the studies identified. The search was conducted for all mitigations for CanL and yielded the title and abstract of 937 articles, from which 84 articles were screened based on full text. Twelve studies on vaccinations (five RCTs, seven NRCTs) were identified. Ten studies were at a high risk of methodological shortcomings, whilst two were at an unclear risk. The use of 200 μg ALM protein, Leishmune(®), CaniLeish(®), LiESAp with MDP, and ALM with BCG tended to significantly reduce the proportion of dogs infected with L. infantum based on either parasitological or serological evidence. The use of lyophilized protein vaccine significantly

  8. [Use of gold implants as a treatment of pain related to canine hip dysplasia--a review. Part 2: Clinical trials and case reports]. (United States)

    Deisenroth, A; Nolte, I; Wefstaedt, P


    Gold bead implantation/gold acupuncture is becoming increasingly used in veterinary medicine as a method of pain treatment in cases of osteoarthritic diseases. Part one of the overview dealing with the use of gold implants as a treatment of canine hip joint dysplasia (cHD) introduced the method of implanting gold in tissue and publications which investigated the subsequent effects of implantation. This article focuses on publications concerning the clinical effectiveness of gold implantation within the scope of pain therapy in cHD. Due to the study design, a classification using evidence-based levels (EbL) was carried out. Three double-blind, placebo-controlled randomised studies (EbL II) were considered together with three retrospective studies on own patients (EbL IV) and five case studies (EbL IV). While the case and retrospective studies reported impressive therapeutic success in treating cHD-incurred pain with gold implantation, a pain-reducing effect through gold implantation was only demonstrated in one of the three double-blind studies. The two remaining EbL II studies found no differences between the placebo-group and the group of dogs treated with gold implantation. In one of these two studies, kinematic and kinetic gait analyses were used for objective evaluation of the effects of the treatment. Thus, the only study that carried out an objective evaluation of the therapeutic result of gold implantation came to the conclusion that the method is ineffective. For a concluding assessment of gold implantation in the case of cHD, gait analysis studies investigating the effects of gold implantation in comparison to a standard treatment with nonsteroidal anti-inflammatory drugs are currently lacking. PMID:23958708

  9. Canine Leishmaniasis, Italy


    Ferroglio, Ezio; Maroli, Michele; Gastaldo, Silvia; Mignone, Walter; Rossi, Luca


    We report the results of a survey to determine the prevalence of canine leishmaniasis and the presence of sand flies in northwestern Italy, where autochthonous foci of canine leishmaniasis have not been reported. Active foci of canine leishmaniasis were identified, which suggests that the disease is now also endemic in continental climate areas.

  10. Effects of canine serum collected from dogs at different estrous cycle stages on in vitro nuclear maturation of canine oocytes. (United States)

    Oh, Hyun Ju; Fibrianto, Yuda Heru; Kim, Min Kyu; Jang, Goo; Hossein, M Shamim; Kim, Hye Jin; Kang, Sung Keun; Lee, Byeong Chun; Hwang, Woo Suk


    Canine oocytes are ovulated at prophase of the first meiotic division and undergo maturation in the distal part of the oviduct for at least 48-72 h. Because of these differences from other domestic mammals, the efficiency of in vitro maturation (IVM) of canine oocyte is very low. The present study was conducted to evaluate the effects of canine serum on IVM of canine oocytes recovered from ovaries in various reproductive states (follicular, luteal or anestrous stages). Oocytes were recovered by mincing ovaries from bitches presented for ovariohysterectomy at various stages of the estrous cycle. Heat-inactivated canine serum was prepared with blood taken from dogs at the anestrous, estrous or diestrous stage of the estrous cycle as determined by progesterone concentration and vaginal cytology. Oocytes were cultured for 72 h in tissue culture medium (TCM)-199 supplemented with 10% canine anestrous, estrous or diestrous serum or fetal bovine serum (FBS) (experiment 1), or supplemented with 0 (control), 5%, 10% or 20% canine estrous serum (experiment 2). In experiment 1, IVM of oocytes collected at the follicular stage of the estrous cycle to metaphase II (MII) stage was higher (p < 0.05) with canine estrous serum (14.2%) than with canine anestrous (5.2%) or diestrous serum (6.3%), FBS (2.2%) or in the control (2.2%). In experiment 2, oocytes collected at the follicular stage of the estrous cycle cultured in TCM-199 with 10% canine estrous serum showed a higher maturation rate to MII stage (13.5%, p < 0.05) compared with those cultured with 5% (1.3% MII) or 20% canine estrous serum (5.1% MII) or the control (2.7% MII). In conclusion, our results demonstrate that supplementing culture medium with 10% canine estrous serum improves IVM of canine follicular stage oocytes. PMID:16261767

  11. Canine pulmonary angiostrongylosis

    DEFF Research Database (Denmark)

    Koch, Jørgen; Willesen, Jakob Lundgren


    Canine pulmonary angiostrongylosis is an emerging snail-borne disease causing verminous pnemonia and coagulopathy in dogs. The parasite is fund in Europe, North and South America and Africa, covering tropical, subtropical and temperate regions. Its distribution has been characterised by isolated...... larvae may not reflect what happens under field conditions. There is insufficient understanding of the spread of infection and the dynamic consequences of this parasite in the canine population. This review discusses the biology, epidemiology, clinical aspects and management of canine pulmonary...

  12. The Canine Oral Microbiome


    Dewhirst, Floyd E.; Klein, Erin A.; Thompson, Emily C.; Blanton, Jessica M.; Chen, Tsute; Milella, Lisa; Buckley, Catherine M. F.; Davis, Ian J.; Bennett, Marie-Lousie; Marshall-Jones, Zoe V.


    Determining the bacterial composition of the canine oral microbiome is of interest for two primary reasons. First, while the human oral microbiome has been well studied using molecular techniques, the oral microbiomes of other mammals have not been studied in equal depth using culture independent methods. This study allows a comparison of the number of bacterial taxa, based on 16S rRNA-gene sequence comparison, shared between humans and dogs, two divergent mammalian species. Second, canine or...

  13. Evidence-based control of canine rabies: a critical review of population density reduction


    Morters, M.K.; Restif, O.; Hampson, K.; Cleaveland, S.; Wood, J.L.N.; Conlan, A J K; Boots, M.


    Control measures for canine rabies include vaccination and reducing population density through culling or sterilization. Despite the evidence that culling fails to control canine rabies, efforts to reduce canine population density continue in many parts of the world. The rationale for reducing population density is that rabies transmission is density-dependent, with disease incidence increasing directly with host density. This may be based, in part, on an incomplete interpretation of historic...

  14. Canine Gouging: A Taboo Resurfacing in Migrant Urban Population


    Anila Virani Noman; Ferranti Wong; Ravikiran Ramakrishna Pawar


    Cosmopolitan cities have become a pool of migrants from different parts of the world, who carry their cultural beliefs and superstitions with them around the globe. Canine gouging is a kind of infant oral mutilation (IOM) which is widely practiced among rural population of Africa where the primary tooth bud of the deciduous canine is enucleated. The belief is that the life threatening illnesses in children like vomiting, diarrhoea, and fevers are caused by worms which infest on tooth buds. Th...

  15. Vaccines for Canine Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Faeze Foroughi-Parvar


    Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

  16. 9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Hepatitis and Canine Adenovirus...; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus. Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed...

  17. CANINE: a robotic mine dog (United States)

    Stancil, Brian A.; Hyams, Jeffrey; Shelley, Jordan; Babu, Kartik; Badino, Hernán.; Bansal, Aayush; Huber, Daniel; Batavia, Parag


    Neya Systems, LLC competed in the CANINE program sponsored by the U.S. Army Tank Automotive Research Development and Engineering Center (TARDEC) which culminated in a competition held at Fort Benning as part of the 2012 Robotics Rodeo. As part of this program, we developed a robot with the capability to learn and recognize the appearance of target objects, conduct an area search amid distractor objects and obstacles, and relocate the target object in the same way that Mine dogs and Sentry dogs are used within military contexts for exploration and threat detection. Neya teamed with the Robotics Institute at Carnegie Mellon University to develop vision-based solutions for probabilistic target learning and recognition. In addition, we used a Mission Planning and Management System (MPMS) to orchestrate complex search and retrieval tasks using a general set of modular autonomous services relating to robot mobility, perception and grasping.

  18. Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes


    Shields, Emily J.; Lam, Carol J.; Cox, Aaron R.; Rankin, Matthew M.; Van Winkle, Thomas J.; Hess, Rebecka S.; Kushner, Jake A.


    The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been prop...

  19. Canine length in wild male baboons: maturation, aging and social dominance rank.

    Directory of Open Access Journals (Sweden)

    Jordi Galbany

    Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.

  20. The canine vomeronasal organ.


    Adams, D. R.; Wiekamp, M D


    The vomeronasal organ was studied in mature dogs with the optical, transmission electron, and scanning electron microscopes. The canine vomeronasal complex is structurally well developed. Large blood vessels are present deep to both the lateral, 'non-receptor' and medial, 'receptor' epithelia. In addition to the unmyelinated vomeronasal nerves in the lamina propria deep to the 'receptor' epithelium, numerous nerves containing both myelinated and unmyelinated fibres are present deep to the 'no...

  1. Canine Distemper Virus Naturally Infected Pet Dogs in Different Parts of the Detection Rate Analysis%犬瘟热病毒自然感染宠物犬不同部位检出率的分析

    Institute of Scientific and Technical Information of China (English)

    郝中香; 夏丹; 郭玲; 刘晓; 文彩芳; 颜其贵


    Use of RT-PCR detection methods of canine distemper virus (CDV) natural infection pet dogs different parts of samples for testing, determine the distribution of CDV in the tissues of infected dogs. 14 CDV positive dogs only to blood, eye secretions, nasal fluid, saliva, feces and urine testing, detected by RT-PCR positive rates were 92. 9%, 85. 7%, 100%, 85. 7%,100% and 66. 7%, the results showed that the detection rate, the feces and nasal fluid samples was highest, was 100% , it is appropriate to the material as a detection object.%本试验利用RT-PCR检测方法对犬瘟热病毒(CDV)自然感染宠物犬的不同部位样品进行检测,确定CDV在感染犬组织中的分布情况.对14只CDV阳性犬的血液、眼分泌物、鼻液、唾液、粪便和尿液进行检测,RT-PCR方法检出的阳性率分别为92.9%、85.7%、100%、85.7%、100%和66.7%,结果显示粪便和鼻液样品的检出率最高,检出率达100%,宜于作为检测对象取材.

  2. Canine mast cell tumors. (United States)

    Macy, D W


    Despite the fact that the mast cell tumor is a common neoplasm of the dog, we still have only a meager understanding of its etiology and biologic behavior. Many of the published recommendations for treatment are based on opinion rather than facts derived from careful studies and should be viewed with some skepticism. Because of the infrequent occurrence of this tumor in man, only a limited amount of help can be expected from human oncologists; therefore, burden of responsibility for progress in predicting behavior and developing treatment effective for canine mast cell tumors must fall on the shoulders of the veterinary profession. PMID:3929444

  3. Brazilian canine hepatozoonosis. (United States)

    O'Dwyer, Lucia Helena


    The genus Hepatozoon includes hundreds of species that infect birds, reptiles, amphibians and mammals, in all continents with tropical and subtropical climates. Two species have been described in domestic dogs: H. canis, reported in Europe, Asia, Africa, South America and the United States; and H. americanum, which so far has only been diagnosed in the United States. In Brazil, the only species found infecting dogs is H. canis. The objective of this review was to detail some aspects of canine hepatozoonosis, caused by H. canis, and the main points of its biology, transmission, pathogenicity, symptoms, epidemiology and diagnostic methods, with emphasis on research developed in Brazil. PMID:21961746

  4. Extraglandular and intraglandular vascularization of canine prostate. (United States)

    Stefanov, Miroslav


    The literature on the vascularization of the canine prostate is reviewed and the clinical significance of prostate morphology is described. Scanning Electron Microscopy (SEM), combined with improved corrosion casting methods, reveal new morphological details that promise better diagnostics and treatment but also require expansion of clinical nomenclature. A proposal is made for including two previously unnamed veins in Nomina Anatomica Veterinaria (NAV). The canine prostate has two lobes with independent vascularization. Each lobe is supplied through the left and right a. prostatica, respectively. The a. prostatica sprouts three small vessels (cranial, middle, and caudal) towards the prostate gland. A. prostatica is a small-size artery whose wall structure is similar to the arteries of the muscular type. V. prostatica is a small-size valved vein. The canine prostate has capsular, parenchymal, and urethral vascular zones. The surface vessels of the capsule are predominantly veins and the diameter of arterial vessels is larger than that of the veins. The trabecular vessels are of two types: direct and branched. The prostate parenchyma is supplied by branches of the trabecular vessels. The periacinary capillaries are fenestrated and form a net in a circular pattern. The processes of the myoepithelial cells embrace both the acins and the periacinar capillaries. In the prostate ductal system. there are spermatozoa. The prostatic part of the urethra is supplied by an independent branch of a. prostatica. The prostatic urethral part is drained by v. prostatica, the vein of the urethral bulb and the ventral prostate veins. M. urethralis begins as early as the urethral prostatic part. The greater part of the white muscle fibers in m. urethralis suggest an enhanced anaerobic metabolism. PMID:14988915

  5. 9 CFR 113.305 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine. (United States)


    ... STANDARD REQUIREMENTS Live Virus Vaccines § 113.305 Canine Hepatitis and Canine Adenovirus Type 2 Vaccine. Canine Hepatitis Vaccine and Canine Adenovirus Type 2 Vaccine shall be prepared from virus-bearing cell... hepatitis, the test is inconclusive and may be repeated. (B) If at least 19 of the 20 vaccinates do...

  6. Experimental research of covered stent implanted in canine hepatic artery

    International Nuclear Information System (INIS)

    Objective: To evaluate the feasibility of success rate of implantation, post-procedure stenosis rate, apposition ability and endothelialization level, etc. for implantation with balloon-expandable covered stent in canine hepatic artery. Methods: 8 adult canines were implanted with balloon-expendable stents covered by expandable poly Teflon ester membrane (e-PTFEM). Follow-up DSA was performed immediately, 2, 4 and 12 wk after the procedure. The canines were sacrificed for histopathologic examination and statistical analysis with correlation of implantation manenvor and angiographic manifestations. Results: 8 cases were all implanted with the covered stents in proper hepatic artery/right hepatic artery successfully; showing good apposition ability and non-opacification of the separated branches. 2 cases showed intraluminal obvious stenosis( > 50%)of the stent at 2 weeks follow-up, so did 3 cases at 12 weeks follow-up, and the total stenosis rate was 37.5% and 5 cases manifested full endothelialization (3 different locations of the sample all manifested full endothelialization), 3 cased manifested partial endothelialization (at least 1 location of the sample didn't show full endothelialization), and the two terminal parts were easier to get endothelialization than the central part. Before and after the stent implantation, hepatic function of all cases didn't demonstrate any obvious changes. Conclusions: Balloon-expandable covered stent can be implanted in canine hepatic artery. successfully, with good apposition ability, full endothelialization, and no influence on hepatic function. (authors)

  7. New hominin fossils from Kanapoi, Kenya, and the mosaic evolution of canine teeth in early hominins

    Directory of Open Access Journals (Sweden)

    J. Michael Plavcan


    Full Text Available Whilst reduced size, altered shape and diminished sexual dimorphism of the canine–premolar complex are diagnostic features of the hominin clade, little is known about the rate and timing of changes in canine size and shape in early hominins. The earliest Australopithecus, Australopithecus anamensis, had canine crowns similar in size to those of its descendant Australopithecus afarensis, but a single large root alveolus has suggested that this species may have had larger and more dimorphic canines than previously recognised. Here we present three new associated dentitions attributed to A. anamensis, recently recovered from the type site of Kanapoi, Kenya, that provide evidence of canine evolution in early Australopithecus. These fossils include the largest mandibular canine root in the hominin fossil record. We demonstrate that, although canine crown height did not differ between these species, A. anamensis had larger and more dimorphic roots, more like those of extant great apes and Ardipithecus ramidus, than those of A. afarensis. The canine and premolar occlusal shapes of A. anamensis also resemble those of Ar. ramidus, and are intermediary between extant great apes and A. afarensis. A. afarensis achieved Homo-like maxillary crown basal proportions without a reduction in crown height. Thus, canine crown size and dimorphism remained stable during the early evolution of Australopithecus, but mandibular root dimensions changed only later within the A. anamensis–afarensis lineage, coincident with morphological changes in the canine–premolar complex. These observations suggest that selection on canine tooth crown height, shape and root dimensions was not coupled in early hominin evolution, and was not part of an integrated adaptive package.

  8. Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.

    Directory of Open Access Journals (Sweden)

    Emily J Shields

    Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.

  9. Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia

    Directory of Open Access Journals (Sweden)

    Víctor Acero P


    Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.

  10. Surgical innovations in canine gonadectomy

    NARCIS (Netherlands)

    Van Goethem, Bart


    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated n

  11. Prognostic markers of canine pyometra


    M.C. Sant'Anna; L.G.P. Giordano; K.K.M.C. Flaiban; E.E. Muller; M.I.M. Martins


    The pyometra is a disease that affects middle age and elderly female dogs during diestrus. Hormonal, microbiological, biochemical and hematological aspects are well described. However, few studies have evaluated the role of each in the prognosis of canine pyometra. The aim of this study was to identify markers associated with clinical worsening of dogs with pyometra. We prospectively evaluated 80 dogs with pyometra tre...

  12. Maxillary canine with two root canals


    Nagesh Bolla; Sarath Raj Kavuri


    To report a rare case of maxillary canine with two root canals. The case describes the treatment of a maxillary canine with two root canals which was referred from department of prosthodontia for intentional root canal treatment for prosthetic rehabilitation. Clinical examination revealed a maxillary canine with carious lesion and responded within normal limits to electric pulp test. Radiographic examination revealed a distal carious lesion (close proximity to pulp) and also appeared to be an...

  13. Canine specific ELISA for coagulation factor VII

    DEFF Research Database (Denmark)

    Knudsen, Tom; Kjelgaard-Hansen, Mads; Tranholm, Mikael; Wiinberg, Bo; Clausen, Jes T.; Hansen, Jens Jacob; Nichols, Timothy C.; Kjalke, Marianne; Jensen, Asger Lundorff; Kristensen, Annemarie Thuri


    Canine coagulation factor VII (FVII) deficiency can be hereditary or acquired and may cause life threatening bleeding episodes if untreated. FVII procoagulant activity can be measured by FVII activity (FVII:C), but assays for measurement of canine specific FVII antigen (FVII:Ag) have not been...... available to date. In this study, a canine specific ELISA for measurement of FVII:Ag in plasma was developed and validated. The FVII:Ag ELISA correctly diagnosed homozygous and heterozygous hereditary FVII deficiency. Together with activity based assays, such as FVII:C, the FVII:Ag ELISA should be valuable...... in the diagnosis of hereditary canine FVII deficiency....

  14. Sewage surveillance reveals the presence of canine GVII norovirus and canine astrovirus in Uruguay. (United States)

    Lizasoain, A; Tort, L F L; García, M; Gómez, M M; Leite, J P G; Miagostovich, M P; Cristina, J; Berois, M; Colina, R; Victoria, Matías


    Canine norovirus (NoV) and astrovirus (AstV) were studied in 20 domestic sewage samples collected in two cities in Uruguay. Four samples were characterized as canine AstV after phylogenetic analysis clustering with strains detected in Italy and Brazil in 2008 and 2012, respectively. One sample was characterized as canine NoV and clustered with a strain detected in Hong Kong and recently classified as GVII. This study shows the occurrence of a canine NoV GVII strain for the first time in the American continent and also warns about possible zoonotic infection, since canine strains were detected in domestic sewage. PMID:26280526

  15. Canine mammary tumors - clinical survey


    Elena Atanaskova Petrov; Ksenija Ilievska; Plamen Trojacanec; Irena Celeska; Goran Nikolovski; Ivica Gjurovski; Toni Dovenski


    Mammary tumours are the second most frequent neoplasia in dogs, mainly affecting older female patients. Approximately 50% of the mammary tumours are malignant with high percentage of mortality if not treated in time. The aim of this study was to analyze the data of canine patients with mammary tumours, to evaluate the type of tumours, as well as the relationship between tumour incidence and dogs’ age, reproductive cycle and sterilization. The survey was used to retrieve the information in the...

  16. Surgical innovations in canine gonadectomy


    Van Goethem, Bart


    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated negative consequences (lengthy placement, impaired wound healing around bulky knots, and the effect of unsightly knots on cosmetics). A study in 9 dogs found that celiotomy closure was easily achiev...

  17. Canine mammary tumours, an overview. (United States)

    Sleeckx, N; de Rooster, H; Veldhuis Kroeze, E J B; Van Ginneken, C; Van Brantegem, L


    Canine mammary tumours (CMTs) are the most common neoplasms in intact female dogs. Although the prevalence of these tumours decreases in regions where preventive ovari(ohyster)ectomy is performed, it remains an important disease entity in veterinary medicine. Moreover, treatment options are limited in comparison with human breast cancer. Nevertheless, recent human treatment protocols might have potential in bitches suffering from CMTs. PMID:21645126

  18. Canine adenovirus based rabies vaccines. (United States)

    Tordo, N; Foumier, A; Jallet, C; Szelechowski, M; Klonjkowski, B; Eloit, M


    Adenovirus based vectors are very attractive candidates for vaccination purposes as they induce in mammalian hosts potent humoral, mucosal and cellular immune responses to antigens encoded by the inserted genes. We have generated E1-deleted and replication-competent recombinant canine type-2 adenoviruses expressing the rabies virus glycoprotein (G). The effectiveness of both vectors to express a native G protein has been characterized in vitro in permissive cell lines. We compared the humoral and cellular immune responses induced in mice by intramuscular injection of the recombinant canine adenovirus vectors with those induced by a human (Ad5) E1-deleted virus expressing the same rabies G protein. Humoral responses specific to the adenoviruses or the rabies glycoprotein antigens were studied. The influence of the mouse strain was observed using replication-competent canine adenovirus. A high level of rabies neutralizing antibody was observed upon i.m. inoculation, and 100% of mice survived lethal challenge. These results are very promising in the perspective of oral vaccine for dog rabies control. PMID:18634509

  19. Computed Tomography Imaging of the Topographical Anatomy of Canine Prostate

    International Nuclear Information System (INIS)

    AIM: To investigate the topographical anatomy of canine prostate gland by computed tomography (CT) for diagnostic imaging purposes. ÐœATERIAL AND METHODS: Seven clinically healthy mongrel male dogs at the age of 3−4 years and body weight of 10−15 kg were submitted to transverse computerized axial tomography (CAT) with cross section thickness of 5 mm. RESULTS: The CT image of canine prostate is visualized throughout the scans of the pelvis in the planes through the first sacral vertebra (S1) dorsally; the bodies of iliac bones laterally and cranially to the pelvic brim (ventrally). The body of prostate appears as an oval homogenous relatively hypo dense finding with soft tissue density. The gland is well differentiated from the adjacent soft tissues. CONCLUSION: By means of CT, the cranial part of prostate gland in adult dogs aged 3−4 years exhibited an abdominal localization. (author)

  20. 9 CFR 113.306 - Canine Distemper Vaccine. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of...

  1. Individual human odor fallout as detected by trained canines. (United States)

    Vyplelová, Petra; Vokálek, Václav; Pinc, Ludvík; Pacáková, Zuzana; Bartoš, Luděk; Santariová, Milena; Čapková, Zuzana


    We tested the hypothesis that if odor fallout (the release of a human's odor onto an untouched object) in human subjects exists, then holding a hand above an absorbent will produce a detectable scent which will be subsequently matched in a detection test by trained canines. Scents were collected from seven males to sterile cotton absorbent squares. The left hand was used to get the control scent and the right hand served as the target scent. Each experimental subject was sitting; his left hand was laid down on a cotton square for 3 min. The right hand was held 5 cm above another cotton square for 3 min. The scent identification was done by two specially trained police German shepherds. These canines had routinely performed scent identification line-ups as part of criminal investigation procedures. Both canines performed 14 line-ups and correctly matched the collected scents of all test subjects. The results suggest the existence of human odor fallout, whereby a human scent trace is left by humans even if they do not touch an object. PMID:24378296

  2. Biotinylated dextran amine anterograde tracing of the canine corticospinal tract

    Institute of Scientific and Technical Information of China (English)

    Xiao Han; Guangming Lv; Huiqun Wu; Dafeng Ji; Zhou Sun; Yaofu Li; Lemin Tang


    In this study, biotinylated dextran amine (BDA) was microinjected into the left cortical motor area of the canine brain. Fluorescence microscopy results showed that a large amount of BDA-labeled pyramidal cells were visible in the left cortical motor area after injection. In the left medulla oblongata, the BDA-labeled corticospinal tract was evenly distributed, with green fluorescence that had a clear boundary with the surrounding tissue. The BDA-positive corticospinal tract entered into the right lateral funiculus of the spinal cord and descended into the posterior part of the right lateral funiculus, close to the posterior horn, from cervical to sacral segments. There was a small amount of green fluorescence in the sacral segment. The distribution of BDA labeling in the canine central nervous system was consistent with the course of the corticospinal tract. Fluorescence labeling for BDA gradually diminished with time after injection. Our findings indicate that the BDA anterograde tracing technique can be used to visualize the localization and trajectory of the corticospinal tract in the canine central nervous system.

  3. Early eruption of permanent canines

    Directory of Open Access Journals (Sweden)

    S Madhu


    Full Text Available Systemic and local factors can modify the eruption time of teeth. Generalized eruption time changes could be due to some systemic diseases like hyperthyroidism, hypophosphatasia, precocious puberty, Proteus syndrome, etc. Localized early eruption of permanent teeth could be due to early extraction of deciduous teeth. Presented here is an extremely rare case of early eruption of permanent canines in a 7-year old female child. Though the number of such cases is very limited, the clinician should poses adequate knowledge and keeps an open eye to identify such cases.

  4. Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

    International Nuclear Information System (INIS)

    Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

  5. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies


    J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides


    Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...

  6. Prognostic markers of canine pyometra

    Directory of Open Access Journals (Sweden)

    M.C. Sant'Anna


    Full Text Available The pyometra is a disease that affects middle age and elderly female dogs during diestrus. Hormonal, microbiological, biochemical and hematological aspects are well described. However, few studies have evaluated the role of each in the prognosis of canine pyometra. The aim of this study was to identify markers associated with clinical worsening of dogs with pyometra. We prospectively evaluated 80 dogs with pyometra treated surgically. Group 1 consisted of dogs that were discharged within 48 hours after surgery and Group 2 consisted of those who required prolonged hospitalization or died. The findings of hematological, biochemical and blood lactate levels were compared between groups and variables such as bacterial multidrug resistance, systemic inflammatory response syndrome (SIRS, hyperlactatemia and increased creatinine were analyzed through the dispersion of frequencies between groups. Among the variables studied, the presence of SIRS and elevated serum creatinine >2.5mg/mL were effective in predicting the worsening of the disease and can be used as prognostic markers of canine pyometra.

  7. Estimating canine tooth crown height in early Australopithecus. (United States)

    Plavcan, J Michael; Ward, Carol V; Paulus, Faydre L


    Canine tooth size reduction and the associated reduction in canine dimorphism is a basal hominin character that also provides important evidence for models of behavioral evolution. Two specimens of Australopithecus anamensis (KNM-KP 29287 and KNM-KP 29283) that do not preserve the canine crown, but do preserve the root or alveolus, appear to suggest that canine size variation and canine dimorphism in this species may have been greater than in other hominins. We evaluate canine root and crown dimensions in a series of extant hominoids, and estimate canine crown height in Australopithecus afarensis and A. anamensis. Our results demonstrate that it is possible to generate estimates of canine crown height from basal canine crown and root dimensions with a moderate degree of accuracy. Estimates of maxillary canine crown size for A. anamensis are slightly larger than those of A. afarensis, and are approximately the same size as canines of modern female chimpanzees. Estimated mandibular canine crown height is very similar in the two species. Variation within the A. anamensis sample of estimated canine crown heights is similar to that of modern humans, suggesting a low degree of sexual dimorphism. Inclusion of estimates for KNM-KP 29287 and KNM-KP 29283 does not substantially increase either the estimate of overall canine size or variation for A. anamensis. PMID:19482334

  8. Extrusion processing : effects on dry canine diets

    NARCIS (Netherlands)

    Tran, Q.D.


    Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying. Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the nutritional and

  9. Triple bone labeling of canine mandibles

    DEFF Research Database (Denmark)

    Pinholt, E M; Kwon, P H


    Fluorescence microscopy was used for evaluation of new bone formation in 16 canine mandibles augmented with hydroxylapatite (HA) granules. Three fluorochromes were injected at different time intervals during therapeutic radiation treatment. Oxytetracycline, DCAF, and alizarin-complexone were give...

  10. Canine adenovirus type 1 in a fennec fox (Vulpes zerda). (United States)

    Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku


    A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing. PMID:25632689

  11. [Nonsurgical endodontic treatment of an invaginated canine]. (United States)

    Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P


    We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment. PMID:2638021

  12. Canine babesiosis: from molecular taxonomy to control

    Directory of Open Access Journals (Sweden)

    Irwin Peter J


    Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

  13. Overexpression of vimentin in canine prostatic carcinoma

    DEFF Research Database (Denmark)

    Rodrigues, M M P; Rema, A; Gärtner, F;


    associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests that...... the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....

  14. Breed predisposition to canine gastric carcinoma

    DEFF Research Database (Denmark)

    Seim-Wikse, Tonje; Jörundsson, Einar; Nødtvedt, Ane;


    Previous research has indicated a breed predisposition to gastric carcinoma in dogs. However, results to date are inconsistent since several studies have failed to prove such a predisposition. Better knowledge of breeds at risk could facilitate early detection of gastric carcinoma in dogs. The aim...... of the study was to retrospectively investigate the proportion and possible breed predisposition to canine gastric carcinoma using the Norwegian Canine Cancer Register for calculations of proportional morbidity ratios (PMRs) for the period 1998-2009....

  15. Systemic inflammarory response in canine pyometra


    Fransson, Boel


    Research efforts have focused mainly on the hormonal aspects of canine pyometra for more than 6 decades. However, this disease is often manifested as systemic illness in response to the bacterial uterine infection. Studies I-II were undertaken to clarify bacteriological aspects of canine pyometra; i.e. the origin of the infecting bacteria, the infecting bacteria’s impact on severity of the systemic illness and the presence of bacterial endotoxin in the systemic circulation. Study I, a bacteri...

  16. Clinical and Statistical Study on Canine Impaction

    Directory of Open Access Journals (Sweden)

    Adina-Simona Coșarcă


    Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic

  17. Environmental contamination by canine geohelminths (United States)


    Intestinal nematodes affecting dogs, i.e. roundworms, hookworms and whipworms, have a relevant health-risk impact for animals and, for most of them, for human beings. Both dogs and humans are typically infected by ingesting infective stages, (i.e. larvated eggs or larvae) present in the environment. The existence of a high rate of soil and grass contamination with infective parasitic elements has been demonstrated worldwide in leisure, recreational, public and urban areas, i.e. parks, green areas, bicycle paths, city squares, playgrounds, sandpits, beaches. This review discusses the epidemiological and sanitary importance of faecal pollution with canine intestinal parasites in urban environments and the integrated approaches useful to minimize the risk of infection in different settings. PMID:24524656

  18. Environmental contamination by canine geohelminths. (United States)

    Traversa, Donato; Frangipane di Regalbono, Antonio; Di Cesare, Angela; La Torre, Francesco; Drake, Jason; Pietrobelli, Mario


    Intestinal nematodes affecting dogs, i.e. roundworms, hookworms and whipworms, have a relevant health-risk impact for animals and, for most of them, for human beings. Both dogs and humans are typically infected by ingesting infective stages, (i.e. larvated eggs or larvae) present in the environment. The existence of a high rate of soil and grass contamination with infective parasitic elements has been demonstrated worldwide in leisure, recreational, public and urban areas, i.e. parks, green areas, bicycle paths, city squares, playgrounds, sandpits, beaches. This review discusses the epidemiological and sanitary importance of faecal pollution with canine intestinal parasites in urban environments and the integrated approaches useful to minimize the risk of infection in different settings. PMID:24524656

  19. Canine distemper virus detection in asymptomatic and non vaccinated dogs


    Del Puerto, Helen L; Vasconcelos, Anilton C.; Luciana Moro; Fabiana Alves; Braz, Gissandra F; Almir S. Martins


    A quantitative real time polymerase chain reaction (PCR) revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus...

  20. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

    Directory of Open Access Journals (Sweden)

    Anna McRee


    Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  1. Development of the canine tooth in the beagle

    International Nuclear Information System (INIS)

    The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla

  2. 9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus..., DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper...

  3. Canine hypothyroidism. A diagnostic challenge?

    International Nuclear Information System (INIS)

    Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen registered) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high interobserver

  4. Transmigration of mandibular canine – case report

    International Nuclear Information System (INIS)

    Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation

  5. Canine kobuvirus infections in Korean dogs. (United States)

    Oem, Jae-Ku; Choi, Jeong-Won; Lee, Myoung-Heon; Lee, Kyoung-Ki; Choi, Kyoung-Seong


    To investigate canine kobuvirus (CaKoV) infection, fecal samples (n = 59) were collected from dogs with or without diarrhea (n = 21 and 38, respectively) in the Republic of Korea (ROK) in 2012. CaKoV infection was detected in four diarrheic samples (19.0 %) and five non-diarrheic samples (13.2 %). All CaKoV-positive dogs with diarrhea were found to be infected in mixed infections with canine distemper virus and canine parvovirus or canine adenovirus. There was no significant difference in the prevalence of CaKoV in dogs with and without diarrhea. By phylogenetic analysis based on partial 3D genes and complete genome sequences, the Korean isolates were found to be closely related to each other regardless of whether they were associated with diarrhea, and to the canine kobuviruses identified in the USA and UK. This study supports the conclusion that CaKoVs from different countries are not restricted geographically and belong to a single lineage. PMID:24906525

  6. Canine mammary tumors - clinical survey

    Directory of Open Access Journals (Sweden)

    Elena Atanaskova Petrov


    Full Text Available Mammary tumours are the second most frequent neoplasia in dogs, mainly affecting older female patients. Approximately 50% of the mammary tumours are malignant with high percentage of mortality if not treated in time. The aim of this study was to analyze the data of canine patients with mammary tumours, to evaluate the type of tumours, as well as the relationship between tumour incidence and dogs’ age, reproductive cycle and sterilization. The survey was used to retrieve the information in the period of two years from the patient data base of the University Veterinary Hospital at the Faculty of Veterinary medicine in Skopje. Patients included in this survey were subjected to routine clinical investigation and additional laboratory tests (cytological examination, x-rays imaging, CBC and biochemical profile, histopathology of the tumor samples. Aged female patients (12 – 13 years are the most susceptible category for development of mammary tumours. The reproductive history showed that five of the patients with malignant mammary tumourshave never whelped and were not treated with any exogenous hormones. Malignant tumours (adenocarcinoma were diagnosed in 90% of the patients. Three patients died due to lung metastasis. Late diagnosis is one of the major problems that results in lethal outcome due to lung metastases. Since ovarian steroids play an important role in the aetiology, the most effective prevention of mammary tumoursis elective ovariectomy of the bitch at an early age.

  7. Composite mandibular allografts in canines

    Institute of Scientific and Technical Information of China (English)


    Objective: To evaluate the feasibility of transplanting composite mandibular allografts to repair large mandibular defects. Methods: Three composite mandibular transplantation models were established. The first model consisted of hemimandible with the attached teeth, muscle and skin, and oral mucosa. The second model was transplanted in the same way with the first one excluding oral mucosa and some teeth, and third one excluding the oral mucosa and all dental crowns. Fourteen transplanting operations were performed in canines. Cyclosporine A and methylprednisone were given for immunosuppression. Results: The composite mandibular organs had an effective and closed return circuit. Transplantation of vascularized allograft of mandibular compound organs was feasible. Two longest time survivors of 67 d and 76 d were in the third model group. Cyclosporine A was successful in suppressing rejection of transplanted composite allograft and prolonging survival time of transplantation models. Conclusions: The composite mandibular allografts were available with large block of living composite tissue,and helpful in restoration of appearance and function for severe mandibular defects.

  8. Oncolytic Virotherapy of Canine and Feline Cancer

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev


    Full Text Available Cancer is the leading cause of disease-related death in companion animals such as dogs and cats. Despite recent progress in the diagnosis and treatment of advanced canine and feline cancer, overall patient treatment outcome has not been substantially improved. Virotherapy using oncolytic viruses is one promising new strategy for cancer therapy. Oncolytic viruses (OVs preferentially infect and lyse cancer cells, without causing excessive damage to surrounding healthy tissue, and initiate tumor-specific immunity. The current review describes the use of different oncolytic viruses for cancer therapy and their application to canine and feline cancer.

  9. Tooth fractures in canine clinical practice

    International Nuclear Information System (INIS)

    Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients

  10. Computerized digital image processing on radiographs of canine filariosis

    International Nuclear Information System (INIS)

    For objective evaluation in the lung arterial lesions, density histogram revealed by survey thoracic radiographies of fifteen canine filariosis and five normal canine were digitally analyzed, and preparation of pulmonary artery angiogram with inflated-fixed lung, the changes in the histogram and the pulmonary arterial lesion by a soft X-ray examination were compared. In the lung areas affected by filariosis, the density histogram increased the white level and decreased the black level in each part compared to a normal lung. In comparison with the normal parameters, those of the filariosis it were significantly increased in minimum grey level values (Min), maximum grey level values (Max), and the maximum frequency grey level values (Mode) and, it was significantly decreased in maximum frequency values (MaF). The pulmonary arterial lesion of the filariosis showed obvious morphological changes such as in distinction, pruning, angiectasis, and meandering. In the grade of pulmonary arterial lesion, the parameter Min, Max, Mode and MaF were changed significantly. From these results, it was clear that the methods for the lung arterial lesions analysis of X-ray images were confirmed to be highly beneficial in the lung arterial lesions for objective diagnosis

  11. Preclinical evaluation of oncolytic vaccinia virus for therapy of canine soft tissue sarcoma.

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    Full Text Available Virotherapy using oncolytic vaccinia virus (VACV strains is one promising new strategy for canine cancer therapy. In this study we describe the establishment of an in vivo model of canine soft tissue sarcoma (CSTS using the new isolated cell line STSA-1 and the analysis of the virus-mediated oncolytic and immunological effects of two different Lister VACV LIVP1.1.1 and GLV-1h68 strains against CSTS. Cell culture data demonstrated that both tested VACV strains efficiently infected and destroyed cells of the canine soft tissue sarcoma line STSA-1. In addition, in our new canine sarcoma tumor xenograft mouse model, systemic administration of LIVP1.1.1 or GLV-1h68 viruses led to significant inhibition of tumor growth compared to control mice. Furthermore, LIVP1.1.1 mediated therapy resulted in almost complete tumor regression and resulted in long-term survival of sarcoma-bearing mice. The replication of the tested VACV strains in tumor tissues led to strong oncolytic effects accompanied by an intense intratumoral infiltration of host immune cells, mainly neutrophils. These findings suggest that the direct viral oncolysis of tumor cells and the virus-dependent activation of tumor-associated host immune cells could be crucial parts of anti-tumor mechanism in STSA-1 xenografts. In summary, the data showed that both tested vaccinia virus strains and especially LIVP1.1.1 have great potential for effective treatment of CSTS.

  12. Production of monoclonal antibodies against canine leukocytes. (United States)

    Aguiar, Paulo Henrique Palis; Borges dos Santos, Roberto Robson; Lima, Carla Andrade; Rios de Sousa Gomes, Hilton; Larangeira, Daniela Farias; Santos, Patrícia Meira; Barrouin-Melo, Stella Maria; Conrado dos-Santos, Washington Luis; Pontes-de-Carvalho, Lain


    A panel of anti-canine leukocyte monoclonal antibodies (MAbs) was produced by immunizing BALB/c mice with canine peripheral blood mononuclear cells (PBMC), either resting or stimulated with concanavalin A (ConA). Three out of 28 clones-IH1, AB6, and HG6-screened by ELISA and producing antibody with the highest specificity for canine cell immunostaining, were subjected to three subsequent subcloning steps by limiting dilution, and selected for further characterization. These MAbs belonged to IgG1 (HG6 and IH1) and IgG2a (AB6) isotypes. The distribution of cell populations expressing the antigen recognized by the antibodies was identified by indirect immunoflorescence on canine PBMC and on tissue sections of lymph node, spleen, liver and skin. The possible crossreactivity with human PBMC was also examined in immunocytochemistry. One of the antibodies specifically recognized macrophages. The MAbs presented here can be foreseen as possible valuable diagnostic and research tools to study immune functions in dogs. PMID:15165486

  13. Experimental Forelimb Allotransplantation in Canine Model (United States)


    As reconstructive transplantation is gaining popularity as a viable alternative for upper limb amputees, it is becoming increasingly important for plastic surgeons to renew surgical skills and knowledge of this area. Forelimb allotransplantation research has been performed previously in rodent and swine models. However, preclinical canine forelimb allotransplantation studies are lacking in the literature. The purpose of this paper is to provide an overview of the surgical skills necessary to successfully perform forelimb transplantation in canines as a means to prepare for clinical application. A total of 18 transplantation operations on canines were performed. The recipient limb was shortened at the one-third proximal forearm level. The operation was performed in the following order: bones (two reconstructive plates), muscles and tendons (separately sutured), nerves (median, ulnar, and radial nerve), arteries (two), and veins (two). The total mean time of transplantation was 5 hours ± 30 minutes. All of the animals that received transplantation were treated with FK-506 (tacrolimus, 2 mg/kg) for 7 days after surgery. Most allografts survived with perfect viability without vascular problems during the early postoperative period. The canine forelimb allotransplantation model is well qualified to be a suitable training model for standard transplantation and future research work. PMID:27597952

  14. Seroprevalence of Canine Distemper Virus in Cats


    Ikeda, Yasuhiro; Nakamura, Kazuya; Miyazawa, Takayuki; Chen, Ming-Chu; Kuo, Tzong-Fu; Lin, James A; Mikami, Takeshi; Kai, Chieko; TAKAHASHI, Eiji


    A seroepidemiological survey of canine distemper virus (CDV) infection in Asian felids revealed that the prevalence of antibodies varied depending on region and, in some cases, exposure to dogs. The serologic pattern in cats with antibodies indicated that they had likely been exposed to field strains rather than typical CDV vaccine strains.

  15. Canine Distemper Outbreak in Rhesus Monkeys, China


    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang; Hu, Rongliang


    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People’s Republic of China. Approximately 10,000 animals were infected (25%–60% disease incidence); 5%–30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain.

  16. Experimental Forelimb Allotransplantation in Canine Model. (United States)

    Hong, Sa-Hyeok; Eun, Seok-Chan


    As reconstructive transplantation is gaining popularity as a viable alternative for upper limb amputees, it is becoming increasingly important for plastic surgeons to renew surgical skills and knowledge of this area. Forelimb allotransplantation research has been performed previously in rodent and swine models. However, preclinical canine forelimb allotransplantation studies are lacking in the literature. The purpose of this paper is to provide an overview of the surgical skills necessary to successfully perform forelimb transplantation in canines as a means to prepare for clinical application. A total of 18 transplantation operations on canines were performed. The recipient limb was shortened at the one-third proximal forearm level. The operation was performed in the following order: bones (two reconstructive plates), muscles and tendons (separately sutured), nerves (median, ulnar, and radial nerve), arteries (two), and veins (two). The total mean time of transplantation was 5 hours ± 30 minutes. All of the animals that received transplantation were treated with FK-506 (tacrolimus, 2 mg/kg) for 7 days after surgery. Most allografts survived with perfect viability without vascular problems during the early postoperative period. The canine forelimb allotransplantation model is well qualified to be a suitable training model for standard transplantation and future research work. PMID:27597952

  17. Case study in canine intestinal lymphangiectasia


    Brooks, Thomas A.


    A 9.52 kg, 9-year-old, spayed female beagle was presented with the chief complaint of abdominal distention of 1 week’s duration. A presumptive diagnosis of canine intestinal lymphangectasia was arrived at by exclusion of other causes for the patient’s ascites. The patient was successfully treated with dietary modification and immunosuppressive therapy.


    A research project was undertaken to learn how the highly acute olfactory sensitivity of the canine could be applied with advantage to environmental problems. The objectives were to determine how dogs could be trained to detect hazardous and toxic pollutants in the environment an...

  19. Canine visceral leishmaniasis in Sicily. (United States)

    Orndorff, G R; Cooper, B A; Smith, W; Ryan, J R


    The Sicilian province of Catania is an active foci for human visceral leishmaniasis (VL) in the Mediterranean area. Approximately 10 to 15 cases of VL are diagnosed via hospital admissions each year in this community. Recently, an increase in VL case reporting by Sicilian physicians was noted, with 38 and 37 VL cases in 1996 and 1997, respectively. Before 1995, there were no reported VL cases among U.S. military personnel or their family members living in Sicily. However, since 1996, there have been four cases referred to Walter Reed Army Medical Center for diagnosis and treatment, all involving the children of personnel assigned to Naval Air Station Sigonella. Exposure histories for all infected individuals excluded exposure to Leishmania parasites outside of Sicily. All patients lived in areas where vectoring sandflies are present. All had dogs as family pets. To evaluate the level of infection among dogs owned by Navy personnel and their families, U.S. Navy Environmental and Preventive Medicine Unit 7, in a collaborative study with the U.S. Army Veterinary Clinic, Naval Air Station Sigonella, and the Walter Reed Army Institute of Research, performed clinical evaluation and serological testing of 50 dogs residing with U.S. personnel assigned to Naval Air Station Sigonella. The data indicate a high exposure rate to Leishmania (60% of the animals tested had elevated immunoglobulin M antibody levels) in the study population, suggesting that they were infected with Leishmania infantum. Distribution of seropositive dogs by sex was equal. Most of the dogs studied appeared to be in good health. However, inapparent infection of dogs, seen by Italian veterinarians, has been observed throughout all areas of Catania. Sandflies responsible for vectoring L. infantum were trapped in the same locations as the dogs sampled in this study. The level of subclinical infection was 75% among seropositive dogs. The overall level of canine infection observed was higher than expected

  20. Lymphatic Territories (Lymphosomes) in a Canine: An Animal Model for Investigation of Postoperative Lymphatic Alterations


    Suami, Hiroo; Yamashita, Shuji; Soto-Miranda, Miguel A.; Chang, David W.


    Background Lymph node dissection is often performed as a part of surgical treatment for breast cancer and malignant melanoma to prevent malignant cells from traveling via the lymphatic system. Currently little is known about postoperative lymphatic drainage pattern alterations. This knowledge may be useful for management of recurrent cancer and prevention of breast cancer related lymphedema. We mapped the complete superficial lymphatic system of a dog and used this canine model to perform pre...

  1. Combined orthodontic-surgical management of a transmigrated mandibular canine. (United States)

    Cavuoti, Serena; Matarese, Giovanni; Isola, Gaetano; Abdolreza, Jamilian; Femiano, Felice; Perillo, Letizia


    The presence of an impacted mandibular canine is one of the most difficult challenges that an orthodontist will meet. Orthodontic treatment is planned on an individual basis after thoroughly considering the patient's overall facial and dentoskeletal characteristics; the duration, risks, and costs of treatment; patient preferences; and the orthodontist's experience. This article reports an orthodontic treatment of a boy, age 12.9 years, with an impacted mandibular canine in the permanent dentition that was successfully managed. Radiographic analysis indicated a transmigration of the mandibular right canine. The orthodontic treatment plan included extraction of the deciduous right canine followed by surgical exposure and ligation of the permanent canine. Eruption was properly guided, and the correct position of the tooth was achieved. This challenging treatment approach is described in detail, including the mechanics used to align the impacted canine. PMID:26502299

  2. Evidence supporting the conceptual framework of cancer chemoprevention in canines. (United States)

    Kondratyuk, Tamara P; Adrian, Julie Ann Luiz; Wright, Brian; Park, Eun-Jung; van Breemen, Richard B; Morris, Kenneth R; Pezzuto, John M


    As with human beings, dogs suffer from the consequences of cancer. We investigated the potential of a formulation comprised of resveratrol, ellagic acid, genistein, curcumin and quercetin to modulate biomarkers indicative of disease prevention. Dog biscuits were evaluated for palatability and ability to deliver the chemopreventive agents. The extent of endogenous DNA damage in peripheral blood lymphocytes from dogs given the dietary supplement or placebo showed no change. However, H2O2-inducible DNA damage was significantly decreased after consumption of the supplement. The expression of 11 of 84 genes related to oxidative stress was altered. Hematological parameters remained in the reference range. The concept of chemoprevention for the explicit benefit of the canine is compelling since dogs are an important part of our culture. Our results establish a proof-of-principle and provide a framework for improving the health and well-being of "man's best friend". PMID:27216246

  3. Bi-rooted Primary Maxillary Canines: A Case Report



    This report presents a rare case of bi-rooted primary maxillary canines. A 6-year-old girl presented at the Department of Pediatric Dentistry, Faculty of Dentistry, Mashhad University of Medical Sciences, Iran, with the chief complaint of pain in the lower right quadrant of her dentition. Radiographic examination revealed bifurcation of primary maxillary canine roots. This report discusses the possible etiology of bi-rooted canines, implications for the developing dentition, and treatment opt...

  4. Autochthonous canine leishmaniasis in Romania: neglected or (re)emerging?


    Mircean, Viorica; Dumitrache, Mirabela Oana; MIRCEAN, MIRCEA; Bolfa, Pompei; Györke, Adriana; Mihalca, Andrei Daniel


    Canine leishmaniasis is a vector-borne zoonotic disease caused by the protozoan parasite Leishmania infantum. In Romania between 1955 and 2013, no cases of human autochthonous visceral leishmaniasis were reported. Data regarding canine leishmaniasis is similarly scarce. Since the first report of clinical autochthonous canine leishmaniasis in 1935, there were only three sporadic reports of positive dogs all without any clinical signs. Our study reports the first clinical case of autochthonous ...

  5. Portrait of a Canine Probiotic – from Gut to Gut


    O'Mahony, D.; Murphy, K. Barry; MacSharry, J.; Boileau, T.; Sunvold, G.; Reinhart, G.; Kiely, B.; Shanahan, F; O'Mahony, L.


    Abstract The gastrointestinal environment is a complex interactive system involving the host, ingested dietary components, and numerous microbial species. We hypothesised that isolation and screening of Lactobacilli and Bifidobacteria adherent to healthy canine gastrointestinal tissue would yield strains with commensal activity in canines. The aims of this study were 1) to isolate a bank of commensal organisms from the canine gastrointestinal tract; 2) to screen these novel microbi...

  6. Canine oral biofilms: Cultural, molecular, and in vitro studies.


    Elliott, D. R.


    The canine oral microbiota is poorly understood compared to that of humans. The aim of this work was to improve understanding of the canine oral microbiota. This was achieved by surveying the canine oral microbiota, determining coaggregation interactions between its members, and developing a laboratory microcosm. Bacteria were isolated from the dental plaque and saliva of dogs, and isolates were identified by comparative 16S rRNA gene sequencing. From 339 isolates, 84 phylotypes belonging to ...

  7. Coryneform bacteria associated with canine otitis externa

    DEFF Research Database (Denmark)

    Aalbæk, Bent; Bemis, David A.; Schjærff, Mette;


    This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...

  8. Antigenic typing Polish isolates of canine parvovirus

    International Nuclear Information System (INIS)

    Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs

  9. Myoepithelial cells in canine mammary tumours. (United States)

    Sánchez-Céspedes, Raquel; Millán, Yolanda; Guil-Luna, Silvia; Reymundo, Carlos; Espinosa de Los Monteros, Antonio; Martín de Las Mulas, Juana


    Mammary tumours are the most common neoplasms of female dogs. Compared to mammary tumours of humans and cats, myoepithelial (ME) cell involvement is common in canine mammary tumours (CMT) of any subtype. Since ME cell involvement in CMT influences both histogenetic tumour classification and prognosis, correct identification of ME cells is important. This review describes immunohistochemical methods for identification of canine mammary ME cells used in vivo. In addition, phenotypic and genotypic methods to isolate ME cells for in vitro studies to analyse tumour-suppressor protein production and gene expression are discussed. The contribution of ME cells to both histogenetic classifications and the prognosis of CMT is compared with other species and the potential use of ME cells as a method to identify carcinoma in situ is discussed. PMID:26639832

  10. Characterization of pantropic canine coronavirus from Brazil. (United States)

    Pinto, Luciane D; Barros, Iracema N; Budaszewski, Renata F; Weber, Matheus N; Mata, Helena; Antunes, Jéssica R; Boabaid, Fabiana M; Wouters, Angélica T B; Driemeier, David; Brandão, Paulo E; Canal, Cláudio W


    Characterization of canine coronavirus (CCoV) strains currently in circulation is essential for understanding viral evolution. The aim of this study was to determine the presence of pantropic CCoV type IIa in tissue samples from five puppies that died in Southern Brazil as a result of severe gastroenteritis. Reverse-transcriptase PCR was used to generate amplicons for sequence analysis. Phylogenetic analysis of the CCoV-IIa strains indicated that they were similar to those found in other countries, suggesting a common ancestor of these Brazilian isolates. This is the first report of pantropic CCoV-II in puppies from Latin America and our findings highlight that CCoV should be included as a differential diagnosis when dogs present with clinical signs and lesions typically seen with canine parvovirus infection. PMID:25294661

  11. Antigenic typing Polish isolates of canine parvovirus

    Energy Technology Data Exchange (ETDEWEB)

    Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)


    Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.

  12. Extrusion processing : effects on dry canine diets


    Tran, Q.D.


    Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying. Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the nutritional and physical quality of the product. Effects of extrusion on the feed quality for other animals than pets have been well recognized. Our studies investigated to what extent extrusion and/or drying of a c...

  13. Remote detection of explosives using trained canines

    International Nuclear Information System (INIS)

    Use of dogs is a search method which combines high probability of detection, speed of search, and low cost. It was concluded that the canine could be used for explosive screening of personnel, but that it was imperative that the dog be in a position remote from employees and employee traffic. A study was made of the design of booths and air flow for this purpose. Results of tests and conclusions are given and discussed

  14. Ultrasonographic characteristics of canine renal lymphoma. (United States)

    Taylor, Angela J; Lara-Garcia, Ana; Benigni, Livia


    There is little published information on the ultrasonographic appearance of canine renal lymphoma. The purpose of this retrospective study was to provide additional information regarding the ultrasonographic characteristics of canine renal lymphoma, suggest ultrasonographic description criteria, and evaluate the role of fine-needle aspirate cytology in the diagnosis of this disease. The ultrasonographic features of confirmed renal lymphoma were reviewed in ten dogs. Pyelectasia was found in all dogs. Other ultrasonographic findings were loss of corticomedullary distinction (9/10 dogs), renomegaly (8/10 dogs), renal deformity (6/10 dogs), hypoechoic lesion(s) (6/10 dogs), and hyperechoic lesion(s) (2/10 dogs). Hypoechoic lesions were described as masses, nodules, and indistinct areas. In 30% of the cases (3/10 dogs) ultrasound revealed only minor abnormalities, including grade 1 pyelectasia, mild renomegaly, and focal loss of corticomedullary definition. Bilateral lesions were seen in nine dogs (90%). Renal fine-needle aspirates were performed in 9/10 dogs, yielding a diagnosis in seven on first attempt (78%). Two dogs had been given a provisional cytological diagnosis of round cell neoplasia; in one dog lymphoma was confirmed by second aspirate and by tissue core biopsy in the other. In 1/10 dogs, lymphoma was found at necropsy. Findings indicated that ultrasonographic signs of canine renal lymphoma may be subtle, canine renal lymphoma should be included in the differential diagnosis when the above ultrasonographic features are observed, and fine-needle aspirate cytology is a useful method for diagnosing this disease. PMID:24629062

  15. Cardiac troponin I levels in canine pyometra


    Hagman Ragnvi; Lagerstedt Anne-Sofie; Fransson Boel A; Bergström Annika; Häggström Jens


    Abstract Background Myocardial injury may contribute to unexpected deaths due to pyometra. To detect myocardial damage, measurement of cardiac troponin I (cTnI) is currently the most sensitive and specific method. The aims of the present study were to evaluate presence of myocardial damage in canine pyometra by analysis of cTnI, to explore whether myocardial injury was associated with systemic inflammatory response syndrome (SIRS) and to evaluate whether other clinical or laboratory parameter...

  16. Microbiological and histopathological aspects of canine pyometra


    Coggan, Jennifer Anne; Melville, Priscilla Anne; de Oliveira, Clair Motos; Faustino, Marcelo; Moreno, Andréa Micke; Benites, Nilson Roberti


    As pyometra is recognized as one of the main causes of disease and death in the bitch the purposes of this study were to evaluate microbiological and histopathological aspects of canine pyometra and to research the virulence factors of the E. coli isolates identifying possible risks to human health. The microbiological isolation from the intrauterine contents of 100 dogs with pyometra was carried out and the virulence factors in the E. coli strains were identified using PCR method. This study...

  17. Recent developments in Canine Cognitive Dysfunction Syndrome


    Seisdedos Benzal, Alejandro; Galán Rodríguez, Alba


    Canine Cognitive Dysfunction Syndrome (CCD) is a neurodegenerative disease affecting aging dogs. CCD is an underdiagnosed disease that involves at least 14% of geriatric dogs, but apparently less than 2% of diseased dogs are diagnosed. There are several physiopathological similarities between Alzheimer disease (AD) and CCD, developing amyloid-β deposits in brain parenchyma and blood vessels, brain atrophy and neuronal loss. The clinical signs lead to behavioural changes. They are ...

  18. Canine epilepsy as a translational model? (United States)

    Potschka, Heidrun; Fischer, Andrea; von Rüden, Eva-Lotta; Hülsmeyer, Velia; Baumgärtner, Wolfgang


    Dogs with spontaneous diseases can exhibit a striking similarity in etiology, clinical manifestation, and disease course when compared to human patients. Therefore, dogs are intensely discussed as a translational model of human disease. In particular, genetic studies in selected dog breeds serve as an excellent tool to identify epilepsy disease genes. In addition, canine epilepsy is discussed as a translational platform for drug testing. On one hand, epileptic dogs might serve as an interesting model by allowing the evaluation of drug efficacy and potency under clinical conditions with a focus on chronic seizures resistant to standard medication, preventive strategies, or status epilepticus. On the other hand, several limitations need to be considered including owner-based seizure monitoring, species differences in pharmacokinetics and drug interactions, as well as cost-intensiveness. The review gives an overview on the current state of knowledge regarding the etiology, clinical manifestation, pathology, and drug response of canine epilepsy, also pointing out the urgent need for further research on specific aspects. Moreover, the putative advantages, the disadvantages, and limitations of antiepileptic drug testing in canine epilepsy are critically discussed. PMID:23506100

  19. Canine kobuviruses in diarrhoeic dogs in Italy. (United States)

    Di Martino, Barbara; Di Felice, Elisabetta; Ceci, Chiara; Di Profio, Federica; Marsilio, Fulvio


    Canine kobuviruses (CaKVs) are newly recognized picornaviruses recently detected in dogs in the US. By molecular analysis of the whole genome, CaKV that appeared genetically closest to the murine kobuvirus (MuKV) and to the human Aichi virus (AiV), may be classified in the Kobuvirus genus as new genotype (CaKV type 1) within the species Aichivirus A. To date, there are no information on the epidemiology of these novel viruses in other continents. In this study, by screening a collection of 256 dog fecal samples either from diarrhoeic or asymptomatic animals, CaKV was identified in six specimens with an overall prevalence of 2.34% (6/256). All the positive dogs presented diarrhea and were found to be infected by CaKV alone or in mixed infections with canine coronavirus (CCoV) and/or canine parvovirus type 2 (CPV-2). By molecular analysis of the partial 3D gene, all the strains detected displayed a close relatedness with the CaKVs recently identified in the US. This study provides evidence that CaKVs circulate in diarrhoeic dogs in Italy and are not geographically restricted to the North American continent, where they were first signaled. PMID:23806200

  20. Increasing incidence of canine leptospirosis in Switzerland. (United States)

    Major, Andrea; Schweighauser, Ariane; Francey, Thierry


    A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes 90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25) or rainy days (r2 0.38). Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%), pulmonary (76.7%), hepatic (26.0%), and hemorrhagic syndromes (18.2%), leading to a high mortality rate (43.3%). Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3). Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species. PMID:25032740

  1. Increasing Incidence of Canine Leptospirosis in Switzerland

    Directory of Open Access Journals (Sweden)

    Andrea Major


    Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.

  2. Cytodiagnostics of canine lymphomas - possibilities and limitations. (United States)

    Sapierzyński, R; Kliczkowska-Klarowicz, K; Jankowska, U; Jagielski, D


    Malignant lymphomas are one of the most common malignant tumours occurring in dogs. The basic method of lymphoma diagnosis in human, as well as in canine oncology is histopathology supported by immunohistochemistry. It was suggested that in veterinary medicine excisional biopsy of lymph node and histopathology should be considered only where the cytologic diagnosis is equivocal or needs to be confirmed. There are at least three basic reasons for which cytological examination ought to be accepted as a sufficient and reliable diagnostic method for lymphoma in dogs. Firstly, most dog owners consider the fine-needle biopsy as an acceptable non-harmful method of sample collection. Secondly, an increasing number of studies recommend cytology as an accurate test for diagnosing and subtyping canine lymphoma. Finally, the vast majority of canine lymphoma subtypes belong to 4-5 categories characterized by a typical cytological picture. Immunocytochemical staining of cytological smears gives new diagnostic possibilities, such as detection of markers better characterizing given growth or a potential goal for target therapy in individual cases (for example inhibitors of platelet-derived growth factor). PMID:27487521

  3. Increasing Incidence of Canine Leptospirosis in Switzerland (United States)

    Major, Andrea; Schweighauser, Ariane; Francey, Thierry


    A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes 90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25) or rainy days (r2 0.38). Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%), pulmonary (76.7%), hepatic (26.0%), and hemorrhagic syndromes (18.2%), leading to a high mortality rate (43.3%). Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3). Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species. PMID:25032740

  4. Evidence-based control of canine rabies: a critical review of population density reduction. (United States)

    Morters, Michelle K; Restif, Olivier; Hampson, Katie; Cleaveland, Sarah; Wood, James L N; Conlan, Andrew J K


    Control measures for canine rabies include vaccination and reducing population density through culling or sterilization. Despite the evidence that culling fails to control canine rabies, efforts to reduce canine population density continue in many parts of the world. The rationale for reducing population density is that rabies transmission is density-dependent, with disease incidence increasing directly with host density. This may be based, in part, on an incomplete interpretation of historical field data for wildlife, with important implications for disease control in dog populations. Here, we examine historical and more recent field data, in the context of host ecology and epidemic theory, to understand better the role of density in rabies transmission and the reasons why culling fails to control rabies. We conclude that the relationship between host density, disease incidence and other factors is complex and may differ between species. This highlights the difficulties of interpreting field data and the constraints of extrapolations between species, particularly in terms of control policies. We also propose that the complex interactions between dogs and people may render culling of free-roaming dogs ineffective irrespective of the relationship between host density and disease incidence. We conclude that vaccination is the most effective means to control rabies in all species. PMID:23004351

  5. Low Titers of Canine Distemper Virus Antibody in Wild Fishers (Martes pennanti) in the Eastern USA. (United States)

    Peper, Steven T; Peper, Randall L; Mitcheltree, Denise H; Kollias, George V; Brooks, Robert P; Stevens, Sadie S; Serfass, Thomas L


    Canine distemper virus (CDV) infects species in the order Carnivora. Members of the family Mustelidae are among the species most susceptible to CDV and have a high mortality rate after infection. Assessing an animal's pathogen or disease load prior to any reintroduction project is important to help protect the animal being reintroduced, as well as the wildlife and livestock in the area of relocation. We screened 58 fishers for CDV antibody prior to their release into Pennsylvania, US, as part of a reintroduction program. Five of the 58 (9%) fishers had a weak-positive reaction for CDV antibody at a dilution of 1:16. None of the fishers exhibited any clinical sign of canine distemper while being held prior to release. PMID:26555109

  6. The establishment of bilateral external iliac artery stenosis model in experimental canines and its angiographic evaluation

    International Nuclear Information System (INIS)

    Objective: To establish an experimental canine model of bilateral external iliac artery stenosis by surgical method with absorbable suture. Methods: Under general anesthesia bilateral external iliac arteries were partly obstructed (about 50%) with absorbable suture in ten dogs. Three months later angiography was performed to evaluate the arterial stricture degree. Results: Bilateral external iliac artery stenosis model was successfully established in eight dogs and the other two dogs died within two weeks after the procedure. Angiography performed three months after the procedure showed that the stricture degree of arterial lumen was (60.6±12.5)%. Conclusion: Satisfactory experimental canine model of bilateral external iliac artery stenosis can be established by surgical method with absorbable suture. This method can be used for reference when peripheral artery stenosis model is to be prepared in larger animals. (authors)

  7. Canine evolution in sabretoothed carnivores: natural selection or sexual selection? (United States)

    Randau, Marcela; Carbone, Chris; Turvey, Samuel T


    The remarkable elongated upper canines of extinct sabretoothed carnivorous mammals have been the subject of considerable speculation on their adaptive function, but the absence of living analogues prevents any direct inference about their evolution. We analysed scaling relationships of the upper canines of 20 sabretoothed feliform carnivores (Nimravidae, Barbourofelidae, Machairodontinae), representing both dirk-toothed and scimitar-toothed sabretooth ecomorphs, and 33 non-sabretoothed felids in relation to body size in order to characterize and identify the evolutionary processes driving their development, using the scaling relationships of carnassial teeth in both groups as a control. Carnassials display isometric allometry in both sabretooths and non-sabretooths, supporting their close relationship with meat-slicing, whereas the upper canines of both groups display positive allometry with body size. Whereas there is no statistical difference in allometry of upper canine height between dirk-toothed and scimitar-toothed sabretooth ecomorphs, the significantly stronger positive allometry of upper canine height shown by sabretooths as a whole compared to non-sabretooths reveals that different processes drove canine evolution in these groups. Although sabretoothed canines must still have been effective for prey capture and processing by hypercarnivorous predators, canine morphology in these extinct carnivores was likely to have been driven to a greater extent by sexual selection than in non-sabretooths. Scaling relationships therefore indicate the probable importance of sexual selection in the evolution of the hypertrophied sabretooth anterior dentition. PMID:23951334

  8. Canine evolution in sabretoothed carnivores: natural selection or sexual selection?

    Directory of Open Access Journals (Sweden)

    Marcela Randau

    Full Text Available The remarkable elongated upper canines of extinct sabretoothed carnivorous mammals have been the subject of considerable speculation on their adaptive function, but the absence of living analogues prevents any direct inference about their evolution. We analysed scaling relationships of the upper canines of 20 sabretoothed feliform carnivores (Nimravidae, Barbourofelidae, Machairodontinae, representing both dirk-toothed and scimitar-toothed sabretooth ecomorphs, and 33 non-sabretoothed felids in relation to body size in order to characterize and identify the evolutionary processes driving their development, using the scaling relationships of carnassial teeth in both groups as a control. Carnassials display isometric allometry in both sabretooths and non-sabretooths, supporting their close relationship with meat-slicing, whereas the upper canines of both groups display positive allometry with body size. Whereas there is no statistical difference in allometry of upper canine height between dirk-toothed and scimitar-toothed sabretooth ecomorphs, the significantly stronger positive allometry of upper canine height shown by sabretooths as a whole compared to non-sabretooths reveals that different processes drove canine evolution in these groups. Although sabretoothed canines must still have been effective for prey capture and processing by hypercarnivorous predators, canine morphology in these extinct carnivores was likely to have been driven to a greater extent by sexual selection than in non-sabretooths. Scaling relationships therefore indicate the probable importance of sexual selection in the evolution of the hypertrophied sabretooth anterior dentition.

  9. Stroma and extracellular matrix proteins in canine tumours

    NARCIS (Netherlands)

    Mukaratirwa, Sydney


    In this thesis, studies on temporal and spatial changes in stromal cells and extracellular matrix (ECM) molecules in canine gastrointestinal (GIT) tumours and canine transmissible venereal (CTVT) tumours are described. The mechanisms involved in the phenotypic transformation of fibroblasts to myofib

  10. First report of canine visceral leishmaniasis in Bulgaria


    TSATCHEV, Illia; KYRIAZIS, Ioannis D.; BOUTSINI, Sofia; Karagouni, Evdokia; Dotsika, Eleni


    Seroepidemiological studies on canine leishmaniasis in Bulgaria, even in areas where human leishmaniasis has been detected, are controversial. This report describes 2 clinical cases of canine visceral leishmaniasis. The disease was confirmed by microscopical, serological, and molecular methods. It is, therefore, suggested that infected dogs could constitute the reservoir for human leishmaniasis in the country.

  11. Management of an Unusual Maxillary Canine: A Rare Entity


    Jaya Nagendra Krishna Muppalla; Krishnamurthy Kavuda; Rajani Punna; Amulya Vanapatla


    Clinicians need to have intimate knowledge and thorough understanding of both pulp chamber and root canal anatomy. They should be aware of possibility of anatomical variations in the root canal system during endodontic treatment. Maxillary canines usually have single root and root canal but rarely may have single root with two root canals. This case describes a lengthier maxillary canine with two root canals.

  12. 9 CFR 113.317 - Parvovirus Vaccine (Canine). (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... for immunogenicity. The selected virus dose shall be established as follows: (1) Twenty-five...

  13. Apicotomy: surgical management of maxillary dilacerated or ankylosed canines. (United States)

    Araújo, Eustáquio A; Araújo, Cristiana V; Tanaka, Orlando M


    This clinical article reports a technique, apicotomy, for managing dilacerated or ankylosed canines. The records of 3 patients successfully treated with apicotomy are presented. Orthodontists observe clinically significant incidences of impacted maxillary canines in their daily practices. Several procedures have been described to bring an ankylosed, impacted tooth into occlusion. Luxation is the most widely used solution, but there are risks involved with that approach, and the success rate is low. Surgical repositioning has also been used, but morbidity is high, and the aggressiveness of the procedure might also contraindicate it. Ankylosis might be related to the anatomic position of the canine's root apex and its adjacent anatomic structures. Apicotomy is a guided fracture of a canine root apex, followed by its orthodontic traction. It is a conservative surgical alternative for treating impacted canines with dilacerations or apical root ankylosis. PMID:24286914

  14. Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus




    Serum neutralisation test (SNT) has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA) is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig) G antibodies to canine distemper virus (CDV) was developed by using Onderstepoort strain of canine dis...

  15. The Serological and Virological Investigation of Canine Adenovirus Infection on the Dogs


    Oya Bulut; Orhan Yapici; Oguzhan Avci; Atilla Simsek; Kamil Atli; Irmak Dik; Sibel Yavru; Sibel Hasircioglu; Mehmet Kale; Nuri Mamak


    Two types of Canine Adenovirus (CAVs), Canine Adenovirus type 1 (CAV-1), the virus which causes infectious canine hepatitis, and Canine Adenovirus type 2 (CAV-2), which causes canine infectious laryngotracheitis, have been found in dogs. In this study, blood samples taken from 111 dogs, which were admitted to the Internal Medicine Clinic of Selcuk University, Faculty of Veterinary Medicine, with clinical symptoms. Seventy-seven dogs were sampled from Isparta and Burdur dog shelters by random ...

  16. Canine Visceral Leishmaniasis in Boyer Ahmad District, Kohgiluyeh & Boyer Ahmad Province, Southwest of Iran

    Directory of Open Access Journals (Sweden)

    V Barati


    Full Text Available Background: Mediterranean type of visceral leishmaniasis (VL is present in different parts of Iran. Several studies have identified dogs as the main reservoirs of the VL caused by Leishmania infantum in Iran and other Mediterranean regions. This study aimed to determine the seroprevalence of canine visceral leishmaniasis as animal reservoir host for human visceral leishmaniasis in Boyer Ahmad dis­trict in southwest of Iran.Methods: A seroepidemiological study was carried out to determine the seroprevalence of canine visceral leishmaniasis (CVL among ownership dogs by using direct agglutination test (DAT in 23 of 182 villages of Boyer Ahmad district, during August 2009 to August 2010. One hundred and seventy serum samples from ownership dogs were selected by multi-stage cluster sampling in villages of Boyer Ahmad district. All samples were tested by DAT and anti-Leishmania antibodies titers at ≥ 1:320 was considered as positive.Results: Of the 170 serum samples, 10% were positive by DAT at titers of 1:320 and higher. No statistical significant difference was found between male (10.7% and female (8.3% seroprevalence. The highest seroprevalence rate (15.1% was observed among the ownership dogs of four to seven years age. Altogether, seventeen (25.4% of the seropositive dogs had clinical signs and symptoms.Conclusion: It seems that Boyer Ahmad district is an endemic area for canine visceral leishmaniasis in Iran.

  17. Lymphatic territories (lymphosomes in a canine: an animal model for investigation of postoperative lymphatic alterations.

    Directory of Open Access Journals (Sweden)

    Hiroo Suami

    Full Text Available BACKGROUND: Lymph node dissection is often performed as a part of surgical treatment for breast cancer and malignant melanoma to prevent malignant cells from traveling via the lymphatic system. Currently little is known about postoperative lymphatic drainage pattern alterations. This knowledge may be useful for management of recurrent cancer and prevention of breast cancer related lymphedema. We mapped the complete superficial lymphatic system of a dog and used this canine model to perform preliminary studies of lymphatic architectural changes in postoperative condition. METHODS: Lymphatic territories (lymphosomes were mapped with 4 female mongrel carcasses using an indocyanine green (ICG fluorescent lymphography and a radiographic microinjection technique. Two live dogs were then subjected to unilateral lymph node dissection of lymph basins of the forelimb, and ICG lymphography and lymphangiogram were performed 6 months after the surgery to investigate lymphatic changes. Lymphatic patterns in the carcass were then compared with postoperative lymphatic patterns in the live dogs. RESULTS: Ten lymphosomes were identified, corresponding with ten lymphatic basins. Postoperative fluorescent lymphographic images and lymphangiograms in the live dogs revealed small caliber lymphatic network fulfilling gaps in the surgical area and collateral lymphatic vessels arising from the network connecting to lymph nodes in the contralateral and ipsilateral neck in one dog and the ipsilateral subclavicular vein in another dog. CONCLUSION: Our canine lymphosome map allowed us to observe lymphatic collateral formations after lymph node dissection in live dogs. This canine model may help clarify our understanding of postoperative lymphatic changes in humans in future studies.

  18. Isolation and characterization of canine parvovirus type 2c (CPV-2c from symptomatic puppies

    Directory of Open Access Journals (Sweden)

    R Puentes


    Full Text Available Canine parvovirus type 2 (CPV-2 is a leading cause of diarrhea in puppies in several parts of the world. In this study CPV-2 was detected and recovered from puppies showing clinical disease from Montevideo, Uruguay. Samples were processed and used to infect CRFK and MDCK cells in order to isolate the virus. Out of twelve, two samples were positive for CPV-2. A genomic region of 583 bp was amplified and the molecular characterization was performed by sequencing, phylogenetic analysis and Restriction Fragment Length Polymorphism (RFLP. Two isolated viruses (UY1 and UY2 were CPV-2c-like viruses. The comparison between the cytophatic effect (CPE of CPV-2 (vaccinal virus and CPV-2c (isolated virus on primary canine cells cultures and on CRFK line cells, demonstrated that CPV-2c is less citopathogenic in CRFK than in primary cultures. Our study represents the first report on isolation and characterization of canine parvovirus type 2c (CPV-2c in cell cultures from South American dogs.

  19. Thermographic image analysis as a pre-screening tool for the detection of canine bone cancer (United States)

    Subedi, Samrat; Umbaugh, Scott E.; Fu, Jiyuan; Marino, Dominic J.; Loughin, Catherine A.; Sackman, Joseph


    Canine bone cancer is a common type of cancer that grows fast and may be fatal. It usually appears in the limbs which is called "appendicular bone cancer." Diagnostic imaging methods such as X-rays, computed tomography (CT scan), and magnetic resonance imaging (MRI) are more common methods in bone cancer detection than invasive physical examination such as biopsy. These imaging methods have some disadvantages; including high expense, high dose of radiation, and keeping the patient (canine) motionless during the imaging procedures. This project study identifies the possibility of using thermographic images as a pre-screening tool for diagnosis of bone cancer in dogs. Experiments were performed with thermographic images from 40 dogs exhibiting the disease bone cancer. Experiments were performed with color normalization using temperature data provided by the Long Island Veterinary Specialists. The images were first divided into four groups according to body parts (Elbow/Knee, Full Limb, Shoulder/Hip and Wrist). Each of the groups was then further divided into three sub-groups according to views (Anterior, Lateral and Posterior). Thermographic pattern of normal and abnormal dogs were analyzed using feature extraction and pattern classification tools. Texture features, spectral feature and histogram features were extracted from the thermograms and were used for pattern classification. The best classification success rate in canine bone cancer detection is 90% with sensitivity of 100% and specificity of 80% produced by anterior view of full-limb region with nearest neighbor classification method and normRGB-lum color normalization method. Our results show that it is possible to use thermographic imaging as a pre-screening tool for detection of canine bone cancer.

  20. Socio-cultural practices of deciduous canine tooth bud removal among Maasai children. (United States)

    Mutai, J; Muniu, E; Sawe, J; Hassanali, J; Kibet, P; Wanzala, P


    The removal of teeth amongst the Maasai is a traditional practice as part of an initiation or to make space for feeding in an event of diseases locking the jaw. Removal of deciduous canine tooth buds (DCB) among infants below 2 years has been reported in several studies to be common mainly amongst communities in East Africa, Ethiopia and Sudan. The main reason for the practice revolves around the belief that tooth buds or 'maggots' are false teeth, nylon or worms and are responsible for diarrhoea, vomiting, fever and growth retardation in children, amongst other illnesses. The main objective of this study was to assess the socio-cultural factors which contribute to this practice. The main methods of data collected included Focus Group Discussions (FGD) with mothers of children in that age group and Traditional Birth Attendants (TBA). In-depth interviews (IDI)were conducted with key informants versed with Maasai traditions whereas observations were done within the manyattas where participants live. Proceedings at both the FGD and the IDI were recorded on paper and were analysed thematically. The study showed that the removal of canine tooth buds amongst children that started initially with calves--that diseases that cause diarrhoea in calves were brought about by the canine tooth buds that were turning reddish in colour--is deeply rooted and practised in the community despite sensitisation interventions mounted jointly by the University of Nairobi, Kenya Medical Research Institute and the Kenya Medical Training College, among others. This study discovered that canine tooth buds are associated with bad spirits that cause diarrhoea and vomiting and the belief that removing them is a sure way of providing a cure for all children's ailments. PMID:20476714

  1. Diagnosis and management of canine claw diseases. (United States)

    Mueller, R S


    The diagnostic workup for canine claw disease consists of a good history and complete clinical examination which may provide clues for a possible underlying disorder. In dogs with claw disease but no other clinical or historical signs, further recommended diagnostic procedures include cytological evaluation of impression smears or discharge from the claw fold, bacterial culture and sensitivity testing, biopsy of the claw matrix, and an elimination diet for 6 to 8 weeks. If no underlying disease can be identified, trial treatment with essential fatty acid supplementation, vitamin E, or a combination of doxycycline hydrochloride and niacinamide may be useful. In some patients, onychectomy of all claws may be considered. PMID:10563005

  2. Definition, Classification, and Pathophysiology of Canine Glaucoma. (United States)

    Pizzirani, Stefano


    Glaucoma is a common ocular condition in humans and dogs leading to optic nerve degeneration and irreversible blindness. Primary glaucoma is a group of spontaneous heterogeneous diseases. Multiple factors are involved in its pathogenesis and these factors vary across human ethnic groups and canine breeds, so the clinical phenotypes are numerous and their classification can be challenging and remain superficial. Aging and oxidative stress are major triggers for the manifestation of disease. Multiple, intertwined inflammatory and biochemical cascades eventually alter cellular and extracellular physiology in the optic nerve and trabecular meshwork and lead to vision loss. PMID:26456751

  3. Creation of distal canine limb lymphedema

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H.C.; Pribaz, J.J.; O' Brien, B.M.; Knight, K.R.; Morrison, W.A.


    A canine model of distal limb lymphedema was established in order to study the treatment of this condition by lymph node transfer. This model was more difficult to establish than whole-limb lymphedema. Significant edema was achieved by a combination of preoperative irradiation and circumferential removal of skin from the irradiated areas followed by removal of the contents of the popliteal fossa. Despite these measures, it was not possible to produce lymphedema in every case, possibly because of the presence of lymphaticovenous shunts and panvascular compensation mechanisms.

  4. Increasing Incidence of Canine Leptospirosis in Switzerland


    Andrea Major; Ariane Schweighauser; Thierry Francey


    A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73) and rainfall (r2 0.39), >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of ...

  5. Functional characterization of canine interferon-lambda. (United States)

    Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun; Yang, Limin; Luo, Tingrong


    In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2'5'-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142

  6. Cone beam computed tomography findings of impacted upper canines

    International Nuclear Information System (INIS)

    To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

  7. Cone beam computed tomography findings of impacted upper canines

    Energy Technology Data Exchange (ETDEWEB)

    Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)


    To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

  8. Establishment of a sensitized canine model for kidney transplantation

    Institute of Scientific and Technical Information of China (English)

    XIE Sen; XIA Sui-sheng; TANG Li-gong; CHENG Jun; CHEN Zhi-shui; ZHENG Shan-gen


    Objective:To establish a sensitized canine model for kidney transplantation. Methods:12 male dogs were averagely grouped as donors and recipients. A small number of donor canine lymphocytes was infused into different anatomic locations of a paired canine recipient for each time and which was repeated weekly. Specific immune sensitization was monitored by means of Complement Dependent Cytotoxicity (CDC) and Mixed Lymphocyte Culture (MLC) test. When CDC test conversed to be positive and MLC test showed a significant proliferation of reactive lymphocytes of canine recipients, the right kidneys of the paired dogs were excised and transplanted to each other concurrently. Injury of renal allograft function was scheduled determined by ECT dynamic kidney photography and pathologic investigation. Results :CDC test usually conversed to be positive and reactive lymphocytes of canine recipients were also observed to be proliferated significantly in MLC test after 3 to 4 times of canine donor lymphocyte infusions. Renal allograft function deterioration occurred 4 d post-operatively in 4 of 6 canine recipients, in contrast to none in control dogs. Pathologic changes suggested antibody-mediated rejection (delayed) or acute rejection in 3 excised renal allograft of sensitized dogs. Seven days after operation, all sensitized dogs had lost graft function, pathologic changes of which showed that the renal allografts were seriously rejected. 2 of 3 dogs in control group were also acutely rejected. Conclusion:A convenient method by means of repeated stimulation of canine lymphocyte may induce specific immune sensitization in canine recipients. Renal allografts in sensitized dogs will be earlier rejected and result in a more deteriorated graft function.

  9. Canine babesiosis treatment with three different medicines

    Directory of Open Access Journals (Sweden)

    Torbica G.


    Full Text Available Canine babesiosis is a relatively frequent disease in Croatia. Elevated body temperature, anemia and haemoglobinuria are the most common signs. Diagnosis is rapidly obtained by employing blood smears, as B. canis is present in the red blood cells of affected dogs. Treatment is favourable and without consequences. Blood work was performed initialy, prior to treatment, and on the 1st and the 7th day following treatment. Following history and examination of the dogs blood and urine samples were taken. After confirmation of B. canis in the red blood cells, alltogether 226 dogs were tretated. Out of them 80 were tretaed with Berenil® (diminazen aceturate, Hoechst, 72 were tretated with Imizol® (imidocarb dipropionate, Schering-Plough-Animal-Health and 74 with Oxopirvedin® (fenamidine dizetionate, Merial. Clinical findings, haematological analysis and urine analysis are given and statistically assesed. After tretment with Berenil®, symptoms of babesiosis regressed within 24 hours. Health improved more slowly in the group treated with Oxopirvedin® in comparioson with the group treated with Berenil®. Contrary to the above, Imizol® displayed the slowest regression of the disease and reinfestation with B. canis within 30 days was not noted. That is not the case if treatment was provided by Berenil® and Oxopirvedin®. In all 226 cases of canine babesiosis side effects were not noted, except topically inflammed tissue at the site of subcutaneous application.

  10. Seroepidemiology of Canine parvovirus infection in dogs

    Directory of Open Access Journals (Sweden)

    Indrawati Sendow


    Full Text Available Canine parvovirus is an acute and fatal viral disease in dogs. A total of 209 local, cross breed and breed dogs sera from Kodya Bogor, Kabupaten Bogor, Sukabumi, and Jakarta, had been tested using Haemagglutination Inhibition Test (HI with pig red blood cells. A total of 64 breed and cross breed dogs from Sukabumi and Kodya Bogor, were used as a sentinel dogs to study the epidemiology of Canine parvovirus (CPV infection and its immunological responses caused by vaccination. The results indicated that 78% (95 breed and cross bred dogs and 59% (51 local dogs had antibody to CPV. Sentinel dogs results indicated that dogs had been vaccinated showed antibody response with the varied titre dependant upon prevaccination titre. Low prevaccinated titre gave better response than protective level titre. From 19 puppies observed, Maternal antibodi were still detected until 5 weeks old puppies. First vaccination given at less than 3 months old, should be boosted after 3 months old puppied. Antibodi titre produced by natural infection will keep untill 2 years. These data concluded that the dog condition and time of vaccination will affect the optimum antibody response.

  11. Canine neosporosis: perspectives on pathogenesis and management

    Directory of Open Access Journals (Sweden)

    Silva RC


    Full Text Available Rodrigo C Silva,1 Gustavo P Machado2 1Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Starkville, MS, USA; 2Department of Internal Medicine and Surgery of Small Animals, Dr Munhoz Veterinary Hospital, Itápolis, Brazil Abstract: Canine neosporosis is a worldwide disease caused by the obligate intracellular parasite protozoan Neospora caninum, manifesting mainly neurological symptoms. N. caninum has a heteroxenous life cycle and affects a wide range of warm-blooded animals. The domestic and wild canids are the definitive host of the parasite. They shed oocysts after ingestion of tissue cysts from infected intermediate hosts (ovine, equine, bovine, canine, and many other species, containing bradyzoites, or oocyst-contaminated water and food. The presence of dogs in farms is considered a risk factor for production animals. A wide range of diagnostic methods are currently available, but the most used is serology, ie, indirect fluorescent antibody test specific to the antibody detection in blood serum samples. No vaccine is available, but control strategies should be focused on the vertical and horizontal transmission of the parasite, ie, avoid feeding dogs with raw or undercooked meat, and taking care with water for human and animal consumption. No medicines to control the transplacental transmission are available yet. Keywords: neosporosis, Neospora caninum, pathogenesis, management, dogs

  12. Alpha basic crystallin expression in canine mammary tumors


    Guvenc, Tolga; Gulbahar, Mustafa Yavuz; YARIM, Murat; Kabak, Yonca Betil; Karayigit, Onder; Sozmen, Mahmut


    The aim of this study was to evaluate prognostic and/or diagnostic factors of canine mammary tumors by immunohistochemically analyzing the expression of alpha basic crystallin (αB-c). For this, formalin-fixed, paraffin-embedded blocks of 51 naturally-occurring canine mammary tumors (11 benign and 40 malignant) were used. Tissue from eight normal canine mammary glands were served as a control. Immunohistochemically, in the control mammary tissues, a few luminal epithelial cells were αB-c posit...

  13. Canine pluripotent stem cells: Are they ready for clinical applications?

    Directory of Open Access Journals (Sweden)

    Dean Harvey Betts


    Full Text Available The derivation of canine embryonic stem cells and generation of canine induced pluripotent stem cells are significant achievements that have unlocked the potential for developing novel cell-based disease models, drug discovery platforms and transplantation therapies in the dog. A progression from concept to cure in this clinically relevant companion animal will not only help our canine patients but also help advance human regenerative medicine. Nevertheless, many issues remain to be resolved before pluripotent cells can be used clinically in a safe and reproducible manner.

  14. Clinical and serological response of wild dogs (Lycaon pictus to vaccination against canine distemper, canine parvovirus infection and rabies

    Directory of Open Access Journals (Sweden)

    J. Van Heerden


    Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

  15. Validation of commercially available automated canine-specific immunoturbidimetric method for measuring canine C-reactive protein

    DEFF Research Database (Denmark)

    Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold;


    with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was < 2.4% for 4 tested serum pools analyzed twice daily over 10 days. The method was linear under dilution, and no prozone...... comparison study, there was good agreement between the validated human CRP assay and the new canine-specific assay. Healthy dogs had CRP concentrations that were less than the limit of quantification of the Gentian cCRP method (6.8 mg/L). CONCLUSIONS: The new canine-specific immunoturbidimetric CRP assay is...

  16. Case Report: Canine Fossa Abscess; A Rare Etiological Factor: The Lower Canine Tooth


    Agacayak, K. Serkan; Atılgan, S. Serhat; GORGUN, Belgin; Yaman, Ferhan; Ucan, M. Can; Atalay, Yusuf


    Odontogenic infection may be dangerous; especially when life-threatening complications occur. Infection spreads through the bone and periosteum toward nearby or more distant structures and spaces. Canine fossa abscess is an odontogenic infection that can lead to life-threatening complications. Successful treatment requires early recognition, determination of etiological factors, and proper medical and surgical management. The aim of this paper is to emphasize different and rare etiological fa...

  17. Canine index – A tool for sex determination

    Directory of Open Access Journals (Sweden)

    Shankar M. Bakkannavar


    Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.

  18. Death of a wild wolf from canine parvovirus enteritis (United States)

    Mech, L.D.; Kurtz, H.J.; Goyal, S.


    A 9-mo-old female wolf (Canis lupus) in the Superior National Forest of Minnesota (USA) died from a canine parvovirus (CPV) infection. This is the first direct evidence that this infection effects free-ranging wild wolves.

  19. Severe canine distemper outbreak in unvaccinated dogs in Mozambique

    Directory of Open Access Journals (Sweden)

    Julieta Zacarias


    Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

  20. Prediction of width of un-erupted incisors, canines and premolars in a Ugandan population: A cross sectional study


    Buwembo William; Kutesa Annet; Muwazi Louis; Rwenyonyi Charles


    Abstract Background Accurate prediction of the space forms an important part of an orthodontic assessment in the mixed dentition. However the most commonly used methods of space analysis are based on data developed on Caucasian populations. In order to provide more accurate local data we set out to develop a formula for predicting the widths of un-erupted canines and premolars for a Ugandan population and to compare the predicted widths of the teeth from this formula with those obtained from ...

  1. Assessment of Knowledge, Attitude and Practice of Dog Owners to Canine Rabies in Wukari Metropolis, Taraba State Nigeria


    Ameh, Veronica O.; Dzikwi, Asabe A.; Umoh, Jarlath U.


    Canine rabies is endemic and occurs throughout the year in all parts of Nigeria. A descriptive cross sectional study was designed to assess knowledge, attitude and practice of dog owners towards rabies, to check for the presence of rabies antigens in brain tissue of dogs slaughtered for human consumption and to assess rabies vaccination coverage of dogs in Wukari. Structured questionnaires were prepared and administered to 200 dog owners by face to face interview. The questionnaire sought inf...

  2. Emerging perspectives on hereditary glomerulopathies in canines

    Directory of Open Access Journals (Sweden)

    Littman MP


    Full Text Available Meryl P LittmanDepartment of Clinical Studies – Philadelphia, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA, USAAbstract: Familial glomerulopathies have been described in more than two dozen dog breeds. These canine spontaneous cases of glomerular disease are good models for their human counterparts. The dogs present clinically with protein-losing nephropathy and variable signs of hypertension, thromboembolic events, edema/effusions/nephrotic syndrome, or eventually with signs of renal disease such as anorexia, vomiting, weight loss, and/or polyuria/polydipsia. Laboratory changes include proteinuria, hypoalbuminemia, hypercholesterolemia, and eventually azotemia, hyperphosphatemia, anemia, and isosthenuria. Renal biopsies examined with transmission electron microscopy, immunofluorescence, and thin section light microscopy may show ultrastructural glomerular basement membrane abnormalities, glomerulosclerosis, amyloidosis, non-amyloid fibrillary deposition, or breed-associated predispositions for immune-complex glomerulonephritis. Genome-wide association studies and fine sequencing of candidate genes have led to the discovery of variant alleles associated with disease in some breeds; eg, 1 glomerular basement membrane ultrastructural abnormalities due to defective collagen type IV, caused by different premature stop codons in each of four breeds; ie, in COL4A5 in Samoyeds and Navasota mix breed dogs (X-linked, and in COL4A4 in English Cocker Spaniels and English Springer Spaniels (autosomal recessive; and 2 glomerulosclerosis-related podocytopathy with slit diaphragm protein anomalies of both nephrin and Neph3/filtrin due to non-synonymous single nucleotide polymorphisms in conserved regions of their encoding genes, NPHS1 and KIRREL2, in Soft Coated Wheaten Terriers and Airedale Terriers, with a complex mode of inheritance. Age at onset and progression to end-stage renal disease vary depending on the model. Genetic

  3. Canine distemper virus in Lake Baikal seals (Phoca sibirica).


    Mamaev, L.V.; Visser, Ilona; Belikov, S.I.; Denikina, N.N.; Harder, Timm; Goatley, L.; Rima, B.; Edginton, B.; Osterhaus, Albert; Barrett, Thomas,


    textabstractThe virus epizootic which resulted in significant mortality in Siberian seals (Phoca sibirica) in Lake Baikal during 1987/88 was caused by canine distemper virus. Sequence analysis of the virus glycoprotein genes revealed that it was most closely related to recent European field isolates of canine distemper virus. This paper presents evidence that the same virus continued to circulate in seals in Lake Baikal after the initial epizootic. Three out of 45 brain tissue samples collect...

  4. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus


    Otávio Valério Carvalho; Clarisse Vieira Botelho; Caroline Gracielle Torres Ferreira; Paulo Oldemar Scherer; Jamária Adriana Pinheiro Soares-Martins; Márcia Rogéria de Almeida; Abelardo Silva Júnior


    Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availabilit...

  5. A Study of Transmigrated Canine in an Indian Population


    Sharma, Gaurav; Nagpal, Archna


    Aim. The purpose of this study was to investigate the prevalence of transmigrated canines in a north Indian population and association with gender, side, associated pathologies, and dental anomalies. Subjects and methods. The prospective study consisted of panoramic radiographs of 3000 patients from two dental colleges in north India. The panoramic radiographs were screened for radiographically identified position of the transmigrated tooth, retained canine, and other coexisting dental anomal...

  6. Characterization of a Canine Homolog of Human Aichivirus


    Kapoor, A.; Simmonds, P.; Dubovi, E. J.; Qaisar, N.; Henriquez, J.A.; Medina, J.; Shields, S.; Lipkin, W. I.


    Many of our fatal "civilization" infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5' and 3' untranslated regions...

  7. Characterization of a Canine Homolog of Human Aichivirus▿


    Kapoor, Amit; Simmonds, Peter; Dubovi, Edward J.; Qaisar, Natasha; Henriquez, Jose A.; Medina, Jan; Shields, Shelly; Lipkin, W. Ian


    Many of our fatal “civilization” infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5′ and 3′ untranslated regions...

  8. Canine Evolution in Sabretoothed Carnivores: Natural Selection or Sexual Selection?


    Marcela Randau; Chris Carbone; Turvey, Samuel T.


    The remarkable elongated upper canines of extinct sabretoothed carnivorous mammals have been the subject of considerable speculation on their adaptive function, but the absence of living analogues prevents any direct inference about their evolution. We analysed scaling relationships of the upper canines of 20 sabretoothed feliform carnivores (Nimravidae, Barbourofelidae, Machairodontinae), representing both dirk-toothed and scimitar-toothed sabretooth ecomorphs, and 33 non-sabretoothed felids...

  9. Characterization of a Canine Homolog of Human Aichivirus▿


    Kapoor, A; Simmonds, P.; Dubovi, E J; Qaisar, N.; Henriquez, J. A.; J. Medina; S Shields; Lipkin, W. I.


    Many of our fatal "civilization" infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5' and 3' untranslated regions...

  10. Permanent Maxillary Canine Agenesis: A Rare Case Report


    Halaswamy V Kambalimath; Jain, Somya; Patil, Raju Umaji; Asokan, Alexander; Kambalimath, Deepashri


    ABSTRACT Congenitally missing teeth (CMT) are among one of the commonly known dental anomalies. The most frequently missing teeth in the permanent dentition, excluding the third molars, are mandibular second premolars and maxillary lateral incisors. Exclusive agenesis of both maxillary canines is an extremely rare occurrence and only a few cases have been reported. Previous studies showed that the prevalence of maxillary canine agenesis varies between 0.07 and 0.13%. In recent studies on Indi...

  11. Nutraceuticals for canine liver disease: assessing the evidence. (United States)

    Vandeweerd, Jean-Michel; Cambier, Carole; Gustin, Pascal


    Nutraceuticals, or nutritional supplements, have been promoted for the ancillary treatment of liver disease in dogs. However, minimal information is available in the scientific literature about commonly used nutraceuticals, such as S-adenosylmethionine, silymarin, and vitamin E. No strong clinical evidence exists regarding the efficacy of these compounds as hepatoprotectants in canine liver disease. Until this evidence exists, individual veterinarians must assume responsibility for their decision to use nutritional supplements in their canine patients with liver disease. PMID:23890245

  12. Epidermal growth factor receptor expression in canine transitional cell carcinoma


    HANAZONO, Kiwamu; Fukumoto, Shinya; KAWAMURA, Yoshio; ENDO, Yoshifumi; Kadosawa, Tsuyoshi; IWANO, Hidetomo; UCHIDE, Tsuyoshi


    Transitional cell carcinoma (TCC), a urinary bladder tumor with high mortality, is encountered commonly in dogs. Whereas overexpression of epidermal growth factor receptor (EGFR) is associated with development of human urinary bladder cancer, information on EGFR expression in canine TCC is lacking. In this study, EGFR protein and mRNA expression in canine normal bladder (n=5), polypoid cystitis (n=5) and TCC (n=25) were examined by immunohistochemistry and real-time polymerase chain reaction....

  13. Canine leishmaniasis surveillance program in a San Marino Republic kennel

    Directory of Open Access Journals (Sweden)

    Daniela Salvatore


    Full Text Available The Republic of San Marino is an autonomous State that, in view of its geographical and environmental features, can be considered a part of the Northern Italian territory, where the canine leishmaniasis (CanL is endemic. In the past, a CanL focus in the Republic's kennel was described. As a consequence of this epidemiological situation, a surveillance program was carried-out covering a 6-year period (2006-2012. A total of 1,094 sera were collected from 420 kennel dogs and examined for antibodies to Leishmania infantum by the indirect fluorescent antibody test (IFAT. Eighty-eight (21% dogs resulted IFAT positive (antibody titre ≥1/40. The overall seroprevalence increased in the first 4 years (2006-2010, going from 5.5% to 26.8% and then decreased in the 2 following years going to 17.9% (2011 and 3.9% (2012. The cumulative incidence constantly increased from 0.6% to 2.6%. This trend could be attributed to a changed infection pressure due to the dog turnover in the kennels. According to the observed incidence values, the CanL focus seems to be stable, supported by autochthonous transmission, new case introduction and Leishmania spp. circulation in owned dogs in the same area.

  14. Canine vector-borne diseases in Brazil

    Directory of Open Access Journals (Sweden)

    Dantas-Torres Filipe


    Full Text Available Abstract Canine vector-borne diseases (CVBDs are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi, bacteria (e.g., Anaplasma platys and Ehrlichia canis, and helminths (e.g., Dirofilaria immitis and Dipylidium caninum that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance of CVBDs in Brazil and discusses research gaps to be addressed in future studies.

  15. Canine distemper in endangered Ethiopian wolves. (United States)

    Gordon, Christopher H; Banyard, Ashley C; Hussein, Alo; Laurenson, M Karen; Malcolm, James R; Marino, Jorgelina; Regassa, Fekede; Stewart, Anne-Marie E; Fooks, Anthony R; Sillero-Zubiri, Claudio


    The Ethiopian wolf (Canis simensis) is the world's rarest canid; ≈500 wolves remain. The largest population is found within the Bale Mountains National Park (BMNP) in southeastern Ethiopia, where conservation efforts have demonstrated the negative effect of rabies virus on wolf populations. We describe previously unreported infections with canine distemper virus (CDV) among these wolves during 2005-2006 and 2010. Death rates ranged from 43% to 68% in affected subpopulations and were higher for subadult than adult wolves (83%-87% vs. 34%-39%). The 2010 CDV outbreak started 20 months after a rabies outbreak, before the population had fully recovered, and led to the eradication of several focal packs in BMNP's Web Valley. The combined effect of rabies and CDV increases the chance of pack extinction, exacerbating the typically slow recovery of wolf populations, and represents a key extinction threat to populations of this highly endangered carnivore. PMID:25898177

  16. European surveillance for pantropic canine coronavirus. (United States)

    Decaro, Nicola; Cordonnier, Nathalie; Demeter, Zoltan; Egberink, Herman; Elia, Gabriella; Grellet, Aurélien; Le Poder, Sophie; Mari, Viviana; Martella, Vito; Ntafis, Vasileios; von Reitzenstein, Marcela; Rottier, Peter J; Rusvai, Miklos; Shields, Shelly; Xylouri, Eftychia; Xu, Zach; Buonavoglia, Canio


    Highly virulent pantropic canine coronavirus (CCoV) strains belonging to subtype IIa were recently identified in dogs. To assess the distribution of such strains in Europe, tissue samples were collected from 354 dogs that had died after displaying systemic disease in France (n = 92), Hungary (n = 75), Italy (n = 69), Greece (n = 87), The Netherlands (n = 27), Belgium (n = 4), and Bulgaria (n = 1). A total of 124 animals tested positive for CCoV, with 33 of them displaying the virus in extraintestinal tissues. Twenty-four CCoV strains (19.35% of the CCoV-positive dogs) detected in internal organs were characterized as subtype IIa and consequently assumed to be pantropic CCoVs. Sequence and phylogenetic analyses of the 5' end of the spike protein gene showed that pantropic CCoV strains are closely related to each other, with the exception of two divergent French viruses that clustered with enteric strains. PMID:23100349

  17. A canine model of multiple portosystemic shunting. (United States)

    Howe, L M; Boothe, H W; Miller, M W; Boothe, D M


    The objective of this study was to develop and describe an experimental canine model of multiple acquired portosystemic shunts (PSS) similar in nature to spontaneously occurring PSS. Sixteen dogs were used and were divided into a control (n = 6) and a diseased group (n = 10). Dogs of the diseased group were administered dimethylnitrosamine (2 mg/kg of body weight, po) twice weekly, and clinicopathologic, ultrasonographic, and hepatic scintigraphic findings were recorded during the development of hepatic disease and PSS. Surgery was then performed to permit visual verification of multiple shunts, catheter placement for portography examination, and biopsy of the liver. All diseased dogs developed severe hepatic disease and multiple PSS as documented visually at surgery and on portography. Based on this study, dimethylnitrosamine-induced portosystemic shunting appears to be an appropriate model for spontaneously occurring multiple PSS secondary to portal hypertension. PMID:10741951

  18. Canine model of contrast medium induced fibrillation

    International Nuclear Information System (INIS)

    The injection of radiocontrast media into coronary arteries will produce a low incidence of ventricular fibrillation. This study establishes the injection duration (or contact time) required to produce fibrillation during right coronary angiography in dogs using a 370 mg I/ml, meglumine/sodium diatrizoate formulation (Renografin 76, Squibb). The mean contact time required to induce fibrillation was 18.8+-5.8 seconds for 66 injections in 47 dogs. Prolonged ischemia of greater than 170 s did not produce either fibrillation or arrhythmias, therefore fibrillation is caused by properties of the media. The contact time was not significantly influenced by test injections and was not significantly different in repeated experiments. The canine contact time model of contrast media induced ventricular fibrillation is reproducible and will facilitate the study of risk factors that increase the possibility of fibrillation. (orig.)

  19. Canine Hip Dysplasia is Predictable by Genotyping (United States)

    Guo, Gang; Zhou, Zhengkui; Wang, Yachun; Zhao, Keyan; Zhu, Lan; Lust, George; Hunter, Linda; Friedenberg, Steven; Li, Junya; Zhang, Yuan; Harris, Stephen; Jones, Paul; Sandler, Jody; Krotscheck, Ursula; Todhunter, Rory; Zhang, Zhiwu


    Summary Objective To establish a predictive method using whole genome genotyping for early intervention in canine hip dysplasia (CHD) risk management, for the prevention of the progression of secondary osteoarthritis (OA), and for selective breeding. Design Two sets of dogs (6 breeds) were genotyped with dense SNPs covering the entire canine genome. The first set contained 359 dogs upon which a predictive formula for genomic breeding value (GBV) was derived by using their estimated breeding value (EBV) of the Norberg angle (a measure of CHD) and their genotypes. To investigate how well the formula would work for an individual dog with genotype only (without using EBV or phenotype), a cross validation was performed by masking the EBV of one dog at a time. The genomic data and the EBV of the remaining dogs were used to predict the GBV for the single dog that was left out. The second set of dogs included 38 new Labrador retriever dogs, which had no pedigree relationship to the dogs in the first set. Results The cross validation showed a strong correlation (r>0.7) between the EBV and the GBV. The independent validation showed a strong correlation (r=0.5) between GBV for the Norberg angle and the observed Norberg angle (no EBV was available for the new 38 dogs). Sensitivity, specificity, positive, and negative predictive value of the genomic data were all above 70%. Conclusions Prediction of CHD from genomic data is feasible, and can be applied for risk management of CHD and early selection for genetic improvement to reduce the prevalence of CHD in breeding programs. The prediction can be implemented before maturity, at which age current radiographic screening programs are traditionally applied, and as soon as DNA is available. PMID:21215318

  20. Fluorescein angiography of the canine retina

    International Nuclear Information System (INIS)

    The retinal vascular bed was examined in 37 canine eyes by studying 50 retinal fluorangiograms. All angiographic phases could distinctly be visualized by the use of a small intravenous bolus of 10 mg/kg fluorescein. The choroidal phase is characterized by spot-like and lobular filling of the choriocapillaris. By coalescence of the choroidal lobules, this uneven filling progressively disappears in the subsequent phases. The retinal arterial phase is characterized by a hyperfluorescence of the retinal arterioles at the level of the optic disc border. The time interval between the start of the choroidal phase and the retinal arterial phase is very short due to the common origin of the choroidal and retinal arteries from the choroidoretinal arteries. The retinal arterio-venous phase is characterized by a complete filling of the smaller arterioles, capillaries, and venules. During this phase the branching pattern of the retinal blood vessels at the area centralis region can be most easily studied. This also applies to the periarteriolar capillary-free zones and the radial peripapillary capillaries. The retinal early venous phase is characterized by the onset of laminar flow in the larger retinal venules. A homogeneous and complete filling of the larger venules is characteristic for the onset of the late venous phase. During the retinal venous phase the border venule can be observed just posterior to the ora ciliaris retinae. Fluorescein angiography of the canine retinal microvasculature shows that the dog is less suitable as an experimental animal model in ophthalmology, due to the presence of the choroidal tapetum which reflects fluorescent light and thus diminishes the contrast between the retinal blood vessels and the background

  1. Production of antibodies to canine IL-1beta and canine TNF to assess the role of proinflammatory cytokines. (United States)

    Baggio, Vannozza; Ott, Fabienne; Fischer, René W; Gram, Hermann; Peele, John; Spreng, David; Schmökel, Hugo; Jungi, Thomas W


    IL-1 and TNF are important proinflammatory cytokines implicated in both antimicrobial host defense and pathogenesis of diseases with an immune-mediated and/or inflammatory component. Respective studies in the dog have been hampered by the unavailability of reagents allowing the specific measurement of canine cytokine proteins and the effect of canine cytokine neutralization by Ab. Starting with recombinant canine (rcan) IL-1beta and rcanTNF, four polyclonal antisera and 22 mAb specific for rcanIL-1beta and rcanTNF were generated. Their usefulness in neutralization assays was determined. Using cytokine-containing supernatants of canine cells in bioassays, polyclonal antisera neutralized either canine IL-1beta or TNF. TNF was also neutralized by three antibodies developed in this study and one commercial mAb. The usefulness of monoclonal and polyclonal Ab in canine cytokine-specific Ab capture ELISA's was assessed. This resulted in the identification of a commercial mAb combination and one pair developed in this study allowing low levels of TNF to be detected by antibody capture ELISA. The detection limit was 141 pg/ml rcanTNF for both combinations. Using rcanIL-1beta as an antigen allowed the detection of lower concentrations of rcanIL-1beta (20 pg/ml, on the average) by a pair of polyclonal antisera than when monoclonals were used. By using such IL-1beta-specific and TNF-specific ELISA's, the respective cytokines were detected in supernatants of canine PBMC stimulated with LPS or heat-killed Listeria monocytogenes and interferon-gamma combined. Thus, monoclonal and polyclonal reagents were identified allowing the quantitation of canine IL-1beta and TNF production in vitro, and the neutralization of these cytokines. PMID:15982477

  2. Canine detection of free-ranging brown treesnakes on Guam (United States)

    Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.


    We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.

  3. A retrospective investigation of canine adenovirus (CAV) infection in adult dogs in Turkey : article


    Gur, S; A. Acar


    Canine adenovirus (CAV) type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11), and Akbash dogs (n = 17) and Turkish Greyhounds (n=15) in Es...

  4. The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells. (United States)

    Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki


    Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. PMID:25680810

  5. Respiratory disease outbreak in a veterinary hospital associated with canine parainfluenza virus infection


    Weese, J Scott; Stull, Jason


    A cluster of canine parainfluenza virus infections was identified in a veterinary referral hospital. While hospital-associated outbreaks of canine parainfluenza virus infection have not been previously reported, veterinary hospitals possess some of the same risk factors that may be present in traditional high-risk sites such as kennels. Hospital-associated transmission of canine respiratory pathogens, therefore, must be considered.

  6. Accuracy of Trained Canines for Detecting Bed Bugs (Hemiptera: Cimicidae). (United States)

    Cooper, Richard; Wang, Changlu; Singh, Narinderpal


    Detection of low-level bed bug, Cimex lectularius L. (Hemiptera: Cimicidae), infestations is essential for early intervention, confirming eradication of infestations, and reducing the spread of bed bugs. Despite the importance of detection, few effective tools and methods exist for detecting low numbers of bed bugs. Scent dogs were developed as a tool for detecting bed bugs in recent years. However, there are no data demonstrating the reliability of trained canines under natural field conditions. We evaluated the accuracy of 11 canine detection teams in naturally infested apartments. All handlers believed their dogs could detect infestations at a very high rate (≥95%). In three separate experiments, the mean (min, max) detection rate was 44 (10-100)% and mean false-positive rate was 15 (0-57)%. The false-positive rate was positively correlated with the detection rate. The probability of a bed bug infestation being detected by trained canines was not associated with the level of bed bug infestations. Four canine detection teams evaluated on multiple days were inconsistent in their ability to detect bed bugs and exhibited significant variance in accuracy of detection between inspections on different days. There was no significant relationship between the team's experience or certification status of teams and the detection rates. These data suggest that more research is needed to understand factors affecting the accuracy of canine teams for bed bug detection in naturally infested apartments. PMID:26470083

  7. Removal of deciduous canine tooth buds in Kenyan rural Maasai. (United States)

    Hassanali, J; Amwayi, P; Muriithi, A


    The removal of deciduous canine tooth buds in early childhood is a practice that has been documented in Kenya and in neighboring countries. This paper describes the occurrence, rationale and method of this practice amongst rural Kenyan Maasai. In a group of 95 children aged between six months and two years, who were examined in 1991/92, 87% were found to have undergone the removal of one or more deciduous canine tooth buds. In an older age group (3-7 years of age), 72% of the 111 children examined exhibited missing mandibular or maxillary deciduous canines. It was found that the actual removal of a deciduous tooth bud is often performed by middle-aged Maasai women who enucleate the developing tooth using a pointed pen-knife. There exists a strong belief among the Maasai that diarrhoea, vomiting and other febrile illnesses of early childhood are caused by the gingival swelling over the canine region, and which is thought to contain 'worms' or 'nylon' teeth. The immediate and long-term hazards of this practice include profuse bleeding, infection and damage to the developing permanent canines. A multi-disciplinary approach involving social anthropologists in addition to dental and medical personnel, is recommend in order to discourage this harmful operation that appears to be on the increase. PMID:7621751

  8. The advent of canine performance science: offering a sustainable future for working dogs. (United States)

    Cobb, Mia; Branson, Nick; McGreevy, Paul; Lill, Alan; Bennett, Pauleen


    Working and sporting dogs provide an essential contribution to many industries worldwide. The common development, maintenance and disposal of working and sporting dogs can be considered in the same way as other animal production systems. The process of 'production' involves genetic selection, puppy rearing, recruitment and assessment, training, housing and handling, handler education, health and working life end-point management. At present, inefficiencies throughout the production process result in a high failure rate of dogs attaining operational status. This level of wastage would be condemned in other animal production industries for economic reasons and has significant implications for dog welfare, as well as public perceptions of dog-based industries. Standards of acceptable animal use are changing and some historically common uses of animals are no longer publicly acceptable, especially where harm is caused for purposes deemed trivial, or where alternatives exist. Public scrutiny of animal use appears likely to increase and extend to all roles of animals, including working and sporting dogs. Production system processes therefore need to be transparent, traceable and ethically acceptable for animal use to be sustainable into the future. Evidence-based approaches already inform best practice in fields as diverse as agriculture and human athletic performance. This article introduces the nascent discipline of canine performance science, which aims to facilitate optimal product quality and production efficiency, while also assuring evidence-based increments in dog welfare through a process of research and development. Our thesis is that the model of canine performance science offers an objective, transparent and traceable opportunity for industry development in line with community expectations and underpins a sustainable future for working dogs. This article is part of a Special Issue entitled: Canine Behavior. PMID:25444772

  9. Canine distemper virus induces apoptosis in cervical tumor derived cell lines

    Directory of Open Access Journals (Sweden)

    Rajão Daniela S


    Full Text Available Abstract Apoptosis can be induced or inhibited by viral proteins, it can form part of the host defense against virus infection, or it can be a mechanism for viral spread to neighboring cells. Canine distemper virus (CDV induces apoptotic cells in lymphoid tissues and in the cerebellum of dogs naturally infected. CDV also produces a cytopathologic effect, leading to apoptosis in Vero cells in tissue culture. We tested canine distemper virus, a member of the Paramyxoviridae family, for the ability to trigger apoptosis in HeLa cells, derived from cervical cancer cells resistant to apoptosis. To study the effect of CDV infection in HeLa cells, we examined apoptotic markers 24 h post infection (pi, by flow cytometry assay for DNA fragmentation, real-time PCR assay for caspase-3 and caspase-8 mRNA expression, and by caspase-3 and -8 immunocytochemistry. Flow cytometry showed that DNA fragmentation was induced in HeLa cells infected by CDV, and immunocytochemistry revealed a significant increase in the levels of the cleaved active form of caspase-3 protein, but did not show any difference in expression of caspase-8, indicating an intrinsic apoptotic pathway. Confirming this observation, expression of caspase-3 mRNA was higher in CDV infected HeLa cells than control cells; however, there was no statistically significant change in caspase-8 mRNA expression profile. Our data suggest that canine distemper virus induced apoptosis in HeLa cells, triggering apoptosis by the intrinsic pathway, with no participation of the initiator caspase -8 from the extrinsic pathway. In conclusion, the cellular stress caused by CDV infection of HeLa cells, leading to apoptosis, can be used as a tool in future research for cervical cancer treatment and control.

  10. Impact of canine control on the epidemiology of canine and human visceral leishmaniasis in Brazil. (United States)

    Palatnik-de-Sousa, C B; dos Santos, W R; França-Silva, J C; da Costa, R T; Reis, A B; Palatnik, M; Mayrink, W; Genaro, O


    Brazil is the only country endemic for zoonotic visceral leishmaniasis (ZVL) that regularly conducts epidemiologic and prophylactic control programs that involve the treatment of human cases, insect vector control, and the removal of seropositive infected dogs. This report reviews 60 studies reporting data on the efficacy of these recommended control tools and concludes that in Brazil 1) eradication of the disease in Minas Gerais was achieved by the concomitant use of the three control methods, 2) although seropositivity by an immunofluorescent assay is not completely related to infectiousness, the removal of seropositive dogs leads to a significant reduction of canine and human incidence, 3) improvement of the sensitivity of the diagnostic tool used for canine control should optimize the efficacy of control, and 4) although difficult and expensive, the public health dog control campaigns performed in Brazil reduced the incidence of ZVL and should be maintained since treatment of dogs is an unrealistic intervention, both because of its prohibitive cost and relatively poor effectiveness. PMID:11716106

  11. Effects of the canine rattlesnake vaccine in moderate to severe cases of canine crotalid envenomation

    Directory of Open Access Journals (Sweden)

    Leonard MJ


    Full Text Available McGee J Leonard,1 Catherine Bresee,2 Andrew Cruikshank1 1Animal Specialty and Emergency Center, Los Angeles, CA, USA; 2The Biostatistics and Bioinformatics Research Center, Cedars-Sinai Medical Center, Los Angeles, CA, USA Abstract: This is a retrospective multicenter study (2006–2012 examining a population of dogs with moderate to severe crotalid envenomation for protective effects of the canine rattlesnake vaccine. Five nonacademic emergency and referral veterinary hospitals in Southern California were involved in the study and contributed records regarding a total of 82 client-owned dogs that were treated for naturally occurring rattlesnake envenomation. All dogs received antivenin (Crotalidae polyvalent, with dosages ranging from one to three vials (mean: 1.3±0.6. Fourteen dogs (17% had a history of prior vaccination against crotalid venom. In univariate logistic regression modeling, cases with lower body weight (P=0.0001 or higher snakebite severity scores (P<0.0001 were associated with greater morbidity. No statistically significant difference in morbidity or mortality between vaccinated and unvaccinated dogs was found. The findings of this study did not identify a significantly protective effect of previous vaccination in the cases of moderate to severe rattlesnake envenomation that require treatment with antivenin. Keywords: rattlesnake envenomation, vaccine, antivenin, canine

  12. Effect of simulated stages of the canine oestrous cycle on Escherichia coli binding to canine endometrium. (United States)

    Krekeler, N; Lodge, K M; Anderson, G A; Browning, G F; Charles, J A; Wright, P J


    Pyometra, a prevalent infectious uterine disease that affects intact middle-aged bitches, is typically associated with Escherichia coli. Our hypotheses were (i) that bacterial adhesion to canine endometrium differs between different stages of the oestrous cycle and (ii) that the adhesin FimH facilitates this adhesion. Twelve post-pubertal, ovariectomized greyhound bitches were treated with exogenous hormones to simulate different stages of the oestrous cycle. Tissue samples from each uterus were incubated with a pathogenic E. coli strain carrying the fimH gene, but no other adhesin genes (P4-wt)--or an E. coli strain in which fimH was insertionally inactivated (P4-∆fimH::kan)--or with phosphate-buffered saline as a negative control. After washing, tissue samples were homogenized for quantification of adherent bacteria. The differences in binding to canine endometrium at different stages of the oestrous cycle were not significant. However, the mean difference in binding of the P4-wt and the P4-∆fimH::kan across all stages of the simulated oestrous cycle was significant (p < 0.001 by paired t-test on geometric means). Individual differences in numbers of P4-wt bacteria bound between dogs might suggest genetic variations or epigenetic differences in FimH receptor expression by the endometrium, unrelated to the stage of the oestrous cycle. PMID:23279531

  13. Canine mdr1 gene mutation in Japan. (United States)

    Kawabata, Akiko; Momoi, Yasuyuki; Inoue-Murayama, Miho; Iwasaki, Toshiroh


    Frequency of the 4-bp deletion mutant in canine mdr1 gene was examined in 193 dogs of eight breeds in Japan. The mutant allele was found in Collies, Australian Shepherds, and Shetland Sheepdogs, where its respective frequencies were 58.3%, 33.3%, and 1.2%. The MDR1 protein was detected on peripheral blood mononuclear cells (PBMC) from a MDR1/MDR1 dog, but not on PBMC from a mdr1-1Delta/mdr1-1Delta Collie. Rhodamine 123 was extruded from MDR1/MDR1 lymphocytes. That excretion was inhibited by a MDR1 inhibitor, verapamil. On the other hand, Rh123 excretion was not observed from lymphocytes derived from a mdr1-1Delta/mdr1-1Delta Collie. These results indicated that the mutant mdr1 allele also existed in Collie-breed dogs in Japan at high rates and that mdr1-1Delta /mdr1-1Delta dogs have no functional MDR1. PMID:16327220

  14. Cryopreservation of canine ovarian and testicular fibroblasts. (United States)

    Yu, Il-Jeoung; Leibo, S P; Songsasen, Nucharin; Dresser, Betsy L; Kim, In-Shik


    To derive a practical procedure to store canine somatic cells, fibroblasts isolated from testicular or ovarian tissues were cryopreserved in 1.2 M ethylene glycol or in 1.2 M dimethylsulfoxide prepared in Dulbecco's Modified Eagle Medium as cryoprotectants, and were frozen either in plastic straws or vials. Thawed cells were cultured for 24 hr at 38.5 degree C in a humidified atmosphere of 5 percent CO2 95 percent air, and then their membrane integrity was assayed with a double fluorescent stain, Fertilight. In addition, frozen-thawed fibroblasts were cultured for 4 days, and then their functional survival was measured after staining small colonies with trypan blue. After freezing and thawing, membrane integrity of testicular fibroblasts was 55-70 percent and functional survival ranged from 20-40 percent. With frozen-thawed ovarian cells, the average membrane integrity was 55-75 percent and the average functional survival was 35-40 percent. When frozen in ethylene glycol, functional survival of ovarian fibroblasts was significantly higher than that of testicular cells (P less than 0.05). These methods should prove useful to preserve cells collected from canids in the wild. PMID:19750243

  15. Canine detection odor signatures for explosives (United States)

    Williams, Marc; Johnston, J. M.; Cicoria, Matt; Paletz, E.; Waggoner, L. Paul; Edge, Cindy C.; Hallowell, Susan F.


    Dogs are capable of detecting and discriminating a number of compounds constituting a complex odor. However, they use only a few of these to recognize a substance. The focus of this research is to determine the compounds dogs learn to use in recognizing explosives. This is accomplished by training dogs under behavioral laboratory conditions to respond differentially on separate levers to 1) blank air, 2) a target odor, such as an explosive, and 3) all other odors (non-target odors). Vapor samples are generated by a serial dilution vapor generator whose operation and output is characterized by GC/MS. Once dogs learn this three-lever discrimination, testing sessions are conducted containing a number of probe trials in which vapor from constituent compounds of the target is presented. Which lever the dogs respond to on these probe trials indicates whether they can smell the compound at all (blank lever) or whether it smells like toe target odor (e.g., the explosive) or like something else. This method was conducted using TNT, C-4, and commercial dynamite. The data show the dogs' reactions to each of the constituent compounds tested for each explosive. Analysis of these data reveal the canine detection odor signature for these explosives.

  16. Countercurrent exchange of water in canine jejunum

    International Nuclear Information System (INIS)

    The possibility of countercurrent exchange of water molecules in canine intestinal villi has been examined. Tritium-labeled water (3H2O) molecules were introduced either into the fluid lavaging the intestinal lumen or into the arterial blood supply for varying periods of time. Quickly frozen samples of intestinal tissue were sectioned such that isotopic concentrations at the villus tip, midvillus, villus base, and underlying submucosa and muscle could be determined. The villus concentration gradients observed were consistent with the existence of a countercurrent exchange but could also be explained by alternative arrangements. More convincing evidence of a countercurrent was obtained from experiments in which [14C]inulin was introduced simultaneously with 3H2O into the intestinal artery. The villus tip-to-base concentration ratio for 3H2O was less than one while the ratio for inulin was greater than one, thus vitiating the alternative explanations and leading to the conclusion that the labeled water molecules must have undergone a countercurrent exchange

  17. Nodular Epiescleritis Granulomatous Canine. Case Report

    Directory of Open Access Journals (Sweden)

    Camilo Guarín Patarroyo


    Full Text Available Granulomatous epiescleritis nodular disease in canines is a very unusual presentation that affects or external fibrous tunic of the eyeball and conjunctiva, which was an increase similar to a unilateral or bilateral tumor. Suspected immune-mediated disease due to lack of identification of an etiologic agent and the response to treatment with immunosuppressive drugs (Couto, 1992. The ideal therapy is the application of steroids via intralesional, topical or systemic, or other immunosuppressants such as cyclosporine and azathioprine; it is still advisable to apply antibiotic is the ideal combination of tetracycline and neomycin (Gilger & Whitley, 1999. The diagnostic method of episcleritis is made by histopathology, which is evident in changes similar to chronic granulomatous inflammation. Are claiming a racial bias in Alsatian, Shepherd Collie Shetland Shepherd, Coker Spaniel, Rottweiler and Labrador Retriever (Gough & Thomas, 2004. The following case is a report of a nodular epiescleritis affecting the cornea, sclera, and the corneoscleral limbus, which describes the diagnosis, signology and treatment.

  18. Canine Oral Eosinophilic Granuloma Treated with Electrochemotherapy

    Directory of Open Access Journals (Sweden)

    Matías Nicolás Tellado


    Full Text Available A case of a canine oral eosinophilic granuloma in a 14-year-old female crossbred is described. The dog was presented with a history of ptyalism, halitosis, local pain, decreased appetite, and blood staining noted on food and water bowls. Clinical, hematologic, and biochemical examinations, abdominal ultrasonography, and 3-view chest radiographs were performed, and no metastases were found. Histopathologic examination of two 6 mm punch biopsies from the oral lesion revealed the presence of eosinophilic granulomatous lesions in the submucosa. After treatment with corticosteroids and wide spectrum antibiotics no significant changes in clinical signs and lesion size were observed. Electrochemotherapy (ECT, a novel tumor treatment routinely used for cutaneous and subcutaneous tumors in human patients in the European Union since 2006, was used to treat the eosinophilic granuloma. The procedure was performed under general anesthesia, followed by intravenous administration of bleomycin. Six weeks after treatment a complete response with disappearance of the mass and improvement of clinical signs were observed.

  19. Molecular epidemiology of canine parvovirus in Morocco. (United States)

    Amrani, Nadia; Desario, Costantina; Kadiri, Ahlam; Cavalli, Alessandra; Berrada, Jaouad; Zro, Khalil; Sebbar, Ghizlane; Colaianni, Maria Loredana; Parisi, Antonio; Elia, Gabriella; Buonavoglia, Canio; Malik, Jamal; Decaro, Nicola


    Since it first emergence in the mid-1970's, canine parvovirus 2 (CPV-2) has evolved giving rise to new antigenic variants termed CPV-2a, CPV-2b and CPV-2c, which have completely replaced the original strain and had been variously distributed worldwide. In Africa limited data are available on epidemiological prevalence of these new types. Hence, the aim of the present study was to determine circulating variants in Morocco. Through TaqMan-based real-time PCR assay, 91 samples, collected from symptomatic dogs originating from various cities between 2011 and 2015, were diagnosed. Positive specimens were characterised by means of minor groove binder (MGB) probe PCR. The results showed that all samples but one (98.9%) were CPV positive, of which 1 (1.1%) was characterised as CPV-2a, 43 (47.7%) as CPV-2b and 39 (43.3%) as CPV-2c. Interestingly, a co-infection with CPV-2b and CPV-2c was detected in 4 (4.4%) samples and 3 (3.3%) samples were not characterised. Sequencing of the full VP2 gene revealed these 3 uncharacterised strains as CPV-2c, displaying a change G4068A responsible for the replacement of aspartic acid with asparagine at residue 427, impacting the MGB probe binding. In this work we provide a better understanding of the current status of prevailing CPV strains in northern Africa. PMID:27083072


    Directory of Open Access Journals (Sweden)

    John Henry Rossmeisl


    Full Text Available In humans, high-grade gliomas may infiltrate across the corpus callosum resulting in bihemispheric lesions that may have symmetrical, winged-like appearances. This particular tumor manifestation has been coined a ‘butterfly’ glioma (BG. While canine and human gliomas share many neuroradiological and pathological features, the BG morphology has not been previously reported in dogs. Here we describe the magnetic resonance imaging (MRI characteristics of BG in three dogs, and review the potential differential diagnoses based on neuroimaging findings. All dogs presented with generalized seizures and interictal neurological deficits referable to multifocal or diffuse forebrain disease. MRI examinations revealed asymmetrical (2/3 or symmetrical (1/3, bihemispheric intra-axial mass lesions that predominantly affected the frontoparietal lobes and associated with extensive perilesional edema, and involvement of the corpus callosum. The masses displayed heterogeneous T1, T2, and FLAIR signal intensities, variable contrast enhancement (2/3, and mass effect. All tumors demonstrated classical histopathological features of glioblastoma (GBM including glial cell pseudopalisading, serpentine necrosis, microvascular proliferation, as well as invasion of the corpus callosum by neoplastic astrocytes. Although rare, GBM should be considered a differential diagnosis in dogs with MRI evidence of asymmetric or symmetric bilateral, intra-axial cerebral mass lesions with signal characteristics compatible with glioma.

  1. Molecular epizootiology of canine hepatozoonosis in Croatia. (United States)

    Vojta, Lea; Mrljak, Vladimir; Curković, Snjezana; Zivicnjak, Tatjana; Marinculić, Albert; Beck, Relja


    An epizootiological survey was conducted to investigate the prevalence of hepatozoonosis in a population of 924 apparently asymptomatic dogs from different regions of Croatia. DNA was isolated from canine blood and screening PCR on the 666 bp fragment of 18S rRNA revealed that 108 (11.8%) of dogs were infected. Positive samples were confirmed by partial sequencing of the 18S rRNA gene. The consensus sequences, derived from various sequence data sets, were compared with sequences of 18S ssrRNA of Hepatozoon spp. available in GenBank. The alignments revealed 106 Hepatozoon canis and two Hepatozoon sp. sequences. Among H. canis isolates, we found a certain amount of heterogeneity, while both Hepatozoon sp. isolates were identical to the Spanish isolate (Accession No. AY600625) from Clethrionomys glareolus. On the basis of eight commonly mutated nucleotide positions in the partial 18S rRNA gene sequence, we divided the H. canis isolates into five groups. The results obtained indicate a higher prevalence and significance of hepatozoonosis in Croatia than previously believed and demonstrate that the organisms belonging to H. canis that infect European dogs are genetically very heterogeneous. PMID:19249302

  2. Genotyping of Canine parvovirus in western Mexico. (United States)

    Pedroza-Roldán, César; Páez-Magallan, Varinia; Charles-Niño, Claudia; Elizondo-Quiroga, Darwin; De Cervantes-Mireles, Raúl Leonel; López-Amezcua, Mario Alberto


    Canine parvovirus (CPV) is one of the most common infectious agents related to high morbidity rates in dogs. In addition, the virus is associated with severe gastroenteritis, diarrhea, and vomiting, resulting in high death rates, especially in puppies and nonvaccinated dogs. To date, there are 3 variants of the virus (CPV-2a, CPV-2b, and CPV-2c) circulating worldwide. In Mexico, reports describing the viral variants circulating in dog populations are lacking. In response to this deficiency, a total of 41 fecal samples of suspected dogs were collected from October 2013 through April 2014 in the Veterinary Hospital of the University of Guadalajara in western Mexico. From these, 24 samples resulted positive by polymerase chain reaction, and the viral variant was determined by restriction fragment length polymorphism. Five positive diagnosed samples were selected for partial sequencing of the vp2 gene and codon analysis. The results demonstrated that the current dominant viral variant in Mexico is CPV-2c. The current study describes the genotyping of CPV strains, providing valuable evidence of the dominant frequency of this virus in a dog population from western Mexico. PMID:25525144

  3. [Diagnostic tools for canine parvovirus infection]. (United States)

    Proksch, A L; Hartmann, K


    Canine parvovirus (CPV) infection is one of the most important and common infectious diseases in dogs, in particular affecting young puppies when maternal antibodies have waned and vaccine-induced antibodies have not yet developed. The mortality rate remains high. Therefore, a rapid and safe diagnostic tool is essential to diagnose the disease to 1) provide intensive care treatment and 2) to identify virus-shedding animals and thus prevent virus spread. Whilst the detection of antibodies against CPV is considered unsuitable to diagnose the disease, there are several different methods to directly detect complete virus, virus antigen or DNA. Additionally, to test in commercial laboratories, rapid in-house tests based on ELISA are available worldwide. The specificity of the ELISA rapid in-house tests is reported to be excellent. However, results on sensitivity vary and high numbers of false-negative results are commonly reported, which potentially leads to misdiagnosis. Polymerase chain reaction (PCR) is a very sensitive and specific diagnostic tool. It also provides the opportunity to differentiate vaccine strains from natural infection when sequencing is performed after PCR. PMID:26403490

  4. Canine Butterfly Glioblastomas: A Neuroradiological Review (United States)

    Rossmeisl, John H.; Clapp, Kemba; Pancotto, Theresa E.; Emch, Samantha; Robertson, John L.; Debinski, Waldemar


    In humans, high-grade gliomas may infiltrate across the corpus callosum resulting in bihemispheric lesions that may have symmetrical, winged-like appearances. This particular tumor manifestation has been coined a “butterfly” glioma (BG). While canine and human gliomas share many neuroradiological and pathological features, the BG morphology has not been previously reported in dogs. Here, we describe the magnetic resonance imaging (MRI) characteristics of BG in three dogs and review the potential differential diagnoses based on neuroimaging findings. All dogs presented for generalized seizures and interictal neurological deficits referable to multifocal or diffuse forebrain disease. MRI examinations revealed asymmetrical (2/3) or symmetrical (1/3), bihemispheric intra-axial mass lesions that predominantly affected the frontoparietal lobes that were associated with extensive perilesional edema, and involvement of the corpus callosum. The masses displayed heterogeneous T1, T2, and fluid-attenuated inversion recovery signal intensities, variable contrast enhancement (2/3), and mass effect. All tumors demonstrated classical histopathological features of glioblastoma multiforme (GBM), including glial cell pseudopalisading, serpentine necrosis, microvascular proliferation as well as invasion of the corpus callosum by neoplastic astrocytes. Although rare, GBM should be considered a differential diagnosis in dogs with an MRI evidence of asymmetric or symmetric bilateral, intra-axial cerebral mass lesions with signal characteristics compatible with glioma.

  5. GdNCT of spontaneous canine melanoma

    International Nuclear Information System (INIS)

    The effectiveness of GdNCT has been studied in dogs with spontaneous melanoma of the mucousmembrane of the oral cavity patients on the NCT base at the IRT MEPhI reactor. The control group with melanomas was treated with neutrons. Fourteen canine patients were selected in the Clinic of Experimental Therapy affiliated with the RCRC RAMS. The calculation of doses has shown that the total dose of energy release depending on Gd concentration in the target can be several times higher than the dose produced by the reactor neutron beam. The calculations were carried out using the diffusion pharmacokinetic model. The gadolinium drug dipentast was administered intratumorally immediately prior to irradiation. The tumor size was estimated by measuring it in three projections. The tumor was irradiated for 60-90 minutes with a thermal neutron flux of 0.7x109 n/cm2s. The dose on tumor was 80-120 Gy, on surrounding tissues - 12-15 Gy. The treatment plan included immunotherapy with Roncoleikin in a dose of (15-10)x103 IE/kg. The results of GdNCT are still under observation. The results conform to those obtained by us earlier in cell cultures and inoculated experimental tumors. GdNCT is also effective in combination with immunotherapy. (author)

  6. Experimental canine parvovirus infection in dogs. (United States)

    Pollock, R V


    In specific pathogen-free dogs, clinical signs of experimental canine parvovirus infection were mild, inconsistent and transient. Clinical signs were more pronounced in conventionally-raised dogs, but the severe disease reported in field cases was not reproduced in either group. A pronounced plasma viremia occurred on the 2nd to 4th day post-infection (d.p.i.) in dogs challenged oronasally. Antibody was detectable on the 5th d.p.i. Marked pyrexia was rare, but a significant temperature rise usually coincided with the appearance of antibody and the cessation of viremia. Significant lymphopenia, but not leukopenia, occurred on the 3rd to 7th d.p.i. Virus could be readily isolated from fecal matter on the 3rd to 8th d.p.i.; a few dogs continued to shed virus for up to 12 days. In dogs challenged parenterally, the onset of elevated temperatures, viral shed and antibody production occurred 24-48 hours sooner. Convalescent dogs were no longer contagious for susceptible contact animals 25 days or longer after challenge, although infectious virus persisted in feces for more than 6 months at room temperature. Active giardiasis seemed to exacerbate the clinical syndrome, although treatment with corticosteroids or anti-thymocyte serum did not. PMID:6211333

  7. Refinement of the canine CD1 locus topology and investigation of antibody binding to recombinant canine CD1 isoforms

    DEFF Research Database (Denmark)

    Schjaerff, Mette; Keller, Stefan M; Fass, Joseph; Froenicke, Lutz; Grahn, Robert A; Lyons, Leslie; Affolter, Verena K; Kristensen, Annemarie T; Moore, Peter F


    -specific antibodies. The canine (Canis familiaris) CD1 locus was previously found to contain three functional CD1A genes: canCD1A2, canCD1A6, and canCD1A8, where two variants of canCD1A8, canCD1A8.1 and canCD1A8.2, were assumed to be allelic variants. However, we hypothesized that these rather represented two...... separate genes. Sequencing of three overlapping bacterial artificial chromosomes (BACs) spanning the entire canine CD1 locus revealed canCD1A8.2 and canCD1A8.1 to be located in tandem between canCD1A7 and canCD1C, and canCD1A8.1 was consequently renamed canCD1A9. Green fluorescent protein (GFP......)-fused canine CD1 transcripts were recombinantly expressed in 293T cells. All proteins showed a highly positive GFP expression except for canine CD1d and a splice variant of canine CD1a8 lacking exon 3. Probing with a panel of anti-CD1 monoclonal antibodies (mAbs) showed that Ca13.9H11 and Ca9.AG5 only...

  8. Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features

    Directory of Open Access Journals (Sweden)

    Sophie Le Poder


    Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

  9. Complex odontoma associated to a primary maxillary canine: case report

    Directory of Open Access Journals (Sweden)

    Estela Maris LOSSO


    Full Text Available Introduction: Odontomas are malformations of the dental tissues and may interfere with the eruption of the associated tooth. The early diagnosis, followed by a proper treatment at the right time, will result in a favorable prognosis and a desirable occlusion development. Complex odontomas associated to primary teeth are rare. Case report and conclusion: This article describes a case of a complex odontoma in a four-year-old girl that prevented eruption of the left primary canine. The treatment choice was enucleation of the odontoma and the maintenance of the left primary canine.In this case, complete removal of the complex odontoma was successfully conducted, since after one year of follow-up the primary maxillary canine restarted its eruption process.

  10. Canine dysautonomia in a litter of Havanese puppies. (United States)

    Hull, Noah C; O'Toole, Donal; Miller, Myrna M; Shoults, Hannah; Deck, Robin; Jones, Warren; Johnson, Gayle C; Shaw, Daniel P; Schumaker, Brant A


    Canine dysautonomia is a sporadic, generally fatal disease that rarely affects groups of related animals. Four 10-week-old Havanese puppies from a litter of 5 developed clinical signs of canine dysautonomia. The 4 affected dogs were exposed to an outdoor environment, whereas the fifth littermate was not exposed to the outdoors and remained clinically healthy. Clinical signs of dysautonomia developed 10-16 days after going outside the house. An unrelated dog also developed dysautonomia after exposure to 1 of the affected Havanese littermates. All 5 dogs had morphological changes consistent with dysautonomia (widespread neuronal degeneration in autonomic ganglia, select brainstem nuclei, and ventral horn motor neurons). Differential diagnoses were excluded through negative toxicological evaluation, fecal parasite screening, negative Canine distemper virus reverse transcription polymerase chain reaction, fluorescent antibody testing, attempted virus isolation, and electron microscopy. The 5 affected dogs were in the Kansas City, Missouri area, where there is a high incidence of dysautonomia. PMID:26179098

  11. Testosterone biotransformation by the isolated perfused canine pancreas

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))


    There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.

  12. Testosterone biotransformation by the isolated perfused canine pancreas

    International Nuclear Information System (INIS)

    There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis

  13. The innervation of canine hip joint capsule: an anatomic study. (United States)

    Huang, C H; Hou, S M; Yeh, L S


    To clarify the contributions of the nerves supplying the canine hip joint capsule for clinical application, cadaver study of six healthy mongrel dogs was performed. The pelvises and hindlimbs of cadavers were dissected and fixed in formaldehyde. Innervation of the joint capsule was investigated with the aid of an operative microscope. As a result, the canine hip joint capsule receives multiple innervations from articular branches of four nerves. They are articular nerve fibres of femoral, obturator, cranial gluteal and sciatic nerves from the cranioventral, caudoventral, craniolateral and dorsolateral directions of the joint, respectively. No branch originating from the caudal gluteal nerve was observed innervating the hip joint capsule. Our data provides useful information for research on the canine hip joint, including pain analysis with hip disorders and surgical nerve blockade to relieve pain. PMID:23410229

  14. The Cost of Canine Rabies on Four Continents. (United States)

    Anderson, A; Shwiff, S A


    We estimated the economic impacts of canine rabies in Latin America, Africa and Asia. Direct and indirect costs of rabies post-exposure prophylaxis, dog vaccination and control, rabies diagnostic testing and cattle mortality-related costs were accounted for. The number of human deaths was updated from previous estimates based on population growth, and the costs associated with the risk of human mortality were incorporated. We accounted for uncertainty associated with the parameter estimates using a Monte Carlo simulation and estimated that the global burden of canine rabies is approximately $124 billion annually. This result illustrates the potential benefits that could be realized if canine rabies was eliminated and provides an important benchmark against which the cost of any potential elimination campaign can be compared. PMID:24112194

  15. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    Directory of Open Access Journals (Sweden)

    Otávio Valério Carvalho


    Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.

  16. Distribution of beta-amyloid in the canine brain. (United States)

    Hou, Y; White, R G; Bobik, M; Marks, J S; Russell, M J


    The distribution of amyloid-beta protein (A beta) in the canine brain was demonstrated by immunochemistry on serially sectioned tissues from 10 aged mixed breed dogs. Summation of quantitative data and relegation to anatomical sites for the 10 dogs showed A beta to be widely distributed in the cortex and hippocampus while completely absent in the brain stem and cerebellum. The highest density of A beta was in the dentate gyrus of the hippocampus. Cortical areas exhibiting the greatest A beta deposition were the posterior and medial suprasylvius gyrus and the proreus gyrus of the frontal lobe. Unlike humans the canine entorhinal cortex, amygdala, basal ganglia and olfactory bulbs were rarely affected. This suggested that the highly developed olfactory pathways of the canine are generally spared from A beta deposition. PMID:9141082

  17. Severe canine distemper outbreak in unvaccinated dogs in Mozambique. (United States)

    Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G


    Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. PMID:27543040

  18. FLT3 mutations in canine acute lymphocytic leukemia

    International Nuclear Information System (INIS)

    FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias

  19. Microbiota and probiotics in canine and feline welfare. (United States)

    Grześkowiak, Łukasz; Endo, Akihito; Beasley, Shea; Salminen, Seppo


    Dogs and cats have been cohabiting with us for thousands of years. They are the major human companions. Today, dogs and cats live in urban areas. Cats and most dogs are on high carbohydrate diets and face similar life-style challenges as the human beings. The health and well-being of companion animals, just as their owners, depends on the gut microbes. Providing a proper care and nutritionally balanced diet to companion animals is recognised as a part of our responsibility to maintain the health and well being of our pet. However, as microbiota differences may facilitate exposure to pathogens and harmful environmental influences, it is prudent to search for novel tools to protect dogs and cats and at the same time the human owners from pathogens. Specific probiotic strains and/or their defined combinations may be useful in the canine and feline nutrition, therapy, and care. Probiotic supplementations have been successful in the prevention and treatment of acute gastroenteritis, treatment of IBD, and prevention of allergy in companion animals. New challenges for probiotic applications include maintenance of obesity and overweight, urogenital tract infections, Helicobacter gastritis and parasitic infections. The probiotics of human origin appear to be among the new promising tools for the maintenance of pets' health. However, the host-derived microorganisms might be the most appropriate probiotic source. Therefore, more controlled trials are needed to characterise new and safe probiotic preparations with an impact on general health and well being as well as health maintenance in dogs and cats. PMID:25863311

  20. Canine brucellosis: Epizootiological characteristics, therapy and control of the disease

    Directory of Open Access Journals (Sweden)

    Radojičić Sonja


    Full Text Available The paper describes different aspects of canine brucellosis caused by Brucella canis. The disease is present in a large number of countries all over the world, where it inflicts severe economic damages, in particular in the commercial breeding and major dog breeding facilities. The disease was discovered in 1966 in the United States of America, but there were no data about its presence or distribution in our country until 1999. It was established, following the initial investigations, that the prevalence of the disease is extremely high, and that it amounted to 4.27% among pet dogs in the territory of Belgrade. Investigations of stray dogs in the territory of Podgorica showed that the seroprevalence (an equal titer or higher than 1/200 was 9.37%, while the prevalence among stray dogs in the territory of Belgrade was 10.87%. Data for other parts of Serbia are mostly lacking, and the seroprevalence for stray dogs in the Municipality of Pozarevac amounted to over 15%, while not a single serologically positive case was found among pet dogs. In addition to the epizootiological specificities of the disease established in our country, isolates of B. canis from the territory of Serbia also indicate digressions in the test of resistance to colors with respect to the referent strain RM6/66. All isolates (SR1-SR-7 are resistant to base fuchsine, and it is probable that this characteristic could also be an important epizootiological marker. Even though the isolation of the cause is the most reliable diagnostic method, it is not possible to achieve this in most cases. That is why one of the most important tasks is to define the most ideal tests for the serological diagnostics of the disease, and the obligation of reporting the disease makes it imperative that wider-scale investigations are conducted and that measures are taken toward reducing the number of positive cases in our country. .

  1. Canine distemper spillover in domestic dogs from urban wildlife. (United States)

    Kapil, Sanjay; Yeary, Teresa J


    Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing. PMID:22041204

  2. Comprehensive characterization of commercially available canine training aids. (United States)

    Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A


    Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine

  3. Survey of Canine Dirofilaria immitis Infection in New Caledonia


    Watier-Grillot, S.; J.-L. Marié; Cabre, O.; Davoust, B


    Canine dirofilariosis is a frequent parasitic disease in New-Caledonia. A survey of canine heartworm (Dirofilaria immitis) infection among dogs from the cities of Tontouta, Nandaï and Nouméa, was performed in March 2009 using two antigen test kits; the microwell ELISA test: DiroCHE (Synbiotics Europe) and the Rapid Immuno Migration ( R I M ) test: WITNESS DIROFILARIA (Synbiotics Europe). Blood samples were collected from 64 dogs: 49 strays and 15 military working dogs. The military dogs recei...

  4. FDG PET/CT imaging in canine cancer patients

    DEFF Research Database (Denmark)

    Hansen, Anders Elias; McEvoy, Fintan; Engelholm, Svend Aage;


    and organs in canine cancer patients. FDG PET/CT was performed in 14 dogs including, nine mesenchymal tumors, four carcinomas, and one incompletely excised mast cell tumor. A generally higher FDG uptake was observed in carcinomas relative to sarcomas. Maximum SUV of carcinomas ranged from 7.6 to 27.......0, and for sarcomas from 2.0 to 10.6. The FDG SUV of several organs and tissues, including regional brain uptake is reported, to serve as a reference for future FDG PET studies in canine cancer patients. Several potential pitfalls have been recognized in interpretation of FDG PET images of human patients, a number...

  5. Establishment of a High Canine Rabies Burden in Haiti through the Implementation of a Novel Surveillance Program [corrected].

    Directory of Open Access Journals (Sweden)

    Ryan M Wallace


    Full Text Available The Republic of Haiti is one of only several countries in the Western Hemisphere in which canine rabies is still endemic. Estimation methods have predicted that 130 human deaths occur per year, yet existing surveillance mechanisms have detected few of these rabies cases. Likewise, canine rabies surveillance capacity has had only limited capacity, detecting only two rabid dogs per year, on average. In 2013, Haiti initiated a community-based animal rabies surveillance program comprised of two components: active community bite investigation and passive animal rabies investigation. From January 2013 -December 2014, 778 rabies suspect animals were reported for investigation. Rabies was laboratory-confirmed in 70 animals (9% and an additional 36 cases were identified based on clinical diagnosis (5%, representing an 18-fold increase in reporting of rabid animals compared to the three years before the program was implemented. Dogs were the most frequent rabid animal (90%. Testing and observation ruled out rabies in 61% of animals investigated. A total of 639 bite victims were reported to the program and an additional 364 bite victims who had not sought medical care were identified during the course of investigations. Only 31% of people with likely rabies exposures had initiated rabies post-exposure prophylaxis prior to the investigation. Rabies is a neglected disease in-part due to a lack of surveillance and understanding about the burden. The surveillance methods employed by this program established a much higher burden of canine rabies in Haiti than previously recognized. The active, community-based bite investigations identified numerous additional rabies exposures and bite victims were referred for appropriate medical care, averting potential human rabies deaths. The use of community-based rabies surveillance programs such as HARSP should be considered in canine rabies endemic countries.

  6. Identification of quantitative trait loci (QTL for canine hip dysplasia and canine elbow dysplasia in Bernese mountain dogs.

    Directory of Open Access Journals (Sweden)

    Sophia Pfahler

    Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.

  7. Identification of quantitative trait loci (QTL) for canine hip dysplasia and canine elbow dysplasia in Bernese mountain dogs. (United States)

    Pfahler, Sophia; Distl, Ottmar


    A genome-wide association study for canine hip dysplasia (CHD) and canine elbow dysplasia (CED) using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs) on dog chromosome (CFA) 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED. PMID:23189162

  8. Canine Prostate Palpation Simulator as a Teaching Tool in Veterinary Education. (United States)

    Capilé, Karynn V; Campos, Gabriela M B; Stedile, Rafael; Oliveira, Simone T


    Adult dogs, especially elderly ones, are commonly affected by prostate diseases. Performing rectal palpation during physical examination in dogs is important in small animal clinical diagnosis. Prostate palpation training allows students to learn how to correctly introduce the finger into the rectum and identify the location, size, symmetry, and consistency of the prostate. Alternative methods are needed to teach this technique without using live dogs. Thus, our aim was to develop a canine prostate palpation simulator to provide students with the opportunity to learn the prostate palpation technique in dogs and to assess their opinion of this simulator as a teaching tool. The inner part of the canine mannequin contains a rotation system with three types of prostates that can be exchanged during the exam. Of the 64 participating students, 81% had never used alternative methods and 92.2% had never performed any prostatic palpation. According to the students' opinions, performing a clinical examination on a simulator allowed them to be prepared and familiarized with the palpation technique. They felt satisfied learning a practical method in a harmless way. Both the 3R (replacement, reduction, and refinement) and dog welfare principles were present in most of the students' concerns. We conclude that the simulator can help students to develop clinical skills for prostate palpation in dogs. PMID:25862400

  9. Dopamine-induced cyclic AMP increase in canine myocardium, kidney and superior mesenteric artery.

    Directory of Open Access Journals (Sweden)



    Full Text Available The effect of dopamine on cyclic AMP levels in tissue slices of canine myocardium and kidney, and in chopped superior mesenteric arterial wall was investigated to identify dopamine receptors. Tissues were incubated in modified Krebs-Henseleit Ringer bicarbonate solution at 37 degrees C for 20 min with test drugs, after 20-min preincubation. In the presence of 3-isobutyl-1-methylxanthine (IBMX, dopamine and apomorphine caused dose-dependent increases in cyclic AMP levels in the myocardium, kidney and superior mesenteric artery. Phentolamine significantly intensified the cyclic AMP-increasing effect of dopamine in the superior mesenteric artery, but it did not influence the cyclic AMP increase caused by dopamine or apomorphine in the myocardium and kidney. Propranolol markedly blocked the effect of dopamine on cyclic AMP levels in all tissues studied. Haloperidol slightly inhibited the effect of dopamine and completely blocked the effect of apomorphine in the myocardium and kidney. These data suggest that dopamine increases cyclic AMP levels by activating predominantly beta-adrenergic receptors and partly dopamine receptors in the canine myocardium, kidney and superior mesenteric artery. The present results also suggest that dopamine acts not only on beta-adrenergic and dopamine receptors but also on alpha-adrenergic receptors in the superior mesenteric artery. Contrary to the activation of beta-adrenergic and dopamine receptors, the activation of alpha-adrenergic receptors resulted in a decrease in cyclic AMP levels in this tissue.

  10. Canine adenovirus type 2 vector generation via I-Sce1-mediated intracellular genome release.

    Directory of Open Access Journals (Sweden)

    Sandy Ibanes

    Full Text Available When canine adenovirus type 2 (CAdV-2, or also commonly referred to as CAV-2 vectors are injected into the brain parenchyma they preferentially transduce neurons, are capable of efficient axonal transport to afferent regions, and allow transgene expression for at last >1 yr. Yet, translating these data into a user-friendly vector platform has been limited because CAV-2 vector generation is challenging. Generation of E1-deleted adenovirus vectors often requires transfection of linear DNA fragments of >30 kb containing the vector genome into an E1-transcomplementing cell line. In contrast to human adenovirus type 5 vector generation, CAV-2 vector generation is less efficient due, in part, to a reduced ability to initiate replication and poor transfectibility of canine cells with large, linear DNA fragments. To improve CAV-2 vector generation, we generated an E1-transcomplementing cell line expressing the estrogen receptor (ER fused to I-SceI, a yeast meganuclease, and plasmids containing the I-SceI recognition sites flanking the CAV-2 vector genome. Using transfection of supercoiled plasmid and intracellular genome release via 4-OH-tamoxifen-induced nuclear translocation of I-SceI, we improved CAV-2 vector titers 1,000 fold, and in turn increased the efficacy of CAV-2 vector generation.

  11. Surgical-orthodontic treatment of Class III malocclusion with agenesis of lateral incisor and unerupted canine

    Directory of Open Access Journals (Sweden)

    Bruno Boaventura Vieira


    Full Text Available INTRODUCTION: Orthodontic-surgical treatment was performed in patient with skeletal Class III malocclusion due to exceeding mandibular growth. Patient also presented upper and lower dental protrusion, overjet of -3.0 mm, overbite of -1.0 mm, congenital absence of tooth #22, teeth #13 and supernumerary impaction, tooth #12 with conoid shape and partly erupted in supraversion, prolonged retention of tooth #53, tendency to vertical growth of the face and facial asymmetry. The discrepancy on the upper arch was -2.0 mm and -5.0 mm on the lower arch. METHODS: The pre-surgical orthodontic treatment was performed with extractions of the teeth #35 and #45. On the upper arch, teeth #53, #12 and supernumerary were extracted to accomplish the traction of the impacted canine. The spaces of the lower extractions were closed with mesialization of posterior segment. After aligning and leveling the teeth, extractions spaces closure and correct positioning of teeth on the bone bases, the correct intercuspation of the dental arch, with molars and canines in Angle's Class I, coincident midline, normal overjet and overbite and ideal torques, were evaluated through study models. The patient was submitted to orthognathic surgery and then the post-surgical orthodontic treatment was finished. RESULTS: The Class III malocclusion was treated establishing occlusal and facial normal standards.

  12. Brazilian canine hepatozoonosis Hepatozoonose canina brasileira

    Directory of Open Access Journals (Sweden)

    Lucia Helena O'Dwyer


    Full Text Available The genus Hepatozoon includes hundreds of species that infect birds, reptiles, amphibians and mammals, in all continents with tropical and subtropical climates. Two species have been described in domestic dogs: H. canis, reported in Europe, Asia, Africa, South America and the United States; and H. americanum, which so far has only been diagnosed in the United States. In Brazil, the only species found infecting dogs is H. canis. The objective of this review was to detail some aspects of canine hepatozoonosis, caused by H. canis, and the main points of its biology, transmission, pathogenicity, symptoms, epidemiology and diagnostic methods, with emphasis on research developed in Brazil.O gênero Hepatozoon compreende centenas de espécies que infectam aves, répteis, anfíbios e mamíferos, em todos os continentes de clima tropical e subtropical. No cão doméstico duas espécies são descritas, H. canis e H. americanum; a primeira presente na Europa, Ásia, África, América do Sul e nos Estados Unidos da América do Norte (EUA, e a segunda, diagnosticada até o momento somente nos EUA. No Brasil, a espécie que infecta o cão foi caracterizada como H. canis. Esta revisão objetiva detalhar alguns aspectos da hepatozoose canina, causada pelo H. canis e principais pontos de biologia, transmissão, patogenia e sintomas, epidemiologia e métodos de diagnóstico, enfatizando as pesquisas desenvolvidas no Brasil.

  13. Radiographic imaging of the canine intercondylar fossa

    International Nuclear Information System (INIS)

    The intercondylar fossa is believed to play an important role in the pathology of cranial cruciate ligament rupture and therefore has received considerable attention in the last decade. Accurate radiographic imaging of the intercondylar fossa requires that the central x-ray beam pass through the center of the intercondylar “tunnel”. The anatomy of the canine intercondylar fossa is similar to humans, however, the orientations of the intercondylar fossa's differ. Consequently, the positioning techniques described for humans are not appropriate for the dog. To pass through the center of the dog, intercondylar fossa, the central x-ray beam should be 12° (S.D. 1.7°) caudal from the femoral diaphysis in the sagittal plane and obliqued caudolateral to craniomedial 7° (S.D. 0.60°) (caudo78°proximo7° lateralcraniodistomedial oblique). Cross table positioning was used with the hip flexed and the radiograph cassette placed on the cranial surface of the stifle. However, superimposition of the tuber ischii and soft tissues caudal to the femur made 15° to 20° the best angle obtainable. There was not a significant difference (p = 0.17) in the notch width index between a 12° versus 20° angle of the central x-ray beam caudal to the femoral diaphysis, both with 7° of external rotation of the stifle. The notch width index of 0.252 obtained from radiographic measurements was not significantly different from measurements obtained grossly of 0.254 (n = 26; p = 0.69). Failure to oblique the central x-ray beam caused a significant (p = 0.0008) decrease in the apparent fossa width radiographically

  14. Myogenic potential of canine craniofacial satellite cells

    Directory of Open Access Journals (Sweden)

    Rita Maria Laura La Rovere


    Full Text Available The skeletal fibres have different embryological origin; the extraocular and jaw-closer muscles develop from prechordal mesoderm while the limb and trunk muscles from somites. These different origins characterise also the adult muscle stem cells, known as satellite cells (SCs and responsible for the fibre growth and regeneration. The physiological properties of presomitic SCs and their epigenetics are poorly studied despite their peculiar characteristics to preserve muscle integrity during chronic muscle degeneration. Here we isolated SCs from canine somitic (SDM: vastus lateralis, rectus abdominus, gluteus superficialis, biceps femoris, psoas and presomitic (PSDM: lateral rectus, temporalis and retractor bulbi muscles as myogenic progenitor cells from young and old animals. In addition, SDM and PSDM satellite cells were obtained also from Golden retrievers affected by muscular dystrophy (GRMD. We characterised the lifespan, the myogenic potential and functions and oxidative stress of both somitic and presomitic SCs with the aim to reveal differences with ageing and between healthy and dystrophic animals. The different proliferation rate was consistent with higher telomerase activity in PSDM-SCs compared to SDM-SCs, although restricted at early passages. SDM-SCs express early (Pax7, MyoD and late (MyHC, Myogenin myogenic markers differently from PSDM-SCs resulting in a more efficient and faster cell differentiation. Taken together our results showed that PSDM-SCs elicit a stronger stem cell phenotype compared to SDM ones. Finally, myomiR expression profile reveals a unique epigenetic signature in GRMD satellite cells and miR-206, highly expressed in dystrophic SCs, seems to play a critical role in muscle degeneration. Thus, miR-206 could represent a potential target for novel therapeutic approaches.

  15. Associations between neurologic dysfunction and lesions in canine fucosidosis. (United States)

    Fletcher, J L; Taylor, R M


    Canine fucosidosis in English Springer spaniels is the only animal model of the neurovisceral lysosomal storage disease fucosidosis available for preclinical therapeutic trials. For this reason, it is crucial to identify critical time points in disease progression, and if there are particular lesions associated with specific aspects of neurologic dysfunction. Historical records of 53 canine fucosidosis cases from 1979 to 2009 containing a neurologic dysfunction score assessing motor, behavioral and sensory dysfunction were interrogated by statistical analysis. Motor and behavioral dysfunction scores assessing gait deficits and apprehensive behavior first significantly increased at 12-17 months, and increased at each 6-month interval thereafter. Sensory dysfunction scores, assessing hearing loss, balance and vision deterioration, did not significantly increase until 18-23 months, and coincided with a rapid decline in neurologic function. Regression analysis incorporating published neuropathology data, measured by image analysis, identified neuroinflammation and apoptotic cell death as significant informative predictors of increasing neurologic dysfunction. These findings indicate that the level of neuropathology required to induce consistent and conspicuous clinical signs in canine fucosidosis is reached by approximately 12 months of age in the absence of other disease processes. Significant association between neuroinflammation and apoptotic cell death also suggests that specifically targeting these lesions combined with enzyme replacement in future studies may reduce disease burden in fucosidosis. Overall, examining this historical clinical data to identify associations between the extent of neuropathology and degree of clinical dysfunction provides a useful reference tool for monitoring disease and evaluating therapeutic trials conducted in canine fucosidosis. PMID:26711085

  16. 9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine). (United States)


    ... Seed. (a) The Master Seed shall meet the applicable general requirements prescribed in § 113.200. (b... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccination, a second serum sample shall be drawn from each dog and tested for neutralizing antibody to...

  17. 9 CFR 113.316 - Canine Parainfluenza Vaccine. (United States)


    ... applicable general requirements prescribed in § 113.300 and the requirements in this section. (b) Each lot of... virus. Blood samples shall also be drawn and individual serum samples tested for neutralizing antibody... are negative for canine parainfluenza antibody at a 1:2 final dilution in a constant...

  18. Canine distemper virus - a morbillivirus in search of new hosts?


    Harder, Timm; Osterhaus, Albert


    textabstractCanine distemper morbillivirus (CDV) induces a multisystemic, often fatal disease in a wide and seemingly expanding host range among the Carnivora. Several genotypes of an otherwise monotypic virus species co-circulate in a geographically restricted pattern. Interspecies transmissions frequently occur, often leading to devastating epizootics in highly susceptible or immunologically naive populations.

  19. Pneumocystosis associated with canine distemper virus infection in a mink.


    Dyer, N W; Schamber, G J


    An adult mink from a farm experiencing 100% mortality in affected animals was submitted for diagnostic examination. Clinical history included signs of respiratory disease, oculonasal discharge, and thickening of footpads. Canine distemper virus and Pneumocystis carinii were identified in lung tissue, suggesting immunosuppresion and secondary infection due to morbillivirus disease.

  20. Canine brachycephalic airway syndrome: pathophysiology, diagnosis, and nonsurgical management. (United States)

    Trappler, Michelle; Moore, Kenneth


    Canine brachycephalic airway syndrome is a progressive disease that affects many brachycephalic dogs. This article describes the components of this syndrome and focuses on acute emergency management and long-term conservative management of these patients. Surgical management is described in a companion article. PMID:21870353

  1. Compensatory canine angulation in angle Class II and III patients

    Directory of Open Access Journals (Sweden)

    Mauro Carlos Agner Busato


    Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.

  2. Selection against canine hip dysplasia: success or failure? (United States)

    Wilson, Bethany; Nicholas, Frank W; Thomson, Peter C


    Canine hip dysplasia (CHD) is a multifactorial skeletal disorder which is very common in pedigree dogs and represents a huge concern for canine welfare. Control schemes based on selective breeding have been in operation for decades. The aim of these schemes is to reduce the impact of CHD on canine welfare by selecting for reduced radiographic evidence of CHD pathology as assessed by a variety of phenotypes. There is less information regarding the genotypic correlation between these phenotypes and the impact of CHD on canine welfare. Although the phenotypes chosen as the basis for these control schemes have displayed heritable phenotypic variation in many studies, success in achieving improvement in the phenotypes has been mixed. There is significant room for improvement in the current schemes through the use of estimated breeding values (EBVs), which can combine a dog's CHD phenotype with CHD phenotypes of relatives, other phenotypes as they are proven to be genetically correlated with CHD (especially elbow dysplasia phenotypes), and information from genetic tests for population-relevant DNA markers, as such tests become available. Additionally, breed clubs should be encouraged and assisted to formulate rational, evidenced-based breeding recommendations for CHD which suit their individual circumstances and dynamically to adjust the breeding recommendations based on continuous tracking of CHD genetic trends. These improvements can assist in safely and effectively reducing the impact of CHD on pedigree dog welfare. PMID:21727013

  3. Migration of canine neutrophils to chitin and chitosan. (United States)

    Usami, Y; Okamoto, Y; Minami, S; Matsuhashi, A; Kumazawa, N H; Tanioka, S; Shigemasa, Y


    Suspension of chitin and chitosan particles (mean size of 1 micron) were found to attract canine neutrophils chemotactically as determined by a checkerboard assay through polycarbonate filter with 5 microns pore size in Blind well chamber. Suspension of chitin induced chemokinetic migrations of the neutrophils. These evidences might reflect accumulation of neutrophils to chitin- and chitosan-implanted regions in dogs. PMID:7696425

  4. In vitro activity of difloxacin against canine bacterial isolates

    NARCIS (Netherlands)

    Hoven, van den J.R.; Wagenaar, J.A.; Walker, R.D.


    The in vitro activity of difloxacin against canine bacterial isolates from clinical cases was studied in the United States and The Netherlands. Minimal inhibitory concentrations (MIC), the postantibiotic effect, the effect of pH on antimicrobial activity, and the bacterial killing rate tests were de

  5. The blood supply to the canine middle ear. (United States)

    Stevens-Sparks, Cathryn; Jarrett, Keith; McNulty, Margaret A; Strain, George M


    Current descriptions of the anatomy of the blood supply to the canine middle ear are either incomplete or inconsistent, particularly in regards to the vascular branches in close proximity to the temporomandibular articulation (TMJ). To further investigate this blood supply, dissections (n = 9), corrosion casts (n = 4), and computed tomography (n = 8) of canine temporal regions/ears were performed. The goal of this study was to identify and describe branches of the external carotid and maxillary arteries in close proximity to the TMJ that supply the middle ear of the dog. Specific focus was placed on the constancy and origin of the canine rostral tympanic artery since this artery was anticipated to arise from the maxillary artery and enter a foramen at the medial aspect of the mandibular fossa adjacent to the TMJ. New anatomical variations of three canine arteries are described in this study. (1) The rostral tympanic artery is a branch of the temporomandibular ramus and is accommodated by a small foramen located within a depression medial to the temporomandibular joint. (2) A pharyngeal branch of the caudal deep temporal artery was identified. (3) The origin of the caudal auricular artery occurred opposite the lingual artery in 25.8% of dissected specimens, contrary to published descriptions. Anat Rec, 299:907-917, 2016. © 2016 Wiley Periodicals, Inc. PMID:27082971

  6. Canine hip dysplasia: significance of early bony spurring

    International Nuclear Information System (INIS)

    It is the purpose of this study to call attention to new bone production that often occurs early in the sequence of pathological changes associated with canine hip dysplasia. New bone production extending to bony remodeling, as well as femoral head subluxation, both occur in the sequence of pathologic changes associated with canine hip dysplasia. Subluxation is considered primary, while osteoarthrosis is a secondary feature, and both are used in the diagnosis of canine hip dysplasia. This report concerns the significance of the presence of a solitary bony osteophyte, or spur, that is frequently evident on the caudal aspect of the femoral neck as viewed on the conventional ventrodorsal projection. This report utilizes findings from pelvic radiographs of 605 dogs (five breeds). There was a greater frequency (54%)of this bony change in cases diagnosed radiographically as dysplastic than in cases diagnosed as normal(15%).Thus, it is suggested that this minimal radiographic change can be used as an indicator of early canine hip dysplasia, especially in the absence of subluxation of the femoral head

  7. When Reading Gets Ruff: Canine-Assisted Reading Programs (United States)

    Lane, Holly B.; Zavada, Shannon D. W.


    Canine-assisted reading programs show promise as an innovative method for engaging reluctant readers and motivating them to practice. In such programs, specially trained dogs visit classrooms and libraries, and children read to them. Children who struggle with reading may be motivated to read more because they find dogs to be calming and…

  8. Dilated Canine Hearts: A Specimen for Teaching Cardiac Anatomy (United States)

    Cope, Lee Anne


    Dilated canine hearts were used to teach undergraduate students internal and external cardiac anatomy. The specimens were dilated using hydrostatic pressure and then fixed using 5% formalin. These specimens provided the students with an alternative to prepackaged embalmed hearts and anatomical models for studying the external and internal cardiac…

  9. Canine cancer patients are included in translational research

    DEFF Research Database (Denmark)

    Børresen, Betina; Clausen, Malene Martini; Hansen, Anders Elias; Engelholm, Svend Aage; Kjær, Andreas; Kristensen, Annemarie Thuri; Zornhagen, Kamilla Westarp


    Cancer bearing dogs represent a unique clinical cancer model with a direct potential for accelerating translation into human patients. A research collaboration between the veterinary and human medical facilities at Copenhagen University and Rigshospitalet has taken offset in this. Canine cancer...

  10. Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman


    Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.

  11. Recent advances in canine leptospirosis: focus on vaccine development

    Directory of Open Access Journals (Sweden)

    Klaasen HLBM


    Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis

  12. The Human-Canine Bond: Closer than Family Ties? (United States)

    Barker, Sandra B.; Barker, Randolph T.


    Used Family Life Space Diagram to compare relationship between human family members with the human-canine relationship. Subjects were 29 dog enthusiasts, 66 typical pet owners, and 27 elementary school students with dogs. Results suggest that individuals may perceive their relationship with their pet dog as being as close as their relationship…

  13. Prognosis in canine idiopathic immune-mediated haemolytic anaemia

    NARCIS (Netherlands)

    Piek, C.J.


    Canine idiopathic immune-mediated haemolytic anaemia (iIMHA) is one of the most frequently occurring immune-mediated diseases in dogs. A gel-based Coombs' test was shown to perform equally well as a classical Coombs' test. Since the gel-based Coombs' test can be commercially produced and is easy and

  14. Molecular Characterization of Canine Rabies Virus, Mali, 2006–2013 (United States)

    Traoré, Abdallah; Picard-Meyer, Evelyne; Mauti, Stephanie; Biarnais, Melanie; Balmer, Oliver; Samaké, Kassim; Kamissoko, Badian; Tembely, Saïdou; Sery, Amadou; Traoré, Abdel K.; Coulibaly, Amy P.; Robardet, Emmanuelle; Zinsstag, Jakob


    We genetically characterized 32 canine rabies viruses isolated in Mali during 2006–2013 and identified 3 subgroups that belonged to the Africa 2 lineage. We also detected subgroup F rabies virus. This information should be useful for development of mass vaccination campaigns for dogs and eventual large-scale control programs in this country. PMID:27089307

  15. Morphological study of maxillary canine region based on CT

    International Nuclear Information System (INIS)

    The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)

  16. Morphometric analysis of canine in gender determination: Revisited in India

    Directory of Open Access Journals (Sweden)

    Geetha Paramkusam


    Interpretation and Conclusion: Use of the standard mandibular CI in gender determination is recommended for forensic procedures as it was found to have an acceptable accuracy. MD width of canine may be used in a setup when only the single tooth or a fragment of a jaw is available for analysis, with due consideration to its relatively low accuracy.

  17. Canine distemper virus - a morbillivirus in search of new hosts?

    NARCIS (Netherlands)

    T.C. Harder (Timm); A.D.M.E. Osterhaus (Albert)


    textabstractCanine distemper morbillivirus (CDV) induces a multisystemic, often fatal disease in a wide and seemingly expanding host range among the Carnivora. Several genotypes of an otherwise monotypic virus species co-circulate in a geographically restricted pattern. Interspecies transmissions fr

  18. Canine distemper virus in Lake Baikal seals (Phoca sibirica).

    NARCIS (Netherlands)

    L.V. Mamaev; I.K.G. Visser (Ilona); S.I. Belikov; N.N. Denikina; T.C. Harder (Timm); L. Goatley; B. Rima; B. Edginton; A.D.M.E. Osterhaus (Albert); T. Barrett (Thomas)


    textabstractThe virus epizootic which resulted in significant mortality in Siberian seals (Phoca sibirica) in Lake Baikal during 1987/88 was caused by canine distemper virus. Sequence analysis of the virus glycoprotein genes revealed that it was most closely related to recent European field isolates

  19. Ventilation and diaphragm activity during sustained hypoxia in awake canines. (United States)

    Fujimura, Naoyuki; Ji, Michael; Jagers, Jenny Suneby; Katagiri, Masato; Easton, Paul A


    In humans, isocapnic hypoxia sustained for 20-30 min elicits a biphasic ventilatory response with an initial increased peak followed by a roll-off to a lesser, intermediate plateau. However, it is uncertain if this hypoxic roll-off is common for all mammals, as canines have been a notable exception. We examined the effect of moderate isocapnic hypoxia (SpO2 80%) sustained for 20 min in 13 adult, awake, intact canines. The ventilatory response to sustained isocapnic hypoxia in these canines was not maintained: after an initial brisk response, ventilation declined significantly to an intermediate plateau. The hypoxic ventilatory decline occurred via a decrease in tidal volume, without change in breathing frequency. Distinct from airflow, costal diaphragm EMG showed a concurrent decline during sustained isocapnic hypoxia. However, the change in ventilation during sustained hypoxia in canines was very different from the response in humans. Although some decline in ventilation during sustained hypoxia may be common to all mammals, there are notable differences among species. PMID:26099798

  20. Canine hypertrophic osteopathy associated with extra-thoracic lesions


    Headley Selwyn Arlington; Ribeiro Eduardo Alcântara; Santos Gustavo José Von G. dos; Bettini Carlos Maia; Mattos Júnior Ewaldo


    Canine hypertrophic osteopathy is described in a dog that presented extra-thoracic lesions, mainly in the liver. Hepatic lesions were characterized by necrosis, hemorrhage, severe hydropic degeneration of centrolobular hepatocytes, proliferation of epithelial cells of bile ducts, and mild biliary stasis. The disease syndrome was diagnosed based on clinical signs, radiological evaluation, and inspection of macerated bones.

  1. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    Directory of Open Access Journals (Sweden)

    Helen L. Del Puerto


    Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

  2. Current state of knowledge: the canine gastrointestinal microbiome. (United States)

    Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S


    Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome. PMID:22647637

  3. Establishment of Canine-Derived Giardia duodenalis Isolates in Culture. (United States)

    Tysnes, Kristoffer R; Robertson, Lucy J


    Researchers continue to rely on axenic cultivation of Giardia duodenalis trophozoites in vitro to study the life cycle and host-parasite interactions of G. duodenalis and to develop vaccines and drugs to prevent and treat giardiasis. The majority of in vitro studies of G. duodenalis have used a small subset of isolates, mostly of assemblage A, and these isolates are usually originally isolated from humans. The most commonly used isolate for lab studies is known as WB. Canine giardiasis is a disease of veterinary importance, but it may also be of relevance in zoonotic transmission. Few G. duodenalis isolates from dogs have been adapted to in vitro culture, probably because the methods used are not suitable for the canine-specific genotypes that tend to dominate in most dog populations. In the current study, an experimental approach to cultivating canine-derived isolates of G. duodenalis was attempted by modification of the standard protocol based on physiological differences between the human and canine digestive system. An adapted method is described for improving the rate of in vitro excystation of cysts isolated from dogs by chemically weakening the cyst wall. A new canine-derived assemblage A G. duodenalis isolate was successfully adapted to axenic culture by using this method; the dog apparently had a mixed infection of assemblages A and D, but the assemblage A successfully outcompeted the assemblage D under conditions of in vitro culture. Based on the results, reasons regarding why humans do not seem to be suitable hosts for G. duodenalis in assemblages C and D are discussed. PMID:26835750

  4. Release of canine parvovirus from endocytic vesicles

    International Nuclear Information System (INIS)

    Canine parvovirus (CPV) is a small nonenveloped virus with a single-stranded DNA genome. CPV enters cells by clathrin-mediated endocytosis and requires an acidic endosomal step for productive infection. Virion contains a potential nuclear localization signal as well as a phospholipase A2 like domain in N-terminus of VP1. In this study we characterized the role of PLA2 activity on CPV entry process. PLA2 activity of CPV capsids was triggered in vitro by heat or acidic pH. PLA2 inhibitors inhibited the viral proliferation suggesting that PLA2 activity is needed for productive infection. The N-terminus of VP1 was exposed during the entry, suggesting that PLA2 activity might have a role during endocytic entry. The presence of drugs modifying endocytosis (amiloride, bafilomycin A1, brefeldin A, and monensin) caused viral proteins to remain in endosomal/lysosomal vesicles, even though the drugs were not able to inhibit the exposure of VP1 N-terminal end. These results indicate that the exposure of N-terminus of VP1 alone is not sufficient to allow CPV to proliferate. Some other pH-dependent changes are needed for productive infection. In addition to blocking endocytic entry, amiloride was able to block some postendocytic steps. The ability of CPV to permeabilize endosomal membranes was demonstrated by feeding cells with differently sized rhodamine-conjugated dextrans together with the CPV in the presence or in the absence of amiloride, bafilomycin A1, brefeldin A, or monensin. Dextran with a molecular weight of 3000 was released from vesicles after 8 h of infection, while dextran with a molecular weight of 10,000 was mainly retained in vesicles. The results suggest that CPV infection does not cause disruption of endosomal vesicles. However, the permeability of endosomal membranes apparently changes during CPV infection, probably due to the PLA2 activity of the virus. These results suggest that parvoviral PLA2 activity is essential for productive infection and presumably

  5. Cardiac troponin I levels in canine pyometra

    Directory of Open Access Journals (Sweden)

    Hagman Ragnvi


    Full Text Available Abstract Background Myocardial injury may contribute to unexpected deaths due to pyometra. To detect myocardial damage, measurement of cardiac troponin I (cTnI is currently the most sensitive and specific method. The aims of the present study were to evaluate presence of myocardial damage in canine pyometra by analysis of cTnI, to explore whether myocardial injury was associated with systemic inflammatory response syndrome (SIRS and to evaluate whether other clinical or laboratory parameters were associated with cTnI increase. Methods Preoperative plasma levels of cTnI were investigated in 58 female dogs with pyometra and 9 controls. The value of physical examination findings, haematological, serum biochemical and pro-inflammatory (CRP and TNF-α parameters as possible predictors of increased cTnI levels was also evaluated. Results Seven dogs with pyometra (12% and one control dog (11% had increased levels of cTnI. In the pyometra group, the levels ranged between 0.3–0.9 μg l-1 and in the control dog the level was 0.3 μg l-1. The cTnI levels did not differ significantly between the two groups. No cardiac abnormalities were evident on preoperative physical examinations. Four of the pyometra patients died within two weeks of surgery, of which two were examined post mortem. In one of these cases (later diagnosed with myocarditis and disseminated bacterial infection the cTnI levels increased from 0.9 μg l-1 preoperatively to 180 μg l-1 the following day when also heart arrhythmia was also detected. The other patient had cTnI levels of 0.7 μg l-1 with no detectable heart pathology post mortem. CTnI increase was not associated with presence of SIRS. There was a trend for the association of cTnI increase with increased mortality. No preoperative physical examination findings and few but unspecific laboratory parameters were associated with increased cTnI levels. Conclusion Increased cTnI levels were observed in 12% of the dogs with pyometra. The

  6. Survey of canine babesiosis in South Africa

    Directory of Open Access Journals (Sweden)

    M.G. Collett


    Full Text Available A questionnaire, designed to obtain qualitative information on a number of variables concerning canine babesiosis (biliary fever in South Africa, was sent to 510 veterinary practices in late 1993. Of the 157 practices that responded, all were presented with cases of babesiosis and most were situated in Gauteng, the Western Cape and KwaZulu-Natal. Apart from the Western Cape, a winter-rainfall region, the prevalence of babesiosis cases in dogs was highest in summer. Most of the respondent practices treated between 1000 and 5000 sick dogs that included 100 to 500 babesiosis cases each year. Respondents identified cerebral babesiosis, enterorrhagia, 'red' or haemoconcentrated babesiosis, acute renal failure and pulmonary babesiosis or 'shock lung', amongst others, as the most prevalent forms of complicated ('atypical' babesiosis. Diminazene, imidocarb and trypan blue were the most popular antibabesials. Trypan blue was most often used in shocked patients, whereas diminazene and imidocarb were preferred when there was a high parasitaemia in the absence of shock. At least 19 antibabesial treatment regimens were used in practices. These comprised the use of single doses of antibabesial drugs; split doses with repeat injections, and combined drug variations, some of which are undesirable due to possible sterilisation of Babesia infection or potential toxicity. Side-effects were most commonly associated with imidocarb use. Ninety-six percent of respondents used supportive treatment (e.g. corticosteroids, vitamins and 'liver support' in all cases of babesiosis. The use of blood transfusion as supportive treatment varied according to practice and severity of the case. Most practices never cross-matched blood to be transfused, and transfusion reactions were rare. Diminazene was most frequently incriminated in cases where drug 'resistance' or relapses occurred. Cerebral and 'red' cases resulted in high mortality. Treatment of babesiosis costs the dog

  7. Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel

    International Nuclear Information System (INIS)

    Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old

  8. Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma. (United States)

    Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid


    Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma. PMID:26733734

  9. The canine intervertebral disk. 2. Degenerative changes: nonchondrodystrophoid versus chondrodystrophoid disks

    International Nuclear Information System (INIS)

    In the second of a two-part article on the canine intervertebral disk, the morphological changes which occur within the disk during aging and degeneration are described. Degeneration of the intervertebral disk appears to be a self-perpetuating process as a consequence of disruption to the annulus fibrous, cellular remodeling, altered biomechanical loading, and nutritional deficiencies. In the nonchondrodystrophoid disk, premature acceleration of the aging process can occur following traumatic disruption to the annulus fibrous. This degeneration usually occurs in isolated disks along the length of the vertebral column, By contrast, disk degeneration in the chondrodystrophoid breeds occurs simultaneously in all disks along the vertebral column and usually is well advanced by two years of age, Ultrastructural differences between the intervertebral disk of the nonchondrodystrophoid dog and that of the chondrodystrophoid dog may explain the rapidity and severity of degenerative changes in the latter breeds

  10. Canine Bone Marrow Stromal Cells Promote Functional Recovery in Mice with Spinal Cord Injury


    Oda, Yasutaka; Tani, Kenji; ASARI, Yusuke; Quintanilha, Luiz Fernando; HARAGUCHI, Tomoya; MOMOTA, Yutaka; Katayama, Masaaki; Itamoto, Kazuhito; Nakazawa, Hiroshi; TAURA, Yasuho


    ABSTRACT Regenerative therapy has begun to be clinically applied in humans and dogs to treat neurological disorders, such as spinal cord injury (SCI). Here, we show the therapeutic potential of transplantation of cultured canine bone marrow stromal cells (BMSCs) into mice with SCI. Canine BMSC transplantation therapy was performed, immediately after the spinal cord was injured. Canine BMSC therapy enhanced functional recovery of the hind limbs in mice with SCI. Nestin-positive cells were obse...

  11. Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma


    Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid


    Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...

  12. Optimization of canine interleukin-12 production using a baculovirus insect cell expression system


    de Pinheiro, Cristiane Garboggini Melo; Pedrosa, Mayara de Oliveira; Teixeira, Naiara Carvalho; Ano Bom, Ana Paula Dinis; van Oers, Monique M.; Oliveira, Geraldo Gileno de Sá


    Background Interleukin-12 is an important cytokine in mediating cellular immune responses. Results Recombinant single-chain canine IL-12 was produced in a baculovirus-insect cell system with the aim of conducting further studies on modulation of immune responses in dogs. To optimize the production of recombinant canine IL-12, a classical baculovirus and a modified vector (chitinase A and v-cathepsin knockout) were used containing a native or an optimized insert of canine IL-12. The optimized ...

  13. Orthodontic treatment of the transposition of a maxillary canine and a first premolar: a case report


    Teresa, Dinoi Maria; Stefano, Mummolo; Annalisa, Monaco; Enrico, Marchetti; Vincenzo, Campanella; Giuseppe, Marzo


    Introduction Transposition is an anomaly of tooth position, the most frequent of which involves the canine and the first maxillary premolar. We describe the orthodontic treatment of a unilateral transposition of an upper canine and an upper right first premolar in the permanent dentition. Case presentation A 12-year-old Caucasian boy presented with transposition of his upper right canine and upper right first premolar. He had combined surgical-orthodontic treatment to correct the transpositio...

  14. Avian-origin H3N2 canine influenza A viruses in Southern China


    Li, Shoujun; Shi, Zhihai; Jiao, Peirong; Zhang, Guihong; Zhong, Zhiwen; Tian, Wenru; Long, Li-Ping; Cai, Zhipeng; Zhu, Xingquan; Liao, Ming; Wan, Xiu-Feng


    This study reports four sporadic cases of H3N2 canine influenza in southern China, which were identified from sick dogs from May 2006 to October 2007. The evolutionary analysis showed that all eight segments of these four viruses are avian-origin and phylogenetically close to the H3N2 canine influenza viruses reported earlier in South Korea. Systematic surveillance is required to monitor the disease and evolutionary behavior of this virus in canine populations in China.

  15. Canine hypothyroidism. A diagnostic challenge?; Die canine Hypothyreose. Eine diagnostische Herausforderung?

    Energy Technology Data Exchange (ETDEWEB)

    Boretti, Felicitos; Reusch, C.E. [Klinik fuer Kleintiermedizin, Vetsuisse Fakultaet Zuerich, Univ. Zuerich (Switzerland)


    Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen {sup registered}) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high

  16. New Aspects of the Pathogenesis of Canine Distemper Leukoencephalitis

    Directory of Open Access Journals (Sweden)

    Charlotte Lempp


    Full Text Available Canine distemper virus (CDV is a member of the genus morbillivirus, which is known to cause a variety of disorders in dogs including demyelinating leukoencephalitis (CDV-DL. In recent years, substantial progress in understanding the pathogenetic mechanisms of CDV-DL has been made. In vivo and in vitro investigations provided new insights into its pathogenesis with special emphasis on axon-myelin-glia interaction, potential endogenous mechanisms of regeneration, and astroglial plasticity. CDV-DL is characterized by lesions with a variable degree of demyelination and mononuclear inflammation accompanied by a dysregulated orchestration of cytokines as well as matrix metalloproteinases and their inhibitors. Despite decades of research, several new aspects of the neuropathogenesis of CDV-DL have been described only recently. Early axonal damage seems to represent an initial and progressive lesion in CDV-DL, which interestingly precedes demyelination. Axonopathy may, thus, function as a potential trigger for subsequent disturbed axon-myelin-glia interactions. In particular, the detection of early axonal damage suggests that demyelination is at least in part a secondary event in CDV-DL, thus challenging the dogma of CDV as a purely primary demyelinating disease. Another unexpected finding refers to the appearance of p75 neurotrophin (NTR-positive bipolar cells during CDV-DL. As p75NTR is a prototype marker for immature Schwann cells, this finding suggests that Schwann cell remyelination might represent a so far underestimated endogenous mechanism of regeneration, though this hypothesis still remains to be proven. Although it is well known that astrocytes represent the major target of CDV infection in CDV-DL, the detection of infected vimentin-positive astrocytes in chronic lesions indicates a crucial role of this cell population in nervous distemper. While glial fibrillary acidic protein represents the characteristic intermediate filament of mature

  17. Cloning and expression of canine interferon-alpha genes in Escherichia coli. (United States)

    Taira, Osamu; Watanugi, Itsuki; Hagiwara, Yuko; Takahashi, Masaki; Arai, Setsuo; Sato, Hisaaki; Maehara, Nobutoshi


    We cloned five new subtypes of cDNA encoding canine interferon-alpha (CaIFN-alpha) from a canine epithelial cell line. CaIFN-alphas were divided into two groups by amino acid sequences and a molecular phylogenic tree. Two subtypes of them were expressed in Escherichia coli, and IFN proteins were purified. Recombinant CaIFN-alphas were highly species-specific and showed antiviral activity against Vesicular stomatitis New Jersey virus and canine adenovirus-1 , but not against canine herpesvirus-1. PMID:16276065

  18. Dental anomalies in first-degree relatives of transposed canine probands

    Institute of Scientific and Technical Information of China (English)

    Adriana Bartolo; Neville Calleja; Fraser McDonald; Simon Camilleri


    The aim of this study was to investigate and compare the inheritance pattern and prevalence of inheritable dental anomalies in a sample of patients with maxillary canine—first premolar transposition and their first-degree relatives with a sample of palatally displaced canine families. Thirty-five consecutive maxillary canine—first premolar transposition probands and 111 first-degree relatives were matched to 35 consecutive palatally displaced canine probands and 115 first-degree relatives. These were assessed for palatally displaced canines and incisor-premolar hypodontia. Parental age at birth of the proband was also noted. The results revealed that (i) there is no difference in the overall prevalence of palatally displaced canine or incisor-premolar hypodontia between the groups of relatives; (ii) first-degree relatives of bilateral palatally displaced canine probands have a higher prevalence of palatally displaced canine and incisor-premolar hypodontia than those with unilateral palatally displaced canine; and (iii) maternal age at birth of the maxillary canine—first premolar transposition probands was significantly higher than that of the palatally displaced canine probands. The results suggest that maxillary canine—first premolar transposition and palatally displaced canine are unlikely to be different genetic entities and also indicate environmental or epigenetic influences on dental development.

  19. Exposure of pampas fox (Pseudalopex gymnocercus) and crab-eating fox (Cerdocyon thous) from the Southern region of Brazil to Canine distemper virus (CDV), Canine parvovirus (CPV) and Canine coronavirus (CCoV)


    Silvia de Oliveira Hübner; Felipe Geraldes Pappen; Jerônimo Lopes Ruas; Gilberto D'Ávila Vargas; Geferson Fischer; Telmo Vidor


    The exposure of 13 Brazilian free-ranging nondomestic canids (five pampas fox - Pseudalopex gymnocercus and eight crab-eating fox -Cerdocyon thous) from Southern region of Brazil, to Canine distemper virus (CDV), canine parvovirus (CPV) and Canine coronavirus (CCoV) was investigated. Antibodies against CDV were detected in 38.5% (5/13) of the samples. There were anti-CDV antibodies in 60% (3/5) of P. gymnocercus and in 25% (2/8) of C. thous. The frequency was higher among the adults and males...

  20. The unerupted maxillary canine - a post-surgical review.

    LENUS (Irish Health Repository)

    O'Dowling, Ian


    The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.

  1. Survivin and related proteins in canine mammary tumors: immunohistochemical expression. (United States)

    Bongiovanni, L; Romanucci, M; Malatesta, D; D'Andrea, A; Ciccarelli, A; Della Salda, L


    Survivin is reexpressed in most human breast cancers, where its expression has been associated with tumor aggressiveness, poor prognosis, and poor response to therapy. Survivin expression was evaluated in 41 malignant canine mammary tumors (CMTs) by immunohistochemistry, in relation to histological grade and stage, and correlated with that of some related molecules (β-catenin, caspase 3, heat shock proteins) to understand their possible role in canine mammary tumorigenesis. An increase in nuclear survivin expression, compared with healthy mammary glands, was observed in CMTs, where nuclear immunolabeling was related to the presence of necrosis. No statistically significant relation was found between the expression of the investigated molecules and the histological grade or stage. The present study may suggest an important involvement of survivin in CMT tumorigenesis. Its overexpression in most of the cases evaluated might suggest that targeting survivin in CMTs may be a valid anticancer therapy. PMID:24686389

  2. Serotonin transporter and dopamine transporter imaging in the canine brain

    Energy Technology Data Exchange (ETDEWEB)

    Peremans, Kathelijne [Department of Medical Imaging, Faculty of Veterinary Sciences, Ghent University, B-9000 Ghent (Belgium); Goethals, Ingeborg [Division of Nuclear Medicine, University Hospital Ghent, B-9000 Ghent (Belgium); De Vos, Filip [Laboratory of Radiopharmacy, Pharmaceutical Sciences, Ghent University, B-9000 Ghent (Belgium); Dobbeleir, A. [Department of Medical Imaging, Faculty of Veterinary Sciences, Ghent University, B-9000 Ghent (Belgium); Ham, Hamphrey [Division of Nuclear Medicine, University Hospital Ghent, B-9000 Ghent (Belgium); Van Bree, Henri [Department of Medical Imaging, Faculty of Veterinary Sciences, Ghent University, B-9000 Ghent (Belgium); Heeringen, Cees van [Department of Psychiatry and Medical Psychology, Faculty of Medical and Health Sciences, Ghent University, B-9000, Ghent (Belgium); Audenaert, Kurt [Division of Nuclear Medicine, University Hospital Ghent, B-9000 Ghent (Belgium) and Department of Psychiatry and Medical Psychology, Faculty of Medical and Health Sciences, Ghent University, B-9000, Ghent (Belgium)]. E-mail:


    The serotonergic and dopaminergic systems are involved in a wide range of emotional and behavioral aspects of animals and humans and are involved in many neuropsychiatric disorders. Selective serotonin (5-HT) reuptake inhibitors (SSRIs) are designed to block the 5-HT transporter (SERT), thereby increasing the available 5-HT in the brain. Functional imaging with specific SERT and dopamine transporter (DAT) ligands contributes to the study of the SSRI-transporter interaction. First, we evaluated the feasibility of a canine model in the study of the SERT and DAT with the radioligands [{sup 123}I]-{beta}-CIT and [{sup 123}I]-FP-CIT as well as single-photon emission computed tomography imaging. Second, we studied the effect of SSRIs (sertraline, citalopram and escitalopram) on the SERT and DAT in two dogs. The position of the canine model in the study of the SERT and DAT is discussed and compared with other animal models.

  3. An Update on Therapeutic Management of Canine Demodicosis

    Directory of Open Access Journals (Sweden)

    S. K. Singh


    Full Text Available Canine demodicosis is a common noncontagious parasitic dermatosis caused by different spp of Demodex mites including Demodex canis, Demodex injai and D. cornei. Generalized demodicosis can be one of the most frustrating skin diseases, one will ever treat. Conventional and newer miticidal therapies are available to veterinarian to treat this frustrating skin disease. All recognized Demodex mites in dogs appear to respond similarly to mite targeted therapy. Treatment for canine demodicosis includes amitraz, ivermectin, milbemicin oxime, moxidectin, and doramectin. The use of any glucocorticoid-containing products is contraindicated and could favour disease generalization. Conventional treatments will often appear to work however, but it relies heavily on a highly toxic method of treatment. Using natural remedies for mange, on the other hand, can enhance the dog’s immune system, so that the body can fight off the mange mite infection by itself. [Veterinary World 2011; 4(1.000: 41-44

  4. Measurement of plasma canine C peptide by radioimmunoassay

    International Nuclear Information System (INIS)

    A sensitive radioimmunoassay for canine C peptide (CCP) was established using synthetic CCP, a specific antiserum, and rabbit anti-guinea pig serum. Radioiodination was performed according to a modified chloramine T method. Tracer preparations have been used for 6 weeks after iodination. The standard curve ranges from 0.028 to 3.0 nmol/l. The intra-assay coefficient of variation (CV) was 3-5% and the inter-assay CV was 6-9% in the optimal range between 0.3 and 0.8 nmol/l. The average recovery of CCP added to plasma samples was 100.6% (n = 9). Canine insulin, porcine proinsulin, bovine proinsulin, and human C peptide exhibited no cross-reactivity. The mean fasting plasma CCP concentration was 0.089 +- 0.021 nmol/l in normal dogs and -0.005 +- 0.007 nmol/l (mean +- SEM) in diabetic dogs, respectively. (author)

  5. Serotonin transporter and dopamine transporter imaging in the canine brain

    International Nuclear Information System (INIS)

    The serotonergic and dopaminergic systems are involved in a wide range of emotional and behavioral aspects of animals and humans and are involved in many neuropsychiatric disorders. Selective serotonin (5-HT) reuptake inhibitors (SSRIs) are designed to block the 5-HT transporter (SERT), thereby increasing the available 5-HT in the brain. Functional imaging with specific SERT and dopamine transporter (DAT) ligands contributes to the study of the SSRI-transporter interaction. First, we evaluated the feasibility of a canine model in the study of the SERT and DAT with the radioligands [123I]-β-CIT and [123I]-FP-CIT as well as single-photon emission computed tomography imaging. Second, we studied the effect of SSRIs (sertraline, citalopram and escitalopram) on the SERT and DAT in two dogs. The position of the canine model in the study of the SERT and DAT is discussed and compared with other animal models

  6. Magnetic resonance imaging of canine degenerative lumbar spine diseases

    International Nuclear Information System (INIS)

    Degenerative lumbar spine diseases, i.e., sacrolumbar stenosis, intervertebral disk degeneration and protrusion and spondylosis deformans of the canine lumbar spine were studied in eleven canine patients and three healthy controls using radiography and 0.02 T and 0.04 T low field magnetic resonance imaging. The T1 and T2 weighted images were obtained in sagittal and transverse planes. The loss of hydration of nucleus pulposus, taken as a sign of degeneration in the intervertebral disks, could be evaluated in both T1 and T2 weighted images. As a noninvasive method magnetic resonance imaging gave more exact information about the condition of intervertebral disks than did radiography. Sacrolumbar stenosis and compression of the spinal cord or cauda equina and surrounding tissue could be evaluated without contrast medium

  7. Vasoactive intestinal peptide (VIP) receptors in the canine gastrointestinal tract

    International Nuclear Information System (INIS)

    Vasoactive intestinal peptide (VIP) is a putative neurotransmitter in both the brain and peripheral tissues. To define possible target tissues of VIP we have used quantitative receptor autoradiography to localize and quantify the distribution of 125I-VIP receptor binding sites in the canine gastrointestinal tract. While the distribution of VIP binding sites was different for each segment examined, specific VIP binding sites were localized to the mucosa, the muscularis mucosa, the smooth muscle of submucosal arterioles, lymph nodules, and the circular and longitudinal smooth muscle of the muscularis externa. These results identify putative target tissues of VIP action in the canine gastrointestinal tract. In correlation with physiological data, VIP sites appear to be involved in the regulation of a variety of gastrointestinal functions including epithelial ion transport, gastric secretion, hemodynamic regulation, immune response, esophageal, gastric and intestinal motility

  8. Canine tooth wear in captive little brown bats (United States)

    Clark, D.R., Jr.


    Upper canine teeth of little brown bats Myotis lucifugus lucifugus held in stainless steel wire mesh cages underwent severe wear which exceeded that observed previously in caged big brown bats, Eptesicus fuscus fuscus. This suggests a relationship between amount of wear and size of the caged bats with damage increasing as size decreases. Rapid wear of canine teeth by little brown bats resembled that observed in big brown bats in that it was limited to the first 2 weeks of captivity. This result indicates a universal interval for acclimation to cage conditions among vespertilionid bats. Dietary toxicants DDE and PCB did not affect the extent of wear. If bats are to be released to the wild, confinement in wire mesh cages should be avoided.

  9. Survey of Canine Dirofilaria immitis Infection in New Caledonia. (United States)

    Watier-Grillot, S; Marié, J-L; Cabre, O; Davoust, B


    Canine dirofilariosis is a frequent parasitic disease in New-Caledonia. A survey of canine heartworm (Dirofilaria immitis) infection among dogs from the cities of Tontouta, Nandaï and Nouméa, was performed in March 2009 using two antigen test kits; the microwell ELISA test: DiroCHE (Synbiotics Europe) and the Rapid Immuno Migration (RIM) test: WITNESS DIROFILARIA (Synbiotics Europe). Blood samples were collected from 64 dogs: 49 strays and 15 military working dogs. The military dogs received a permanent chemoprophylaxis (moxidectin). In 11 stray dogs, both tests were positive (22.4%). All the military dogs were negative, showing efficiency of chemoprophaxis. Results were discrepant in 6 dogs, negative with one test and doubtful with the other. Antigen heartworm test kits are available and reliable diagnostic tools. They are useful to evaluate the efficiency of chemoprophylaxis and to detect infected animals in order to treat them and to prevent the spreading of the disease. PMID:21547264

  10. Survey of Canine Dirofilaria immitis Infection in New Caledonia

    Directory of Open Access Journals (Sweden)

    S. Watier-Grillot


    Full Text Available Canine dirofilariosis is a frequent parasitic disease in New-Caledonia. A survey of canine heartworm (Dirofilaria immitis infection among dogs from the cities of Tontouta, Nandaï and Nouméa, was performed in March 2009 using two antigen test kits; the microwell ELISA test: DiroCHE (Synbiotics Europe and the Rapid Immuno Migration (RIM test: WITNESS DIROFILARIA (Synbiotics Europe. Blood samples were collected from 64 dogs: 49 strays and 15 military working dogs. The military dogs received a permanent chemoprophylaxis (moxidectin. In 11 stray dogs, both tests were positive (22.4%. All the military dogs were negative, showing efficiency of chemoprophaxis. Results were discrepant in 6 dogs, negative with one test and doubtful with the other. Antigen heartworm test kits are available and reliable diagnostic tools. They are useful to evaluate the efficiency of chemoprophylaxis and to detect infected animals in order to treat them and to prevent the spreading of the disease.

  11. Xenobiotic-metabolizing enzymes in canine mammary tumours. (United States)

    Kumaraguruparan, R; Subapriya, R; Balachandran, C; Manohar, B Murali; Thangadurai, A; Nagini, S


    Mammary tumours are the most common neoplasms in female dogs. The present study was designed to evaluate the relationship between different clinical stages with activities of phase I and phase II carcinogen-metabolizing enzymes in canine mammary tumours. The levels of cytochrome P450 and cytochrome b5 and the activities of glutathione S-transferase (GST), gamma-glutamyl transpeptidase (GGT), DT-diaphorase (DTD) and NADPH diaphorase in tumour tissues of 25 bitches was estimated. Enhanced levels of cytochrome P450 and b5 and phase II enzyme activities were observed in tumour tissues compared to the corresponding uninvolved adjacent tissues. The magnitude of the changes in phase I and phase II enzyme status was, however, more pronounced in stages I and II compared to stages III and IV. The results suggest that the balance between phase I carcinogen activation and phase II detoxification systems may play an important role in canine mammary tumour development. PMID:16014333

  12. Canine IgA nephropathy: a case report. (United States)

    Yabuki, Akira; Shimokawa Miyama, Takako; Kohyama, Moeko; Yamato, Osamu


    Immunoglobulin (Ig) A nephropathy is a rare form of canine glomerular disease. This report describes a case of canine IgA nephropathy showing characteristics typical of human IgA nephropathy. An 8-year-old, spayed female Miniature Dachshund showed persistent severe proteinuria without azotemia. She was receiving long-term glucocorticoid therapy due to chronic gastritis and an intra-abdominal suture granuloma. A renal biopsy demonstrated mesangial proliferative glomerulonephritis with predominantly mesangial IgA deposition and electron-dense deposits in the paramesangium. These findings closely resembled those of human IgA nephropathy. Glucocorticoid treatment was discontinued, and the angiotensin-converting enzyme inhibitor enalapril was administrated as an antiproteinuric agent. The proteinuria subsequently went into remission, and the patient has maintained good condition without recurrence. PMID:26596464

  13. Effects of various drugs on canine tracheal mucociliary transport

    International Nuclear Information System (INIS)

    A study of the effects of dehydration, atropine, terbutaline and N-acetylcysteine on canine tracheobronchial mucus is presented. Mucociliary clearance rates, mucus secretion volumes and mucus rheologic properties were studied. Clearance rates were studied by a radioisotope technique mucus collected by a canine Tracheal pouch method and rheologic studies performed on a microrheometer. Clearance rate was unaffected by dehydration and terbutaline, increased by N-acetylcysteine and decreased by atropine. Secretion volume was increased by terbutaline while dehydration and atropine were without effect. Rheologic factors were increased by dehydration and atropine while terbutaline was without an effect. The effects of N-acetylcysteine on secretion volume and rheologic properties could not be studied because of the nature of the techniques employed

  14. Morphologic and biochemical studies of canine mucopolysaccharidosis I.


    Shull, R M; Helman, R. G.; Spellacy, E.; Constantopoulos, G.; Munger, R. J.; Neufeld, E F


    This report presents the necropsy and biochemical findings on the first dog to die with alpha-L-iduronidase deficiency (mucopolysaccharidosis I, MPS I). Gross pathologic features, light- and electron-microscopic findings, and tissue enzyme, glycosaminoglycan (GAG), and sphingolipid levels are compared with the human disease counterpart and the previously described feline model. Results lend further support for the similarities of the canine disease and human MPS I.

  15. Antioxidants in the Canine Model of Human Aging


    Dowling, Amy L. S.; Head, Elizabeth


    Oxidative damage can lead to neuronal dysfunction in the brain due to modifications to proteins, lipids and DNA/RNA. In both human and canine brain, oxidative damage progressively increases with age. In the Alzheimer’s disease (AD) brain, oxidative damage is further exacerbated, possibly due to increased deposition of beta-amyloid (Aβ) peptide in senile plaques. These observations have led to the hypothesis that antioxidants may be beneficial for brain aging and AD. Aged dogs naturally develo...

  16. Acute pancreatitis : a newly recognised potential complication of canine babesiosis


    A.J. Möhr; Lobetti, R. G.; J.J. Van der Lugt


    This retrospective study describes 4 cases of canine babesiosis with histologically confirmed acute pancreatitis. In addition, 16 dogs with babesiosis are reported with serum amylase (>3500 U/l ) and/or lipase (>650 U/l ) activity elevations of a magnitude that would support a diagnosis of probable acute pancreatitis, although extra-pancreatic sources of the enzymes could not be excluded in these cases. Median time of pancreatitis diagnosis was 2.5 days post-admission, with primarily yo...

  17. Prediction of unerupted canines and premolars in a Syrian sample


    Burhan, Ahmad S; Nawaya, Fehmieh R


    Background The current study aimed to evaluate the applicability of the methods of Moyers and of Tanaka and Johnston to estimate the mesiodistal widths of permanent canines and premolars in Syrian individuals, to determine whether the predicting equations differ by sex, and to develop more accurate regression equations using various teeth groups as predictors. Methods A total of 670 pretreatment pairs of casts belonging to 342 female patients and 328 male patients were selected from the archi...

  18. Phylogenetic evidence of canine distemper virus in Serengeti's lions.


    Harder, Timm; Kenter, Marcel; Appel, Max; Roelke-Parker, Melody; Barrett, Thomas,; Osterhaus, Albert


    textabstractRecently an epizootic, reported to be due to a morbillivirus infection, affected the lion population of the Tanzanian Serengeti National Park. A morbillivirus phosphoprotein (P) gene fragment was amplified by PCR from tissue samples of several affected lions. Sequencing of the amplificates and subsequent phylogenetic analyses revealed that a wild-type strain of canine distemper morbillivirus (CDV) was involved. Vaccination of the local domestic dog population with proven safe CDV ...

  19. Fatal canine distemper virus infection of giant pandas in China


    Na Feng; Yicong Yu; Tiecheng Wang; Peter Wilker; Jianzhong Wang; Yuanguo Li; Zhe Sun; Yuwei Gao; Xianzhu Xia


    We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possess...

  20. The pathogenesis and diagnosis of canine hip dysplasia: a review.


    Fries, C L; Remedios, A M


    Hip dysplasia is a common developmental problem affecting the canine population. Despite extensive research into the condition, many questions remain unanswered and numerous misconceptions are present among the general public. The purpose of this paper is to review the current knowledge on the development of hip dysplasia, factors modifying its development, and current diagnostic techniques. A computerized literature search was conducted for the period of January 1983 to April 1985 using the ...

  1. Diagnosis, prevention, and management of canine hip dysplasia: a review

    Directory of Open Access Journals (Sweden)

    Schachner ER


    Full Text Available Emma R Schachner, Mandi J Lopez Department of Veterinary Clinical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA, USA Abstract: Canine hip dysplasia (CHD is a polygenic and multifactorial developmental disorder characterized by coxofemoral (hip joint laxity, degeneration, and osteoarthritis (OA. Current diagnostic techniques are largely subjective measures of joint conformation performed at different stages of development. Recently, measures on three-dimensional images generated from computed tomography scans predicted the development of OA associated with CHD. Continued refinement of similar imaging methods may improve diagnostic imaging techniques to identify dogs predisposed to degenerative hip joint changes. By current consensus, joint changes consistent with CHD are influenced by genetic predisposition as well as environmental and biomechanical factors; however, despite decades of work, the relative contributions of each to the development and extent of CHD signs remain elusive. Similarly, despite considerable effort to decipher the genetic underpinnings of CHD for selective breeding programs, relevant genetic loci remain equivocal. As such, prevention of CHD within domestic canine populations is marginally successful. Conservative management is often employed to manage signs of CHD, with lifelong maintenance of body mass as one of the most promising methods. Surgical intervention is often employed to prevent joint changes or restore joint function, but there are no gold standards for either goal. To date, all CHD phenotypes are considered as a single entity in spite of recognized differences in expression and response to environmental conditions and treatment. Identification of distinct CHD phenotypes and targeting evidence-based conservative and invasive treatments for each may significantly advance prevention and management of a prevalent, debilitating condition in canine companions. Keywords: canine

  2. Classification and grading of canine malignant mammary tumors


    Abbas Tavasoly; Hannaneh Golshahi; Annahita Rezaie; Mohammad Farhadi


    Histological grading is a good parameter to stratify tumors according to their biological aggressiveness. The Elston and Ellis grading method in humans, invasive ductal breast carcinomas and other invasive tumors are routinely used. The aims of this study were classification of mammary gland tumors and also application of a human grading method in canine mammary carcinoma. The samples included 37 tumors of mammary glands. Mammary tumors were carcinomas (n = 32) and sarcomas (n = 5). The carci...

  3. Canine aggression toward people: a guide for practitioners. (United States)

    Sueda, Karen Lynn C; Malamed, Rachel


    This article reviews the various causes of human-directed aggression in dogs and provides a step-by-step plan guiding the general practitioner through history taking, behavior observations, diagnosis, consultation, treatment, and follow-up care. Charts summarizing how to obtain behavioral information, the client's management options, treatment recommendations, diagnosis and treatment of human-directed aggression, and the clinician's role in preventing human-directed aggression are included. A graphic illustration of canine body language is also provided. PMID:24766702

  4. Feline and canine coronaviruses : common genetic and pathobiological features


    Sophie Le Poder


    A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious ...

  5. Polarized entry of canine parvovirus in an epithelial cell line.


    Basak, S; Compans, R W


    The binding and uptake of canine parvovirus (CPV) in polarized epithelial cells were investigated by growing the cells on a permeable support and inoculating with the virus either from the apical or basolateral surface. Binding of radiolabeled CPV occurred preferentially on the basolateral surface. In contrast, when a similar experiment was carried out on nonpolarized A72 cells, virus binding occurred regardless of the direction of virus input. Binding appeared to be specific for CPV and coul...

  6. Colorectal cancer screening with odour material by canine scent detection


    Sonoda, Hideto; Kohnoe, Shunji; Yamazato, Tetsuro; Satoh, Yuji; Morizono, Gouki; Shikata, Kentaro; Morita, Makoto; Watanabe, Akihiro; Morita, Masaru; Kakeji, Yoshihiro; Inoue, Fumio; Maehara, Yoshihiko


    Objective Early detection and early treatment are of vital importance to the successful treatment of various cancers. The development of a novel screening method that is as economical and non-invasive as the faecal occult blood test (FOBT) for early detection of colorectal cancer (CRC) is needed. A study was undertaken using canine scent detection to determine whether odour material can become an effective tool in CRC screening. Design Exhaled breath and watery stool samples were obtained fro...

  7. Organization and expression of canine olfactory receptor genes.


    Issel-Tarver, L; Rine, J


    Four members of the canine olfactory receptor gene family were characterized. The predicted proteins shared 40-64% identity with previously identified olfactory receptors. The four subfamilies identified in Southern hybridization experiments had as few as 2 and as many as 20 members. All four genes were expressed exclusively in olfactory epithelium. Expression of multiple members of the larger subfamilies was detected, suggesting that most if not all of the cross-hybridizing bands in genomic ...

  8. Canine parvovirus effect on wolf population change and pup survival (United States)

    Mech, L.D.; Goyal, S.M.


    Canine parvovirus infected wild canids more than a decade ago, but no population effect has been documented. In wild Minnesota wolves (Canis lupus) over a 12-yr period, the annual percent population increase and proportion of pups each were inversely related to the percentage of wolves serologically positive to the disease. Although these effects did not seem to retard this large extant population, similar relationships in more isolated wolf populations might hinder recovery of this endangered and threatened species.

  9. Molecular identification of bacteria associated with canine periodontal disease


    Riggio, Marcello P.; Lennon, Alan; Taylor, David J.; Bennett, David


    Abstract Periodontal disease is one of the most common diseases of adult dogs, with up to 80% of animals affected. The aetiology of the disease is poorly studied, although bacteria are known to play a major role. The purpose of this study was to identify the bacteria associated with canine gingivitis and periodontitis and to compare this with the normal oral flora. Swabs were obtained from the gingival margin of three dogs with gingivitis and three orally healthy controls, and subg...

  10. Selection of reference genes in canine uterine tissues. (United States)

    Du, M; Wang, X; Yue, Y W; Zhou, P Y; Yao, W; Li, X; Ding, X B; Liu, X F; Guo, H; Ma, W Z


    Real-time quantitative polymerase chain reaction (RT-qPCR) is usually employed in gene expression studies in veterinary research, including in studies on canine pyometra. Canine pyometra is a common clinical disease in bitches. When using RT-qPCR, internal standards, such as reference genes, are necessary to investigate relative gene expression by quantitative measurements of mRNA levels. The aim of this study was to evaluate the stability of reference genes and select reference genes suitable for canine pyometra studies. We collected 24 bitch uterine tissue samples, including five healthy and 19 pyometra infected samples. These were used to screen the best reference genes of seven candidate genes (18SrRNA, ACTB, B2M, GAPDH, HPRT, RPL13A, and YWHAZ). The method of KH Sadek and the GeNorm, Normfinder, BestKeeper, and RefFinder software were used to evaluate the stability of gene expression in both pyometra and healthy uterine samples. The results showed that the expression stability of the candidate gene in pyometra and healthy tissues differed. We showed that YWHAZ was the best reference gene, which could be used as an accurate internal control gene in canine pyometra studies. To further validate this recommendation, the expression profile of a target gene insulin-like growth factor 1 receptor gene (IGF1R) was investigated. We found that the expression of IGF1R was significantly altered when different reference genes were used. All reference genes identified in the present study will enable more accurate normalization of gene expression data in both pyometra infected and healthy uterine tissues. PMID:27323194

  11. Aggregative Behavior of Bacteria Isolated from Canine Dental Plaque


    Elliott, D. R.; Wilson, M; Buckley, C. M. F.; Spratt, D. A.


    Interbacterial adhesion of bacteria isolated from canine dental plaque was assessed by performing a visual coaggregation assay. Using conditions mimicking those likely to be encountered in vivo, the entire cultivable plaque microbiota from a single dog was assessed, and eight (6.7%) unique coaggregation interactions were detected for 120 crosses. Transmission electron microscopy was used to visualize several of the bacteria in isolation and as coaggregates, which revealed surface structures t...

  12. Differential Genetic Regulation of Canine Hip Dysplasia and Osteoarthritis


    Zhengkui Zhou; Xihui Sheng; Zhiwu Zhang; Keyan Zhao; Lan Zhu; Gang Guo; Steve G Friedenberg; Hunter, Linda S.; Vandenberg-Foels, Wendy S.; Hornbuckle, William E.; Ursula Krotscheck; Elizabeth Corey; Moise, Nancy S.; Dykes, Nathan L.; Junya Li


    BACKGROUND: Canine hip dysplasia (HD) is a common polygenic trait characterized by hip malformation that results in osteoarthritis (OA). The condition in dogs is very similar to developmental dysplasia of the human hip which also leads to OA. METHODOLOGY/PRINCIPAL FINDINGS: A total of 721 dogs, including both an association and linkage population, were genotyped. The association population included 8 pure breeds (Labrador retriever, Greyhounds, German Shepherd, Newfoundland, Golden retriever,...

  13. Transmission Dynamics and Prospects for the Elimination of Canine Rabies


    Hampson, Katie; Dushoff, Jonathan; Cleaveland, Sarah; Haydon, Daniel T.; Kaare, Magai; Packer, Craig; Dobson, Andy


    Rabies has been eliminated from domestic dog populations in Western Europe and North America, but continues to kill many thousands of people throughout Africa and Asia every year. A quantitative understanding of transmission dynamics in domestic dog populations provides critical information to assess whether global elimination of canine rabies is possible. We report extensive observations of individual rabid animals in Tanzania and generate a uniquely detailed analysis of transmission biology...

  14. Transmission dynamics and prospects for the elimination of canine rabies.


    Katie Hampson; Jonathan Dushoff; Sarah Cleaveland; Haydon, Daniel T.; Magai Kaare; Craig Packer; Andy Dobson


    Rabies has been eliminated from domestic dog populations in Western Europe and North America, but continues to kill many thousands of people throughout Africa and Asia every year. A quantitative understanding of transmission dynamics in domestic dog populations provides critical information to assess whether global elimination of canine rabies is possible. We report extensive observations of individual rabid animals in Tanzania and generate a uniquely detailed analysis of transmission biology...

  15. Isolation and characterization of canine natural killer cells. (United States)

    Michael, Helen T; Ito, Daisuke; McCullar, Valarie; Zhang, Bin; Miller, Jeffrey S; Modiano, Jaime F


    NK cells are non-T, non-B lymphocytes that kill target cells without previous activation. The immunophenotype and function of these cells in humans and mice are well defined, but canine NK cells remain incompletely characterized. Our objectives were to isolate and culture canine peripheral blood NK cells, and to define their immunophenotype and killing capability. PBMC were obtained from healthy dogs and T cells were depleted by immunomagnetic separation. The residual cells were cultured in media supplemented with IL-2, IL-15 or both, or with mouse embryonic liver (EL) feeder cells. Non-T, non-B lymphocytes survived and expanded in these cultures. IL-2 was necessary and sufficient for survival; the addition of IL-15 was necessary for expansion, but IL-15 alone did not support survival. Culture with EL cells and IL-2 also fostered survival and expansion. The non-T, non-B lymphocytes uniformly expressed CD45, MHC I, and showed significant cytotoxic activity against CTAC targets. Expression of MHC II, CD11/18 was restricted to subsets of these cells. The data show that cells meeting the criteria for NK cells in other species, i.e., non-T, non-B lymphocytes with cytotoxic activity, can be expanded from canine PBMC by T-cell depletion and culture with cytokines or feeder cells. PMID:23876304

  16. Heat shock protein expression in canine malignant mammary tumours

    Directory of Open Access Journals (Sweden)

    Sarli Giuseppe


    Full Text Available Abstract Background Abnormal levels of Heat Shock Proteins (HSPs have been observed in many human neoplasms including breast cancer and it has been demonstrated that they have both prognostic and therapeutic implications. In this study, we evaluated immunohistochemical expression of HSPs in normal and neoplastic canine mammary glands and confronted these results with overall survival (OS, in order to understand the role of HSPs in carcinogenesis and to establish their potential prognostic and/or therapeutic value. Methods Immunohistochemical expression of Hsp27, Hsp72, Hsp73 and Hsp90 was evaluated in 3 normal canine mammary glands and 30 malignant mammary tumours (10 in situ carcinomas, 10 invasive carcinomas limited to local structures without identifiable invasion of blood or lymphatic vessels, 10 carcinomas with invasion of blood or lymphatic vessels and/or metastases to regional lymph nodes. A semi-quantitative method was used for the analysis of the results. Results Widespread constitutive expression of Hsp73 and Hsp90 was detected in normal tissue, Hsp72 appeared to be focally distributed and Hsp27 showed a negative to rare weak immunostaining. In mammary tumours, a significant increase in Hsp27 (P Conclusion These results suggest that Hsp27, Hsp72 and Hsp90 are involved in canine mammary gland carcinogenesis. In addition, Hsp27 appears to be implicated in tumour invasiveness and its high immunodetection in invasive tumours is indicative of a poorer clinical outcome.

  17. Morphological characteristics of the canine and feline stomach mucosa. (United States)

    Zahariev, P; Sapundzhiev, E; Pupaki, D; Rashev, P; Palov, A; Todorov, T


    The stomach mucosa structure in animals belonging to Order Carnivora indicates some specific characteristics in comparison with the other mammals. Between the bases of the mucosal glands and the lamina muscularis mucosae there is an additional plate which most of the morphologists have defined as lamina subglandularis. In currently used Nomina histologica this layer is indicated as stratum compactum in carnivorous stomach mucosa. The investigation aims were to study and compare canine and feline stomach tunica mucosa characteristics as well as to measure the thickness of stratum compactum and to specify some of the certain collagen types and fibronectin compounds. Conventional and differential histological and ultrastructural methods and immuno-histochemical approaches for investigation of the canine and feline stomach samples were used. The specific organization of the carnivorous stomach wall arrangement was established. In the structure of the canine stomach mucosa, no evidence of stratum compactum was observed. The presence of stratum compactum in feline stomach mucosa was ascertained and measured. Using an immunohistochemical method very high expression of collagen type IV and fibronectin, moderate positive reaction of collagen type III, and a comparatively weakest expression of collagen types I and V in the structure of stratum compactum from cat stomach mucosa was shown. The obtained results clarify the characteristics of the stomach mucosa morphology and could be used as a basis for distinguishing the stomach wall structure of the animal species belonging to Canidae and Felidae families although they are both carnivores. PMID:20825386

  18. Characterization of a Canine Homolog of Human Aichivirus▿ (United States)

    Kapoor, Amit; Simmonds, Peter; Dubovi, Edward J.; Qaisar, Natasha; Henriquez, Jose A.; Medina, Jan; Shields, Shelly; Lipkin, W. Ian


    Many of our fatal “civilization” infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5′ and 3′ untranslated regions. Comparative phylogenetic analysis using various structural and nonstructural proteins of CKoV confirmed it as the animal virus homolog most closely related to human Aichivirus (AiV). Bayesian Markov chain Monte Carlo analysis suggests a mean recent divergence time of CKoV and AiV within the past 20 to 50 years, well after the domestication of canines. The discovery of CKoV provides new insights into the origin and evolution of AiV and the species specificity and pathogenesis of kobuviruses. PMID:21880761

  19. Characterization of a canine homolog of human Aichivirus. (United States)

    Kapoor, Amit; Simmonds, Peter; Dubovi, Edward J; Qaisar, Natasha; Henriquez, Jose A; Medina, Jan; Shields, Shelly; Lipkin, W Ian


    Many of our fatal "civilization" infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5' and 3' untranslated regions. Comparative phylogenetic analysis using various structural and nonstructural proteins of CKoV confirmed it as the animal virus homolog most closely related to human Aichivirus (AiV). Bayesian Markov chain Monte Carlo analysis suggests a mean recent divergence time of CKoV and AiV within the past 20 to 50 years, well after the domestication of canines. The discovery of CKoV provides new insights into the origin and evolution of AiV and the species specificity and pathogenesis of kobuviruses. PMID:21880761

  20. Pathophysiology, diagnosis, and treatment of canine hip dysplasia

    International Nuclear Information System (INIS)

    Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education

  1. Does contemporary canine diet cause cancer? ; A review

    Directory of Open Access Journals (Sweden)

    Joseph B Gentzel


    Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer

  2. The effect of nematode administration on canine atopic dermatitis. (United States)

    Mueller, R S; Specht, L; Helmer, M; Epe, C; Wolken, S; Denk, D; Majzoub, M; Sauter-Luis, C


    Canine atopic dermatitis is a common disease and is considered as an animal model of the human disease. Immunomodulation by helminths is reported in several species. The aim of this study was to determine whether nematodes have an immunomodulatory effect on atopic dermatitis in dogs. In the pilot study, 12 atopic dogs were infected with either embryonated eggs of Trichuris vulpis (500 and 2500 eggs in 3 dogs each) or L3 larvae of Uncinaria stenocephala (100, 500 and 2500 eggs in 2 dogs each), respectively, for 3 months. Pruritus was evaluated with visual analogue scales and clinical lesions with the canine atopic dermatitis extent and severity index (CADESI). Skin biopsies were obtained for histopathology at the beginning and end of the study. In the subsequent placebo-controlled, double-blinded, randomised study, 21 dogs received either 2500 embryonated T. vulpis eggs or placebo and were evaluated similarly. In addition, allergen-specific serum IgE concentrations were determined. All dogs in the pilot study improved in their lesion scores, most in their pruritus scores. The cutaneous inflammatory infiltrate did not change significantly. In the subsequent randomised study, there was no significant difference between placebo and Trichuris administration in regard to pruritus or CADESI. IgE concentrations also did not change significantly. Infection with T. vulpis did not significantly change clinical signs of canine atopic dermatitis. PMID:21621922

  3. Electrogene therapy with interleukin-12 in canine mast cell tumors

    International Nuclear Information System (INIS)

    Mast cell tumors (MCT) are the most common malignant cutaneous tumors in dogs with extremely variable biological behaviour. Different treatment approaches can be used in canine cutaneous MCT, with surgical excision being the treatment of choice. In this study, electrogene therapy (EGT) as a new therapeutic approach to canine MCTs, was established. Eight dogs with a total of eleven cutaneous MCTs were treated with intratumoral EGT using DNA plasmid encoding human interleukin-12 (IL-12). The local response to the therapy was evaluated by repeated measurements of tumor size and histological examination of treated tumors. A possible systemic response was assessed by determination of IL-12 and interferon- γ (IFN-γ) in patients’ sera. The occurence of side effects was monitored with weekly clinical examinations of treated animals and by performing basic bloodwork, consisting of the complete bloodcount and determination of selected biochemistry parameters. Intratumoral EGT with IL-12 elicits significant reduction of treated tumors’ size, ranging from 13% to 83% (median 50%) of the initial tumor volume. Additionally, a change in the histological structure of treated nodules was seen. There was a reduction in number of malignant mast cells and inflammatory cell infiltration of treated tumors. Systemic release of IL-12 in four patients was detected, without any noticeable local or systemic side effects. These data suggest that intratumoral EGT with plasmid encoding IL-12 may be useful in the treatment of canine MCTs, exerting a local antitumor effect

  4. [Canine excrement in the urban environment: what is the solution?]. (United States)

    Parizot, X


    With the increase in urban dog populations during the 1960s and 1970s, the problem of canine excreta has become more serious, and has become a typical subject of concern for the urban environment and the quality of life. While there may be a discrepancy between the often controversial treatment of the subject by the media and the actual situation for city dwellers, responsibility lies with the local authorities. This article presents the results of ten years of theoretical study and practical applications, undertaken on behalf of the French Association for Information and Studies on Companion Animals (AFIRAC) by experts from many disciplines: doctors, veterinarians, ethologists, teachers, landscape gardeners, town planners and architects, in collaboration with those responsible for open spaces, roadways, urban cleaning, etc. The results obtained are illustrated by the success of programmes implemented by cities such as Grenoble, Le Havre and Mulhouse, and they have led to the establishment of basic principles designed to solve the problem of canine excreta in the urban environment. Details of these principles are provided: the need for an overall approach to animals in towns, a permanent long-term programme under centralised guidance, suitable regulations complemented by information, education, etc. Next there is an account of sanitary equipment specific for dealing with the problem of canine excreta in the urban environment. Cleaning and general maintenance of such equipment are also discussed. PMID:1782423

  5. Surgical treatments of the impacted canine tooth in young dogs

    International Nuclear Information System (INIS)

    Surgical treatments of the impacted canine tooth were carried out in 8 young dogs, and the results were successful in 12 out of 14 cases (85.7%). The treatments consisting of surgical correction by immediate tipping movement, fenestration of the gingiva, and removal of the impacted tooth, were applied to 14 cases radiographically showing the immature tooth root and no abnormalities in the tooth root or alveolar bone. Impacted teeth were seen in 8 regions of the maxilla and 6 regions of the mandible. Mesioversion was seen in almost all maxillary impacted teeth, while linguoversion or lingual mesioversion in all mandibular cases. Surgical correction was carried out by immediate tipping movement after removal of the retained deciduous canine with or without resection of the alveolar bone. Fixation of the moved teeth was done using a wedge made from the deciduous canine root, which was driven into the vacant alveolar cavity after moving. An additional fixation using a steel wire and/or self-curing resin was done, if necessary

  6. Lipids and FA analysis of canine prostate tissue. (United States)

    Attar-Bashi, Nadia M; Orzeszko, Karyn; Slocombe, Ronald F; Sinclair, Andrew J


    It is widely reported that an association exists between dietary fat intake and the incidence of prostate cancer in humans. To study this association, there is a need for an animal model where prostate carcinogenesis occurs spontaneously. The canine prostate is considered a suitable experimental model for prostate cancer in humans since it is morphologically similar to the human prostate and both humans and dogs have a predisposition to benign and malignant prostate disease. In this study, the FA and lipids profiles of the normal canine prostate tissue from nine dogs were examined. The total lipid content of the canine prostate tissue was 1.7 +/- 0.5% (wet weight). The lipid composition analysis using TLC-FID showed that the two major lipid classes were phospholipids and TAG. Total FA, phospholipid, and TAG FA analysis showed that the major FA were palmitic acid (16:0), stearic acid (18:0), oleic acid (18:1), linoleic acid (18:2n-6), and arachidonic acid (20:4n-6). The n-3 FA were present at premium brand dogfoods was <3% (wet weight), and the n-3/n-6 ratio was low. PMID:12934677

  7. Somatostatin modulates cholinergic neurotransmission in canine antral muscle

    International Nuclear Information System (INIS)

    Somatostatin has been shown to inhibit antral motility in vivo. To examine the effect of somatostatin on cholinergic neurotransmission in the canine antrum, we studied the mechanical response of and the release of [3H]acetylcholine from canine longitudinal antral muscle in response to substance P, gastrin 17, and electrical stimulation. In unstimulated tissues, somatostatin had a positive inotropic effect on spontaneous phasic contractions. In tissues stimulated with substance P and gastrin 17, but not with electrical stimulation, somatostatin inhibited the phasic inotropic response dose dependently. This inhibitory effect was abolished by indomethacin. Somatostatin stimulated the release of prostaglandin E2 radioimmunoreactivity, and prostaglandin E2 inhibited the release of [3H]acetylcholine induced by substance P and electrical stimulation. Somatostatin increased the release of [3H]acetylcholine from unstimulated tissues by a tetrodotoxin-sensitive mechanism but inhibited the release induced by substance P and electrical stimulation. These results suggest that somatostatin has a dual modulatory effect on cholinergic neutrotransmission in canine longitudinal antral muscle. This effect is excitatory in unstimulated tissues and inhibitory in stimulated tissues. The inhibitory effect is partially mediated by prostaglandins

  8. Antiviral antibodies stimulate production of reactive oxygen species in cultured canine brain cells infected with canine distemper virus.


    Bürge, T; Griot, C; Vandevelde, M; Peterhans, E


    Canine distemper is characterized mainly by respiratory, enteric, and nervous symptoms. Infection of the central nervous system results in demyelination, to which inflammation has been shown to contribute significantly. It has been proposed that macrophages play a major role as effector cells in this process. We report that cultured dog brain cells contain a population of macrophages capable of producing reactive oxygen species as measured by luminol-dependent chemiluminescence. In cultures i...

  9. Efficacy of two canine distemper vaccines in wild Nearctic river otters (Lontra canadensis). (United States)

    Peper, Steven T; Peper, Randall L; Kollias, George V; Brooks, Robert P; Stevens, Sadie S; Serfass, Thomas L


    Canine distemper virus (CDV), a contagious morbillivirus, infects families in the order Carnivora, including Nearctic river otters (Lontra canadensis). As a preventative measure, vaccinations against CDV are frequently given to mustelids in captive environments. The Pennsylvania River Otter Reintroduction Project (PRORP) used wild-caught river otters to evaluate the efficacy and need for vaccinations against CDV as part of any reintroduction project. The objectives of this study were to: 1) evaluate the prevalence of exposure to CDV in wild river otters, 2) determine the immunologic response of river otters (i.e., seroconversion) after vaccination with a single (primary) vaccine dose compared to a second (booster) dose of Galaxy-D, a modified live-virus canine distemper (CD) vaccine (MLV CDV), and 3) determine the immunologic response after being vaccinated with a primary vaccination compared to a booster dose of Fervac-D, an MLV CDV. River otters were injected subcutaneously in the nape of the neck with their designated vaccine. Timeframes for collection of blood samples and/or injection of booster vaccines varied depending on the parameters of PRORP. Ten of the 22 river otters had positive prevaccination titer levels to CD. Both vaccines, Galaxy-D and Fervac-D, produced sufficient seroconversion or rise of titer levels (86% and 57%, respectively) to recommend the use of vaccines in wild river otters. Future studies are recommended to evaluate currently produced CD vaccines. Future research should also focus on the number of days required between administration of primary and booster vaccines to achieve sufficient immune response. If only a primary dose is required, then hard-release reintroduction projects for river otters could be recommended. If primary and booster vaccines are required then soft-release reintroduction projects should be recommended. Soft-release projects should include captive management periods that allow for appropriate vaccination intervals

  10. Genotypic characterization of canine coronaviruses associated with fatal canine neonatal enteritis in the United States. (United States)

    Licitra, Beth N; Whittaker, Gary R; Dubovi, Edward J; Duhamel, Gerald E


    Emerging canine coronavirus (CCoV) variants that are associated with systemic infections have been reported in the European Union; however, CCoV-associated disease in the United States is incompletely characterized. The purpose of this study was to correlate the clinicopathological findings and viral antigen distribution with the genotypic characteristics of CCoV in 11 puppies from nine premises in five states that were submitted for diagnostic investigation at Cornell University between 2008 and 2013. CCoV antigen was found in epithelial cells of small intestinal villi in all puppies and the colon in 2 of the 10 puppies where colon specimens were available. No evidence of systemic CCoV infection was found. Comparative sequence analyses of viral RNA extracted from intestinal tissues revealed CCoV-II genotype in 9 out of 11 puppies. Of the nine CCoV-IIs, five were subtyped as group IIa and one as IIb, while three CCoVs could not be subtyped. One of the CCoV-IIa variants was isolated in cell culture. Infection with CCoV alone was found in five puppies, of which two also had small intestinal intussusception. Concurrent infections with either parvovirus (n = 1), attaching-effacing Escherichia coli (n = 4), or protozoan parasites (n = 3) were found in the other six puppies. CCoV is an important differential diagnosis in outbreaks of severe enterocolitis among puppies between 4 days and 21 weeks of age that are housed at high population density. These findings will assist with the rapid laboratory diagnosis of enteritis in puppies and highlight the need for continued surveillance for CCoV variants and intestinal viral diseases of global significance. PMID:25253797

  11. Molecular surveillance of traditional and emerging pathogens associated with canine infectious respiratory disease. (United States)

    Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio


    A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. PMID:27527760

  12. Mass die-Off of Caspian seals caused by canine distemper virus.


    Kennedy, S.; Kuiken, T.; Jepson, P. D.; Deaville, R.; Forsyth, M.; Barrett, T; van de Bildt, M. W.; Osterhaus, A D; Eybatov, T.; Duck, C.; Kydyrmanov, A; Mitrofanov, I.; Wilson, S


    Thousands of Caspian seals (Phoca caspica) died in the Caspian Sea from April to August 2000. Lesions characteristic of morbillivirus infection were found in tissue specimens from dead seals. Canine distemper virus infection was identified by serologic examination, reverse transcriptase- polymerase chain reaction, and sequencing of selected P gene fragments. These results implicate canine distemper virus infection as the primary cause of death.


    NARCIS (Netherlands)



    A canine model is described to study the tolerance of the pancreas to intra-operative radiotherapy (IORT). The canine pancreas is a horseshoe-shaped organ. To create a homogeneous delivery of IORT to the whole pancreas surgical manipulation is necessary which may induce pancreatitis. A resection of

  14. The pathogenesis of H3N8 canine influenza virus in chickens, turkeys and ducks (United States)

    Canine influenza virus (CIV) of the H3N8 subtype has emerged in dog populations throughout the U.S. where is has become endemic in kennels and animal shelters in some regions. It has not previously been determined whether the canine adapted virus can be transmitted to domestic poultry, which are su...

  15. Infants' Intermodal Perception of Canine ("Canis Familairis") Facial Expressions and Vocalizations (United States)

    Flom, Ross; Whipple, Heather; Hyde, Daniel


    From birth, human infants are able to perceive a wide range of intersensory relationships. The current experiment examined whether infants between 6 months and 24 months old perceive the intermodal relationship between aggressive and nonaggressive canine vocalizations (i.e., barks) and appropriate canine facial expressions. Infants simultaneously…

  16. Mandibular Canine Dimorphism in Establishing Sex Identity in the Lebanese Population



    Background and Objective. In forensic investigations, mandibular canines provide excellent materials to identify gender since they are more likely to survive disasters. The objective of this study was to investigate gender dimorphism by comparing the mesiodistal width of mandibular permanent canines and intercanine distance in a group of Lebanese population. Methods. Participants consisted of undergraduate students from the Sch...

  17. The effects of taurolidine alone and in combination with doxorubicin or carboplatin in canine osteosarcoma in vitro

    Directory of Open Access Journals (Sweden)

    Marley Kevin


    Full Text Available Abstract Background Osteosarcoma (OS affects over 8000 dogs/year in the United States. The disease usually arises in the appendicular skeleton and metastasizes to the lung. Dogs with localized appendicular disease benefit from limb amputation and chemotherapy but most die within 6–12 months despite these treatments. Taurolidine, a derivative of taurine, has anti-tumor and anti-angiogenic effects against a variety of cancers. The following in vitro studies tested taurolidine as a candidate for adjuvant therapy for canine OS. Tests for p53 protein status and caspase activity were used to elucidate mechanisms of taurolidine-induced cell death. Results Taurolidine was cytotoxic to osteosarcoma cells and increased the toxicity of doxorubicin and carboplatin in vitro. Apoptosis was greatly induced in cells exposed to 125 μM taurolidine and less so in cells exposed to 250 μM taurolidine. Taurolidine cytotoxicity appeared caspase-dependent in one cell line; with apparent mutant p53 protein. This cell line was the most sensitive to single agent taurolidine treatment and had a taurolidine-dependent reduction in accumulated p53 protein suggesting taurolidine’s effects may depend on the functional status of p53 in canine OS. Conclusion Taurolidine’s cytotoxic effect appears dependent on cell specific factors which may be explained, in part, by the functional status of p53. Taurolidine initiates apoptosis in canine OS cells and this occurs to a greater extent at lower concentrations. Mechanisms of cell death induced by higher concentrations were not elucidated here. Taurolidine combined with doxorubicin or carboplatin can increase the toxicity of these chemotherapy drugs and warrants further investigation in dogs with osteosarcoma.

  18. Immunohistochemical detection of a potential molecular therapeutic target for canine hemangiosarcoma. (United States)

    Adachi, Mami; Hoshino, Yuki; Izumi, Yusuke; Takagi, Satoshi


    Canine hemangiosarcoma (HSA) is a progressive malignant neoplasm of dogs for which there is currently no effective treatment. A recent study suggested that receptor tyrosine kinases (RTKs), the PI3K/Akt/m-TOR and MAPK pathways are all activated in canine and human HSA. The aim of the present study was to investigate the overexpression of these proteins by immunohistochemistry in canine splenic HSA to identify potential molecular therapeutic targets. A total of 10 splenic HSAs and two normal splenic samples surgically resected from dogs were sectioned and stained with hematoxylin and eosin for histological diagnosis or analyzed using immunohistochemistry. The expression of RTKs, c-kit, VEGFR-2 and PDGFR-2, as well as PI3K/Akt/m-TOR and MEK was higher in canine splenic HSAs compared to normal spleens. These proteins may therefore be potential therapeutic targets in canine splenic HSA. PMID:26685984

  19. Canine Babesiosis in China Caused by Babesia gibsoni: A Molecular Approach.

    Directory of Open Access Journals (Sweden)

    Da-Wei Yao


    Full Text Available To provide a point of reference to study the epidemiology and clinical expression of canine babesiosis in China.A total of 30 dogs infected with canine babesiosis were evaluated by mean of clinical history, physical examination, hematological, restriction fragment length polymorphism of PCR products (PCR-RFLP and sequencing analysis.The most prevalent clinical abnormalities were lethargy (100%, anorexia (100%, pale or icteric mucous membranes (80%, fever (70% and dark urine (70%. Hematology parameters revealed that anemia and thrombocytopenia were the major abnormalities in blood of dogs infected with canine babesia. The results of PCR-RFLP and sequencing analysis indicated that B. gibsoni was the main species responsible for canine babesiosis cases at the time of the study in Nanjing, China.The results provide valuable information for better understanding of the epidemiology of canine babesiosis in China.

  20. Antiviral effect of lithium chloride on infection of cells by canine parvovirus. (United States)

    Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun


    Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies. PMID:26315688

  1. Oncolytic virotherapy in veterinary medicine: current status and future prospects for canine patients

    Directory of Open Access Journals (Sweden)

    Patil Sandeep S


    Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.

  2. Canine snoops trained for pipeline leaks

    Energy Technology Data Exchange (ETDEWEB)



    The training of dogs to detect leaks in gas lines is discussed. The most-up-to-date field pack monitor or sensor can only read down to 50 parts per million; dogs have proven that they can pick up particles of scent better than one part per billion, similar in magnitude to locating one specific grain of sand in a truck load. Dogs have the capacity to search not only for a single substance, but they can be trained also to search for specific combinations of different smells. Once trained, they are completely reliable and extremely cost effective. German shepherds are favoured for their sociability, desire for work and lack of 'hunting dog' instincts, which allows them to remain focused even in the presence of wildlife. Training begins at the puppy stage; to reach 'operational level' may require up to two years per animal.

  3. First Isolation of New Canine Parvovirus 2a from Tibetan Mastiff and Global Analysis of the Full-Length VP2 Gene of Canine Parvoviruses 2 in China

    Directory of Open Access Journals (Sweden)

    Zhijun Zhong


    Full Text Available Canine parvovirus 2 (CPV-2 was first identified in 1978, and is responsible for classic parvoviral enteritis. Despite the widespread vaccination of domestic carnivores, CPVs have remained important pathogens of domestic and wild carnivores. In this study, we isolated CPV-2 from Tibetan mastiffs and performed a global analysis of the complete VP2 gene sequences of CPV-2 strains in China. Six isolates were typed as new CPV-2a, according to key amino acid positions. On a phylogenetic tree, these six sequences formed a distinct clade. Five isolates occurred on the same branch as KF785794 from China and GQ379049 from Thailand; CPV-LS-ZA1 formed a separate subgroup with FJ435347 from China. One hundred ninety-eight sequences from various parts of China and the six sequences isolated here formed seven distinct clusters, indicating the high diversity of CPVs in China. Of 204 VP2 sequences, 183 (91.04% encoded the mutation Ser297Ala, regardless of the antigenic type, implying that most Chinese CPV-2 strains contain the VP2 mutation Ser297Ala. However, the biological significance of this change from prototype CPV-2a/2b to new CPV-2a/2b types remains unclear. This study is the first to isolate new CPV-2a from the Tibetan mastiff. Our data show that new CPV-2a/2b variants are now circulating in China.

  4. Multi-frequency time-difference complex conductivity imaging of canine and human lungs using the KHU Mark1 EIT system

    International Nuclear Information System (INIS)

    We evaluated the performance of the lately developed electrical impedance tomography (EIT) system KHU Mark1 through time-difference imaging experiments of canine and human lungs. We derived a multi-frequency time-difference EIT (mftdEIT) image reconstruction algorithm based on the concept of the equivalent homogeneous complex conductivity. Imaging experiments were carried out at three different frequencies of 10, 50 and 100 kHz with three different postures of right lateral, sitting (or prone) and left lateral positions. For three normal canine subjects, we controlled the ventilation using a ventilator at three tidal volumes of 100, 150 and 200 ml. Three human subjects were asked to breath spontaneously at a normal tidal volume. Real- and imaginary-part images of the canine and human lungs were reconstructed at three frequencies and three postures. Images showed different stages of breathing cycles and we could interpret them based on the understanding of the proposed mftdEIT image reconstruction algorithm. Time series of images were further analyzed by using the functional EIT (fEIT) method. Images of human subjects showed the gravity effect on air distribution in two lungs. In the canine subjects, the morphological change seems to dominate the gravity effect. We could also observe that two different types of ventilation should have affected the results. The KHU Mark1 EIT system is expected to provide reliable mftdEIT images of the human lungs. In terms of the image reconstruction algorithm, it would be worthwhile including the effects of three-dimensional current flows inside the human thorax. We suggest clinical trials of the KHU Mark1 for pulmonary applications

  5. Genotypes and antibiotic resistance of canine Campylobacter jejuni isolates. (United States)

    Amar, Chantal; Kittl, Sonja; Spreng, David; Thomann, Andreas; Korczak, Bożena M; Burnens, André P; Kuhnert, Peter


    Campylobacter jejuni is the most important cause of bacterial gastroenteritis in humans. It is a commensal in many wild and domestic animals, including dogs. Whereas genotypes of human and chicken C. jejuni isolates have been described in some detail, only little information on canine C. jejuni genotypes is available. To gain more information on genotypes of canine C. jejuni and their zoonotic potential, isolates from routine diagnostics of diarrheic dogs as well as isolates of a prevalence study in non-diarrheic dogs were analyzed. Prevalence of thermophilic Campylobacter among non-diarrheic dogs was 6.3% for C. jejuni, 5.9% for Campylobacter upsaliensis and 0.7% for Campylobacter coli. The C. jejuni isolates were genotyped by multi locus sequence typing (MLST) and flaB typing. Resistance to macrolides and quinolones was genetically determined in parallel. Within the 134 genotyped C. jejuni isolates 57 different sequence types (ST) were found. Five STs were previously unrecognized. The most common STs were ST-48 (11.2%), ST-45 (10.5%) and ST-21 (6.0%). Whereas no macrolide resistance was found, 28 isolates (20.9%) were resistant to quinolones. ST-45 was significantly more prevalent in diarrheic than in non-diarrheic dogs. Within the common time frame of isolation 94% of the canine isolates had a ST that was also found in human clinical isolates. In conclusion, prevalence of C. jejuni in Swiss dogs is low but there is a large genetic overlap between dog and human isolates. Given the close contact between human and dogs, the latter should not be ignored as a potential source of human campylobacteriosis. PMID:24210812

  6. Changes of Haematobiochemical Parameters during Canine Parvoviral Enteritis

    Directory of Open Access Journals (Sweden)



    Full Text Available Canine parvovirus is a highly contagious virus that can affect all dogs, but unvaccinated dogs and puppies younger than four months old are the most at risk. The pathology caused by CPV-2 is very common in Albania despite the existence of an effective vaccine.Changes in haematobiochemical parameters during canine parvoviral enteritiswould be very important for determining the prognosis of the disease. This hypothesis prompted the start of the study. From fecal samples taken from puppies 65 individuals resulted positive. Of all individuals 14 of them (21.5% failed to survive. All puppies presented leukopenia. In individuals that survived the WBC count began to grow in the first 24- 48 hours (p <0.05. In non-survivors the WBC was never higher than 2.1x109 / l at the time of admission in the clinic and in the first 24-48 hours began to decline further (p <0.05. There weren’t significant change in RBC count (p <0.05. In the first 12-24 hours 54% of individuals who did not survive had a PLT count less than 362.28x109 / l compared to only 8% of individuals who survived. Urea and creatinine were higher in survivors compared to nonsurvivors (p <0.05.These parameters reached normal levels after the start of the treatment in individuals that survived. Urea and creatinine levels in non-survivors continued to decrease until they died. The changes observed in leukocyte, platelet, urea and serum creatinine levels duringfirst stages of canine parvoviral enteritiscan be used to determine prognosis.

  7. Structure of the immediate early gene of canine herpesvirus. (United States)

    Miyoshi, M; Takiguchi, M; Yasuda, J; Hashimoto, A; Takada, A; Okazaki, K; Kida, H


    The nucleotide sequence of the immediate early (IE) gene of canine herpesvirus was determined. This gene was located in the inverted repeat regions, encoding a polypeptide of 1,383 amino acids. The predicted amino acid sequence was most closely related to that of the feline herpesvirus 1 IE protein among those of other alphaherpesviruses. DNA binding and transcriptional activation domains were found in the IE protein. A spliced region of the IE gene transcript was determined in its 5' non-coding region. PMID:10470264

  8. Retrospective study of canine epithelial and melanocytic tumors


    Aleksić-Kovačević Sanja; Kukolj V.; Marinković D.; Knežević Milijana A.


    Out of the total number of canine tumors examined at the Department of pathology based on biopsy and section materials over the last five years skin tumors and mammary gland tumors were proved to be the two largest groups diagnosed in 33.4% and 36% of cases, respectively. Cutaneous tumors were diagnosed in 211 cases, i.e., in 123 (58.3%) male dogs and 88 (41.7%) bitches, of different breeds, on average 7 years old. Among the total number of 211 skin tumors, 32 types of cutaneous neoplasms wer...

  9. Effects of x radiation on the canine heart

    International Nuclear Information System (INIS)

    Ten dogs received a single exposure of 10 MeV x rays to the heart. Five dogs received 1500 rad to the midline and five received 1000 rad. When the dogs expired or were killed 73 to 85 days after irradiation, their hearts were examined pathologicaly. The changes most frequently observed were pericardial effusion in the right atrium, myocardial necrosis, and fibrosis. The data suggest that under the conditions of this experiment, irradiation of the canine heart causes greatest damage to the right atrium

  10. Canine tooth in hand – A rare entity


    Ranganatha, B.T.; Pawan Kumar, K.M.


    The hand plays an important role in day to day activities and is more prone for accidental injuries. Injuries to the hand are frequently associated with foreign body penetration. Many a times the foreign body is not detected at the initial visit and can later present with other complications. We present a case of canine tooth presenting as a retained foreign body in the hand following a dog bite. The article stresses the importance of looking for foreign bodies in penetrating hand injuries, e...

  11. Establishment of a Rescue System for Canine Distemper Virus


    Gassen, Uta; Collins, Fergal M.; Duprex, W. Paul; Rima, Bert K.


    Canine distemper virus (CDV) has been rescued from a full-length cDNA clone. Besides Measles virus (MV) and Rinderpest virus, a third morbillivirus is now available for genetic analysis using reverse genetics. A plasmid p(+)CDV was constructed by sequential cloning using the Onderstepoort vaccine strain large-plaque-forming variant. The presence of a T7 promoter allowed transcription of full-length antigenomic RNA by a T7 RNA polymerase, which was provided by a host range mutant of vaccinia v...

  12. Radiation-induced DNA damage in canine hemopoietic cells and stromal cells as measured by the comet assay

    International Nuclear Information System (INIS)

    Stromal cell progenitors (fibroblastoid colony-forming unit; CFU-Fs) are representative of the progenitor cell population of the hemopoietic microenvironment in bone marrow (BM). Previous studies of the radiation dose-effect relationships for colony formation have shown that canine CFU-Fs are relatively radioresistant as characterized by a D0 value of about 2.4 Gy. In contrast, hemopoietic progenitors are particularly radiosensitive (D0 values = 0.12-0.60 Gy). In the present study, the alkaline single-cell gel electrophoresis technique for the in situ quantitation of DNA strand breaks and alkalilabile site was employed. Canine buffy coat cells from BM aspirates and cells harvested from CFU-F colonies or from mixed populations of adherent BM stromal cell (SC) layers were exposed to increasing doses of X-rays, embedded in agarose gel on slides, lysed with detergents, and placed in an electric field. DNA migrating from single cells in the gel was made visible as open-quotes cometsclose quotes by ethidium bromide staining. Immediate DNA damage was much less in cultured stromal cells than in hemopoietic cells in BM aspirates. These results suggest that the observed differences in clonogenic survival could be partly due to differences in the type of the initial DNA damage between stromal cells and hemopoietic cells. 37 refs., 2 figs., 1 tab

  13. Interleukin-10 inhibits lipopolysaccharide-induced upregulation of tissue factor in canine peripheral blood monocytes. (United States)

    Ogasawara, Seigo; Stokol, Tracy


    The potentially fatal hemostatic disorder of disseminated intravascular coagulation (DIC) is initiated in bacterial sepsis by lipopolysaccharide (LPS)-induced tissue factor (TF) expression on monocytes. Interleukin-10 (IL-10) is a potent inhibitory cytokine that downregulates monocyte inflammatory and procoagulant responses. We hypothesized that canine recombinant IL-10 (rIL-10) would inhibit LPS-induced TF upregulation on canine monocytes in a dose-dependent manner. Canine peripheral blood mononuclear cells (PBMC), obtained by double-density gradient centrifugation, and monocytes, purified from PBMC by immunomagnetic bead separation with an anti-canine CD14 antibody (Ab), were stimulated in suspension with LPS (0.1-1000 ng/mL) for various times. Recombinant IL-10 (10-5000 pg/mL) was added with LPS or up to 2h later. Tissue factor procoagulant activity was measured by cleavage of a chromogenic substrate by activated Factor X generated by the TF-factor VII complex. We found that rIL-10, when given concurrently or 1h after LPS, strongly inhibited LPS-induced TF procoagulant activity in canine PBMC and monocytes. This inhibition was dose-dependent and blocked by an anti-canine IL-10 Ab. Our results indicate that rIL-10 effectively inhibits LPS-induced TF upregulation in canine monocytes and could potentially be useful in limiting the development of DIC in dogs with endotoxemia. PMID:22609246

  14. Comparative stimulation of motilin duodenal receptor by porcine or canine motilin. (United States)

    Poitras, P; Lahaie, R G; St-Pierre, S; Trudel, L


    Motilins purified from porcine and canine intestine differ in their amino acid composition in positions 7-8-12-13-14. We studied in vitro the contractile response of longitudinal duodenal muscles from various animals (guinea pig, rabbit, dog) to porcine and canine synthetic motilins. Both substances failed to elicit contraction of the guinea pig duodenum but were active and equally potent on rabbit muscle. In dogs, porcine motilin was inactive at the concentrations tested (up to 10(-4) M) whereas canine motilin induced duodenal contractions in a dose-response fashion (mean dose required to induce half-maximal response: 4.82 +/- 0.25 X 10(-5) M). The contraction generated by synthetic canine motilin (10(-5) M) was not influenced by atropine, hexamethonium, tetrodotoxin, naloxone, or sodium nitroprusside (all used at 10(-4) M) but was blocked by verapamil (10(-4)). Our study shows that species-related structural alterations in motilin molecules generate different bioactive capacities in some animal species, suggests that the middle portion of the molecule is important for its bioactive expression, suggests the presence of motilin receptors on canine duodenal muscle, and suggests that an influx of extracellular calcium is involved in the canine duodenal muscle contraction elicited by canine motilin. PMID:3817389

  15. Novel canine bocavirus strain associated with severe enteritis in a dog litter. (United States)

    Bodewes, Rogier; Lapp, Stefanie; Hahn, Kerstin; Habierski, André; Förster, Christine; König, Matthias; Wohlsein, Peter; Osterhaus, Albert D M E; Baumgärtner, Wolfgang


    Bocaviruses are small non-enveloped viruses with a linear ssDNA genome, that belong to the genus Bocaparvovirus of the subfamiliy Parvovirinae. Bocavirus infections are associated with a wide spectrum of disease in humans and various mammalian species. Here we describe a fatal enteritis associated with infection with a novel strain of canine bocavirus 2 (CaBoV-2), that occurred in a litter of German wirehaired pointers. Necropsy performed on three puppies revealed an enteritis reminiscent of canine parvovirus associated enteritis, accompanied with signs of lymphocytolytic disease in bone marrow, spleen, lymph nodes and thymus. While other major causes of enteritis of young dogs, including canine parvovirus, were excluded, by random PCR in combination with next-generation sequencing, a novel CaBoV-2 strain was detected. Phylogenetic analysis of the genome of this novel canine bocavirus strain indicated that this virus was indeed most closely related to group 2 canine bocaviruses. Infection with canine bocavirus was confirmed by in situ hybridization, which revealed the presence of CaBoV-2 nucleic acid in the intestinal tract and lymphoid tissues of the dogs. In a small-scale retrospective analysis concerning the role of CaBoV-2 no additional cases were identified. The findings of this study provide novel insights into the pathogenicity of canine bocaviruses. PMID:25263495

  16. Comparison of canine retraction using single and Siamese edgewise brackets: An in vivo study

    Directory of Open Access Journals (Sweden)

    Zeeshan Iqbal Bhat


    Full Text Available Objectives: The purpose of this study was to check the rate of canine retraction with bodily mechanics using two different pre-adjusted edgewise bracket Systems. Materials and Methods: A split mouth study with twenty patients who were randomly selected and allotted to a single operator. Duration of canine retraction, angulation of canine during its retraction, degree of Rotation, anchorage Loss, distance between canine and premolar at different time intervals were then evaluated, pre- (To, 3 months- (T1 and canine tip touches the second premolar- (T2. Descriptive statistics including mean values and standard deviations were calculated. Paired and unpaired t-test was performed to evaluate the differences between the groups. Results: Rotation and angulation of the canines did not show significant difference in both the systems. There was statistically significant difference (P<0.01 in anchorage loss between single wing and Siamese bracket being 2.65 ±1.41 mm and 1.31 ± 0.93 respectively. There was statistically significant intergroup difference (P<0.01 in canine movement i.e distance between canine and premolar was recorded as 4.72mm (15.06 ± 1.69 to 10.34 ± 1.68mm in single wing bracket and 6.25mm in Siamese (15.52 ± 1.41 to 9.27 ± 1.94. Conclusion: In cases where high anchorage is required and the rate of canine retraction is a concern, Siamese brackets pose a definite advantage over Single wing brackets.

  17. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    International Nuclear Information System (INIS)

    Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs

  18. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    Directory of Open Access Journals (Sweden)

    Kiupel Matti


    Full Text Available Abstract Background Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. Methods In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. Results No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. Conclusion In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs.

  19. The relationship between the Southern Oscillation Index, rainfall and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. (United States)

    Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P


    The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. PMID:25841899

  20. Environmental tobacco smoke and canine urinary cotinine level

    International Nuclear Information System (INIS)

    Epidemiologic studies of companion animals such as dogs have been established as models for the relationship between exposure to environmental tobacco smoke (ETS) and cancer risk in humans. While results from these studies are provocative, pet owner report of a dog's ETS exposure has not yet been validated. We have evaluated the relationship between dog owner's report of household smoking by questionnaire and dog's urinary cotinine level. Between January and October 2005, dog owners presenting their pet for non-emergency veterinary care at the Foster Hospital for Small Animals at Cummings School of Veterinary Medicine, Tufts University, were asked to complete a 10-page questionnaire measuring exposure to household ETS in the previous 24 h and other factors. A free-catch urine sample was also collected from dogs. Urinary cotinine level was assayed for 63 dogs, including 30 whose owners reported household smoking and 33 unexposed dogs matched on age and month of enrollment. Urinary cotinine level was significantly higher in dogs exposed to household smoking in the 24 h before urine collection compared to unexposed dogs (14.6 ng/ml vs. 7.4 ng/ml; P=0.02). After adjustment for other factors, cotinine level increased linearly with number of cigarettes smoked by all household members (P=0.004). Other canine characteristics including age, body composition and nose length were also associated with cotinine level. Findings from our study suggest that household smoking levels as assessed by questionnaire are significantly associated with canine cotinine levels

  1. Isolation and phylogenetic characterization of Canine distemper virus from India. (United States)

    Swati; Deka, Dipak; Uppal, Sanjeev Kumar; Verma, Ramneek


    Canine distemper (CD), caused by canine distemper virus (CDV) is a highly contagious disease that infects a variety of carnivores. Sequence analysis of CDVs from different geographical areas has shown a lot of variation in the genome of the virus especially in haemagglutinin gene which might be one of the causes of vaccine failure. In this study, we isolated the virus (place: Ludhiana, Punjab; year: 2014) and further cloned, sequenced and analyzed partial haemagglutinin (H) gene and full length genes for fusion protein (F), phosphoprotein (P) and matrix protein (M) from an Indian wild-type CDV. Higher sequence homology was observed with the strains from Switzerland, Hungary, Germany; and lower with the vaccine strains like Ondersteport, CDV3, Convac for all the genes. The multiple sequence alignment showed more variation in partial H (45 nucleotide and 5 amino acid substitutions) and complete F (79 nucleotide and 30 amino acid substitutions) than in complete P (44 nucleotide and 22 amino acid substitutions) and complete M (22 nucleotide and 4 amino acid substitutions) gene/protein. Predicted potential N-linked glycosylation sites in H, F, M and P proteins were similar to the previously known wild-type CDVs but different from the vaccine strains. The Indian CDV formed a distinct clade in the phylogenetic tree clearly separated from the previously known wild-type and vaccine strains. PMID:26396979

  2. Duchenne muscular dystrophy gene therapy in the canine model. (United States)

    Duan, Dongsheng


    Duchenne muscular dystrophy (DMD) is an X-linked lethal muscle disease caused by dystrophin deficiency. Gene therapy has significantly improved the outcome of dystrophin-deficient mice. Yet, clinical translation has not resulted in the expected benefits in human patients. This translational gap is largely because of the insufficient modeling of DMD in mice. Specifically, mice lacking dystrophin show minimum dystrophic symptoms, and they do not respond to the gene therapy vector in the same way as human patients do. Further, the size of a mouse is hundredfolds smaller than a boy, making it impossible to scale-up gene therapy in a mouse model. None of these limitations exist in the canine DMD (cDMD) model. For this reason, cDMD dogs have been considered a highly valuable platform to test experimental DMD gene therapy. Over the last three decades, a variety of gene therapy approaches have been evaluated in cDMD dogs using a number of nonviral and viral vectors. These studies have provided critical insight for the development of an effective gene therapy protocol in human patients. This review discusses the history, current status, and future directions of the DMD gene therapy in the canine model. PMID:25710459

  3. Differential genetic regulation of canine hip dysplasia and osteoarthritis.

    Directory of Open Access Journals (Sweden)

    Zhengkui Zhou

    Full Text Available BACKGROUND: Canine hip dysplasia (HD is a common polygenic trait characterized by hip malformation that results in osteoarthritis (OA. The condition in dogs is very similar to developmental dysplasia of the human hip which also leads to OA. METHODOLOGY/PRINCIPAL FINDINGS: A total of 721 dogs, including both an association and linkage population, were genotyped. The association population included 8 pure breeds (Labrador retriever, Greyhounds, German Shepherd, Newfoundland, Golden retriever, Rottweiler, Border Collie and Bernese Mountain Dog. The linkage population included Labrador retrievers, Greyhounds, and their crosses. Of these, 366 dogs were genotyped at ∼22,000 single nucleotide polymorphism (SNP loci and a targeted screen across 8 chromosomes with ∼3,300 SNPs was performed on 551 dogs (196 dogs were common to both sets. A mixed linear model approach was used to perform an association study on this combined association and linkage population. The study identified 4 susceptibility SNPs associated with HD and 2 SNPs associated with hip OA. CONCLUSION/SIGNIFICANCE: The identified SNPs included those near known genes (PTPRD, PARD3B, and COL15A1 reported to be associated with, or expressed in, OA in humans. This suggested that the canine model could provide a unique opportunity to identify genes underlying natural HD and hip OA, which are common and debilitating conditions in both dogs and humans.

  4. Canine gastrointestinal physiology: Breeds variations that can influence drug absorption. (United States)

    Oswald, Hayley; Sharkey, Michele; Pade, Devendra; Martinez, Marilyn N


    Although all dogs belong to Canis lupus familiaris, the physiological diversity resulting from selective breeding can lead to wide interbreed variability in drug pharmacokinetics (PK) or in oral drug product performance. It is important to understand this diversity in order to predict the impact of drug product formulation attributes on in vivo dissolution and absorption characteristics across the canine population when the dog represents the targeted patient population. Based upon published information, this review addresses breed differences in gastrointestinal (GI) physiology and discusses the in vivo implications of these differences. In addition to the importance of such information for understanding the variability that may exist in the performance of oral dosage forms in dogs for the purpose of developing canine therapeutics, an appreciation of breed differences in GI physiology can improve our prediction of oral drug formulation performance when we extrapolate bioavailability results from the dog to the humans, and vice versa. In this literature review, we examine reports of breed associated diversity in GI anatomy and morphology, gastric emptying time (GET), oro-cecal transit time (OCTT), small intestinal transit time (SITT), large intestinal transit time (LITT), intestinal permeability, sodium/potassium fecal concentrations, intestinal flora, and fecal moisture content. PMID:26409436

  5. Characterization of a canine homolog of hepatitis C virus. (United States)

    Kapoor, Amit; Simmonds, Peter; Gerold, Gisa; Qaisar, Natasha; Jain, Komal; Henriquez, Jose A; Firth, Cadhla; Hirschberg, David L; Rice, Charles M; Shields, Shelly; Lipkin, W Ian


    An estimated 3% of the world's population is chronically infected with hepatitis C virus (HCV). Although HCV was discovered more than 20 y ago, its origin remains obscure largely because no closely related animal virus homolog has been identified; furthermore, efforts to understand HCV pathogenesis have been hampered by the absence of animal models other than chimpanzees for human disease. Here we report the identification in domestic dogs of a nonprimate hepacivirus. Comparative phylogenetic analysis of the canine hepacivirus (CHV) confirmed it to be the most genetically similar animal virus homolog of HCV. Bayesian Markov chains Monte Carlo and associated time to most recent common ancestor analyses suggest a mean recent divergence time of CHV and HCV clades within the past 500-1,000 y, well after the domestication of canines. The discovery of CHV may provide new insights into the origin and evolution of HCV and a tractable model system with which to probe the pathogenesis, prevention, and treatment of diseases caused by hepacivirus infection. PMID:21610165

  6. Canine aural cholesteatoma: a histological and immunohistochemical study. (United States)

    Banco, Barbara; Grieco, Valeria; Di Giancamillo, Mauro; Greci, Valentina; Travetti, Olga; Martino, Pieranna; Mortellaro, Carlo M; Giudice, Chiara


    Canine aural cholesteatoma is an epidermoid cyst that forms in the middle ear cavity as a rare complication of otitis media but the aetiopathogenesis remains controversial. In the present study, 13 cases of canine aural cholesteatoma were investigated histologically and immunohistochemically and compared with cases of chronic otitis. The immunohistochemical investigation was performed using the following monoclonal antibodies: anti-cytokeratins (CK) 14, 16, 8/18, and 19, and anti-Ki67. The proliferative indexes (PIs) of cholesteatomata and otitis epithelium were calculated as the percentage of Ki67 positive nuclei/total nuclei. Histologically, the cholesteatomata were composed of a hyperplastic, hyperkeratotic epithelium (matrix) resting on a fibrous perimatrix, infiltrated by inflammatory cells and devoid of cutaneous adnexa. Immunohistochemically, the cholesteatoma epithelium was CK14- and CK16-positive, and CK8/18- and CK19-negative. A similar pattern of CK expression was found in otitis externa. In otitis media, ciliated epithelium stained CK8/18- and CK19-positive in all layers, CK14-positive in the basal layers, and CK16-negative. The mean PIs in cholesteatomata and otitides were 18.8 and 17.8, respectively. The immunohistochemical pattern of CK expression in cholesteatomata, when compared with chronic otitis, was suggestive of hyperproliferative epithelium, but its origin could not be demonstrated. Comparable PI values were obtained in cholesteatoma and in chronic otitis, which confirmed that Ki67 is a valuable indicator of a hyperproliferative state, but not a predictor of aggressiveness. PMID:24775276

  7. Behavioral and psychological characteristics of canine victims of abuse. (United States)

    McMillan, Franklin D; Duffy, Deborah L; Zawistowski, Stephen L; Serpell, James A


    Abuse is an intentional act that causes harm to an individual. Dogs (Canis familiaris) with a known or suspected history of abuse were solicited for the study. A panel of 5 experts in canine behavior and abuse selected the dogs judged as having a certain or near certain history of being abused for inclusion in the study. Behavioral evaluations of the dogs were obtained using the Canine Behavioral Assessment and Research Questionnaire, which utilizes ordinal scales to rate either the intensity or frequency of the dog's behaviors. Sixty-nine dogs ultimately met the criteria for inclusion in the study. When compared with a convenience sample of 5,239 companion dogs, abused dogs were reported as displaying significantly higher rates of aggression and fear directed toward unfamiliar humans and dogs, excitability, hyperactivity, attachment and attention-seeking behaviors, persistent barking, and miscellaneous strange or repetitive behaviors. Delineating the behavioral and psychological characteristics of abused dogs provides the first step in identifying and distinguishing the risk factors and sequelae associated with abuse, which may inform the development of preventive and therapeutic programs for nonhuman animal abuse. PMID:25257564

  8. Epizootic canine distemper virus infection among wild mammals. (United States)

    Kameo, Yuki; Nagao, Yumiko; Nishio, Yohei; Shimoda, Hiroshi; Nakano, Hitoshi; Suzuki, Kazuo; Une, Yumi; Sato, Hiroshi; Shimojima, Masayuki; Maeda, Ken


    In the spring of 2007, seven raccoon dogs and a weasel were captured near the city of Tanabe in Wakayama prefecture, Japan. The causative agent of the animals' death 1-2 days after capture was identified as canine distemper virus (CDV) by virus isolation, immunostaining with an anti-CDV polyclonal antibody, and a commercially available CDV antigen-detection kit. Sequence analysis of hemagglutinin genes indicated the isolated viruses belong to genotype Asia-1 and possess the substitution from tyrosine (Y) to histidine (H) at position 549 that is associated with the spread of CDV to non-canine hosts. A serosurvey for CDV was then conducted among wild animals in the region. The animals assayed consisted of 104 raccoons, 41 wild boars, 19 raccoon dogs, five Sika deer, two badgers, one weasel, one marten, one Siberian weasel and one fox. Virus-neutralization (VN) tests showed that, except for fox and weasel, all of the species assayed had VN antibodies to CDV. Interestingly, 11 of the 41 wild boars (27%) and two of the five Sika deer assayed possessed VN antibodies to CDV. These findings indicate that CDV infection was widespread among wild mammals during this epizootic. PMID:21840141

  9. Experiments on the External Aerodynamics of Canine Olfaction (United States)

    Kester, Douglas A.; Settles, Gary S.


    In our previous work (APS/DFD97, Ii1), flow visualization was used to observe canine olfactory airflows for the first time. We have since observed two general types of such flows: high-frequency ("short") sniffing during close inspection of an object and low-frequency ("long") sniffing of more distant objects. In both cases the inspiratory airflow pattern is essentially an inviscid sink flow. However, a comparison of the two types of olfaction shows that the dog has some directional control over the twin turbulent jets generated from its nostrils during expiration. During close inspection of a scent source from directly above, the canine nostrils direct the expired air rearward, so that it does not impinge upon the object. However, when "scanning" the vicinity of a scent source on the ground, the motion of the dog's nose can aim its expiratory jets directly at the source. If particulates are present, they are then readily entrained and can be subsequently inspired. No significant distinction was observed between pet animals and a trained explosive detection dog regarding this behavior. High-speed video records of these experiments will be shown. (Research supported by DARPA.)

  10. Potential of regenerative medicine techniques in canine hepatology. (United States)

    Schotanus, Baukje A; Penning, Louis C; Spee, Bart


    Liver cell turnover is very slow, especially compared to intestines and stomach epithelium and hair cells. Since the liver is the main detoxifying organ in the body, it does not come as a surprise that the liver has an unmatched regenerative capacity. After 70% partial hepatectomy, the liver size returns to normal in about two weeks due to replication of differentiated hepatocytes and cholangiocytes. Despite this, liver diseases are regularly encountered in the veterinary clinic. Dogs primarily present with parenchymal pathologies such as hepatitis. The estimated frequency of canine hepatitis depends on the investigated population and accounts for 1%-2% of our university clinic referral population, and up to 12% in a general population. In chronic and severe acute liver disease, the regenerative and replicative capacity of the hepatocytes and/or cholangiocytes falls short and the liver is not restored. In this situation, proliferation of hepatic stem cells or hepatic progenitor cells (HPCs), on histology called the ductular reaction, comes into play to replace the damaged hepatocytes or cholangiocytes. For unknown reasons the ductular reaction is often too little and too late, or differentiation into fully differentiated hepatocytes or cholangiocytes is hampered. In this way, HPCs fail to fully regenerate the liver. The presence and potential of HPCs does, however, provide great prospectives for their use in regenerative strategies. This review highlights the regulation of, and the interaction between, HPCs and other liver cell types and discusses potential regenerative medicine-oriented strategies in canine hepatitis, making use of (liver) stem cells. PMID:24422896

  11. Evaluation of SPECT quantification of radiopharmaceutical distribution in canine myocardium

    International Nuclear Information System (INIS)

    This study evaluates the quantitative accuracy of SPECT for in vivo distributions of 99mTc radiopharmaceuticals using fanbeam (FB) and parallel-beam (PB) collimators and compares uniform and nouniform attenuation correction methods in terms of quantitative accuracy. SPECT quantification of canine myocardial radioactivity was performed followed by well counter measurements of extracted myocardial tissue samples. Transmission scans using a line source and an FB collimator were performed to generate nonuniform attenuation maps of the canine thorax. Emission scans with two energy windows were acquired. Images were reconstructed using a filtered backprojection algorithm, with a dual-window scatter subtraction combined with either no attenuation compensation or single iteration Chang attenuation compensation based on a uniform attenuation map μ=0.152 cm-1 or the nonuniform transmission map. The measured mean counts from the SPECT images were converted using the well counter. The experimental results demonstrate that, compared with well counter values, the in vivo distributions of 99mTc were most accurately determined in FB and PB SPECT reconstructions with nonuniform attenuation compensation, under-estimated without attenuation compensation and overestimated with uniform attenuation compensation. 37 refs., 9 figs., 10 tabs

  12. Experimental chemonucleolysis with chymopapain in canine intervertebral disks

    International Nuclear Information System (INIS)

    The present study describes the radiological and histological changes in the canine intervertebral disk after the experimental injection of chymopapain as the chemical reagent, and determines the appropriate dose of the enzyme for treatment of herniated disks. By radiography, narrowing of the disk space was observed within 2 weeks after the injection of chymopapain, and recovered to 74.1% in the 0.1 mg group, 61.1% in the 1.0 mg group and 71.7% in the 10.0 mg group at 12 weeks. The disk space recovery showed a tendency to delay with aging. Microscopically, proteoglycan positive matrix appeared and the nuclear space was reduced in each disk at 2 weeks after chymopapain injection. The nucleus pulposus contained an irregularly-defined mass consisting of clusters of degenerated notochordal cells surrounded by proliferated chondrocytes and collagen matrix. In each disk at 12 weeks after chymopapain injection, the center of the nucleus pulposus was replaced by fibrocartilage tissue. In the disk into which 10.0 mg chymopapain was injected, the nuclear space filled with dense fibrocartilage tissue without a regenerated matrix component and narrowing of the disk were maintained. It is suggested that canine chemonucleolysis with 10.0 mg of chymopapain reduces the interdiskal pressure. This treatment may therefore relieve the signs and symptoms of herniation of the nucleus pulposus, and may effect chemical disk decompression

  13. Receptors for tachykinins in canine intestine circular muscle

    International Nuclear Information System (INIS)

    125I-Tyr8-substance P binding was examined in a plasma membrane enriched fraction from the circular muscle of canine small intestine. The binding was quick in onset, reversible and saturable to a single high affinity binding site; KD and maximum receptor concentration were 0.50 = 0.06 nM and 742 +/- 173 fmol/mg of protein, respectively. KD values from kinetic and saturation studies were in agreement. The rank order of potency of the tachykinins and related compounds in displacing this binding was consistent with that of a neurokinin (NK)-P (NK-1) type binding site. 125I-eledoisin did not bind specifically to these membranes and eledoisin was relatively ineffective in displacing the 125I-Tyr8 substance P. Kassinin was totally ineffective. Based on relative agonist potencies, the tachykinins appeared to contract the circular muscle of canine small intestine in vitro by a mechanism which also could be considered to be a NK-P (NK-1) type receptor. However, a comparison of data obtained by these two techniques suggests that the NK-P (NK-1) type binding site and the receptor(s) responsible for contractile responses are not identical. There were discrepancies in relative orders of potency and in absolute potencies. The simplest explanation is that there is also an NK-A (NK-2) receptor which is functional but not labeled by our ligands. Possible reasons for these discrepancies are discussed

  14. Nonuniform irradiation of the canine intestine. II. Dosimetry

    International Nuclear Information System (INIS)

    An experimental model has been developed for quantitative studies of radiobiological damage to the canine small intestine following partial-body nonuniform irradiation. Animals were irradiated with 60Co gamma rays to simulate the nonuniform irradiation which do occur in victims of radiation accidents. The model used a short source-to-surface distance for unilateral irradiations to produce a dose gradient of a factor of two laterally across the canine intestinal region. The remainder of the animal's body was shielded to prevent lethal damage to the bone marrow. In situ dosimetry measurements were made using thermoluminescent dosimeters to determine the radiation dose delivered as a function of position along a segment of the small intestine. This system made it possible to correlate the radiation dose delivered at a specific point along the small intestine with the macroscopic and microscopic appearance of the intestinal mucosa at that point, as determined by direct observation and biopsy using a fiberoptic endoscope. A key feature of this model is that dosimetry data for multiple sites, which receive a graded range of radiation doses, can be correlated with biological measurements to obtain a dose-response curve. This model is being used to evaluate the efficacy of new therapeutic procedures to improve survival following nonuniform irradiation

  15. Morphological and Immunohistochemical Characterization of Canine Osteosarcoma Spheroid Cell Cultures. (United States)

    Gebhard, C; Gabriel, C; Walter, I


    Spheroid cell culture emerges as powerful in vitro tool for experimental tumour research. In this study, we established a scaffold-free three-dimensional spheroid system built from canine osteosarcoma (OS) cells (D17). Spheroids (7, 14 and 19 days of cultivation) and monolayer cultures (2 and 7 days of cultivation) were evaluated and compared on light and electron microscopy. Monolayer and spheroid cultures were tested for vimentin, cytokeratin, alkaline phosphatase, osteocalcin and collagen I by means of immunohistochemistry. The spheroid cell culture exhibited a distinct network of collagen I in particular after 19-day cultivation, whereas in monolayer cultures, collagen I was arranged as a lamellar basal structure. Necrotic centres of large spheroids, as observed in 14- and 19-day cultures, were characterized by significant amounts of osteocalcin. Proliferative activity as determined by Ki-67 immunoreactivity showed an even distribution in two-dimensional cultures. In spheroids, proliferation was predominating in the peripheral areas. Metastasis-associated markers ezrin and S100A4 were shown to be continuously expressed in monolayer and spheroid cultures. We conclude that the scaffold-free spheroid system from canine OS cells has the ability to mimic the architecture of the in vivo tumour, in particular cell-cell and cell-matrix interactions. PMID:26287450

  16. Early Life Experiences and Exercise Associate with Canine Anxieties.

    Directory of Open Access Journals (Sweden)

    Katriina Tiira

    Full Text Available Personality and anxiety disorders across species are affected by genetic and environmental factors. Shyness-boldness personality continuum exists across species, including the domestic dog, with a large within- and across-breed variation. Domestic dogs are also diagnosed for several anxiety-related behavioral conditions, such as generalized anxiety disorders, phobias, and separation anxiety. Genetic and environmental factors contributing to personality and anxiety are largely unknown. We collected questionnaire data from a Finnish family dog population (N = 3264 in order to study the associating environmental factors for canine fearfulness, noise sensitivity, and separation anxiety. Early life experiences and exercise were found to associate with anxiety prevalence. We found that fearful dogs had less socialization experiences (p = 0.002 and lower quality of maternal care (p < 0.0001 during puppyhood. Surprisingly, the largest environmental factor associating with noise sensitivity (p < 0.0001 and separation anxiety (p = 0.007 was the amount of daily exercise; dogs with noise sensitivity and separation anxiety had less daily exercise. Our findings suggest that dogs share many of the same environmental factors that contribute to anxiety in other species as well, such as humans and rodents. Our study highlights the importance of early life experiences, especially the quality of maternal care and daily exercise for the welfare and management of the dogs, and reveals important confounding factors to be considered in the genetic characterization of canine anxiety.

  17. Altered oxidant-antioxidant profile in canine mammary tumours. (United States)

    Kumaraguruparan, R; Balachandran, C; Manohar, B Murali; Nagini, S


    Mammary tumours are the most common neoplasms in female dogs. Oxidative stress arising due to overproduction of reactive oxygen species, coupled with altered antioxidant capacities has been implicated in the pathogenesis of all types of cancers. However, the extent of lipid peroxidation and the status of antioxidants in canine mammary tumours have not been investigated. The present study was designed to evaluate the oxidant-antioxidant profile in canine mammary tumours. Lipid peroxidation as evidenced by the formation of thiobarbituric acid-reactive substances, lipid hydroperoxides, and conjugated dienes, as well as the status of the antioxidants superoxide dismutase, catalase, reduced glutathione, glutathione peroxidase, glutathione S-transferase and vitamin C, in tumour tissues of 25 bitches was estimated. Lipid peroxidation in tumour tissues was enhanced compared to the corresponding adjacent uninvolved tissues. This was accompanied by significant elevation in both enzymatic and non-enzymatic antioxidants. This study suggests that upregulation of antioxidants induced by lipid peroxidation confers a selective growth advantage to tumour cells over their adjacent normal counterparts. PMID:15751580

  18. Effect of Arctium lappa (burdock) extract on canine dermal fibroblasts. (United States)

    Pomari, Elena; Stefanon, Bruno; Colitti, Monica


    Although the biological activities of Arctium lappa (burdock) have been already investigated in human and other species, data evaluating the molecular mechanisms have not been reported in the dog. In this study we analyzed for the first time the effect of a root extract of burdock on molecular responses in canine dermal fibroblasts with H2O2 stimulation (H group), with burdock treatment (B group) and with H2O2 stimulation and burdock treatment (BH group), using RNAseq technology. Differentially expressed genes (P<0.05) of H, B and BH groups in comparison to the untreated sample (negative control, C group) were identified with MeV software and were functional annotated and monitored for signaling pathways and candidate biomarkers using the Ingenuity Pathways Analysis (IPA). The expression profile of canine dermal fibroblasts treated with burdock extract with or without H2O2 stimulation, showed an up-regulation of mitochondrial superoxide dismutase (SOD2), disheveled 3 (DVL3) and chondroitin sulfate N-acetylgalactosaminyltransferase 2 (CSGALNACT2). The data suggested that burdock has implications in cell adhesion and gene expression with the modulation of Wnt/β catenin signaling and Chondroitin Sulphate Biosynthesis that are particularly important for the wound healing process. PMID:24192279

  19. Minor histocompatibility antigens on canine hemopoietic progenitor cells. (United States)

    Weber, Martin; Lange, Claudia; Günther, Wolfgang; Franz, Monika; Kremmer, Elisabeth; Kolb, Hans-Jochem


    Adoptive immunotherapy with CTL against minor histocompatibility Ags (mHA) provides a promising way to treat leukemia relapse in allogeneic chimeras. Here we describe the in vitro generation of CTL against mHA in the dog. We tested their inhibitory effect on the growth of hemopoietic progenitor cells stimulated by hemopoietic growth factors in a 4-day suspension culture. CTL were produced by coculture of donor PBMC with bone marrow-derived dendritic cells (DCs). These DCs were characterized by morphology, high expression of MHC class II and CD1a, and the absence of the monocyte-specific marker CD14. Characteristically these cells stimulated allogeneic lymphocytes (MLR) and, after pulsing with a foreign Ag (keyhole limpet hemocyanin), autologous T cells. CTL were generated either ex vivo by coculture with DCs of DLA-identical littermates or in vivo by immunization of the responder with DCs obtained from a DLA-identical littermate. In suspension culture assays the growth of hemopoietic progenitor cells was inhibited in 53% of DLA-identical littermate combinations. In canine families mHA segregated with DLA as restriction elements. One-way reactivity against mHA was found in five littermate combinations. In two cases mHA might be Y chromosome associated, in three cases autosomally inherited alleles were detected. We conclude that CTL can be produced in vitro and in vivo against mHA on canine hemopoietic progenitor cells using bone marrow-derived DCs. PMID:12794111

  20. Transmission dynamics and prospects for the elimination of canine rabies.

    Directory of Open Access Journals (Sweden)

    Katie Hampson


    Full Text Available Rabies has been eliminated from domestic dog populations in Western Europe and North America, but continues to kill many thousands of people throughout Africa and Asia every year. A quantitative understanding of transmission dynamics in domestic dog populations provides critical information to assess whether global elimination of canine rabies is possible. We report extensive observations of individual rabid animals in Tanzania and generate a uniquely detailed analysis of transmission biology, which explains important epidemiological features, including the level of variation in epidemic trajectories. We found that the basic reproductive number for rabies, R0, is very low in our study area in rural Africa (approximately 1.2 and throughout its historic global range (<2. This finding provides strong support for the feasibility of controlling endemic canine rabies by vaccination, even near wildlife areas with large wild carnivore populations. However, we show that rapid turnover of domestic dog populations has been a major obstacle to successful control in developing countries, thus regular pulse vaccinations will be required to maintain population-level immunity between campaigns. Nonetheless our analyses suggest that with sustained, international commitment, global elimination of rabies from domestic dog populations, the most dangerous vector to humans, is a realistic goal.

  1. Canine distemper virus detection by different methods of One-Step RT-qPCR


    Claudia de Camargo Tozato; Vívian Ferreira Zadra; Caroline Rodrigues Basso; João Pessoa Araújo Junior


    ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR) assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A) and a One-Step RT-qPCR combined with NESTED-qPCR (system B). Limits of detection for both systems were determined using a serial dilution of Canine Distemper...

  2. Canine faecal contamination and parasitic risk in the city of Naples (southern Italy

    Directory of Open Access Journals (Sweden)

    Veneziano Vincenzo


    Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between

  3. Genetic characterization of canine distemper virus involved in outbreaks in farmed mink in Denmark 2012

    DEFF Research Database (Denmark)

    Trebbien, Ramona; Struve, T.; Hjulsager, Charlotte Kristiane;

    Danish farmed mink herds experienced a large outbreak of canine distemper virus in 2012. Full-length sequence analysis (1824 nucleotides) of the variable hemagglutinin (H) gene were performed on 27 viruses collected from mink and on 7 viruses collected from wild foxes. Results of the study showed...... phylogenetically with other European canine distemper viruses and showed the highest level of similarity (99.3 - 99.6 %) to viruses isolated from wild foxes in Germany. The fox should therefore be considered as an important wild life reservoir of canine distemper virus and may also contribute to the transmission...

  4. Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro

    Directory of Open Access Journals (Sweden)

    Cintia Xavier de Mello


    Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.

  5. Compartmentalization of prostaglandins in the canine kidney

    International Nuclear Information System (INIS)

    The kidney has been shown to synthesize all of the naturally occurring major prostaglandins which may be restricted to a discrete part of the kidney where their actions are physiologically important, such as the vascular compartment and the tubular compartment. In order to examine this concept of compartmentalization, the authors conducted a series of experiments to determine whether PGl2, measured as 6-keto-pGF/sub 1α/, produced in the kidney is restricted to the renal vascular compartment or whether it also has access to the tubular compartment. Experiments were performed in the pentobarbital-anesthetized dog. Increasing pre-glomerular levels of 6-keto-PFG/sub 1α/ caused marked increases in both the urinary excretion and the renal venous outflow to 6-keto-PGF/sub 1α/. When 3H-6-keto-PGF/sub 1α/ was co-infused with inulin into the renal artery, 33% of the radioactivity and 23% of the inulin was recovered on first pass. With infusion of 3H-PGl2 and inulin, 20% of the radioactivity and 28% of the inulin reached the urine on first pass. Radioactive PGl2 appeared to be less filterable at the glomeruli than either 3H-6-keto-PGF/sub 1α/ or inulin. In the final set of experiments, in which dogs were prepared for a ureteral stopped-flow study, the PGE2/U/P/sub In/ ratio a peak was observed proximal to the Na+ plateau but distal to the Na+ nadir. In light of the results from the stopped-flow study and the intrarenal infusion studies, they conclude that PGE2 synthesized in the kidney enters both the renal and tubular compartments. In contrast, they find that 6-keto-PGF/sub 1α/ of renal origin enters only the renal origin enters only the renal vascular compartment and not the tubular compartment

  6. Prevalence of canine monocitic ehrlichiosis and canine thrombocytic anaplasmosis in dogs suspected of hemoparasitosis in Cuiabá Mato Grosso

    Directory of Open Access Journals (Sweden)

    Rute Witter


    Full Text Available The present study evaluated Canine Monocytic Ehrlichiosis and Canine Thrombocytic Anaplasmosis in 77 dogs treated at the Veterinary Hospital (HOVET of the Federal University of Mato Grosso (UFMT in 2009. An association among clinical and hematological, serological and molecular data was investigated. Dogs were evaluated by partial amplification of dsb and 16S rRNA of Ehrlichia canis and Anaplasma platys and by Indirect Fluorescence Antigen Test (IFAT for E. canis. DNA of E. canis and A. platys were detected in 18 (23.3% and 07 (9.1% dogs respectively. Fifty four (70.1% dogs were positive by IFAT with titers ranging from 40 to 327,680. There were higher frequencies of E. canis positive PCR in dogs less than 12 months old, with anemia, lymphopenia and thrombocytopenia (P?0.05. Leukopenic dogs presented tendency to be A. platys PCR positive (P=0.07. Thrombocytopenia and hyperproteinemia of dogs were associated with high anti-E. canis antibody titers (P?0.05. Lymphadenopathy and pulmonary changes were observed in 15 (30.6% and 4 (57.1% E. canis PCR positive dogs (P?0.05. No other clinical features were associated between E. canis and A. platys infected dogs. E. canis was the only specie of Ehrlichia detected in dogs attended at the HOVET with a higher infection rate in young dogs, and statistically associated with anemic and thrombocytopenic dogs. On the other side, A. platys presented low occurrence among evaluated dogs.

  7. Assessment and Comparison of Impacted Maxillary Canine Position in Panoramic Radiography with CBCT

    Directory of Open Access Journals (Sweden)

    F Ezoddiniardakani


    Conclusion: The study findings revealed that the angulation and magnification methods were not reliable in order to assess the impacted maxillary canines in panoramic radiography, though Angulation proved to be more successful than magnification method.

  8. Four cases of cell cannibalism in highly malignant feline and canine tumors. (United States)

    Ferreira, Fernando Costa; Soares, Maria João; Carvalho, Sandra; Borralho, Liliana; Vicente, Gonçalo; Branco, Sandra; Correia, Jorge; Peleteiro, Maria Conceição


    Four cases of tumors in which cell internalization was frequently visualized are reported: one feline mammary carcinoma, one feline cutaneous squamous cell carcinoma, one canine pulmonary squamous cell carcinoma and one canine pleural mesothelioma. Cell internalization was observed by cytology in two of these cases (the feline mammary tumour and the pleural effusion in the canine mesothelioma) and by histopathology in all but the canine mesothelioma. Immunohistochemical staining for pancytokeratin was positive for both internalized and host cells, while E-cadherin expression was frequently absent, although internalized cells occasionally stained positive. This cell-to-cell interaction seems to be associated with tumors displaying a strong epithelial-mesenchymal transitional phenotype, in which cancer cells become engulfed by other cancer cells. Such event could be regarded as an important hallmark of very high malignancy. PMID:26525147

  9. Seroprevalence of CANINE LEISHMANIASIS AND American trypanosomiasis in dogs from Grenada, West Indies (United States)

    Canine leishmaniasis and American trypanosomiasis (AT) are caused by related hemoflagellated parasites, Leishmania spp. and Trypanosoma cruzi, which share several common host species. Dogs are reservoirs for human infections with both pathogens. We determined the prevalence of antibodies to Leishman...

  10. A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article

    Directory of Open Access Journals (Sweden)

    S. Gur


    Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.

  11. A retrospective investigation of canine adenovirus (CAV) infection in adult dogs in Turkey. (United States)

    Gür, S; Acar, A


    Canine adenovirus (CAV) type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serum samples were collected from native pure-bred Kangal(n = 11), and Akbash dogs (n = 17) and Turkish Greyhounds (n = 15) in Eskişehir and Konya provinces. None of the dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2%, 93.3% and 100% prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51) were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3%) were detected as seropositive. In total, 82 of 94 dogs (87.2%) were found to be positive for CAV serum antibodies. PMID:19831268


    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha


    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  13. Diagnostic imaging of the male canine reproductive organs: methods and limitations

    International Nuclear Information System (INIS)

    Survey radiographic, contrast radiographic, and ultrasonographic techniques for evaluation of the male canine reproductive organs are reviewed. The applications and limitations of these technique as they apply to reproductive diseases involving the prostate gland and testicles are illustrated

  14. Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012-2013

    DEFF Research Database (Denmark)

    Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted;


    During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit in...... distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine...... distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case...

  15. Epidemiological Survey on Canine Parvovirus Disease in Taizhou Region,Jiangsu Province,China

    Institute of Scientific and Technical Information of China (English)

    Yuan; Weifeng; Liu; Jing; Zhao; Xuegang; Lu; Jiang; Zheng; Xiaoliang; Zhu; Hongfei


    The canine parvovirus disease is an acute infectious disease caused by canine parvovirus(CPV). It is clinically characterized by severe vomiting,hemorrhagic enteritis,significant reduction in white blood cells and myocarditis. The disease with high incidence,highly infectious and high mortality has become one of the serious infectious diseases threatening dog raising industry in China. In this research,260 cases of canine parvovirus case from an Aite Pet Clinic in Taizhou City during January 2010 and March 2011 were analyzed. This study discloses the epidemiology of CPV in Taizhou region of Jiangsu Province,i. e.,the incidence of CPV and canine motility are closely correlated with age,breed,immune inoculation and season. This study provides useful guide for the clinical treatment of CPV in the future.

  16. Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease

    Directory of Open Access Journals (Sweden)

    Andrew Specht


    Full Text Available A canine model of Glycogen storage disease type Ia (GSDIa is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size, and longer lifespan compared to other animal models. Use of this model in preclinical trials of gene therapy is described and briefly compared to the murine model. Although the canine model offers a number of advantages for evaluating potential therapies for GSDIa, there are also some significant challenges involved in its use. Despite these challenges, the canine model of GSDIa should continue to provide valuable information about the potential for generating curative therapies for GSDIa as well as other genetic hepatic diseases.

  17. The potential of canine sentinels for reemerging Trypanosoma cruzi transmission (United States)

    Neyra, Ricardo Castillo; Chu, Lily Chou; Quispe-Machaca, Victor; Ancca-Juarez, Jenny; Malaga Chavez, Fernando S.; Mazuelos, Milagros Bastos; Naquira, Cesar; Bern, Caryn; Gilman, Robert H.; Levy, Michael Z.


    Background Chagas disease, a vector-borne disease transmitted by triatomine bugs and caused by the parasite Trypanosoma cruzi, affects millions of people in the Americas. In Arequipa, Peru, indoor residual insecticide spraying campaigns are routinely conducted to eliminate Triatoma infestans, the only vector in this area. Following insecticide spraying, there is risk of vector return and reinitiation of parasite transmission. Dogs are important reservoirs of T. cruzi and may play a role in reinitiating transmission in previously sprayed areas. Dogs may also serve as indicators of reemerging transmission. Methods We conducted a cross-sectional serological screening to detect T. cruzi antibodies in dogs, in conjunction with an entomological vector collection survey at the household level, in a disease endemic area that had been treated with insecticide 13 years prior. Spatial clustering of infected animals and vectors was assessed using Ripley’s K statistic, and the odds of being seropositive for dogs proximate to infected colonies was estimated with multivariate logistic regression. Results There were 106 triatomine-infested houses (41.1%), and 45 houses infested with T. cruzi-infected triatomine insects (17.4%). Canine seroprevalence in the area was 12.3% (n=154); all seropositive dogs were 9 months old or older. We observed clustering of vectors carrying the parasite, but no clustering of seropositive dogs. The age- and sex-adjusted odds ratio between seropositivity to T. cruzi and proximity to an infected triatomine (≤50m) was 5.67 (95% CI: 1.12 – 28.74; p=0.036). Conclusions Targeted control of reemerging transmission can be achieved by improved understanding of T. cruzi in canine populations. Our results suggest that dogs may be useful sentinels to detect re-initiation of transmission following insecticide treatment. Integration of canine T. cruzi blood sampling into existing interventions for zoonotic disease control (e.g. rabies vaccination programs

  18. Heat shock protein expression in canine malignant mammary tumours

    International Nuclear Information System (INIS)

    Abnormal levels of Heat Shock Proteins (HSPs) have been observed in many human neoplasms including breast cancer and it has been demonstrated that they have both prognostic and therapeutic implications. In this study, we evaluated immunohistochemical expression of HSPs in normal and neoplastic canine mammary glands and confronted these results with overall survival (OS), in order to understand the role of HSPs in carcinogenesis and to establish their potential prognostic and/or therapeutic value. Immunohistochemical expression of Hsp27, Hsp72, Hsp73 and Hsp90 was evaluated in 3 normal canine mammary glands and 30 malignant mammary tumours (10 in situ carcinomas, 10 invasive carcinomas limited to local structures without identifiable invasion of blood or lymphatic vessels, 10 carcinomas with invasion of blood or lymphatic vessels and/or metastases to regional lymph nodes). A semi-quantitative method was used for the analysis of the results. Widespread constitutive expression of Hsp73 and Hsp90 was detected in normal tissue, Hsp72 appeared to be focally distributed and Hsp27 showed a negative to rare weak immunostaining. In mammary tumours, a significant increase in Hsp27 (P < 0.01), Hsp72 (P < 0.05) and Hsp90 (P < 0.01) expression was observed as well as a significant reduction in Hsp73 (P < 0.01) immunoreactivity compared to normal mammary gland tissue. Hsp27 demonstrated a strong positivity in infiltrating tumour cells and metaplastic squamous elements of invasive groups. High Hsp27 expression also appeared to be significantly correlated to a shorter OS (P = 0.00087). Intense immunolabelling of Hsp72 and Hsp73 was frequently detected in infiltrative or inflammatory tumour areas. Hsp90 expression was high in all tumours and, like Hsp73, it also showed an intense positivity in lymphatic emboli. These results suggest that Hsp27, Hsp72 and Hsp90 are involved in canine mammary gland carcinogenesis. In addition, Hsp27 appears to be implicated in tumour invasiveness and

  19. Co-Circulation of Canine Coronavirus I and IIa/b with High Prevalence and Genetic Diversity in Heilongjiang Province, Northeast China


    Chunqiu Li; Donghua Guo; Xinyu Wang; Shan Wei; Yufei Geng; Enyu Wang; Zhihui Wang; Xiwen Zhao; Mingjun Su; Qiujin Liu; Siyao Zhang; Li Feng; Dongbo Sun


    To trace the evolution of canine coronavirus (CCoV), 201 stool samples from diarrheic dogs in northeast China were subjected to reverse transcription-polymerase chain reactions (RT-PCRs) targeting the partial M and S genes of CCoV, followed by an epidemiological analysis. M gene RT-PCRs showed that 28.36% (57/201) of the samples were positive for CCoV; of the 57 positive samples, CCoV-I and CCoV-II accounted for 15.79% (9/57) and 84.21% (48/57), respectively. A sequence comparison of the part...

  20. Establishment of a Canine Rabies Burden in Haiti through the Implementation of a Novel Surveillance Program


    Wallace, Ryan M.; Reses, Hannah; Franka, Richard; Dilius, Pierre; Fenelon, Natael; Orciari, Lillian; Etheart, Melissa; Destine, Apollon; Crowdis, Kelly; Blanton, Jesse D; Francisco, Calvin; Ludder, Fleurinord; Del Rio Vilas, Victor; Haim, Joseph; Millien, Max


    The Republic of Haiti is one of only several countries in the Western Hemisphere in which canine rabies is still endemic. Estimation methods have predicted that 130 human deaths occur per year, yet existing surveillance mechanisms have detected few of these rabies cases. Likewise, canine rabies surveillance capacity has had only limited capacity, detecting only two rabid dogs per year, on average. In 2013, Haiti initiated a community-based animal rabies surveillance program comprised of two c...

  1. Serosurvey for canine distemper virus exposure in dogs in communal lands in Zimbabwe


    Kelly, P. J.; G. Musuka; G. Nic Eoghin; J.B.U. Tebje-Kelly; Carter, S.


    Sera from 173 apparently healthy, unvaccinated dogs from 4 widely separated communal lands in Zimbabwe were tested by ELISA for antibodies against canine distemper virus. Overall, 82 % were positive with high prevalences found in each communal land. The highest seroprevalence was in dogs between 1 and 2 years of age (91 %; 49/54). These results show dogs in the communal lands of Zimbabwe are commonly exposed to canine distemper virus and that a substantial number survive infection. The role t...

  2. Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012–2013


    Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted; Andresen, Lars; Chriél, Mariann; Hagberg, Emma; Jensen, Mette Kragh; Hansen, Mette Sif; Hjulsager, Charlotte Kristiane; Struve, Tina


    Background During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit in biosecurity on the mink farms. The aim of this study was to investigate the extent and association of specific biosecurity measures with the outbreak. The study was carried out in an epidemiologic...

  3. Canine Distemper Viral Inclusions in Blood Cells of Four Vaccinated Dogs


    McLaughlin, Bruce G.; Adams, Pamela S.; Cornell, William D.; Elkins, A. Darrel


    Four cases of canine distemper were detected by the presence of numerous cytoplasmic inclusions in various circulating blood cells. Fluorescent antibody techniques and electron microscopy confirmed the identity of the viral inclusions. The cases occurred in the same geographic area and within a short time span. All four dogs had been vaccinated against canine distemper, but stress or other factors may have compromised their immune status. The possibility of an unusually virulent virus strain ...

  4. Canine distemper virus infection in a lesser grison (Galictis cuja): first report and virus phylogeny


    Jane Megid; Teixeira, Carlos R; Adriana Cortez; Heinemann, Marcos B; Antunes, João M.A.P.; Felipe Fornazari; Fabricio B. Rassy; Richtzenhain, Leonardo J


    Infectious diseases in wild animals have been increasing as a result of their habitat alterations and closer contact with domestic animals. Canine distemper virus (CDV) has been reported in several species of wild carnivores, presenting a threat to wildlife conservation. We described the first case of canine distemper virus infection in lesser grison (Galictis cuja). A free-ranging individual, with no visible clinical sigs, presented sudden death after one day in captivity. Molecular diagnosi...

  5. Age and Diet Affect Gene Expression Profile in Canine Skeletal Muscle


    Middelbos, Ingmar S.; Brittany M Vester; Lisa K Karr-Lilienthal; Schook, Lawrence B; Swanson, Kelly S.


    We evaluated gene transcription in canine skeletal muscle (biceps femoris) using microarray analysis to identify effects of age and diet on gene expression. Twelve female beagles were used (six 1-year olds and six 12-year olds) and they were fed one of two experimental diets for 12 months. One diet contained primarily plant-based protein sources (PPB), whereas the second diet contained primarily animal-based protein sources (APB). Affymetrix GeneChip Canine Genome Arrays were used to hybridiz...

  6. Spontaneous remission in canine myasthenia gravis: implications for assessing human MG therapies. (United States)

    Shelton, G D; Lindstrom, J M


    The natural course of autoimmune canine MG was determined in 53 dogs with muscular weakness and a positive acetylcholine receptor antibody titer. Dogs were treated with anticholinesterase therapy, without immunosuppression. Spontaneous clinical and immunologic remission occurred in 47 of 53 dogs within an average of 6.4 months. Neoplasia was identified in the six dogs that did not spontaneously remit. This study questions the value of using canine MG in studies designed to assess the effect of immunotherapies. PMID:11739846

  7. Canine faecal contamination and parasitic risk in the city of Naples (southern Italy)


    Veneziano Vincenzo; Catelan Dolores; Musella Vincenzo; Biggeri Annibale; Carbone Sabrina; Rinaldi Laura; Cringoli Giuseppe


    Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts) by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks,...

  8. International veterinary epilepsy task force consensus proposal: outcome of therapeutic interventions in canine and feline epilepsy



    Common criteria for the diagnosis of drug resistance and the assessment of outcome are needed urgently as a prerequisite for standardized evaluation and reporting of individual therapeutic responses in canine epilepsy. Thus, we provide a proposal for the definition of drug resistance and partial therapeutic success in canine patients with epilepsy. This consensus statement also suggests a list of factors and aspects of outcome, which should be considered in addition to the impact on seizures....

  9. Major HGF-mediated regenerative pathways are similarly affected in human and canine cirrhosis


    Spee, Bart; Arends, Brigitte; van den Ingh, Ted SGAM; Roskams, Tania; Rothuizen, Jan; Penning, Louis C


    Background The availability of non-rodent animal models for human cirrhosis is limited. We investigated whether privately-owned dogs (Canis familiaris) are potential model animals for liver disease focusing on regenerative pathways. Several forms of canine hepatitis were examined: Acute Hepatitis (AH), Chronic Hepatitis (CH), Lobular Dissecting Hepatitis (LDH, a specific form of micronodulair cirrhosis), and Cirrhosis (CIRR). Canine cirrhotic samples were compared to human liver samples from ...

  10. Hepatitis in skunks caused by the virus of infectious canine hepatitis. (United States)

    Karstad, L; Ramsden, R; Berry, T J; Binn, L N


    Two cases of acute, fatal, hepatitis occurred in young, striped skunks (Mephitis mephitis) trapped in southern Ontario. Histologically, lesions in the liver were similar to infectious canine hepatitis. A virus was isolated which produced large intranuclear inclusions in dog kidney cell cultures. These inclusions were Feulgen-positive and fluoresced green with acridine orange stain. The skunk hepatitis isolate was identified as the virus of infectious canine hepatitis by virus neutralization tests. PMID:172663

  11. Effects of thymol on calcium and potassium currents in canine and human ventricular cardiomyocytes


    Magyar, János; Szentandrássy, Norbert; Bányász, Tamás; Fülöp, László; Varró, András; Nánási, Péter P


    Concentration-dependent effects of thymol (1–1000 μM) was studied on action potential configuration and ionic currents in isolated canine ventricular cardiomyocytes using conventional microelectrode and patch clamp techniques.Low concentration of thymol (10 μM) removed the notch of the action potential, whereas high concentrations (100 μM or higher) caused an additional shortening of action potential duration accompanied by progressive depression of plateau and reduction of Vmax.In the canine...

  12. Canine babesiosis in Slovenia: Molecular evidence of Babesia canis canis and Babesia canis vogeli


    Duh, Darja; Tozon, Nataša; Petrovec, Miroslav; StraŠek, Katja; AvŠic-Županc, Tatjana


    Canine babesiosis, caused by intraerythrocytic Babesia spp., is a tick-borne disease of worldwide importance. No information on canine babesiosis has been documented in Slovenia. Therefore, 238 dogs admitted to the Small animal clinic in Ljubljana from the years 2000 to 2002 were tested for the presence of babesial parasites in the blood. Based on clinical, microscopic and molecular investigations, 14 dogs (5.9%) were determined as being infected with babesiae. Clinical signs relating to acut...

  13. Retrospective canine skin peripheral nerve sheath tumors data with emphasis on histologic, immunohistochemical and prognostic factors


    Gisele S. Boos; Daniele M. Bassuino; Fabiana Wurster; Neusa B. Castro; Tatiane T.N. Watanabe; Gustavo S. Silva; Luciana Sonne; David Driemeier


    Abstract: In this retrospective study was determined the frequency of canine skin peripheral nerve sheath tumors (PNST) in cases diagnosed by the Setor de Patologia Veterinária of the Universidade Federal do Rio Grande do Sul (SPV-UFRGS), Brazil, between the years 2000 and 2012. The canine profiles, as well as histological, immunohistochemical and prognostic aspects of the tumors were based on 70 samples, comprising 40 females, 29 males and one unspecified sample. Between 2000 and 2012, 2,984...

  14. Comparison of sexual dimorphism of permanent mandibular canine with mandibular first molar by odontometrics (United States)

    Agrawal, Aditi; Manjunatha, Bhari Shranesha; Dholia, Bhavik; Althomali, Yousef


    Background and Objectives: Sexual dimorphism is one of important tool of forensic science. The objective of this study is to assess the dimorphic status of mesio-distal (MD) and bucco-lingual (BL) diameter of mandibular canine with mandibular first molar among the students of dental college. This study is of definite significance as sex chromosomes and hormonal production influenced tooth morphology. Materials and Methods: The descriptive study adopted the purposive sampling technique, of 50 male and 50 female aged 17-25 years, using study casts for mesio-distal and bucco-lingual dimensions of mandibular canine with mandibular first molar were taken using digital Vernier caliper. The data obtained were subjected to statistical analysis using descriptive statistics and t-test to compare MD and BL dimensions in male and female populations and P ≤ 0.05 was found statistically significant. Results: Sexual dimorphism can be predicted by measuring mesiodistal dimension of mandibular canine and mandibular first molar. The left mandibular canine showed more sexual dimorphism (12.66%) in comparison to left mandibular first molar (0.824%) only. Right mandibular canine showed greater dimorphism in MD dimensions (10.94%) in comparison to right mandibular first molar (6.96%). In bucco-lingual dimensions mandibular canine showed less variability when compared with mandibular first molar, thus our study showed more significance on mesio-distal dimensions of both teeth. Conclusion: The present study concludes statistically significant sexual dimorphism in mandibular canine over mandibular first molar on study casts. The MD dimensions in mandibular canine and mandibular first molar can help in determining sex and identification of unknown person. PMID:26816466

  15. Heterogeneity within the hemagglutinin genes of canine distemper virus (CDV) strains detected in Italy

    DEFF Research Database (Denmark)

    Martella, V.; Cirone, F.; Elia, G.;


    Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause of...... lineage. These results suggest that at least three different CDV lineages are present in Italy. Keywords: Canine distemper virus; Dogs; Lineages; H gene...

  16. Unambiguous typing of canine adenovirus isolates by deoxyribonucleic acid restriction-endonuclease analysis.


    Assaf, R; Marsolais, G; Yelle, J; Hamelin, C


    Viral deoxyribonucleic acid extracted from a limited number of cells infected with canine adenovirus type 1 or type 2 was cleaved with several restriction endonucleases. Agarose gel electrophoresis of the limit digests showed stable differences between the canine adenovirus type 1 and type 2 cleavage patterns. Rapid and accurate typing of large numbers of clinical isolates may thus be done by deoxyribonucleic acid restriction-endonuclease analysis.

  17. Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease


    Andrew Specht; Laurie Fiske; Kirsten Erger; Travis Cossette; John Verstegen; Martha Campbell-Thompson; Struck, Maggie B.; Young Mok Lee; Chou, Janice Y.; Byrne, Barry J; Correia, Catherine E.; Mah, Cathryn S.; Weinstein, David A.; Conlon, Thomas J.


    A canine model of Glycogen storage disease type Ia (GSDIa) is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size,...

  18. The feasibility of canine rabies elimination in Africa: dispelling doubts with data


    Lembo, T.; Hampson, K.; Kaare, M.T.; Ernest, E.; Knobel, D.; Kazwala, R.R.; Haydon, D. T.; Cleaveland, S.


    Background: Canine rabies causes many thousands of human deaths every year in Africa, and continues to increase throughout much of the continent. Methodology/Principal Findings: This paper identifies four common reasons given for the lack of effective canine rabies control in Africa: (a) a low priority given for disease control as a result of lack of awareness of the rabies burden; (b) epidemiological constraints such as uncertainties about the required levels of vaccination coverage and...

  19. Comparison of sexual dimorphism of permanent mandibular canine with mandibular first molar by odontometrics

    Directory of Open Access Journals (Sweden)

    Aditi Agrawal


    Full Text Available Background and Objectives: Sexual dimorphism is one of important tool of forensic science. The objective of this study is to assess the dimorphic status of mesio-distal (MD and bucco-lingual (BL diameter of mandibular canine with mandibular first molar among the students of dental college. This study is of definite significance as sex chromosomes and hormonal production influenced tooth morphology. Materials and Methods: The descriptive study adopted the purposive sampling technique, of 50 male and 50 female aged 17-25 years, using study casts for mesio-distal and bucco-lingual dimensions of mandibular canine with mandibular first molar were taken using digital Vernier caliper. The data obtained were subjected to statistical analysis using descriptive statistics and t-test to compare MD and BL dimensions in male and female populations and P ≤ 0.05 was found statistically significant. Results: Sexual dimorphism can be predicted by measuring mesiodistal dimension of mandibular canine and mandibular first molar. The left mandibular canine showed more sexual dimorphism (12.66% in comparison to left mandibular first molar (0.824% only. Right mandibular canine showed greater dimorphism in MD dimensions (10.94% in comparison to right mandibular first molar (6.96%. In bucco-lingual dimensions mandibular canine showed less variability when compared with mandibular first molar, thus our study showed more significance on mesio-distal dimensions of both teeth. Conclusion: The present study concludes statistically significant sexual dimorphism in mandibular canine over mandibular first molar on study casts. The MD dimensions in mandibular canine and mandibular first molar can help in determining sex and identification of unknown person.

  20. Preliminary comparison of the therapeutic efficacy of accelerated relative to conventional fractionation radiotherapy by treatment of spontaneous canine malignancies

    International Nuclear Information System (INIS)

    Purpose/Objective: This study's ultimate goals involve development of an accelerated fractionation (AF) regimen with an integrated final concomitant boost (CB) and examination of factors prognostic of the CB's therapeutic efficacy which could be measured during the initial AF portion to determine for which patients CB should be used. These endpoints can be accurately determined quickly by evaluating the treatment (tx) of spontaneous canine veterinary patient tumors. Because surviving tumor clonogen growth rate increases after radiotherapy (RT) begins, this accelerated repopulation (AR) should be reduced by AF. Furthermore, CB using a small field encompassing only the tumor bed, given as a second daily tx during the last week of RT, should further reduce AR. The initial portion of this project which is nearing completion was designed to determine if incidentally treated normal tissues could tolerate the AF regimen and project whether addition of the tumor bed CB would also be tolerated. Materials and Methods: Currently 20 canine patients with biopsy proven localized tumors have received canine AF radiotherapy given as 3.2Gy/fraction(fx) administered 5 days a week (Mon-Fri) to a total of 15 fxs (48Gy) within 18 elapsed days. RT is given with a 60Co teletherapy unit. Their tumor response, control, survival, and acute normal tissue responses are being directly compared to results we previously obtained from canines receiving a nearly equivalent dose/fx and total dose conventional fractionation (CF) regimen which was given alone or with adjuvant hyperthermia (HT). In that study the canines were stratified by tumor histology and anatomic site and randomly assigned to receive canine CF (3.5Gy/fx, 3 fxs/week [Mon-Wed-Fri] to 14 fxs (49Gy) in an elapsed time of approx. 30 days) either alone or followed weekly by local HT (44 deg. +/- 2 deg. C) for 30 minutes (5 HT fxs). As is currently done, these CF+/-HT patients were followed up to 3 years to quantitate the magnitudes and


    Watts, Dominique E; Benson, Anna-Marie


    We collected blood samples from wolves ( Canis lupus ) on the Alaska Peninsula, southwest Alaska, US, 2006-11 and tested sera for antibodies to canine adenovirus (CAV), canine coronavirus (CCV), canine distemper virus (CDV), canine herpesvirus (CHV), canine parainfluenza (CPI), canine parvovirus (CPV), Neospora caninum , and Toxoplasma gondii . Detected antibody prevalence was 90% for CAV, 28% for CCV, 12% for CDV, 93% for CHV, 0% for CPI, 20% for CPV, 0% for N. caninum, and 86% for T. gondii . Prevalence of CCV antibodies suggested a seasonal pattern with higher prevalence during spring (43%) than in fall (11%). Prevalence of CCV antibodies also declined during the 6-yr study with high prevalence during spring 2006-08 (80%, n=24) and low prevalence during spring 2009-11 (4%, n=24). Prevalence of N. caninum and T. gondii antibodies were highly variable in the study area during 2006-11. Results suggested that some pathogens might be enzootic on the Alaska Peninsula (e.g., CAV and CHV) while others may be epizootic (e.g., CCV, N. caninum , T. gondii ). PMID:27195683

  2. A comparative study between mixed-type tumours from human salivary and canine mammary glands

    International Nuclear Information System (INIS)

    In comparative pathology, canine mammary tumours have special interest because of their similarities with human breast cancer. Mixed tumours are uncommon lesions in the human breast, but they are found most frequently in the mammary gland of the female dogs and in the human salivary glands. The aim of the study was to compare clinical, morphological and immunohistochemical features of human salivary and canine mammary gland mixed tumours, in order to evaluate the latter as an experimental model for salivary gland tumours. Ten examples of each mixed tumour type (human pleomorphic adenoma and carcinomas ex-pleomorphic adenomas and canine mixed tumour and metaplastic carcinoma) were evaluated. First, clinical and morphologic aspects of benign and malignant variants were compared between the species. Then, streptavidin-biotin-peroxidase immunohistochemistry was performed to detect the expression of cytokeratins, vimentin, p63 protein, estrogen receptor, β-catenin, and E-cadherin. After standardization, similar age and site distributions were observed in human and canine tumours. Histological similarities were identified in the comparison of the benign lesions as well. Metaplastic carcinomas also resembled general aspects of carcinomas ex-pleomorphic adenomas in morphological evaluation. Additionally, immunohistochemical staining further presented similar antigenic expression between lesions. There are many similar features between human salivary and canine mammary gland mixed tumours. This observation is of great relevance for those interested in the study and management of salivary gland tumours, since canine lesions may constitute useful comparative models for their investigations

  3. 犬瘟热的诊治%Diagnosis and Treatment of Canine Distemper

    Institute of Scientific and Technical Information of China (English)

    罗厚强; 段龙川; 王清艳; 涂宜强; 涂国众


    Canine distemper is an acute infectious disease caused by the canine distemper virus in Canidae. Many symptoms were characterized by infected dogs, such as biphasic fever, rhinitis, severe inflammation of the digestive tract and respiratory inflammation. The pathogen, epidemiology, clinical symptoms and pathological changes of canine distemper were introduced in the paper. Though a typical case of canine distemper, a series of effective measures to treat canine distemper were introduced in order to provide reference for the control of canine distemper.%犬瘟热是一种由犬瘟热病毒引起的犬科动物急性传染病,病犬以双相热、鼻炎、严重的消化障碍和呼吸道炎症为特征。主要对该病的病原、流行病学、临床症状及病理变化等作一阐述,并以一例犬瘟热典型病例的诊治为例,介绍了治疗该病的有效措施,以期为有效防治犬瘟热提供参考。

  4. In vivo 31P-NMR spectroscopy of chronically stimulated canine skeletal muscle

    International Nuclear Information System (INIS)

    Chronic stimulation converts skeletal muscle of mixed fiber type to a uniform muscle made up of type I, fatigue-resistant fibers. Here, the bioenergetic correlates of fatigue resistance in conditioned canine latissimus dorsi are assessed with in vivo phosphorus-31 nuclear magnetic resonance (31P-NMR) spectroscopy. After chronic electrical stimulation, five dogs underwent 31P-NMR spectroscopic and isometric tension measurements on conditioned and contralateral control muscle during stimulation for 200, 300, 500, and 800 ms of an 1,100-ms duty cycle. With stimulation, phosphocreatine (PCr) fell proportional to the degree of stimulation in both conditioned and control muscle but fell significantly less in conditioned muscle at all the least intense stimulation period (200 ms). Isometric tension, expressed as a tension time index per gram muscle, was significantly greater in the conditioned muscle at the two longest stimulation periods. The overall small change in PCr and the lack of a plateau in tension observed in the conditioned muscle are similar to that seen in cardiac muscle during increased energy demand. This study indicates that the conditioned muscle's markedly enhanced resistance to fatigue is in part the result of its increased capacity for oxidative phosphorylation

  5. Comparison of steroid receptor expression in normal, dysplastic, and neoplastic canine and feline mammary tissues. (United States)

    Millanta, F; Calandrella, M; Bari, G; Niccolini, M; Vannozzi, I; Poli, A


    Steroid receptor expression was assessed by immunohistochemistry in neoplastic, hyperplastic/dysplastic, and normal mammary tissue samples removed from 68 queens and 47 bitches, using monoclonal antibodies against human oestrogen-alpha (ER) and progesterone receptors (PR). Mammary lesions were classified according to World Health Organization (WHO) criteria, and all animals with invasive carcinomas were clinically followed for 2 years. Stromal and/or lymphatic invasion and histological grading were also recorded. In both species, ER expression was significantly higher in healthy tissues, hyperplastic/dysplastic lesions, and benign tumours than in carcinomas. The loss of ER expression was more marked in feline than in canine carcinomas. In queens, PR expression increased in dysplastic lesions and "in situ" carcinomas and decreased in invasive carcinomas, even if parts of these tumours were still PR-positive. In bitches no significant variation in PR expression was observed between normal tissue, dysplasias, and benign neoplasms, but was significantly lower in carcinomas. In both species ER and PR expression in invasive carcinomas did not correlate either with histological parameters or overall survival time. This study demonstrates several differences in steroid hormone dependency between the two species. The percentage of PR-positive feline carcinomas suggests a possible role of progesterone in promoting early tumour cell growth in queens. The low percentage of ER-positive invasive carcinomas further demonstrated the aggressive phenotype and behaviour of feline mammary tumours. PMID:16054892

  6. A pRb-responsive, RGD-modified, and Hyaluronidase-armed Canine Oncolytic Adenovirus for Application in Veterinary Oncology


    Laborda, Eduardo; Puig-Saus, Cristina; Rodriguez-García, Alba; Moreno, Rafael; Cascalló, Manel; Pastor, Josep; Alemany, Ramon


    Human and canine cancer share similarities such as genetic and molecular aspects, biological complexity, tumor epidemiology, and targeted therapeutic treatment. Lack of good animal models for human adenovirotherapy has spurred the use of canine adenovirus 2-based oncolytic viruses. We have constructed a canine oncolytic virus that mimics the characteristics of our previously published human adenovirus ICOVIR17: expression of E1a controlled by E2F sites, deletion of the pRb-binding site of E1a...

  7. Evaluation of the use of serum C-reactive protein concentration to predict outcome in puppies infected with canine parvovirus

    DEFF Research Database (Denmark)

    McClure, Vanessa; van Schoor, Mirinda; Thompson, Peter N.;


    Objective-To evaluate associations of serum C-reactive protein (CRP) concentration with duration of hospitalization and with outcome in puppies with canine parvoviral enteritis. Design-Prospective observational study. Animals-79 client-owned puppies with naturally acquired canine parvovirus.......7%, respectively (considered moderately accurate). Conclusions and Clinical Relevance-Although serum CRP concentration was associated with outcome in puppies with canine parvovirus enteritis, it did not prove to be a good predictor of outcome when used alone....

  8. Leishmania spp. Epidemiology of Canine Leishmaniasis in the Yucatan Peninsula

    Directory of Open Access Journals (Sweden)

    A. López-Céspedes


    Full Text Available Canine Leishmaniasis is widespread in various Mexican states, where different species of Leishmania have been isolated from dogs. In the present study, we describe the detection of L. braziliensis, L. infantum, and L. mexicana in serum of dogs from the states of Yucatan and Quintana Roo in the Yucatan Peninsula (Mexico. A total of 412 sera were analyzed by ELISA using the total extract of the parasite and the iron superoxide dismutase excreted by different trypanosomatids as antigens. We found the prevalence of L. braziliensis to be 7.52%, L. infantum to be 6.07%, and L. mexicana to be 20.63%, in the dog population studied. The results obtained with ELISA using iron superoxide dismutase as the antigen were confirmed by western blot analysis with its greater sensitivity, and the agreement between the two techniques was very high.

  9. [The canine neuronal ceroid-lipofuscinosis: a review]. (United States)

    Karli, P; Karol, A; Oevermann, A; Drögemüller, C; Gorgas, D; Henke, D


    The present article gives a survey over the current scientific knowledge of the canine neuronal ceroid-lipofuscinosis (NCL). NCL is a heterogenous group of lysosomal storage diseases in humans and animals. In consequence of a gene mutation, there is an accumulation of ceroid-lipofuscin in neurons, cells of the retina and the skin and other cells. The stored ceroid-lipofuscin in neurons leads to an impaired cell function and subsequently to cell death. Recently, the underlying genetic defect was discovered in several dog breeds. Genetic testing permits an ante mortem diagnosis of the disease, which up to now was only possible with a positive biopsy result. Another advantage is the identification of carrier animals to eliminate the deleterious alleles. PMID:25183673

  10. Serological Survey of Canine Leptospirosis in Southern China

    Directory of Open Access Journals (Sweden)

    Dayou Shi1§, Mingchao Liu§, Shining Guo1, Shenquan Liao2, Mingfei Sun2, Jianzhu Liu*, Lin Wang, Zhenyong Wang, Shujing Wang, Dubao Yang and Tongjie Chai


    Full Text Available The present study conducts a serological survey on the presence of canine leptospirosis in domestic dogs using ELISA kit. A total of 314 household dogs (168 females and 146 males in Chongqing, Kunming, Nanchang, Fuzhou, Guangzhou, Shenzheng, and Nanning in Southern China were examined. Of the 314 dogs, 23 (7.3% were seropositive for leptospirosis. No statistically significant difference was observed in terms of sex and age in the seroprevalence of leptospirosis, but statistically significant differences were observed among different regional groups in the seroprevalence of leptospirosis (P<0.05. The results of this survey indicate that the control and treatment of leptospirosis have been effective in some cities of Southern China. However, further implementation of integrated strategies is necessary to prevent and control leptospirosis in dogs.

  11. Canine angiostrongylosis: recent advances in diagnosis, prevention, and treatment

    Directory of Open Access Journals (Sweden)

    Di Cesare A


    Full Text Available Angela Di Cesare, Donato Traversa Faculty of Veterinary Medicine, University of Teramo, Teramo, Italy Abstract: Angiostrongylus vasorum is a parasitic nematode affecting the heart and pulmonary arteries of wild (eg, foxes and domestic canids. The parasite has an indirect life cycle in which slugs and snails act as intermediate hosts. In the last few years the parasite has spread outside the traditional endemic foci, and there is a rise of documented cases of canine angiostrongylosis across Europe. Angiostrongylus vasorum causes cardiopulmonary disorders and coagulopathies, along with different nonspecific clinical signs. Fatal infections are frequently reported. Given the severity of the infection and the recent geographic spreading of the parasite, this article reviews and discusses the current knowledge of A. vasorum, with a special focus on recent insights on diagnosis, prevention, and treatment of dog angiostrongylosis. Keywords: Angiostrongylus vasorum, dog, epidemiology, diagnostic approaches, control, therapy

  12. Canine visceral leishmaniasis on Margarita Island (Nueva Esparta, Venezuela). (United States)

    Zerpa, O; Ulrich, M; Negrón, E; Rodríguez, N; Centeno, M; Rodríguez, V; Barrios, R M; Belizario, D; Reed, S; Convit, J


    The frequency of American visceral leishmaniasis affecting humans on Margarita Island, Venezuela, has increased in recent years, and infected dogs appear to constitute the principal source of infection. ELISA tests with Leishmania donovani promastigotes and rK39 antigen from L. chagasi in serum from 541 dogs were positive in 33.1% and 21.6% of the samples, respectively. A second blood sample taken from 50 animals after 8-10 months revealed an increase from 24% to 40% of ELISA positivity to both antigens, suggesting high susceptibility and transmission in the canine population. Among 42 serologically positive dogs, 33% of which showed clinical signs of disease, 79% were positive in polymerase chain reactions using primers specific for the L. donovani complex. Control measures including epidemiological hypersurveillance, the humane sacrifice of infected dogs, and rapid diagnosis and treatment of human cases have been initiated. PMID:11132371

  13. EGFR and microvessel density in canine malignant mammary tumours. (United States)

    Carvalho, Maria Isabel; Guimarães, Maria João; Pires, Isabel; Prada, Justina; Silva-Carvalho, Ricardo; Lopes, Carlos; Queiroga, Felisbina L


    The epidermal growth factor receptor (EGFR) is a transmembrane tyrosine kinase receptor which has been shown to have an important role in human breast cancer. Its role appears to be associated with increased angiogenesis and metastasis. In order to clarify its role in canine mammary tumours (CMT), 61 malignant neoplasms were studied by using immunohistochemistry, comparing expression of EGFR, microvessel density (MVD) by CD31 immunolabelling and characteristics of tumour aggressiveness. High EGFR immunoexpression was statistically significantly associated with tumour size, tumour necrosis, mitotic grade, histological grade of malignancy and clinical stage. High CD31 immunoreactivity was statistically significantly associated with tubule formation, histological grade of malignancy and clinical stage. A positive correlation between EGFR and CD31 immunoexpression (r = 0.843; P aggression in malignant CMT, presenting the possibility of using EGFR inhibitors in the context of metastatic disease treatment. PMID:24091029

  14. KRAS Mutations in Canine and Feline Pancreatic Acinar Cell Carcinoma. (United States)

    Crozier, C; Wood, G A; Foster, R A; Stasi, S; Liu, J H W; Bartlett, J M S; Coomber, B L; Sabine, V S


    Companion animals may serve as valuable models for studying human cancers. Although KRAS is the most commonly mutated gene in human ductal pancreatic cancers (57%), with mutations frequently occurring at codons 12, 13 and 61, human pancreatic acinar cell carcinomas (ACCs) lack activating KRAS mutations. In the present study, 32 pancreatic ACC samples obtained from 14 dogs and 18 cats, including seven metastases, were analyzed for six common activating KRAS mutations located in codons 12 (n = 5) and 13 (n = 1) using Sequenom MassARRAY. No KRAS mutations were found, suggesting that, similar to human pancreatic ACC, KRAS mutations do not play a critical role in feline or canine pancreatic ACC. Due to the similarity of the clinical disease in dogs and cats to that of man, this study confirms that companion animals offer potential as a suitable model for investigating this rare subtype of pancreatic carcinoma. PMID:27290644

  15. Distribution and characterization of canine Chagas disease in Texas. (United States)

    Kjos, S A; Snowden, K F; Craig, T M; Lewis, B; Ronald, N; Olson, J K


    Although acute and chronic cases of canine Chagas disease have been reported from multiple areas in the southern region of the United States, little data are available on current disease occurrence patterns in endemic areas. Therefore, a study to assess frequency, geographic distribution, signalment, and clinical spectrum of Chagas disease in domestic dogs from Texas was conducted. Serology, histopathology, and clinical case records from multiple institutions for the time period 1993-2007 were analyzed. A total of 537 serologically and/or histopathologically confirmed cases were documented. Cases were reported from 48 of 254 counties within Texas, covering all major geographic regions. Forty-eight dog breeds were represented among the cases, primarily in the sporting and working groups. In histopathologically confirmed cases, acute death occurred in 42%, approximately half of which were ecoregions of Texas, affecting a broad range of dog breeds and age groups. PMID:18255233

  16. Bone compaction enhances implant fixation in a canine gap model

    DEFF Research Database (Denmark)

    Kold, Søren; Rahbek, Ole; Toft, Marianne;


    A new bone preparation technique, compaction, has increased fixation of implants inserted with exact-fit or press-fit to bone. Furthermore, a demonstrated spring-back effect of compacted bone might be of potential value in reducing the initial gaps that often exist between clinical inserted...... implants and bone. However, it is unknown whether the compression and breakage of trabeculae during the compaction procedure results in impaired gap-healing of compacted bone. Therefore, we compared compaction with conventional drilling in a canine gap model. Grit-blasted titanium implants (diameter 6 mm...... that the beneficial effect of reduced gap size, as compacted bone springs back, is not eliminated by an impaired gap-healing of compacted bone....

  17. Low-Field Magnetic Resonance Imaging of Canine Hydrocephalus

    Directory of Open Access Journals (Sweden)

    Z. Adamiak* and M. Jaskólska and A. Pomianowski1


    Full Text Available The aim of presented study was to evaluate selected surface spine coil, and low-field magnetic resonance (MR selected sequences in diagnosing hydrocephalus in dogs. This paper discusses 19 dogs (14 canine patients with hydrocephalus and 5 healthy dogs, of five breeds, subjected to low-field magnetic resonance imaging (MRI of hydrocephalus. Area of the lateral ventricles and brain were examined in dogs with hydrocephalus using low-field MRI (at 0.25 Tesla. The MRI of FSE REL, SE, FLAIR, STIR, 3D HYCE, T3DT1, GE STIR 3D and 3D SHARC sequences with an indication of the most effective sequences are described. Additionally, coils for MR were compared, and models for infusion anesthesia were described. As a result of performed study all estimated sequences were diagnostically useful. However, spinal coil No. 2 (ESAOTE was the most optimal for examining and positioning the cranium.

  18. Plasma biomarkers of SIRS and MODS associated with canine babesiosis. (United States)

    Kuleš, J; de Torre-Minguela, C; Barić Rafaj, R; Gotić, J; Nižić, P; Ceron, J J; Mrljak, V


    Canine babesiosis is a tick-borne disease caused by the haemoprotozoan parasites of the genus Babesia. Early detection of systemic inflammatory response syndrome (SIRS) and multiple organ dysfunction syndrome (MODS) is of major importance in clinical practice for providing information about severity and outcomes of the disease and therapy. Plasma samples were taken at admission from five dogs with uncomplicated babesiosis caused by B. canis canis, five dogs with babesiosis and SIRS, five dogs with babesiosis and MODS, and five healthy dogs. After two-dimensional electrophoresis and capillary reversed - phase liquid chromatography coupled online with tandem mass spectrometry, 68 differentially expressed spots with level of significance P<0.05 were detected between groups. SIRS in babesiosis was characterised by increases in paraoxonase 1 and apoA-I, whereas MODS with decrease of complement inhibitors leading to prolonged complement activation and decrease of vitamin D binding protein due to haemolysis and activation of the coagulation cascade. PMID:27033937


    Directory of Open Access Journals (Sweden)

    I. N. Bashir, Z. I. Chaudhry, S. Ahmed and M. A. Saeed


    Full Text Available Canine babesiosis is increasing in incidence and prevalence and is now a major problem in dogs. During this study, a total of 6204 dogs were examined for babesiosis over a 12 month period from January to December, 2006 in Lahore and 2.62% were found positive. The dogs were grouped on the basis of their age, sex and breed and season of the year. The male dogs were more prone to disease than female dogs (3.39 vs. 1.32%, whereas the incidence of disease was higher in younger dogs (6.9% than older age groups. Crossbreds were more prone to the infection (10.9% than purebreds. However, none of them were completely resistant. Warm and humid season played a key role in the spread of disease. Predominant vector of the disease was found to be Rhipicephalus species.

  20. Cytological diagnostic of canine transmissible venereal tumor - Case report

    Directory of Open Access Journals (Sweden)

    Ulčar Igor


    Full Text Available Canine Transmissible Venereal Tumor (CTVT is a benign reticuloendothelial (histiocytic tumor of the dog that mainly affects the external genitalia. This tumor was found in male 2 years old mongrel dog. According the anamnestic data, there was no visible change of its general clinical status, except spontaneous bleeding with blood drops on the praeputium and the presence of blood in the urine. With clinical examination a multilobular mass on radix penis mucosa was found, which actually caused pseudohemorrhagia. The material for cytological diagnostic was taken with the imprint method and 4 cytological films were prepared and strained. The conclusion of the cytological diagnosis was CTVT. The tumor cause only local disturbances, and the differential diagnosis of the other "round cells tumors", histiocytomas, plasmacytomas, lymphoma, some melanomas and especially lymphosarcomas, which could be located on the external genitalia, had a big significance. Although some authors are mentioning spontaneous regression, however, because this is invasive tumor, a complete chirurgical excision was made.

  1. Vertebral scale system to measure canine heart size in radiographs

    International Nuclear Information System (INIS)

    A method for measuring canine heart size in radiographs was developed on the basis that there is a good correlation between heart size and body length regardless of the conformation of the thorax. The lengths of the long and short axes of the heart of 100 clinically normal dogs were determined with calipers, and the dimensions were scaled against the length of vertebrae dorsal to the heart beginning with T4. The sum of the long and short axes of the heart expressed as vertebral heart size was 9.7 +/- 0.5 vertebrae. The differences between dogs with a wide or deep thorax, males and females, and right or left lateral recumbency were not significant. The caudal vena cava was 0.75 vertebrae +/- 0.13 in comparison to the length of the vertebra over the tracheal bifurcation

  2. Canine pemphigus foliaceus with concurrent immune-mediated thrombocytopenia. (United States)

    Kawarai, Shinpei; Hisasue, Masaharu; Matsuura, Shinobu; Ito, Tetsuro; Inoue, Yukari; Neo, Sakurako; Fujii, Yoko; Madarame, Hiroo; Shirota, Kinji; Tsuchiya, Ryo


    A 3 yr old wirehaired fox terrier was presented to his primary care veterinarian with fever, thrombocytopenia, and generalized crusting dermatitis. The skin lesion had progressed for at least 18 days, and thrombocytopenia had developed 3 days before presentation. Histopathology and direct immunofluorescence studies of the skin were consistent with pemphigus foliaceus (PF). Immunofluorescence revealed immunoglobulin G deposition around the keratinocytes in the stratum spinosum. A diagnosis of immune-mediated thrombocytopenia (IMT) was confirmed by the presence of platelet surface-associated immunoglobulin using flow cytometry. Systemic immunosuppressive therapy with cyclosporine and azathioprine was effective, and the dog survived for >2 years from the initial presentation. IMT is rarely associated with PF. This appears to be the first detailed report of a definitive diagnosis of concurrent PF and IMT in a dog. The authors' findings indicate that canine PF could be complicated by hematologic immune-mediated diseases such as IMT. PMID:25415212

  3. Microwave scattering parameter imagery of an isolated canine kidney

    International Nuclear Information System (INIS)

    This paper describes a method for imaging biosystems using radiation in the microwave frequency range (3.9 GHz). The advantages of interrogation with microwave radiation are discussed in terms of its physiological significance. An electromechanical scanning system for imaging isolated organs and the subsequent image processing techniques are described. Imagery is presented for a phantom target and an isolated canine kidney. The kidney images are interpreted in terms of the known anatomical and functional organization of the organ. It does appear to be possible to distinguish cortex corticis corresponding to a high proportion of proximal and distal convoluted tubules, deeper cortical layers corresponding to a high population density of glomeri, a medullary outer zone corresponding to the loops of Henle as well as the collecting system, and the region of calyces/renal pelvis

  4. Antibiogram of bacterial species isolated from canine pyometra

    Directory of Open Access Journals (Sweden)

    Madhu Swamy


    Full Text Available Aim: The aim of the present work was to ascertain the bacterial flora causing pyometra in female dogs and their antibiotic sensitivity. Materials and Methods: A study was conducted to determine the antibiogram of bacterial species isolated from 20 female dogs diagnosed with pyometra. The vaginal discharge was collected by sterile swab and streaked smoothly over Mueller Hinton medium and sensitivity towards antibiotics was determined by measuring the zone of inhibition using a Hi-media scale. Results: The antobiogram showed that Gentamicin was the most sensitive (85% antibiotic followed by Enrofloxacin, Ciprofloxacin and Amoxicillin (65%, 65% and 55%, respectively. The isolates were most resistant to Oxytetracycline (85% followed by Tetracycline, Ampicillin, Chloramphenicol, Cloxacillin and Erythromycin (80%, 80%, 75%, 70% and 70%, respectively. Conclusion: Gentamicin was found to be most effective antibiotic against the bacterial species isolated from canine pyometra. [Vet World 2013; 6(8.000: 546-549

  5. Microangiographic study of the canine dental tissues: a preliminary report

    International Nuclear Information System (INIS)

    A microangiographic study of the dental tissues was performed on one adult mongrel dog to examine the usefulness of the technique. This preliminary study used 30% wt/vol Micropaque suspension which was perfused into the common carotid arteries. After the complete perfusion, the specimen was fixed into a mixture of 10% buffered neutral formalin solution and 95% ethyl alcohol. The mandibular bone with teeth in situ was decalcified. The specimen was embedded in methyl methacrylate. One mm slab sections were made, and then the microangiographs were made. Adequate filling of arterioles was evident on the microangiographs. This technique is shown to be useful in characterizing the nature of the blood supply to the bone and teeth that might be involved in the pathogenesis of radiation-induced injury in the canine dental and periodontal tissues

  6. Canine genome assembly correction facilitates identification of a MAP9 deletion as a potential age of onset modifier for RPGRIP1-associated canine retinal degeneration. (United States)

    Forman, Oliver P; Hitti, Rebekkah J; Boursnell, Mike; Miyadera, Keiko; Sargan, David; Mellersh, Cathryn


    Retinal degeneration (RD) in the Miniature Long Haired Dachshund (MLHD) is a cone-rod dystrophy resulting in eventual blindness in affected individuals. In a previous study, a 44-nucleotide insertion (ins44) in exon 2 of RPGRIP1 was associated with RD. However, results on an extended population of MLHD revealed a variable RD onset age for ins44 homozygous dogs. Further investigations using a genome-wide association study comparing early onset and late onset RD cases identified an age of onset modifying locus for RD, approximately 30 Mb upstream of RPGRIP1 on chr15. In this investigation, target enriched sequencing identified a MAP9 deletion spanning approximately 22 kb associated with early RD onset. Identification of the deletion required correction to the CanFam3.1 genome build as canine MAP9 is part of a historic tandem duplication, resulting in incomplete assembly of this genome region. The deletion breakpoints were identified in MAP9 intron 10 and in a downstream partial MAP9 pseudogene. The fusion of these two genes, which we have called MAP9 EORD (microtubule-associated protein, early onset retinal degeneration), is in frame and is expressed at the RNA level, with the 3' region containing several predicted deleterious variants. We speculate that MAP9 associates with α-tubulin in the basal body of the cilium. RPGRIP1 is also known to locate to the cilium, where it is closely associated with RPGR. RPGRIP1 mutations also cause redistribution of α-tubulin away from the ciliary region in photoreceptors. Hence, a MAP9 partial deficit is a particularly attractive candidate to synergise with a partial RPGRIP1 deficit to cause a more serious disease. PMID:27017229

  7. Genomic prediction of traits related to canine hip dysplasia

    Directory of Open Access Journals (Sweden)

    Enrique eSanchez-Molano


    Full Text Available Increased concern for the welfare of pedigree dogs has led to development of selection programs against inherited diseases. An example is canine hip dysplasia (CHD, which has a moderate heritability and a high prevalence in some large-sized breeds. To date, selection using phenotypes has led to only modest improvement, and alternative strategies such as genomic selection may prove more effective. The primary aims of this study were to compare the performance of pedigree- and genomic-based breeding against CHD in the UK Labrador retriever population and to evaluate the performance of different genomic selection methods. A sample of 1179 Labrador Retrievers evaluated for CHD according to the UK scoring method (hip score, HS was genotyped with the Illumina CanineHD BeadChip. Twelve functions of HS and its component traits were analyzed using different statistical methods (GBLUP, Bayes C and Single-Step methods, and results were compared with a pedigree-based approach (BLUP using cross-validation. Genomic methods resulted in similar or higher accuracies than pedigree-based methods with training sets of 944 individuals for all but the untransformed HS, suggesting that genomic selection is an effective strategy. GBLUP and Bayes C gave similar prediction accuracies for HS and related traits, indicating a polygenic architecture. This conclusion was also supported by the low accuracies obtained in additional GBLUP analyses performed using only the SNPs with highest test statistics, also indicating that marker-assisted selection would not be as effective as genomic selection. A Single-Step method that combines genomic and pedigree information also showed higher accuracy than GBLUP and Bayes C for the log-transformed HS, which is currently used for pedigree based evaluations in UK. In conclusion, genomic selection is a promising alternative to pedigree-based selection against CHD, requiring more phenotypes with genomic data to improve further the accuracy

  8. Safety assessment of potential food ingredients in canine hepatocytes. (United States)

    Zhang, Leshuai W; Koci, Juraj; Jeffery, Brett; Riviere, Jim E; Monteiro-Riviere, Nancy A


    This research aimed to develop in vitro methods to assess hazard of canine food ingredients. Canine hepatocytes were harvested and cell viability of clove-leaf oil (CLO), eugenol (EUG), lemongrass oil (LGO), guanosine monophosphate (GMP), inosine monophosphate (IMP), sorbose, ginger-root extract (GRE), cinnamon-bark oil (CBO), cinnamaldehyde (CINA), thymol oil (TO), thymol (THYM), and citric acid were assessed with positive controls: acetaminophen (APAP), aflatoxin B1 and xylitol. Molecular Toxicology PathwayFinder array (MTPF) analyzed toxicity mechanisms for LGO. LC50 for APAP was similar among human (3.45), rat (2.35), dog (4.26 mg/ml). Aflatoxin B1 had an LC50 of 4.43 (human), 5.78 (rat) and 6.05 (dog) µg/ml; xylitol did not decrease viability. LC50 of CLO (0.185 ± 0.075(SD)), EUG (0.165 ± 0.112), LGO (0.220 ± 0.012), GRE (1.54 ± 0.31) mg/ml; GMP (166.03 ± 41.83), GMP + IMP (208.67 ± 15.27) mM; CBO (0.08 ± 0.03), CINA (0.11 ± 0.01), TO (0.21 ± 0.03), THYM (0.05 ± 0.01), citric acid (1.58 ± 0.08) mg/ml, while sorbose was non-toxic. LGO induced upregulation of 16 and down-regulation of 24 genes, which CYP and heat shock most affected. These results suggest that in vitro assays such as this may be useful for hazard assessment of food ingredients for altered hepatic function. PMID:25660481

  9. Comparative expression pathway analysis of human and canine mammary tumors

    Directory of Open Access Journals (Sweden)

    Marconato Laura


    Full Text Available Abstract Background Spontaneous tumors in dog have been demonstrated to share many features with their human counterparts, including relevant molecular targets, histological appearance, genetics, biological behavior and response to conventional treatments. Mammary tumors in dog therefore provide an attractive alternative to more classical mouse models, such as transgenics or xenografts, where the tumour is artificially induced. To assess the extent to which dog tumors represent clinically significant human phenotypes, we performed the first genome-wide comparative analysis of transcriptional changes occurring in mammary tumors of the two species, with particular focus on the molecular pathways involved. Results We analyzed human and dog gene expression data derived from both tumor and normal mammary samples. By analyzing the expression levels of about ten thousand dog/human orthologous genes we observed a significant overlap of genes deregulated in the mammary tumor samples, as compared to their normal counterparts. Pathway analysis of gene expression data revealed a great degree of similarity in the perturbation of many cancer-related pathways, including the 'PI3K/AKT', 'KRAS', 'PTEN', 'WNT-beta catenin' and 'MAPK cascade'. Moreover, we show that the transcriptional relationships between different gene signatures observed in human breast cancer are largely maintained in the canine model, suggesting a close interspecies similarity in the network of cancer signalling circuitries. Conclusion Our data confirm and further strengthen the value of the canine mammary cancer model and open up new perspectives for the evaluation of novel cancer therapeutics and the development of prognostic and diagnostic biomarkers to be used in clinical studies.

  10. Scintigraphy of infected total hip arthroplasty (THA): A canine model

    International Nuclear Information System (INIS)

    Differentiating low-grade sepsis from aseptic loosening of an orthopedic prosthesis is difficult. This study was designed to compare the ability of Tc-99m-HMDP, Ga-67, and In-111 leukocytes (WC) to differentiate low-grade sepsis from aseptic THA component loosening in a canine model. A canine THA was implanted in 14 dogs. Six dogs were given infected femoral components by injecting 10/sup 5/ colony-forming units of Staphylococcus aureus into the femoral canal 6y0 to 90 seconds prior to cementing. Four dogs had an aseptic loose femoral component, and four dogs had an aseptic tight femoral component (control). At six months all dogs were evaluated with X-ray, lab scintigraphy, and tissue quantitation of each tracer. Diagnosis was confirmed by histology and quantitative microbiology. White blood cell counts and differentials were normal in all dogs, and in only one out of six infected dogs was the sedimentation rate abnormal. X-rays were interpreted as possible infection in five dogs and probable infection in only one dog. In-111 WBC scans were more accurate than sequential Tc-Ga scans (sensitivity 94% vs 61%, specificity 86% vs 71% accuracy 90% vs 67%). Quantitative counting of gamma camera data and tissue samples demonstrated significantly (P < .01) higher accumulation of In-111 WBC about the infected than the loose or control component. No significant difference was demonstrated between the loose and septic components with TC-HMDP or Ga. These results correlate well and confirm our clinical data that In-111 WBC scanning is accurate and useful in the workup of the painful orthopedic prosthesis

  11. Immunoglobulin G concentration in canine colostrum: Evaluation and variability. (United States)

    Mila, Hanna; Feugier, Alexandre; Grellet, Aurélien; Anne, Jennifer; Gonnier, Milène; Martin, Maelys; Rossig, Lisa; Chastant-Maillard, Sylvie


    Canine neonates are born hypogammaglobulinemic, and colostrum is their main source of immunoglobulins. The purpose of this study was to evaluate the immune quality of canine colostrum and its variability both among bitches and among mammary glands. The immune quality was estimated from immunoglobulin G (IgG) concentration (ELISA test). The correlation of IgG concentration with refractometry was evaluated. From a total of 44 bitches from 13 different breeds from a single breeding kennel, samples of colostrum and blood were collected one day after the parturition onset. Colostrum was collected separately from each pair of mammary glands (180 pairs). The mean colostrum IgG concentration in our population was 20.8 ± 8.1g/L (ranging from 8.0 to 41.7 g/L) with no influence of breed size, litter size, age of dam or serum IgG concentration. Colostrum IgG concentration varied widely among pairs of mammary glands within one bitch (variation coefficient: 42 ± 32.1%). Nevertheless, no single pair of mammary glands was found to produce regularly a secretion of higher quality. No difference in IgG concentration was recorded between anterior and posterior pairs either. The BRIX index and the refractive index were significantly, but moderately correlated with colostrum IgG concentration (r=0.53 and 0.42, respectively). This study demonstrates a great variability in immune quality of colostrum among bitches and among mammary glands within one bitch. Further studies on the suckling behavior of puppies and on determination of the minimal immune quality of colostrum are required to evaluate their impact of this high variability on neonatal mortality in dogs. PMID:26186389

  12. Genomic prediction of traits related to canine hip dysplasia. (United States)

    Sánchez-Molano, Enrique; Pong-Wong, Ricardo; Clements, Dylan N; Blott, Sarah C; Wiener, Pamela; Woolliams, John A


    Increased concern for the welfare of pedigree dogs has led to development of selection programs against inherited diseases. An example is canine hip dysplasia (CHD), which has a moderate heritability and a high prevalence in some large-sized breeds. To date, selection using phenotypes has led to only modest improvement, and alternative strategies such as genomic selection (GS) may prove more effective. The primary aims of this study were to compare the performance of pedigree- and genomic-based breeding against CHD in the UK Labrador retriever population and to evaluate the performance of different GS methods. A sample of 1179 Labrador Retrievers evaluated for CHD according to the UK scoring method (hip score, HS) was genotyped with the Illumina CanineHD BeadChip. Twelve functions of HS and its component traits were analyzed using different statistical methods (GBLUP, Bayes C and Single-Step methods), and results were compared with a pedigree-based approach (BLUP) using cross-validation. Genomic methods resulted in similar or higher accuracies than pedigree-based methods with training sets of 944 individuals for all but the untransformed HS, suggesting that GS is an effective strategy. GBLUP and Bayes C gave similar prediction accuracies for HS and related traits, indicating a polygenic architecture. This conclusion was also supported by the low accuracies obtained in additional GBLUP analyses performed using only the SNPs with highest test statistics, also indicating that marker-assisted selection (MAS) would not be as effective as GS. A Single-Step method that combines genomic and pedigree information also showed higher accuracy than GBLUP and Bayes C for the log-transformed HS, which is currently used for pedigree based evaluations in UK. In conclusion, GS is a promising alternative to pedigree-based selection against CHD, requiring more phenotypes with genomic data to improve further the accuracy of prediction. PMID:25821457

  13. Surgical construction of a novel simulated carotid siphon in canines

    International Nuclear Information System (INIS)

    Objective: To develop in vivo carotid siphon models by surgical method using the shaped devices for testing the performance of covered stent specially designed for intracranial vascular diseases. Methods: Six carotid siphon-shaped devices were established using stereolithographic biomodeling and the lost-wax technique. Six canines underwent surgery to expose and isolate bilateral CCA. The right CCA origin was ligated and incised distal to the ligation point after the distal right CCA was temporarily closed. The distal left CCA was ligated and incised proximal to the ligation point after the left CCA origin was closed. The proximal isolated left CCA was passed through the shaped device. The distal isolated right CCA and the proximal isolated left CCA were anastomosed end-to-end. Finally, the shaped device of carotid siphon was fixed with suture and embedded in the left neck. The intraarterial DSA was performed on postprocedural 7 days, 2 weeks and 1 month. The morphological characteristics of carotid siphon models were visually evaluated by two observers. The patency of siphon model and the stenosis of anastomotic stoma were followed-up. Results: All animals tolerated the surgical procedure well with mean model time construction of 90 minutes. The morphological characteristics of siphon models were similar to those in human. The anastomotic stoma stenosis occurred in 2 siphon models, and thrombosis of anastomotic stoma in 1, but all siphons of these models were patent on post-procedural follow-up angiography. Conclusion: Surgical construction of an in vivo carotid siphon model of canine with shaped device is practically feasible. This model can be used for testing neurovascular devices. (authors)

  14. Immunohistochemical detection of estrogen receptors in canine mammary tumors

    Directory of Open Access Journals (Sweden)

    Elena Atanaskova Petrov


    Full Text Available Mammary tumors are among the most common neoplasms in intact female dogs.They have a complex morphology, usually affecting middle age and older bitches. Almost 50% of the mammary tumors in dogs are malignant neoplasms. Prognosis is based on several factors: stage, age, tumor size, metastasis, histopathology, ovariectomy status and hormone-receptor activity. Immunohistochemical (IHC measurement has become increasingly an important diagnostic and prognostic parameter, with the development of monoclonal antibodies against nuclear estrogen and progestin receptors. The aim of this study was to detect the presence of ER receptors in malignant canine mammary tumors and to identify their association with the clinical course of the tumor. Mammary tumor samples have been obtained by mastectomy from dogs presented at our clinic. Detailed clinical examination, CBC and basic serum biochemical profile were performed in all patients. Surgery was the only treatment. Histopathological examination and immunohistochemical detection of estrogen α receptors (ERα was performed on 8 formalin-fixed, paraffin-embedded tissue samples, using the PT LINK immunoperoxidase technique. Histopathological examination of the mammary tumor samples (n=11 revealed tubular adenocarcinoma (n=6,54.5% and ductal adenocarcinoma (n=3, 27.3%, one patient with benign adenoma and one with mastitis. Patients with positive ER tumors are alive, without remission, while 3 of the patients that were ER negative died due to lung metastases. According to our results, it can be concluded that the appearance and development of canine mammary tumors is highly connected with ovarian steroid hormones and that immunostaining of the tumors may be used as a good prognostic parameter in these patients.

  15. Crowdsourcing reproducible seizure forecasting in human and canine epilepsy. (United States)

    Brinkmann, Benjamin H; Wagenaar, Joost; Abbot, Drew; Adkins, Phillip; Bosshard, Simone C; Chen, Min; Tieng, Quang M; He, Jialune; Muñoz-Almaraz, F J; Botella-Rocamora, Paloma; Pardo, Juan; Zamora-Martinez, Francisco; Hills, Michael; Wu, Wei; Korshunova, Iryna; Cukierski, Will; Vite, Charles; Patterson, Edward E; Litt, Brian; Worrell, Gregory A


    SEE MORMANN AND ANDRZEJAK DOI101093/BRAIN/AWW091 FOR A SCIENTIFIC COMMENTARY ON THIS ARTICLE  : Accurate forecasting of epileptic seizures has the potential to transform clinical epilepsy care. However, progress toward reliable seizure forecasting has been hampered by lack of open access to long duration recordings with an adequate number of seizures for investigators to rigorously compare algorithms and results. A seizure forecasting competition was conducted on using open access chronic ambulatory intracranial electroencephalography from five canines with naturally occurring epilepsy and two humans undergoing prolonged wide bandwidth intracranial electroencephalographic monitoring. Data were provided to participants as 10-min interictal and preictal clips, with approximately half of the 60 GB data bundle labelled (interictal/preictal) for algorithm training and half unlabelled for evaluation. The contestants developed custom algorithms and uploaded their classifications (interictal/preictal) for the unknown testing data, and a randomly selected 40% of data segments were scored and results broadcasted on a public leader board. The contest ran from August to November 2014, and 654 participants submitted 17 856 classifications of the unlabelled test data. The top performing entry scored 0.84 area under the classification curve. Following the contest, additional held-out unlabelled data clips were provided to the top 10 participants and they submitted classifications for the new unseen data. The resulting area under the classification curves were well above chance forecasting, but did show a mean 6.54 ± 2.45% (min, max: 0.30, 20.2) decline in performance. The model using open access data and algorithms generated reproducible research that advanced seizure forecasting. The overall performance from multiple contestants on unseen data was better than a random predictor, and demonstrates the feasibility of seizure forecasting in canine and human

  16. A novel reassortant canine H3N1 influenza virus between pandemic H1N1 and canine H3N2 influenza viruses in Korea


    Song, Daesub; Moon, Hyoung-Joon; An, Dong-Jun; Jeoung, Hye-Young; Kim, Hyekwon; Yeom, Min-Joo; Hong, Minki; Nam, Jeong-Hyun; Park, Seong-Jun; Park, Bong-Kyun; Oh, Jin-Sik; Song, Manki; Webster, Robert G; Kim, Jeong-Ki; Kang, Bo-Kyu


    During recent canine influenza surveillance in South Korea, a novel H3N1 canine influenza virus (CIV) that is a putative reassortant between pandemic H1N1 2009 and H3N2 CIVs was isolated. Genetic analysis of eight genes of the influenza virus revealed that the novel H3N1 isolate presented high similarities (99.1–99.9 %) to pandemic influenza H1N1, except for in the haemagglutinin (HA) gene. The HA gene nucleotide sequence of the novel CIV H3N1 was similar (99.6 %) to that of CIV H3N2 isolated...

  17. Genetic and antigenic characterization of recombinant nucleocapsid proteins derived from canine coronavirus and canine respiratory coronavirus in China. (United States)

    Lu, Shuai; Chen, Yingzhu; Qin, Kun; Zhou, Jianfang; Lou, Yongliang; Tan, Wenjie


    To characterize the antigenicity of nucleocapsid proteins (NP) derived from canine coronavirus (CCoV) and canine respiratory coronavirus (CRCoV) in China, the N genes of CCoV (CCoV-BJ70) and CRCoV (CRCoV-BJ202) were cloned from swabs obtained from diseased pet dogs in Beijing and then sequenced. The recombinant NPs (rNPs) were expressed in Escherichia coli and purified by nickel-affinity column and size exclusion chromatography. Sequencing data indicated that the N genes of CCoV-BJ70 and CRCoV-BJ202 belonging to two distinctly different groups were relatively conserved within each subgroup. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) results showed that rNPs of CCoV and CRCoV were expressed efficiently and isolated with a final purity of over 95%. Western blot analysis revealed the rNP from CRCoV could cross-react with mice antisera against human coronavirus (HCoV-229E, NL63, OC43, HKU1), while rNP of CCoV had cross-reactivity with only anti-sera against viruses belonging to the same group (HCoV-229E and NL63). In summary, CCoV and CRCoV rNPs were successfully expressed in E. coli and showed antigenic cross-reactivity with antisera raised against human coronaviruses. These findings indicate that further serologic studies on coronavirus infections at the animal-human interface are needed. PMID:27084706

  18. Developmental and radiobiologic characteristics of canine multinucleated, osteoclast-like cells generated in vitro from canine bone marrow

    International Nuclear Information System (INIS)

    We report here our initial observations on the growth and morphology, and developmental radiosensitivity of giant, multinucleated, osteoclast-like cells (MN-OS) generated through in vitro cultivation of hematopoietic progenitor-enriched canine bone marrow samples. Maximum cell densities of 5.5 x 10(3) to 6.5 x 10(3) MN-OS per cm2 of growth area were achieved following 10 to 14 days of culture at 37 degrees C. Acute gamma irradiation of the initial marrow inocula resulted in significant, dose-dependent perturbations of MN-OS formation, growth, and development. Attempts to estimate radiosensitivity of MN-OS progenitors from canine marrow yielded a range of Do values from a low of 212 cGy measured at six days of culture to higher values of 405 to 542 cGy following 10 to 22 days of culture. At the intermediate times of culture (10 to 14 days), the radiation-induced responses were clearly biphasic, reflecting either (a) the presence of multiple subpopulations of MN-OS progenitors with varying degrees of radiosensitivity or (b) the inherent biphasic nature of MN-OS development involving early progenitor cell proliferation followed by maturation and subsequent fusion. Morphologically, MN-OS generated from irradiated marrow inocula appeared only marginally altered, with alterations expressed largely in a biphasic, dose-dependent fashion in terms of smaller cell size, reduced number of nuclei, increased expression of both surface microprojections, and a unique set of crystalloid cytoplasmic inclusions. Functionally, MN-OS appeared to be impaired by irradiation of marrow progenitors, as evidenced by failure to initiate resorptive attachments to devitalized bone spicules in vitro

  19. Neosporosis canina: Presencia de anticuerpos sericos en poblaciones caninas rurales y urbanas de Chile Neosporosis canine: detection of sera antibodies in rural and urban canine population of chile

    Directory of Open Access Journals (Sweden)

    A.N. Patitucci


    Full Text Available Neospora caninum es un protozoo parásito cuya infección se ha reportado en vacunos, caninos y otras especies en diversas partes del mundo. Los perros actúan como huéspedes definitivos e intermediario a la vez. En esta especie la enfermedad se caracteriza por paresia y/o parálisis de los miembros posteriores y puede ser fatal tanto en cachorros infectados transplacentariamente como en adultos. En Chile, no existe información sobre Neospora en caninos pero se ha demostrado la presencia de anticuerpos contra el protozoo en bovinos, por tal motivo se propuso la identificación de la infección mediante la detección de anticuerpos séricos contra N. caninum en perros. Se estudiaron 201 sueros caninos de diferentes edades, sexo, raza, ambiente ("rural" vs. "urbano" y tipo de alimentación ("carne cruda" vs. "no cruda" en una dilución 1:50 mediante la técnica de Inmuno Fluorescencia Indirecta (IFA. Del total de perros estudiados, el 18% (36/201 presentó anticuerpos contra N. caninum. Además se demostró asociación entre la cantidad de positivos y el ambiente y con el tipo de alimentación; no obstante, no hubo relación con el sexo, raza y edad. Los resultados indican que el pertenecer al ambiente rural y/o consumir carne cruda pueden ser importantes factores de riesgo dentro de la epidemiología de la infección por N.caninum. Complementariamente se procesaron dos sueros de zorros (Pseudolapex fulvipes mediante la técnica del Aglutinación de taquizoitos de Neospora (NAT que resultaron positivos hasta la máxima dilución analizada (1:320, demostrando que los animales estaban infectados al momento de la toma de muestra y abriendo interrogantes en la epidemiología de la enfermedad a nivel local.Neospora caninum is a protozoan parasite whose infection has been detected in canine, bovine and others species around the world. In Chile, the presence of the disease has been already demonstrated in cows of the IX Region of the country. In the

  20. Effect of thyroid hormone on in vivo contractility of the canine diaphragm. (United States)

    Miyashita, A; Suzuki, S; Suzuki, M; Numata, H; Suzuki, J; Akahori, T; Okubo, T


    This study was designed to examine the effects of long-term (4 wk) administration of thyroid hormone on the in vivo contractility of the canine diaphragm. We implanted a pair of piezoelectric crystals chronically in the left crural and costal parts of the diaphragm by a midline laparotomy. Contractility was assessed by changes in the shortening of muscle fibers after twitch stimulation of both the crural and the costal parts of the diaphragm and in the transdiaphragmatic pressure (Pdi) after tetanic stimulation (10 to 100 Hz). As a reference, we also studied the response of the quadriceps femoris. Pretreatment measurements were taken 2 wk after surgery. Then, dogs assigned to the hyperthyroid group were given thyroid powder, 0.6 g/kg/day, orally for 4 wk. The control group was fed a diet without thyroid powder for 4 wk. Serum free-T4 level (RIA) in the hyperthyroid group (n = 9) increased from 0.68 +/- 0.07 to 5.72 +/- 0.95 ng/dl (mean +/- SE) (p less than 0.01). Pdi decreased 30 to 40% at all frequencies (p less than 0.05) except 10 Hz. Twitch shortening of the crural and costal parts, compared with pretreatment state, decreased significantly by 47.7 +/- 13.1 and 48.1 +/- 15.0%, respectively (p less than 0.05). The maximal rate of relaxation became significantly faster, by 63.5% (p less than 0.05), in the crural part, whereas that of the costal part tended to become faster but not to a significant extent. In the quadriceps femoris, although twitch force showed no change, both the maximal rate of contraction and maximal rate of relaxation became faster, and tetanic force decreased. Histologic examination of hyperthyroid dogs showed vacuolization and loss of fiber area of the diaphragm. These observations suggest that thyroid hormone impairs contractility of both the crural and costal parts of the diaphragm similarly, and that the decrease in contractility may be due to a loss of muscle mass and summation impairment of twitch contraction, which differs from that in

  1. Expression of EBV-encoded oncogenes and EBV-like virions in multiple canine tumors. (United States)

    Chiu, Hung-Chuan; Chow, Kuan-Chih; Fan, Yi-Hsin; Chang, Shih-Chieh; Chiou, Shiow-Her; Chiang, Shu-Fen; Chiou, Che-Hao; Wu, Guo-Hua; Yang, Hsiu-Ching; Ho, Shu-Peng; Chen, Yuh-Kun; Lee, Wei-Cheng; Sun, H Sunny


    Epstein-Barr virus (EBV) is a ubiquitous human oncovirus. Previous studies by us and others have indicated that pet dogs frequently encounter EBV or EBV-related viral infection. In this study, we explored whether EBV is involved in canine malignancies in dogs. EBV-specific BamHI W sequence was detected by polymerase chain reaction (PCR) in 10 of 12 canine tumor specimens, including 8 of 10 oral tumors. Using reverse transcription-PCR, gene expressions of latent membrane protein 1 (LMP 1) and BamHI H rightward reading frame 1 (BHRF1) were identified in 8 and 7 of 12 specimens, respectively. A novel LMP1 variant, T0905, was predominant in 5 canine tumor specimens and found to exist in EBV positive human BC-2 cells. Another LMP1 variant, T0902, was similar to human tumor variant JB7. The BHRF1 sequence identified from these canine tumors was identical to that of the B95-8 viral strain. LMP1 protein and EBV-encoded RNA (EBER) were detected by immunohistochemistry and fluorescent in situ hybridization, respectively, in several tumors, particularly in tumor nests of oral amelanotic melanomas. Furthermore, EBV-like virions adopting a herpesvirus egress pathway were detected in a canthal fibroblastic osteosarcoma and an oral amelanotic melanoma. In conclusion, we report the expressions of BHRF1 transcript (a viral anti-apoptotic protein), LMP1 (a viral oncoprotein) transcript and protein, EBER (a viral oncogenic RNA), and EBV-like virions in multiple canine tumors. The identity of BHRF1 and the resemblance of LMP1 variants between canine and human tumors indicate either a close evolutionary relationship between canine and human EBV, or the possibility of zoonotic transmission. PMID:23380461

  2. Serosurvey of veterinary conference participants for evidence of zoonotic exposure to canine norovirus – study protocol

    Directory of Open Access Journals (Sweden)

    Mesquita João


    Full Text Available Abstract Background Noroviruses have emerged as the leading cause of outbreaks and sporadic cases of acute gastroenteritis in humans worldwide. Person-to-person contact and consumption of contaminated food are considered the most important ways of transmission of noroviruses however zoonotic transmission has been suggested. Recently, noroviruses have been found in dogs which, unlike bovine and swine noroviruses, may present a higher risk of zoonotic transfer, given to the often close contacts between humans and pet dogs in many societies across the world. The present paper describes a seroepidemiologic study aiming to provide information on the exposure level of humans to canine norovirus. Methods/Design A case–control study was designed to address the potential exposure to canine norovirus based on the presence of antibodies against canine norovirus. Sera from veterinarians (a population repeatedly in close contact with dogs will be collected in an annual Veterinary Sciences Congress in Portugal. In addition, sera from general population will be obtained and used as controls for comparative purposes. All sera will be tested for the presence of canine norovirus antibodies using a virus-like particle-based enzyme immune assay. Risk factors for canine norovirus antibodies presence in veterinarians will be investigated through the delivery of an anonymized questionnaire to the participants. Discussion The present study aims to identify seropositive individuals to canine norovirus and to assess risk profiles among veterinary professionals with occupational exposure to dogs. To our knowledge this is the first study providing information on the potential zoonotic risk of canine norovirus, thus allowing the development of preventive measures and ascertaining potential risks for Public Health resulting from contact to dogs.

  3. Characterization of canine dendritic cells in healthy, atopic, and non-allergic inflamed skin. (United States)

    Ricklin, Meret Elisabeth; Roosje, Petra; Summerfield, Artur


    Atopic dermatitis in humans and dogs is a chronic relapsing allergic skin disease. Dogs show a spontaneous disease similar to the human counterpart and represent a model to improve our understanding of the immunological mechanisms, the pathogenesis of the disease, and new therapy development. The aim of the study was to determine the frequency and phenotype of dendritic cells (DC) in the epidermis and dermis of healthy, canine atopic dermatitis lesional, and non-allergic inflammatory skin to further validate the model and to obtain insights into the contribution of DC to the pathogenesis of skin diseases in dogs. We first characterized canine skin DC using flow-cytometric analysis of isolated skin DC combined with an immunohistochemical approach. A major population of canine skin dendritic cells was identified as CD1c(+)CD11c(+)CD14(-)CD80(+)MHCII(+)MAC387(-) cells, with dermal DC but not Langerhans cells expressing CD11b. In the epidermis of lesional canine atopic dermatitis and non-allergic inflammatory skin, we found significantly more dendritic cells compared with nonlesional and control skin. Only in canine atopic dermatitis skin did we find a subset of dendritic cells positive for IgE, in the epidermis and the dermis. Under all inflammatory conditions, dermal dendritic cells expressed more CD14 and CD206. MAC387(+) putative macrophages were absent in healthy but present in inflamed skin, in particular during non-allergic diseases. This study permits a phenotypic identification and differentiation of canine skin dendritic cells and has identified markers and changes in dendritic cells and macrophage populations related to allergic and non-allergic inflammatory conditions. Our data suggest the participation of dendritic cells in the pathogenesis of canine atopic dermatitis similar to human atopic dermatitis and further validate the only non-murine spontaneous animal model for this disease. PMID:20676740

  4. Comparative photoelastic study of dental and skeletal anchorages in the canine retraction

    Directory of Open Access Journals (Sweden)

    Cristiane Aparecida de Assis Claro


    Full Text Available OBJECTIVE: To compare dental and skeletal anchorages in mandibular canine retraction by means of a stress distribution analysis. METHODS: A photoelastic model was produced from second molar to canine, without the first premolar, and mandibular canine retraction was simulated by a rubber band tied to two types of anchorage: dental anchorage, in the first molar attached to adjacent teeth, and skeletal anchorage with a hook simulating the mini-implant. The forces were applied 10 times and observed in a circular polariscope. The stresses located in the mandibular canine were recorded in 7 regions. The Mann-Whitney test was employed to compare the stress in each region and between both anchorage systems. The stresses in the mandibular canine periradicular regions were compared by the Kruskal-Wallis test. RESULTS: Stresses were similar in the cervical region and the middle third. In the apical third, the stresses associated with skeletal anchorage were higher than the stresses associated with dental anchorage. The results of the Kruskal-Wallis test showed that the highest stresses were identified in the cervical-distal, apical-distal, and apex regions with the use of dental anchorage, and in the apical-distal, apical-mesial, cervical-distal, and apex regions with the use of skeletal anchorage. CONCLUSIONS: The use of skeletal anchorage in canine retraction caused greater stress in the apical third than the use of dental anchorage, which indicates an intrusive component resulting from the direction of the force due to the position of the mini-implant and the bracket hook of the canine.

  5. Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus

    Directory of Open Access Journals (Sweden)



    Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.

  6. Multi-drug resistance in a canine lymphoid cell line due to increased P-glycoprotein expression, a potential model for drug-resistant canine lymphoma

    NARCIS (Netherlands)

    Zandvliet, M; Teske, E; Schrickx, J A


    Canine lymphoma is routinely treated with a doxorubicin-based multidrug chemotherapy protocol, and although treatment is initially successful, tumor recurrence is common and associated with therapy resistance. Active efflux of chemotherapeutic agents by transporter proteins of the ATP-Binding Casset

  7. Binding of 125I-labeled endotoxin to bovine, canine, and equine platelets and endotoxin-induced agglutination of canine platelets

    International Nuclear Information System (INIS)

    Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using 125I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed

  8. Efficacy of canine influenza virus (H3N8) vaccine to decrease severity of clinical disease after co-challenge with canine influenza virus and Streptococcus equi subsp. Zooepidemicus (United States)

    Since first emerging into the North American canine population in 2004, canine influenza virus (CIV) subtype H3N8 has shown horizontal transmission among dogs, with a high level of adaptation to this species. Severity of disease is variable, and co-infection by other respiratory pathogens is an impo...

  9. Prediction of width of un-erupted incisors, canines and premolars in a Ugandan population: A cross sectional study

    Directory of Open Access Journals (Sweden)

    Buwembo William


    Full Text Available Abstract Background Accurate prediction of the space forms an important part of an orthodontic assessment in the mixed dentition. However the most commonly used methods of space analysis are based on data developed on Caucasian populations. In order to provide more accurate local data we set out to develop a formula for predicting the widths of un-erupted canines and premolars for a Ugandan population and to compare the predicted widths of the teeth from this formula with those obtained from Moyers’ tables, and Tanaka and Johnston’s equations. Methods Dental casts were prepared using mandibular and maxillary arch impressions of 220 children (85 boys/135 girls aged 12–17 years recruited from schools in Kampala, Uganda. The mesio-distal width of the mandibular incisors, mandibular and maxillary canines and premolars were measured with a pair of digital calipers. Based on regression analysis, predictive equations were derived and the findings were compared with those presented in Moyers’ probability tables, and Tanaka and Johnston’s equations. Results There were no statistically significant differences between the tooth widths predicted by our equations and those from Moyers’ probability tables at the 65th and 75th percentile probabilities for the girls and at 75th level in boys in the mandibular arch. While in the maxillary arch no statistically significant differences at the 75th and 95th levels were noted in girls. There were statistically significant differences between predicted tooth sizes using equations from the present study and those predicted from the Tanaka and Johnston regression equations. Conclusions In this Ugandan population, Moyers’ probability tables could be used to predict tooth widths at specific percentile probabilities, but generally, Tanaka and Johnston technique tends to overestimate the tooth widths.

  10. Coprological survey of alimentary tract parasites in dogs from Zambia and evaluation of a coproantigen assay for canine echinococcosis. (United States)

    Nonaka, N; Nakamura, S; Inoue, T; Oku, Y; Katakura, K; Matsumoto, J; Mathis, A; Chembesofu, M; Phiri, I G K


    Faecal samples were collected from the rectum of 540 domestic dogs from four districts (Lusaka, Katete, Petauke and Luangwa) in Zambia between 2005 and 2006 and prevalences of canine alimentary tract parasites were determined by coprological examination. Thirteen different ova and parasites including strongyle (43.3%), Spirocerca lupi (18.7%), taeniid (13.1%), Toxocara canis (7.6%), Sarcocystis sp.* (7.5%), Isospora sp.* (5.7%), Physaloptera sp.* (4.6%), Capillaria sp.* (2.8%), Dipylidium caninum (2.2%), Mesocestoides sp.* (2.0%), Ascaris sp.* (1.7%), Trichuris vulpis* (0.4%) and Schistosoma mansoni* (0.4%) were detected, Ascaris and Schistosoma probably originating from coprophagy. The species with asterisks and later-described Taenia multiceps are for the first time reported from dogs in Zambia. A coproantigen enzyme-linked immunosorbent assay (CoproAg-ELISA) developed for Echinococcus spp. revealed 43 positive dogs and 37 of these harboured taeniid eggs. From 63 of the 71 taeniid egg-positive samples, eggs and DNA thereof were isolated and subjected to a multiplex polymerase chain reaction for differentiating E. granulosus sensu lato, E. multilocularis and Taenia spp. Amplicons indicative for Taenia spp. were obtained from 60 samples. Sequencing of amplicons spanning part of the mitochondrial cytochrome c oxidase subunit 1 gene, which was possible with 38 samples, revealed 35 infections with T. hydatigena and 3 with T. multiceps. Therefore, the CoproAg-ELISA showed some positives, but concrete evidence for the existence of canine E. granulosus infection could not be established. Comparison of the results of the CoproAg-ELISA and Taenia species identification indicated that the CoproAg-ELISA cross-reacts with patent infections of T. hydatigena (57%) and T. multiceps (33%). PMID:22185947

  11. Cutaneous immune mechanisms in canine leishmaniosis due to Leishmania infantum. (United States)

    Papadogiannakis, E I; Koutinas, A F


    Canine leishmaniosis (CanL) caused by the parasite Leishmania infantum is a systemic disease with variable clinical signs. The disease is endemic in the Mediterranean countries and dogs are the main domestic reservoir of the parasite. The quite complicated immune response against the parasite is crucial for the evolution of CanL infection with the skin playing a major role in its immunopathogenesis. After the inoculation of Leishmania promastigotes into the dermis by sand fly bites, complement factors, Langerhan's cells, neutrophils, fibroblasts and keratinocytes are involved in the activation of the innate arm of the skin immune system, with the macrophages and dendritic cells to play a major key role. The effective activation of cellular immunity is the cornerstone of dog's resistance against the parasite. Promastigotes reaching the dermis are engulfed, processed and transferred by APCs to draining lymph nodes to stimulate naïve T-cells for proliferation and differentiation into armed effector T-cells. Th1 cells activate the infected macrophages to kill Leishmania, whereas Th2 cells divert the immune response to humoral immunity and down regulation of cellular immunity with Th1 cell anergy. Inhibition of co-stimulatory molecules expression by infected macrophages contributes to T-cell anergy. In canine subclinical infections cutaneous lymphocytic infiltrate and parasites are absent, as opposed to dogs with clinical leishmaniosis. CD8+ cells constitute a significant population of cellular immunity in CanL since they outnumber CD4+ cells in the dermis, producing IFN-γ in sub clinically infected dogs and high levels of IL-4 in dogs with clinical leishmaniosis. Numerous B-lymphocytes have been shown to heavily infiltrate the dermis at least in exfoliative dermatitis in CanL. A mixed Th1/Th2 cytokine profile has been found in the dermis of naturally infected with L. infantum dogs. In the skin of dogs with clinical leishmaniosis, where plasma cells outnumber T

  12. Canine atopic dermatitis / Dermatite atópica canina

    Directory of Open Access Journals (Sweden)

    Thalita da Costa Teles


    Full Text Available Canine Atopic Dermatitis is a skin disease of genetic origin. The affected dog becomes sensible to antigens presents in the environment, developing a severe alergic, pruriginous reaction, which intervenes in the quality of life of the patient. Because of the genetic character, that is an illness that in most of the times has no cure, just control. The treatment in general is lifetime. Thus, some used drugs, for example the corticosteroides, might cause collateral effects when used for a long time, and might decrease the lifetime of the animals. By this way, the owner of the dog with atopia, must know about the complications of the disease, and occasional return of the clinical signs during the period of treatment. Therefore, this article has an objective of a review about Canine Atopic Dermatitis that is an increasing problem in the small animal practice.A Dermatite Atópica Canina é uma dermatopatia de origem genética. Os cães acometidos tornam-se sensíveis aos antígenos presentes no meio ambiente, desenvolvendo grave reação alérgica, pruriginosa, que interferem na qualidade de vida do paciente. Devido ao seu caráter genético, esta é uma doença que na maioria das vezes não tem cura, apenas controle. O tratamento em geral é vitalício. Assim sendo, algumas drogas utilizadas, a exemplo dos corticosteróides, podem causar efeitos colaterais que em longo prazo, são capazes de diminuir o período de vida do animal. Desta maneira, o proprietário do cão portador de atopia, precisa ser esclarecido em relação às complicações e provável recidiva dos sinais clínicos, durante o período de tratamento. Portanto, presente artigo tem como objetivo uma revisão sobre Dermatite Atópica Canina, que está se tornando um problema crescente na clínica de pequenos animais.

  13. Heterogeneity in stabilization phenomena in FLT PET images of canines

    International Nuclear Information System (INIS)

    3'-(18F)fluoro-3'-deoxy-L-thymidine (FLT) is a PET marker of cellular proliferation. Its tissue uptake rate is often quantified with a Standardized Uptake Value (SUV), although kinetic analysis provides a more accurate quantification. The purpose of this study is to investigate the heterogeneity in FLT stabilization phenomena. The study was done on 15 canines with spontaneously occurring sinonasal tumours. They were imaged dynamically for 90 min with FLT PET/CT twice; before and during the radiotherapy. Images were analyzed for kinetics on a voxel basis through compartmental analysis. Stabilization curves were calculated as a time-dependant correlation between the time-dependant SUV and the kinetic parameters (voxel values within the tumour were correlated). Stabilization curves were analyzed for stabilization speed, maximal correlation and correlation decrease following the maximal correlation. These stabilization parameters were correlated with the region-averaged kinetic parameters. The FLT SUV was highly correlated with vasculature fraction immediately post-injection, followed by maximum in correlation with the perfusion/permeability. At later times post-injection the FLT SUV was highly correlated (Pearson correlation coefficient above 0.95) with the FLT influx parameter for cases with tumour-averaged SUV30–50 min above 2, while others were indeterminate (correlation coefficients from 0.1 to 0.97). All cases with highly correlated SUV and FLT influx parameter had correlation coefficient within 0.5% of its maximum in the period of 30–50 min post-injection. Stabilization time was inversely proportional to the FLT influx rate. Correlation between the FLT SUV and FLT influx parameter dropped at later times post-injection with drop being proportional to the dephosphorylation rate. The FLT was found to be metabolically stable in canines. FLT PET imaging protocol should define minimal and maximal FLT uptake period, which would be 30–50 min for

  14. Emerging insights into the genetic basis of canine hip dysplasia

    Directory of Open Access Journals (Sweden)

    Ginja M


    Full Text Available Mário Ginja,1 Ana Rita Gaspar,1 Catarina Ginja,2,3 1Department of Veterinary Sciences-CITAB, University of Trás-os-Montes and Alto Douro, Vila Real, Portugal; 2Ce3C – Centro de Ecologia, Evolução e Alterações Ambientais, Faculdade de Ciências, Universidade de Lisboa, Lisboa, Portugal; 3CIBIO-InBIO – Centro de Investigação em Biodiversidade e Recursos Genéticos, Universidade do Porto, Vairão, Portugal Abstract: Canine hip dysplasia (CHD is the most common inherited polygenic orthopedic trait in dogs with the phenotype influenced also by environmental factors. This trait was described in the dog in 1935 and leads to a debilitating secondary hip osteoarthritis. The diagnosis is confirmed radiographically by evaluating signs of degenerative joint disease, incongruence, and/or passive hip joint laxity. There is no ideal medical or surgical treatment so prevention based on controlled breeding is the optimal approach. The definitive CHD diagnosis based on radiographic examination involves the exposure to ionizing radiation under general anesthesia or heavy sedation but the image does not reveal the underlying genetic quality of the dog. Phenotypic expression of CHD is modified by environmental factors and dogs with a normal phenotype can be carriers of some mutations and transmit these genes to their offspring. Programs based on selection of dogs with better individual phenotypes for breeding are effective when strictly applied but remain inferior to the selection of dogs based on estimation of breeding values. Molecular studies for dissecting the genetic basis of CHD are ongoing, but progress has been slow. In the future, the recommended method to improve hip quality in controlled breeding schemes, which will allow higher selection pressure, would be based on the estimation of the genomic breeding value. Since 2012, a commercial DNA test has been available for Labrador Retrievers using a blood sample and provides a probability for

  15. Panoramic radiological study to identify locally displaced maxillary canines in Bangladeshi population

    International Nuclear Information System (INIS)

    This study was performed to determine the prevalence of maxillary canine impaction on a basis of a single panoramic radiograph in Bangladeshi population. A random sample of seven hundred panoramic radiographs was collected from the patient record of a dental clinic. All the selected panoramic radiographs were taken from January 2009 to August 2010 by a single panoramic radiograph machine with the same exposure time (19 seconds) for all radiographs. One hundred and twenty panoramic radiographs were excluded to minimize the selection bias. In a dim lit room, an observer assessed the radiographs on a standard radiographic light box. The position of the impacted maxillary canine was recorded in line with the longitudinal axis of a tooth using the edge of a metal ruler. Data were subsequently put on SPSS 11.5 software and chi-square (x2) tests were applied to find out the association. Among 580 panoramic radiographs it was found that impacted maxillary canines were present in only 7 (1.2%) radiographs. A statistical significant difference was found between the age of the patients and the vertical position of the impacted canines (p=0.000) and between the age of the patients and the horizontal position of the impacted canines (p=0.003). The prevalence was found to be low compared with the present study from the limitation of panoramic image. Further study needs to include three-dimensional imaging modality.

  16. Molecular epidemiology of canine norovirus in dogs from Portugal, 2007–2011

    Directory of Open Access Journals (Sweden)

    Mesquita João


    Full Text Available Abstract Background Canine noroviruses (NoVs have been recently described in south European countries and associated with outbreaks of diarrhea in kennels. Unlike human NoV which are known as an important cause of acute gastroenteritis, little is known about the role of canine NoV as pathogens in dogs as well as its epidemiological features. Results From 2007–2011, 256 stool samples were collected from dogs across Portugal and tested by RT-PCR for canine NoV. Viral fecal shedding was found to be 23% (60/256. All sequences contained the GLPSG amino acid motif characteristic of the RNA-dependent RNA-polymerase gene of NoVs and had a high nucleotide identity (range 98%–100% to the canine NoV first described in Portugal. The highest shedding rate was detected during the winter months. Conclusions This study shows that canine NoV infection is endemic in the dog population of Portugal. Peak shedding was detected in the winter months, a well-known epidemiologic feature of human NoV infections.

  17. Geographical Information Systems and canine faecal contamination: the experience in the city of Naples (southern Italy). (United States)

    Veneziano, V; Rinaldi, L; Carbone, S; Biggeri, A; Cringoli, G


    Geographical Information Systems (GIS) can be used to make transect sampling when non-moving objects are to be counted, involving choosing a line or series of lines along which the counts are to take place. This approach has been used by us in order to study canine faecal contamination in the city of Naples (southern Italy), and to evaluate the consequent presence of canine parasitic elements. A GIS was constructed utilizing the geo-referenced digital photographs and the cadastral maps of Naples. In order to uniformly evaluate the canine faecal contamination throughout the city, a grid representing sub-areas of 1 km x 700 m was overlaid on the city map within the GIS. The territory of Naples was divided in 218 equal, rectangular sub-areas. In each sub-area a 1 km transect was drawn, and digitalized on-screen in the GIS. Canine faeces (copros in Greek) were counted along the transects in 143 sub-areas. In these sub-areas, 415 copros were collected and examined. Out of the 143 sub-areas, 141 contained canine copros. The results of the negative binomial regression model showed a positive association between the number of copros and the human population density. Out of the total of 415 copros, 70 (16.9%) were positive for parasitic elements; eggs of Toxocara canis, Toxascaris leonina, Ancylostoma caninum and Trichuris vulpis were found, as well as oocysts of Isospora canis. PMID:16881413

  18. Alkylation and Carbamylation Effects of Lomustine and Its Major Metabolites and MGMT Expression in Canine Cells

    Directory of Open Access Journals (Sweden)

    Thushara Chakkath


    Full Text Available DNA Alkylation is thought to be the reason for the efficacy of lomustine while carbamylation has been implicated as the cause for the side effects seen with lomustine treatment such as hepatotoxicity. In the alkylation study we show that lomustine and its metabolites form similar levels of the DNA adducts N7 hydroxyethylguanine and O6 hydroxyethyldeoxyguanosine. In terms of carbamylation, lomustine showed greater extent of carbamylation in the canine hepatocytes and lymphoma cell lines. The DNA repair enzyme O6 methylguanine DNA methyltransferase (MGMT causes resistance of tumor cells to bifunctional nitrosourea, like lomustine. There is no data available regarding MGMT expression/activity in canine cells or tissues. Our study shows that there is low MGMT activity in the canine lymphoid cell line 17–71 while the GL-1 cells did not show any detectable enzyme activity or mRNA expression. The MGMT enzyme activity measured in canine hepatocytes is about 250–350 fmol/mg protein as compared to about 90 fmol/mg protein in 17–71 cells. We also show that MGMT mRNA expression in 17–71 cells and canine hepatocytes positively correlates with its enzyme activity in these cells.

  19. Direct preparation protocol to obtain mitotic chromosomes from canine mammary tumors. (United States)

    Morais, C S D; Affonso, P R A M; Bitencourt, J A; Wenceslau, A A


    Currently, mammary neoplasms in female canines are a serious problem in veterinary clinics. In addition, the canine species is an excellent disease model for human oncology because of the biological and genetic similarities between the species. Cytogenetics has allowed further study of the characterization of neoplasms in canines. We hypothesized that the use of a direct preparation protocol for mitotic chromosome analysis would provide a simple and low cost protocol for use in all laboratories. The objective of this method is to display in a few hours of dividing cells just like the time of collection since cell division in tissue can be obtained. Ten female canines with the spontaneous occurrence of mammary neoplasia were used to test a pioneering direct preparation protocol to obtain mitotic chromosomes. The excised breast tumor tissue fragments were subjected to the protocol consisting of treatment with colchicine, treatment with hypotonic solution, and fixation. Mitotic chromosomes were absent in cell suspensions of only two samples among the 10 materials analyzed, based on the analysis of five blades for each preparation obtained. So, the cell suspension obtained allowed for the observation of eight tissue samples viable for cytogenetic analysis, five of which had excellent numbers of mitotic chromosomes. However, the technique was unsuccessful in producing high-quality cell suspensions because of inadequate condensation and scattering of chromosomes. While adjustments to methodological procedures are needed, this protocol represents a low cost and simplified method to study the cytogenetics of canine tumors. PMID:26782592

  20. The serological and virological investigation of canine adenovirus infection on the dogs. (United States)

    Bulut, Oya; Yapici, Orhan; Avci, Oguzhan; Simsek, Atilla; Atli, Kamil; Dik, Irmak; Yavru, Sibel; Hasircioglu, Sibel; Kale, Mehmet; Mamak, Nuri


    Two types of Canine Adenovirus (CAVs), Canine Adenovirus type 1 (CAV-1), the virus which causes infectious canine hepatitis, and Canine Adenovirus type 2 (CAV-2), which causes canine infectious laryngotracheitis, have been found in dogs. In this study, blood samples taken from 111 dogs, which were admitted to the Internal Medicine Clinic of Selcuk University, Faculty of Veterinary Medicine, with clinical symptoms. Seventy-seven dogs were sampled from Isparta and Burdur dog shelters by random sampling, regardless of the clinical findings. Dogs showed a systemic disease, characterized by fever, diarrhea, vomiting, oculonasal discharge, conjunctivitis, severe moist cough, signs of pulmonary disease and dehydration. Two dogs had corneal opacity and photophobia. In serological studies, 188 serum samples were investigated on the presence of CAV antibodies by ELISA. Total 103 (103/188-54.7%) blood samples were detected to be positive for CAV antibodies by ELISA. However, 85 (85/188-45.2%) blood samples were negative. Blood leukocyte samples from dogs were processed and inoculated onto confluent monolayers of MDCK cells using standard virological techniques. After third passage, cells were examined by direct immunoflourescence test for virus isolation. But positive result was not detected. In conclusion, this study clearly demonstrates the high prevalence of CAV infection in dogs. PMID:24223508

  1. Panoramic radiological study to identify locally displaced maxillary canines in Bangladeshi population

    Energy Technology Data Exchange (ETDEWEB)

    Alif, Sheikh Mohammad [Northern University, Dhaka (Bangladesh); Haque, Sejuty [Bangladesh Dental College, Dhaka (Bangladesh); Nimmi, Naima; Ashraf, Ali [AIKO Dental Clinic and Implant Centre, Dhaka (Bangladesh); Khan, Saeed Hossain; Khan, Mahfujul Haq [WHO Collaborating Centre and Ibrahim Medical College, Dhaka (Bangladesh)


    This study was performed to determine the prevalence of maxillary canine impaction on a basis of a single panoramic radiograph in Bangladeshi population. A random sample of seven hundred panoramic radiographs was collected from the patient record of a dental clinic. All the selected panoramic radiographs were taken from January 2009 to August 2010 by a single panoramic radiograph machine with the same exposure time (19 seconds) for all radiographs. One hundred and twenty panoramic radiographs were excluded to minimize the selection bias. In a dim lit room, an observer assessed the radiographs on a standard radiographic light box. The position of the impacted maxillary canine was recorded in line with the longitudinal axis of a tooth using the edge of a metal ruler. Data were subsequently put on SPSS 11.5 software and chi-square (x{sup 2}) tests were applied to find out the association. Among 580 panoramic radiographs it was found that impacted maxillary canines were present in only 7 (1.2%) radiographs. A statistical significant difference was found between the age of the patients and the vertical position of the impacted canines (p=0.000) and between the age of the patients and the horizontal position of the impacted canines (p=0.003). The prevalence was found to be low compared with the present study from the limitation of panoramic image. Further study needs to include three-dimensional imaging modality.

  2. Ebola virus mediated infectivity is restricted in canine and feline cells. (United States)

    Han, Ziying; Bart, Stephen M; Ruthel, Gordon; Vande Burgt, Nathan H; Haines, Kathleen M; Volk, Susan W; Vite, Charles H; Freedman, Bruce D; Bates, Paul; Harty, Ronald N


    Ebolaviruses and marburgviruses belong to the Filoviridae family and often cause severe, fatal hemorrhagic fever in humans and non-human primates. The magnitude of the 2014 outbreak in West Africa and the unprecedented emergence of Ebola virus disease (EVD) in the United States underscore the urgency to better understand the dynamics of Ebola virus infection, transmission and spread. To date, the susceptibility and possible role of domestic animals and pets in the transmission cycle and spread of EVD remains unclear. We utilized infectious VSV recombinants and lentivirus pseudotypes expressing the EBOV surface glycoprotein (GP) to assess the permissiveness of canine and feline cells to EBOV GP-mediated entry. We observed a general restriction in EBOV-mediated infection of primary canine and feline cells. To address the entry mechanism, we used cells deficient in NPC1, a host protein implicated in EBOV entry, and a pharmacological blockade of cholesterol transport, to show that an NPC1-dependent mechanism of EBOV entry is conserved in canine and feline cells. These data demonstrate that cells of canine and feline origin are susceptible to EBOV GP mediated infection; however, infectivity of these cells is reduced significantly compared to controls. Moreover, these data provide new insights into the mechanism of EBOV GP mediated entry into cells of canine and feline origin. PMID:26711035

  3. Stimulation with Concanavalin-A Induces IL-17 Production by Canine Peripheral T Cells

    Directory of Open Access Journals (Sweden)

    Michelle G. Ritt


    Full Text Available The characteristics of canine IL-17-producing cells are incompletely understood. Expression of mRNA encoding orthologs of IL-17 and the IL-17 receptor has been documented in tissues from dogs with arthritis, inflammatory bowel disease, and lymphoma; however, no associations have been found between IL-17 gene expression and disease phenotype in these conditions. Robust assessment of the role of IL-17-producing cells in dogs will require measuring the frequency of these cells in health and disease in balance with other lymphocyte subsets. The aim of this study was to confirm that the T-cell IL-17 response in dogs is evolutionarily conserved. Canine peripheral blood mononuclear cells were stimulated with Concanavalin A with or without polarizing cytokines. We used a canine specific IL-17 ELISA and flow cytometry to identify IL-17-producing T cells. Accumulation of intracellular IL-17 was observed in stimulated CD4 and CD8 T cells. The addition of pro-inflammatory cytokines appeared to enhance polarization of canine CD4 T cells to the Th17 phenotype. Conversely, the addition of IL-2 in the presence of TGF-β resulted in expansion of Treg cells. We conclude that canine IL-17-producing cells behave similarly to those from humans and mice when stimulated with mitogens and polarized with pro-inflammatory or immune regulatory cytokines.

  4. Comparative in vitro fermentation activity in the canine distal gastrointestinal tract and fermentation kinetics of fiber sources

    NARCIS (Netherlands)

    Bosch, G.; Pellikaan, W.F.; Rutten, P.G.P.; Poel, van der A.F.B.; Verstegen, M.W.A.; Hendriks, W.H.


    The current study aimed to evaluate the variation in fermentation activity along the distal canine gastrointestinal tract (GIT, Exp. 1). It also aimed to assess fermentation kinetics and end product profiles of 16 dietary fibers for dog foods using canine fecal inoculum (Exp. 2). For Exp. 1, digesta

  5. Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

    Energy Technology Data Exchange (ETDEWEB)

    Pang, Lisa Y., E-mail:; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J. [Royal (Dick) School of Veterinary Studies and Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG (United Kingdom)


    Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology.

  6. Culture conditions affecting the incorporation of 125I-labelled iododeoxyuridine into DNA of mitogen-stimulated canine lymphocytes

    International Nuclear Information System (INIS)

    A series of experiments have been conducted to define and describe the response of canine lymphocytes in the mitogen stimulation assay systems. These studies include the effects of serum, mitogen, and FUDR concentrations on the incorporation of 125I-IUDR by canine lymphocytes

  7. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus

    DEFF Research Database (Denmark)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter;


    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is...

  8. Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

    International Nuclear Information System (INIS)

    Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology

  9. Functional Characterization of the Canine Heme-Regulated eIF2α Kinase: Regulation of Protein Synthesis

    Directory of Open Access Journals (Sweden)

    Kimon C. Kanelakis


    Full Text Available The heme-regulated inhibitor (HRI negatively regulates protein synthesis by phosphorylating eukaryotic initiation factor-2α (eIF2α thereby inhibiting protein translation. The importance of HRI in regulating hemoglobin synthesis in erythroid cells makes it an attractive molecular target in need of further characterization. In this work, we have cloned and expressed the canine form of the HRI kinase. The canine nucleotide sequence has 86%, 82%, and 81% identity to the human, mouse, and rat HRI, respectively. It was noted that an isoleucine residue in the ATP binding site of human, rat, and mouse HRI is replaced by a valine in the canine kinase. The expression of canine HRI protein by in vitro translation using wheat germ lysate or in Sf9 cells using a baculovirus expression system was increased by the addition of hemin. Following purification, the canine protein was found to be 72 kD and showed kinase activity determined by its ability to phosphorylate a synthetic peptide substrate. Quercetin, a kinase inhibitor known to inhibit mouse and human HRI, inhibits canine HRI in a concentration-dependent manner. Additionally, quercetin is able to increase de novo protein synthesis in canine reticulocytes. We conclude that the canine is a suitable model species for studying the role of HRI in erythropoiesis.

  10. Anti-tumour activity of oncolytic Western Reserve vaccinia viruses in canine tumour cell lines, xenografts, and fresh tumour biopsies. (United States)

    Autio, K; Knuuttila, A; Kipar, A; Ahonen, M; Parviainen, S; Diaconu, I; Kanerva, A; Hakonen, T; Vähä-Koskela, M; Hemminki, A


    Cancer is one of the most common reasons for death in dogs. One promising approach is oncolytic virotherapy. We assessed the oncolytic effect of genetically modified vaccinia viruses in canine cancer cells, in freshly excised tumour biopsies, and in mice harbouring canine tumour xenografts. Tumour transduction efficacy was assessed using virus expressing luciferase or fluorescent marker genes and oncolysis was quantified by a colorimetric cell viability assay. Oncolytic efficacy in vivo was evaluated in a nude mouse xenograft model. Vaccinia virus was shown to infect most tested canine cancer cell lines and primary surgical tumour tissues. Virus infection significantly reduced tumour growth in the xenograft model. Oncolytic vaccinia virus has antitumour effects against canine cancer cells and experimental tumours and is able to replicate in freshly excised patient tumour tissue. Our results suggest that oncolytic vaccinia virus may offer an effective treatment option for otherwise incurable canine tumours. PMID:25302859

  11. Acute pancreatitis : a newly recognised potential complication of canine babesiosis

    Directory of Open Access Journals (Sweden)

    A.J. Möhr


    Full Text Available This retrospective study describes 4 cases of canine babesiosis with histologically confirmed acute pancreatitis. In addition, 16 dogs with babesiosis are reported with serum amylase (>3500 U/l and/or lipase (>650 U/l activity elevations of a magnitude that would support a diagnosis of probable acute pancreatitis, although extra-pancreatic sources of the enzymes could not be excluded in these cases. Median time of pancreatitis diagnosis was 2.5 days post-admission, with primarily young (median age 3 years, sexually intact dogs affected. The development of pancreatitis was unrelated to the degree of anaemia at time of admission. In addition to pancreatitis, 80 % of cases suffered from other babesial complications, namely icterus (13, acute respiratory distress syndrome (6, immune-mediated haemolytic anaemia (6, renal failure (3, haemoconcentration (2 and cerebral syndrome (2. Acute respiratory distress syndrome, renal failure and cerebral syndrome were associated with a poor prognosis, with 4 of the 5 dogs included in the overall 26 % mortality rate having at least 1 of these complications. Haemolytic anaemia with ischaemia-reperfusion injury to the pancreas is proposed as a possible primary pathophysiological mechanism in babesial pancreatitis. Hypotensive shock, immune-mediated haemolytic anaemia, haemoconcentration and possibly altered lipid metabolism in babesiosis may also be involved. The previously postulated pro-inflammatory cytokine milieu of complicated babesiosis may underlie the progression, if not the primary initiation, of pancreatic pathology. Acute pancreatitis may represent the previously reported 'gut' form of babesiosis.

  12. Canine detection odor signatures for mine-related explosives (United States)

    Johnston, James M.; Williams, Marc; Waggoner, L. Paul; Edge, Cindy C.; Dugan, Regina E.; Hallowell, Susan F.


    Dogs are capable of detecting and discriminating a number of compounds constituting a complex odor. However, they use only a few of these to recognize a substance. The focus of this research is to determine the compounds dogs learn to use in recognizing explosives used in land mines. This is accomplished by training dogs under behavioral laboratory conditions to respond differentially on separate levers to (1) blank air, (2) a target odor such as an explosive, and (3) all other odors (non-target odors). Vapor samples are generated by a serial dilution vapor generator whose operation and output is characterized by GC/MS. Once dogs learn this three-lever discrimination, testing sessions are conducted containing a number of probe trials in which vapor from constituent compounds is presented. Which lever the dogs respond to on these probe trials indicates whether they can smell the compound at all (blank lever) or whether it smells like the target odor (e.g., the explosive) or like something else. This method was conducted using TNT and C-4. The data show the dogs' reactions to each of the constituent compounds tested for each explosive. Analysis of these data reveal the canine detection odor signature for these explosives.

  13. Canine Distemper Virus in Wild Felids of Costa Rica. (United States)

    Avendaño, Roberto; Barrueta, Flor; Soto-Fournier, Sofía; Chavarría, Max; Monge, Otto; Gutiérrez-Espeleta, Gustavo A; Chaves, Andrea


    Several highly infectious diseases can be transmitted through feces and cause elevated mortality among carnivore species. One such infectious agent, canine distemper virus (CDV; Paramyxoviridae: Morbillivirus), has been reported to affect wild carnivores, among them several felid species. We screened free-ranging and captive wild carnivores in Costa Rica for CDV. Between 2006 and 2012, we collected 306 fecal samples from 70 jaguars (Panther onca), 71 ocelots ( Leopardus pardalis ), five jaguarundis (Puma yaguaroundi), 105 pumas ( Puma concolor ), five margays ( Leopardus wiedii ), 23 coyotes ( Canis latrans ), and 27 undetermined Leopardus spp. We found CDV in six individuals: one captive jaguarundi (rescued in 2009), three free-ranging ocelots (samples collected in 2012), and two free-ranging pumas (samples collected in 2007). Phylogenetic analyses were performed using sequences of the phosphoprotein (P) gene. We provide evidence of CDV in wild carnivores in Costa Rica and sequence data from a Costa Rican CDV isolate, adding to the very few sequence data available for CDV isolates from wild Central American carnivores. PMID:26967127

  14. Fatal canine distemper virus infection of giant pandas in China. (United States)

    Feng, Na; Yu, Yicong; Wang, Tiecheng; Wilker, Peter; Wang, Jianzhong; Li, Yuanguo; Sun, Zhe; Gao, Yuwei; Xia, Xianzhu


    We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possessed the substitutions V26M, T213A, K281R, S300N, P340Q, and Y549H. The presence of the Y549H substitution is notable as it is found at the signaling lymphocytic activation molecule (SLAM) receptor-binding site and has been implicated in the emergence of highly pathogenic CDV and host switching. These findings demonstrate that giant pandas are susceptible to CDV and suggest that surveillance and vaccination among all captive giant pandas are warranted to support conservation efforts for this endangered species. PMID:27310722

  15. An Update on Canine Adenovirus Type 2 and Its Vectors

    Directory of Open Access Journals (Sweden)

    Eric J. Kremer


    Full Text Available Adenovirus vectors have significant potential for long- or short-term gene transfer. Preclinical and clinical studies using human derived adenoviruses (HAd have demonstrated the feasibility of flexible hybrid vector designs, robust expression and induction of protective immunity. However, clinical use of HAd vectors can, under some conditions, be limited by pre-existing vector immunity. Pre-existing humoral and cellular anti-capsid immunity limits the efficacy and duration of transgene expression and is poorly circumvented by injections of larger doses and immuno-suppressing drugs. This review updates canine adenovirus serotype 2 (CAV-2, also known as CAdV-2 biology and gives an overview of the generation of early region 1 (E1-deleted to helper-dependent (HD CAV-2 vectors. We also summarize the essential characteristics concerning their interaction with the anti-HAd memory immune responses in humans, the preferential transduction of neurons, and its high level of retrograde axonal transport in the central and peripheral nervous system. CAV-2 vectors are particularly interesting tools to study the pathophysiology and potential treatment of neurodegenerative diseases, as anti-tumoral and anti-viral vaccines, tracer of synaptic junctions, oncolytic virus and as a platform to generate chimeric vectors.

  16. Characterization of pseudorabies virus glycoprotein B expressed by canine herpesvirus. (United States)

    Nishikawa, Y; Xuan, X; Kimura, M; Otsuka, H


    A recombinant canine herpesvirus (CHV) which expressed glycoprotein B (gB) of pseudorabies virus (PrV) was constructed. The antigenicity of the PrV gB expressed by the recombinant CHV is similar to that of the native PrV. The expressed PrV gB was shown to be transported to the surface of infected cells as judged by an indirected immunofluorescence test. Antibodies raised in mice immunized with the recombinant CHV neutralized the infectivity of PrV in vitro. It is known that the authentic PrV gB exists as a glycoprotein complex, which consists of gBa, gBb and gBc. In MDCK cells, PrV gB expressed by the recombinant CHV was processed like authentic PrV gB, suggesting that the cleavage mechanism of PrV gB depends on a functional cleavage domain from PrV gB gene and protease from infected cells. PMID:10563288

  17. Mutation hot spots in the canine herpesvirus thymidine kinase gene. (United States)

    Yamada, Shinya; Matsumoto, Yasunobu; Takashima, Yasuhiro; Otsuka, Haruki


    The guanine and cytosine content (GC-content) of alpha-herpesvirus genes are highly variable despite similar genome structures. It is known that drug resistant HSV, which has the genome with a high GC-content (approximately 70%), commonly includes frameshift mutations in homopolymer stretches of guanine (G) and cytosine (C) within the thymidine kinase (TK) gene. However, whether such mutation hotspots exist in the TK gene of canine herpesvirus (CHV) which has a low GC-content was unknown. In this study, we investigated mutations in the TK gene of CHV. CHV was passaged in the presence of iodo-deoxyuridine (IDU), and IDU-resistant clones were isolated. In all IDU-resistant virus clones, mutations in the TK gene were observed. The majority of these mutations were frameshift mutations of an adenine (A) insertion or deletion within either of 2 stretches of eight A's in the TK gene. It was demonstrated that CHV TK mutations frequently occur at a limited number of hot spots within long homopolymer nucleotide stretches. PMID:15965615

  18. Canine experimental infection: intradermal inoculation of Leishmania infantum promastigotes

    Directory of Open Access Journals (Sweden)

    Gabriela M Santos-Gomes


    Full Text Available Five mixed breed dogs were inoculated intradermally (ID with cultured virulent stationary phase promastigotes of Leishmania infantum Nicole, 1908 stocks recently isolated. Parasite transformations in the skin of ID infected dogs were monitored from the moment of inoculation and for 48 h, by skin biopsies. Anti-Leishmania antibody levels were measured by indirect immunofluorescence assay, counterimmunoelectrophoresis and direct agglutination test, and clinical conditions were examined. Thirty minutes after ID inoculation the first amastigotes were visualised and 3 to 4 h after inoculation the promastigotes were phagocyted by neutrophils and by a few macrophages. These cells parasitised by amastigotes progressively disappeared from the skin and 24 h after inoculation parasites were no longer observed. Local granulomes were not observed, however, serological conversion for antibodies anti-Leishmania was achieved in all dogs. Direct agglutination test was the only technique positive in all inoculated dogs. Amastigotes were found in the popliteal lymph node in one dog three months after inoculation. This work demonstrates that, with this inoculum, the promastigotes were transformed into amastigotes and were up taken by neutrophils and macrophages. The surviving parasites may have been disseminated in the canine organism, eliciting a humoral response in all cases.

  19. Computed tomographic anatomy of the canine lumbosacral spine

    International Nuclear Information System (INIS)

    The lumbosacral spine (L5–S3) was examined by high resolution computed tomography (CT) in five canine cadaver specimens and one anesthetized dog using 5mm thick transverse slices at 5mm intervals. In each dog, anatomic features observed on CT images were confirmed by comparison with corresponding 5 mm thick anatomic transverse sections and section radiographs. CT anatomic features visualized in all dogs included the vertebral bodies, pedicles, laminae, articular processes, spinous processes, transverse processes, mammillary processes, basivertebral venous canals, vertebral foramina, intervertebral foramina, sacral wings, median sacral crest, intermediate sacral crests, lateral sacral crests, articular process joints, sacroiliac joints, internal vertebral venous plexus, epidural fat, thecal sac, L5–S3 nerve roots, and spinal nerves. Spinal ganglia, yellow ligaments, and portions of the intervertebral discs were visible in some dogs. The spinal cord, intrathecal nerve roots, dorsal and ventral longitudinal ligaments, spinal arteries, and radicular vessels were not distinguishable. Accessory processes were identified on the caudal L5 pedicles in most dogs, an observation that differed from descriptions in standard anatomy texts. Previously undescribed osseous grooves, termed “lateral recesses,” were identified in the caudal L7 vertebral foramen of all dogs

  20. [Canine and human rabies in Conakry: epidemiology and preventive aspects]. (United States)

    Youla, A S; Traore, F A; Sako, F B; Feda, R M; Emeric, M A


    In Guinea, stray dogs are present in large numbers in public places and around landfills. The objectives of this study were to determine the frequency of human exposure to rabies risk, the cases of human and canine rabies and to describe the epidemiological profile of the cases. This retrospective and descriptive study was conducted in health and veterinarian facilities within the city of Conakry. All records of patients admitted in these facilities because of animal bites and veterinary records for aggression by domestic animals from 2002 to 2012, so, during an 11-year period, were collected. During the study period, 7 994 people were concerned by domestic animal bites. Males were the most affected with 60.4% of all cases. Students represented the higher class with 36.0%, followed by workers (18%). The majority of injuries were to the lower limbs (54.4%). The dog has been implicated in the attacks in 98.8% of cases. Among the 2 916 biting dogs which were placed under observation, 14 developed clinical rabies. Among those assaulted, 11 cases of rabies were reported. From 7 994 victims of domestic animal bites, 2 634 received post-exposure prophylaxis and the dropout rate was 51%. Rabies is a real risk in Conakry. Provisions in terms of public health strategy must be taken to minimize it. PMID:24363015

  1. Superior osteogenesis in transplanted allogeneic canine skull following chemical sterilization

    Energy Technology Data Exchange (ETDEWEB)

    Prolo, D.J.; Pedrotti, P.W.; Burres, K.P.; Oklund, S.


    Sterilization of allogeneic bone increases the availability of this tissue for supplanting skeletal defects and effecting fusions. The optimal sterilant destroys micro-organisms, preserves the physical and chemical integrity of bone and possibly even reduces immunogenicity. Cortical bone of skull heals slowly and is variably resorbed. Of 36 dogs, spontaneous regeneration in 72 paired 20 mm defects was constant but always incomplete, and restored only about one third of the cross-sectional area of the defect at six months. The repair in defects replaced with canine allogeneic bony disc, sterilized with ethylene oxide (n . 9), gamma irradiation (n . 7), or methanol/chloroform/iodoacetic acid (n . 7) and then lyophilizedd, was compared with repair in defects filled with aseptically procured lyophilized only (n . 23) discs from the same donor. Criteria for evaluation of implants at six months included volume of defect filled, radiodensity, extent of fusion around circumference, revascularization, and remodeling. Bony discs sterilized with methanol/chloroform/iodoacetic acid remodeled at a superior rate (p less than 0.01). Radiation sterilization resulted in diminished density and inferentially reduced protection of the brain (p less than 0.025). Ethylene oxide, lyophilized implants, and implants lyophilized only produced comparable repair. Whereas an acceptable cranioplasty was achieved in 86% of methanol/chloroform/iodoacetic acid, lyophilize implants, all other alloimplants served an osteoconductive function with a successful repair occurring in 56% to 58%.

  2. Noninvasive laser coagulation of the canine vas deferens, ex vivo (United States)

    Cilip, Christopher M.; Jarow, Jonathan P.; Fried, Nathaniel M.


    Male sterilization (vasectomy) is more successful, safer, less expensive, and easier to perform than female sterilization (tubal ligation). However, female sterilization is more popular, due to male fear of vasectomy complications (e.g. incision, bleeding, infection, and scrotal pain). The development of a completely noninvasive vasectomy technique may allay some of these concerns. Ytterbium fiber laser radiation with a wavelength of 1075 nm, average power of 11.7 W, 1-s pulse duration, 0.5 Hz pulse rate, and 3-mm-diameter spot was synchronized with cryogen cooling of the scrotal skin surface in canine tissue for a treatment time of 60 s. Vas thermal lesion dimensions measured 2.0 +/- 0.3 mm diameter by 3.0 +/- 0.9 mm length, without skin damage. The coagulated vas bursting pressure measured 295 +/- 72 mm Hg, significantly higher than typical vas ejaculation pressures of 136 + 29 mm Hg. Noninvasive thermal coagulation and occlusion of the vas is feasible.

  3. Inorganic phosphate inhibits sympathetic neurotransmission in canine saphenous veins

    International Nuclear Information System (INIS)

    Inorganic phosphate has been proposed as the initiator of metabolic vasodilatation in active skeletal muscle. The present study was primarily designed to determine if this substance has an inhibitory effect on adrenergic neurotransmission. Rings of canine saphenous veins were suspended for isometric tension recording in organ chambers. A comparison was made of the ability of inorganic phosphate (3 to 14 mM) to relax rings contracted to the same degree by electrical stimulation, exogenous norepinephrine, and prostaglandin F/sub 2α/. The relaxation during electrical stimulation was significantly greater at all concentrations of phosphate. In strips of saphenous veins previously incubated with [3H]norepinephrine, the depression of the contractile response caused by phosphate during electrical stimulated was accompanied by a significant reduction in the overflow of labeled neurotransmitter. Thus inorganic phosphate inhibits sympathetic neurotransmission and hence may have a key role in the sympatholysis in the active skeletal muscles during exercise. By contrast, in this preparation, it has a modest direct relaxing action on the vascular smooth muscle

  4. Evaluation of the status of canine hydrotherapy in the UK. (United States)

    Waining, M; Young, I S; Williams, S B


    To establish the current status of canine hydrotherapy in the UK and to ascertain information regarding the current use of hydrotherapy, a questionnaire was sent to 152 hydrotherapy centres throughout the UK, from which 89 responded. Hydrotherapy was found to be a rapidly growing business. Stand-alone centres were in existence; however, many centres were connected to other businesses, including boarding kennels and general practice veterinary surgeries. The dogs using the facility were mainly pedigree breeds, particularly labrador retrievers (30 per cent), and the most commonly encountered conditions were rupture of the cranial cruciate ligament (25 per cent), hip dysplasia (24 per cent) and osteoarthritis (18 per cent). The proportion of qualified versus unqualified staff varied between centres, highlighting a need for improved regulation of this aspect of the industry. However, all the dogs treated by the hydrotherapy centres surveyed were direct veterinary referrals, suggesting a good degree of professionalism in the field and a high regard for the benefits of hydrotherapy. PMID:21493454

  5. A canine distemper virus epidemic in Serengeti lions (Panthera leo). (United States)

    Roelke-Parker, M E; Munson, L; Packer, C; Kock, R; Cleaveland, S; Carpenter, M; O'Brien, S J; Pospischil, A; Hofmann-Lehmann, R; Lutz, H; Mwamengele, G L; Mgasa, M N; Machange, G A; Summers, B A; Appel, M J


    Canine distemper virus (CDV) is thought to have caused several fatal epidemics in canids within the Serengeti-Mara ecosystem of East Africa, affecting silver-backed jackals (Canis mesomelas) and bat-eared foxes (Otocyon megalotis) in 1978 (ref. 1), and African wild dogs (Lycaon pictus) in 1991 (refs 2, 3). The large, closely monitored Serengeti lion population was not affected in these epidemics. However, an epidemic caused by a morbillivirus closely related to CDV emerged abruptly in the lion population of the Serengeti National Park, Tanzania, in early 1994, resulting in fatal neurological disease characterized by grand mal seizures and myoclonus; the lions that died had encephalitis and pneumonia. Here we report the identification of CDV from these lions, and the close phylogenetic relationship between CDV isolates from lions and domestic dogs. By August 1994, 85% of the Serengeti lion population had anti-CDV antibodies, and the epidemic spread north to lions in the Maasai Mara National reserve, Kenya, and uncounted hyaenas, bat-eared foxes, and leopards were also affected. PMID:8559247

  6. Ascorbic acid: Nonradioactive extracellular space marker in canine heart

    International Nuclear Information System (INIS)

    The distribution pattern of ascorbic acid and L-[14C]ascorbic acid in myocardial tissue was compared with those of the classical radioactive extracellular space markers [3H]-inulin, [3H]sucrose, and Na82Br. A new polarographic techniques was developed for analogue registration of ascorbic acid concentration in coronary venous blood. The kinetic data of the markers were studied in an open-chest canine heart preparation during a constant tracer infusion of up to 9 min. Distribution volumes were calculated based on the mean transit time method of Zierler. The distribution volume of ascorbic acid as well as of L-[14C]ascorbic acid in myocardial tissue agreed closely with those of [3H]inulin and [3H]sucrose as well as 82Br. The obtained kinetic data confirmed that ascorbic acid exhibits the physicochemical properties of an extracellular space marker, though this compound was shown to leak slowly into myocardial cells. Favorable attributes of this indicator are its low molecular weight, high diffusibility in interstitial fluid, low binding affinity to macromolecules, and high transcapillary as well as low transplasmalemmal penetration rate. Therefore, this nonradioactive marker can be applied in a safe and simple fashion, and without untoward side effects in experimental animals as well as in patients

  7. Profile of canine patient with esophageal foreign bodies

    Directory of Open Access Journals (Sweden)

    Carlos Rodríguez-Alarcón


    Full Text Available ABSTRACT Objective. Determine the profile of the canine patient with esophageal foreign bodies to identify risk factors associated with the foreign bodies. Materials and Methods. This is a retrospective study made by the Veterinary Hospital Clinic of the Universidad de Extremadura (VHC. Different factors were analyzed in dogs with an endoscopic diagnosis of esophageal foreign bodies. Results. This pathology was more commonly found in young adult dogs and in small breeds. This pathology was present for the first time in the Portuguese Warren Hound, which was also the breed with the highest risk. Conclusions. The results obtained in this investigation are in agreement with the previous description of a patient that presents esophageal foreign bodies. Also, the Portuguese Warren Hound was found to be predisposed to this problem, with a higher risk factor than other breeds previously mentioned in the literature. To prevent esophageal foreign bodies, dogs should be fed raw meat and bones, especially small breeds. This pathology should always be kept in mind in dogs with esophagitis symptomology regardless of age, although it is most common in young adult dogs.

  8. Canine fetal echocardiography: correlations for the analysis of cardiac dimensions. (United States)

    Giannico, Amália Turner; Gil, Elaine Mayumi Ueno; Garcia, Daniela Aparecida Ayres; Sousa, Marlos Gonçalves; Froes, Tilde Rodrigues


    The aim of this study was to develop regression models for correlation of canine fetal heart development with body size to characterize normal development or suggest cardiac anomalies. Twenty clinically healthy pregnant bitches, either brachycephalic and non-brachycephalic, were examined ultrasonographically. Transabdominal fetal echocardiography was conducted every 4 days from the beginning of cardiac chambers differentiation until parturition. Ten cardiac parameters were measured: length, width and diameter of the heart; heart area; left and right ventricular dimensions; left and right atrial dimensions; and aortic and pulmonary artery diameter. Femoral length, biparietal diameter and abdominal cross-sectional area were also recorded. Regression equations were developed for each parameter of fetal body size, and linear and logarithmic models were compared. The model with the highest correlation coefficient was chosen to produce equations to calculate relative dimensions based on the correlations. Only the left-ventricular chamber differed between the two racial groups. Biparietal diameter was the independent parameter that produced the highest correlation coefficient for the most fetal cardiac dimensions, although good correlations were also observed using femoral length and abdominal cross-sectional area. Heart width and heart diameter were used as surrogates of cardiac development, as these measurements showed the best statistical correlation. Quantitative evaluation of fetal cardiac structures can be used to monitor normal and abnormal cardiac development. PMID:26689920

  9. Using the canine genome to cure cancer and other diseases. (United States)

    Olson, P N


    A high-quality draft genome sequence of the domestic dog (Canis familiaris), together with a dense map of single nucleotide polymorphisms, has been reported. Such new tools offer scientists amazing opportunities to define genetic, nutritional, environmental, and other risk factors for various canine diseases. Because many of the diseases that affect man's best friend also affect us, understanding a dog's disease may lead to new preventions and therapies for diseases that affect both dogs and people. Since a dog's life span is shorter than that for a human, monitoring potential risk factors in a well-controlled population of dogs is possible. Such a population should be one where dogs live in close relationship with their owners. Although longitudinal studies have been previously conducted on animals housed in laboratory environments, the natural environment offers a chance to study dogs in environments shared by their owners. If dogs are carefully monitored, and select exposures defined, considerable information could be collected in a dog's lifetime--the next 10-20 years. Such information could hold the clues for important discoveries, including causes and cures for cancer. PMID:17498794

  10. Echobiometrics kidney and renal artery triplex doppler of canine fetuses

    Directory of Open Access Journals (Sweden)

    M.A.R. Feliciano


    Full Text Available The aim of this study was to assess the sogographic parameters and biometry of canine fetal kidneys using the B mode, and to determinate the vascular index of the fetal renal arteries using the Doppler Triplex. Twenty four Shi-tzu and Pug, weighting between 4 and 10kg, aging between 4 and 6 years old were evaluated. The B mode, the fetal renal echobiometry and regularity of the renal surface, echotexture and cortex:medular ratio were evaluated during the 5th, 6th, 7th and 8th weeks of pregnancy. At the same time point of the B mode evaluation, the Doppler Triplex was carried out to assess the sistolic peak velocity (SPV, end diastolic velocity (EDV, vascular resistive (RI and pulsatility index (PI. B mode revealed no fetal renal abnormalities and echobiometry showed important measurements during fetal development (P0.05. B mode and Doppler Triplex were important tools for the assessment of fetal renal development, using echobiometry and renal arterial index in canie fetuses.

  11. Superior osteogenesis in transplanted allogeneic canine skull following chemical sterilization

    International Nuclear Information System (INIS)

    Sterilization of allogeneic bone increases the availability of this tissue for supplanting skeletal defects and effecting fusions. The optimal sterilant destroys micro-organisms, preserves the physical and chemical integrity of bone and possibly even reduces immunogenicity. Cortical bone of skull heals slowly and is variably resorbed. Of 36 dogs, spontaneous regeneration in 72 paired 20 mm defects was constant but always incomplete, and restored only about one third of the cross-sectional area of the defect at six months. The repair in defects replaced with canine allogeneic bony disc, sterilized with ethylene oxide (n . 9), gamma irradiation (n . 7), or methanol/chloroform/iodoacetic acid (n . 7) and then lyophilizedd, was compared with repair in defects filled with aseptically procured lyophilized only (n . 23) discs from the same donor. Criteria for evaluation of implants at six months included volume of defect filled, radiodensity, extent of fusion around circumference, revascularization, and remodeling. Bony discs sterilized with methanol/chloroform/iodoacetic acid remodeled at a superior rate (p less than 0.01). Radiation sterilization resulted in diminished density and inferentially reduced protection of the brain (p less than 0.025). Ethylene oxide, lyophilized implants, and implants lyophilized only produced comparable repair. Whereas an acceptable cranioplasty was achieved in 86% of methanol/chloroform/iodoacetic acid, lyophilize implants, all other alloimplants served an osteoconductive function with a successful repair occurring in 56% to 58%

  12. Mandibulo-Canine index value for sex identification

    Directory of Open Access Journals (Sweden)

    Akhlaghi M.


    Full Text Available Background: The value of the mandibulo-canine index (MCI in gender identification has been proved in some studies in various countries. The goal of our study was to determine the utility of MCI in gender identification in Iran.Methods: This descriptional survey was performed on a group of 18- to 25-year-old Iranian students at the Tehran University of Medical Science. We included 50 males and 50 females that were selected using a single sampling method. Data were statistically analyzed by SPSS (v. 13 and t-test.Results: No statistically significant difference was found between the mean ages of the two groups. Among men, the MCI ranged from 0.209 to 0.293, with a mean of 0.252. Among women, the MCI ranged from 0.202 to 0.276, with a mean of 0.245. There was significant statistical difference between the two means, (0.007; P value = 0.04. The standard MCI of 0.247 was compared to that of each gender, after which no significant statistical difference was found between the two genders (P value = 0.8. Conclusions: Despite some studies performed in other countries displaying the usefulness of MCI in sex determination, our data did not support this conclusion. Perhaps this difference can be explained because of the variety ethnic groups from various cities of Iran represented in this research had some influence on the results.

  13. Effect of blood transfusions on canine renal allograft survival

    Energy Technology Data Exchange (ETDEWEB)

    van der Linden, C.J.; Buurman, W.A.; Vegt, P.A.; Greep, J.M.; Jeekel, J.


    In this study significantly prolonged canine renal allograft survival has been demonstrated after transfusion of 100 ml of third-party whole blood given peroperatively. Peroperative transfusions of third-party leukocyte-free blood or pure lymphocyte cell suspensions did not influence graft survival. Furthermore, no improvement in graft survival has been found after a peroperative transfusion of irradiated whole blood (2500 rad). These data suggest that delayed graft rejection after blood transfusions can only be expected after the administration of whole blood. The role of competent lymphocytes in whole blood is questionable, since a transfusion or irradiated whole blood in combination with nonirradiated lymphocytes did not lead to prolonged graft survival. Immunosuppression of the recipient directly after transfusion seems to be essential to induce the beneficial effect of blood transfusions. This has been demonstrated for a transfusion of whole blood 14 days before transplantation. A single transfusion of 100 ml of whole blood 14 days before transplantation could effectively prolong graft survival if immunosuppression with azathioprine and prednisone was started on the day of transfusion. No improvement in graft survival has been found with such a transfusion if preoperative immunosuppression has been omitted.

  14. Effect of blood transfusions on canine renal allograft survival

    International Nuclear Information System (INIS)

    In this study significantly prolonged canine renal allograft survival has been demonstrated after transfusion of 100 ml of third-party whole blood given peroperatively. Peroperative transfusions of third-party leukocyte-free blood or pure lymphocyte cell suspensions did not influence graft survival. Furthermore, no improvement in graft survival has been found after a peroperative transfusion of irradiated whole blood (2500 rad). These data suggest that delayed graft rejection after blood transfusions can only be expected after the administration of whole blood. The role of competent lymphocytes in whole blood is questionable, since a transfusion or irradiated whole blood in combination with nonirradiated lymphocytes did not lead to prolonged graft survival. Immunosuppression of the recipient directly after transfusion seems to be essential to induce the beneficial effect of blood transfusions. This has been demonstrated for a transfusion of whole blood 14 days before transplantation. A single transfusion of 100 ml of whole blood 14 days before transplantation could effectively prolong graft survival if immunosuppression with azathioprine and prednisone was started on the day of transfusion. No improvement in graft survival has been found with such a transfusion if preoperative immunosuppression has been omitted

  15. Effect of blood transfusions on canine renal allograft survival

    Energy Technology Data Exchange (ETDEWEB)

    Van Der Linden, C.J.; Buurman, W.A.; Vegt, P.A.; Greep, J.M.; Jeekel, J.


    In this study significantly prolonged canine renal allograft survival has been demonstrated after transfusion of 100 ml of third-party whole blood given peroperatively. Peroperative transfusions of third-party leukocyte-free blood or pure lymphocyte cell suspensions did not influence graft survival. Futhermore, no improvement in graft survival has been found after a peroperative transfuson of irradiated whole blood (2500 rad). These data suggest that delayed graft rejection after blood transfusions can only be expected after the administration of whole blood. The role of competent lymphocytes in whole blood is questionable, since a transfusion of irradiated whole blood in combination with nonirradiated lymphocytes did not lead to prolonged graft survival. Immunosuppression of the recipient directly after transfusion seems to be essential to induce the beneficial effect of blood transfusions. This has been demonstrated for a transfusion of whole blood 14 days before transplantation. A single transfusion of 100 ml of whole blood 14 days before transplantation could effectively prolong graft survival if immunosuppression with azathioprine and prednisone was started on the day of transfusion. No improvement in graft survival has been found with such a transfusion if preoperative immunosuppression has been omitted.

  16. Effect of blood transfusions on canine renal allograft survival

    International Nuclear Information System (INIS)

    In this study significantly prolonged canine renal allograft survival has been demonstrated after transfusion of 100 ml of third-party whole blood given peroperatively. Peroperative transfusions of third-party leukocyte-free blood or pure lymphocyte cell suspensions did not influence graft survival. Futhermore, no improvement in graft survival has been found after a peroperative transfuson of irradiated whole blood (2500 rad). These data suggest that delayed graft rejection after blood transfusions can only be expected after the administration of whole blood. The role of competent lymphocytes in whole blood is questionable, since a transfusion of irradiated whole blood in combination with nonirradiated lymphocytes did not lead to prolonged graft survival. Immunosuppression of the recipient directly after transfusion seems to be essential to induce the beneficial effect of blood transfusions. This has been demonstrated for a transfusion of whole blood 14 days before transplantation. A single transfusion of 100 ml of whole blood 14 days before transplantation could effectively prolong graft survival if immunosuppression with azathioprine and prednisone was started on the day of transfusion. No improvement in graft survival has been found with such a transfusion if preoperative immunosuppression has been omitted

  17. Current concepts in the treatment of canine chronic hepatitis. (United States)

    Honeckman, Adam


    Chronic hepatitis is a common disorder in dogs seen by general practitioners. Several new drugs have been marketed for treating this disease. Unfortunately, there are few controlled studies that examine the efficacy of these medications for the treatment of canine chronic hepatitis. A rational therapeutic approach can be implemented based on histopathologic findings of a liver biopsy. A liver biopsy is essential for establishing a definitive diagnosis and guiding the optimal therapy. The biopsy allows characterizing the inflammatory process, quantitating hepatic copper concentrations, and determining if fibrosis is present. Copper associated hepatopathy is treated with zinc and copper chelators. Idiopathic chronic hepatitis is thought to be immune mediated. The treatment of idiopathic chronic hepatitis consists of controlling inflammation (prednisone, azathioprine), reversing fibrosis (colchicine), and protecting against oxidant damage (vitamin E, ursodeoxycholic acid, S-adenosylmethionine). The prognosis for chronic hepatitis is quite variable. Dogs with end-stage disease have a poor prognosis, while dogs diagnosed earlier can have a mean survival of years. Early diagnosis and intervention are key to the successful treatment of dogs with chronic hepatitis. PMID:14738204

  18. Effects of canine parvovirus on gray wolves in Minnesota (United States)

    Mech, L.D.; Goyal, S.M.


    Long-term effects of disease on wild animal population demography is not well documented. We studied a gray wolf (Canis lupus) population in a 2,060km2 area of Minnesota for 15 years to determine its response to canine parvovirus (CPV). The CPV had little effect (P gt 0.05) on wolf population size while epizootic during 1979-83. However, after CPV became enzootic, percentage of pups captured during summer-fall 1984-93 and changes in subsequent winter wolf numbers were each inversely related to the serological prevalence of CPV in wolves captured during July-November (r2 = 0.39 and 0.72, P = 0.05 and lt 0.01, respectively). The CPV antibody prevalence in adult wolves increased to 87% in 1993 (r2 = 0.28, P = 0.05). However, because population level remained stable, CPV-induced mortality appeared to compensate for other mortality factors such as starvation. We -predict that the winter wolf population will decline when CPV prevalence in adults consistently exceeds 76%. The CPV may become important in limiting wolf populations.

  19. Phylogenetic Analysis of Canine Parvovirus VP2 Gene in China. (United States)

    Yi, L; Tong, M; Cheng, Y; Song, W; Cheng, S


    In this study, a total of 37 samples (58.0%) were found through PCR assay to be positive for canine parvovirus (CPV) of 66 suspected faecal samples of dogs collected from various cities throughout China. Eight CPV isolates could be obtained in the CRFK cell line. The sequencing of the VP2 gene of CPV identified the predominant CPV strain as CPV-2a (Ser297Ala), with two CPV-2b (Ser297Ala). Sequence comparison revealed homologies of 99.3-99.9%, 99.9% and 99.3-99.7% within the CPV 2a isolates, within the CPV 2b isolates and between the CPV 2a and 2b isolates, respectively. In addition, several non-synonymous and synonymous mutations were also recorded. The phylogenetic tree revealed that most of the CPV strains from different areas in China were located in the formation of a large branch, which were grouped together along with the KU143-09 strain from Thailand and followed the same evolution. In this study, we provide an updated molecular characterization of CPV 2 circulation in China. PMID:25209922

  20. Antigenic typing of canine parvovirus using differential PCR. (United States)

    Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Sharma, N S


    Canine parvovirus (CPV) is an enteric pathogen causing hemorrhagic enteritis in pups of 3-6 months of age and is mainly transmitted via feco-oral route. In the present study, a total of 85 animals rectal swabs suspected of CPV were tested using a PCR, nested PCR and a newly designed differential PCR. Using PCR 7 (8.23 %) animals were positive whereas 39 (45.88 %) were positive by using nested PCR and 40 (47.05 %) were positive for either one or more than one antigenic types of CPV using differential PCR. Using differential PCR it was found that CPV-2a and CPV-2b were the most prevailing antigenic types. Also it was found that dogs that were vaccinated too yielded positive CPV indicating a possible presence of additional CPV antigenic types. Thus, the primers used in differential PCR can be used in a single PCR reaction to detect various antigenic types of CPV. PMID:25674626